USOO954.0691 B2

(12) United States Patent (10) Patent No.: US 9,540,691 B2 Fava et al. (45) Date of Patent: Jan. 10, 2017

(54) ASSAYS AND METHODS FOR SELECTING A 2011 O1891.61 A1 8, 2011 Blum et al. TREATMENT REGIMEN FOR A SUBJECT 2012/0277180 A1 11/2012 Marini et al. 2012/0329749 A1 12/2012 Smith et al. WITH DEPRESSION 2013/0267523 A1* 10/2013 Fava et al...... 514,249 2016,0058766 A1* 3, 2016 Fava ...... A61K 31,519 (71) Applicants: THE GENERAL HOSPITAL 514,249 CORPORATION, Boston, MA (US); NESTLE HEALTH FOREIGN PATENT DOCUMENTS SCIENCE-PAMLAB, INC., Covington, LA (US) WO 2012/128799 A2 9, 2012 WO 2010/1387.96 A2 12/2012 (72) Inventors: Maurizio Fava, Newton, MA (US); OTHER PUBLICATIONS George Papakostas, Brookline, MA Coppen A. et al. Journal of Affective Disorders 60 (2000) 121-130.* (US); Harold O. Koch, Jr., Mandeville, Jacques P.F. et al. Circulation. 1996: 93: 7-9.* LA (US); David Kronlage, Slidell, LA Tong S.-Y. et al. Cancer Causes Control (2010) 21:23-30.* (US) Combination Deplin R) and Therapy for a Major Depressive Episode (MDE)—a Retrospective Analysis (Dec. 3, (73) Assignee: NESTEC S.A., Vevey (CH) 2009), NCT01001559, from clinicaltrials.gov, pp. 1-3.* Levomefolic acid—from Wikipedia, the free encyclopedia—3 Notice: Subject to any disclaimer, the term of this printed pages from May 12, 2015, en.wikipedia.org. (*) DEPLIN 15 Capsules package insert, Mar. 2014, from Nestlé Health patent is extended or adjusted under 35 Science-Pamlab, Inc. Covington, LA 70433, 2 printed pages.* U.S.C. 154(b) by 246 days. Aberg et al., Journal of Affective Disorders, 129:158-166 (2011). “The functional VAL 158Met polymorphism in catechol-O- (21) Appl. No.: 13/789,075 methyltransferase (COMT) is associated with depression and moti vation in men from a Swedish population-based study.” (22) Filed: Mar. 7, 2013 Agurs-Collins et al., Appetite, 57:339-348 (2011). " polymorphisms and depressive symptoms predict foods intake. Prior Publication Data Results from a nationally representative sample.” (65) Baune et al., Neuropsychopharmacology, 33:924-932 (2008). US 2013/0172361 A1 Jul. 4, 2013 “Association of the COMT val158met Variant with Antidepressant Treatment Response in Major Depression.” Bhat et al., Progress in Neurobiology, 99:1-14 (2012). "CACNA1C Related U.S. Application Data (Cav1.2) in the pathophysiology of psychiatric disease.” (63) Continuation of application No. Bi et al., Neurobiology of Aging, 30:1601-1607 (2009). "Associa tion of RFC1 A80G and MTHFR C677T polymorphisms with PCT/US2012/065084, filed on Nov. 14, 2012. Alzheimer's disease.” (60) Provisional application No. 61/559,541, filed on Nov. Bigos et al., Arch Gen Psychiatry, 67(9):939-945 (2010). “Genetic Variation in CACNA1C Affects Brain Circuitries Related to Mental 14, 2011. Illness. Bjelland et al., Arch Gen Psychiatry, 60:618-626 (2003). “Folate, (51) Int. C. Vitamin B12, Homocysteine, and the MTHFR 677C-T Polymor CI2O I/68 (2006.01) phism in Anxiety and Depression.” CI2P 19/34 (2006.01) A6 IK3I/74 (2006.01) (Continued) (52) U.S. C. Primary Examiner — Stephen Kapushoc CPC ...... CI2O 1/6883 (2013.01); C12O 2600/106 (74) Attorney, Agent, or Firm — Kilpatrick Townsend & (2013.01); C12O 2600/156 (2013.01); C12O Stockton LLP 2600/158 (2013.01); G0IN 2800/52 (2013.01) (57) ABSTRACT (58) Field of Classification Search Disclosed herein are novel assays, systems and kits for CPC ...... C12Q 1/6883; C12O 2600/106; C12O selecting a treatment regimen for a Subject with depression 2600/156; C12O 1/68: G01N 2800/52 by identifying at least one nucleic acid polymorphism, e.g., See application file for complete search history. but not limited to, at the MTHFR, MTR, or MTRR locus, and/or determining expression levels of peripheral biomark (56) References Cited ers (e.g., SAM, SAH, and 4-HNE) in a test sample from a U.S. PATENT DOCUMENTS human Subject. These biomarkers can be used to determine the effectiveness of treating a depressed subject with a 6,218,120 B1 4/2001 Rozen et al. folate-containing compound (alone or as an adjunct to an 6,528,259 B1 3/2003 Rozen et al. 2003. O100476 A1 5/2003 Weinberger et al. antidepressant). Additionally, these biomarkers can be used 2003. O148323 A1 8, 2003 Rozen to select an appropriate treatment regimen for Subjects with 2005, OO69936 A1 3/2005 Diamond et al. treatment-resistant depression (e.g., resistant to at least one 2006/0234223 A1 10, 2006 Darvasi et al. 2007/0254288 A1 11/2007 Woolf et al. selective ). Methods and com 2009.0075827 A1 3/2009 Young et al. positions for treating a Subject with depression and/or deter 2009/0307180 A1 12/2009 Colby et al. mining or improving the effectiveness of an antidepressant 2010/O112589 A1 5, 2010 Xie drug taken by a subject are also provided herein. 2010/0304391 A1 12/2010 Lombard 2011 OO86763 A1 4/2011 Bodeau et al. 8 Claims, 24 Drawing Sheets US 9,540,691 B2 Page 2

(56) References Cited Lewis et al., Molecular Psychiatry, 11:352-360 (2006). “The thermolabile variant of MTHFR is associated with depression in the British Women's Heart and Health Study and a meta-analysis.” OTHER PUBLICATIONS Lewis et al., European Journal of Clinical Nutrition, 66:97-103 Bosco et al., J Neurol Neurosurg Psychiatry, 75: 1036-1038 (2004). (2012). "Folic acid Supplementation during pregnancy may protect “Assocation of IL-1 RN2 allele and methionine synthase 2756 AA against depression 21 months after pregnancy, an effect modified by genotype with dementia severity of sporadic Alzheimer's disease.” MTHFR C677T genotype.” Casamassima et al., Am J Med Genet Part B, 153B:1373-1390 Liu et al., Human Gene Therapy, 13:1777-1782 (2002). “The (2010). “L-Type Calcium Channels and Psychiatric Disorders: A Murine-Reduced Folate Carrier Gene Can Act as a Selectable Brief Review. Marker and a Suicide Gene in Hematopoietic Cells In Vivo.” Coppen et al., Journal of Psychopharmacology, 19(1):59-65 (2005). Lucock, Molecular Genetics and Metabolism, 71:121-138 (2000). “Treatment of depression: time to consider folic acid and vitamin “Folic Acid: Nutritional Biochemistry, Molecular Biology, and Role B12. in Disease Processes.” Dac et al., Biol Psychiatry, 68:801-810 (2010). “Mood Disorder McHugh et al., The Pharmacogenomics Journal, 11:207-213 (2011). Susceptibility Gene CACNA1C Modifies Mood-Related Behaviors “A polymorphism of the GTP-cyclohydrolase I feedback regulator in Mice and Interacts with Sex to Influence Behavior in Mice and gene alters transcriptional activity and may affect response to SSRI Diagnosis in Humans.” .” De Wit et al., Psychiatry Research, 178:230-235 (2010). “Depres McHugh, Pharmacogenomics, 12(12): 1625-1627 (2011). “The sion and obesity: a meta-analysis of community-based studies.” tetrahydrobiopterin pathway: a novel target for the treatment of Domschke et al., NeuroImage, 60:2222-2229 (2012). “Catechol-O- depression.” methyltransferase gene variation: Impact on amygdala response to Mischoulon et al., CNS Spectrums, 17:76-86 (2012). “Prevalence of aversive stimuli.” MTHFRC677T and MS A2756G polymorphisms in major depres Evinova et al., Gen. Physiol. BiophyS., 31:415-422 (2012). “Analy sive disorder, and their impact on response to treatment.” sis of genetic polymorphisms of brain-derived neurotrophic factor Murphy et al., Genes, Brain and Behavior, 12:125-132 (2013). and methylenetetrahydrofolate reductase in depressed patients in a "Genetic variation in DNMT3B and increased global DNA Slovak (Caucasian) population.” methylation is associated with Suicide attempts in psychiatric Elovainio et al., Psychosomatic Medicine, 69:391-395 (2007). patients.” "Genetic Variants in the DRD2 Gene Moderate the Relationship Between Stressful Life Events and Depressive Symptoms in Adults: Nelson et al., The Journal of Neuroscience, 28(2):395-406 (2008). Cardiovascular Risk in Young Finns Study.” “Activity-Dependent Suppression of Miniature Neurotransmission Fava et al., J. Clin Psychiatry, 70(suppl 5): 12-17 (2009). “Folate in through the Regulation of DNA Methylation.” Depression: Efficacy, Safety, Differences in Formulations, and Panet al., BMJ Case Reports, doi:10.1136/bcr.03.2011.3927 (2011). Clinical Issues.” "GTP-cyclohydrolase deficiency responsive to sapropterin and Feng et al., International Review of Neurobiology, 89:67-84 (2009). 5-HTP Supplementation: relief of treatment-refractory depression “The Role of DNA Methylation in the Central Nervous System and and Suicidal behaviour.” Neuropsychiatric Disorders.” Peerbooms et al., Brain Behavior, and Immunity, 25:1530-1543 Fernandez-De-Las-Penas et al., The Journal of Pain, 13(11):1068 (2011). "Meta-analysis of MTHFR gene variants in schizophrenia, 1074 (2012). “Catechol-O-Methyltransferase Val158Met Polymor bipolar disorder and unipolar depressive disorder: Evidence for a phism Influences Anxiety, Depression, and Disability, but not Pres common genetic vulnerability?” sure Pain Sensitivity, in Women with Fibromyalgia Syndrome.” Roberts et al., BMC Psychiatry, 7:65 doi.10.1186/1471-244X-7-65 Gilbody et al., Am J Epidemiol, 165: 1-13 (2007). (2007). "Folate Augmentation of Treatment-Evaluation for Depres "Methylenetetrahydrofolate Reductase (MTHFR) Genetic sion (FolATED): protocol of a randomised controlled trial.” Polymorphisms and Psychiatric Disorders: A HuGE Review.” Roetker et al., BMJ Open, 2:e(000944 (2012). “Multigene interac Green et al., Molecular Psychiatry, 15:1016-1022 (2010). “The tions and the prediction of depression in the Wisconsin Longitudinal bipolar disorder risk allele at CACNA1C also confers risk of Study.” recurrent major depression and of Schizophrenia.” Roffman et al., Schizophrenia Bulletin, 39(2):330-338 (2013). Guilarte et al., Schizophrenia Research, 99:324-332 (2008). "Genetic Variation Throughout the Folate Metabolic Pathway Influ “Dysregulation of glutamate carboxypeptidase II in psychiatric ences Negative Symptom Severity in Schizophrenia.” disease.” Schaevitz et al., Develop Neurobiol, 72:891-905 (2012). “Gluta Hahn et al., Arch Neurol, 58:749-755 (2001). “Neurologic and mate Carboxypeptidase II and Folate Deficiences Result in Recip Psychiatric Manifestations in a Family With a Mutation in Exon 2 rocal Protection Against Cognitive and Social Deficits in Mice: of the Guanosine Triphosphate-Cyclohydrolase Gene.” Implications for Neurodevelopmental Disorders.” Halsted et al., Am J Clin Nutr, 86:514-521 (2007). “Relations of Shelton et al., Progress in Neurobiology, 91:275-299 (2010). “Eat glutamate carboxypeptidase II (GCPII) polymorphisms to folate and ing ourselves to death (and despair): The contribution of adiposity homocysteine concentrations and to scores of cognition, anxiety, and inflammation to depression.” and depression in a homogenous Norwegian population: the Slopien et al., Maturitas, 61:252-255 (2008). “Polymorphic variants Hordaland Homocysteine Study.” of genes encoding MTHFR, MTR, and MTHFD1 and the risk of Hatzimanolis et al., Journal of Affective Disorders, http://dx.doi. depression in postmenopausal women in Poland.” org/10.1016/jjad.2012. 12.018 (2013). "Potential role of membrane Stanislawska-Sachadyn et al., Annals of Human Genetics, 73:484 bound COMT gene polymorphisms in female depression vulner 491 (2009). “The Reduced Folate Carrier (SLC19A1) c.80G>A ability.” Polymorphism is Associated with Red Cell Folate Concentrations Higuchi et al., Journal of Psychiatric Research, 45:1295-1300 Among Women.” (2011). "State-dependent changes in the expression of DNA Stapleton et al., Pharmacogenetics and Genomics, 21:447-453 methyltransferases in mood disorder patients.” (2011). “Association between DRD2/ANKK1 Taq1A genotypes, Kempisty et al., Psychiatric Genetics, 17:177-181 (2007). “MTHFD depression and Smoking cessation with nicotine replacement 1958G-> A and MTR 2756A-G polymorphisms are associated with therapy.” bipolar disorder and Schizophrenia.” Uher et al., Journal of Affective Disorders, 118: 147-154 (2009). Kishi et al., Journal of Affective Disorders, 142:315-322 (2012). "Body weight as a predictor of antidepressant efficacy in the “GTP cyclohydrolase 1 gene haplotypes as predictors of SSRI GENDEP project.” response in Japanese patients with major depressive disorder.” Villanueva et al., Clin Exp Res. 25(3):415-420 (2001). Kloiber et al., Biol Psychiatry, 62:321-326 (2007). “Overweight and "Reduced Folate Carrier: Tissue Distribution and Effects of Chronic Obesity Affect Treatment Response in Major Depression.” Ethanol Intake in the Micropig.” US 9,540,691 B2 Page 3

(56) References Cited haplotypes on treatment response phenotypes in major depressive disorder: a case-control association study.” OTHER PUBLICATIONS Casamassima et al., Am J Med Genet Part B, 153B:303-309 (2009). "Phenotypic Effects of a Bipolar Liability Gene Among Individuals Wang et al., Psychiatry Research, 200: 1047-1050 (2012). “The role With Major Depressive Disorder.” of single nucleotide polymorphism of D2 dopamine receptor gene Alpert et al., “Folinic Acid (Leucovorin) as an Adjunctive Treatment on major depressive disorder and response to antidepressant treat for SSRI-Refractory Depression.” Annals of Clinical Psychiatry, Mar. 2002, vol. 14(1), pp. 33-38. ment. Restriction Requirement dated Nov. 25, 2014 in U.S. Appl. No. Wray et al., Molecular Psychiatry, 17:36-48 (2012). "Genome-wide 13/796,362, filed Mar. 12, 2013. association study of major depressive disorder: new results, meta Jain et al., “Personalized therapy of adjunctive L-methylfolate to analysis, and lessons learned.” Selective serotonin reuptake inhibitor-resistant major depressive Ye et al., Psychosomatic Medicine, 73:385-392 (2011). “The Folate disorder.” Poster presentation at the College of Psychiatric and Hydrolase 1561C>T Polymorphism Is Associated With Depressive Neurologic Pharmacists Annual Meeting, Tampa, Florida, May 2, Symptoms in Puerto Rican Adults.” 2012. Zhang et al., Neuroscience Letters, 462:308-311 (2009). "DNA Bedson, E. et al., “Folate Augmentation of Treatment—Evaluation methyltransferase 3B gene increases risk of early onset schizophre for Depression (FolATED): randomized trial and economic evalu ation.” Health Technology Assessment, National Institute for Health nia. Research, published by the NIHR Journals Library, Jul. 2014, Zhao et al., Brain Research, 1204:118-122 (2008). “Association 18(48); vii-viii. 1-159. analysis of methionine synthase gene 2756 A>G polymorphism and Rivenes, A.C. et al., “The relationship between abdominal fat, Alzheimer disease in a Chinese population.” obesity, and common mental disorders: Results from the HUNT Zimmermann et al., Biochem J., 448:93-102 (2012). “Antidepres Study,” Journal of Psychosomatic Research 66 (2009) 269-275. sants inhibit DNA methyltransferase 1 through reducing G9a lev Ginsberg, et al.; L-methylfolate Plus SSRI or SNRI from Treatment els. Initiation Compared to SSRI or SNRI Monotherapy in a Major Zintzaras, Psychiatric Genetics, 16:105-115 (2006). “C677T and Depressive Episode; Innov Clin Neurosci.; 2011;8(1): 19-28. A1298C methylenetetrahydrofolate reductase gene polymorphisms Taylor, Matthew J. et al.; Folate for depressive disorders: systematic in Schizophrenia, biopolar disorder and depression: a meta-analysis review and meta-analysis of randomized controlled trials; Journal of of genetic association studies.” Psychopharmacology; 18(2) (2004) 251-256. Kocabas et al., International Clinical Psychopharmacology, 25.2 18 227 (2010). “The impact of catechol-O-methyltransferase SNPs and * cited by examiner

U.S. Patent US 9,540,691 B2

U.S. Patent Jan. 10, 2017 Sheet 5 of 24 US 9,540,691 B2

SNOOSN39NWHONSW U.S. Patent Jan. 10, 2017 Sheet 6 of 24 US 9,540,691 B2

°50IJI(O8

NOISSIWNSN: 0% U.S. Patent Jan. 10, 2017 Sheet 7 of 24 US 9,540,691 B2

^9IJIC18

NOISSINNSINBO %

U.S. Patent Jan. 10, 2017 Sheet 8 of 24 US 9,540,691 B2

£18°50IJI

NOINNINOOSIGINTO% U.S. Patent Jan. 10, 2017 Sheet 9 of 24 US 9,540,691 B2

So vm CN w us s o e 3-SCHNWHONW U.S. Patent Jan. 10, 2017 Sheet 10 of 24 US 9,540,691 B2

ce es So P. ce op of cre v S1909NYHONW U.S. Patent Jan. 10, 2017 Sheet 11 of 24 US 9,540,691 B2

HSH80-NUN

8 OWHN39NWHO U.S. Patent US 9,540,691 B2

°5)IJI819

300S 90 NNWHONSW U.S. Patent Jan. 10, 2017 Sheet 13 of 24 US 9,540,691 B2

TEST SAMPLE (E.G., BLOOD, PLASMA, SALIYA, BUCCAL URINE) OBTAINED FROM THE SUBJECT PLACETEST SAMPLE INTEST SAMPLE RECEPTACLE Al -600

TEST SAMPLE RECEPTACLE IN DETERMINATIONMODULE

DETERMINATION MODULE: 602 TO DETERMINE THE PRESENCE OR ABSENCE OFAT LEAST ONESNP (E.G., ATLEAST TWO SNPs SUCH AS, BUT NOT LIMITED TO, 300 BOO 1300 MTHFRC677T, MTR A2756G AND MTRRAGGG, OR ANY COMBINATIONS THEREOF) AND OPTIONALLY PERIPHERAL BIOMARKERS (SAM/SAHRATIO, 4-HNE)

COMPARISON 606 MODULE: 604

OUTPUT DATA

REPORT DATA->REREVED CONTENT 610

OMTHFRC67TT OMTHFRC677T (Y/N) ONTRA2756G OMTRA2756G (Y/N) 608 OMTRRA66G OMTRRA66G (Y/N) OSAM/SAH <2.8 OSAM/SAH <2.8 (Y/N) O4-HNE2 3.28ug/ml O4-HNE2 328ug/ml (Y/N)

FIG. 6 U.S. Patent Jan. 10, 2017 Sheet 14 of 24 US 9,540,691 B2

700

PLACE AT LEAST ONE TEST SAMPLE INTO A DETERMINATIONMODULE

DETERMINATIONSYSTEM DETERMINES THE PRESENCE OR ABSENCE OF AT LEAST ONE SNP (E.G., AT LEAST TWOSNPs SUCH AS, BUT NOT LIMITED TO, MTHFRC677T, MTRA2756G, MTRRA66G, AND ANY COMBINATIONS THEREOF) AND OPTIONALLY PERIPHERAL BIOMARKERS (SAM/SAHRATIO, 4-HNE)

OUTPUT DATA

COMPARISON MODULE COMPARESOUTPUT STORED STORE OUTPUT DATA DATA FROMDETERMINATION MODULE WITH FROM DETERMINATION REFERENCE DATA MODULE ON STORAGEMODULE

IS AT LEASTONE CONDITION PRESENT (E.G, BUT NOT LIMITED TO, MTHFRC677T, MTRA2756G; MTRRA66G, SAM/SAHRATIO < 2.8 AND 4-HNE>3.28ug/mL)?

