University of Groningen

Maternal-fetal cholesterol transport in the second half ofmouse pregnancy does not involve LDL receptor-related protein 2 Zwier, Mathijs V; Baardman, Maria E; van Dijk, Theo H.; Jurdzinski, Angelika; Wisse, Lambertus J; Bloks, Vincent; Berger, Rolf M. F. ; DeRuiter, Marco C; Groen, Albert; Plosch, Torsten Published in: Acta physiologica

DOI: 10.1111/apha.12845

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Final author's version (accepted by publisher, after peer review)

Publication date: 2017

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA): Zwier, M. V., Baardman, M. E., van Dijk, T. H., Jurdzinski, A., Wisse, L. J., Bloks, V. W., ... Plösch, T. (2017). Maternal-fetal cholesterol transport in the second half ofmouse pregnancy does not involve LDL receptor-related protein 2. Acta physiologica, 220(4), 471-485. DOI: 10.1111/apha.12845

Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

Download date: 11-02-2018 This article isprotected rights by All copyright. reserved. 10.1111/apha.12845doi: lead todifferences version between this andthe ofPleasec Version Record. been and throughtypesetting, proofreadingwhich may thecopyediting, process, pagination This article undergone has for and buthas accepted been not review publication fullpeer Departmentof Obstetrics and Gynecology Torsten Plösch, PhD Corresponding author: andLrp2 placental cholesterol transport Shorttitle: Groningen, Hanzeplein 1, 9713 GZ Groningen, NetherlandsThe 6 Leiden, NetherlandsThe 5 Groningen, University Groningen,of Hanzeplein 97131, Groningen, GZ Netherlands.The 4 Leiden 3 97131, GZ Gronin 2 Hanzeplein 1, 9713Groningen, GZ Netherlands. The 1 3 Zwier V. Mathijs LRP2 involve Maternal Article typePaper :Regular Accepted Date :16 Revised Date :27 Received :03 Date , Department of Obstetrics and Gynaecology, University Medical Center Groningen, University of Department Anatomy of and Embryology, Leiden University Medical Center, P forCenter Congenital HeartDiseases, BeatrixChildren’s Hospital, University Medical Center Genetics,Department of University Medical Center Groningen, University Groningen,of Hanzeplein Department of Pediatrics, University Medical Center Groningen, University Groningen,of Department of Anatomy and Embryology, Leiden University Medical Center, PO Box 9600, 2300 RC 2300 9600, Box PO Center,Medical University Leiden Embryology, Anatomyand of Department Accepted ArticleVincentW. Bloks

- fetal cholesterol transport in the second half of of half second the in transport cholesterol fetal

1 , Maria E. Maria , gen, The Netherlands.

1

, Rolf M.F. Berger - - - Oct Feb Dec

- - - 2016 2016 2016

Baardman

4

, Marco C. DeRuiter 2 , Theo ,

H. van Dijk van

1

, 5 , Albert Groen K. Angelika Jurdzinski Angelika

.

mouse

1 , Torsten Plösch rgac de not does pregnancy O Box 9600, 2300 RC 1 , ite this articleite this as Lambertus J. Wisse J. Lambertus

6

This article isprotected rights by All copyright. reserved. of half second the in LRP2 involve not do but concentrations cholesterol Maternal Conclusions probucol treatment. between interaction an for found were indications No rates. cholesteroltransport fetal However, l The Results transport E16.5 At water. drinking supplemented of injection an received dams gestation during diet enriched probucol 0.5% a Lrp2 Methods mice. availability cholesterol Donnai M expresse highlyis (LRP2) 2 proteintype relatedreceptorLipoprotein Aim Abstract Email: Hanzeplein 1, 9713Groningen, GZ Netherlands the University Medical Center Groningen

Accepted Articleas known humans, in defects birth severe with associated are gene corresponding the in utations

+/

Lrp2

-

[email protected] mice -

arw syndrome. Barrow

-

and fetal synthesis fetal cholesterol transport and endogenous cholesterolfetal synthesis depend on maternal eoye i nt nlec maternal influence not did genotype ow

were were mated heterozygously

ering of maternal plasma cholesterol levels probucol by

to ; phone: +31 50 3613149

. In the fetal liver, this liver, fetal the In . maternal W

quantified e here D7 - fetal cholesterol transport and fetal cholesterol levelscholesterol fetal and cholesteroltransportfetal

characteri labeled by

to to yield fetuses genotypes all3 of ,

isotope fetal fetal

cholesterol e te otiuin f LRP2 of contribution the zed

to decrease maternal HDL cholesterol HDL maternal decrease to was associated with increased with associated was -

ise were tissues ea coetrl rnpr and transport cholesterol fetal

enrichments infetal tissues and

olce and collected 1 with provided were

the d on both yolk sac and placenta.and sac yolk both on d

significantly Lrp2 . Half t of

eoye and genotype murine

by n mtra plasma maternal and

aenl cholesterol maternal cholesterol GC reduced maternal hedams received fetal fetal - pregnancy MS . At E13.5 At . - 13 . cholesterol.

acetate C in utero in

synthesis maternal .

Our the

in - - This article isprotected rights by All copyright. reserved. maternal whether know to importance crucial of however is It pregnancy. during for screened routinely not are levels cholesterol since complex heartdefectcongenital with mothers also describedbeenpreviouslyhave outcome birth adverse 6 defects heart and defects tube holoprosencephaly,neural severe microcephalyto mild from ranging SHH the in errors Similarly, by characterized are Smith in like pathways,synthesischolesterol in Defects when its own cholesterol synthesis is relatively low. be may cholesterol amounts significant in fetus the to transported is cholesterol recent gestation of most during correlated strongly are levels cholesterol plasma fetal and maternal shown been has it itself, fetus the by synthesis cholesterol Besides pathway. transcription a membranes, embryonic for important is Cholesterol Introduction Key words: is synthesis and regulated in thehuman fetus and placenta. transport cholesterol of system delicate the how question relevant a remains results - 8 Accepted. Article t s hrfr nt upiig ht associations that surprising not therefore is It suggest human lipop

precursor for steroid hormones steroid for precursor tde have studies It levels. cholesterol maternal decreased for compensate can fetus mouse the that rotein increased

h ms i most the a , placenta, transport, fetus, cholesterol 12 ra . nge of of nge Analyzing - cholesterol levels have a higher chance of giving birth to a child wit child a to birth giving of chance higher a have levels cholesterol L tasrpin aha ae nw t cue eiu brh defects, birth serious cause to known are pathway transcription GLI indicated prat ore o te growing the for source mportant ogntl it defects birth congenital

the effec the

ht uig h scn tietr f rgac maternal pregnancy of trimester second the during that eeomn ad ea growth, fetal and development

ts of hypercholesterolemia is morepregnantof tsinwomen ,

and the activator of the of activator the and

- ewe lw aenl hlseo lvl and levels cholesterol maternal low between ea coetrl rnpr i ivle in involved is transport cholesterol fetal

- in humans in Lemli , both -

Opitz syndrome or syndrome Opitz

n humans in

9 eu drn ogn development organ during fetus - 2,3 11 Ti sget ta maternal that suggests This . . Recently, a study showed thatshowed study Recently,a . sonic hedgehog ( hedgehog sonic ic it since and

in murine is desmosterolosis,

at f l cell all of part models SHH 1

-

that GLI and

h a h 4,5 ) . ,

This article isprotected rights by All copyright. reserved. [25,26,26,26,27,27,27] Accepted transport cholesterol the the of thinning marked and valve myocardium ventricular tricuspid straddling anomalies, arch aortic trunk, arterial utero have We function of anomalies congenital observed the of cause birth die and abnormalities, kidney and defects tube neural holoprosencephaly, transport co in and, cholesterol LDL du placenta and sac yolk secondary both on expressed highly is megalin, as known also (LRP2), 2 protein related Articlephenotyp human is receptor One and lipoprotein receptor knockoutpups arrest developmental early from rece scavenger rangingin exencephaly phenotypes, different show models mouse important source of an is cholesterol maternal that suggests further which transport, cholesterol in involved proteins Maternal diabetesand obesity areincreasing r sin organogenesis usin hte LP o yl sc n paet is placenta and sac yolk on LRP2 whether question

21 24 Atog asne f ucinl R2 n the in LRP2 functional of absence Although . .

on nutrienton transport -

Lrp2 very fetal 20 . Mice homozygous for for homozygous Mice . ring pregnancy (reviewed in (reviewed pregnancy ring - / recently described recently - interfaces

,

eue show fetuses however e with congenital anomalies congenital with e e h peaec o dsae afcig aenl hlseo lvl sc as such levels cholesterol maternal affecting diseases of prevalence the ce fetal cholesterol (reviewed by: -

D7 . We here performed here We and , - -

cholesterol was injected in the dams, followed by administr by followed dams, the in injected was cholesterol

of particular interest since it is known that mutations in this gene give a give gene this in mutations that known is it since interest particular of h yl sc n placenta and sac yolk the - rnpr wt cbln i frhroe novd n D cholesterol HDL in involved furthermore is cubilin, with transport in the placenta and the yolk sac ptor class B deficient embryos deficient B class ptor high o ht extend what to

that

17 apidlyamong pregnantwomen eerne f ogntl er aoais including anomalies, heart congenital of penetrance Lrp2 .

Lrp2 19

). kno - / - a bind to known is It

, the Donnai the , a cholesterol tr cholesterol a fetuses ck u ae on ih eee birth severe with born are out Lrp2 14,15 hs otiue to contributes this develop severe congenital heart anomalies heart congenital severe develop - ) affected / . Absence of . Absenceof - -

- eue, a fetuses, r kon o expr to known are Barrow syndrome Barrow substantially ansport study in Lrp2 in study ansport

is likely 16 fet , to no birth defec birth no to , l organs al large variety large thesecholesterol transporters in 13 otiuig fet f receptor of effect contributing .

22,23 . novd n maternal in involved

tef s h ms likely most the is itself 18 s a ess ihn 4 or after hours 24 within ra development organ : Lipoprotein receptorLipoprotein : of ligands, including ligands, of - defects; / - ts in low density low in ts large

mice to answer to mice ation of 1 of ation ubr of number

including common - fetal - 13

in C .

