JPET#119412 1 TRPV1 Agonists Cause Endoplasmic Reticulum

JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 JPET ThisFast article Forward. has not been Published copyedited onand formatted.March 1, The 2007 final versionas DOI:10.1124/jpet.107.119412 may differ from this version.

JPET#119412

TRPV1 Agonists Cause Endoplasmic Reticulum Stress and Cell Death in Human Lung

Cells

Karen C. Thomas, Ashwini S. Sabnis, Mark E. Johansen, Diane L. Lanza, Philip J. Moos, Garold Downloaded from

S. Yost, and Christopher A. Reilly

jpet.aspetjournals.org (K.C.T., A.S.S., M.E.J., D.L.L, P.J.M., G.S.Y., and C.A.R.) Department of Pharmacology and

Toxicology, University of Utah, 112 Skaggs Hall, Salt Lake City, UT 84112.

at ASPET Journals on September 25, 2021

Copyright 2007 by the American Society for Pharmacology and Experimental Therapeutics. JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Running title: TRPV1 Agonists, ER Stress, and Cell Death

Corresponding Author:

Dr. Christopher A. Reilly, Ph.D.

University of Utah

Department of Pharmacology and Toxicology

30 S. 2000 E., Room 201 Skaggs Hall Downloaded from

Salt Lake City, UT 84112

Phone: (801) 581-5236 jpet.aspetjournals.org FAX: (801) 585-3945

Email: [email protected]

at ASPET Journals on September 25, 2021

Number of text pages: 32

Number of tables: 2

Figures: 6

References: 40

Number of words in Abstract: 250

Number of words in Introduction: 733

Number of words in Discussion: 1473

Non Standard Abbreviations:

GADD153, growth arrest- and DNA damage-inducible transcript 3 (a.k.a. DDIT3 and CHOP);

GADD45α, growth arrest and DNA-damage-inducible, alpha (a.k.a. DDIT1); GRP78/BiP,

2 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 glucose regulated protein, 70kDa (a.k.a. HSPA5); ATF3, activating transcription factor 3; ATF4, activating transcription factor 4; ATF6, activating transcription factor 6; CCND1, cyclin D1;

CCNG2, cyclin G2, EIF2α, eukaryotic translation initiation factor 2, subunit 1 (alpha, 35kDa);

EIF2α-P, phosphorylated eukaryotic translation initiation factor 2, subunit 1; Bcl-2, B-cell lymphoma protein 2; Akt/PKB, protein kinase B; NF-kB, nuclear factor of kappa light polypeptide gene enhancer in B cells; RT-PCR, reverse transcription-polymerase chain reaction; Downloaded from TRPV1, transient receptor protein vanilloid 1 (a.k.a. VR1 or the Capsaicin Receptor); LC50, concentration at which 50% loss in viability (lethality) is observed.

jpet.aspetjournals.org

Recommended Section Assignment: Toxicology at ASPET Journals on September 25, 2021

3 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Abstract:

TRPV1 is a calcium-selective ion channel expressed in human lung cells. We show that activation of the intracellular sub-population of TRPV1 causes endoplasmic reticulum (ER) stress and cell death in human bronchial epithelial and alveolar cells. TRPV1 agonist

(nonivamide) treatment caused calcium release from the ER and altered the transcription of

GADD153, GADD45α, GRP78/BiP, ATF3, CCND1, and CCNG2 in a manner comparable to prototypical ER stress-inducing agents. The TRPV1 antagonist LJO-328 inhibited mRNA Downloaded from responses and cytotoxicity. EGTA and ruthenium red inhibited cell surface TRPV1 activity, but did not prevent ER stress gene responses or cytotoxicity. Cytotoxicity paralleled EIF2α jpet.aspetjournals.org phosphorylation and the induction of GADD153 mRNA and protein. Transient over-expression of GADD153 caused cell death independent of agonist treatment, and cells selected for stable

over-expression of a GADD153 dominant negative mutant exhibited reduced sensitivity. at ASPET Journals on September 25, 2021

Salubrinal, an inhibitor of ER stress-induced cytotoxicity via the EIF2αK3/EIF2α pathway, or stable over-expression of the EIF2α-S52A dominant negative mutant also inhibited cell death.

Treatment of the TRPV1-null HEK293 cell line with TRPV1 agonists did not initiate ER stress responses. Similarly, n-benzylnonanamide, an inactive analogue of nonivamide, failed to cause

ER calcium release, an increase in GADD153 expression, and cytotoxicity. We conclude that activation of ER-bound TRPV1 and stimulation of GADD153 expression via the

EIF2αK3/EIF2α pathway represents a common mechanism for cytotoxicity by cell-permeable

TRPV1 agonists. These findings are significant within the context of lung inflammatory diseases where elevated concentrations of endogenous TRPV1 agonists are likely produced in sufficient quantities to cause TRPV1 activation and lung cell death.

4 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Introduction:

Lung cell damage causes acute respiratory distress and contributes to the pathogenesis of chronic lung diseases (Knight and Holgate, 2003). Evidence suggests that the transient receptor potential vanilloid type-1 receptor (TRPV1, capsaicin receptor, VR1; Hs. 268202) may be a mediator of lung pathologies caused by xenobiotic toxicants and endogenous agonists as well as a therapeutic target for treating and/or preventing lung disorders (Jia et al., 2005; Szallasi et al.,

2006). Downloaded from

TRPV1 is widely expressed in the respiratory tract including nasal mucosal cells (Seki et al., 2006), C-fiber neurons and airway smooth muscle cells (Mitchell et al., 2005; Watanabe et jpet.aspetjournals.org al., 2005), and alveolar and bronchial epithelial cells (Veronesi et al., 1999; Reilly et al., 2003;

Agopyan et al., 2004). TRPV1 is selectively activated by capsaicin, the primary pain producing chemical in hot peppers, and a variety of exogenous and endogenous respiratory toxicants at ASPET Journals on September 25, 2021 including anandamide (Van Der Stelt and Di Marzo, 2004), products of arachidonic acid metabolism by lipoxygenases (Hwang et al., 2000), H2S (Trevisani et al., 2005), ethanol

(Trevisani et al., 2004), acids (Tominaga et al., 1998; Ricciardolo et al., 2004), and particulate pollutants (Veronesi et al., 1999; Agopyan et al., 2004). Capsaicin and other TRPV1 agonists are routinely used to study the TRPV1 pharmacology and have proven instrumental in defining the physiological roles of TRPV1 in the lung and other organs. Here we use capsaicin to elucidate toxicological phenomena associated with TRPV1 activation in lung cells.

Capsaicin is used clinically to induce cough (Morice et al., 2001) and to treat rhinitis (van

Rijswijk and Gerth van Wijk, 2006). However, numerous case reports have described adverse respiratory effects and death in humans following exposures to concentrated capsaicinoid aerosols (Heck, 1995; Steffee et al., 1995; Billmire et al., 1996). In animal models, high doses of

5 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 capsaicin cause acute respiratory and cardiovascular failure, independent of the route of administration (Glinsukon et al., 1980). Inhalation of capsaicinoids by rats causes lung inflammation and widespread damage to tracheal, bronchial and alveolar cells (Reilly et al.,

2003). In vitro studies with human bronchial epithelial cells have demonstrated two principal outcomes associated with TRPV1 activation: pro-inflammatory cytokine (IL-6 and IL-8) production and oncotic cell death (Reilly et al., 2003; Reilly et al., 2005). Cytokine synthesis

and cell death were inhibited by TRPV1 antagonists that prevented calcium release from the Downloaded from endoplasmic reticulum (ER) and included LJO-328, SC0030, 5-iodo-RTX. Conversely, inhibition of the cell surface population of TRPV1 using EGTA, ruthenium red and calcium-free jpet.aspetjournals.org media only prevented cytokine responses.