DISPLAY MODULE INDICATES DISPLAY MODULE INDICATES THATSUBJECT DOES NOT THAT SUBJECT CAN BE NEED A FOLATE-CONTAINING RECOMMENDED FOR ATREATMENT COMPOUND ALONE FOR REGIMENCOMPRISINGAFOLATE TREATMENT, OR AS AN CONTAINING COMPOUND AND ADJUNCT TO ASSR OPTIONALLY ASSR

TRANSMIT DISPLAY DATA TOPATIENT/ PHYSICAN (OPTIONAL)

PROGRAM STOP FIG. 7 U.S. Patent Jan. 10, 2017 Sheet 15 of 24 US 9,540,691 B2

MEAN CHANGE INHAMD-28 2 C O C ed C '%,

s U.S. Patent Jan. 10, 2017 Sheet 16 of 24 US 9 9 540,691 B2

(99)} U.S. Patent Jan. 10, 2017 Sheet 17 of 24 US 9,540,691 B2

Analyses on full sample *denotes sample size in (phase , phase I) Phase - Phase II Pooled phases Effect p-value Effect p-value Effect 95% C p-value SFO (70,34)* -0.066 0.850 0.111 0.779 0.092 (-0.412, 0.720 0.596) VAs (6530) -0.257 0.736 0.589 0.432 -0.061 (-1,015, 0900 --- 0.893) CPFO (74,38) -2.565 0.045 -0.394 0.775 -1.510 Its o 0.110)

FIG. 9A U.S. Patent Jan. 10, 2017 Sheet 18 of 24 US 9,540,691 B2

FIG. 9B Analyses in biomarker Subgroups rur *denotes Sample size in phase , phase II) Phase Phase I Pooled phases Effect p-value Effect p-value Effect 95% Cl p-value SFQ - w SAM/SAH-med (34,16) -0567 0.387 0.571 0.464 0215 (0.701, 1130) 0646 SAM/SAHK med (35.18) 0.383 0.261 -0182 0,594 0.094 (-0.466,0.655) 0.741

1. hSCRP)=med (33,16) 0.024 0.954 || 0 1. -0.033 (-0.540, 0.474) 0.898 M hSCRPK med(36,18) -0.399 0.513 0.250 0.742 -0.032 (-0.915, 0.851) 0.944 HNE-his->med (34,16) 0.213 0710 -0.333 0.447 -0.051 (0.856,0755) 0.902 HNE-his < med (35.18) I-0300 0.474 0.610 0.365 0146 (-0.534,0827) |0.673 5-MTHF>=med (35,15) |-0421 0.395 || 0 1 -0184 (-0,686, 0.318) 0.472 5-MTHF g med(34,19) 0462 0.363 0.222 0.755 0.504 (0.339, 1,347) 0.241 Female (48.21) 0.349 0407 -0.083 0878 -0.053 (0.735,0629) 0879 Male (22,13) 0.529 0.392 0.262 0.640 0280 (-0.572, 1.132) 0519 BMk25 (147) |-0300 0630 -0.700 |0.672 0740 (0.949, 2.429) 0.390 25-kBMk30 (17.9) 0.095 0.924 0.050 0879 0.222 (0.671, 1114) 0627 BMX-30 (37.17) -0.140 0.767 0.097 0.841 -0068 (0.794, 0.658) 0.854

WAS w SAM/SAH)-med (32,16) 0417 0.739 -0.175 0.817 -0.112 (1444, 1221) 0869 SAM/SAH < med (33,14) -0.861 0.364 1.289 0.383 0.014 (-1.494, 1.522) w 0.985 ar hsCRP-med (33.15) 0455 0.638 0.333 0.717 0.292 (-0939, 1524) 0642 hsCRPK med (32,15) -1011 0.419 0804 0.531 -0.581 (2217,1055) 0487 HNE-his>=med (30,11) -1365 0.108 -0,893 0.241 -1045 (1943, -0.148) 0,022 HNE-his K med (35.19) 0.692 0.571 1.321 0.254 0.549 (-1021, 2.118) 0.493 s 5-MTHF)-med (32,13) 0147 0.386 O548 0565 0.697 (0.649, 2043) 0310 5-MTHF g med(33,17) -0.725 0.549 0.611 0.596 -0,850 (-2,400, 0,701) 0.283 - U.S. Patent Jan. 10, 2017 Sheet 19 of 24 US 9,540,691 B2

Female (4521) -0743 0422 0436 0.652 -0.203 (-1395, 0.989) 0.738 Male (209) 0.867 0.534 1,050 0.329 0.414 (-1444, 2.272) 0.662 - - - He -

--- - BMI < 25 (146) -4.200 0013 1.000 0.720 -1212 (3.924, 1500) || 0.381 BMX=3025-kBMI (32,15)<30 (17.8) 09521009 0.3180415 0.571-0.250 08090574 || 0.1240.366 (-0920,(1356, 1604)1651) |0.5770870 mim - CPFO -- -- -m-m-ma

wm- - -- wamu SAM/SAH-med (3620) 2,250 0314 1828 0.371 -0.150 (-2.812, 2.512) 0.912 SAM/SAHg med (37.18) I-2634 0.076 -2377 0.202 -2.661 (4.607, 0.715) 0.007 h ------+ hs.CRP)=med (36.18) I-1931 |0,169 -0.844 0669 -1594 (3.791,0.603) 0.155 hsCRP < med (37.20) -2,429 0.289 0.374 0.855 -0.807 (-3.457, 1844) 0.551 - HNE-his->-med (36.19) 3,556 0.064 muO886 0644 - -1548 mm-(3994,0898) --0215 HNEhis < med (37.19) 1533 O388 -0.869 0.677 -0904 (3,117,1308) 0423 5-MTHF>=med (37.17) -2.812 0.148 0.871 g -1,531 (388,080) 0.199 5-MTHF < med (36.21) 2125 0.220 T-1109 10581 -1271 (3834, 1291) 0.331 - | | | - Female (52.25) 2.822 0.078 1.110 0,537 -0.958 (-3.068, 1152) 0374

Male (22,13) mmu1859 0385 3.048 0170 I-2.574 (5.435, 0.288) 0.078 BMIK 25 (15,7) 4.818 0.107 1200 0.442 -1520 (-4055, 1.016) 0.240 25-kBM<30 (18,10) -0.267 0.905 2.200 |02.3 |1605 (-1,021, 4,232) 0.231 BMI)=30 (39.20) 3.645 0.036 -1600 0506 (-5.820, -0.265) | | | FIG. 9B (cont.) U.S. Patent Jan. 10, 2017 Sheet 20 of 24 US 9,540,691 B2

Analyses in genetic Subgroups *denotes sample size in (phase , phase II); | Phase Phase I - Pooled phases Effect p-value Effect p-value Effect 95%CI p l value

SFQ wa - MTHFR677 CC (37.15)" || 0.444 0.383 0.661 0411 0.293 (-0.603, 1.190) 0521 MTHFR677 CT (189) 0,250 0673 -0.550 0456 (-0.503 (1401,0395) 0272 MTHFR677 TT (63) 0.250 0541 - - - MTHFR677 CT/IT (24.12) 03140502 -0.333 0541 -0.326 (1018,0365 0355 MTR2756AA (42.18) I-0183 0588 0.475 0529 (0.099 |(-0701,0900) 0.808 MTR 2756 AG (177) 0429 O297 -0.333 0286 0.039 (-0363,0441) 0848 MTR 2756 GG(2,2) se re mw MTR 2756AG/GG (199) |0,179 0.719 -0.250 0292 -0.125 (0.773,0523) 0705 MTRR 66AA (168) 0000 1000 0733 0582 0509 Tes 1781) 0.433 MTRR 66AG (30,13) 0.105 0.860 0.350 0.579 -0.086 (-0865, 0.694) 0.829 MTRR 66GG (156) O500 0526 0500 0.178 0087 (1027, 1200) 0879 MTRR 66AGGG (4519) -0.014 0.976 0.233 as a |(-0652,0562) 0.884 WAS o MTHER677 cc (3615) 0607 10.636 (0696 |0.573 0510 Igen 0.541 MTHFR677 CT(178) 0028 0.978 0.250 0823 0.036 (1123, 1194) 0.952 MTHFR677 TT (53) 1167 0630 0500 0.667 - ar MTHFR677 CITT (22.11)0283 0.749 0300 0703 0311 (0.723, 1346) 0555 MTR 2756AA (39.18) 0166 0.875 0.778 0496 -0.357 (1845, 1130) 0638 MTR 2756 AG (177) 10286 0804 0250 0677 0131 (0.554,0826) 0712 MTR 2756GG(2,1) - e W | MTR 2756 AG/GG (198) -0.786 0.529 0,250 0.620 -0.046 (-0.861, 0.769) 0.912 MTRR 66AA (169) 0346 es 0.833 0.375 -0.189 (-1363,0984) 0752 MTRR 66AG (28.10) 0.200 0.871 1375 0318 0.236 (1741, 2,214) 0815 MTRR 66GG (147) 2.394 0.287 (4900 0021 0.224 (2523,2971) 0873 MTRR 66AGGG (42.17) -0.358 0.736 1514 0.184 0.084 (-1489, 1321) 0.907

w mrmga | U.S. Patent Jan. 10, 2017 Sheet 21 of 24 US 9,540,691 B2

CPFO MTHFR677 CC (4119) -0.460 0824 -0.811 |-0747 0955 (3.802, 1891) T0511 MTHFR677 CT(189) -5,775 0.001 | 1600 0.424 -2.220 (-4.159, -0.280) 0.025 MTHFR677 TT (63) -2500 0.662 -4500 0.593 - -- MTHFR677 CITT (24,125,214 0004 0000 1000 |-2.212 (402-035) 0.020 | MTR 2756AA (45,21) I-126 0.462 -0.436 -0.849 -0.626 (3,103, 1850) . 0620 MTR 2756AG (188) 4442 |0078 0000 1000 -2.846 (5.9600268) 0073 MTR 2756GG(2,2) -- | - | MTR 2756AGGG (2010) 5,022 |0.036 -0.600 0.782 -3.005 (-6.107,0.097) (0.058 MTRR 66AA (17.9) 3000 0103 ||3833 0.025 0.685 (-1715,3086) 0576 MTRR 66AG (33,15) -1697 0.424 -4900 0.135 -3981 (-7370, -0.591) 0021 MTRR 66GG (15,7) 5.333 0145 1,700 0530 -1995 (6.715, 2725) 0407 MTRR 66AG/GG (48.22) -2,497 0.160 -2.267 0.309 -2.846 (5.345, -0.347) 0.026

FIG. 9C (cont.) U.S. Patent Jan. 10, 2017 Sheet 22 of 24 US 9,540,691 B2

Maier SPCD m Phase Phase II Pooledphases Effect -- p-value Effect p-value Effect 95% C p-value MAIER HAMD7 -1802 0.041 -1.786 to 130 -1616 (-2.936, -0.296) 0.016

-- -- HAMD7>= median 2,198 0.058 -3,000 0.037 -2.691 (-4,203, -1180) - <0.001

HAMD7 & median -1405 O303 -1.186 0.929 --0.083 (-2,481, 2,315) 0.946

mummm. ------

Maier means TPhase Phase Pooled

------|Med-12.5 |N Mean Std N Mean Std I Mean Std

--- MAER

- -- - - muu Treatment All 18 -4.4 3.4 18 -2.2 4.0 -3.3 3.7

wnim. MM - maier)=med 9 -4.6 3.6 11 -2.7 3.2 -36 3.4

vuu- l mater

-- FIG. 10B U.S. Patent Jan. 10, 2017 Sheet 23 of 24 US 9,540,691 B2

HAMD 7 SPCD | Phasel Phase I Pooled phases Effect p-value Effect p-value Effect 95% Cl p-value

HAMD-7 rwa amm w - HAMD7 -1998 0.032 -1,325 0.245 -1.494 (-2.737, -0.251) 0.018

w - HAMD7x median -3.860 0.003 -3.022 0.065 -3.437 (-5,043, -1830) |<0.001

HAMD7 -g median 0.194 0.887 0.333 0.838 0.322 (-1.596,2240) 0.742

HAMD7 means Phase Phase Pooled

Med=12 N Mean Std N Mean Std Mean Std

m m w HAMD7 t Treatment All |18 |49 |37 |18 |49 |37 ||34 ||37 | HAMD7>med 10 -6.5 3.6 9 -3.2 3.8 -49 3.7

- w ww - m |- w HAMD7=

www. |- -- Placebo AI 56 -2.9 |33 |21 |-06 |33 |18 |3.3 HAMD7 med 25 26 30 10 on 29 T-14 29 |

manama mrmwww-w m w swe - HAMD7=

- FIG. IOD U.S. Patent Jan. 10, 2017 Sheet 24 of 24 US 9,540,691 B2

TRD2 Biomarker and geneticanalyses On Maier Scale Phase | Phase I Pooled phases Effect p-value Effect p-value Effect 95% Cl - p-value Maier - --- SAM/SAH>=med (36.21)* -0.695 0.572 - 0.009 0.995 -0380 (-2.239,1479) 0.689

SAM/SAHg med (37.18) -2.311 1 0.072 -4.130 0.027 -2.398 (4.312, -0.485) -- 0.014 -- HNE-his>=med (37.20) -2.198 |0,126 2,727 0.127 2.471 (4.483, -0.459) O.O16

HNE-his g med(36.19) w -1.296 0.225 -0.619 0.714 -0.796 www(-2.579, 0.988) 0.382

: -- w aw

hSCRP>=med (37.19) -1.823 0.169 mr.-2.131 0.270 -1.668 (-3.843,0507) 0.133 hSCRP < med(36.20) -1533 0.214 -1.707 0.281 -1918 (-3,637, -0.199) 0.029

wo w w BMI <25 (147) -0.849 0.663 -2.000 0.475 -1.812 (-6.195, 2.570) 0.418 25-kBM-30 (1810) 1600 0.417 0.200 0.927 1597 (0904,4098) 0211 BMX-30 (4021) 3477 0001 I-1773 0304 -2.637 (4410,0864) 0004 BMI <30 (32,17) 0.308 0.823 -0.857 |0.586 O.320 (-1729, 2.370) 0.760

m aw MTHFR 677 CC (41,20) -0,807 0,518 -1,300 0.447 -0.948 (-2.611, 0.715) 0.264 MTHFR677 CT(189) -2,750 0.074 -0.550 0.843 -1621 (4.650, 1409) 0.294 MTHFR677 TT(6,3) 0.750 0755 T-3000de 0667 m | MTHFR677 CTITT(24,12) -2.457 0.061 -1500 0.509 -2004 (-4,315,0308) 0.089 MTR 2756AA (4521) -0.250 0.795 |-0.746 |0.678 -0.632 (2484, 1221) 0.504 MTR 2756AG (189) 4.333 0021 -2.750 loss 3,582 (-6.257, -0.904) 0.009 MTR 2756GG(2,2) - I - | - MTR 2756GG (2011) -4,619 0.009 -2.767 0.155 -3.686 (-5.881, -1.491) 0.001