This article isprotected rights by All copyright. reserved. maternal quantify a either receiving cholesterollevels fetal and transportcholesterol In from two these through transport exchange lipid transplacental of directionalities and action of mechanisms placenta addition, In lipid cholesterol HDL in reduction a to lead to known are diabetes and maternal on levels HDL reduced transporter(ABCA1),A1 which crucially is involved in the formation HDL of level cholesterol plasma lowers probucol which cholesterollevelsHDL reductionof bycholesterol, plasmamainly total pregnancy. during dams the and transport effe the elucidate further To pathogenesis of the congenital heartanomalies in be could cholesterol maternal of lack a that hypothesized we ligands, LRP2 calculated be could rates synthesis and transport both cholesterol, formed newly in acetate the of incorporation and tissues different in labels the of distribution the on Based water. drinking the in acetate labeled

Accepted to order Article exchange human ,

ers are not fully understood fully not are ers indicative

the quantify the effect of of effect the quantify fetal endothelial cells to

(Mass Isotopomer Distrib Isotopomer (Mass resulting cholesterol levels cholesterol resulting characteristics ABC transporters ABC control - fetal cholesterol transport and fetal cholesterol synthesis in synthesis cholesterol fetal and transport cholesterol fetal for a synergistic function in lipid exchange during pregnancy. Althoughpregnancy. during exchange lipid in functionsynergistic a for or

probucol supplemented diet. St diet. supplemented probucol ct of adverse maternal cholesterol levels on maternal on levels cholesterol maternal adverse of ct Probucol administration in mice is associated with a 60% reduction in reduction 60% a with associated is mice in administration Probucol 27 .

- fetal transport may be of part of be may transport fetal

Abca1 Lrp2 , the fetal circulation a role for ABCA1 and ABCG1 in mediating efflux of cholesterolof mediating effluxin ABCG1 and ABCA1 for role a ution Analysis (MIDA)) Analysis ution

and eoye n pouo amnsrto o maternal on administration probucol and genotype in the in Abc

in utero in g1 mouse Lrp2 i b ihbto o te T bnig cassette binding ATP the of inhibition by is s are expressed in multiple compartments of compartments multiple in expressed are

knock

, fetus, we administered probucol to half of half to probucol administered we fetus, has been suggested previously Lrp2 ab out out embryos

.

le isotope le mice were bred heterozygouslybred were mice icular interest since maternal obesity maternal since interest icular As HDL and LDL particles are known are particles LDL and HDL As ,

which may which 25 . One of the mechanisms bymechanisms the of One . labelling .

26 . Analyzingeffects theof affect otiuig to contributing fetuses of of fetuses

was performed was - fetal cholesterol fetal maternal

28,29 t different . he exact he

while - - fetal fetal the the

to This article isprotected rights by All copyright. reserved. were females the injections, the 20% 0.5 [25,26,26,26,27,27,27] a received females pregnant the (E13.5), 13.5 day embryonic On Administration of stable isotopes and fetal tissues Experimental Procedures consent oflocal the ethical committeefor animal experiments of the University of Groningen. age.weeks ofandbetweenwere 1610 E0.5. as taken was mating the after morning the overnight, males libitum ad t (Sigma probucol 0.5% with Netherlands Lrp2 by the of disruption a with Mice Animals methodsand Materials cholesterol transport. availability Lrp2 Accepted(23 rooms controlled emperature Article Prof. +/ intra - genotypes

ie ee fed were mice

Thomas Willnow (Max Delbrück Center for Molecular Medicine, Berlin, Germany). Berlin, Medicine, Molecular for Center Delbrück (Max Willnow Thomas -

lipid (Fresenius Kabi, Den Bosch, Netherlands) by retro by Netherlands)Bosch, Den Kabi, (Fresenius lipid throughout the throughout by administratioby ; containing 5% fat, 23.5% protein, 42.3% protein, 23.5% fat, 5% containing ; . oehr te obnto o genoty of combination the Together,

- D7

- ihr RMH either

cholesterol (Cambridge Isotope Laboratories, Andover, MA) dissolved in dissolved MA) Andover, Laboratories, Isotope (Cambridge cholesterol experiments. After one week, the week, one After experiments. n of probucol of n - Lrp2 Aldrich,

osd eaaey n poie wt 2 1 2% with provided and separately housed gene have been described previously described been have gene C) with a 12/12h light/dark cycle. light/dark 12/12h a with C) - wjdeh, Netherlands). Zwijndrecht, bedn ad aneac de (AB diet maintenance and breeding B Allexperimental proceduresperformedhave been und allowed us to determine the role of of role the determine to us allowed

collection

carbohydrates pe

Lrp2 n lwrd aenl cholesterol maternal lowered and - orbital injection. Directly following Directly injection. orbital +/ - h aias ee osd in housed were animals The At the time of mating, females mating, of time the At

Food and Food ), or the former supplemented former the or ), females were mated to mated were females 21

and were kindly provided kindly were and g nrvnu ds of dose intravenous mg LRP2 water - 13 C -

it, Woerden, diets, in maternal in labeled

were provided were

acetate

F Lrp2 emale er theer - fetal +/ -

This article isprotected rights by All copyright. reserved. paraffin Ger Darmstadt, for (Merck, haematoxylin 0.1% processed with performed was Counterstaining routinely and hours 48 chain light for myocardial using evaluation, immunohistochemical paraformaldehyde 4% in fixed were E15.5 at embryos the of thoraxes isolated we hearts, fetal the of examination histological For Histological examination of the fetal hearts for product. bp 300 a in performe TCTCCT Lrp2 primers (Sigma Kit For isotopeanalysis, were F maternal of removal by isolated was placenta the cholesterol capill heparinized using collected was blood fetal of amount small a addition, In paper. filter on exsanguination by spots as collected was blood U after containing EDTA in collected was Blood puncture. cardiac paper. before collected were Bloodspots the of administration water. drinking supplemented OH) Miamisburg, (Isotec, et Accepted Articlefetuses. the extracting while ice on PBS in kept and excised were dams pregnant the of teri al 5 genotyping,

15 15 min liver, brain, the remaining the brain, liver, s then , At embryonic day 16.5, the females were anaesthetized with isoflurane and terminated by terminated and isoflurane with anaesthetized were females the 16.5, day embryonic At GTCAGTCCCATCGTA

d using the primers Lrp2 primers the using d -

Aldrich

collected Cfor concentrations utes

.

genomic DNA was isolated from fetal tail tip using the Extract the using tip tail fetal from isolated was DNA genomic 5 centrifugation

- ) E+T

following standard manufacturers standard following s ,

The and n pre in - labeled F PCR p PCR

. Both for the stable isotope data and RT and data isotope stable the for Both . - -

ege tubes, weighed 3’

C for Cfor 45s, finalwith a (5’

, rdcn a 6 b famn. eeto o te uat lee was allele mutant the of Detection fragment. bp 361 a producing ), hlseo/ctt (=) n tie dy b ti bedn o filter on bleeding tail by day, a twice and (T=0) cholesterol/acetate rogram at - carcass CATATCTTGGAAATAAAGCGACATC 2000 gat - E+T - F utilized

(from + Lrp2 +

4 snap ° re t oti ftl lsa o te determination the for plasma fetal obtain to aries C here one here , as -

T and - - rzn n iud nitrogen liquid in frozen R ( R step of 7 min. at 72 5 decidual finally 5’ ’

protocol. -

GAGGATTGGGAAGACAATAGCA C for 10 min., followed min., 10 for C

referred tubes; stored

ise fe ecso fo the from excision after tissue -

2a (Mlc 2a

The WT allele was amplified by the by amplified was allele WT The

to as “fetal body”) “fetal as to the plasma the at - 3’) - - qPCR analysis, the fetal part of part fetal the analysis, qPCR 80

° - C 2a) as a myocardial marker. myocardial a as 2a)

° .

C.

Lrp2 + n soe at stored and

fraction - by N - Amp™ Tissue PCR Tissue Amp™ 3 3 ay fr sec, 5 for many) and

cycles of cycles was - - 3’ E -

), resulting ), ( R placenta - collected 80 uterus . They .

C 5 Fetal

f 5’ or of

’s C - .

This article isprotected rights by All copyright. reserved. AcceptedDiagnostics). X concentrations triton cholesterol 2% using emulsified was extracts tissue lipid total the of subfraction Germany) Hilden, (Qiagen, PBS 10% extractions, spect chromatography/mass gas for v/v) (1:1 ethanol/aceton 100% of ml 1 with bloodspots fetal and dam both from extracted was Cholesterol Lipid ext for commercially available enzymaticassay assayed (Roche Diagnostics, Man were fractions Individual collected. were µl 500 of fractions ml/minand 0.5 of rate flow a chromatographedatSampleswere Sweden). Uppsala, proteinliquidfastchromatographyHealthcare, filtrationSuperose(GE (FPLC)to gel column usinga6 subjectedwere supplementedgroup probucol and control the of damsfrom samples plasma Pooled ArticleFPLC Analytical procedures metho myo ventricular total the myocardial against ventricular compact volume the of ratio the analyzing by E15.5 at myocardium the ventricular on morphometry performed We morphometry. cardiac as well as examination histological 12 of total a fetuses, heterozygous in development effect the examine To Germany). Entellan Darmstadt, with mounted (Merck, finally, and dehydration min, 10 for water tap with rinsing by followed

dology see ractions

and cholesterol determination Gundersen et al. -

tissue homogenates were homogenates tissue floe b ttl ii extraction lipid total by followed , were determined using determined were

30 .

ada vlms Fr n xesv dsrpin f the of description extensive an For volumes. cardial oerc nlss codn to according analysis rometric

obtained from whole tissue whole from obtained a

commercial available enzymatic assay (Roche assay enzymatic available commercial Lrp2 of of

o mtra coetrl n cardiac on cholesterol maternal low +/ hlseo cnetain uig a using concentrations cholesterol -

n according to Bligh and Dyer Dyer and Bligh to according heim, Germany). f tss ee xmnd oh by both examined were etuses using a Tissuelyser LT Tissuelyser a using 31 Pir o h lipid the to Prior . -