In mammalian cells, depletion of ER calcium initiates a homeostatic stress response program termed ER stress. ER stress is generally initiated by a reduction in protein processing at ASPET Journals on September 25, 2021 efficiency in the ER and its roles in human diseases and xenobiotic toxicities have been reviewed

(Cribb et al., 2005; Schroder and Kaufman, 2005; Zhang and Kaufman, 2006). ER stress is predominantly regulated by three sensors: Activating transcription factor 6 (ATF6; Hs. 492740), eukaryotic initiation factor 2α kinase-3 (EIF2αK3 or PERK; Hs. 591589), and ER to nucleus signaling 1 and 2 (ERN1 and 2, a.k.a. IRE1α and β; Hs. 133982 and Hs. 592041) (Schroder and

Kaufman, 2005). Activation of one or more of these proximal sensors is dependent upon the type of cellular stress. For example, the prototypical ER stress-inducing agent thapsigargin preferentially activates the “translational branch” involving EIF2αK3. Activated EIF2αK3 catalyzes the phosphorylation of cytosolic EIF2α (Hs. 151777) (Lu et al., 2004; Boyce et al.,

2005). Heterodimerization of EIF2α-P with EIF2β promotes ATF4 translation (Hs. 496487) and inhibits the translation of “non-essential” genes (Wek et al., 2006). ATF4 translocates to the

6 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 nucleus where it modulates the expression of a subset of stress-response genes that include

ATF3, GADD153, CCND1, and BiP/GRP78 (see Table 1 for UniGene IDs). Phosphorylation of

EIF2α is considered protective (Lu et al., 2004; Boyce et al., 2005), but increased expression of

GADD153, as a consequence of EIF2α phosphorylation, causes cell cycle arrest at G1/S and cell death (Oyadomari and Mori, 2004).

In this study we tested the hypothesis that activation of the intracellular ER sub- population of TRPV1 by prototypical and endogenous TRPV1 agonists would disrupt ER Downloaded from calcium homeostasis and activate EIF2αK3-dependent ER stress responses to cause cytotoxicity.

The data obtained from this work implies that a common mechanism of cytotoxicity exists for jpet.aspetjournals.org cell-permeable TRPV1 agonists and that conditions that promote TRPV1 activation in vivo (e.g., inflammation, inhalation of polluted air, etc.) may promote lung pathologies through TRPV1-

and EIF2αK3-dependent pro-cytotoxic ER stress pathways. at ASPET Journals on September 25, 2021

Methods:

Chemicals: Structures of the TRPV1 agonists and antagonists used in this study are shown in Figure 1. Nonivamide (n-vanillylnonanamide), sulfinpyrazone, dithiothreitol (DTT), hydrogen peroxide (H2O2), ruthenium red, ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′- tetraacetic acid (EGTA), benzylamine-HCl, and nonanoyl chloride were purchased from Sigma

Chemical Corporation (St. Louis, MO). N-(4-tert-butylbenzyl)-N’-(1-[3-fluoro-4-

(methylsulfonylamino)phenyl]ethyl)thiourea (LJO-328) was generously provided by Dr. Jeewoo

Lee (Seoul National University, Seoul, Korea). Thapsigargin and 5-iodo-resiniferatoxin were purchased from Axxora (San Diego, CA). Salubrinal (EIF2α-inhibitor) was purchased from

Calbiochem (San Diego, CA). PCR primers were purchased from Integrated DNA Technologies

7 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

(Coralville, IA). n-Benzylnonanamide was synthesized by reacting benzylamine-HCl and nonanoyl chloride in 0.1M NaOH and collecting the precipitate. Product structure was verified by liquid chromatography-tandem mass spectrometry (m/z 248), 1H-and 13C-NMR. Purity was estimated to be ~98% by HPLC/UV analysis (230 nm). Chemical analysis data are included in supplemental data file 1, figure 1. All other chemicals and reagents were purchased from established suppliers.

Cell culture: BEAS-2B human bronchial epithelial cells (CRL-9609) were purchased Downloaded from from American Type Culture Collection (ATCC) (Rockville, MD). TRPV1-overexpressing cells were generated as previously described (Reilly et al., 2003). BEAS-2B and TRPV1- jpet.aspetjournals.org overexpressing cells were cultured in LHC-9 media (BioSource, Camarillo, CA). Normal human bronchial epithelial (NHBE) cells, a primary cell line, were purchased from Cambrex

(Walkersville, MD) and cultured in BEGM media. HEK293 human embryonic kidney (CRL- at ASPET Journals on September 25, 2021

1573) and A549 human lung carcinoma (CCL-185) cells were purchased from ATCC and were cultured in DMEM:F12 containing 10% FBS (Hyclone Laboratories, Logan UT). Culture flasks for BEAS-2B and TRPV1-overexpressing BEAS-2B cells were coated with LHC basal media fortified with collagen (30 µg/ml), fibronectin (10 µg/ml), and bovine serum albumin (10 µg/ml).

Cells were maintained between 30-90% maximum density and were sub-cultured every 2-4 days.

Fluorometric Calcium Flux Assays: TRPV1-overexpressing cells were used to evaluate calcium flux. Flux in BEAS-2B, A549, and NHBE cells was not detectable. Functional evidence provided here and in previous studies (Reilly et al., 2003; Reilly et al., 2005; Johansen et al., 2006) demonstrates that the TRPV1-overexpressing cells model responses of BEAS-2B and other lung cells when treated with diverse TRPV1 agonists, with the exceptions that TRPV1- dependent calcium flux is quantifiable and dose-responses for TRPV1 agonists are shifted to

8 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 lower concentrations. To assay calcium flux, TRPV1-overexpressing cells were sub-cultured into 96-well culture plates and grown to ~90% maximum density. Cells were loaded with the fluorogenic calcium indicator Fluo-4-AM (2.5 µM) (Invitrogen, Carlsbad, CA), for 90 min at room temperature (~22°C) in LHC-9 media containing 200 µM sulfinpyrazone. Cells were washed and incubated for an additional 20 min at room temperature to permit methyl ester hydrolysis and activation of Fluo-4. Changes in cellular fluorescence in response to agonist and antagonist treatments were assessed microscopically on cell populations 1 min after treatments Downloaded from using methods previously described (Reilly et al., 2005; Johansen et al., 2006). ER calcium flux was evaluated by pre-treating cells with thapsigargin (2.5 µM) for 5 min followed by addition of jpet.aspetjournals.org nonivamide (2.5 µM). Calcium flux due to cell surface TRPV1 activity was assessed by treating cells with nonivamide in calcium free media containing EGTA (50 µM) and ruthenium red (250

µM). Differences in fluorescence responses observed between the treatments and controls were at ASPET Journals on September 25, 2021 used to assess the relative contribution of ER-bound and cell surface TRPV1 in total calcium flux initiated by agonists. Data are expressed as fold change in fluorescence intensity.

Cytotoxicity Assays: Cells were sub-cultured into multi-well plates and allowed to reach

~90% confluence. The cells were treated for 24h with various agonists and antagonists prepared in the appropriate culture media without FBS. Cell viability was assessed using the Dojindo Cell

Counting Kit-8 (Dojindo Laboratories, Gaithersburg, MD), according to the supplier recommendations. Loss of cell monolayer integrity due to treatment with toxic TRPV1 agonists was confirmed microscopically. Toxicity data are expressed as the percentage of remaining viable cells relative to untreated controls, calculated using the absorbance ratio of the formazan dye product generated from the Dojindo reagent.

9 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

RT-PCR analysis: Cells were sub-cultured into 25 cm2 cell culture flasks, grown to a density of ~90%, and treated with TRPV1 agonists and antagonists. Total RNA was extracted from cells using the RNeasy RNA isolation kit (Qiagen, Valencia, CA) and 2.5 µg of total RNA was transcribed into cDNA using PolyT and Superscript III (Invitrogen, Carlsbad, CA). cDNA corresponding to GADD153, GADD45α, ATF3, CCND1, CCNG2, BiP/GRP78 and β-actin was amplified by PCR from 1 µL of the cDNA synthesis reaction using the primers listed in Table 1 and GoTaq green PCR mastermix (Promega, Madison, WI). The PCR program consisted of an Downloaded from initial 2 min incubation at 94ºC and 28 cycles of 94ºC (30 s), 55ºC (30 s), and 72ºC (30 s). A final extension period of 10 min at 72ºC followed. PCR products were resolved on 1% SB jpet.aspetjournals.org agarose gels and images were captured using a Bio-Rad Gel-Doc imaging system. Product quantification was achieved by determining the band intensities for each PCR product relative to

-actin, the internal PCR control, using the Gel Doc density analysis tools in the Quantity One at ASPET Journals on September 25, 2021 software. Experiments were reproduced a minimum of three times on different passages of cells.