FIG. IOE US 9,540,691 B2 1. 2 ASSAYS AND METHODS FOR SELECTING A develop effective antidepressant therapies and/or to stratify TREATMENT REGIMEN FOR A SUBJECT patients with depression Such that they can receive appro WITH DEPRESSION priate antidepressant therapies. Aspects of various embodi ments described herein stem from the discovery of single CROSS REFERENCE TO RELATED nucleotide polymorphisms (SNPs), peripheral biomarkers APPLICATIONS and/or clinical features that are associated with an efficacy response to the use of a folate-containing compound for This application is a continuation application under 35 treatment of depression, e.g., major depressive disorders, as U.S.C. S 120 of a co-pending International Patent Applica a monotherapy or as an adjunct to an antidepressant drug. In tion Serial No. PCT/US 12765084 filed Nov. 14, 2012, which 10 Some embodiments, the inventors have also shown that these claims the benefit under 35 U.S.C. S 119(e) of U.S. provi markers or conditions described herein can also be used to sional Patent Application No. 61/559,541 filed Nov. 14, select a more effective treatment for subjects with treatment 2011, the contents of which are incorporated herein by resistant depression (TRD), e.g., resistant to at least one reference in their entireties. selective serotonin reuptake inhibitor (SSRI). 15 Particularly, one or a combination of biomarkers that can SEQUENCE LISTING be indicative of a patient (e.g., with major depressive disorders and/or TRD) suitable for a treatment regimen The instant application contains a Sequence Listing which comprising a folate-containing compound include, but are has been submitted in ASCII format via EFS-Web and is not limited to, at least one or more SNPs identified by rs hereby incorporated by reference in its entirety. Said ASCII numbers as follows: rs1801 133 present in methylenetetra copy, created on Mar. 6, 2013, is named 34.1471 PC.txt and hydrofolate reductase (MTHFR): rs2274.976 present in is 38,877 bytes in size. MTHFR: rs1805087 present in methionine synthase (MTR): rs 1801394 present in methionine synthase reductase TECHNICAL FIELD OF THE DISCLOSURE (MTRR): rs1006737 present in calcium channel, voltage 25 dependent, L-type, alpha 1 C subunit (CACNA1C); Embodiments of the inventions generally relate to assays, rs 1883729 present in DNA (cytosine-5)-methyltransferase 3 methods and systems for selecting a treatment regimen for beta (DNMT3B): rs7163862 present in GTP cyclohydrolase a subject with depression, e.g., major depressive disorder. 1 feedback regulatory protein (GCHFR): rs12659 present in The inventions further relate to methods for treating a reduced folate carrier protein (RCF2): rs202676 present in Subject with depression, e.g., major depressive disorder. 30 folate hydrolase (prostate-specific membrane antigen) (FOLH1); rs2297291 present in reduced folate carrier pro BACKGROUND tein (RCF1): rs1051266 present in reduced folate carrier protein 1 (RCF1): rs8007267 present in GTP cyclohydrolase Recent estimates indicate that more than 19 million 1 (GCH1); rs7639752 present in choline-phosphate cytidy Americans over the age of 18 years experience a depressive 35 lytransferase A (PCYT1A): rs6275 present in dopamine illness each year. It has been generally believed that there is receptor D2 (DRD2): rs1079596 present in DRD2: Some form of association between folate-deficiency states rs 11240594 present in DRD2: rs4633 present in catechol and depression 1, 2 and 3, which in turn helps to explain O-methyltransferase (COMT): rs4680 present in COMT: prior observations on the myriad neuropsychiatric presen rs250682 present in dopamine active transporter (DAT, or tations of megaloblastic anemia 4. Recently, the relevance 40 SLC6A3); rs2277.820 present in formiminotransferase of folate in other medical conditions, in particular neural cyclodeaminase (FTCD): rs2236225 present in methyl tube defects 5 and cardiovascular disease, 6 and potential enetetrahydrofolate dehydrogenase (NADP+ dependent) 1 antidepressant efficacy of agents marketed as dietary Supple (MTHFD1); and any combinations thereof; and/or expres ments or “nutraceuticals, 7 and 8 such as S-adenosyl sion of at least one of S-adenosyl methionine (SAM), S-ad methionine (SAMe), hypericum perforatum (St. John's 45 enosyl homocysteine (SAH), 4-hydroxynonenal (4-HNE), wort), and omega-3-fatty acids, has been increasingly rec high sensitivity c-reactive protein (hsCRP), and any com ognized. The field has gradually moved toward researching binations thereof. Additionally or alternatively, determina the impact of folate deficiency, replacement, and Supple tion of whether a human Subject is obese or not (e.g., by mentation on the course and management of depressive measurement of a BMI value) can also be used as a disorders, in particular major depressive disorder, 9 and 50 biomarker to select an appropriate treatment regimen (e.g., putative roles of folate in central-nervous-system function. comprising a folate-containing compound or not) for a 10, 11 and 12. While significant advances in the treatment patient with depression or a risk for depression. Any indi of depression have been made in the past decade, as many vidual or combinations of such biomarkers disclosed herein as 29% to 46% of patients with depression taking an can be used to identify patients, who are diagnosed as having anti-depressant are still partially or totally resistant to the 55 depression or having a risk for depression, for receiving a treatment. Those who suffer from treatment-resistant depres treatment regimen comprising a folate-containing com sion have almost no alternatives. As not every treatment pound. In some embodiments, a folate-containing com regimen is effective for each individual, there is a strong pound can be used in the absence of an anti-depressant drug need to identify markers that can facilitate selection of an for treatment of depression (e.g., major depressive disor appropriate treatment regimen for a Subject with depression. 60 ders) in Subjects selected for carrying at least one or more biomarkers described herein. In alternative embodiments, a SUMMARY folate-containing compound can be used alone or in com bination (e.g., as an adjunct) with an anti-depressant drug for A significant portion of patients with depression, such as treatment of depression (e.g., major depressive disorders) in major depressive disorders, show only partial or no response 65 Subjects selected for carrying at least one or more biomark to conventional antidepressant drugs, e.g., selective sero ers described herein. In one embodiment, the anti-depressant tonin reuptake inhibitors. Thus, there is a strong need to drug can include a selective serotonin reuptake inhibitor US 9,540,691 B2 3 4 (SSRI). Examples of the SSRI include, but are not limited to, NO. 15 is a portion of a genomic nucleic acid sequence fluoxetine, , , , , of folate hydrolase (prostate-specific membrane anti and any combinations thereof. gen) 1 (FOLH1); Accordingly, provided herein generally relate to assays, (x) genotype of a SNP locus at position 27 of SEQID NO. methods, systems, and kits for selecting a treatment regimen 5 16 (identified by rs2297291), wherein the SEQID NO. for a subject with depression or a risk for depression, 16 is a portion of a genomic nucleic acid sequence of treating a subject with depression or a risk for depression, reduced folate carrier protein (RCF1): and/or improving the effectiveness of a treatment regimen (xi) genotype of a SNP locus at position 27 of SEQ ID recommended for or administered to a subject with depres NO. 17 (identified by rs1051266), wherein the SEQ ID sion or a risk for depression. Provided herein also relate to 10 NO. 17 is a portion of a genomic nucleic acid sequence folate-comprising compositions for use in treatment of of reduced folate carrier protein (RCF1): depression in a subject (e.g., a human Subject) selected to (xii) genotype of a SNP locus at position 27 of SEQ ID carry at least one (e.g., at least two or more) or any NO. 18 (identified by rs8007267), wherein the SEQ ID combinations of the biomarkers or conditions described 15 NO. 18 is a portion of a genomic nucleic acid sequence herein. of GTP cyclohydrolase 1 (GCH1); In one aspect, provided herein is an assay for selecting a (xiii) genotype of a SNP locus at position 27 of SEQ ID treatment regimen for a human Subject having depression or NO. 19 (identified by rs7639752), wherein the SEQ ID having a risk for depression. The assay comprises: NO. 19 is a portion of a genomic nucleic acid sequence (a) Subjecting a test sample of a human Subject, who is of choline-phosphate cytidylyltransferase A diagnosed as having depression or having a risk for depres (PCYT1A); Sion, to at least one analysis to determine parameters of at (xiv) genotype of a SNP locus at position 27 of SEQ ID least two biomarkers from the following: NO. 20 (identified by rs6275), wherein the SEQID NO. (i) genotype of a SNP locus at position 677 of SEQ ID 20 is a portion of a genomic nucleic acid sequence of NO. 1 or position 27 of SEQ ID NO. 7 (identified by 25 dopamine receptor D2 (DRD2); rs 1801133), wherein the SEQ ID NO. 1 and SEQ ID (XV) genotype of a SNP locus at position 27 of SEQ ID NO. 7 are each independently a portion of a genomic NO. 21 (identified by rs1079596), wherein the SEQ ID nucleic acid sequence of methylenetetrahydrofolate NO. 21 is a portion of a genomic nucleic acid sequence reductase (MTHFR): of dopamine receptor D2 (DRD2); (ii) genotype of a SNP locus at position 1793 of SEQ ID 30 (xvi) genotype of a SNP locus at position 27 of SEQ ID NO. 1 or position 27 of SEQ ID NO. 8 (identified by NO. 22 (identified by rs11240594), wherein the SEQ rs2274.976), wherein the SEQ ID NO. 1 and SEQ ID ID NO. 22 is a portion of a genomic nucleic acid NO. 8 are each independently a portion of a genomic sequence of dopamine receptor D2 (DRD2); nucleic acid sequence of MTHFR: 35 (xvii) genotype of a SNP locus at position 27 of SEQID (iii) genotype of a SNP locus at position 2756 of SEQID NO. 23 (identified by rS4633), wherein the SEQID NO. NO. 2 or position 27 of SEQ ID NO. 9 (identified by 23 is a portion of a genomic nucleic acid sequence of rs 1805087), wherein the SEQ ID NO. 2 and SEQ ID catechol-O-methyltransferase (COMT): NO. 9 are each independently a portion of a genomic (xviii) genotype of a SNP locus at position 27 of SEQID nucleic acid sequence of methionine synthase (MTR); 40 NO. 24 (identified by rS4680), wherein the SEQID NO. (iv) genotype of a SNP locus at position 66 of SEQ ID 24 is a portion of a genomic nucleic acid sequence of NO. 3 or position 27 of SEQ ID NO. 10 (identified by catechol-O-methyltransferase (COMT): rs 1801394), wherein the SEQ ID NO. 3 and SEQ ID (xix) genotype of a SNP locus at position 27 of SEQ ID NO. 10 are each independently a portion of a genomic NO. 25 (identified by rs250682), wherein the SEQ ID nucleic acid sequence of methionine synthase reductase 45 NO. 25 is a portion of a genomic nucleic acid sequence (MTRR): of solute carrier family 6 (neurotransmitted transported, (v) genotype of a SNP locus at position 27 of SEQID NO. dopamine), member 3 (SLC6A3); 11 (identified by rs1006737), wherein the SEQID NO. (XX) genotype of a SNP locus at position 27 of SEQ ID 11 is a portion of a genomic nucleic acid sequence of NO. 26 (identified by rs2277820), wherein the SEQ ID calcium channel, Voltage-dependent, L type, alpha 1C 50 NO. 26 is a portion of a genomic nucleic acid sequence subunit (CACNA1C); of formiminotransferase cyclodeaminase (FTCD); (vi) genotype of a SNP locus at position 27 of SEQ ID (xxi) genotype of a SNP locus at position 27 of SEQ ID NO. 12 (identified by rs1883729), wherein the SEQ ID NO. 27 (identified by rs2236225), wherein the SEQ ID NO. 12 is a portion of a genomic nucleic acid sequence NO. 27 is a portion of a genomic nucleic acid sequence of DNA (cytosine-5)-methyltransferase 3 beta 55 of methylenetetrahydrofolate dehydrogenase (NADP+ (DNMT3B); dependent) 1 (MTHFD1)); (vii) genotype of a SNP locus at position 27 of SEQ ID (xxii) level of expression of SAM and SAH; NO. 13 (identified by rs7163862), wherein the SEQ ID (xxiii) level of expression of 4-HNE; NO. 13 is a portion of a genomic nucleic acid sequence (xxiv) level of expression of hsCRP; and any combina of GTP cyclohydrolase 1 feedback regulatory protein 60 tions thereof, and (GCHFR): (b) detecting, optionally with a non-human machine, from (viii) genotype of a SNP locus at position 27 of SEQ ID the determined parameters of at least two biomarkers, the NO. 14 (identified by rs12659), wherein the SEQ ID presence of at least one condition selected from the follow NO. 14 is a portion of a genomic nucleic acid sequence 1ng: of reduced folate carrier protein (RCF2); 65 (A) a SNP at position 677 of SEQ ID NO. 1 or position (ix) genotype of a SNP locus at position 27 of SEQ ID 27 of SEQ ID NO. 7 (identified by rs1801133) com NO. 15 (identified by rs202676), wherein the SEQ ID prising at least one thymine “T” allele; US 9,540,691 B2 5 6 (B) a SNP at position 1793 of SEQ ID NO. 1 or position Any combinations of at least two biomarkers (i) to (xxiv) 27 of SEQ ID NO. 8 (identified by rs2274.976) com described herein can be determined in a test sample for the prising at least one adenine “A” allele; assays described herein. Exemplary combinations of at least (C) a SNP at position 2756 of SEQ ID NO. 2 or position two biomarkers described herein can comprise genotypes of 27 of SEQ ID NO. 9 (identified by rs1805087) com at least two SNP loci; or genotype of at least one SNP loci prising at least one guanine "G” allele; and expression level of at least one indicated biomarker (D) a SNP at position 66 of SEQID NO. 3 or position 27 (e.g., 4-HNE); or expression level of at least two indicated of SEQID NO. 10 (identified by rs1801394) compris biomarkers (e.g., SAM, SAH). Depending upon selected ing at least one guanine "G” allele; combinations of at least two biomarkers described herein, (E) a SNP at position 27 of SEQID NO. 11 (identified by 10 the test sample can be subjected to one or more analyses, rs 1006737) comprising at least one adenine “A” allele; e.g., including, but not limited to, genotyping assays, expres (F) a SNP at position 27 of SEQID NO. 12 (identified by sion assays (e.g., protein and/or transcript levels), or any rs 1883729) comprising at least one adenine “A” allele; combinations thereof. (G) a SNP at position 27 of SEQID NO. 13 (identified by 15 Accordingly, in Some embodiments, the assay can com rs7163862) comprising at least one thymine “T” allele; prise Subjecting a test sample from a human Subject, who is (H) a SNP at position 27 of SEQID NO. 14 (identified by diagnosed as having depression or having a risk for depres rs 12659) comprising at least one thymine “T” allele; sion to at least one genotyping assay adapted to determine (I) a SNP at position 27 of SEQID NO. 15 (identified by genotypes of at least two loci, wherein said at least two loci rs202676) comprising at least one guanine “G” allele; are: (i) position 677 of SEQID NO. 1 or position 27 of SEQ (J) a SNP at position 27 of SEQID NO. 16 (identified by ID NO. 7 (identified by rs18.01133) and (ii) position 2756 of rs2297291) comprising at least one adenine “A” allele; SEQ ID NO. 2 or position 27 of SEQ ID NO. 9 (identified (K) a SNP at position 27 of SEQID NO. 17 (identified by by rs1805087). In such embodiment, detection of at least at rs1051266) comprising at least one adenine “A” one SNP at either position 677 of SEQID NO. 1 (or position allele; 25 27 of SEQ ID NO. 7) comprising at least one thymine “T” (L) a SNP at position 27 of SEQID NO. 18 (identified by allele or position 2756 of SEQ ID NO. 2 (or position 27 of rs8007267) comprising at least one thymine “T” allele; SEQID NO. 9) comprising at least one guanine “G” allele, (M) a SNP at position 27 of SEQID NO. 19 (identified by or detection of both aforementioned SNPs indicates selec rs7639752) comprising at least one adenine “A” allele; tion and optional administration of a treatment regimen (N) a SNP at position 27 of SEQID NO. 20 (identified by 30 comprising an effective amount of a folate-containing com rs6275) comprising at least one thymine “T” allele; (O) a SNP at position 27 of SEQID NO. 21 (identified by pound to the human subject. rs 1079596) comprising at least one thymine “T” allele; In some embodiments, the genotyping assay can comprise (P) a SNP at position 27 of SEQID NO. 22 (identified by the step of amplifying the test sample with a set of primers rs 11240594) comprising at least one adenine “A” 35 flanking any one of the SNPs described herein. In some allele; embodiments, at least two (e.g., at least three, at least four, (Q) a SNP at position 27 of SEQID NO. 23 (identified by at least five or more) sets of primers amplifying at least two rs4633) comprising at least one cytosine “C” allele; (e.g., at least three, at least four, at least five or more) of the (R) a SNP at position 27 of SEQID NO. 24 (identified by SNPs can be used in a multiplex amplification assay. rs4680) comprising at least one guanine “G” allele; 40 In some embodiments, the test sample can be subjected to (S) a SNP at position 27 of SEQID NO. 25 (identified by determine parameters of at least three, at least four, at least rs250682) comprising at least one cytosine “C” allele; five or more biomarkers (i) to (xxiv) described herein. For (T) a SNP at position 27 of SEQID NO. 26 (identified by example, in some embodiments, the assay can comprise: (a) rS2277820) comprising at least one thymine “T” allele; Subjecting a test sample of a subject to one or more than one (U) a SNP at position 1958 of SEQID NO. 27 (identified 45 analyses (e.g., genotyping and/or expression analyses) to by rs2236225) comprising at least one adenine “A” determine the presence or absence of at least one of the allele; following conditions: (V) an expression level ratio of SAM to SAH smaller than i. an expression ratio of S-adenosyl methionine (SAM) to a pre-determined reference ratio: S-adenosyl homocysteine (SAH) Smaller than a pre (W) an expression level of 4-HNE greater than a pre 50 determined reference ratio: determined reference value; ii. expression of 4-hydroxynonenal (4-HNE) greater than (X) an expression of hsCRP greater than about 2.3 mg per a pre-determined reference value: liter as measured in a plasma sample; and any combi iii. a single nucleotide polymorphism (SNP) at position nations thereof. 677 of SEQID NO: 1 comprising at least one thymine Based on the analysis results from step (b), if at least one 55 “T” allele, wherein the SEQ ID NO: 1 is a portion of of the conditions described above is detected, the assay can a genomic nucleic acid sequence of methylenetetrahy further comprise selecting for the human Subject and option drofolate reductase (MTHFR): ally administering to the human Subject a treatment regimen iv. a SNP at position 2756 of SEQ ID NO: 2 comprising comprising an effective amount of a folate-containing com at least one guanine “G” allele, wherein the SEQ ID pound. 60 NO: 2 is a portion of a genomic nucleic acid sequence In some embodiments of this aspect and all other aspects of methionine synthase (MTR); and described herein, any of the SNPs described herein can v. a SNP at position 66 of SEQ ID NO: 3 comprising at comprise one or two folate-responsive alleles. By way of least one guanine “G” allele, wherein the SEQID NO: example only, a SNP at position 677 of SEQ ID NO. 1 or 3 is a portion of a genomic nucleic acid sequence of position 27 of SEQ ID NO. 7 (identified by rs1801133) can 65 methionine synthase reductase (MTRR); and comprise one thymine “T” allele, or two thymine “T” if at least one of these conditions is determined to be present, alleles. the assay can further comprise selecting for the human US 9,540,691 B2 7 8 Subject and optionally administering to the human Subject a recommend or administer to the human Subject a treatment treatment regimen comprising an effective amount of a regimen comprising a folate-containing compound. folate-containing compound. In some embodiments, the assay can further comprise In some embodiments of this aspect and all other aspects determining the presence or absence of a SNP at position described herein, when the expression ratio of SAM to SAH 1298 of the SEQID NO. 1 comprising at least one cytosine is Smaller than the pre-determined reference ratio, e.g., “Callele, wherein the presence of the SNP at position 1298 smaller than 3.0, or smaller than about 2.8 as measured in a of the SEQID NO: 1 comprising at least one cytosine “C” plasma sample, the Subject can be recommended for and/or is indicative of the subject recommended for and optionally optionally administered with a treatment regimen compris administered with a treatment regimen comprising a folate 10 containing compound. ing a folate-containing compound. In one embodiment, the In some embodiments, the assay can further comprise expression ratio of SAM to SAH being smaller than 2.71, as determining expression of high-sensitivity c-reactive protein measured in a plasma sample, is indicative of a subject (hsCRP), wherein the hsCRP expression greater than about recommended for and/or optionally administered with a 2.3 mg per liter of plasma, as measured in a plasma sample, treatment regimen comprising a folate-containing com 15 is indicative of the subject recommended for and optionally pound. In some embodiments, if the expression ratio of administered with a treatment regimen comprising a folate SAM to SAH is at least or greater than 2.71 as measured in containing compound. In some embodiments, if the expres a plasma sample, the Subject is not recommended for nor sion of hsCRP is lower than 2.3 mg per liter of plasma, as administered with a treatment regimen comprising a folate measured in a plasma sample, then the Subject is not containing compound. Depending on the test sample source, recommended for nor administered with a treatment regimen e.g., a blood sample vs. a buccal sample, the pre-determined comprising a folate-containing compound. Depending on reference ratio for a blood plasma sample can be different the test sample source, e.g., a blood sample vs. a buccal from that for, e.g., a buccal sample. sample, the hsCRP expression a plasma sample can be In some embodiments of this aspect and all other aspects different from that in, e.g., a buccal sample. described herein, when the expression of 4-HNE is greater 25 While detection of the presence of at least one condition than the pre-determined reference value, e.g., greater than (A)-(X) described herein in a test sample of a human subject about 3 mg per liter, or greater than about 3.2 mg per liter with depression is generally sufficient to indicate the human of plasma or higher as measured in a plasma sample, the Subject be amenable to a treatment regimen comprising an Subject can be recommended for and/or optionally admin effective amount of a folate-containing compound, in some istered with a treatment regimen comprising a folate-con 30 embodiments, it can be desirable to detect the presence of at taining compound. In one embodiment, if the expression of least two conditions, three conditions, four conditions or 4-HNE is at least 3.28 mg per liter of plasma as measured more corresponding to the selected biomarkers in order to in a plasma sample or higher, a Subject can be recommended select for or administer to the human Subject a treatment for and/or optionally administered with a treatment regimen regimen comprising an effective amount of a folate-contain comprising a folate-containing compound. In some embodi 35 ing compound. In some embodiments, if none of these ments, if the expression of 4-HNE is less than 3.28 mg per conditions (A)-(X) described herein occurs in the human liter of plasma as measured in a plasma sample or lower, the Subject, the Subject is not recommended for a treatment Subject is not recommended for nor administered with a regimen comprising a folate-containing compound. treatment regimen comprising a folate-containing com Accordingly, in some embodiments of this aspect and all pound. Depending on the test sample source, e.g., a blood 40 other aspects described herein, the test sample can be sample vs. a buccal sample, the pre-determined reference analyzed to determine at least one or at least two, at least value for a plasma sample can be different from that for, e.g., three, at least four, at least five or six of the conditions a buccal sample. (A)-(X) provided herein. For example, in some embodi In some embodiments of this aspect and all other aspects ments, the test sample can be analyzed to determine if the described herein, the assay can further comprise determining 45 subject has at least the SNPs located at the positions 677 and if the human subject is obese or not. If the human subject is 2756 of the MTHFR and MTR loci, respectively. In some determined to be obese, then selecting for the human subject embodiments, the test sample can be analyzed to determine and optionally administering to the human Subject a treat if the subject is obese (e.g., whether the subject has at least ment regimen comprising an effective amount of a folate the BMI value of at least 30 kg/m), and at least one or both containing compound. Methods of determining obesity in a 50 of the SNPs located at the positions 2756 and 66 of the MTR human Subject are known in the art and can include, but are and MTRR loci, respectively. In some embodiments, the test not limited to, body mass index (BMI) measurement, mea sample can be analyzed to determine if the Subject is obese Surement of abdominal fat (e.g., by waist circumference or (e.g., whether the subject has at least the BMI value of at waist-hip ratio), measurement of body fat, skinfold thick least 30 kg/m), and at least one or both of the SNPs located ness, underwater weighing (densitometry), air-displacement 55 at the positions 677 and 2756 of the MTHFR and MTR loci, plethysmography, computerized tomography (CT) and mag respectively. In other embodiments, the test sample can be netic resonance imaging (MRI), and dual energy X-ray analyzed to determine if the subject has at least the BMI absorptiometry (DEXA), and any combinations thereof. For value of at least 30 kg/m and the SNP located at the position example, in one embodiment, the assay can further comprise 2756 of the MTR locus. In some embodiments, the test measuring body mass index (BMI) of the human subject to 60 sample can be analyzed to determine if the Subject has at determine if the human subject is obese or not, and if the least the SAM/SAH ratio smaller than the pre-determined BMI value of at least 30 kg/m or greater is measured in the reference ratio and the SNP located at the position 2756 of Subject, then selecting for the human Subject and optionally the MTR locus. In some embodiments, the test sample can administering to the human Subject a treatment regimen be analyzed to determine if the subject has at least the comprising an effective amount of a folate-containing com 65 4-HNE expression greater than the pre-determined standard pound. In some embodiments, if the human Subject has a and the SNPs located at the positions 2756 and 66 of the BMI value of less than 30 kg/m, it may not be desirable to MTR and MTRR loci, respectively. It is envisioned that any US 9,540,691 B2 10 combinations of all the conditions (A)-(X) can be analyzed SEQ ID NO. 1 or position 27 of SEQ ID NO. 7 (identified in the assay as described herein. by rs1801133) comprising at least one thymine “T” allele, In some embodiments, if at least one or at least two, and (ii) a SNP at position 2756 of SEQID NO. 2 or position including at least three or more, of the conditions (A)-(X) 27 of SEQ ID NO. 9 comprising at least one guanine “G” provided herein are determined to be present in the test allele. In these embodiments, the method can further com sample, a treatment regimen comprising a folate-containing prise determining the presence or absence of any of the compound is recommended or selected and optionally conditions (A)-(X) described herein. administered to the human Subject. In some embodiments, the Subject administered with a In some embodiments, if the human Subject satisfies at treatment regimen comprising a folate-containing com least one, including at least two, at least three or more, of the 10 pound can be further determined to be obese (e.g., with a conditions (A)-(X) described herein (and an indicator of a BMI value of at least about 30 kg/m or higher). human subject being obese, e.g., a BMI value of at least 30 In some embodiments of this aspect and all other aspects kg/m or greater), the subject can be administered or pre described herein, a folate-containing compound can be scribed with a folate-containing compound. administered in an amount effective to reduce at least one Some embodiments of the assays described herein can be 15 symptom (e.g., but not limited to, low mood, insomnia, included as part of a treatment strategy, e.g., to select an agitation, anxiety and/or weight loss) associated with appropriate treatment regimen for a human Subject diag depression, e.g., major depressive disorders. In some nosed as having or having a risk for depression. Accordingly, embodiments, the effective amount of a folate-containing another aspect provided herein relates to methods of treating compound can provide at least about 0.1 to about 1 mg/kg a human Subject diagnosed as having, or having a risk, for body weight per day administration to the human Subject. In depression. In some embodiments, a method for treating a Some embodiments, the effective amount of a folate-con human Subject with depression can comprise performing one taining compound can provide at least about 7.5 mg/day to or more embodiments of the assay provided herein. In some about 50 mg/day administration to the human Subject. In one embodiments, if the subject satisfies at least one of the embodiment, the effective amount of a folate-containing conditions described in the assay provided herein, the treat 25 compound can provide at least about 15 mg/day of folate ment method can further comprise administering or pre administration to the human Subject. scribing the Subject with a treatment regimen comprising an The effective amount of the folate-containing compound effective amount of a folate-containing compound. can be administered to a selected human Subject as a single Accordingly, in one embodiment, the method can com daily dose, or alternatively, in more than one divided doses prise determining in a test sample of a human Subject 30 per day via any Suitable administration route, e.g., oral parameters of at least two or more (including at least three, administration. at least four, at least five or more) biomarkers (i) to (xxiv) The effective amount of folate administered to a selected described herein; and administering to the human Subject a human Subject for treatment of depression as described treatment regimen comprising an