0, after 100, which 32 A . e This article isprotected rights by All copyright. reserved. Acceptedcholesterol pool that fractional the gives contri cholesterol synthesized newly the in distribution fractional estimated the and cholesterol of distribution fractional measured the of ratio The estimated. be can cholesterol enrichment, pool precursor against plotted are M3 and M1 which in curve a from Next, estimated. be can pool precursor corresponding the M3, and M1 of ratios the against plotted is enrichment pool precursor which in curves, multinomial M3 mass of ratio the of calculation the isalgorithm this of step first fractional s cholesterol MIDA The MIDA calculations enrichment M of Articledividi by calculated was and tissues fetal the to cholesterol maternal of transport relative the represents tissues fetal the in (M7) cholesterol D7 administered IV the of enrichment fractional approach, this isoto and dilution isotope from resulting isotopomers linear dis fractional the for corrected was m0 the to corresponding and temperature N,O GC/MS, For Gas chromatography/mass spectrometry (GC/MS)

- u t icroain f h peusr 1 precursor the of incorporation to due bis ng the fractional enrichment of M7 within each of the respective fetal tissues b tissues fetal respective the of each within M7 of enrichmentfractional the ng uin f el snhszd hlseo i te ol ad s eie a te rcin f the of fraction the as defined is and pool, the in cholesterol synthesized newly of bution regression - tiehltilooctmd (SF) 1% / (BSTFA) (trimethyl)trifluoroacetamide contribution Ms Ioooe Dsrbto Analysis) Distribution Isotopomer (Mass unesterified cholesterol from both bloodspots and tissue extracts was derivatized using derivatized was extracts tissue and bloodspots both from cholesterol unesterified ynthesis in both fetus and dam dam and fetus both in ynthesis 7 in 7 the plasma of the mother atthe time of termination (72 hours).

s ecie b Le t al. et Lee by described as analysed

has been

of newly of - 8 as stpmr. h fatoa ioooe dsrbto measured distribution isotopomer fractional The isotopomers. mass m8

y uduoe as pcrmty In mntrd ee / 458 m/z were monitored Ions spectrometry. mass quadrupole by synthesized per unit of time. synthesized cholesterol from cholesterol synthesized tribution due to natural abundance of of abundance natural to due tribution mass 33 - 13

34 o obtain to C - 36 - - ctt. y oprn tee r these comparing By acetate. isotopomer distributions of the newly synthesized newly the of distributions isotopomer Te IA loih alw u t etmt the estimate to us allows algorithm MIDA The .

pe incorporation of the administered labels. In labels. administered the of incorporation pe prah a ue t estimate to used was approach rmtyclrsln (MS a room at (TMCS) trimethylchlorosilane the

xes rcinldsrbto o mass of distribution fractional excess

a non a - isotopomer distributionsisotopomer - accessible 13 and C precursor to t theoretical to atios y the fractional the y

2 b multiple by H of of pool. The pool. e novo de M1 and M1 - 465

This article isprotected rights by All copyright. reserved. the in cholesterol synthesized maternal characterize isotope Stable maternal on genotypes Lrp2 half of LRP2 Results p<0.01 and ***p<0.001 test hoc post Tukey Chicago) Inc., (SPSS model R Statistics performed 37 real fast 7900HT a on Nanodrop2000c(ThermoScientific, Pittsburg TriReagent extractions placenta total, In RNA isolation and RT sls f h sal iso stable the of esults Accepted ArticleThe .

mice were bred heterozygously, bred were mice does not play a play not does

(Pearson) murine qPCR data were normalized agains normalized were data qPCR

) as separate runs , originating from five independentfivefromoriginating , Sga S. oi, O t oti ttl RNA total obtain to MO) Louis, St. (Sigma, pregnancy , according to to according , labeling

n liver and

or or or or - -

qPCR time PCR system PCR time - quantitative ea coetrl rnpr and transport cholesterol fetal Mann . -

Mann

ea coetrl rnpr ad re and transport cholesterol fetal to

and

pe .

from from – Primer – Whitney U test U Whitney data Whitney U Whitney as stpmr itiuin nlss ( Analysis Distribution Isotopomer Mass genotype,

fetus. 10

role in maternal in role and sequences

Lrp2 allowing (Applied Biosystems, Foster City, CA) City, FosterBiosystems, (Applied A total of of total A cholesterol . Significance levels are denoted as follows: * p<0.05, ** p<0.05, * follows: as denoted are levels Significance . experimental group experimental t +/

the geometric mean of of mean geometric the h, PA, USA)PA,h, -

. Si . eue pr group per fetuses

litters were used as us to investigate the influence of all three possible three all of influence the investigate to us gnificance was assumed when p< when assumed was gnificance - measurements , 8

fetal cholesterol transport cholesterol fetal were

. eue pr genotype per fetuses

R determine eal sulting stored - previously described

time quantitative PCR were performedwerequantitative time PCR and litter and fractions ( ht were that at fetal

36b otiuin o endogenously of contributions were - 80 4

hlseo levels cholesterol

of origin of

( C Rplp n qatfe using quantified and MIDA analysed .

RNA was RNA as o ue fr h lipid the for used not oiiaig rm 5 from originating , 0 previously ) )

and during 34 38 0.05 were were -

, using , 36 y univariate a by

. extracted withextracted B

- according acti the second the applied described SPSS v20 SPSS n utero in n , ( Atcb

to to a ) .

This article isprotected rights by All copyright. reserved. concentrations in listed are group) per (n=5 th for Parameters pregnancy. during fetus the to availability cholesterol decreased for model a as dams the of half to administered was Probucol fetal cholesterol transport Probucol and P=0.014, respectively). increased 20% average on were fetal the fetal the cholesterol Furthermore, averaging 2.7 mg/g brain n cholesterol concentrations we placenta, of expression shown previously the Seen placental (p<0.001 retardation growth severe heterozygotes e litter, one litters, independent Accepted Articlegenotypes. three the between observed were differences o , another known site of of site known another ,

body body weightsbetween the thr administration during pregnancy during administration

ach litter contained at least one wild one least containedat litter ach Splmnay figure (Supplementary the . and brain and the analyzed or An

genotype had no influence on on influence no had genotype litter sizelitter except , average

though were

(Figure 1D). 1D). (Figure hte asne f ucinl R2 rti wud fet oa fetal total affect would protein LRP2 functional of absence whether ion analyzed

in utero

total the w is ere Table Lrp2 the fetal brain fetal the levels of cholesterol

relative to wild type and type wild to relative fet observed. eegenotypes .

1 within the control group. To directly compare genotypes within genotypes compare directly To group. control the within Total fetal c al 1 ) Fgr 1 Figure ; The o The expression, , no diffe no , ,

body n or or bserved fractional synthesis rates wererates synthesisfractional bserved Lrp2 the

Both a Both weights decreases , were f were , e dams from the control and probucol treated group treated probucol and control the from dams e re A

acltd aenlcnrbtos f cholester of contributions maternal calculated holesterol concentrations were on average 1.7 in the in were ).

nces in body weight, liver weight, liver weight, body in nces type and one knockout fetus. For the wild type and type wild the For fetus. knockout one and type neit were

fter one week on the week on one fter ept te paet ifrne n ea weight, fetal in difference apparent the Despite were not affected by genotype were similar, while the while similar, were her identical ractional synthesis rates synthesis ractional

maternal maternal plasma cholesterol and cholesterol plasma maternal vrl hge than higher overall

the measured fractional enrichments of D7 of enrichments fractional measured the

heterozygous

C

(Figure 1B) holesterol - fetal interfaces of the yolk sac and sac yolk the of interfaces fetal

probucolsupplemented . concentrations f

etuses (Figure 1E (Figure etuses for Lrp2 within the within te ftl tissues, fetal other -

/ also

-

(Figure 1C)

liver liver fetuses

unchanged cholesterol i

n the fetal the n knock maternal , P=0.02 , showed

. mg/g l for ol

outs diet in - ,

This article isprotected rights by All copyright. reserved. Acceptedbrain fetal the in found were cholesterol from chol derived maternally plasma maternal with correlated strongly cholesterol were dam per enrichments D7 fractional average nor groupsthe two isolated label D7the of enrichmentsfractional the measured we levels, cholesterolfetal and transport cholesterol determine To state was point time hour a control the both in lower were blood dam the in pools (F water drinking acetate different Article MIDA by determined cholesterol p=0.187 differences no indicated after significantlyDespitedecreased (Figure2B). decrease pr that indicating profiling, FPLC to subjected were E16.5 group control the dams the in cholesterol plasma total pregnancy, of E16.5 at and any of of any

for for 50.7 intravenous rpae maueet ANOVA measurement repeated ,

relevant fetal tissuesfetal relevant

ewe dm fo te oto ad rbcl treated probucol and control the from dams between achieved % in the fetal blood to 35.0% for 35.0% to blood fetal the in % of the fetal the

levels

any D coetrl while cholesterol, HDL mainly

if compared to later time pointtimelatercompared to

t h ti the at

(Figure 2A, P<0.001 2A, (Figure diitain s el as well as administration erae mtra pam coetrl ees ol affect would levels cholesterol plasma maternal decreased (P organs - treatment =0 esterol are shown inare shown

between gr 3B igure e f slto (E16.5, isolation of me analyzed

f rom the control and probucol supplemented group. Fetal weights Fetal group.supplemented probucol and control the rom maternal were evident for all fetal tissues within the control group, averaging group, control the within tissues fetal all for evident were and +C . as rm h cnrl n pouo tetd as Fgr 3A, (Figure dams treated probucol and control the from dams 318). , i.e. , p=0.792 , Figure , the Mann , plasmacholesterol levels,

,

brain and liver. and brain on average 11%. 11%. average on siae rcro po ercmns ee ute not further were enrichments pool precursor estimated ).

4A, no differences no 4A, were observed weights fetus for total

the fetal the salr euto i LDL in reduction smaller a s – , suggesting that from the 8 hour time pointtime hour the 8 suggestingfrom , that

h f The cholesterol D7 the of contributions fractional Whitney U Whitney n p=0.318 and iue B p<0.001) 4B, Figure atoa cnrbtos f ne of contributions ractional

body Linear regression analysis showed that the that showed analysis regression Linear nd probucol supplemented group at the 8 the at group supplemented probucol nd ) . . Only limited contributions of maternal of contributions limited Only .

bcl ramn las o significant a to leads treatment obucol M

Pooled plasma samples of the dams the of samples plasma Pooled respectively

aternal contributio aternal were group both decay curves of the D7 labeldecaybothcurvesD7the of

strongly .