Cloning of ER Stress Gene cDNA: The full-length cDNA for human GADD153, ATF3,

EIF2α, and ATF4 were amplified from BEAS-2B cells using Phusion GC-rich PCR supermix

(New England Biolabs, Ipswich, MA). The following primers were used: GADD153 (+) 5’-

CACCATGGCAGCTGAGTCATTGCCTTTC and (-) 5’-TGCTTGGTGCAGATTCACCATTC,

ATF3 (+) 5’- CACCATGATGCTTCAACACCCAG and (-) 5’-

ATACTGAAGCTGCAGGCACTC, EIF2α (+) 5’-CACCATGCCGGGTCTAAGTTGTAG and

(-) 5’-ATCTTCAGCTTTGGCTTCCATTTC, ATF4 (+) 5’-

CACCATGACCGAAATGAGCTTCCTG and (-) 5’-GGGGACCCTTTTCTTCCCCCTTG.

These primers incorporated a 5’-CACC sequence immediately prior to the ATG start site to permit directional cloning into the pcDNA3.1-V5/His6 mammalian expression vector

10 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

(Invitrogen, Carlsbad, CA) and eliminated the stop codon to allow for epitope tagging with V5-

His6. An expression plasmid for p58IPK (pcDNA1-p58IPK) was generously provided by Dr.

Michael G. Katze, University of Washington, Seattle, WA. The pMaxGFP expression vector was purchased from Amaxa Biosystems (Gaithersburg, MD). All clones were sequence verified by comparison to the appropriate GenBank sequences. Plasmids used in the transient transfection assays were simultaneously purified using the Qiagen Plasmid DNA Midi-Prep kit

and further purified using the GeneElute HP Plasmid Miniprep kit (Sigma, St. Louis, MO). Downloaded from

Site-Directed Mutagenesis: The GADD153-L134A/L141A (Matsumoto et al., 1996) and

EIF2α-S52A (Srivastava et al., 1998) dominant negative mutants were constructed using the jpet.aspetjournals.org Quick-Change XL Site -Directed Mutagenesis Kit (Stratagene, Madison WI) and the following primers: GADD153-L134A/L141A (+) 5’-

GGCACAGGCAGCTGAAGAGAATGAACGGGCCAAGCAGG and (-) 5’- at ASPET Journals on September 25, 2021

CCTGCTTGGCCCGTTCATTCTCTTCAGCTGCCTGTGCC, and EIF2αS52A (+) 5’-

CTTCTTAGTGAATTAGCCAGAAGGCG and (-) 5’-

GGATACGCCTTCTGGCTAATTCACTA.

Transient Over-Expression Assays and Stable Over-Expressing Cell Lines: A459 cells respond to TRPV1 agonists similar to BEAS-2B, NHBE, and TRPV1-overexpressing cells, with the exception that they exhibit slightly reduced sensitivity to agonists due to lower levels of

TRPV1 expression (Reilly et al., 2003). A549 cells were used as transfection hosts to evaluate the pro-toxic effects of ER stress-induced gene products in lung cells because they exhibited reproducibility in transfection efficiency and limited toxicity due to transfection reagents.

Transfection efficiency typically reached ~80% using A549 cells versus ~5-10% with BEAS-2B cells, or <1% using NHBE cells. This level of transfection was necessary to evaluate the effects

11 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 of ER stress genes on cell populations. A549 cells were sub-cultured into 48-well cell culture plates and grown to a density of ~70-80%. Cells were washed with OptiMem media and transfected for ~18h using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) at a ratio of 3:1 lipid:plasmid DNA. Following transfection, cells were washed with OptiMem and allowed to grow for an additional 24h. Cell viability was assessed as described above. All experiments were performed in triplicate and were normalized to control cells transfected with equal

quantities of the pMaxGFP plasmid. Downloaded from

Stably over-expressing cell lines were generated by culturing transfected A549 cells in media fortified with Geneticin (600 µg/mL) (Invitrogen, Carlsbad, CA) for ~3 weeks. Resistant jpet.aspetjournals.org foci were isolated and expanded in selective media. Individual clones were screened for over- expression of the target genes by assaying for V5-His6 expression by RT-PCR and subsequently

used for cytotoxicity screening. at ASPET Journals on September 25, 2021

Western blotting: BEAS-2B cells were grown to ~90% maximum density in 25 cm2 flasks. Prior to treatment cells were cultured in fresh media for 2h. Cells were treated for 0, 1, 2,

4, and 8h, rinsed with PBS, and immediately lysed on ice using 20 mM HEPES, pH 7.5 containing 150 mM NaCl, 1% Triton X100, 1 mM EDTA, 10 mM sodium pyrophosphate, 100 mM sodium fluoride, 17.5 mM β-glycerophosphate, 1 mM phenylmethylsulfonyl fluoride

(PMSF), 4 mg/mL aprotinin, and 2 mg/mL pepstatin A. The lysates were clarified by centrifugation at ~20,000 xg for 15 min at 4oC and the concentration of protein determined using the BCA Assay (Pierce, Rockford, IL). 50 µg of soluble protein from each sample was resolved on a 10% NuPAGE gel (Invitrogen, Carlsbad, CA) and subsequently transferred to PVDF membrane. The blots were probed for EIF2α-P using a rabbit polyclonal IgG fraction specific to

EIF2α-pS52 (BioSource, International, Camarillo, CA) according to supplier protocols.

12 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

GADD153 expression was determined using an anti-GADD153 antibody from Biolegend (San

Diego, CA) and the protocol provided by the supplier.

Statistical Analysis: Statistical testing utilized the paired t-tests and ANOVA with post- hoc testing using Dunnett's test to determine significance. A 95% confidence interval was used as the limit for significance. Specific details on statistical analyses are presented in the figure legends.

Downloaded from

Results:

Treatment of TRPV1-overexpressing cells with nonivamide (2.5 µM) produced marked jpet.aspetjournals.org increases in cytosolic calcium due to release of calcium from ER stores (Figure 2A). EGTA and ruthenium red co-treatment had little to no effect on calcium flux, but co-treatment with LJO-328

or prior depletion of ER calcium stores with thapsigargin completely prevented calcium flux. n- at ASPET Journals on September 25, 2021

Benzylnonanamide failed to elicit ER calcium release at 2.5 µM (Figure 2A) or at concentrations up to 25 µM (data not shown). Treatment of TRPV1-overexpressing cells with 1 µM nonivamide caused an approximate 50% loss in cell viability after a 24h period (Figure 2B).

Cell death corresponded to a loss of monolayer consistency (data not shown) and was inhibited by LJO-328 co-treatment, but not by EGTA and ruthenium red. n-Benzylnonanamide did not cause cell death, consistent with a lack of TRPV1 activation.

Analysis of collective genetic responses in TRPV1-overexpressing and BEAS-2B cells exposed to 1 and 100 µM (LC50 concentrations) nonivamide, respectively, for 4h, in the presence of or absence of LJO-328, by microarray yielded preliminary insights into cellular processes that constituted the cell death process (data are provided in supplemental data files 2 and 3).

Increased expression of GADD153, GADD45α, ATF3, CCNG2, and BiP/GRP78 mRNA and a

13 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 decrease in CCND1 mRNA were observed and these responses were validated by RT-PCR

(Figure 3A). Co-treatment of cells with the TRPV1 antagonist LJO-328 prevented changes in gene expression, while little to no inhibition was observed using EGTA and ruthenium red

(Figure 3A). Treatment of BEAS-2B cells with the prototypical ER stress-inducing agents thapsigargin and DTT produced similar changes in the expression of GADD153, GADD45α,

ATF3, CCND1, CCNG3, and BiP/GRP78 (Figure 3B) mRNA.