effective amount of a herein is significantly higher than the typical amount taken folate-containing compound, if the presence of at least one 35 as a dietary supplement (between 50-600 ug/day). In some or more (including at least two, at least three, at least four, embodiments, the effective amount of folate administered to at least five or more), or any combinations of the conditions a selected human Subject is at least about 2-fold, at least (A)-(X) described herein is detected in the test sample. about 5-fold, at least about 10-fold, at least about 25-fold, at In particular embodiments, the method can comprise least about 50-fold, at least about 100-fold, at least about determining in a test sample of a human Subject genotypes 40 250-fold, at least about 500-fold, at least about 1000-fold or of at least two loci at position 677 of SEQ ID NO. 1 (or more than the typical amount taken as a dietary Supplement. position 27 of SEQ ID NO. 7) and at position 2756 of SEQ Accordingly, in Some embodiments, the folate-containing ID NO. 2 (or position 27 of SEQ ID NO. 9); and adminis compound is desirable to be formulated in slow-release or tering to the human Subject a treatment regimen comprising Sustained release composition. For example, in one embodi an effective amount of a folate-containing compound if 45 ment, the composition comprising a folate-containing com either at least one or both of the following conditions is/are pound can be formulated to release the effective amount of detected: (i) at least one thymine “T” allele present at the folate-containing compound over a period between 3-6 position 677 of SEQ ID NO. 1 (or position 27 of SEQ ID hours or 4-5 hours post-administration. NO. 7); and (ii) at least one guanine “G” allele present at Any art-recognized folate-containing compound can be position 2756 of SEQ ID NO. 2 (or position 27 of SEQ ID 50 selected and/or optionally administered to a human Subject NO. 9). In these embodiments, the method can further selected to carry at least one or more conditions (A)-(X) comprise determining the presence or absence of any of the described herein. In some embodiments, the folate-contain conditions (A)-(X) described herein. ing compound can comprise a L-methylfolate compound. In In some embodiments, a method for treating a human one embodiment, the folate-containing compound can com Subject with depression can comprise administering a com 55 prise 6 (S)-5-methyltetrahydrofolate or a derivative thereof. position comprising an effective amount of a folate-contain In some embodiments of this aspect and all other aspects ing compound to the human Subject, who is diagnosed as described herein, the treatment regimen can further com having, or having a risk for, depression, and is further prise selecting and optionally administering an antidepres determined to carry at least one or more (including at least sant drug. In some embodiments, the anti-depressant drug two, at least three, at least four or more), or any combina 60 can include a selective serotonin reuptake inhibitor, includ tions of the conditions (A)-(X) described herein. ing, but not limited to, fluoxetine, citalopram, paroxetine, In certain embodiments, the method can comprise admin escitalopram, Sertraline, and any combinations thereof. istering a composition comprising an effective amount of a In these embodiments, an antidepressant drug can be folate-containing compound to the human Subject, who is administered in the same composition as the folate-contain diagnosed as having, or having a risk for, depression, and is 65 ing compound. In alternative embodiments, the antidepres further determined to carry at least one of the following sant drug and the folate-containing compound can be admin SNPs or a combination thereof: (i) a SNP at position 677 of istered in separate compositions at the same time (e.g., US 9,540,691 B2 11 12 concurrently) or sequentially (e.g., one after the other), or in output from the computing module, wherein the content any temporal administration regimen, where the adjuvant comprises a signal indicative of the presence of at least one effect of the folate-containing compound increases the effi condition (A) to CX) described herein, and optionally the cacy of the antidepressant drug as compared to the efficacy absence of any one of the conditions (A) to (X) described without the folate-containing compound. In some embodi herein, or a signal indicative of the absence of all of the ments, the anti-depressant drug and/or the folate-containing conditions (A) to (X) described herein. compound can be administered in a single dose or in divided In some embodiments, the determination module can be doses. The number of dosages administered over a period of configured to perform at least one genotyping analysis on at time (e.g., per day) for the antidepressant drug and the least one test sample to determine the genotypes of at least folate-containing compound can be the same or different. 10 two loci comprising position 677 of SEQ ID NO. 1 (or The antidepressant drug and the folate-containing com position 27 of SEQID NO. 7) and position 2756 of SEQ ID pound can be administered via the same or different routes. NO. 2 (or position 27 of SEQ ID NO. 9). In these embodi In some embodiments of this aspect and all other aspects ments, the computing module can be configured to deter described herein, the adjuvant effect of the folate-containing mine the presence of at least one SNP located at position 677 compound administered in combination with an antidepres 15 of SEQ ID NO. 1 (or position 27 of SEQ ID NO. 7) sant drug can be additive. comprising at least one thymine “Tallele, and/or at position In some embodiments of this aspect and all other aspects 2756 of SEQ ID NO. 2 (or position 27 of SEQ ID NO. 9) described herein, the adjuvant effect of the folate-containing comprising at least one guanine "G” allele. compound administered in combination with an antidepres In another embodiment, the determination module can be sant drug can be synergistic. configured to perform at least one analysis on at least one A further aspect provided herein is a method of determin test sample to determine the presence or absence of at least ing and/or improving the effectiveness of an anti-depressant one of the following conditions: drug administered to a human Subject, e.g., by determining i. an expression ratio of S-adenosyl methionine (SAM) to if the human subject is amenable to folate or a derivative S-adenosyl homocysteine (SAH) Smaller than a pre thereofas an adjuvant, e.g., using the assay described herein. 25 determined reference ratio: In some embodiments of this aspect, the method can further ii. expression of 4-hydroxynonenal (4-HNE) greater than comprise administering or prescribing the Subject with a a pre-determined reference value: compound containing an effective amount of folate as an iii. a single nucleotide polymorphism (SNP) at position adjuvant to the anti-depressant drug, if the Subject satisfies 677 of SEQID NO. 1 (or at position 27 of SEQID NO. at least one of the conditions (A)-(X) provided herein. An 30 7) comprising at least one thymine “T” allele, wherein exemplary effective amount of folate is about 7.5 mg/day to the SEQ ID NO. 1 and SEQ ID NO. 7 are each about 50 my day, or in one embodiment, the effective independently a portion of a genomic nucleic acid amount is at least about 15 mg/day. In one embodiment, the sequence of methylenetetrahydrofolate reductase anti-depressant drug is a selective serotonin reuptake inhibi (MTHFR): tor, for example, without limitations, fluoxetine, citalopram, 35 iv. a SNP at position 2756 of SEQID NO. 2 (or at position paroxetine, escitalopram, Sertraline, and any combinations 27 of SEQ ID NO. 9) comprising at least one guanine thereof. “G” allele, wherein the SEQID NO. 2 and SEQID NO. Yet another aspect provided herein is a method of improv 9 are each independently a portion of a genomic nucleic ing the effectiveness or efficacy of an anti-depressant drug acid sequence of methionine synthase (MTR); and taken by a subject, e.g., by identifying the Subject with at 40 v. a SNP at position 66 of SEQ ID NO. 3 (or at position least one of the conditions as determined in the assay 27 of SEQID NO. 10) comprising at least one guanine described herein. Accordingly, in Some embodiments of this “G” allele, wherein the SEQID NO. 3 and SEQID NO. aspect, the method can further comprise administering or 10 are each independently a portion of a genomic prescribing the Subject with a compound containing an nucleic acid sequence of methionine synthase reductase effective amount of folate as an adjuvant to the anti-depres 45 (MTRR). sant drug, if the Subject satisfies at least one of the conditions In these embodiments, the determination module can be determined in the assay provided herein. An exemplary further configured to determine the presence or absence of at effective amount of folate is at least about 15 mg/day. In one least one other condition (A)-(X) described herein. For embodiment, the anti-depressant drug is a selective sero example, in Some embodiments, the determination module tonin reuptake inhibitor, for example, without limitations, 50 can be further configured to determine expression of high fluoxetine, citalopram, paroxetine, escitalopram, Sertraline, sensitivity c-reactive protein (hsCRP). In some embodi and any combinations thereof. ments, the determination module can be further configured Computer systems for use in any aspects of the assays to determine the presence or absence of a SNP at position and/or methods described herein are also provided. For 1298 of the SEQID NO. 1 comprising at least one cytosine example, one embodiment provided herein is a computer 55 “Callele. system for obtaining data from at least one test sample In some embodiments, the determination module can be obtained from at least one Subject. The system comprises: configured to analyze at least one test sample to determine (a) a determination module configured to receive at least one the presence or absence of at least two of the conditions test sample and perform at least one analysis on at least one provided above. test sample to determine parameters of at least two biomark 60 In Some embodiments, the determination module can ers (i) to (xxiv) described herein; (b) a storage device further comprise a comparison module adapted to compare configured to store output data from the determination the data output from the determination module with refer module; (c) a computing module, e.g., a non-human ence data stored on the storage device. machine, comprising specifically-programmed instructions In some embodiments, the storage device can be further to determine from the output data the presence of at least one 65 configured to store physical information of at least one condition (A) to (X) described herein; and (d) a display Subject, for example, comprising indicators of whether a test module for displaying a content based in part on the data subject is obese, e.g., BMI of at least one subject). US 9,540,691 B2 13 14 In some embodiments, the content displayed on the dis In some embodiments, the computer readable medium play module can further comprises the BMI value or a signal can further comprise instructions to determine or calculate if indicative of whether the BMI value is at least 30 kg/m or the subject is obese (e.g., whether the subject has BMI of at not. In some embodiments, the content displayed on the least 30 kg/m or not), based on input data of the subject's display module can further comprise a signal indicative of 5 physical features (e.g., weight and height). the Subject recommended to receive a treatment regimen In some embodiments, the computer readable medium comprising a folate-containing compound, or a signal can further comprise instructions to display a measurement indicative of the subject recommended to receive an alter to determine whether a subject is obese (e.g., a BMI value) native treatment regimen without a folate-containing com or a signal indicative of whether the Subject is obese (e.g., pound. 10 whether the BMI value is at least 30 kg/m or not). Atangible and non-transitory (e.g., not transitory forms of In some embodiments, the computer readable medium signal transmission) computer readable medium having can further comprise instructions to display a signal indica computer readable instructions recorded thereon to define tive of the subject recommended to receive a treatment Software modules for implementing a method on a computer regimen comprising a folate-containing compound, or a is also provided herein. In one embodiment, the computer 15 signal indicative of the Subject recommended to receive an readable storage medium comprises: (a) instructions for alternative treatment regimen without a folate-containing comparing the data stored on a storage device with reference compound. data to provide a comparison result, wherein the comparison Based on the identification of SNPs and/or peripheral identifies the presence or absence of at least one condition markers associated with a response to the use of a folate (A)-(X) described herein; and (b) instructions for displaying containing compound, one aspect described herein also a content based in part on the data output from the deter provides for the design and preparation of detection reagents mination module, wherein the content comprises a signal needed to identify the SNPs and/or peripheral markers indicative of the presence of at least one of the conditions disclosed herein in a test sample of a Subject. For example, (A)-(X) described herein, and optionally the absence of any the detection reagents can be designed and prepared to one of these conditions (A)-(X) described herein. In other 25 identify SNPs in MTHFR locus and MTR locus and option embodiments, the content can comprise a signal indicative ally MTRR locus involved in assays and methods described of the absence of all of the conditions (A)-(X) described herein, and/or measure expression levels of SAM, SAH and herein. 4-HNE in a test sample. Examples of detection reagents that In some embodiments, the instructions can be specifically can be used to identify the disclosed SNPs in a test sample programmed to perform a comparison to identify the pres 30 can include a primer and a probe, wherein the probe can ence of at least one SNP located at position 677 of SEQ ID selectively hybridize the SNP-containing nucleic acid mol NO. 1 (or position 27 of SEQID NO. 7) comprising at least ecules, as compared to a nucleic acid molecule which does one thymine “T” allele, and/or at position 2756 of SEQ ID not contain the SNP at the same nucleotide position. NO. 2 (or position 27 of SEQID NO. 9) comprising at least Examples of detection regents that can be used to measure one guanine “G” allele. 35 expression levels of serum or plasma proteins (e.g., SAM, In other embodiments, the instructions can be specifically SAH and/or 4-HNE) in a test sample can include antibodies programmed to perform a comparison to identify one of the against Such proteins, or a primer and a probe, wherein the following conditions: probe specifically hybridizes to a nucleic acid molecule i. an expression ratio of S-adenosyl methionine (SAM) to corresponding to such proteins. S-adenosyl homocysteine (SAH) Smaller than a pre 40 In one embodiment, a kit can comprise an oligonucleotide determined reference ratio: array affixed with a plurality of oligonucleotide probes that ii. expression of 4-hydroxynonenal (4-HNE) greater than interrogate, e.g., no more than 30 SNPs, wherein the SNPs a pre-determined reference value: comprise at least two or any combinations of the conditions iii. a single nucleotide polymorphism (SNP) at position (A)-(U) described herein (e.g., but not limited to, a combi 677 of SEQ ID NO: 1 comprising at least one thymine 45 nation of conditions (A) and (C)); and an optional container “T” allele, wherein the SEQ ID NO: 1 is a portion of containing a detectable label (e.g., comprising a fluorescent a genomic nucleic acid sequence of methylenetetrahy molecule) to be conjugated to a nucleotide molecule derived drofolate reductase (MTHFR): from a test sample of a human Subject; and at least one iv. a SNP at position 2756 of SEQID NO: 2 comprising reagent. Examples of a reagent that can be included in the kit at least one guanine “G” allele, wherein the SEQ ID 50 can include, without limitations, a restriction enzyme, a NO: 2 is a portion of a genomic nucleic acid sequence universal adaptor to be conjugated to a nucleotide molecule, of methionine synthase (MTR); and a primer complementary to the universal adaptor, a wash v. a SNP at position 66 of SEQ ID NO:3 comprising at agent, and any combinations thereof. least one guanine “G” allele, wherein the SEQID NO: In an alternative embodiment, a kit can comprise a 3 is a portion of a genomic nucleic acid sequence of 55 plurality of oligonucleotide primers that bind to at least one methionine synthase reductase (MTRR): allele of no more than 30 SNPs, wherein each subset of In these embodiments, the computer readable medium can oligonucleotide primers that bind to a specific allele of a further comprise instructions to identify the presence or SNP is labeled with a distinct reporter, and wherein said absence of at least one other condition (A)-(X) described SNPs comprise at least two or any combinations of the SNP herein. For example, in one embodiment, the computer 60 conditions (A)-(U) described herein (e.g., but not limited to readable medium can further comprise instructions to iden a combination of conditions (A) and (C)); and at least one tify the presence or absence of a SNP at position 1298 of the reagent, e.g., but not limited to, free nucleotide bases, a SEQ ID NO: 1 comprising at least one cytosine “C” allele. polymerase, or both. In some embodiments, the computer readable medium can In some embodiments, the kit can further comprise at least further comprise instructions to compare expression of high 65 one reagent to determine expression of at least one bio sensitivity c-reactive protein (hsCRP) with the reference marker described herein (e.g., SAM, SAH, 4-HNE and data. hsCRP). For example, in one embodiment, the kit can US 9,540,691 B2 15 16 further comprise a solid substrate support affixed with at in combination with an anti-depressant for use in the treat least one protein-based binding moiety (e.g., an antibody) ment of depression in a human Subject who carries at least that specifically binds to one or more of the biomarkers one of the conditions (A)-(X) described herein (e.g., but not described herein. Exemplary Solid Substrate Support can limited to, either one or both conditions (A) and (C)). In include, but not limited to, a microtiter plate for ELISA, a 5 some embodiments of these aspects described herein, the dipstick, a magnetic bead, or any combinations thereof. In folate-comprising composition can comprise at least about 5 another embodiment, the kit can further comprise at least mg of folate (e.g., about 7.5 mg to about 50 mg of folate). one primer designed to probe one or more biomarkers In some embodiments, the folate-comprising composition described herein. can be formulated for a pre-determined release profile (e.g., The assays, methods, systems and/or kits described herein 10 a Sustained release). In some embodiments, the human can be performed and/or used by a third-party service Subject is an adult. provider. For example, a third-party service provider can Embodiments of various aspects described herein can be provide and charge for a service offered to determine the employed for use in a human Subject diagnosed as having, presence or absence of at least one condition (A)-(X) in a or having a risk for, any form of depression. In one embodi test sample of a human Subject, e.g., to facilitate selection of 15 ment, various aspects described herein can be employed for a treatment regimen for a human Subject with depression. use in a human Subject diagnosed as having, or having a risk Accordingly, methods for selecting a treatment regimen for for, a major depressive disorder. In some embodiments, the a human Subject are also provided herein. For example, the human subject can be further determined to be resistant to at method comprises (a) obtaining a test sample from a human least one anti-depressant monotherapy. In some embodi Subject diagnosed as having, or having a risk, for depression; ments, the human Subject is an adult. (b) Subjecting the test sample to at least one analysis to In some embodiments, various aspects described herein determine parameters of at least two biomarkers (i)-(xxiv) can be employed for use in a human Subject who is currently described herein (e.g., but not limited to, a combination of taking an antidepressant. In these embodiments, the human biomarkers (i) and (iii)); (c) determining, from the param Subject who is determined to satisfy at least one (including, eters of the selected biomarkers, the presence of at least one 25 e.g., at least two, at least three or more) of the conditions condition (A)-(X) (e.g., but not limited to, either one or both (A)-(X) can be selected and/or administered with a treatment of conditions (A) and (C)); and (d) providing a result output regimen comprising a folate-containing compound. In some setting forth whether at least one of the conditions (A)-(X) embodiments, the treatment regimen does not include an is detected in the test sample. If at least one condition is antidepressant. In some embodiments, the treatment regi present, the method can further comprise selecting and 30 men can include the same antidepressant that the human optionally administering a treatment regimen comprising an Subject is currently taking or a different antidepressant. effective amount of a folate-containing compound to the human Subject. BRIEF DESCRIPTION OF THE DRAWINGS In some embodiments, the step (b) of the method can further comprise optionally packing and shipping the test 35 FIGS. 1A-1B show schematic diagrams of exemplary sample to a test facility, e.g., a third-party CLIA-certified study designs of analyzing the efficacy of a folate-containing service provider. compound, e.g., as an adjunct to a selective serotonin In some embodiments, the step (d) of the method is reuptake inhibitor (SSRI) for treating a subject with depres performed by a non-human machine. sion or identifying biomarkers or conditions indicative of a The test sample for use in the assays, methods, systems or 40 Subject with depression recommended for a treatment regi kits described herein can be derived from a biological men comprising a folate-containing compound and an SSRI. sample of the Subject, e.g., a blood sample or plasma or FIG. 1A shows an exemplary study design, in which 7.5 serum sample from the Subject. In some embodiments, the mg/day L-methylfolate (e.g., 6(S)-5-methyltetrahydrofolate, test sample can comprise a urine sample. In some embodi abbreviated as 6(S)-5-MTHF as described herein) is admin ments, the test sample can comprise a buccal sample. In 45 istered as an adjunct to an SSRI. FIG. 1B shows an exem Some embodiments, the test sample can comprise a saliva plary study design, in which 15 mg/day L-methylfolate (e.g., sample. 6(S)-5-MTHF) is administered as an adjunct to an SSRI. If the test sample is a nucleic acid sample, the test sample FIG. 2 shows a schematic diagram of an exemplary can be subjected to at least one analysis selected from the double-blind, placebo-controlled study of 6(S)-5-MTHF group consisting of allele-specific probe hybridization, 50 among SSRI-resistant outpatients with major depressive allele-specific primer extension, allele-specific amplifica disorder (MDD) using sequential parallel comparison. As an tion, sequencing, 5' nuclease digestion, molecular beacon example, 10% dropout rate is assumed. The percent assay, DNA chip analysis, oligonucleotide ligation assay, response and non-response rates provided in this figure are size analysis, single-stranded conformation polymorphism, only meant to indicate the relative efficacy effect, but do not polymerase chain reaction (PCR), real-time quantitative 55 mean to be construed as or limited by the absolute values of PCR, and any combinations thereof. the indicated percentages. If the test sample is a protein sample, the test sample can FIGS. 3A-3E show effects of treating MDD patients with be subjected to at least one analysis selected from the group a folate-containing compound, e.g., as an adjunct to an SSRI consisting of western blot, enzyme linked absorbance assay, in Trial 2. FIG. 3A shows the response rates of MDD mass spectrometry, immunoassay, flow cytometry, immuno 60 patients treated with either a folate-containing compound or histochemical analysis, and any combinations thereof. a placebo, in conjunction with an SSRI, after 30-day treat A still further aspect provided herein relates to uses of a ment. A responder is a MDD patient with at least 50% folate-comprising composition in the treatment of depres reduction in HDAM-17 after treatment. FIG. 3B shows the sion in a human Subject who carries at least one of the mean change in scores of various neuropySchological tests conditions (A)-(X) described herein (e.g., but not limited to, 65 (e.g., HDAM-17, QIDS-SR, and CGI-S) for MDD patients either one or both conditions (A) and (C)). Another aspect treated with either a folate-containing compound or a pla provided herein relates to a folate-comprising composition cebo, in conjunction with an SSRI, after 30-day treatment. US 9,540,691 B2 17 18 FIG. 3C shows percents of MDD patients in remission, as Maier SPCD. FIG. 10B shows Maier means. FIG. 10C measured by HDAM-17, after treated with either a folate shows HAMD-7 SPCD. FIG. 10D shows HAMD-7 means. containing compound or a placebo, in conjunction with an FIG. 10E shows a summary of the biomarker and genetic SSRI, after 30-day treatment. FIG. 3D shows percents of analyses on Maier Scale. 5 MDD patients in remission, as measured by QIDS-SR, after DETAILED DESCRIPTION OF THE treated with either a folate-containing compound or a pla INVENTION cebo, in conjunction with an SSRI, after 30-day treatment. FIGS. 3C-3D show that remission rates after 30 days of Recent estimates indicate that more than 19 million adjuvant 15 mg/day L-methylfolate and an SSRI, compared Americans over the age of 18 years experience a depressive to placebo and the SSRI, was not significant in depressed 10 illness each year. While significant advances in the treatment patients who inadequately respond to SSRI monotherapy. of depression have been made in the past decade, as many FIG. 3E shows percent of MDD patients discontinued from as 29% to 46% of patients with depression taking an Trial 2, indicating no significant difference in discontinua anti-depressant are still partially or totally resistant to the tion rates due to overall adverse events. treatment. Those who suffer from treatment-resistant depres 15 sion have almost no alternatives. As not every treatment FIGS. 4A-4B show effects of a single genetic polymor regimen is effective for each individual, there is a strong phism (SNP) in the MTHFR gene (MTHFRC677T) on the need to identify markers that can facilitate selection of an efficacy of the treatment comprising a folate-containing appropriate treatment regimen for a human Subject with compound (e.g., 6(S)-5-MTHF) and optionally an SSRI in a depression patient with depression. FIG. 4A shows efficacy results as In accordance with aspects of various embodiments measured by HDAM-28 (28-item Hamilton Depression Rat described herein, at least 21 single nucleotide polymor ing Scale). FIG. 4B shows efficacy results as measured by phisms (SNPs) and 4 peripheral biomarker parameters have CGI-S (Clinical Global Impression-Severity). been discovered for predicting the effectiveness or efficacy FIGS.5A-5B show effects of obesity (i.e., BMI is at least of a treatment regimen comprising a folate-containing com 30 kg/m or above) on the efficacy of the treatment com 25 pound. That is, these SNPs and serum/plasma biomarker prising a folate-containing compound (e.g., 6(S)-5-MTHF) parameters can be used to identify Subjects with depression and optionally an SSRI in a patient with depression. FIG. 5A that would benefit from or respond to a treatment regimen shows efficacy results as measured by HAMD-28 (28-item comprising a folate-containing compound, as compared to a Hamilton Depression Rating Scale) with a chi-square of treatment without a folate-containing compound. In particu 3.94 for the treatment effect. FIG. 4B shows efficacy results 30 lar, these SNPs and serum/plasma biomarker parameters can as measured by CGI-S (Clinical Global Impression-Sever be used to identify a subject with treatment-resistant depres ity) with a chi-square of 10.03 for the treatment effect. sion (e.g., a subject resistant to at least one selective sero FIG. 6 is a block diagram showing an exemplary system tonin reuptake inhibitor (SSRI)) who would benefit from or for use in the methods described here, e.g., for selecting a respond to a treatment regimen comprising a folate-contain treatment regimen for a subject with depression. 35 ing compound, as compared to a treatment without the FIG. 7 is an exemplary set of instructions on a computer folate-containing compound. The folate-containing com readable storage medium for use with the systems described pound can be administered in the absence of an anti herein. depressant drug, or it can be provided as an adjuvant to an FIGS. 8A-8B show mean changes in HAMD-28 in MDD antidepressant drug. In some embodiments, the adjuvant patients carrying at least one rare variant on the indicated 40 effect of the folate-containing compound administered in gene, as opposed to fully normal on the respective gene, combination with an antidepressant drug can additive. In when they were treated with a folate-containing compound, other embodiments, the adjuvant effect of the folate-con e.g., as an adjunct to an SSRI. FIG. 8A is a bar graph taining compound administered in combination with an showing the mean change in HAMD-28 with respect to antidepressant drug can be synergistic. various SNP biomarkers as indicated. FIG. 8B is a table 45 Specifically, the SNPs that can predict efficacy of admin showing the results as shown in FIG. 8A and the corre istering to a human Subject a folate-containing compound sponding loci in chromosomes. The term “prevalence’ as (e.g., alone or in a combination therapy to increase the used in FIG. 8B refers to the total percentage of MDD efficacy of an antidepressant) for treatment of depression patients who carry the SNP as indicated in this particular include at least one or a combination of SNPs identified by study. 