Significant after provision of of provision after ). hlseo ws observed was cholesterol

h e The decreased relative to relative decreased ns tmtd precursor stimated l synthesized wly for for otiuin of contributions maternal fetuses from fetuses on on 2% steady

- 1 label fetal - for 13 at C

This article isprotected rights by All copyright. reserved. co absolute cholesterol with correlation inverse significant highly an calculatedby multiplyinggroups, F synthesis rates inthe the for unchanged probuco the from fetuses for brain.fetal Synthesisratesfurther were slightly increased blood infetal the were tissues tre probucol the in measured determ to unchanged largely and decreased tissues fetal the incholesterollevels cholesterol fetal of contributions derived maternally With synthesis rates in the fetal liver maternalDecreased significant cholesterol maternal 4E). Figure p=0.032; respectively, mmol/l 1.80 and mmol/l found were and group probucol and 4C grouptreated probucol the rhroe a urthermore,

Accepted Article p<0.001). , ine if synthesis rates would be would rates synthesis if ine n ftl plasma fetal and increasein cholesterol levels was observed

eeswr lrey nhne, ihteecpino te ea ie, ee slight a were liver, fetal the of exception the with unchanged, largely were levels (Figure 5 (Figure

td as aeaig o 12.9%. to averaging dams, ated

much higher than in the in than higher much Fetal plasma cholesterol levels were determined for 5 plasma pools within the control the within pools plasma 5 for determined were levels cholesterolplasma Fetal slt contributions bsolute maternal fetal -

fetal cholesterol transport by probucol treatment is associated with treatment probucolis by fetaltransport cholesterol B, r2= 0.607, p<0.001) 0.607, r2= B, remaining brain were were lo a te ie f slto wr smlr ewe te oto and control the between similar were isolation of time the at blood cholesterol

Fgr 5 (Figure and and blood fetal fetal tetd ru rltv t cnrl wie ytei rts were rates synthesis while control, to relative group treated l tissue leveltissue further upon

body to be on average 20% decreased in the probucol group (2.24 group probucol the in decreased 20% average on be to f el snhszd hlseo i te ea lvr f both of liver fetal the in cholesterol synthesized newly of dam, A, 50% decreased50%

increased

probucol werenot statistically different concentrations . p=0.015,

s of s of Since the assumption of a steady state steady a of assumption the Since the in 13.4% to blood fetal the in 20.9% from ranging F atoa snhss rates synthesis ractional cholesterol

treatment in

p=0.021

( the Figure4D, relative to control to relative

fetal tissues fetal pn rbcl treatment probucol upon per gramper

, we turned our attention to the MIDAthe toattention our turnedwe , n p=0.959 and ept ti apparent this Despite ntribution p=0.0 of tissue of . 0 Fractional synthesis rates as rates synthesis Fractional 1).

(

p= s s esrd n the in measured as

(27.0%) in all fetal tissues fetal all in respectively 0.130). f aenly derived maternally of with the FSR, showedthe with

and liver condition

fetal , r ) dcin in eduction .

F increased ractional

(29.0%) (F tissue is igure fetal but per

This article isprotected rights by All copyright. reserved. mothe tissues these in pool cholesterol the of group supplemented probucol and control the from and synthesized newly tissues fetal the differences no but respectively) fetal dams the p in changes to translating pool, Alternatively, 5 in involved genes several differentbetween control andprobucol the treated group. the we efflux, decreased b could results these Since pregnancy, Moreover relate definitionem C, Acceptedfeta the inenrichments pool recursor Article Hmgcr transcript body

r, to or ’ differences ,

( blood at the time of termination, averaging to 9.2%. Precursor pool enrichments in the in enrichments pool Precursor 9.2%. to averaging termination, of time the at blood from newly synthesized n ban ee oe cmae t toe f h ftl ie ad lo ( blood and liver fetal the of those to compared lower were brain and o the for this correlation absentwas p=

not valid not ional 0.206 hne in changes Fgr 5D). (Figure

levels of levels ) fetal fetal ,

S in analyzed

qle for a growing tissue, we examined the possibility that this correlation may correlation this that possibility the examined we tissue, growing a for

unaccounted cholesterol unaccounted fetal

brain cholesterolsynthesis , ( h observed the e explained both by an increase in fetal hepatic synthesis rates as well as well as rates synthesis hepatic fetal in increase an by both explained e p= the cholesterol transporterscholesterol the

liver weight, liver 0.391

,

gene expression levels of the most relevant genes involved. Overall, involved. genes relevant most the of levels expression gene ial, hoeia dsrbtos f aenly eie cholesterol, derived maternally of distributions theoretical Finally,

hc relies which

between the ( ) data not shown

and observed

l blood and liver were not significantly different from those in those fromsignificantlydifferent not were liverand blood l (r2 = 0.091) may be may S my eae to relate may FSR Mvk the control and probucol group probucol and control the which was not the case (Figure 5 (Figure case the not was which mostly on endogenous synthesis during this stage of of stage this during synthesis endogenous on mostly , , none of which reached statisticalreachedsignificance which of none , ( comprised o comprised p=

rcro po enrichments. pool precursor w 0.268). .

ere calculated for the fetal the for calculated ere ). . T .

hese results indicate results hese Abca1

Next, we measured transcription levels of underlying f cholesterolf

and Abcg1 differences that is not derived from thefromderived not is that

were observed were in the in

that a larger percentage larger a that B, r2= 0.023, r2= B, body oee, estimated However,

fetal liver fetal nte acetyl the in

.% n 5.7% and 7.3% and fetal livers fetal and for any of any for p= were not were

(Figure 0.578) - CoA .

This article isprotected rights by All copyright. reserved. chole of efflux family Additionally respectively). ( I type B class receptor scavenger placenta for increased significantly trophoblast placental the in uptake we groups, group and contributions of maternally derived cholesterol were Since prob 11% about to averaging E16.5, at blood F D). and 6C (Figures group probucol the of placentas for changed not were contributions maternal B groups. both for 80% about to averaging cholesterol, derived maternally of contribution fractional large a to translating p=0.105) 6B, (Figure control enric to Fractional compared group probucol the in levels lower towards trend prob and control the group per maternal contribute a constitutes placenta The plasma cholesterol levels in the fetus Decreased Acceptedsimilar were MIDA by determined as rates synthesis ractional Article u only a trend towards trend a only c

and phospholipid transfer protein ( protein transfer phospholipid and ol group.ol - fetal cholesterol transport, we we transport, cholesterol fetal ) s

.

flx capacity efflux we , Placental weights Placental analyzed to

sterol to the fetal circulation. fetal the to sterol

mns f h D lbl ee iia t toe bevd n h mtra blood, maternal the in observed those to similar were label D7 the of hments the transport of of transport the

analyzed

u transcript levels of of levels transcript c ol t fatoa ercmns f h D7 the of enrichments fractional oth

rncit ees o svrl rnpres rm the from transporters several for levels transcript group f h placenta the of reduced are shown in shown are iet nefc bten h mat the between interface direct

( p= hlseo t te fetus the to cholesterol fo te rbcl rae gop wie rncit ees of levels transcript while group, treated probucol the from s Epeso o te o dniy iorti rcpo ( receptor lipoprotein density low the of Expression . cholesterol levels was observed in the probucol supplemented probucol the in observed was levels cholesterol 0.527). Srb analyzed , 1 eea key several Pltp ih o ap no with )

Figure 6A, showing 6A, Figure

Although y rbcl a cnrbt to contribute may probucol by C ee nhne (iue F p=0.0 6F, (Figure unchanged were holesterol ) ,

all of which of all

the placentas of the corresponding fetuse corresponding the of placentas the gene expression levels for levels expression gene aet differenc parent iorti rcpos eitn cholesterol mediating receptors lipoprotein concentrations Sne rbcl infcnl reduced significantly probucol Since .

have been implemented been have

no differences no found to be to those observed in the in observed those to - hlseo lbl a label cholesterol ra ad ea c fetal and ernal s ewe te oto and control the between es

in

similar betweentwo the h paet soe a showed placenta the the

between placenta between ATP Abca1 bevd reduced observed - 19 binding irculation

d calculated nd

n p=0.743 and in mediating in were slightly were Ldlr maternal cassette s was )

(n=8 that s of .

This article isprotected rights by All copyright. reserved. Figure7C). fetuse treated probucol the for myocardium ventricular the sep normal showing development, cardiac disturbed supplementedgroups probucol and control the both for heart fetal the of pregnancy that possibility the tested we Finally, p= litter same when Even 7A. Figure in shown cholesterol, of uptake availability Lrp2 Lrp2 maternal cholesterol levels anoma Heart were significantly decreased upon probucol treatment (p= for unchanged and group supplemented probucol the in decreased

Accepted0.642). Article

ventricular septa ventricular - / is expressed inseveralcontributing tissues to the development theof heart. fetal Consequently, -

eue so a range a show fetuses

, may induce heart defects in the otherwise normally developing normally otherwise the in defectsheart induce may in utero in

rcinl enrichments fractional is soitd ih R2 knock LRP2 with associated lies ,

especially common arterial tr arterial common especially (Figure 7B). 7B). (Figure presented

standardized to enrichments in the wild type wild the in enrichments to standardized f eee ada abnormalities cardiac severe of Furthermore, no differences were observed in the in observed weredifferences no Furthermore, as the fractional enrichments of the IV administered D7 label D7 administered IV the of enrichments fractional the as hwd o differences no showed togy eue mtra pam cholester plasma maternal reduced strongly u d nt eae o oa cholestero local to relate not do out unk and ventricular myocardial thinning myocardial ventricular and unk tation of the outflow tract and development of development and tract outflow the of tation 0.005). s eaie o h cnrl group control the to relative ewe h tregntps ( genotypes three the between

ht a rlt t cholesterol to relate may that A bcg 1 revealed , transcript levels for levels transcript , Lrp2 fetal hearts within the within hearts fetal