BEAS-2B cells treated with nonivamide (100 and 200 µM) also exhibited a shift in the Downloaded from relative amount of EIF2α-P and an increase in the expression of GADD153 mRNA and protein

(Figure 4A-C). EIF2α phosphorylation and GADD153 expression was inhibited by LJO-328, jpet.aspetjournals.org but not by EGTA and ruthenium red (Figure 4A). The kinetic and dose-dependent features of

GADD153 induction and EIF2α-P accumulation paralleled cytotoxicity (Figures 4A-C). The highest levels of EIF2α phosphorylation and GADD153 protein were detected at ~8h with 200 at ASPET Journals on September 25, 2021

µM nonivamide. For GADD153, increases in mRNA in BEAS-2B cells was maximal at ~4h and occurred at concentrations >150 µM. Similar responses were observed using the TRPV1- overexpressing cells, but maximum increases in protein and mRNA were observed with a dose of 1-2 µM (data not shown).

Transient over-expression of GADD153 in A549 cells produced an approximate 50% loss in cell viability relative to pMaxGFP-transfected control cells in the absence of cytotoxic

TRPV1 agonists (Figure 5A). Transient over-expression of ATF4, which stimulates GADD153 transcription, also produced ~20% cell death. GADD153-L134A/L141A, ATF3, or p58IPK were not cytotoxic. Transient co-transfection of A549 cells with ATF3 and GFP (10:1) yielded a high proportion of viable GFP-expressing cells 48h after the transfection procedure (Figure 5B). No ethidium bromide (EtBr)-stained nuclei were observed in these cells, indicating cellular integrity.

14 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Conversely, very few cells transfected with GADD153 and GFP (10:1) survived, while those that remained attached to the culture dish exhibited intense nuclear staining with EtBr. These data were consistent with a loss of cell viability, cell membrane integrity, and oncotic cell death, as previously reported for BEAS-2B and A549 cells treated with capsaicin (Reilly et al., 2003).

Inhibition of cytotoxicity using dominant negative forms of EIF2α (EIF2α-S52A) and

GADD153 (GADD153-L134A/L141A) was also evaluated (Figure 6). Figure 6A shows that both the EIF2α-S52A and GADD153-L134A/L141A over-expressing A549 cells were less Downloaded from susceptible to cytotoxicity by nonivamide. Similarly, addition of salubrinal to treatment solutions containing nonivamide (1 or 100 µM) inhibited cell death in TRPV1-over-expressing jpet.aspetjournals.org and BEAS-2B cells with a maximum effect between 2.5 and 5 µM (Figure 6B). Salubrinal inhibits EIF2αK3-induced cytotoxicity (Lu et al., 2004; Boyce et al., 2005)

Induction of the pro-apoptotic/oncotic ER stress-induced gene GADD153 was also at ASPET Journals on September 25, 2021 compared in TRPV1-overexpressing, BEAS-2B, A549, and NHBE lung cells as well as human embryonic kidney (HEK-293) cells (Table 2). All four lung cell types express TRPV1, but

HEK-293 cells do not. Significant (6-8-fold) GADD153 mRNA induction was observed following 4h treatment of BEAS-2B, TRPV1-overexpressing, A549, and NHBE cells with LC50 concentrations of nonivamide, resiniferatoxin, and anandamide, but not with n- benzylnonanamide. Interestingly, n-benzylnonanamide inhibited cell death caused by nonivamide in the TRPV1-overexpressing cells at concentration ratios >5:1 (data not shown).

Induction of GADD153 transcription was attenuated by LJO-328 in all cells types exhibiting a response as well as by 5-iodo-RTX in the TRPV1-overexpressing line. GADD153 induction was not observed in HEK293 cells treated with nonivamide or resiniferatoxin.

15 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Discussion:

Previous studies of TRPV1 and the effects of its agonists on cultured lung cells and in animal models of airway injury support the hypothesis that TRPV1 is a mediator of lung injury and inflammation (Reilly et al., 2003; Vargaftig and Singer, 2003; Li et al., 2005; Reilly et al.,

2005; Trevisani et al., 2005; Bhatia et al., 2006; Geppetti et al., 2006). However, precise molecular mechanisms of cell death have not been established.

Quantitation of calcium flux in TRPV1-overexpressing cells demonstrated that 85-90% Downloaded from of functional TRPV1 existed in the ER membrane (Figure 2A). Selective inhibitors of TRPV1 and treatments that reduced the passage of calcium ions from extracellular sources into cells jpet.aspetjournals.org (Figure 2A and B) confirmed previous data demonstrating a correlation between ER calcium release and cytotoxicity in TRPV1-overexpressing cells (Reilly et al., 2005). Although calcium flux was not detected in BEAS-2B, NHBE, or A549 cells, results presented here demonstrate at ASPET Journals on September 25, 2021 that the TRPV1-overexpressing cells model the TRPV1 agonist-induced effects in these cell types.

cDNA microarray analysis (supplemental data files 2 and 3) demonstrated that TRPV1 activation was associated with changes in the expression of several prototypical ER stress genes in lung cells. Comparisons between gene expression changes elicited by nonivamide in the presence and absence of LJO-328 and EGTA/ruthenium red (Figure 3A) and changes elicited by the prototypical ER stress inducing-agents thapsigargin and DTT (Figures 3B) support our conclusion that TRPV1 activation causes ER stress. Furthermore, ER stress proceeded via pathways similar to those activated by thapsigargin and DTT (Schroder and Kaufman, 2005).

ER stress responses are compensatory responses. Up-regulation of specific gene products through dedicated signaling pathways, coupled with cell cycle arrest and a temporary halt of

16 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 general transcription and translation, are coordinated processes that have evolved to help cells overcome inefficiencies in protein processing (Schroder and Kaufman, 2005). Alterations in ER processing efficiency occur with nutrient deprivation, viral infection, disruption of cellular redox state, changes in ER folding environment (e.g., alterations in calcium homeostasis, redox state), expression of unstable polymorphic variant proteins, and toxicant exposures (Cribb et al., 2005;

Schroder and Kaufman, 2005). If cells cannot compensate for a specific stress, they die.

ER stress-induced cell death has been primarily attributed to the expression of GADD153 Downloaded from following EIF2αK3 activation (Matsumoto et al., 1996; McCullough et al., 2001; Oyadomari and Mori, 2004). GADD153 inhibits cell proliferation by reducing the expression of CCND1 jpet.aspetjournals.org and causes cell death by sequestering the anti-apoptotic Bcl-2 protein, and inhibiting of NF-κB and Akt/PKB-mediated cytoprotective processes (McCullough et al., 2001; Hu et al., 2004;

Hyoda et al., 2006). The balance between cell death and survival ultimately depends upon the at ASPET Journals on September 25, 2021 level of GADD153 expression and the co-expression of other pro- and anti-cytotoxic gene products that participate in ER stress responses.

Treatment of BEAS-2B cells with nonivamide promoted the phosphorylation of EIF2α at serine 52 (Figure 4A). This was indicative of EIF2αK3 activation. EIF2α phosphorylation was associated with increased expression of GADD153 expression (Figure 3A, 4A, and 4B).

Increased concentrations of EIF2α-P and GADD153 correlated with the onset of cell death in

BEAS-2B cells, as determined using dose- and temporal-response correlations with protein and mRNA (Figure 4A-C). These trends were reproduced using the TRPV1-overexpressing line.

EIF2α phosphorylation and GADD153 expression were attenuated by LJO-328, but not by

EGTA or ruthenium red. n-Benzylnonanamide, a pharmacologically inactive nonivamide analogue, did not promote ER calcium release or induce GADD153 expression in BEAS-2B or

17 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 any other cells tested, and was non-toxic at concentrations equal to or in 2-fold excess of nonivamide (Figures 2A and B, Table 2). These data support our conclusion that TRPV1 activation promotes cytotoxicity via activation of EIF2αK3, phosphorylation of EIF2α, and expression of GADD153.