50 rs numbers as follows: rs1801 133 present in methylenetet FIGS. 9A-9C are result tables showing effects of the rahydrofolate reductase (MTHFR): rs2274.976 present in presence or absence of an indicated condition, in MDD MTHFR: rs1805087 present in methionine synthase (MTR): patients on the degree of depression, when the patients were rs 1801394 present in methionine synthase reductase treated with a treatment regimen comprising a folate-con (MTRR): rs1006737 present in calcium channel, voltage taining compound. The degree of depression was measured 55 dependent, L-type, alpha 1 C subunit (CACNA1C); by Social Functioning Questionnaire (SFQ), Visual Ana rs 1883729 present in DNA (cytosine-5)-methyltransferase 3 logue Scale (VAS), and Cognitive and Physical Function beta (DNMT3B): rs7163862 present in GTP cyclohydrolase Questionnaire (CPFO). FIG. 9A shows analyses on all 1 feedback regulatory protein (GCHFR): rs12659 present in samples. FIG. 9B shows analyses in biomarker subgroups. reduced folate carrier protein (RCF2): rs202676 present in FIG. 9C shows analyses in genetic Subgroups. 60 folate hydrolase (prostate-specific membrane antigen) FIGS. 10A-10E are result tables showing effects of the (FOLH1); rs2297291 present in reduced folate carrier pro presence or absence of an indicated condition, in MDD tein (RCF1): rs1051266 present in reduced folate carrier patients on the degree of depression, when the patients were protein 1 (RCF1): rs8007267 present in GTP cyclohydrolase treated with a folate-containing compound (treatment group) 1 (GCH1); rs7639752 present in choline-phosphate cytidy or without a folate-containing compound (placebo group). 65 lytransferase A (PCYT1A): rs6275 present in dopamine The degree of depression was measured by Maier or receptor D2 (DRD2): rs1079596 present in DRD2: HAMD-7 Subscale of HAMD. FIG. 10A shows results of rs 11240594 present in DRD2: rs4633 present in catechol US 9,540,691 B2 19 20 O-methyltransferase (COMT): rs4680 present in COMT: peripheral biomarker as described herein in order to deter rs250682 present in dopamine active transporter (DAT, or mine the responsiveness of the human Subject to a treatment SLC6A3): rs2277.820 present in formiminotransferase regimen comprising a folate-containing compound. The cyclodeaminase (FTCD): rs2236225 present in methyl assay comprises: enetetrahydrofolate dehydrogenase (NADP+ dependent) 1 (a) Subjecting a test sample of a human Subject, who is (MTHFD1); and any combinations thereof. diagnosed as having depression or having a risk for depres Further, peripheral biomarker parameters that can predict Sion, to at least one analysis to determine parameters of at efficacy of administering to a human Subject a folate least two (including, e.g., at least three, at least four, at least containing compound (e.g., alone or in a combination five or more) of the biomarkers (i) to (xxiv): therapy to increase the efficacy of an antidepressant) for 10 (i) genotype of a SNP locus at position 677 of SEQ ID treatment of depression include relative expression levels NO. 1 or position 27 of SEQ ID NO. 7 (identified by between S-adenosyl methionine (SAM) and S-adenosyl rs 1801133), wherein the SEQ ID NO. 1 and SEQ ID homocysteine (SAH), expression of 4-hydroxynonenal NO. 7 are each independently a portion of a genomic (4-HNE), expression of high-sensitivity c-reactive protein nucleic acid sequence of methylenetetrahydrofolate (hsCRP), and any combinations thereof. Additionally, obe 15 reductase (MTHFR): sity has also been discovered to be predicative of effective (ii) genotype of a SNP locus at position 1793 of SEQ ID ness of a treatment regimen comprising a folate-containing NO. 1 or position 27 of SEQ ID NO. 8 (identified by compound (e.g., as a monotherapy or a combination therapy rs2274.976), wherein the SEQ ID NO. 1 and SEQ ID with an antidepressant). These genetic polymorphisms, NO. 8 are each independently a portion of a genomic peripheral biomarkers and clinical features have been nucleic acid sequence of MTHFR: assessed on a human cohort, who has major depressive (iii) genotype of a SNP locus at position 2756 of SEQID disorder and has shown resistance to anti-depressant mono NO. 2 or position 27 of SEQ ID NO. 9 (identified by therapies, e.g., has treatment-resistant depression (TRD), in rs 1805087), wherein the SEQ ID NO. 2 and SEQ ID particular, selective serotonin reuptake inhibitor (SSRI)- NO. 9 are each independently a portion of a genomic resistant depression. 25 nucleic acid sequence of methionine synthase (MTR); Accordingly, some embodiments described herein are (iv) genotype of a SNP locus at position 66 of SEQ ID generally related to assays, methods, systems or kits for NO. 3 or position 27 of SEQ ID NO. (identified by selecting a treatment regimen for a Subject with depression rs 1801394), wherein the SEQ ID NO. 3 and SEQ ID or identifying a Subject with depression amenable for, or NO. 10 are each independently a portion of a genomic responsive to a treatment comprising a folate-containing 30 nucleic acid sequence of methionine synthase reductase compound. In some embodiments, the treatment can com (MTRR): prise a combination of a folate-containing compound and an (v) genotype of a SNP locus at position 27 of SEQID NO. antidepressant drug. In one embodiment, the assays, meth 11 (identified by rs1006737), wherein the SEQID NO. ods, systems and kits are directed to determining in a test 11 is a portion of a genomic nucleic acid sequence of sample from a human Subject, e.g., a human Subject diag 35 calcium channel, Voltage-dependent, L type, alpha 1C nosed as having, or having a risk for depression (e.g., but not subunit (CACNA1C); limited to, major depressive disorder) the presence or (vi) genotype of a SNP locus at position 27 of SEQ ID absence of at least one of single nucleotide polymorphisms NO. 12 (identified by rs1883729), wherein the SEQ ID (SNPs) and/or peripheral biomarker parameters to predict NO. 12 is a portion of a genomic nucleic acid sequence the response of a Subject to a treatment comprising a 40 of DNA (cytosine-5)-methyltransferase 3 beta folate-containing compound. If at least one of the conditions (DNMT3B); described herein is determined to be present in the test (vii) genotype of a SNP locus at position 27 of SEQ ID sample from the human Subject, a treatment regimen com NO. 13 (identified by rs7163862), wherein the SEQ ID prising a folate-containing compound can be selected and NO. 13 is a portion of a genomic nucleic acid sequence optionally administered to the human Subject. In some 45 of GTP cyclohydrolase 1 feedback regulatory protein embodiments, the treatment regimen can further comprise (GCHFR): an anti-depressant drug (e.g., an SSRI) to be administered, (viii) genotype of a SNP locus at position 27 of SEQ ID separately or concurrently, with a folate-containing com NO. 14 (identified by rs12659), wherein the SEQ ID pound. NO. 14 is a portion of a genomic nucleic acid sequence Assays for Selecting a Treatment Regimen for a Human 50 of reduced folate carrier protein (RCF2); Subject with Depression (ix) genotype of a SNP locus at position 27 of SEQ ID Accordingly, provided herein generally relate to assays, NO. 15 (identified by rs202676), wherein the SEQ ID methods, systems, and kits for selecting a treatment regimen NO. 15 is a portion of a genomic nucleic acid sequence for a subject with depression or a risk for depression; for of folate hydrolase (prostate-specific membrane anti treating a subject with depression or a risk for depression, 55 gen) 1 (FOLH1); and/or for improving the effectiveness of a treatment regi (x) genotype of a SNP locus at position 27 of SEQID NO. men recommended for and/or administered to a Subject with 16 (identified by rs2297291), wherein the SEQID NO. depression or a risk for depression. Provided herein also 16 is a portion of a genomic nucleic acid sequence of relate to folate-comprising compositions for use in treatment reduced folate carrier protein (RCF1): of depression in a subject (e.g., a human Subject) selected to 60 (xi) genotype of a SNP locus at position 27 of SEQ ID carry at least one (e.g., at least two or more) or any NO. 17 (identified by rs1051266), wherein the SEQ ID combinations of the biomarkers or conditions described NO. 17 is a portion of a genomic nucleic acid sequence herein. of reduced folate carrier protein (RCF1): One aspect described herein provides an assay for select (xii) genotype of a SNP locus at position 27 of SEQ ID ing a treatment regimen for a Subject with depression, by 65 NO. 18 (identified by rs8007267), wherein the SEQ ID identifying in a test sample from the Subject genotypes of at NO. 18 is a portion of a genomic nucleic acid sequence least one of the SNPs and/or expression of at least one of GTP cyclohydrolase 1 (GCH1); US 9,540,691 B2 21 22 (xiii) genotype of a SNP locus at position 27 of SEQ ID (H) a SNP at position 27 of SEQID NO. 14 (identified by NO. 19 (identified by rs7639752), wherein the SEQ ID rs 12659) comprising at least one thymine “T” allele; NO. 19 is a portion of a genomic nucleic acid sequence (I) a SNP at position 27 of SEQID NO. 15 (identified by of choline-phosphate cytidylyltransferase A rs202676) comprising at least one guanine “G” allele; (PCYT1A); (J) a SNP at position 27 of SEQID NO. 16 (identified by (xiv) genotype of a SNP locus at position 27 of SEQ ID rs2297291) comprising at least one adenine “A” allele; NO. 20 (identified by rs6275), wherein the SEQID NO. (K) a SNP at position 27 of SEQID NO. 17 (identified by 20 is a portion of a genomic nucleic acid sequence of at rs1051266) comprising at least one adenine “A” dopamine receptor D2 (DRD2); allele; (XV) genotype of a SNP locus at position 27 of SEQ ID 10 (L) a SNP at position 27 of SEQID NO. 18 (identified by NO. 21 (identified by rs1079596), wherein the SEQ ID rs8007267) comprising at least one thymine “T” allele; NO. 21 is a portion of a genomic nucleic acid sequence (M) a SNP at position 27 of SEQID NO. 19 (identified by of dopamine receptor D2 (DRD2); rs7639752) comprising at least one adenine “A” allele; (xvi) genotype of a SNP locus at position 27 of SEQ ID (N) a SNP at position 27 of SEQID NO. 20 (identified by NO. 22 (identified by rs11240594), wherein the SEQ 15 rs6275) comprising at least one thymine “T” allele; ID NO. 22 is a portion of a genomic nucleic acid (O) a SNP at position 27 of SEQID NO. 21 (identified by sequence of dopamine receptor D2 (DRD2); rs 1079596) comprising at least one thymine “T” allele; (xvii) genotype of a SNP locus at position 27 of SEQ ID (P) a SNP at position 27 of SEQID NO. 22 (identified by NO. 23 (identified by rs4633), wherein the SEQID NO. rs 11240594) comprising at least one adenine “A” 23 is a portion of a genomic nucleic acid sequence of allele; catechol-O-methyltransferase (COMT); (Q) a SNP at position 27 of SEQID NO. 23 (identified by (xviii) genotype of a SNP locus at position 27 of SEQID rs4633) comprising at least one cytosine “C” allele; NO. 24 (identified by rs4680), wherein the SEQID NO. (R) a SNP at position 27 of SEQID NO. 24 (identified by 24 is a portion of a genomic nucleic acid sequence of rs4680) comprising at least one guanine “G” allele; catechol-O-methyltransferase (COMT); 25 (S) a SNP at position 27 of SEQID NO. 25 (identified by (xix) genotype of a SNP locus at position 27 of SEQ ID rs250682) comprising at least one cytosine “C” allele; NO. 25 (identified by rs250682), wherein the SEQ ID (T) a SNP at position 27 of SEQID NO. 26 (identified by NO. 25 is a portion of a genomic nucleic acid sequence rS2277820) comprising at least one thymine “T” allele; of solute carrier family 6 (neurotransmitted transported, (U) a SNP at position 1958 of SEQID NO. 27 (identified dopamine), member 3 (SLC6A3); 30 by rs2236225) comprising at least one adenine “A” (XX) genotype of a SNP locus at position 27 of SEQ ID allele; NO. 26 (identified by rs2277820), wherein the SEQID (V) an expression level ratio of SAM to SAH smaller than NO. 26 is a portion of a genomic nucleic acid sequence a pre-determined reference ratio: of formiminotransferase cyclodeaminase (FTCD); (W) an expression level of 4-HNE greater than a pre (xxi) genotype of a SNP locus at position 27 of SEQ ID 35 determined reference value; NO. 27 (identified by rs2236225), wherein the SEQ ID (X) an expression of hsCRP greater than about 2.3 mg per NO. 27 is a portion of a genomic nucleic acid sequence liter as measured in a plasma sample; and any combi of methylenetetrahydrofolate dehydrogenase (NADP+ nations thereof. dependent) 1 (MTHFD1)); In some embodiments of this aspect and all other aspects (xxii) level of expression of SAM and SAH; 40 described herein, any of the SNPs described herein can (xxiii) level of expression of 4-HNE; comprise one or two folate-responsive alleles. By way of (xxiv) level of expression of hsCRP; and any combina example only, a SNP at position 677 of SEQ ID NO. 1 or tions thereof, and position 27 of SEQ ID NO. 7 (identified by rs18.01133) can (b) detecting, optionally with a non-human machine, from comprise one thymine “T” allele, or two thymine “T” the determined parameters of at least two biomarkers, the 45 alleles. Without wishing to be bound by theory, a human presence of at least one condition (including, e.g., at least subject determined to carry two folate-responsive alleles in two conditions, at least three conditions, at least four con a SNP locus described herein can show greater response to ditions or more) selected from the following conditions a treatment regimen comprising a folate-containing com (A)-(X): pound than a human Subject with one folate-responsive (A) a SNP at position 677 of SEQ ID NO. 1 or position 50 allele in the same SNP locus. 27 of SEQ ID NO. 7 (identified by rs1801133) com Depending on the design of primers and probes, the SNP prising at least one thymine “T” allele; conditions (A)-(U) can be also represented by alleles (B) a SNP at position 1793 of SEQ ID NO. 1 or position complementary to the corresponding folate-responsive 27 of SEQ ID NO. 8 (identified by rs2274.976) com alleles described herein. For example, instead of detecting prising at least one adenine “A” allele; 55 the presence of a SNP at position 677 of SEQ ID NO. 1 or (C) a SNP at position 2756 of SEQ ID NO. 2 or position position 27 of SEQ ID NO. 7 (identified by rs1801133) 27 of SEQ ID NO. 9 (identified by rs1805087) com comprising at least one thymine “Tallele, one of skill in the prising at least one guanine "G” allele; art can readily design primers and/or probes for the comple (D) a SNP at position 66 of SEQID NO. 3 or position 27 mentary sequence of SEQ ID NO. 7 to probe for a SNP at of SEQID NO. 10 (identified by rs1801394) compris 60 the same location comprising at least one “A” allele instead. ing at least one guanine "G” allele; Accordingly, in some embodiments of this aspect and all (E) a SNP at position 27 of SEQID NO. 11 (identified by other aspects described herein, the presence of at least one rs 1006737) comprising at least one adenine “A” allele; condition (including, e.g., at least two conditions, at least (F) a SNP at position 27 of SEQID NO. 12 (identified by three conditions, at least four conditions or more) selected rs 1883729) comprising at least one adenine “A” allele; 65 from the conditions (A)-(U) can be indicated by detecting (G) a SNP at position 27 of SEQID NO. 13 (identified by the presence of the complementary allele of the folate rs7163862) comprising at least one thymine “T” allele; responsive allele as shown above and also in Table 42 below. US 9,540,691 B2 23 24 Based on the analysis results from step (b), if at least one iii. a single nucleotide polymorphism (SNP) at position of the conditions (A)-(X) described above is detected, the 677 of SEQID NO: 1 (or at position 27 of SEQID NO. assay can further comprise selecting for the human Subject 7) comprising at least one thymine “T” allele, wherein and optionally administering to the human Subject a treat the SEQ ID NO: 1 and SEQ ID NO. 7 are each ment regimen comprising an effective amount of a folate independently a portion of a genomic nucleic acid containing compound. sequence of methylenetetrahydrofolate reductase Any combinations of at least two biomarkers (i) to (xxiv) (MTHFR): described herein can be determined in a test sample for the iv. a SNP at position 2756 of SEQID NO: 2 (or at position assays described herein. Exemplary combinations of at least 27 of SEQ ID NO. 9) comprising at least one guanine 10 “G” allele, wherein the SEQID NO. 2 and SEQID NO. two biomarkers described herein can comprise genotypes of 9 are each independently a portion of a genomic nucleic at least two SNP loci or more (e.g., including at least three acid sequence of methionine synthase (MTR); and SNP loci, at least four SNP loci, at least five SNP loci or v. a SNP at position 66 of SEQ ID NO. 3 (or at position more); or genotype of at least one SNP loci or more (e.g., 27 of SEQID NO. 10) comprising at least one guanine including at least two SNP loci or more) and expression 15 “G” allele, wherein the SEQID NO. 3 and SEQID NO. level of at least one peripheral biomarker or more (e.g., 10 are each independently a portion of a genomic 4-HNE, SAM, SAH); or expression level of at least two nucleic acid sequence of methionine synthase reductase peripheral biomarkers (e.g., 4-HNE, SAM, SAH). Depend (MTRR). ing upon selected combinations of at least two biomarkers In these embodiments, detection of the presence of at least described herein, the test sample can be subjected to one or one of these conditions is indicative of the subject recom more analyses, e.g., including, but not limited to, genotyping mended for a treatment regimen comprising a folate-con assays, expression assays (e.g., protein and/or transcript taining compound. In some embodiments, if none of the levels), or any combinations thereof. conditions described herein is present, the Subject is not Accordingly, in Some embodiments, the assay can com recommended for a treatment regimen comprising a folate prise Subjecting a test sample from a human Subject, who is 25 containing compound. diagnosed as having depression or having a risk for depres In some embodiments of this aspect and all other aspects sion to at least one genotyping assay adapted to determine described herein, when the expression ratio of SAM to SAH genotypes of at least two loci, wherein said at least two loci is Smaller than the pre-determined reference ratio, e.g., are: (i) position 677 of SEQID NO. 1 or position 27 of SEQ smaller than 3.0, or smaller than about 2.8 as measured in a ID NO. 7 (identified by rs1801133) and (ii) position 2756 of 30 plasma sample, the Subject can be recommended for and SEQ ID NO. 2 or position 27 of SEQ ID NO. 9 (identified optionally administered with a treatment regimen compris by rs1805087). In such embodiment, detection of at least ing a folate-containing compound. In one embodiment, the one SNP at either position 677 of SEQID NO. 1 (or position expression ratio of SAM to SAH being smaller than 2.71 (as 27 of SEQ ID NO. 7) comprising at least one thymine “T” measured in a plasma sample) is indicative of the Subject allele or position 2756 of SEQ ID NO. 2 (or position 27 of 35 recommended for and optionally administered with a treat SEQID NO. 9) comprising at least one guanine “G” allele, ment regimen comprising a folate-containing compound. In or detection of both aforementioned SNPs indicates selec some embodiments, if the expression ratio of SAM to SAH tion and optional administration of a treatment regimen is at least or greater than 2.71 as measured in a plasma comprising an effective amount of a folate-containing com sample, the Subject is not recommended for nor adminis pound to the human Subject. 40 tered with a treatment regimen comprising a folate-contain In some embodiments, the test sample can be subjected to ing compound. Depending on the test sample source, e.g., a at least one genotyping assay adapted to determine geno blood sample vs. a buccal sample, the pre-determined ref types of at least three loci, at least four loci, at least five loci, erence ratio for a blood plasma sample can be different from at least six loci, at least seven loci, at least eight loci, at least that for, e.g., a buccal sample. nine loci, at least ten loci or more. The additional loci to be 45 In some embodiments of any aspects described herein, interrogated can be selected from any combinations of the when the expression of 4-HNE is greater than the pre biomarkers (i)-(XXi). determined reference value, e.g., greater than about 3 mg/L. In some embodiments, the genotyping assay can comprise or greater than about 3.2 mg per liter (as measured in a the step of amplifying the test sample with a set of primers plasma sample), the Subject can be recommended for and flanking any one of the SNPs described herein. In some 50 optionally administered with a treatment regimen compris embodiments, at least two (e.g., at least three, at least four, ing a folate-containing compound. In one embodiment, the at least five or more) sets of primers amplifying at least two expression of 4-HNE of at least 3.28 mg per liter or higher (e.g., at least three, at least four, at least five or more) of the (as measured in a plasma sample) is indicative of a subject SNPs can be used in a multiplex amplification assay. recommended for and optionally administered with a treat In some embodiments, the test sample can be subjected to 55 ment regimen comprising a folate-containing compound. In determine parameters of at least three, at least four, at least some embodiments, if the expression of 4-HNE is less than five or more biomarkers (i) to (xxiv) described herein. For 3.28 mg per liter of plasma as measured in a plasma sample example, in some embodiments, the assay can comprise: (a) or lower, the Subject is not recommended for nor adminis Subjecting a test sample of a subject to one or more than one tered with a treatment regimen comprising a folate-contain analyses (e.g., genotyping and/or expression analyses) to 60 ing compound. Depending on the test sample source, e.g., a determine the presence or absence of at least one of the blood sample vs. a buccal sample, the pre-determined ref following conditions: erence value for a plasma sample can be different from that i. an expression ratio of S-adenosyl methionine (SAM) to for, e.g., a buccal sample. S-adenosyl homocysteine (SAH) Smaller than a pre In some embodiments of this aspect and all other aspects determined reference ratio: 65 described herein, the assay can further comprise determining ii. expression of 4-hydroxynonenal (4-HNE) greater than if the human subject is obese or not. If the human subject is a pre-determined reference value: determined to be obese, then the human subject is selected US 9,540,691 B2 25 26 for and optionally administered with a treatment regimen Some embodiments, the test sample can be analyzed to comprising an effective amount of a folate-containing com determine if the subject is obese (e.g., whether the subject pound. Methods of determining obesity in a human Subject has at least the BMI value of at least 30 kg/m), and the are known in the art and can include, but are not limited to, SNPs located at the positions 2756 and 66 of the MTR and body mass index (BMI) measurement, measurement of 5 MTRR loci, respectively. In other embodiments, the test abdominal fat (e.g., by waist circumference or waist-hip sample can be analyzed to determine if the Subject is obese ratio), measurement of body fat, skinfold thickness, under (e.g., whether the subject has at least the BMI value of at water weighing (densitometry), air-displacement plethys least 30 kg/m) and the SNP located at the position 2756 of mography, computerized tomography (CT) and magnetic the MTR locus. In some embodiments, the test sample can resonance imaging (MRI), and dual energy X-ray absorpti 10 ometry (DEXA), and any combinations thereof. be analyzed to determine if the subject has at least the Obesity can be defined clinically in different ways. For SAM/SAH ratio smaller than the pre-determined reference example, obesity can be defined by a body mass index ratio and the SNP located at the position 2756 of the MTR (BMI) value of at least about 30 kg/m or higher. In another locus. In some embodiments, the test sample can be ana embodiment, obesity can be defined by excessive abdominal 15 lyzed to determine if the subject has at least the 4-HNE fat (e.g., indicated by waist circumference and/or waist-hip expression greater than the pre-determined reference value ratio). For example, excess abdominal fat can be clinically and the SNPs located at the positions 2756 and 66 of the defined as a waist circumference >40 inches (>102 cm) in MTR and MTRR loci, respectively. As discussed previously, men and >35 inches (>88 cm) in women. Alternatively, any combinations of one or more of the conditions (A)-(X) abdominal obesity can be defined as a waist-hip ratio above described herein can be assayed at the same time or at 0.95 for males and above 0.80 for females. In some embodi different times. ments, obesity can be defined by body fat percentage, e.g., In some embodiments, if at least one or at least two, obesity is defined as a body fat percentage of at least about including at least three or more, of the conditions provided 32% or more in women and at least about 25% or more in herein are determined to be present in the test sample of a C. 25 human Subject, a treatment regimen comprising a folate In one embodiment, measurement of BMI can be used to containing compound is selected and optionally adminis determine whether a human subject is obese. In such tered to the human subject. embodiment, the assay can further comprise measuring body In some embodiments, if the human Subject satisfies at mass index (BMI) of the human subject to determine if the least one, including at least two, at least three or more, of the human subject is obese or not, and if the BMI value of at 30 least 30 kg/m or greater is measured in the subject, then conditions (A)-(X) described herein (and obesity, e.g., selecting for the human subject and optionally administering defined by a BMI value of at least 30 kg/m or greater), the to the human Subject a treatment regimen comprising an subject can be administered or prescribed with a treatment effective amount of a folate-containing compound. In some regimen comprising a folate-containing compound. embodiments, if the human subject has a BMI value of less 35 In some embodiments, the treatment regimen can further than 30 kg/m, it may not be desirable to recommend or comprise an anti-depressant drug (e.g., an SSRI) to be administer to the human Subject a treatment regimen com administered in combination (e.g. concurrently or sepa prising a folate-containing compound. rately) with a folate-containing compound. In some embodiments, the assay can further comprise In some embodiments, the folate-containing compound determining the presence or absence of a SNP at position 40 can comprise a L-methylfolate compound. In one embodi 1298 of the SEQID NO: 1 comprising at least one cytosine ment, the folate-containing compound can comprise 6(S)- “Callele, wherein the presence of the SNP at position 1298 5-methyltetrahydrofolate or a derivative thereof. of the SEQID NO: 1 comprising at least one cytosine “C” The assays, methods, systems and/or kits described herein is indicative of the subject recommended for and/or admin can be performed and/or used by a third-party service istered with a treatment regimen comprising a folate-con 45 provider. For example, a third-party service provider can taining compound. provide and charge for a service offered to determine the In some embodiments, the assay can further comprise presence or absence of at least one condition (A)-(X) in a determining expression of high-sensitivity c-reactive protein test sample of a human Subject, e.g., to facilitate selection of (hsCRP), wherein the hsCRP expression greater than about a treatment regimen for a human Subject with depression. 2.3 mg per liter (as measured in a plasma sample) is 50 Accordingly, methods for selecting a treatment regimen for indicative of the subject recommended for a treatment a human Subject are also provided herein. For example, the regimen comprising an anti-depressant drug and a folate method comprises (a) obtaining a test sample from a human containing compound. In some embodiments, if the expres Subject diagnosed as having, or having a risk, for depression; sion of hsCRP is lower than 2.3 mg per liter of plasma, as (b) Subjecting the test sample to at least one analysis to measured in a plasma sample, then the Subject is not 55 recommended for nor administered with a treatment regimen determine parameters of at least two biomarkers (i)-(xxiv) comprising a folate-containing compound. Depending on described herein (e.g., but not limited to, a combination of the test sample source, e.g., a blood sample vs. a buccal biomarkers (i) and (iii)); (c) determining, from the param sample, the hsCRP expression a plasma sample can be eters of the selected biomarkers, the presence of at least one different from that in, e.g., a buccal sample. 60 condition (A)-(X) (e.g., but not limited to, either one or both In some embodiments of the assay described herein, a test of conditions (A) and (C)); and (d) providing a result output sample can be analyzed to determine at least one or at least setting forth whether at least one of the conditions (A)-(X) two, at least three, at least four, at least five, at least six of is detected in the test sample. If at least one condition is the conditions provided herein. For example, in some present, the method can further comprise selecting and embodiments, the test sample can be analyzed to determine 65 optionally administering a treatment regimen comprising an if the subject has at least the SNPs located at the positions effective amount of a folate-containing compound to the 677 and 2756 of the MTHFR and MTR loci, respectively. In human Subject. US 9,540,691 B2 27 28 In some embodiments, the step (b) of the method can Subject diagnosed as having, or having a risk for, depression, further comprise optionally packing and shipping the test indicates a treatment regimen comprising a folate-contain sample to a test facility, e.g., a third-party CLIA-certified ing compound be selected for and optionally administered to service provider. the human Subject. In some embodiments, the step (d) of the method is performed by a non-human machine. Next page shows Table 41A: Folate-responsive biomark Folate-Responsive Biomarkers (i)-(xxiv) and Associated ers (i)-(XXi) used in assays, methods, systems and kits Conditions (A)-(X) Indicative of a Treatment Regimen described herein, and corresponding folate-responsive con Comprising a Folate-Containing Compound ditions (A)-(U). The sequences of human origin shown in Table 41A-41 B below indicates folate-responsive bio to Table 41A (including complementary sequences thereof) markers (i)-(XXiv) and associated conditions (A)-(X), the can provide a basis for designing primers and probes for presence of at least one of which in a test sample of a human interrogation of the SNP biomarkers described herein.