+/ -

fetuses. Histology fetuses. no indication no

thickness l levels ol utk or uptake l (

p=0.418, 24 ANOVA,

. during of the of Local P

, for lt

is p

This article isprotected rights by All copyright. reserved. to cholesterol maternal of transport mass the that imply Acceptedresults these Together, synthesisdifferent and/or having structural differencesin the t that suggests This to rise gives that and levels cholesterol brain the thatsuggests This genotype. by affected not further were and stage this at brain fetal the for synthesis cholesterol endogenous fract low The which ratessynthesiscalculated cholesterollevels or fetal LRP2 of effect significant between contributions maternal d no Overall, maternal Article isotope stable transp maternal in role quantitative a pregnancy, murine and human during placenta particles including pregnancy, during importance potential of ligands theLRP2 is largest receptor metabolism and developmentally regulated receptors surface lipoprotein density Low Discussion

ort has not been investigatedbeen not has ort showed higher fractional synthesis rates compared to those of wild type and heterozygous. and type wild of those to compared rates synthesis fractional higher showed

- 20,40 fetal fetal cholesterol transport and the resulting cholesterol levels inthe

. the observed the ifferences were found in the relative abundance of of abundance relative the in found were ifferences oa D ercmns on i te ea ban ocr ih srn dpnec on dependence strong a with concur brain fetal the in found enrichments D7 ional Although labeling ,

likely to likely he w amd o uniy h efc o asne f R2 uig rgac on pregnancy during LRP2 of absence of effect the quantify to aimed we , - Lrp2 related receptors (LRPs) comprise a group of multifunctional endocytic cell endocytic multifunctional of group a comprise (LRPs) receptors related bevd nrae n hlseo snhss ae ae iey the likely are rates synthesis cholesterol in increase observed

knockout on fetal body weight, body fetal on knockout

neural tube defects, severely affecting severely defects, tube neural have acquired complex evolutionary intertwined evolutionary complex acquired have of Lrp2

is expressed on maternal on expressed is

this family - contributing eff contributing / - turnover

brain thatrelate may to underlying differences incellpopulations, Lrp2 loss of of loss

41 . Using a Using genotypes . It Lrp2 rates, or (dys)functioning of the blood(dys)functioningthe or rates,of

is implemented ininternalization the large a of variety of signaling

heterozygous breeding approach in combination withcombinationbreedingapproachheterozygous in

xrsin n h dvlpn nros ytm itself system nervous developing the in expression ect of ect

in utero in n u mue model mouse our in

pathw

- maternal fetal interfaces of both the yolk sac and sac yolk the both of interfaces fetal g enotype had no discernible influence on influence discernible no had enotype ays . A

n exception was the fetal the wasexception n 39 - fetal tran fetal . hlseo containing cholesterol

further labeled sport Frhroe dsie a despite Furthermore, .

brain development brain hlseo o calculated or cholesterol functions mouse

is likely negli islikely - brain - the ea cholesterol fetal fetus. between lipid between -

barr mouse Lrp2 lipoprotein

result ier itself. ier gi - / - ble for ble

22,42,43

brain, fetus the of .

This article isprotected rights by All copyright. reserved. sideof the is system. model murine our in significantrole a plays it thatindications give not do data our cholesterol placental of view current the In group. control the of placentas to compared changed significantly not were placenta the in measured as rates synthesis and levels cholesterol overall fetuses, treated probucol maternal of reduction observed the despite Interestingly, found previously values to corresponding found, were contributions cholesterol maternal limited only pregnancy, fetal maternal reducing in successful was probucol that suggesting derived found researchprevious with line In genotype. maternal in reduction a si 6 than more with dam le cholesterol plasma reducing in effective was treatment probucol that confirmed blood decrease for model a as probucol maternal on genotype of effect the studying to addition In development area likelymore cause of the o suggest pregnancy of time this during LRP2 functional of presence the on depend critically not does gnificant part of of part gnificant Acceptedthe on expressed be to found lipoproteinreceptors different of multitudethe by supported Article

mouse in s 4

. fetal tissu fetal ht ihr rnpr o atrae iad o dfcs n local in defects or ligands alternate of transport either that

cholesterol Maternal contributions were further significantly lowered for the probucol treated group,treated probucol the for lowered significantly further were contributions Maternal placental .

Although we have not explicitly addressed endogenous placental cholesterol synthesis, cholesterol placental endogenous addressed explicitly not have we Although brain is considered to rely mostly on endogenous on mostly rely to considered is brain

4 . the

es, indicating that a large a that indicating es,

syncytio metabolism fetal cholesterol is derived from the mother during pregnancy, we anticipatedwe pregnancy, during mother the from derived is cholesterolfetal - % uig rgac, any y euto o HL hlseo. ic a Since cholesterol. HDL of reduction by mainly pregnancy, during 0% fetal cholesterol transport as well as a potential interaction with the with interaction potential a as well as transport cholesterol fetal trophoblast andhigh the maternal contribut

in mice in , coetrl viaiiy o h fts Aayi o te maternal the of Analysis fetus. the to availability cholesterol d h paet lrey eis n h utk o mtral derived maternally of uptake the on relies largely placenta the , signi , ficant fractionalficantcontributions of bserved heartand brain defects part of the fetal cholesterol pool is indeed maternally indeed is pool cholesterol fetal the of part

- - - ea coetrl rnpr, e used we transport, cholesterol fetal fetal cholesterol transport. Since the Since transport. cholesterol fetal ea cholest fetal chol esterol ions found inour model signaling synthesis at this stage of stage this at synthesis labeled rl rnpr fr the for transport erol

22,40,42

.

ahas during pathways cholesterolwere vels in the in vels

This apical .

view Lrp2 This

44 .

This article isprotected rights by All copyright. reserved. Accepted in vitro indirectly, placental of levels HDL to cells from efflux cholesterol expression (PLTP) protein transfer phospholipid of In additionrole to a for ABC transporters, transport and lowered f maternal in reduction observed the to contributing likely is ABCA1 through HDL fetal to efflux inhibitionof mediatedpregnancy,probucol throughoutdeterminedmurine accurately transp cholesterol in placenta and sac yolk the of contributions but and inhibition selective by acts supposedly Probucol fetal the on the sideof pla Articlecirculation fetal the to cholesterol placental of Efflux cholesterol from the maternal blood when trophoblast togeth considered, is which increasedwith the ex lipoprotein of upregulation to through order in receptors, trophoblast the into transport increasing by availability compensate still can probucol, of dose administered maternally derived cholesterol, interpretation one of resultsthese would that be placenta, theat the Althoughis uncertain it to what extend esterified cholesterol from the placental pool exchanges with has

studies iie efcs n BA tasrp lvl itself levels transcript ABCA1 on effects limited interferes with the efflux capacity of the placenta, corresponding to previously performedpreviouslycorrespondingtoplacenta, the of capacity efflux the with interferes 45 - 48 29 . .

hs a sget that suggest may This Pltp pression ofplacental the DeLow maintain cholesterol homeostasis cholesterol maintain etal pl

on might found centa, potentially mediated by r ih SR with er asma asma cholesterol levels - ap olipoproteins and HDL acceptors HDL and olipoproteins further

- endothelial cells facing thefetal circulation are a major site I as BI, n mice in maternal d t te da ht probucol that idea the to add a

extra e lipop key HDL concentrations arelow inactivation of AB of inactivation

48 nsity Lipoprotein receptor (LDLR is thought to be mediated by endothelial cells endothelial by mediated be to thought is ,

.

-

iey o ert activ secrete to likely mroi tsus a tk u mr LDL more up take may tissues embryonic . This view is supported by the association the by supported is view This . the ABCtransporters o te erae n aenl cholesterol maternal in decrease the for

oen receptor rotein

49,50 . r t te eu rmi t be to remain fetus the to ort lhuh h eat absolute exact the Although CA1 in the plasma membraneplasma the in CA1 51,52 . The reduced ex reduced The

,

ihn h placental the within ABCG1 PT t promote to PLTP e .

,

ihr iety or directly either - ea cholesterol fetal ) in) our model,

and ABCA1 pression

29 .

This article isprotected rights by All copyright. reserved. Accepted showed pregnancy Strikingly, 55,56 in increase compensatory a by rates synthesis cholesterol cholesterol derived maternally in decrease a for counteract enrichments pool precursor representing T cholesterol. significant, highly a showed the Despite stea a in is exchange cholesterol that assumes method this since approach, MIDA the of caveats the of one represents acti andexpressionhigh by fetal for demand higher a induce Article likely cholesterol, where endogenous provides synthesis cholesterol,fetal large the a part of reflected asis gestation of end the during rates growth fetal High derived maternally of reduction observed the cholesterol and increased contributions of newly synthe explain may placenta and/or liver fetal the in of levels transcript measuring by deduced ca presence its and placenta the cross can probucol whether unknown currently is it Since probucol.treatmentwith increasedmodestlyuponwere blood liver fetal and fetal the cholesterolin measu synthesis, cholesterol in levels cholesterol levels cholesterol hepatic in increase significant a to lead treatment d Interestingly, .

increased fetal plasma cholesterol levels and lowered hepatic cholesterol levels cholesterol hepatic lowered and levels cholesterol plasma fetal increased , these these s that lead to increased maternal increased to lead that e the total cholesterol pool, cholesterol total the

i association his limitation espite a strong decrease in the contributions of of contributions the in decrease strong a espite results are reminiscent of of reminiscent are results the y tt stain which situation, state dy

s remaining fetal fetal remaining , absolute contributions of newly synthesized choleste synthesized newly of contributions absolute

vity of genes involved in cholesterolgenesinvolvedinsynthesis of vity in fetal tissues fetal in .

e uig IA idctd ht otiuin o nwy synthesized newly of contributions that indicated MIDA, using red oehr these Together ol nt e xlie b dfeecs n niiul ie weight liver individual in differences by explained be not could nes creain with correlation inverse body nor could be could nor , Abca1 especially - fetal cholesterol transport. Furthermore, these studies these Furthermore, transport. cholesterol fetal

and brain and eut suggest results previous a nvr be never can

itself, we speculate that either inhibition of ABCA1 of inhibition either that speculate we itself, related to related the fetal liver, as has been suggested before suggested been has as liver, fetal the sized cholesterol in our model. were unchanged. were studies h cnrbto of contribution the

ht the that

h cs i a ail goig fetus. growing rapidly a in case the

sn LR gnss during agonists LXR using underlying differences underlying aenl cholesterol maternal

n the in mouse

53,54 Furthermore, endogenousFurthermore, . At the same time,thissame the At . mouse fetus rol in the fetal liver fetal the in rol mat ernally can fetus

in probuco , ot likely most , that observed whereas nnot be nnot derived murine were s l , ,