To substantiate the role of GADD153 in cell death, we cloned this gene and transiently transfected A549 cells with the expression construct. Performing transient transfection studies in the BEAS-2B and NHBE cells were hampered by variable transfection efficiency and high levels Downloaded from of toxicity due to transfection reagents. As such, we used A549 cells as the model for these experiments. We have previously shown that A549 cells respond to TRPV1-agonists similar to jpet.aspetjournals.org BEAS-2B cells (Reilly et al., 2003). Cells transfected with GADD153 exhibited reduced viability due to loss of cells from the culture wells (Figure 5A and B). Cytotoxicity and cell loss

IPK

relative to controls were not observed with GADD153-L134A/L141A, ATF3, or p58 , but at ASPET Journals on September 25, 2021 toxicity was observed with ATF4. These results were consistent with the established roles of these proteins (Schroder and Kaufman, 2005). Specifically, ATF3 and p58IPK limit ER stress responses by inhibiting ATF4-dependent gene transcription and the phosphorylation of EIF2α by

EIF2αK3, respectively. Conversely, ATF4 promotes GADD153 transcription, and GADD153 is pro-cytotoxic. Additional support for GADD153 as the ultimate mediator of cytotoxicity was obtained by treating A549 cells that stably over-expressed the GADD153-L134A/L141A dominant negative mutant (Matsumoto et al., 1996). Over-expression of GADD153-

L134A/L141A markedly reduced cytotoxicity caused by nonivamide (Figure 6A). Data in

Figures 5 and 6 imply that GADD153 was the primary cause of cytotoxicity in lung cells treated with TRPV1 agonists.

18 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

The effects of modifying the EIF2αK3/EIF2α signaling were also evaluated. Two approaches were used: stable over-expression of the EIF2α-S52A dominant negative mutant in

A549 cells (Srivastava et al., 1998) and pharmacological stabilization of EIF2α-P in BEAS-2B and TRPV1-overexpressing cells using salubrinal (Boyce et al., 2005). Interestingly, squelching of EIF2α phosphorylation (Figure 6A) and inhibition of EIF2α dephosphorylation (Figure 6B) protected cells from toxicity. Initially, these data seemed contradictory, but literature supports a Downloaded from dual role for EIF2α-P in regulating cell survival and death during ER stress. Thus, the results in

Figures 6A and B highlight this dual effect of the EIF2αK3/EIF2α pathway. However, the

molecular basis for these antithetical responses remains enigmatic. jpet.aspetjournals.org

We also investigated whether ER stress represented a common mechanism of cytotoxicity for structurally diverse TRPV1 agonists. Table 2 shows that transcriptional activation of GADD153 occurred in BEAS-2B, A549, NHBE, and TRPV1-overexpressing cells at ASPET Journals on September 25, 2021 treated with LD50 concentrations of nonivamide, resiniferatoxin, and anandamide. As predicted,

TRPV1 agonists failed to induce GADD153 expression in the TRPV1-null HEK293 cell line

(Table 2). Similarly n-benzylnonanamide failed to elicit GADD153 expression confirming the direct link between TRPV1 activation, GADD153 expression, and cell death. This conclusion was also supported by the inhibition of GADD153 expression by LJO-328 and 5-iodo-RTX

(Table 2). The inability of 5-iodo-RTX to completely inhibit GADD153 expression in the

BEAS-2B cell line was consistent with our previous findings that 5-iodo-RTX (like capsazepine) causes cytotoxicity at elevated concentrations (Reilly et al., 2003; Reilly et al., 2005).

Collectively, the results presented by this study support the following mechanism of cytotoxicity for TRPV1-agonists in lung (and possibly other) cells. First, activation of intracellular TRPV1 leads to a decrease in ER calcium content, an accumulation of

19 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 unfolded/partially folded proteins in the ER lumen, and an overall decrease in protein processing efficiency. As a result, EIF2αK3 is activated resulting in the phosphorylation of EIF2α and an increase in the expression of ATF4, GADD153, and other ER stress-related genes. Ultimately, increased transcription and expression of GADD153 causes cell death.

The translational facets of the results presented in this study are two-fold. First, the near uniform response elicited by structurally diverse TRPV1 agonists in all four lung cell types suggests that this mechanism of toxicity is applicable to many other TRPV1 agonists. Downloaded from

Specifically, environmental TRPV1 agonists that promote lung inflammation and injury (e.g., particle pollutants) and endogenous TRPV1 agonists (e.g., leukotrienes, H2S, etc.) that are jpet.aspetjournals.org produced during inflammation or infection may also cause lung cell death and tissue damage via the EIF2αK3-dependent ER stress pathway. As such, future clinical research targeting TRPV1

and/or the EIF2αK3-dependent ER stress pathways may prove beneficial in the treatment and/or at ASPET Journals on September 25, 2021 prevention diverse respiratory maladies. Second, our results indicate that the effects of a TRPV1 ligand on a cell will depend upon both the relative sub-cellular distribution of TRPV1 and the relative permeability of the ligand. Hence, it must be stressed that the sub-cellular location of

TRPV1 should be established and multiple TRPV1 agonists and antagonists (preferably not capsazepine) should be utilized in future research studies evaluating the role of TRPV1 in specific biological outcomes. Although we have not specifically tested whether cell- impermeable agonists of TRPV1 (e.g. pH or environmental particle pollutants) exhibit different mechanisms of cytotoxicity, evidence supports this hypothesis. Specifically, inhibition of the cell surface TRPV1 in lung cells has no effect on cytotoxicity by TRPV1 agonists, despite inhibition of pro-inflammatory cytokine synthesis (Reilly et al., 2005), and sensory neurons,

20 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 which primarily express TRPV1 on the cell surface, are protected against cytotoxicity by inhibiting cellular influx of calcium (Wood et al., 1988).

Overall, these results provide novel insights into mechanisms by which diverse exogenous and endogenous TRPV1 agonists affect lung cell physiology. These findings provide fundamental knowledge that will facilitate future basic science and clinical research on TRPV1 in an array of physiological and pharmacological models, including models of acute lung injury

and inflammatory lung injury. Downloaded from

Acknowledgements: jpet.aspetjournals.org The authors would like to thank Dr. Manivannan Ethirajan (University of Utah

Department of Medicinal Chemistry) for assistance with n-benzylnonanamide synthesis and Dr.

David Ron (Skirball Institute, NYU Medical Center) for helpful suggestions. at ASPET Journals on September 25, 2021

21 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

References: Agopyan N, Head J, Yu S and Simon SA (2004) TRPV1 receptors mediate particulate matter-

induced apoptosis. Am J Physiol Lung Cell Mol Physiol 286:L563-572.

Bhatia M, Zhi L, Zhang H, Ng SW and Moore PK (2006) Role of substance P in hydrogen

sulfide-induced pulmonary inflammation in mice. Am J Physiol Lung Cell Mol Physiol

291:L896-904. Downloaded from

Billmire DF, Vinocur C, Ginda M, Robinson NB, Panitch H, Friss H, Rubenstein D and Wiley

JF (1996) Pepper-spray-induced respiratory failure treated with extracorporeal membrane jpet.aspetjournals.org

oxygenation. Pediatrics 98:961-963.

at ASPET Journals on September 25, 2021 Boyce M, Bryant KF, Jousse C, Long K, Harding HP, Scheuner D, Kaufman RJ, Ma D, Coen

DM, Ron D and Yuan J (2005) A selective inhibitor of eIF2alpha dephosphorylation

protects cells from ER stress. Science 307:935-939.

Cribb AE, Peyrou M, Muruganandan S and Schneider L (2005) The endoplasmic reticulum in

xenobiotic toxicity. Drug Metab Rev 37:405-442.

Geppetti P, Materazzi S and Nicoletti P (2006) The transient receptor potential vanilloid 1: role

in airway inflammation and disease. Eur J Pharmacol 533:207-214.