Folate-responsive SNP Biomarkers Biomarker identifier SEQ ID NO Sequence rs number Chromosome locus

i 7 CTTGAAGGAGAAGGTGTCTGCGGGAGC/T rs18O1133 1p3 6.3 CGATTTCATCATCACGCAGCTTTTC

ii 8 CGAGGCCTTTGCCCTGTGGATTGAGCA/G rs2274.976 1p3 6.3 GTGGGGAAAGCTGTATGAGGAGGAG

iii 9 GGAAGAATATGAAGATATTAGACAGGA/G rs1805087 1q43 CCATTATGAGTCTCTCAAGGTAAGT

iv O CAGGCAAAGGCCATCGCAGAAGAAATAAG rs18O1394 5p15.31 TGTGAGCAAGCTGTGGTACATGGAT

w 1. TAAGTTCCATTCCATCTCAGCCCGAAA/G rs1 OO6737 12p13.33 TGTTTTCAGAGCCGGAGACCTCACA

vi 2 CTGCTGCTGGTATCAGCCTGGAGGAAA/G rs1883 729 2Oq11.2 TGAGTGACATCAGTTCTCAGCATTA

vii 3 AACCAATCACAACAAGGCAGATAAAGAAT rs7163862 15q15.1 AGGATGAGTTGTCAGATTTTGATAA

viii 4. GCTTCGGAGCTGGAGCGCATGAATCCC/T rs12659 21q22.3 GGCCCAGGCGGGAAGCTGGGACACG

iX 5 AAGCTGAGAACATCAAGAAGTTCTTAC/T rs2O2676 11-p11.2 AGTAAGTACATCCTCGAAAGTTTAT

X 6 GGGAGGGCACCCGCAGAGGCCTGCGCA/G rs229.7291 21q22.3 CTGACACTGCTGAGTGGCTCTGCTC

Xi 7 TGACCCCGAGCTCCGGTCCTGGCGGCA/G rs1O 51266 21q22.3 CCTCGTGTGCTACCTTTGCTTCTAC

Xii 8 CAATAGGAGCGTGTGTTTGAACAGTAC/T rs 8OO7267 14q22.1-q22.2 ACGCCAAACTTCAGTCATTCAAGTA

Xiii 9 GGCCTAATCAATCCTTCTCATCTTTTIA/G rs7639752 3q29 TACCCACCTTTTGCAGGAAACCTGT

Xiw 2O CTGACTCTCCCCGACCCGTCCCACCAC/T rs6275 11q23.2 GGTCTCCACAGCACTCCCGACAGCC

XV 21 GTCCCTGCAGTTTAATTATCCTCAACIA/G rs107.9596 11q23.2 TTACTGCCATACCCTACATTTTTGG

xvi. 22 CTCACAGTTTGTGGTTGAGACTAAGTA/G rs1124 O594 TGACAACAGTGGCACTTTGTGGTCC

xvii 23 ACCAAGGAGCAGCGCATCCTGAACCACAT rs 4633 22q11. 21 GTGCTGCAGCATGCGGAGCCCGGGA q11.2322q11.21

xviii 24 CCCAGCGGATGGTGGATTTCGCTGGCA/G rs 468O 22q11. 21 TGAAGGACAAGGTGTGCATGCCTGA q11.2322q11.21

XiX 25 TAATATGGCCACCCCAACTTTCGTATIC/G rs25 O682 5p15.3 ATTACTGTTTGTGTGGTATTATCTT

XX 26 ATCAGCCCTAGATGCTTGACCAGCTCC/T rs227782O 21q22.3 TCGGGCCT CACC TOCTGGTTC TTCC US 9,540,691 B2 29 30 - Continued

Folate-responsive SNP Biomarkers XXi 27 CTGGGCCAACAAGCTTGAGTGCGATCC/T rs223 6225 14q24 GGTCTGCAATGATGGAGGAATTGCC

Folate Folate responsive Pos. No. of Biomarker Condition responsive complementary SNP in the identifier Gene name identifier allele allele Sequence

i MTHER A. T A. 27

ii MTHER B A. T 27

iii MTR C G C 27

iv MTRR D G C 27

w CACNA1C E A. T 27 Ca ion

vi DNMT3B A. T 27

vii GCHFR G T A. 27 BH4)

viii RCF2 H T A. 27

iX FOLH1. I G C 27 (GCPII)

X RCF1 J A. T 27

Xi RCF1 K A. T 27

Xii GCH1 L T A. 27 BH4)

Xiii PCYT1A M A. T 27

Xiw DRD2 N T A. 27

XV DRD2 O T A. 27

xvi. DRD2 P A. T 27

xvii COMT Q C G 27

xviii COMT R G C 27

XiX SLC6A3 S C G 27

XX FTCD T T A. 27

XXi MTHFD1 U A. T 27

TABLE 41B Folate-responsive biomarkers (xxii)-(XXiv) used in assays, methods, systems and kits described herein, and corresponding folate-responsive conditions (V)-(X). Biomarker Peripherial Condition identifier biomarker identifier Folate-responsive condition XXii SAM, SAH V expression ratio of SAM to SAH < a. pre-determined reference ratio XXiii 4-HNE W expression level of 4-HNE > a pre-determined reference value xxiv. SCRP X expression of hisCRP > -2.3 mg/L as measured in a plasma sample US 9,540,691 B2 31 32 TABLE 42 Combinations of various folate-responsive biomarkers (i)-(XXV) used in assays, methods, systems and kits described herein.

See Tables 41A-41B for additional information of folate-responsive biomarkers (i)- xxiv).

Folate responsive biomarker identifier i ii. iii iv w vi vii. viii ix X Xi xii. xiii. xiv. xv. xvi. xvii. xviii. xix XX XXi XXii Xxiii XXiv XXV (BMI) i X X X X X X X X X X X ii X X X X X X X X X X X iii. X X X X X X X X X X X iv X X X X X X X X X X X X X X X X X X X X X X vi X X X X X X X X X X X vii. X X X X X X X X X X X viii X X X X X X X X X X X ix X X X X X X X X X X X X X X X X X X X X X X X Xi X X X X X X X X X X X xii X X X X X X X X X X X xiii X X X X X X X X X X X xiv X X X X X X X X X X X Xw X X X X X X X X X X xvi. X X X X X X X X X X xvii X X X X X X X X X X xviii X X X X X X X X X X Xix X X X X X X X X X X XX X X X X X X X X X X XXi X X X X X X X X X X XXii X X X X X X X X X X XXiii X X X X X X X X X X xxiv. X X X X X X X X X X xxv (BMI) X X X X X X X X X X