This article isprotected rights by All copyright. reserved. Accepted idea the support view, our in results, These probucol by cholesterol derived maternally of reduction significant a Despite offspring. heterozygous the reduced maternal cholesterol levels by probucol treatment, would interactto induceheart for heterozygosity that possibility the examined we Additionally, related to the fractionalenrichmentstheof a reduced cholesterol ability for uptakewithin show myocardium ventricular the of compaction and tract outflow the of that demonstrating heart fetal the of development that shown have studies previous maternal mediating in LRP2 for role a to addition in Finally,Article further studies. for possibility interesting an is this placenta, murine the of compartments multiple in expressed f account possibly could maternal in decrease a reflect measurement and condition process this in ABCA1 an implement would and liver mouse fetal the in functional already are HDL fetal to pathways excretory that indications reasonable provide studies previous upregulation by caused likely most Lrp2 a near complete penetrance of severe cardiac defects,cardiac severe of penetrancecomplete near a

genotype, o genotype, in fetal tissuesfetalin

the observed cardiac anomalies. a osblt i ta te eue mtra cnrbtos pn rbcl treatment probucol upon contributions maternal reduced the that is possibility a ,

isn ifrain bu aslt fet absolute about information missing Lrp2 ur data ur 37,57 , we observed none of the cardiac anomalies present in thepresentincardiactheanomalies observedof none we ,

is expressed in expressed is r h msig hlseo i ou in cholesterol missing the or .

Although interpretation of our our of interpretation Although labeled cannot exclude the possibility th possibility the exclude cannot - fetal exchange of cholesterol instead of of instead cholesterol of exchange fetal

21,58

cholesterol in the fetal heart were shown to beindependentcholesterolinheartweretofetaltheshown of of of L rp2 W hv rcnl etne tee bevtos by observations these extended recently have We . all cell all A bca1

s xrse i svrl ise cnrbtn t the to contributing tissues several in expressed is any of any of

ht h cric nmle, bevd n the in observed anomalies, cardiac the that

populations involved in the formation and septation and formation the in involved populations ihn the within thecell populations invo fetal data is hampered by a non a by hampered is data - l rwh ae drn te ie of time the during rates growth al fetal cholesterol transport, results from results transport, cholesterol fetal r that we hypothesized to originate from originate to hypothesized we that

important role for placental and fetal fetal and placental for role important model at ligands at - placental Lrp2,

24 . .

in combination with strongly with combination in Consequently, reflecting osdrn ta AC1 is ABCA1 that Considering

other

axis lved

than cholesterol than 37,48 net import net

24 . Lrp2 .

However, since u dt an data Our Lrp2 - - steady state steady / -

defectsin offspring. - / -

, as this as , fetuses Lrp2 are - / d -

This article isprotected rights by All copyright. reserved. GC/MS MIDA 1 D7 cho RT FPLC PBS EDTA E13.5 LXR SR PLTP MVK SQLE HMGCR LDLR ABCG1 ABCA1 VLDL IDL LDL HDL Probucol S LRP2 Abreviations: - Conflictof interest Organization for Scientific Research (TOP ZonMw 40008129811053). Netherlands the and 2004T4801) (grant Foundation Heart Dutch the by supported is Plösch Torsten Funding Klaas Bijsterveld for performing GC thank to like would We Acknowledgements signaling disturbed of result the likely more but cholesterol of concentration the to related not are fetuses, none HH - 13C acetate 13C - - BI Accepted qPCR Article – – - - – –

- - -

– – Liver X Receptor Liver Lipoprotein Density Intermediate – Phosphate Buffered Saline Buffered Phosphate - -

- Low Density Lipoprotein Low Density

– –

High Density Lipoprotein Density High - Sonic HedgeHog Sonic Fast Protein Liquid Chromatography Liquid Protein Fast P Kinase Mevalonate

Squalene Epoxidase Squalene lesterol lesterol Scavenger Receptor Class B member 1 member Class B Receptor Scavenger Ethylenediaminetetraacetic acid Ethylenediaminetetraacetic Low Density Lipoprotein Related Receptor 2 Receptor Related Lipoprotein Low Density Low Density Lipoprotein Receptor Lipoprotein Low Density

– Lipoprotein Density Low Very

– - Embryonic Day 13.5 Day Embryonic hosph Mass Isotopomer Distribution Analysis Distribution Isotopomer Mass

-

Gas Chromatography Gas Chromatography – ATP Binding Cassette Binding ATP

ATP Binding Cassette type G1 type Cassette Binding ATP -

3

uptakeor of other potentially importantligands, which hasbeen suggested previously

4,4' Reverse Transcription Quantitative Polymerase Chain Reaction Chain Polymerase Quantitative Transcription Reverse - hydroxy olipid Transfer Protein Transfer olipid - - -

[propane Sodium acetate Sodium

Cholesterol

- 3

-

methylglutaryl

- 2,2

Rick Havinga for performing the retro the performing for Havinga Rick -

- 25,26,26,26,27,27,27 diylbis(thio)]bis(2,6

– type A1 type

-

1 Mass Spectr Mass - 13C

- CoA reductase

-

MS on on MS all fetal lipid extracts.

ometry

- di - d -

tert

- butylphenol)

- orbital injections and Theo Boer and Boer Theo and injections orbital

22,42

This article isprotected rights by All copyright. reserved. 5. 4. 3. 2. 1. References treated dams. probucol and control the experiments. isotope stable the for used (E16.5), 16 day embryonic at group treated probucol and control the from dams pregnant the for Parameters 1. Table SD FSR TMCS BSTFA size (n) Litter C (%) Liver weight/BW (g) Liver weight (g) weights Body at parameters Dam Table 1.

holesterol

Accepted Article– syndrome. syndrome. etal. ER, Elias M, GS,Irons Tint sterols. of fetal origin SB. Patel G, Xu Q, Shang H, G,Tint Yu maternal synthesis or Endogenous second in sterols of fetal The origin etal. RM, JJH, Berger Erwich ME, Baardman 2010;878(23):2130 defects. biosynthesis cholesterol of diagnosis the to Application GC by fluid amniotic in sterols five of analysis Quantitative al. et R, Rodrigues E, Gallardo C, Amaral 1997;100(11):2680. earl into recruitment precede monocyte oxidation its and lipoprotein lowdensity of accumulation intimal hypercholesterolemia. maternal by enhanced is greatly and fetal aortas human in occurs formation streak Fatty al. et F, D'armiento Mancini C, F, Napoli –

Standard Deviation Standard

Fractional Synthesis Rate Synthesis Fractional – -

Trimethylchlorosilane N,O - bis

liver (mg/g)

N Engl J Med Engl N - (trimethyl)trifluoroacetamide

- 2136. 2136.

J Lipid Res J Lipid . 1994;330(2):107 .

hysterectomy hysterectomy

Defective cholesterol biosynthesis associated with the smith the with associated biosynthesis Defective cholesterol . 2006;47(7):1535 . - fetal transport? transport? fetal

Data represent mean +/ mean represent Data The use of the Dhcr7 knockout mouse to accurately determine the determine the mouse accurately to knockout Dhcr7 the use of The +/ 7.8 2.67 +/ 4.84 +/ 1.53 +/ 31.7 +/ (n=5) Control

-

113. None of the parameters were statistically significant between between significant statistically were parameters the of None - - - - -

3.3

0.24 2.6 0.13 0.69 - y atherosclerotic lesions. lesions. atherosclerotic y 1541.

Obstet Gynecol Obstet

-

SD for 5 dams per group. 5 damsper SD for 8.6+/ 2.58 +/ 4.64 +/ 1.64 +/ 35.3 +/ Probucol (n=5) Probucol Journal of Chrom of Journal

. 2012;207(3):202. e19 2012;207(3):202. . -

- - - - 1.3

0.18 0.47 0.24 3.9

J Clin Invest J Clin

- trimester amniotic fluid: fluid: amniotic trimester atography B atography

. - 202. e25. 202. - lemli . - opitz opitz – MS:

This article isprotected rights by All copyright. reserved. LRP2/megalin al. U, et Anzenberger A, Hammes R, 22. Spoelgen gp330/megalin. lacking mice in development forebrain Defective etal. SA, J, Armstrong Hilpert TE, 21. Willnow endocytic multiligand the of patterns expression Overlapping J,al. et Chandellier F, Châtelet E, 20. Assémat its of functional regulation the and megalin/LRP2 of roles the insightsinto New P. Farfán M, 19. Marzolo Al S, 18. Kantarci RE, Hammer RD, JL, Gerard Goldstein MS, Brown S, 17. Ishibashi Contreras NG, 16. Santander the to cholesterol maternal of Transport LA. Woollett F, GrafGA,Schroeder L, Myatt PL, Colvin KT, 15. Burke fetal cir the to cholesterol of maternal Transport Review: L. 14. Woollett 13. Toes al. et O, Valkenburg E, Uitert van H, 12. Smedts state of low oxidative the of evaluation The al. et B, Schiessl R, Caspers U, 11. Pecks by complicated pregnancies in concentrations lipoprotein and Lipid al. PJ, et Galloway Greer IA, N, 10. Sattar 9. 8. 7. 6.