Glinsukon T, Stitmunnaithum V, Toskulkao C, Buranawuti T and Tangkrisanavinont V (1980)

Acute toxicity of capsaicin in several animal species. Toxicon 18:215-220.

22 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Heck A (1995) Accidental pepper spray discharge in an emergency department. J. Emerg. Nurs.

21.

Hu P, Han Z, Couvillon AD and Exton JH (2004) Critical role of endogenous Akt/IAPs and

MEK1/ERK pathways in counteracting endoplasmic reticulum stress-induced cell death.

J Biol Chem 279:49420-49429. Downloaded from

Hwang SW, Cho H, Kwak J, Lee SY, Kang CJ, Jung J, Cho S, Min KH, Suh YG, Kim D and Oh jpet.aspetjournals.org U (2000) Direct activation of capsaicin receptors by products of lipoxygenases:

endogenous capsaicin-like substances. Proc Natl Acad Sci U S A 97:6155-6160.

at ASPET Journals on September 25, 2021

Hyoda K, Hosoi T, Horie N, Okuma Y, Ozawa K and Nomura Y (2006) PI3K-Akt inactivation

induced CHOP expression in endoplasmic reticulum-stressed cells. Biochem Biophys Res

Commun 340:286-290.

Jia Y, McLeod RL and Hey JA (2005) TRPV1 receptor: a target for the treatment of pain, cough,

airway disease and urinary incontinence. Drug News Perspect 18:165-171.

Johansen ME, Reilly CA and Yost GS (2006) TRPV1 antagonists elevate cell surface

populations of receptor protein and exacerbate TRPV1-mediated toxicities in human lung

epithelial cells. Toxicol Sci 89:278-286.

23 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Knight DA and Holgate ST (2003) The airway epithelium: structural and functional properties in

health and disease. Respirology 8:432-446.

Li L, Bhatia M, Zhu YZ, Zhu YC, Ramnath RD, Wang ZJ, Anuar FB, Whiteman M, Salto-Tellez

M and Moore PK (2005) Hydrogen sulfide is a novel mediator of lipopolysaccharide-

induced inflammation in the mouse. Faseb J 19:1196-1198.

Downloaded from

Lu PD, Jousse C, Marciniak SJ, Zhang Y, Novoa I, Scheuner D, Kaufman RJ, Ron D and

Harding HP (2004) Cytoprotection by pre-emptive conditional phosphorylation of jpet.aspetjournals.org translation initiation factor 2. Embo J 23:169-179.

Matsumoto M, Minami M, Takeda K, Sakao Y and Akira S (1996) Ectopic expression of CHOP at ASPET Journals on September 25, 2021

(GADD153) induces apoptosis in M1 myeloblastic leukemia cells. FEBS Lett 395:143-

147.

McCullough KD, Martindale JL, Klotz LO, Aw TY and Holbrook NJ (2001) Gadd153 sensitizes

cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular

redox state. Mol Cell Biol 21:1249-1259.

Mitchell JE, Campbell AP, New NE, Sadofsky LR, Kastelik JA, Mulrennan SA, Compton SJ and

Morice AH (2005) Expression and characterization of the intracellular vanilloid receptor

(TRPV1) in bronchi from patients with chronic cough. Exp Lung Res 31:295-306.

24 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Morice AH, Kastelik JA and Thompson R (2001) Cough challenge in the assessment of cough

reflex. Br J Clin Pharmacol 52:365-375.

Oyadomari S and Mori M (2004) Roles of CHOP/GADD153 in endoplasmic reticulum stress.

Cell Death Differ 11:381-389.

Reilly CA, Johansen ME, Lanza DL, Lee J, Lim JO and Yost GS (2005) Calcium-dependent and Downloaded from

independent mechanisms of capsaicin receptor (TRPV1)-mediated cytokine production

and cell death in human bronchial epithelial cells. J Biochem Mol Toxicol 19:266-275. jpet.aspetjournals.org

Reilly CA, Taylor JL, Lanza DL, Carr BA, Crouch DJ and Yost GS (2003) Capsaicinoids cause

inflammation and epithelial cell death through activation of vanilloid receptors. Toxicol at ASPET Journals on September 25, 2021

Sci 73:170-181.

Ricciardolo FL, Gaston B and Hunt J (2004) Acid stress in the pathology of asthma. J Allergy

Clin Immunol 113:610-619.

Schroder M and Kaufman RJ (2005) ER stress and the unfolded protein response. Mutat Res

569:29-63.

Seki N, Shirasaki H, Kikuchi M, Sakamoto T, Watanabe N and Himi T (2006) Expression and

localization of TRPV1 in human nasal mucosa. Rhinology 44:128-134.

25 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Srivastava SP, Kumar KU and Kaufman RJ (1998) Phosphorylation of eukaryotic translation

initiation factor 2 mediates apoptosis in response to activation of the double-stranded

RNA-dependent protein kinase. J Biol Chem 273:2416-2423.

Steffee CH, Lantz PE, Flannagan LM, Thompson RL and Jason DR (1995) Oleoresin capsicum

(pepper) spray and "in-custody deaths". Am J Forensic Med Pathol 16:185-192.

Downloaded from

Szallasi A, Cruz F and Geppetti P (2006) TRPV1: a therapeutic target for novel analgesic drugs?

Trends Mol Med 12:545-554. jpet.aspetjournals.org

Tominaga M, Caterina MJ, Malmberg AB, Rosen TA, Gilbert H, Skinner K, Raumann BE,

Basbaum AI and Julius D (1998) The cloned capsaicin receptor integrates multiple pain- at ASPET Journals on September 25, 2021

producing stimuli. Neuron 21:531-543.

Trevisani M, Gazzieri D, Benvenuti F, Campi B, Dinh QT, Groneberg DA, Rigoni M, Emonds-

Alt X, Creminon C, Fischer A, Geppetti P and Harrison S (2004) Ethanol causes

inflammation in the airways by a neurogenic and TRPV1-dependent mechanism. J

Pharmacol Exp Ther 309:1167-1173.

Trevisani M, Patacchini R, Nicoletti P, Gatti R, Gazzieri D, Lissi N, Zagli G, Creminon C,

Geppetti P and Harrison S (2005) Hydrogen sulfide causes vanilloid receptor 1-mediated

neurogenic inflammation in the airways. Br J Pharmacol 145:1123-1131.

26 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Van Der Stelt M and Di Marzo V (2004) Endovanilloids. Putative endogenous ligands of

transient receptor potential vanilloid 1 channels. Eur J Biochem 271:1827-1834.

van Rijswijk JB and Gerth van Wijk R (2006) Capsaicin treatment of idiopathic rhinitis: the new

panacea? Curr Allergy Asthma Rep 6:132-137.

Vargaftig BB and Singer M (2003) Leukotrienes mediate murine bronchopulmonary Downloaded from

hyperreactivity, inflammation, and part of mucosal metaplasia and tissue injury induced

by recombinant murine interleukin-13. Am J Respir Cell Mol Biol 28:410-419. jpet.aspetjournals.org

Veronesi B, Oortgiesen M, Carter JD and Devlin RB (1999) Particulate matter initiates

inflammatory cytokine release by activation of capsaicin and acid receptors in a human at ASPET Journals on September 25, 2021

bronchial epithelial cell line. Toxicol Appl Pharmacol 154:106-115.

Watanabe N, Horie S, Michael GJ, Spina D, Page CP and Priestley JV (2005)

Immunohistochemical localization of vanilloid receptor subtype 1 (TRPV1) in the guinea

pig respiratory system. Pulm Pharmacol Ther 18:187-197.

Wek RC, Jiang HY and Anthony TG (2006) Coping with stress: eIF2 kinases and translational

control. Biochem Soc Trans 34:7-11.

Wood JN, Winter J, James IF, Rang HP, Yeats J and Bevan S (1988) Capsaicin-induced ion

fluxes in dorsal root ganglion cells in culture. J Neurosci 8:3208-3220.