Embodiments of the various aspects described herein Methylenetetrahydrofolate Reductase (MTHFR). relate to determination of appropriate parameters (e.g., Methylenetetrahydrofolate reductase (MTHFR) is an genotypes or expression level) of at least two of the bio enzyme that in humans is encoded by the MTHFR gene. markers (i) to (XXiv) in a test sample of a human Subject. In 35 SEQ ID NO: 1 corresponds to a portion of the genomic Some embodiments, a physical biomarker (XXV) of obesity nucleic acid sequence of human wild-type or normal indicator (e.g., BMI), as shown in Table 42, can also be MTHFR gene obtained from NCBI database (NCBI Refer measured, wherein obesity (e.g., defined by a BMI value of ence Sequence: NM_005957.4), wherein the nucleotide at at least about 30 kg/m or greater) indicates a treatment position 677 and 1298 of SEQ ID NO: 1 are normal (e.g., regimen comprising a folate-containing compound be rec 40 wild-type) “C” allele and “A” allele, respectively. Methyl ommended for and/or administered to the human Subject. As enetetrahydrofolate reductase catalyzes the conversion of shown in Table 42, any one of the folate-responsive bio 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofo markers (selected from biomarker (i) to (xxiv)) can be late, a cosubstrate for homocysteine remethylation to detected in combination with at least one other folate methionine. Genetic variation in this gene has been previ responsive biomarker as indicated by a “x” symbol in the 45 ously shown to influence Susceptibility to occlusive vascular table, including, e.g., at least two, at least three, at least four, disease, neural tube defects, colon cancer, acute leukemia, at least five, at least six, at least seven, at least eight, at least Alzheimer's or vascular dementia, and mutations in this nine, at least ten, at least eleven, at least twelve, at least gene are associated with methylenetetrahydrofolate reduc thirteen, at least fourteen, at least fifteen, at least sixteen, at tase deficiency. 50 The mutation of the MTHFR nucleotide at position 677 of least seventeen, at least eighteen, at least nineteen, at least SEQID NO: 1 from “C” allele to “Tallele (C677T) results twenty, at least twenty-one, at least twenty-two, at least in a change of amino acid residue from alanine to valine at twenty-three, at least twenty-four other folate responsive position 222 of the corresponding amino acid sequence biomarkers. By way of example only, considering column 1 (SEQ ID NO: 4). Such amino acid substitution encodes a of Table 42, a folate responsive biomarker (i) (corresponding 55 thermolabile enzyme with reduced activity. People with the to a SNP at position 27 of SEQID NO. 7 or at position 677 thermolabile form of Such enzyme generally have increased of SEQ ID NO. 1) can be detected with one or any levels of homocysteine in their blood. Accordingly, in some combinations of other folate-responsive biomarkers (ii)- embodiments, detection of an increase in levels of homo (XXV). For example, both folate-responsive biomarkers (i) cysteine in a blood sample of a Subject with patient can be and (iii) can be selected for detection in the assays, methods, 60 an indicative of a SNP at position 677 (e.g., C677T) of the systems and kits described herein. In another embodiment, MTHFR gene (or SEQ ID NO: 1). In some embodiments, a combination of three folate responsive biomarkers (i), (iii). detection of valine at position 222 (e.g., A222V) of the and (Xvii) can be selected for detection in the assays, corresponding amino acid sequence (SEQ ID NO: 4), e.g., methods, systems and kits described herein. In another by mass spectrometry, can indicate a SNP at position 677 embodiment, a combination of three folate responsive bio 65 (e.g., C677T) of the MTHFR gene (or SEQ ID NO: 1). markers (i), (iii), and (XXV) can be selected for detection in At nucleotide 1298 of the MTHFR, there are generally the assays, methods, systems and kits described herein. two possibilities: “A” or “C”. MTHFR 1298A (leading to a US 9,540,691 B2 33 34 Glu at amino acid residue 429) is the most common while Catechol-O-Methyltransferase (COMT). 1298C (leading to an Ala substitution at amino acid 429) is Catechol-O-methyltransferase is an enzyme responsible less common. In some embodiments, detection of alanine at for the breakdown of dopamine and norepinephrine, e.g., in position 429 (E429A) of the corresponding amino acid the prefrontal cortex. Met/Met are more rapid metabolizers sequence (SEQ ID NO: 4) can indicate a SNP at position than Val/Val subjects in which are associated with cognitive 1298 of the MTHFR gene (or SEQ ID NO: 1). Without dysfunction and disease pathology. In some embodiments, a wishing to be bound by theory, previous studies on human hypometholated state has led to an overexpression of COMT recombinant MTHFR have reported that the protein encoded and greater executive dysfunction. COMT polymorphism by 1298C cannot be distinguished from 1298A in terms of (identified by rS4680: SEQ ID NO. 24), an adenine-to activity, thermolability, FAD release, or the protective effect 10 guanine mutation at position 27 of SEQID NO. 24 converts of 5-methyl-THF. (See, e.g., Yamada K. et al. (2001). Proc. a valine (Val) to a methionine (Met) amino acid (Val158Met) Natl. Acad. Sci. U.S.A. 98 (26): 14853-8). It is believed that at the corresponding position of the amino acid sequence. the C mutation (e.g., A1298C) does not appear to affect the Accordingly, in some embodiments, detection of methionine MTHFR protein or result in thermolabile MTHFR, or affect at position 158 (e.g., V22M) of the corresponding amino homocysteine levels. 15 acid sequence (SEQID NO. 28), e.g., by mass spectrometry, Methods for detecting the SNPs of the MTHFR gene, e.g., can indicate a SNP at position 27 of SEQ ID NO. 24. C677T, A1298C, or G1793A are well known in the art, for examples, including the methods and primers used in U.S. Reduced Folate Carrier 1 & 2 (RCF1 and RCF2). Pat. No. 6,833.243, which is incorporated herein by refer Reduced folate carrier 1 and 2 (at SLC19A1) are receptors CCC. that transport 5-MTHF across various membranes including Methionine Synthase (MTR). the choroid plexus and blood brain barrier. Methionine synthase also known as MS, MeSe, MetH is Dopamine Receptor D2 (DRD2). an enzyme that in humans is encoded by the MTR gene Taq1B and H313H are dopamine receptor polymorphisms (5-methyltetrahydrofolate-homocysteine methyltrans that effect dopamine transmission, receptor density, and ferase). SEQ ID NO: 2 corresponds to a portion of the 25 antipsychotic response. genomic nucleic acid sequence of human wild-type or DNA (Cytosine-5)-Methyltransferase 3 Beta (DNMT3B). normal MTR gene obtained from NCBI database (NCBI Reference Sequence: NM 000254.2), wherein the nucleo DNA (cytosine-5)-methyltransferase 3 beta is s gene tide at position 2756 of SEQ ID NO: 2 is normal (e.g., encoding a DNA methyltransferase which is believed to wild-type) “A” allele. This enzyme is responsible for the 30 function in de novo methylation, rather than maintenance regeneration of methionine from homocysteine. Methionine methylation. synthase forms part of the S-adenosylmethionine (SAM) Choline Phosphate Cytidylyltransferase A (PCYT1A). biosynthesis and regeneration cycle. A polymorphism in the Choline-phosphate Cytidylyltransferase A (PCYT1A) is MTR gene, an A-to-G transition at position 2756 (e.g., an enzyme that aids in the transformation of phosphatidyl A2756G) of SEQ ID NO: 2 causes an amino acid substitu 35 choline to choline. tion from aspartic acid to glycine at codon 919 (D919G) of GTP Cyclohydrolase I (GCH1). the corresponding amino acid sequence (SEQ ID NO. 5). GTP cyclohydrolase I is part of the folate and biopterin Accordingly, in Some embodiments, detection of glycine at biosynthesis pathways. It is responsible for the hydrolysis of position 919 (e.g., D919G) of the corresponding amino acid guanosine triphosphate(GTP) to form 7,8-dihydroneopterin sequence (SEQ ID NO. 5), e.g., by mass spectrometry, can 40 indicate a SNP at position 2756 (e.g., A2756G) of the MTR 3'-triphosphate. GTPCH is encoded by the gene GCH1 and gene (or SEQ ID NO: 2). is the rate-limiting enzyme in tetrahydrobiopterin (THEB, Methionine Synthase Reductase (MTRR). BH4) biosynthesis. GCH1 is an essential cofactor in Methionine synthase reductase, also known as MSR, is an monamine synthesis and NO production. enzyme that in humans is encoded by the MTRR gene. SEQ 45 Folate Hydrolase (Prostate-Specific Membrane Antigen) ID NO: 3 corresponds to a portion of the genomic nucleic (FOLH1). acid sequence of human wild-type or normal MTRR gene FOLH1 is also known as glutamate carboxypeptidase II, obtained from NCBI database (NCBI Reference Sequence: which is an enzyme that in humans is encoded by the NM 002454.2), wherein the nucleotide at position 66 of FOLH1 (folate hydrolase 1) gene. GCPII is a class II SEQ ID NO. 3 is normal (e.g., wild-type) “A” allele. 50 membrane glycoprotein. It catalyzes the hydrolysis of Methionine is an essential amino acid required for protein N-acetylaspartylglutamate (NAAG) to glutamate and synthesis and one-carbon metabolism. Its synthesis is cata N-acetylaspartate (NAA). lyzed by the enzyme methionine synthase. Methionine Syn Dopmaine Active Transporter (DAT). thase eventually becomes inactive due to the oxidation of its The dopamine transporter (also dopamine active trans cob(I)alamin cofactor. Methionine synthase reductase 55 regenerates a functional methionine synthase via reductive porter, DAT, SLC6A3) is a membrane-spanning protein that methylation, and is a member of the ferredoxin-NADP(+) pumps the neurotransmitter dopamine out of the synapse reductase (FNR) family of electron transferases. MTRR back into cytosol, from which other transporters sequester polymorphism, an adenine-to-guanine mutation at position DA and NE into vesicles for later storage and release. 66 (e.g., A66G) of SEQID NO: 3 converts an isoleucine to 60 GTP Cyclohydrolase 1 Feedback Regulatory Protein a methionine amino acid (I22M) at position 22 of the (GCHFR). corresponding amino acid sequence (SEQ ID NO: 6). GTP cyclohydrolase 1 feedback regulatory protein is an Accordingly, in some embodiments, detection of methionine enzyme that in humans is encoded by the GCHFR gene. at position 22 (e.g., I22M) of the corresponding amino acid GTP cyclohydrolase 1 feedback regulatory protein binds to sequence (SEQ ID NO: 6), e.g., by mass spectrometry, can 65 and mediates tetrahydrobiopterin inhibition of GTP cyclo indicate a SNP at position 66 (e.g., A66G) of the MTRR hydrolase 1 which aids in the production of de novo BH4 gene (or SEQ ID NO:3). production. US 9,540,691 B2 35 36 Calcium Channel, Voltage-Dependent, L Type, Alpha 1C expression levels of 4-HNE adducts, e.g., 4-HNE-His. Com Subunit (CACNA1C). mercial ELISA kits for measuring 4-HNE adducts, e.g., Gene CACNA1C encodes an alpha-1 subunit of a volt OxiSelectTM HNE-His Adduct ELISA Kit are available, e.g., age-dependent calcium channel. Calcium channels mediate from CellBioLabs. the influx of calcium ions into the cell upon membrane Test Sample and Collection and Preparation Thereof polarization. Collections of test samples for at least one analysis Formiminotransferase Cyclodeaminase (FTCD). performed in the assays and/or methods described herein are Formiminotransferase cyclodeaminase is an enzyme that well known to those skilled in the art. In some embodiments, catalyzes the conversion of formiminoglutamate and tetra a test sample Subjected to analysis performed in the assays hydrofolate into formiminotetrahydrofolate and glutamate. 10 and/or methods described herein are derived from a biologi Methylenetetrahydrofolate Dehydrogenase (NADP+de cal sample of a subject. The term “biological sample” as pendent) 1 (MTHFD 1). used herein denotes a sample taken or isolated from a Methylenetetrahydrofolate dehydrogenase (NADP+de biological organism, e.g., cell lysate, a homogenate of a pendent) 1 is a tri-allelic gene that encodes a protein that tissue sample from a subject or a fluid sample from a Subject. possesses three distinct enzymatic activities, methylenetet 15 The term “biological sample also includes untreated or rahydrofolate dehydrogenase, methenyltetrahydrofolate pre-treated (or pre-processed) biological samples. In some cyclohydrolase and formate-tetrahydrofolate ligase. Each of embodiments, the biological sample can be a biological these activities catalyzes one of three sequential reactions in fluid, including, but not limited to, blood (including whole the interconversion of 1-carbon derivatives of tetrahydrofo blood, plasma, cord blood and serum), lactation products late, which are Substrates for methionine, thymidylate, and (e.g., milk), amniotic fluids, sputum, saliva, urine, semen, de novo purine syntheses. A common single nucleotide cerebrospinal fluid, bronchial aspirate, perspiration, mucus, polymorphism (SNP) at nucleotide 1958 of the MTHFD1 liquefied feces, synovial fluid, lymphatic fluid, tears, tra gene (or at position 27 of SEQ ID 27) causes a “G” to “A” cheal aspirate, and fractions thereof. In other embodiments, transition, which results in an arginine to glutamate Substi the biological sample can include cell lysate and fractions tution at amino acid position 653 in the synthetase domain 25 thereof. For example, cells (such as red blood cells, platelets, of the enzyme (See, e.g., Hol et al., (1998) “Molecular white blood cells and any cells circulating in the biological genetic analysis of the gene encoding the trifunctional fluid described herein) can be harvested and lysed to obtain enzyme MTHFD (methylenetetrahydrofolate-dehydroge a cell lysate. In some embodiments, a test sample or a nase, methenyltetrahydrofolate-cyclohydrolase, formyltetra biological sample is a blood sample. In some embodiments, hydrofolate synthetase) in patients with neural tube defects.” 30 a test sample or a biological sample is a plasma sample. In Clin Genet 53: 119-25). Some embodiments, a test sample or a biological sample is S-Adenosyl Methionine (SAM) and S-Adenosyl Homo a saliva sample. In some embodiments, a test sample or a cysteine (SAH). biological sample is a buccal sample. In some embodiments, S-adenosyl methionine, commonly known as SAM, or a test sample or a biological sample is a urine sample. SAM-e, or AdoMet, is a natural compound found in all 35 A “biological sample' can contain cells from subject, but living cells. It is one of the most used enzymatic Substrates the term can also refer to non-cellular biological material, in biochemical reactions, second only to the universal Such as non-cellular fractions of blood, saliva, or urine, that energy storage and transfer molecule, adenosyltriphosphate can be used to measure plasma/serum biomarker expression (ATP). levels or determine SNPs. In some embodiments, the sample S-Adenosyl methionine is a common cosubstrate 40 is from a resection, biopsy, or core needle biopsy. In involved in methyl group transfers. It is made from adenos addition, fine needle aspirate samples can be used. Samples ine triphosphate (ATP) and methionine by methionine can be either paraffin-embedded or frozen tissue. adenosyltransferase. Transmethylation, transsulfuration, and The sample can be obtained by removing a sample of cells aminopropylation are the metabolic pathways that use SAM. from a Subject, but can also be accomplished by using SAH is formed by the demethylation of S-adenosyl-L- 45 previously isolated cells (e.g. isolated by another person). In methionine (SAM). Further details about SAM and SAH. addition, the biological sample can be freshly collected or a including immunoassays for determining SAM, SAH and/or previously collected Sample. ratios thereof are described in U.S. Pat. App. No.: US In some embodiments, the test sample or the biological 2009/0263879, which is incorporated herein by reference. sample can be a frozen biological sample, e.g., a frozen 4-Hydroxynonenal (4-HNE). 50 tissue or fluid sample Such as urine, blood, serum or plasma. 4-Hydroxynonenal, or 4-hydroxy-2-nonenal or 4-HNE or The frozen sample can be thawed before employing meth HNE, (CHO), is an C, B-unsaturated hydroxyalkenal ods, assays and systems described herein. After thawing, a which is produced by lipid peroxidation in cells. 4-HNE is frozen sample can be centrifuged before being Subjected to the primary C, 3-unsaturated hydroxyalkenal formed in this methods, assays and systems described herein. process. It is found throughout animal tissue, and in higher 55 In some embodiments, a test sample or a biological quantities during oxidative stress due to the increase in the sample can be a nucleic acid product amplified after poly lipid peroxidation chain reaction, due to the increase in merase chain reaction (PCR). The nucleic acid product can stress events. 4-HNE has been believed to play a key role in include DNA, RNA and mRNA and can be isolated from a cell signal transduction, in a variety of pathways from cell particular biological sample using any of a number of cycle events to cellular adhesion. 4-HNE is also considered 60 procedures, which are well-known in the art, the particular as possible causal agents of numerous diseases, such as isolation procedure chosen being appropriate for the par chronic inflammation, neurodegenerative diseases, adult ticular biological sample. Methods of isolating and analyZ respiratory distress syndrome, atherogenesis, diabetes and ing nucleic acid variants as described above are well known different types of cancer. to one skilled in the art and can be found, for example in the Protein residues known to react with 4HNE via 1,4- 65 Molecular Cloning: A Laboratory Manual, 3rd Ed., Sam addition are Cys, His, and Lys. Thus, in some embodiments, brook and Russel, Cold Spring Harbor Laboratory Press, expression levels of 4-HNE can be determined by measuring 2001. US 9,540,691 B2 37 38 In some embodiments, the test sample or the biological can be then gently re-suspended in a buffer Such as Tyrodes sample can be treated with a chemical and/or biological buffer containing 1 U/ml PGE2 and pelleted by centrifuga reagent. Chemical and/or biological reagents can be tion again. The wash can be repeated twice in this manner employed to protect and/or maintain the stability of the before removing the membrane fraction of platelets by sample, including biomolecules (e.g., nucleic acid and pro centrifugation with Triton X, and lysing the pellet of platelet tein) therein, during processing. One exemplary reagent is a for platelet-derived PF4 analyses. Platelets can be lysed protease inhibitor, which is generally used to protect or using 50 mM Tris HCL, 100-120 mM. NaCl, 5 mM EDTA, maintain the stability of protein during processing. In addi 1% Igepal and Protease Inhibitor Tablet (complete TM tion, or alternatively, chemical and/or biological reagents mixture, Boehringer Manheim, Indianapolis, Ind.). can be employed to release nucleic acid or protein from the 10 sample. In one embodiment, platelets are separated from whole The skilled artisan is well aware of methods and processes blood and the SNPs or hsCRP transcripts can be determined appropriate for pre-processing of test or biological samples, therefrom. When whole blood is centrifuged as described e.g., blood, required for determination of SNPs or expres herein to separate the blood cells from the plasma, a pellet sion levels of serum/plasma biomarkers as described herein. 15 is formed at the end of the centrifugation, with the plasma In some embodiments, the test sample or biological above it. Centrifugation separates out the blood components sample is a blood sample, e.g., whole blood, plasma, and (RBC, WBC, and platelets) by their various densities. The serum. In some embodiments, the test sample or biological RBCs are denser and will be the first to move to the bottom sample is a whole blood sample. In some embodiments, the of the collection/centrifugation tube, followed by the smaller test sample or biological sample is a serum sample. In some white blood cells, and finally the platelets. The plasma embodiments, the test sample or biological sample is a fraction is the least dense and is found on top of the pellet. plasma sample. In some embodiments, the blood sample can The “buffy coat' which contains the majority of platelets be allowed to dry at room temperature from about 1 hour to will be sandwiched between the plasma and above the overnight, or in the refrigerator (low humidity) for up to RBCs. Centrifugation of whole blood (with anti-coagulant, several months before subjected to analysis, e.g., SNP 25 PGE and theophylline) can produce an isolated platelet rich analysis. See, for example, Ulvik A. and Ueland P. M. (2001) “buffy coat that lies just above the buoy. The buffy coat Clinical Chemistry 47: 2050, for methods of SNP genotyp contains the concentrated platelets and white blood cells. ing in unprocessed whole blood and serum by real-time In another embodiment, platelets can be separated from PCR. blood according to methods described in U.S. Pat. No. To collect a blood sample, by way of example only, the 30 4,656,035 using lectin to agglutinate the platelets in whole patient’s blood can be drawn by trained medical personnel blood. Alternatively, the methods and apparatus described in directly into anti-coagulants such as citrate, EDTAPGE, and U.S. Pat. No. 7,223,346 can be used involving a platelet theophylline. The whole blood can be separated into the collection device comprising a centrifugal spin-separator plasma portion, the cells, and platelets portion by refriger container with a cavity having a longitudinal inner Surface in ated centrifugation at 3500 g for 2 minutes. After centrifu 35 order to collect the “buffy coat enriched with platelets after gation, the Supernatant is the plasma and the pellet is RBC. centrifugation. As another alternative, the methods and Since platelets have a tendency to adhere to glass, it is apparatus as described in WO/2001/066172 can be used. preferred that the collection tube be siliconized. Another Each of these references is incorporated by reference herein. method of isolating red blood cells (RBCs) is described in In another embodiment, platelets can be isolated by the Best, C A et al., 2003, J. Lipid Research, 44:612-620. 40 two methods described in A. L. Copley and R. B. Houlihan, Alternatively, serum can be collected from the whole Blood, 1947, 2:170-181, which is incorporated by reference blood. By way of example, about 15 mL of whole blood can herein. Both methods are based on the principle that the be drawn for about 6 mL of serum. The blood can be platelet layer can be obtained by repeated fractional cen collected in a hard plastic or glass tube; blood will not clot trifugation. in soft plastic. The whole blood is allowed to stand at room 45 In some embodiments, apparatus and related methods are temperature for 30 minutes to 2 hours until a clot has used to obtain the sample, for example, machines described formed. Then, clot can be carefully separated from the sides in U.S. Pat. Nos. 4,120,448, 5,879,280 and 7,241,281, which of the container using a glass rod or wooden applicator Stick are incorporated herein by reference. and the rest of the sample can be left overnight at 4°C. After Methods for collecting different types of a test sample are which, the sample can be centrifuged, and the serum can be 50 known in the art and can be employed to prepare a test transferred into a clean tube. The serum can be clarified by sample for the assays and methods described herein. centrifugation at 1000 g for 10 minutes at 4°C. The serum SNPs, Polymorphisms and Alleles can be stored at -80° C. before analysis. In such embodi The genomes of all organisms undergo spontaneous muta ments, carotenoids may not be stable for long periods of tion in the course of their continuing evolution, generating time. Detailed described of obtaining serum using collection 55 variant forms of progenitor genetic sequences (Gusella, Ann. tubes can be found in U.S. Pat. No. 3,837,376 and is Rev. Biochem. 55, 831–854 (1986)). The coexistence of incorporated by reference. Blood collection tubes can also multiple forms of a genetic sequence gives rise to genetic be purchased from BD Diagnostic Systems, Greiner Bio polymorphisms, including SNPs. One, and Kendall Company. Approximately 90% of all polymorphisms in the human The whole blood can be first separated into platelet-rich 60 genome are SNPs. SNPs are single base positions in DNA plasma and cells (white and red blood cells). Platelet rich at which different alleles, or alternative nucleotides, exist in plasma (PRP) can be isolated from the blood centrifugation a population. The SNP position (interchangeably referred to of citrated whole blood at 200 g for 20 minutes. The platelet herein as SNP, SNP site, SNP allele or SNP locus) is usually rich plasma is then transferred to a fresh polyethylene tube. preceded by and followed by highly conserved sequences of This PRP is then centrifuged at 800 g to pellet the platelets 65 the allele (e.g., sequences that vary in less than /100 or /1000 and the supernatant (platelet poor plasma PPPI) can be members of the populations). An individual can be homozy saved for analysis, e.g., by ELISA, at a later stage. Platelets gous or heterozygous for an allele at each SNP position. A US 9,540,691 B2 39 40 SNP can, in some instances, be referred to as a “cSNP to taining compound. The SNP at the MTRR locus described denote that the nucleotide sequence containing the SNP is an herein is indicated to have two alleles, “A” or “G”. The amino acid coding sequence. presence of at least one allele “G” at position 66 of SEQID A SNP can arise from a substitution of one nucleotide for NO. 3, wherein SEQ ID NO. 3 is a portion of a genomic another at the polymorphic site. Substitutions can be tran nucleic acid sequence of methionine synthase reductase sitions or transversions. A transition is the replacement of (MTRR), indicates the subject recommended for a treatment one purine nucleotide by another purine nucleotide, or one regimen comprising a folate-containing compound. pyrimidine by another pyrimidine. A transversion is the Those skilled in the art will readily recognize that nucleic replacement of a purine by a pyrimidine, or vice versa. A acid molecules can be double-stranded molecules and that SNP can also be a single base insertion or deletion variant 10 reference to a particular site on one strand refers, as well, to referred to as an “in/del” (Weber et al., “Human diallelic the corresponding site on a complementary strand. In defin insertion/deletion polymorphisms’. Am J Hum Genet Octo ing a SNP position, SNP allele, or nucleotide sequence, ber 2002; 71(4):854-62). reference to an adenine “A”, a thymine “T” (uridine “U”), a A synonymous codon change, or silent mutation/SNP (the cytosine “C”, or a guanine “G” at a particular site on one terms "SNP and “mutation' are used herein interchange 15 Strand of a nucleic acid molecule also defines the thymine ably), is one that does not result in a change of amino acid “T” (uridine “U”), adenine “A”, guanine “G”, or cytosine due to the degeneracy of the genetic code. A substitution that “C” (respectively) at the corresponding site on a comple changes a codon coding for one amino acid to a codon mentary strand of the nucleic acid molecule. Thus, reference coding for a different amino acid (i.e., a non-synonymous can be made to either strand in order to refer to a particular codon change) is referred to as a missense mutation. A SNP position, SNP allele, or nucleotide sequence. Probes nonsense mutation results in a type of non-synonymous and primers can be designed to hybridize to either strand and codon change in which a stop codon is formed, thereby SNP genotyping methods disclosed herein can generally leading to premature termination of a polypeptide chain and target either Strand. a truncated protein. A read-through mutation is another type Accordingly, the claims are intended to cover analysis of of non-synonymous codon change that causes the destruc 25 the opposite Strand as well. For the opposite-strand analysis, tion of a stop codon, thereby resulting in an extended the SNPs at the MTHFR locus is allele “A” at position 677 polypeptide product. While SNPs can be bi-, tri-, or tetra or allele “G” at position 1298 of the complementary allelic, the vast majority of the SNPs are bi-allelic, and are sequence of SEQ ID NO. 1, wherein SEQ ID NO. 1 is a thus often referred to as “bi-allelic markers', or “di-allelic portion of a genomic nucleic acid sequence of methylenetet markers’. 30 rahydrofolate reductase (MTHFR); while the SNP at the A major database of human SNPs is maintained at NCBI MTR locus is allele “C” at position 2756 of the comple as dbSNP, and it contains data for unique human SNPs mentary sequence of SEQID NO. 2, wherein SEQID NO. consisting of 1.78x10 submitted SNP (identified by an “ss” 2 is a portion of a genomic nucleic acid sequence of number) and 5.2x107 reference SNP (identified by an “rs” methionine synthase (MTR); and the SNP at the MTRR number), as of Build History 135: human 9606 based on 35 locus is allele “C” at position 66 of the complementary NCBI human genome build 37.3. The rs numbers are sequence of SEQ ID NO. 3, wherein SEQ ID NO. 3 is a unique, do not change and allow analysis of the particularly portion of a genomic nucleic acid sequence of methionine identified SNP in any genetic sample. Throughout the speci synthase reductase (MTRR). fication, the SNPs described herein can also be identified by Identification method of SNPs can be of either a positive an “rs' number. For example, the SNP at position 677 of 40 type (inclusion of an allele) or a negative-type (exclusion of SEQ ID NO: 1 can be identified by rs 1801133; the SNP at an allele). Positive-type methods determine the identity of a position 1298 of SEQ ID NO: 1 can be identified by rs nucleotide contained in a polymorphic site, whereas nega 18.01131; the SNP at position 2756 of SEQID NO: 2 can be tive-type methods determine the identity of a nucleotide not identified by rs 1805087: The SNP at position 66 of SEQ ID present in a polymorphic site. Thus, a wild-type site can be NO: 2 can be identified by rs 1801394. With the “rs' 45 identified either as wild-type or not mutant. For example, at numbers known for each SNP, one of skill in the art will be a biallelic polymorphic site where the wild-type allele able to determine the position of a specific SNP within a contains thymine and the mutant allele contains cytosine, a respective chromosome. site can be positively determined to be either thymine or While a SNP could conceivably have three or four alleles, cytosine or negatively determined to be not thymine (and nearly all SNPs have only two alleles. Analysis of the SNPs 50 thus cytosine) or not cytosine (and thus thymine). identified herein generally relies on the two alleles that are Methods for Detecting the SNPs Disclosed Herein listed in connection with each SNP. For example, the SNPs According to one aspect described herein, a method for at the MTHFR locus described herein are each indicated to determining whether a subject is homozygous for a poly have two alleles, “C” or “T” at the position 677 of SEQ ID morphism, heterozygous for a polymorphism, or lacking the NO. 1, and “A” or “C” at the position 1298 of SEQ ID NO. 55 polymorphism altogether (i.e. homozygous wildtype) is 1, wherein SEQID NO.1 is a portion of a genomic nucleic encompassed. As an exemplary embodiment only, a method acid sequence of MTHFR. The presence of at least one allele to detect the C>T variance at position 677 of SEQ ID NO: “T” at position 677 of SEQ ID NO. 1 and/or at least one 1, a method for determining the allele, heterozygous for the allele “C” at position 1298 of SEQ ID NO. 1 indicates that C- and T-alleles, or homozygous for the C-allele or the a Subject with depression is recommended for a treatment 60 T-allele at the SNP loci are provided. Substantially any regimen comprising a folate-containing compound. The method of detecting any allele of the SNPs described herein, SNP at the MTR locus described herein is indicated to have Such as restriction enzyme digestion, allele-specific probe two alleles, “A” or “G”. The presence of at least one allele hybridization, allele-specific primer extension, allele spe “G” at position 2756 of SEQ ID NO. 2, wherein SEQ ID cific amplification, sequencing, 5' nuclease digestion, NO: 2 is a portion of a genomic nucleic acid sequence of 65 molecular beacon assay, oligonucleotide ligation assay, size methionine synthase (MTR), indicates the subject recom analysis, and single-stranded conformational polymor mended for a treatment regimen comprising a folate-con phism, can be used. US 9,540,691 B2 41 42 In one embodiment, an allelic discrimination method for plete complementarity of the probe with the target portion) identifying the genotypes of SNPs of a human described can be detected as an increase in fluorescence of the assay herein can be used. Such a method may involve the use of mixture. distinct oligonucleotide probes, for example one comple If detectably different labels are used, more than one mentary to a sequence having a major allele and another 5 labeled probe can be used. For example, the assay mixture complementary to a sequence having a minor allele. The can contain a first probe which is completely complementary allelic discrimination method also involves use of at least to the target portion of the polymorphism of the MTHFR, one, and preferably a pair of amplification primers for MTR, or MTRR gene and to which a first label is attached, amplifying a reference region of the MTHFR, MTR or and a second probe which is completely complementary to 10 the target portion of the wildtype or major allele. In some MTRR locus of a subject. The reference region includes at embodiments, by way of example only, the assay mixture least a portion of the human MTHFR, MTR or MTRR locus. can contain a first probe which is completely complementary For full-length genes and entire protein-coding sequences, to the target portion of the polymorphism of the MTHFR a SNP flanking sequence can be, for example, up to about 10 gene and to which a first label is attached, and a second Kb, 9 Kb, 8 Kb, 7 Kb, 6 Kb, 5 Kb. 4 Kb, 3 Kb, 2 Kb, 1 Kb 15 probe which is completely complementary to the target on either side of the SNP. Furthermore, in such instances, the portion of another gene, e.g., MTR or MTRR. When two isolated nucleic acid molecule comprises exonic sequences probes are used, the probes are detectably different from (including protein-coding and/or non-coding exonic each other, having, for example, detectably different size, sequences), but may also include intronic sequences. Thus, absorbance, excitation, or emission spectra, radiative emis any protein coding sequence may be either contiguous or sion properties, or the like. For example, a first probe can be separated by introns. The important point is that the nucleic completely complementary to the target portion of the acid is isolated from remote and unimportant flanking polymorphism and have FAM and TAMRA attached at or sequences and is of appropriate length Such that it can be near opposite ends thereof. The first probe can be used in the Subjected to the specific manipulations or uses described methods, assays, systems and kits described herein together herein Such as recombinant protein expression, preparation 25 with a second probe which is completely complementary to of probes and primers for assaying the SNP position. the target portion of the wildtype allele and has TET and The probe is preferably a DNA oligonucleotide having a TAMRA attached at or near opposite ends thereof. Fluores length in the range from about 20 to about 40 nucleotide cent enhancement of FAM (i.e. effected by cessation of residues, preferably from about 20 to about 30 nucleotide fluorescence quenching upon degradation of the first probe residues, and more preferably having a length of about 25 30 by Taq polymerase) can be detected at one wavelength (e.g. 518 nanometers), and fluorescent enhancement of TET (i.e. nucleotide residues. In one embodiment, the probe is ren effected by cessation of fluorescence quenching upon deg dered incapable of extension by a PCR-catalyzing enzyme radation of the second probe by Taq polymerase) can be Such as Taq polymerase, for example by having a fluorescent detected at a different wavelength (e.g. 582 nanometers). probe attached at one or both ends thereof. Although non 35 Any approach that detects mutations or polymorphisms in labeled oligonucleotide probes can be used in the kits and a gene can be used to detect the presence or absence of SNP methods described herein, the probes are preferably detect biomarkers described herein, including but not limited to ably labeled. Exemplary labels include radionuclides, light single-strand conformational polymorphism (SSCP) analy absorbing chemical moieties (e.g. dyes), fluorescent moi sis (Orita et al. (1989) Proc. Natl. Acad. Sci. USA 86:2766 eties, and the like. Preferably, the label is a fluorescent 40 2770), heteroduplex analysis (Prior et al. (1995) Hum. moiety, such as 6-carboxyfluorescein (FAM), 6-carboxy-4, Mutat. 