Accepted Article telencephalon. telencephalon. Sciences of Academy National the of Proceedings patterns expression Gene embryo. rodent of the epithelia developing and sensory organs CNS, the in megalin and cubilin receptors expression. cause donnai 1993;92(2):883. adenovirus by its reversal mice and knockout receptor lipoprotein SR receptor HDL the lacking 2009;50(6):1146 hamster. syrian golden the in concentrations cholesterol plasma maternal by affected fetus is diabetes. by complicated pregnancies and pregnancy Diseases offspring. the disease in heart riskof congenital elevated an preeclampsia. and restriction growth intrauterine restriction. growth intrauterine Pediatrics Adverseal. et A, RJ, Berg Remaley K, Edison formation. pole arterial normal for required is and field progenitors heart secondary in proliferation maintains hedgehog Sonic ML. Kirby LA, Dyer activity. patterning neural impair holoprosencephaly human causing Schell 484. a metabolism cholesterol abnormal al. et R, Hennekam E, Kelley Roessler RI, cu V, Nuttall S, Martin U, et al. Changes in plasma lipids and markers of oxidative stress in normal normal stress in markers oxidative of and lipids plasma Changes in etal. U, Martin S, Nuttall V, cu

- Apacik C, Rivero M, Knepper JL, Roessler E, Muenke M, Ming JE. SONIC HEDGEHOG mutations mutations HEDGEHOG SONIC JE. Ming M, Muenke E, JL, Roessler Knepper M, Rivero C, Apacik . 2012;22(6):477 . . 2007;120(4):723 . Biol Res Biol - - barrow and facio and barrow Gazali L, Hill RS, et al. et RS, Hill L, Gazali Development

- 1155. . 2011;44(1): .

- - . 2005;6( . 485. 485. Duarte S, Awad MF, etal. MF, Awad S, Duarte - - 733. 733. BI. BI. . 2005;132(2):405 .

- Hum Mol Genet Mol Hum oculo Journal of Clinical En Clinical of Journal 89

1):69 - ffect the function of sonic hedgehog? hedgehog? sonic of function the ffect 105. 105. Mutations in LRP2, which encodes the multilig the encodes which LRP2, in Mutations - acoustico - 78. Holoprosencephaly in RSH/Smith‐Lemli‐Opitz syndrome: Does Does syndrome: RSH/Smith‐Lemli‐Opitz in Holoprosencephaly

birth outcome among mothers with low serum cholesterol. cholesterol. serum low with mothers among outcome birth A derangement of the maternal lipid profile is associated with with is associated profile lipid maternal of the A derangement Dev Biol Dev - 414. . 2013;22(6):1086 . - renal syndromes. syndromes. renal . 1996;93(16):8460 . Hypertension in Pregnancy in Hypertension Developmental abnormalities in mouse embryos mouse in abnormalities Developmental

docrinology & Metabolism & docrinology . 2009;330(2):305 . ClinSci Nutrition, Metabolism and Cardiovascular and Metabolism Nutrition, is required for patterning of the ventral ventral ofthe patterning is for required . 2004;106(1):93 . Herz J. Hypercholesterolemia in low density lowdensity in J.Hypercholesterolemia Herz

- 1096. 1096. - Nat Genet Nat mediated gene delivery. genedelivery. mediated - 8464. 8464. culation. culation. Hum Genet Hum - 317. 317.

Am J Med Genet JMed Am

. 2007;39(8):957 . . 2012;31(1):156 . - 98. Placenta . 1999;84(1):128 . - . 2003;113(2):170 . density lipoproteins in in lipoproteins density

and receptor megalin, megalin, receptor and . 2011;32:S218 . . 1996;66(4):478 . J ClinInvest - - 959. 959. J Lipid Res J Lipid 165. 165. - 130. -

177. 177.

- S221. .

.

-

This article isprotected rights by All copyright. reserved. AcceptedCY JF, Janda 39. Bazan development. of models animal using studies in methods statistical and Design MF. 38. Festing utero in LXR of activation T.Pharmacological Plösch F, Baller JF, Kuipers NC, Huijkman EM, Straten 37. van etal. BallerJF, EM, Straten van H, Meer 36. van T TH, Dijk van MH, 35. Oosterveer and biosynthesis measuring for Atechnique analysis: distribution isotopomer Mass R. Neese M, 34. Hellerstein practical and Theoretical analysis: J.Mass isotopomer Edmond EA, Bergner LO, Byerley 33. Lee WP, tota of method WJ.A rapid Dyer E, 32. Bligh and rats in cholesterol plasma of synthesis of endogenous Measurement etal. C, Kletke D, Faix 31. NeeseR, Articleal. et T, KORBOL, Bendtsen H, 30. Gundersen deliver efficiently barrier placental the of cells endothelial Human T,al. et Becker U, J, Panzenboeck 29. Stefulj expression ABCG1 and ABCA1 C. Placental Albrecht D, Surbek WengerF, X, Huang M, Körner M, 28. Baumann al. T, Tuomi et P, Almgren B, 27. Isomaa profound causes Abca1 hepatic of Targetedal. inactivation et E, Boudyguina J, Lee JM, 26. Timmins atheros on probucol Effects of N. Yamada S, Ishibashi Z, Chen H, T, Shimano 25. Yoshikawa Wisse ZwierMV, ME, 24. Baardman steroids. of sex uptake cellular in endocytosis of Role al. et Spoelgen R, TK, Andreassen A, 23. Hammes 2012;23(2):227 2006;47(1):5 metabolism. cho adult affect does not mice in but function and expression transporter ABC influences directly fetal lipid and transport cholesterol One PLoS 1001. of polymers. turnover considerations. physiology and E147. MIDA. using humans diagnosis. and research pathological use in ABCG1. and ABCA1 via fetal circulation the to cholesterol 2013;34(11):1079 Pre disease: gestational in syndrome. apoA of hypercatabolism kidney and hypoalphalipoproteinemia receptor LDL or deficient development. cardiac in LRP2 roleof crucial 2005;122(5):751

. 2009;4(6):e6066. . Diabetes Care Diabetes - American Journal of Physiology of Journal American 14. . 1959;37(8):911 . - Biol MassBiol Spectrom 232. 232. -

762. - 1086. 1086. , Garcia KC. Structural architecture and functional evolution of wnts. wnts. of evolution functional and architecture KC.Structural Garcia ,

American Journal of Physiology of Journal American

American Journal of Physiology of Journal American

- . 2001;24(4):683 . deficient mice. mice. deficient - eclampsia affects ABCA1 ABCA1 affects eclampsia

ietge UJ, et al. High fat feeding induces hepatic fatty acid elongation in mice. in elongation acid fatty hepatic induces fat feeding High UJ,al. ietge et -

917. 917. LJ, et al. Common arterial trunk and in Lrp2 knock out a knock mice Lrp2 indicate and in trunk arterial Common al. LJ, et . 1991;20(8):451 . synthesis in mice. synthesis in Cardiovascular

l lipid extraction and purification. purification. and extraction l lipid Hormone and Metabolic Research Metabolic and Hormone - 689. Some new, simple and efficient stereological methods and their their methods and stereological efficient and simple new, Some APMIS - Disease Models and Mechanisms and Models Disease The effects of intrauterine malnutrition on maternal on malnutrition of intrauterine effects The Endocrinology And Metabolism And Endocrinology

. 1 88; (1‐ ):3 ):3 (1‐ 1 88; .

levels in syncytiotrophoblasts. syncytiotrophoblasts. levels in - morbidity and mortality associated with the metabolic metabolic the associatedwith mortality and morbidity - 458. 458. Endocrinology And Metabolism And Endocrinology - Pediatr Res Pediatr Endocrinology And Metabolism And Endocrinology Circ Res Circ

-

I. . 2009;1 . . 2010;68(1):10 . J Clin Invest J Clin - 394. 394. 04(5):600

Canadian journal of biochemistry biochemistry journalof Canadian . 2001;33(08):472 . . 2008;295(6):E1341 . . 2016:dmm. 022053. 2016:dmm. . . 2005;115(5):1333 . - 15. Placenta - 608. . 1993;264(1):E136 .

. 1992;263(5):E988 . clerosis of apoE of clerosis Developmental cell Developmental

. ILAR Journal ILAR - 479. 479. - - - lesterol E1348. E1348. fetal fetal 1342.

Cell - . -

. - . This article isprotected rights by All copyright. reserved. Accepted during cholesterol of Sources P. Morell FZ, Kidwai HA, 55. Jurevics Sterol synth JM. Dietschy WM, 54. Belknap 53. C human in expressed is differentially transferprotein Phospholipid etal. J, Metso C, Wadsack M, 52. Scholler and with interacts transferprotein Phospholipid JJ.Albers C, Tang AM, G, Vaughan JF,Wolfbauer 51. Oram with membrane plasma the in ABCA1 inactivates S. Probucol Yokoyama M, Hayashi M, Tsujita CA, 50. Wu ABCA1 inhibits Probucol GH. Rothblat F, Bernini N, Ronda F, Zimetti I, Zanotti 49. Favari E, al. et Vaisman B, CA, Wassif ML, 48. Lindegaard Article AK, 47. Hatzopoulos low trophoblast placental human of Regulation ED. GJ, Albrecht Pepe RW, 46. Grimes Levak A, Hammer C, 45. Wadsack fetal development: in cholesterol Maternal LA. 44. Woollett adult the in signaling BMP cells regulates ependymal in LRP2 al. et O, Lioubinski H, CR, Emich 43. Gajera developing the in folate uptake mediates LRP2 A. Hammes TE, Willnow RM, Cabrera N, Mecklenburg E, 42. Kur (LRP megalin of The role Howie SE. CE, 41. Fisher its of functional regulation the and megalin/LRP2 of roles the insightsinto New P. Farfán M, 40. Marzolo organs. organs. 1988;82(6):2077 fetal development. during cholesterol fetus.sources tissue for and placenta, rat, Metabolism Metabolism & Endocrinology Clinical HDL. fetal to efflux cholesterol enhances and cells endothelial venous placental and arterial 2003;278(52):52379 ATP stabilizes degradation. proteolytic its to and assembly lipoprotein high density and binding apolipoprotein of its mediation to respect effluxlipid 3813. Smith of therapy utero forin target potential SR receptor estrogen. by vitro in uptake v term firsttrimester and human by lipoprotein fetal circulation. niche. neurogenic tube. neural 297. expression. arr

BR, S BR,

J Lipid Res J Lipid impson . Arterioscler Thromb Vasc Biol Vasc Thromb Arterioscler - Biol Res Biol . 1982;55(3):447 . BI during murine embryogenesis. embryogenesis. murine BI during J Ce - binding cassette transporter A1 and enhances cholesterol efflux from efflux cholesterol enhances and A1 transporter cassette binding - ll Sci Am J ClinNutr J Am Rigotti A, Rosenberg RD, Krieger M. Temporal and spatial pattern of expression of the HDL HDL the of expression of pattern spatial and Temporal M. Krieger RD, Rosenberg A, Rigotti 2085. ER. Cholesterol synthesis in human fetal tissues*. tissues*. fetal human in synthesis Cholesterol ER. . 1997;38(4):723 . JSci Cell . 2011;44(1):89 . - . 2014;127(Pt 10):2261 2014;127(Pt . 52385. 52385.