27 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Zhang K and Kaufman RJ (2006) The unfolded protein response: a stress signaling pathway

critical for health and disease. Neurology 66:S102-109. Downloaded from jpet.aspetjournals.org at ASPET Journals on September 25, 2021

28 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Footnotes: a) Support for this work was provided by a grant from the National Heart, Lung, and Blood

Institute (HL069813).

b) Address correspondence to:

Dr. Christopher A. Reilly, Ph.D.

University of Utah Downloaded from

Department of Pharmacology and Toxicology

30 S. 2000 E., Room 201 Skaggs Hall jpet.aspetjournals.org Salt Lake City, UT 84112

c) M.E.J. Current Address at ASPET Journals on September 25, 2021 Jacobs Dugway Team

Life Sciences Testing Facility

Dugway, UT 84022.

29 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Legends for Figures:

Figure 1: Chemical structures for the TRPV1 agonists and antagonists used in this study.

Figure 2: Relationship between calcium flux (panel A) and cell death (panel B) in TRPV1- overexpressing cells. Cells were assayed for calcium flux and cell death, as described under the materials and methods section. In panel A the treatments were nonivamide 2.5 µM, nonivamide

+ EGTA and ruthenium red (50+250 µM), nonivamide following 5 minute pre-treatment with Downloaded from

2.5 µM thapsigargin, 2.5 µM n-benzylnonanamide, and nonivamide+20 µM LJO-328. Identical treatments were used in panel B with the exception that ruthenium red and EGTA were used jpet.aspetjournals.org separately. *Represents statistical significance (paired t-test, p<0.025, n=3).

Figure 3: Modulation of ER stress response gene expression in BEAS-2B cells treated with at ASPET Journals on September 25, 2021 nonivamide (panel A) and prototypical ER stress-inducing agents (panel B). All treatments were performed for 4h at 37oC in 6-well plates using LHC-9 as the vehicle. Panel A: BEAS-2B cells treated with fresh media (Ct), 100 µM nonivamide (N), nonivamide and 30 µM LJO-328 (NL), or nonivamide and EGTA (50 µM) and ruthenium red (250 µM) (NER). Total RNA was extracted for analysis of gene expression, as described in the materials and methods section.

Images showing changes in the expression of GADD153, GADD45α, ATF3, CCND1, CCNG2, and BiP/GRP78, as well as quantitative results for changes in gene expression (bar graph) are shown. All data are normalized to β-actin, the smaller PCR product shown for each image panel.

White bars represent untreated control cells, light grey bars represent cells treated with 100 µM nonivamide for 4h at 37oC, medium grey bars represent cells treated with nonivamide and 20 µM

LJO-328, and black bars represent cells treated with nonivamide and EGTA+ruthenium red

30 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

(50+250 µM). Panel B: BEAS-2B cells were treated with fresh media (Ct), thapsigargin (2.5

µM), DTT (1 mM) or H2O2 (1 mM), processed, and assayed by RT-PCR, as described for panel

A. White bars represent untreated cells, light grey bars represent cells treated with thapsigargin, medium grey bars represent cells treated with DTT, and black bars represent cells treated with

H2O2. *Represents significant changes in expression relative to control cells and # represents statistically significant changes relative to nonivamide treatment (ANOVA, 95% confidence interval, n=3). Downloaded from

Figure 4: Concentration- and time-dependent changes in GADD153 expression, EIF2α jpet.aspetjournals.org phosphorylation, and cell viability in BEAS-2B cells. Panel A: Western blot analysis showing the time- and dose-dependent changes in GADD153 expression and EIF2α phosphorylation in

BEAS-2B cells treated with 100 µM nonivamide (N1), 200 µM nonivamide (N2), 100 µM at ASPET Journals on September 25, 2021 nonivamide plus 30 µM LJO-328 (N1L), or 100 µM nonivamide plus 50 µM EGTA and 250 µM ruthenium red (N1ER). Panel B: Dose-response relationship between cell death and GADD153 induction. Dose-response cytotoxicity curve for nonivamide in BEAS-2B cells (solid circles, solid line) and induction of GADD153 (open circles, dashed line, right axis). Panel C: Time- dependent loss of cell viability and increased expression of GADD153 mRNA. BEAS-2B cells

(solid squares = cell viability; open squares = GADD153 expression) were treated with 100 µM nonivamide. All data are relative to control cells treated in an identical manner using media only

(n=3).

Figure 5: Panel A: Viability of A549 cells transiently transfected with ER stress -induced genes. Cells were sub-cultured into 48-well plates and transfected for 18h with mammalian

31 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412 expression plasmids harboring cDNA for EGFP, GADD153, ATF3, ATF4, and p58IPK.

Following a 24h recovery period, cell viability was determined. * Represents a statistically significant decrease in viability (95% confidence interval by ANOVA) (n=3). Panel B: Bright field and fluorescence micrographs of A549 cells co-transfected with ATF3 +EGFP and

GADD153+EGFP (10:1 target gene plasmid:pMax-GFP). Light=Bright field image,

GFP=fluorescence image using a filter set to image GFP expression, EtBr=fluorescence image

using a filter set to visualize propidium iodide- or ethidium bromide stained cell nuclei. Downloaded from

Following transfection and a 24h recovery period, cells were sequentially imaged to assess the survival of GFP-transfected cells and dead/damaged cells (EtBr+) resulting from transfection of jpet.aspetjournals.org either ATF3 (-control) or GADD153. A total of 25 ng plasmid DNA was used for each transfection. *Represents statistical significance (paired t-tests, p<0.025, n=3)

at ASPET Journals on September 25, 2021

Figure 6: Panel A: Dose-response cytotoxicity curves for A549 (open triangles), and stably over-expressing cell lines harboring the dominant negative EIF2α-S52A (open squares) and

GADD153-L134A/L141A (open circles) genes. Panel B: Inhibition of cell death in BEAS-2B and TRPV1-overexpressing cells using salubrinal. Cells were treated with nonivamide 1µM

(TRPV1-overexpressing cells) or 100 µM (BEAS-2B cells) in the presence and absence of salubrinal for 24h at 37oC in LHC-9 media. Circles=TRPV1-overexpressing cells and triangles=BEAS-2B cells treated with nonivamide and increasing concentrations of salubrinal.

Data representing changes in viability due to treatment of BEAS-2B and TRPV1-overexpressing cells with salubrinal only are represented as squares and dots, respectively. Cell viability was determined as described in the materials and methods section. Data (n=6) are relative to untreated controls.

32 JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version.

JPET#119412

Table 1: Primer Sequences used for RT-PCR analysis of selected ER stress-responsive genes.

Gene Name PCR (UniGene ID) Product Size (nt) Primer Sequence GADD153 395 (+) 5’-GACCTGCAAGAGGTCCTGTC Hs. 505777 (-) 5’-TCGCCTCTACTTCCCTGGTC GADD45α 258 (+) 5’- TCTCGGCTGGAGAGCAGAAG Hs. 80409 (-) 5’- CGCGCAGGATGTTGATGTCG GRP78/BiP 296 (+) 5’-CGTGGAATGACCCGTCTGTG Hs. 605502 (-) 5’-CTGCCGTAGGCTCGTTGATG CCND1 480 (+) 5’-AGTGCGAGGAGGAGGTCTTC Downloaded from Hs. 523852 (-) 5’-AGCGTGTGAGGCGGTAGTAG CCNG2 744 (+) 5’- AGGGCTGAGTTTGATTGAGG Hs. 13291 (-) 5’- TAGCTGTTGTGGAGGTTCTG ATF3 302 (+) 5’- CTCGGAAGTGAGTGCTTCTG Hs. 460 (-) 5’- CCGTCTTCTCCTTCTTCTTG jpet.aspetjournals.org β-Actin 183 (+) 5’-GACAACGGCTCCGGCATGTGGCA Hs. 520640 (-) 5’-TGAGGATGCCTCTCTTGCTCTG

at ASPET Journals on September 25, 2021

33 JPET#119412

Table 2: Induction of GADD153 expression by multiple TRPV1 agonists and inhibition by antagonists in various cell lines.

GADD153 Induction (Fold Control) Treatment (4h) #

TRPV1-OE BEAS-2B NHBE A549 HEK-293 This articlehasnotbeencopyeditedandformatted.Thefinalversionmaydifferfromthisversion. Nonivamide 1 µM 8.1 ± 0.8* - - - - µ Nonivamide 100 M - 7.9 ± 0.5* 6.0 ± 0.4* 5.5 ± 0.3* 0.88 ± 0.07 JPET FastForward.PublishedonMarch1,2007asDOI:10.1124/jpet.107.119412 Nonivamide 200 µM - - - - 1.19 ± 0.06 Resiniferatoxin 0.01 µM 7.9 ± 0.8* - - - - Resiniferatoxin 7.5 µM - 6.4 ± 0.8* 6.3 ± 0.3* 4.8 ± 0.4* 0.77 ± 0.08 Anandamide 12.5 µM 7.4 ± 0.6* - - - Anandamide 25 µM - 6.9 ± 0.5* - 3.3 ± 0.2* - n-Benzylnonanamide 1 µM 1.3 ± 0.2 - - - n-Benzylnonanamide 100 µM - 2.2 ± 0.3 2.6 ± 0.2* 0.65 ± 0.07 0.78 ± 0.04 Capsaicin 1µM + 5-I-RTX 1µM 0.6 ± 0.4 - - - - Capsaicin 100µM + 5-I-RTX 30µM - 10.4 ± 0.9* 4.2 ± 0.4* - - Capsaicin 1µM + LJO-328 20 µM 1.34 ± 0.03 - - - - Capsaicin 100µM + LJO-328 50 µM - 1.4 ± 0.2 1.0 ± 0.1 0.75 ± 0.09 0.84 ± 0.07 #TRPV1 over-expressing cells. *Statistically significant increase relative to control (t-test, p<0.05, n=3).

Downloaded from from Downloaded jpet.aspetjournals.org at ASPET Journals on September 25, 2021 25, September on Journals ASPET at Figure 1:

TRPV1 Agonists and Analogues TRPV1 Antagonists H

N NHSO2CH3 H H N N This articlehasnotbeencopyeditedandformatted.Thefinalversionmaydifferfromthisversion. O Nonivamide F S O LJO-328 JPET FastForward.PublishedonMarch1,2007asDOI:10.1124/jpet.107.119412 OH H HO N S HO O n-Benzylnonanamide N Cl N H Capsazepine H N HO O Anandamide O O O O O O

O I O OH O O OH OH O O OH O O

Resiniferatoxin 5-Iodo-Resiniferatoxin

Downloaded from from Downloaded jpet.aspetjournals.org at ASPET Journals on September 25, 2021 25, September on Journals ASPET at JPET Fast Forward. Published on March 1, 2007 as DOI: 10.1124/jpet.107.119412 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from

jpet.aspetjournals.org

* e

* 8

a -

n L

* T

n EG

n at ASPET Journals on September 25, 2021 n

d o

e x

* n

P u e

-B

8 h r

* t

2 a

- i

Re R

a t L

h u

d A d i

mi G

v i

n 0

6 5 4 3 2 1 0 o

(Fold Control) (Fold 90 80 70 60 50 40 30 20 10

No 110 100

% Viability % Fluorescence Intensity Fluorescence B. A. Figure 2A and B Figure 2A Figure 3A and B

A. Ct N NL NER This articlehasnotbeencopyeditedandformatted.Thefinalversionmaydifferfromthisversion. 7 GADD153 6 * * * JPET FastForward.PublishedonMarch1,2007asDOI:10.1124/jpet.107.119412 5 GADD45α * 4 # # ATF3 3 #

FoldFold Control Control 2 # CCND1 # # * # 1 * CCNG2 0 3 α 2 8 5 D1 N P7 ATF3 NG BiP/GRP78 CC ADD45 CC /GR GADD1 G P Bi Gene

B. Ct T DTT H2O2 7.5 * * GADD153 * 5.0 GADD45α * * * * ATF3 2.5 FoldFold Control Control * * * CCND1 * ** 0.0 CCNG2 α 3 78 TF G2 P A R G ADD153 CCND1 CCN BiP/GRP78 G iP/ GADD45 B

Gene

Downloaded from from Downloaded jpet.aspetjournals.org at ASPET Journals on September 25, 2021 25, September on Journals ASPET at GADD153 EIF2αS52-P Figure 4A-C A. 0h 1h 2h 4h 8h 0h 1h 2h 4h 8h N1

N2 This articlehasnotbeencopyeditedandformatted.Thefinalversionmaydifferfromthisversion.

N1L JPET FastForward.PublishedonMarch1,2007asDOI:10.1124/jpet.107.119412

N1ER

B. 120 4.0 100 3.0 80 60 2.0 40 1.0 20 Viability (% Control) (% Viability

0 0.0 Fold GADD153 Induction 0 4 8 12 16 20 24 C. Time (h) 110 12 100 11 90 10 80 9 70 8 60 7 6 50 5 40 4 30 3 20 2 Viability (% Control) Viability 10 1 0 0 Fold GADD153Induction 0 50 100 150 200 250 300

[Capsaicin] µM

Downloaded from from Downloaded jpet.aspetjournals.org at ASPET Journals on September 25, 2021 25, September on Journals ASPET at Figure 5A and B This articlehasnotbeencopyeditedandformatted.Thefinalversionmaydifferfromthisversion.

A. B. JPET FastForward.PublishedonMarch1,2007asDOI:10.1124/jpet.107.119412 120 100 Transfected Contruct 80 (10:1 GOI:pMax-GFP) 60 * ATF3 GADD153 40

Viability (% GFP) (% Viability 20 Light 0

GFP pMaxGFP pcDNA3.1-h,ATF3 pcDNA3.1-h,ATF4 pcDNA1-b,p58IPK EtBr pcDNA3.1-h,GADD153

pcDNA3.1-h,GADD153-DNeg.

Downloaded from from Downloaded jpet.aspetjournals.org at ASPET Journals on September 25, 2021 25, September on Journals ASPET at Figure 6A and B

A. This articlehasnotbeencopyeditedandformatted.Thefinalversionmaydifferfromthisversion. 110 100 JPET FastForward.PublishedonMarch1,2007asDOI:10.1124/jpet.107.119412 90 80 70 60 50 40 % Viability % 30 20 10 0 0 25 50 75 100 125 150 175 200 [Capsaicin] µM B. 120 110 100 90 80 70 60 50

% Viability 40 30 20 10 0 0 5 10 15 20 25

[Salubrinal] ( µM)

Downloaded from from Downloaded jpet.aspetjournals.org at ASPET Journals on September 25, 2021 25, September on Journals ASPET at Supplemental Figure 1:

Annotated Mass Spectrum of n-Benzylnonanamide HPLC/UV Chromatogram for n-Benzylnonanamide

91.0 100 100 Estimated Purity = 98% 26.87 91 90 141 90 H N m e 80 80 70 70 O 230 n

60 158 @ 60 ce 50 50 rban

so 40 tive Abundanc 40 M+H Ab a

ve 30 30 248.1 i Rel lat

e 20

20 R 141.1 10 10 25.53 13.57 0 0 60 80 100 120 140 160 180 200 220 240 260 280 300 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 m/z Time (min)

NMR Data for n-Benzylnonanamide 1 H NMR (CDCl3): δ 7.35-7.27 (m, 5H), 5.76 (br S, NH), 4.43 (d, J = 5.9 Hz, 2H), 2.20 (t, J = 7.8 Hz, 2H), 1.64 (br m, 2H), 1.26 (brs, 10H), 0.87 (t, J = 7.0 Hz, 3H).

13 C NMR (CDCl3): δ 173.3, 138.6, 128.9, 128.1, 127.7, 43.8, 37.1, 32.0, 29.5 (2C), 29.4, 26.0, 22.9, 14.3.