J Biol Chem J Biol . 2010;123(11):1922 . J Clin Endocrinol Metab ClinEndocrinol J -

452. - Frank S, et al. Selective cholesteryl ester uptake from high density density fromhigh uptake ester cholesteryl Selective etal. S, Frank . 2005;82(6):1155 .

- - 733. 105. 105. . 2004;279(29):30168 . . 2012;97(7):2466 . esis and low density lipoprotein clearance in vivo in the pregnant pregnant the vivo in clearance in lipoprotein lowdensity esis and

. 2004;24(12):2345 . - Characterization of placental cholester placental of Characterization 2268. 2268. – - 2/Gp330) during development. development. during 2/Gp330) J Lipid Res J Lipid Lemli - illous trophoblast cells. illous trophoblast 1930. 1930. - 1161. 1161.

. 1996;81(7):2675 . – Opitz syndrome. syndrome. Opitz

- 2474. 2474.

. 1998;39(3):495 .

Transport of cholesterol from the maternal to the the to maternal the from of cholesterol Transport - 30174. 30174. - 2350. 2350.

development of the rat fetus and fetal fetus and rat of the development

The Journal of Clinical Endocrinology & & Endocrinology Clinical of Journal The - Hum Mol Genet Mol Hum 2679. 2679. Placenta - 508.

Dev Biol Dev

. 2003;24(2):131 . J ClinInvest J - density lipoprotein lipoprotein density ol transport: ABCA1 is a ABCA1 transport: ol cells. cells. . 2008;17(23):3806 . . 2006;296(2):279 . - mediated cellular mediated J Chem Biol The J The . - ournal of of ournal 143.

.

- - This article isprotected rights by All copyright. reserved. (D) organs. the and blood fetal the against in cholesterol maternal of contributions plotted fetuses the for enrichments concentration D7 fractional average the showing fetal analysed the for represent Weights bars error (A) E16.5, at isolated group. organs supplemented probucol and control the within fetuses for levels 4. Figure mean +/ represent Data measured. over time the condition difference (2 no overall groups, while both for points time later to compared lower significantly 1 poi time different six at measured diet, supplemented probucol and control the from 1 2% treated of provision probucol and cont line) Fractional (continuous (B). control line) the (dotted from groups dams of SAAMII, in fittings curve dam individual +/ measurements actual represent points Data administration. intravenous 3. Figure mean +/ represent Data of pregnancy. 16 day at group sample plasma pooled of profiles (FPLC) Chromatography Liquid Protein Fast (B) group. supplemented probucol the bars black group, control the from dams represent bars white pregnancy, during and mating) to (prior diet supplemented 2. Figure mean +/ represent fetus. Data knockout one and type wild one least at contained litter Each each). (n=8 genotype to according analyzed were fetuses An Distribution Isotopomer Mass by determined as cholesterol of synthesized contributions newly Fractional (E) tissues. fetal and blood dam the in enrichments D7 fractional from calculated Lrp2 (C shown. according on depending levels cholesterol fetal and 1. Figure Figure legends: of related closely two ontogeny and immunochemistry Comparative etal. F, Chatelet N, Mulliez D, 58. Sahali primary term of fusion and differentiation inhibit Oxysterols Keelan J. P, Mark B, Waddell I, 57. Aye sterol novo de of hamster: Contribution syrian fetal golden the in of cholesterol Origin LA. 56. Woollett - Accepted13 Article antibodies. antibodies. 280 the proteins. pit coated X receptors. liver activating by trophoblasts maternal and synthesis aeae n h dikn wtr A te hu tm pit fatoa peusr nihet were enrichments precursor fractional point, time hour 8 the At water. drinking the in acetate C +/+

fetuses, grey bars bars grey fetuses,

Characterization of maternal of Characterization ) Cholesterol concentrations as measured i measured as concentrations Cholesterol ) transport cholesterol fetal maternal characterize to results labeling isotope stable the of Overview A Fatoa ercmn o D7 of enrichment Fractional (A) to genotype. The influence of genotype on the resulting fetal (A) and placental weights (B) are are (B) weights placental and (A) fetal resulting the on genotype of influence The genotype. to (A)

in the dams of the control and probucol supplemented group (n=10). (C) Cal (C) (n=10). group supplemented probucol and control the of dams the in oa pam coetrl ees o te as fe 1 ek on week 1 after dams the for levels cholesterol plasma Total s of the pregnant dams from the control (solid line) and probucol supplemented (dotted line) line) (dotted supplemented probucol and line) (solid control the from dams pregnant the of s Am JPathol Am - 13 C acetate drinking water. (C) Estimated fractional precursor pool enrichments for dams dams for enrichments pool precursor fractional Estimated (C) water. drinking acetate C

Lrp2 - . 1993;142(5):1654 . derived lipoprotein cholesterol. lipoprotein derived s were observed between the two groups (p= 0.318), suggesting a steady state state steady a suggesting 0.318), (p= groups two the between observed were s +/ - - kd target of teratogenic antibodies and the 330 the and antibodies of teratogenic target kd

and black b black and - fetal cholesterol transport using stable isotope labeling and cholesterol cholesterol and labeling isotope stable using transport cholesterol fetal -

SD. iuin o nwy yteie coetrl n h dm lo after blood dam the in cholesterol synthesized newly of ributions Lrp2 -

labeled cholesterol in the maternal blood over 72 hours after after hours 72 over blood maternal the in cholesterol labeled ars -

16 the SD of the individual total fetus weights. (B) Regression plot Regression (B) weights. fetus total individual the of SD the Placenta

genotype 67. Lrp2 n the fetal tissues, white bars represent the results for the for results the represent bars white tissues, fetal the n

- / - - . (D) Contributions of maternally derived cholesterol as as cholesterol derived maternally of Contributions (D) .

SD. . 2011;32(2):183 . .

- Data for fetuses from the control group is shown, shown, is group control the from fetuses for Data Res J Lipid

SD, n=5 dams per group. group. per n=5 dams SD,

. 1996;37(6):1246 - - way repeated measurement ANOVA) ANOVA) measurement repeated way 191. 191. C holesterol levels in the fetal organs, organs, fetal the in levels holesterol -

SD, lines represent the averages of of averages the represent lines SD,

- kd target of nephritogenic nephritogenic of target kd

h cnrl n probucol and control the alysis (MIDA). In total, 24 24 total, In (MIDA). alysis

nts after provision of 2% of provision after nts - 1257. 1257.

plasma cholesterol cholesterol plasma culated fractional fractional culated

This article isprotected rights by All copyright. reserved. Accepted +/ represent mean All data treated group. probucol and control the from fetuses for myocardium total versus myocardium compact of Ratios (C) valves. atrioventricular the of septum ventricular intact an display groups Both (Pt). trunk pulmonary and (Ao) aorta the the of in septation normal observed is there (OFT), were region tract differences outflow No development. cardiac global of marker myocardial as staining (Mlc2a) Chain Light Myocardial (B) litter. same the within fetuses type wild of hearts the for enrichments fractional to standardized label, administered D7 the of enrichments Fractional (A) treatment. probucol without and with 7. Figure group). per (n=10 treated group probucol and control for expressions Gene (F) cholesterol. synthesized newly of derived contributions fractional maternally of contributions fractional calculated (D) enrichments, D7 fractional Article( E16.5 at group treated bars) 6. Figure +/ mean as are shown All data fetal organs. and E16.5 at blood dam the in asobserved enrichments sampl choles derived maternally and synthesized newly of contributions fractional the multiplying by (Calculated groups treated probucol and control the from for cholesterol derived maternally of contributions absolute the against cholesterol synthesized newly of contributions absolute the of regression linear and plot Scatter (B) group. supplemented repre bars White time. of unit per synthesized pool cholesterol the of fraction the as defined organs, fetal and E16.5 at blood dam the for calculated as rates trea probucol 5. Figure +/ mean represent Alldata group). cholesterol (E) group. probucol the from fetuses bars black group, control the from fetuses represent bars white es, n=16). (C) Relative gene expression levels for the fetal liver. (D) Estimated precursor pool pool precursor Estimated (D) liver. fetal the for levels expression gene Relative (C) n=16). es,

Analysis results for the placentas of the fet the of placentas the for results Analysis Cholesterol uptake within the fetal heart per genotype and and genotype per heart fetal the within uptake Cholesterol otiuin o nwy yteie coetrl ihn h fts hw fr oh h cnrl and control the both for shown fetus the within cholesterol synthesized newly of Contributions

leve ted groups, calculated by Mass Isotopomer Distribution Analysis (MIDA). (A) Fractional synthesis synthesis Fractional (A) (MIDA). Analysis Distribution Isotopomer Mass by calculated groups, ted ls for fetuses from the control (open bar) and probucol treated (filled bar) group (n=5 pools per per pools (n=5 group bar) (filled treated probucol and bar) (open control the from fetuses for ls Lrp2 - +/

SD - , n=8 per group). (A) Average placental weight, (B) cholesterol levels, (C) (C) levels, cholesterol (B) weight, placental Average (A) group). per n=8 , around the mitral valve (MV) and tricuspid valve (TV), without anomalies anomalies without (TV), valve tricuspid and (MV) valve mitral the around

terol with the cholesterol concentrations in the in concentrations cholesterol the with terol sent fetuses from the control group, black bars the probucol probucol the bars black group, control the from fetuses sent

uses from the control (white bars) and probucol (black probucol and bars) (white control the from uses -

SD.

c ardiac phenotype of the the of phenotype ardiac Lrp2 the individual fetal livers livers fetal individual the +/ -

individual fetal liver liver fetal individual cholesterol and (E) (E) and cholesterol placentas from the the from placentas Lrp2 -

SD. +/ Plasma Plasma

-

mice mice - 2a This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article

This article isprotected rights by All copyright. reserved. Accepted Article