5:263-268), oligonucleotide ligation (Nickerson et al. 7.2.7'-tetrachlorofluoroscein (TET), rhodamine, JOE (2.7- (1990) Proc. Natl. Acad. Sci. USA 87:8923-8927) and dimethoxy-4,5-dichloro-6-carboxyfluorescein), HEX hybridization assays (Conner et al. (1983) Proc. Natl. Acad. (hexachloro-6-carboxyfluorescein), or VIC. Sci. USA 80:278-282). Traditional Taq polymerase PCR In some embodiments, the probe can comprise both a 45 based strategies, such as PCR-RFLP, allele-specific ampli fluorescent label and a fluorescence-quenching moiety Such fication (ASA) (Ruano and Kidd (1989) Nucleic Acids Res. as 6-carboxy-N,N,N',N'-tetramethylrhodamine (TAMRA), 17:8392), single-molecule dilution (SMD) (Ruano et al. or 4-(4-dimethilyaminophenylazo)benzoic acid (DABCYL). (1990) Proc. Natl. Acad. Sci. USA 87:6296-6300), and When the fluorescent label and the fluorescence-quenching coupled amplification and sequencing (CAS) (Ruano and moiety are attached to the same oligonucleotide and sepa 50 Kidd (1991) Nucleic Acids Res. 19:6877-6882), are easily rated by no more than about 40 nucleotide residues, and performed and highly sensitive methods to determine hap preferably by no more than about 30 nucleotide residues, the lotypes (Michalatos-Beloin et al. (1996) Nucleic Acids Res. fluorescent intensity of the fluorescent label is diminished. 24:4841-4843; Barnes (1994) Proc. Natl. Acad. Sci. USA When one or both of the fluorescent label and the fluores 91:5695-5699: Ruano and Kidd (1991) Nucleic Acids Res. cence-quenching moiety are separated from the oligonucle 55 19:6877-6882). otide, the intensity of the fluorescent label is no longer Restriction Fragment Length Polymorphism Analysis diminished. Preferably, the probe for use in the assays, In some embodiments, restriction enzymes can be utilized methods, systems and kits described herein can have a to identify variances or a polymorphic site using “restriction fluorescent label attached at or near (i.e. within about 10 fragment length polymorphism’ (RFLP) analysis (Lentes et nucleotide residues of) one end of the probe and a fluores 60 al., Nucleic Acids Res. 16:2359 (1988); and C. K. McQuitty cence-quenching moiety attached at or near the other end. et al., Hum. Genet. 93:225 (1994)). In RFLP, at least one Degradation of the probe by a PCR-catalyzing enzyme target polynucleotide is digested with at least one restriction releases at least one of the fluorescent label and the fluo enzyme and the resulting restriction fragments are separated rescence-quenching moiety from the probe, thereby discon based on mobility in a gel. Typically, Smaller fragments tinuing fluorescence quenching and increasing the detect 65 migrate faster than larger fragments. Consequently, a target able intensity of the fluorescent labels. Thus, cleavage of the polynucleotide that contains a particular restriction enzyme probe (which, as discussed above, is correlated with com recognition site will be digested into two or more Smaller US 9,540,691 B2 43 44 fragments, which will migrate faster than a larger fragment E100). and also the GOOD Assay (Sauer S et al. Nucleic lacking the restriction enzyme site. Knowledge of the Acid Res, 2000: 28, E13 and Sauer et al, Nucleic Acid Res, nucleotide sequence of the target polynucleotide, the nature 2000; 28:E100). of the polymorphic site, and knowledge of restriction In some embodiments, variations of MALDI-TOF can be enzyme recognition sequences guide the design of Such 5 performed for analysis of variances in the genes associated assays. In another embodiment, restriction site analysis of with SNPs described herein. For example, MALDI and particular nucleotide sequence to identify a nucleotide at a electrospray ioinization (ESI) (Sauer S. Clin Chem Acta, polymorphic site is determined by the presence or absence 2006; 363; 93-105) can also be used in various aspects of a restriction enzyme site. A large number of restriction described herein. 10 Hybridization Based Genotyping (e.g., Allele-Specific enzymes are known in the art and, taken together, they are Amplification (ASA)) capable of recognizing at least one allele of many polymor Allele-specific Amplification is also known as amplifica phisms. However, Such single nucleotide polymorphisms tion refectory mutation system (ARMS) uses allele specific (SNPs) rarely result in changes in a restriction endonuclease oligonucleotides (ASO) PCR primers and is an well estab site. Thus, SNPs are rarely detectable by restriction fragment 15 lished and known PCR based method for genotyping (New length analysis. ton et al., J Med Genet, 1991: 28; 248-51). Typically, one of Ligation Based Assays (e.g., Oligonucleotide Ligation the two oligonucleotide primers used for the PCR binds to Assay) the mutation site, and amplification only takes place if the A number of approaches use DNA ligase, an enzyme that nucleotide of the mutation is present, with a mismatch being can join two adjacent oligonucleotides hybridized to a DNA refractory to amplification. The resulting PCR Products can template. In Oligonucleotide Ligation Assay (OLA) the be analyzed by any means known to persons skilled in the sequence Surrounding the mutation site is first amplified and art. In a variation of the approach, termed mutagenically one strand serves as a template for three ligation probes, two separated PCR (MS-PCR) the two ARMS primer of different of these are ASO (allele-specific oligonucleotides) and a lengths, one specific for the normal gene and one for the third common probe. Numerous approaches cane be used for 25 mutation are used, to yield PCR procures of different lengths the detection of the ligated products, for example the ASOs for the normal and mutant alleles (Rust et al. Nucl Acids with differentially labeled with fluorescent of hapten labels Res., 1993; 21; 3623-9). Subsequent gel electrophoresis, for and ligated products detected by fluorogenic of colorimetric example will show at least one of the two allelic products, enzyme-linked immunosorbent assays (To be et al. Nucleic with normal, mutant or both (heterozygote) genes. A further Acid Res, 1996; 24; 3728-32). For electrophorosis-based 30 variation of this forms the basis of the Masscode SystemTM (www.bioserve.com) which uses Small molecular weight systems, use of a morbidity modifier taqgs or variation in tags covalently attached through a photo-cleavable linker to probe length coupled with fluorescence detection enables the the ARMS primers, with each ARMS primers labeled with multiplex genotyping of several single nucleotide Substitu a tag of differing weight (Kokoris et al., 2000, 5; 329-40). A tions in a single tube (Baronet al., 1997: Clinical Chem., 43: 35 catalogue of numerous tags allows simultaneous amplifica 1984-6). When used on arrays, ASOs can be spotted at tion/genotyping (multiplexing) of 24 different targets in a specific locations or addresses on a chip, PCR amplified single PCR reaction. For any one mutation, genotyping is DNA can then be added and ligation to labeled oligonucle based on comparison of the relative abundance of the two otides at specific addresses on the array measured (Zhong et relevant mass tags by mass spectrometry. al, Proc Natl Acad Sci 2003: 100: 11559-64). 40 Normal or mutant alleles can be genotyped by measuring Single-Base Extension the binding of allele-specific oligonucleotides (ASO) Single base-extension or miniseduencing involves anneal hybridization probes. In such embodiments, two ASO ing an oligonucleotide primer to the single Strand of a PCR probes, one complementary to the normal allele and the product and the addition of a single dideoxynucleotide by other to the mutant allele are hybridized to PCR-amplified thermal DNA polymerase. The oligonucleotide is designed 45 DNA spanning the mutation site. In some embodiments, the to be one base short of the mutation site. The dideoxynucle amplified products can be immobilized on a solid Surface otide incorporated is complementary to the base at the and hybridization to radiolabelled oligonucleotides such as mutation site. Approaches can use different fluorescent tags known as a dot-blot assay. In alternative embodiments, the or haptens for each of the four different dideoxynucleotides binding of the PCR products containing a quantifiable label (Pastinen et al, Clin Chem 1996, 42; 1391-7). The dideoxy 50 (e.g., biotin or fluorescent labels) to a solid phase allele nucleotide differ in molecular weight and this is the basis for specific oligonucleotide can be measured. Alternatively, for single-base extension methods utilizing mass-spectrometry, a reverse hybridization assay, or “reverse dot-blot the and genotyping based on the mass of the extended oligo binding of PCR products containing a quantifiable label (for nucleotide primer, can be used, for example matrix-assisted example but not limited to biotin or fluorescent labels) to a laser adsorption/ionization time-of flight mass spectrometry 55 Solid phase allele-specific oligonucleotide can be measured. or MALDI-TOF (Li et al. Electrophorosis, 1999, 20; 1258 In some embodiments, the use of microarrays comprising 65), which is quantitative and can be used to calculate the hundreds of ASO immobilized onto a solid support surfaces relative allele abundance making the approach suitable for to form an array of ASO can also be used for large scale other applications such as gene dosage studies (for example genotyping of multiple single polymorphisms simultane for estimation of allele frequencies on pooled DNA 60 ously, for example Affymetrix GENECHIPR) Mapping 10K samples). Array, which can easily be performed by persons skilled in Minisequencing or Microsequencing by MALDI-TOF the art. can be performed by means known by persons skilled in the Homogenous Assays art. In a variation of the MALDI-TOF technique, some Homogenous assays, also called "closed tube' arrays, embodiments can use the Sequenom's Mass Array Technol 65 genomic DNA and all the reagents required for the ampli ogy (www.sequenom.com) (Sauser et al. Nucleic Acid Res, fication and genotyping are added simultaneously. Genotyp 2000, 28; E13 and Sauser et al, Nucleic Acid Res 2000, 28: ing can be achieved without any post-amplification process US 9,540,691 B2 45 46 ing. In some embodiments, one such homogenous assay is activity (to prevent the cleavage of ligation probes during the 5' fluorogenic nuclease assay, also known as the TAC the ligation phase), a thermostable DNA ligase as well as the MANR) Assay (Livak etal, Genet Anal, 1999; 14:143-9) and oligonucleotides for the ligation reaction. The ligation of the in alternative embodiments Melting curve analyses of FRET ASO each have a different acceptor fluorophore and the third probes are used. Such methods are carried out using “real ligation oligonucleotide which binds adjacently to the ASO time' thermocyclers, and utilize two dual-labeled ASO has a donor fluorophore. The three ligation oligonucleotides hybridization probes complementary to normal and mutant are designed to have a lower melting temperature than the alleles, where the two probes have different reported labels annealing temperature for the PCR primers in order to but a common quencher dye. In Such embodiments, the prevent their interference in PCR amplification. Following changes in fluorescence characteristics of the probes upon 10 PCR, the temperature is lowered to allow ligation to pro binding to PCR products of target genes during amplifica ceed. Ligation results in FRET between donor and acceptor tion enables “real-time monitoring of PCR amplification dyes, and alleles can be discerned by comparing the fluo and differences in affinity of the fluorogenic probes for the rescence emission of the two dyes. PCR products of normal and mutant genes enables differ Molecular Beacon Assays entiation of genotypes. The approach uses two dual-labeled 15 Further, variations of the homogenous PCR- and hybrid ASO hybridization probes complementary to the mutant and ization based techniques to detect polymorphisms can also normal alleles. The two probes have different fluorescent be used to detect the presence or absence of SNP biomarkers reported dyes but a common quencher dye. When intact, the described herein. For example, the use of Molecular Bea probes do not fluoresces due to the proximity of the reporter cons (Tyagi et al, Nat Biotech 1998; 16:49-53) and SCOR and quencher dyes. During annealing phase of PCR, two PIONR Probes (Thelwell et al, Nucleic Acid Res 2000; 28: probes compete for hybridization to their target sequences, 3752-61). Molecular Beacons are comprised of oligonucle downstream of the primer sites and are Subsequently cleaved otides that have fluorescent reporter and dyes at their 5' and by 5' nuclease activity of Thermophilis aquaticus (Taq) 3' ends, with the central portion of the oligonucleotide polymerase as the primer is extended, resulting in the hybridizing across the target sequence, but the 5' and 3' separation of the reporter dyes from the quencher. Genotyp 25 flanking regions are complementary to each other. When not ing is determined by measurement of the fluorescent inten hybridized to their target sequence, the 5' and 3' flanking sity of the two reporter dyes after PCR amplification. Thus, regions hybridize to form a stem-loop structure, and there is when intact the probes do not fluoresce due to the proximity little fluorescence because of the proximity of the reported of the quencher dyes, whereas during the annealing phase of and the quencher dyes. However, upon hybridization to their the PCR the probes compete for hybridization of the target 30 target sequence, the dyes are separated and there is a large sequences and the separation of one of the probes from the increase in the fluorescence. Mismatched probe-target quencher which can be detected. hybrids dissociate at substantially lower temperatures than Melting-Curve of FRET Hybridization exactly matched complementary hybrids. There are a num Melting-curve analysis of FRET hybridization is another ber of variations of the “molecular Beacon' approach. In approach that can be used to detect the presence or absence 35 some embodiments, such a variation includes use of SCOR of SNP biomarkers described herein. Briefly, the reaction PIONR Probes which are similar but incorporate a PCR includes two oligonucleotide probes which when in close primer sequence as part of the probe (Thelwell et al. Nucleic proximity forms a fluorescent complex, where one probe Acid Res 2000: 28; 375261). In another variation, “duplex often termed the “mutant sensor probe is designed to format gives a better fluorescent signal (Solinas et al. specifically hybridize across the mutation site and the other 40 Nucleic Acid Res, 2001, 29; E96). probe (often referred to as the “anchor probe') hybridizes to In another embodiment, polymorphisms can be detected an adjacent site. Fluorescent light is emitted by the “donor by genotyping using a homogenous or real-time analysis on excites the “acceptor fluorophore creasing a unique fluo whole blood samples, without the need for DNA extraction rogenic complex, which only forms when the probes bind to or real-time PCR. Such a method is compatible with FRET adjacent sites on the amplified DNA. The “sensor probe is 45 and TAQMANR) (Castley et al. Clin Chem, 2005; 51: complementary to either the normal or the mutant allele. 2025-30) enabling extremely rapid screening for the par Once PCR is complete, heating of the sample through the ticular polymorphism of interest. melting temperatures of the probe yields a fluorescent tem Fluorescent Polarization (FP) perature curve which differs for the mutant and normal In FP, the degree to which the emitted light remains allele. 50 polarized in a particular plane is proportional to the speed at A variation of the FRET hybridization method is the which the molecules rotate and tumble in solution. Under LCGREENTM method, which obviates the requirement for constant pressure, temperature and Viscosity, FP is directly fluorescent labeled probes altogether. LCGREENTM is a related to the molecular weight of a fluorescent species. sensitive highly fluorogenic double-stranded DNA (dsDNA) Therefore, when a small fluorescent molecule is incorpo binding dye that is used to detect the dissociation of unla 55 rated into a larger molecule, there is an increase in FP. FP can belled probes (Liew etal, Clin Chem, 2004: 50: 1156-64 and be used in for genotyping of polymorphisms of interest Zhou et al. Clin Chem, 2005; 51; 1761 2). The method uses (Chen et al. Genome Res, 1999; 9: 492-8 and Latif et al., unlabeled allele-specific oligonucleotides probes that are Genome Res, 2001; 11; 436-40). FP can be utilized in 5' perfectly complementary either to the mutant or normal nuclease assay (as described above), where the oligonucle allele, and the mismatch of the ASO/template double strand 60 otide probe is digested to a lower molecule weight species, DNA complex results in a lower melting temperature and an for example is amenable to analysis by FP, but with the earlier reduction in fluorescent signal form the dsDNA added benefit of not requiring a quencher. For example, binding dye with increasing temperature. Perkin-Elmers AcycloPrimeTM-FPSNP Detection Kit can be The OLA can also be performed by the use of FRET used as a FP minisequencing method. Following PCR ampli probes (Chen et al. Genome Res, 1998; 8: 549-56). In such 65 fication, unicoportated primers and nucleotides are degraded an embodiment, the PCR/ligation mix contains PCR prim enzymatically, the enzymes heat inactivated and a minise ers, a thermostable DNA polymerase without 5' exonuclease quencing reaction using DNA polymerase and fluorescent US 9,540,691 B2 47 48 labeled dideoxynucleotides performed. FP is then measured, CLEAVASER enzyme. The enzyme then cuts one of the typically in a 96- to 386-well plate format on a FP-plate probes to release a short DNA “flap. Each released flap reader. binds to a fluorescently-labeled probe and forms another Pyrosequencing cleavage structure. When the CLEAVASER enzyme cuts the In some embodiments, the primer extension reaction and 5 labeled probe, the probe emits a detectable fluorescence analysis is performed using PYROSEQUENCINGTM signal. (Uppsala, Sweden) which essentially is sequencing by Syn Mutations or polymorphisms can also be detected using thesis. A sequencing primer, designed directly next to the allele-specific hybridization followed by a MALDI-TOF nucleic acid differing between the disease-causing mutation and the normal allele or the different SNP alleles is first 10 MS detection of the different hybridization products. In the hybridized to a single stranded, PCR amplified DNA tem preferred embodiment, the detection of the enhanced or plate from the individual, and incubated with the enzymes, amplified nucleic acids representing the different alleles is DNA polymerase, ATP sulfurylase, luciferase and apyrase, performed using matrix-assisted laser desorption ionization/ and the substrates, adenosine 5' phosphosulfate (APS) and time-of-flight (MALDI-TOF) mass spectrometric (MS) luciferin. One of four deoxynucleotide triphosphates 15 analysis described in the Examples below. This method (dNTP), for example, corresponding to the nucleotide pres differentiates the alleles based on their different mass and ent in the mutation or polymorphism, is then added to the can be applied to analyze the products from the various reaction. DNA polymerase catalyzes the incorporation of the above-described primer-extension methods or the dNTP into the standard DNA strand. Each incorporation INVADER(R) process. event is accompanied by release of pyrophosphate (PPi) in 20 Gel Migration-Based Methods (e.g., Single Stranded Con a quantity equimolar to the amount of incorporated nucleo formation Polymorphism) tide. Consequently, ATP sulfurylase converts PPi to ATP in In other embodiments, alterations in electrophoretic the presence of adenosine 5' phosphosulfate. This ATP mobility are used to identify the particular allelic variant. drives the luciferase-mediated conversion of luciferin to For example, single strand conformation polymorphism oxyluciferin that generates visible light in amounts that are 25 (SSCP) can be used to detect differences in electrophoretic proportional to the amount of ATP. The light produced in the mobility between mutant and wild type nucleic acids (Orita luciferase-catalyzed reaction is detected by a charge coupled et al. (1989) Proc Natl. Acad. Sol USA 86:2766; Cotton device (CCD) camera and seen as a peak in a PYRO (1993) Mutat. Res. 285:125-144 and Hayashi (1992) Genet GRAMTM. Each light signal is proportional to the number of Anal Tech Appl 9:73-79). Single-stranded DNA fragments nucleotides incorporated and allows a clear determination of 30 of sample and control nucleic acids are denatured and the presence or absence of for example, the mutation or allowed to renature. The secondary structure of single polymorphism. Thereafter, apyrase, a nucleotide degrading stranded nucleic acids varies according to the sequence, the enzyme, continuously degrades unincorporated dNTPs and resulting alteration in electrophoretic mobility enables the excess ATP. When degradation is complete, another dNTP is detection of even a single base change. Alterations in the added which corresponds to the dNTP present in for 35 mobility of the resultant products are thus indicative of a example the selected SNP. Addition of dNTPs is performed base change. Suitable controls and knowledge of the “nor one at a time. Deoxyadenosine alfa-thio triphosphate mal migration patterns of the wild-type alleles can be used (dATPS) is used as a substitute for the natural deoxyade to identify polymorphic variants. The DNA fragments can be nosine triphosphate (dATP) since it is efficiently used by the labeled or detected with labeled probes. The sensitivity of DNA polymerase, but not recognized by the luciferase. For 40 the assay can be enhanced by using RNA (rather than DNA), detailed information about reaction conditions for the in which the secondary structure is more sensitive to a PYROSEQUENCING, see, e.g. U.S. Pat. No. 6,210,891, change in sequence. In another preferred embodiment, the which is incorporated herein by reference. Subject method utilizes heteroduplex analysis to separate INVADER(R) Assay double stranded heteroduplex molecules on the basis of Alternatively, an INVADER(R) assay can be used (Third 45 changes in electrophoretic mobility (Keen et al. (1991) Wave Technologies, Inc (Madison, Wis.)). This assay is Trends Genet. 7:5). generally based upon a structure-specific nuclease activity of In yet another embodiment, the identity of the allelic a variety of enzymes, which are used to cleave a target variant is obtained by analyzing the movement of a nucleic dependent cleavage structure, thereby indicating the pres acid comprising the polymorphic region in polyacrylamide ence of specific nucleic acid sequences or specific variations 50 gels containing a gradient of denaturant, which is assayed thereof in a sample (see, e.g. U.S. Pat. No. 6,458,535). For using denaturing gradient gel electrophoresis (DGGE) (My example, an INVADER(R) operating system (OS), provides a ers et al. (1985) Nature 313:495). When DGGE is used as the method for detecting and quantifying DNA and RNA. The method of analysis, DNA will be modified to insure that it INVADER(R) OS is based on a “perfect match' enzyme does not completely denature, for example by adding a GC substrate reaction. The INVADERR OS uses proprietary 55 clamp of approximately 40 bp of high-melting GC rich DNA CLEAVASER enzymes (Third Wave Technologies, Inc by PCR. In a further embodiment, a temperature gradient is (Madison, Wis.)), which recognize and cut only the specific used in place of a denaturing agent gradient to identify structure formed during the INVADER(R) process which differences in the mobility of control and sample DNA structure differs between the different alleles selected for (Rosenbaum and Reissner (1987) Biophys Chem 265:1275). detection, i.e. the disease-causing allele and the normal 60 Other Assays allele as well as between the different selected SNPs Unlike Other methods for genetic screening can be used to detect the PCR-based methods, the INVADER(R) OS relies on the presence or absence of any of the SNP biomarkers linear amplification of the signal generated by the described herein, for example, to detect mutations in INVADER(R) process, rather than on exponential amplifica genomic DNA, cDNA and/or RNA samples. Methods com tion of the target. 65 monly used, or newly developed or methods yet unknown In the INVADERR) process, two short DNA probes are encompassed for use in detection of the presence or hybridize to the target to form a structure recognized by the absence of any of the SNP biomarkers described herein. US 9,540,691 B2 49 50 Examples of newly discovered methods include for types inferred using mathematical approaches (e.g., Clark’s example, but are not limited to: SNP mapping (Davis et al. algorithm (Clark (1990) Mol. Biol. Evol. 7:111-122). Methods Mol Biology, 2006: 351; 75-92): Nanogen Nano For example, methods including complementary DNA Chip, (keen-Kim et al., 2006: Expert Rev Mol Diagnostic. 6; (cDNA) arrays (Shalon et al., Genome Research 6(7):639 287-294); Rolling circle amplification (RCA) combined 5 45, 1996; Bernard et al., Nucleic Acids Research 24(8): with circularable oligonucleotide probes (c-probes) for the 1435-42, 1996), Solid-phase mini-sequencing technique detection of nucleic acids (Zhang et al., 2006: 363; 61-70), (U.S. Pat. No. 6,013,431, Suomalainen et al. Mol. Biotech luminex XMAP system for detecting multiple SNPs in a nol. June; 15(2):123-31, 2000), ion-pair high-performance single reaction vessel (Dunbar SA, Clin Chim Acta, 2006; liquid chromatography (Doris et al. J. Chromatogr. A can 8: 363; 71-82; Dunbar et al, Methods Mol Med, 2005; 114: 10 147-1471) and enzymatic mutation detection methods (Ye 806(1):47-60, 1998), and 5' nuclease assay or real-time ung et al, Biotechniques, 2005; 38: 749-758). RT-PCR (Holland et al. Proc Natl Acad Sci USA 88: In one embodiment, one method of Screening for point 7276-7280, 1991), or primer extension methods described in mutations is based on RNase cleavage of base pair mis the U.S. Pat. No. 6,355,433, can be used. matches in RNA/DNA or RNA/RNA heteroduplexes. As 15 Another method to detect mutations or polymorphisms is used herein, the term “mismatch’ is defined as a region of by using fluorescence tagged dNTP/ddNTPs. In addition to one or more unpaired or mispaired nucleotides in a double use of the fluorescent label in the Solid phase mini-sequenc stranded RNA/RNA, RNA/DNA or DNA/DNA molecule. ing method, a standard nucleic acid sequencing gel can be This definition thus includes mismatches due to insertion/ used to detect the fluorescent label incorporated into the deletion mutations, as well as single or multiple base point 20 PCR amplification product. A sequencing primer is designed mutations. to anneal next to the base differentiating the disease-causing In Such embodiments, protection from cleavage agents and normal allele or the selected SNP alleles. A primer (such as a nuclease, hydroxylamine or osmium tetroxide and extension reaction is performed using chain terminating with piperidine) can be used to detect mismatched bases in dideoxyribonucleoside triphosphates (ddNTPs) labeled with RNA/RNA DNA/DNA, or RNA/DNA heteroduplexes (see, 25 a fluorescent dye, one label attached to the ddNTP to be e.g., Myers et al. (1985) Science 230:1242). In general, the added to the standard nucleic acid and another to the ddNTP technique of "mismatch cleavage' starts by providing het to be added to the target nucleic acid. eroduplexes formed by hybridizing a control nucleic acid, Others have described using the MutS protein or other which is optionally labeled, e.g., RNA or DNA, comprising DNA-repair enzymes for detection of single-base mis a nucleotide sequence of the allelic variant of the gene of 30 matches. Alternative methods for detection of deletion, interest with a sample nucleic acid, e.g., RNA or DNA, insertion or Substitution mutations that can be used in the obtained from a tissue sample. The double-stranded practice of various aspects described herein are disclosed in duplexes are treated with an agent which cleaves single U.S. Pat. Nos. 5,849,483, 5,851,770, 5,866,337, 5,925,525 Stranded regions of the duplex Such as duplexes formed and 5,928,870, each of which is incorporated herein by based on basepair mismatches between the control and 35 reference. sample strands. For instance, RNA/DNA duplexes can be In another embodiment, multiplex PCR procedures using treated with RNase and DNA/DNA hybrids treated with 51 allele-specific primers can be used to simultaneously nuclease to enzymatically digest the mismatched regions. In amplify multiple regions of a target nucleic acid (PCT other embodiments, either DNA/DNA or RNA/DNA Application WO89/10414), enabling amplification only if a duplexes can be treated with hydroxylamine or osmium 40 particular allele is present in a sample. Other embodiments tetroxide and with piperidine in order to digest mismatched using alternative primer-guided nucleotide incorporation regions. After digestion of the mismatched regions, the procedures for assaying polymorphic sites in DNA can be resulting material is then separated by size on denaturing used, and have been described (Komher, J. S. et al., Nucl. polyacrylamide gels to determine whether the control and Acids. Res. 17:7779-7784 (1989); Sokolov, B. P. Nucl. sample nucleic acids have an identical nucleotide sequence 45 Acids Res. 18:3671 (1990); Syvanen, A.-C., et al., Genom or in which nucleotides they are different. See, for example, ics 8:684-692 (1990); Kuppuswamy, M. N. et al., Proc. Nad. U.S. Pat. No. 6,455.249, Cotton et al. (1988) Proc. Natl. Acad. Sci. (U.S.A) 88:1143-1147 (1991); Bajaj et al. (U.S. Acad. Sci. USA 85.4397; Saleeba et al. (1992) Methods Pat. No. 5,846,710); Prezant, T. R. et al., Hum Mutat. 1: Enzy. 217:286-295. In another embodiment, the control or 159-164 (1992); Ugozzoli, L. et al., GATA 9:107-112 47 sample nucleic acid is labeled for detection. 50 (1992); Nyrón, P. et al., Anal. Biochem. 208:171-175 U.S. Pat. No. 4,946,773 describes an RNaseA mismatch (1993)). cleavage assay that involves annealing single-stranded DNA Other known nucleic acid amplification procedures or RNA test samples to an RNA probe, and subsequent include transcription-based amplification systems (Malek, treatment of the nucleic acid duplexes with RNaseA. For the L. T. et al., U.S. Pat. No. 5,130.238; Davey, C. et al., detection of mismatches, the single-stranded products of the 55 European Patent Application 329,822; Schuster et al.) U.S. RNaseA treatment, electrophoretically separated according Pat. No. 5,169,766; Miller, H. I. et al., PCT-Application to size, are compared to similarly treated control duplexes. WO89/06700; Kwoh, D. et al., Proc. Natl. Acad. Sci. Samples containing Smaller fragments (cleavage products) (U.S.A) 86: 1173 Z1989); Gingeras, T. R. et al., PCT Appli not seen in the control duplex are scored as positive. The use cation WO88/10315)), or isothermal amplification methods of RNasel for mismatch detection is also described in 60 (Walker, G. T. et al., Proc. Natl. 4cad Sci. (U.S.A) 89:392 literature from Promega Biotech. Promega markets a kit 396 (1992)) can also be used. containing RNasel that is reported to cleave three out of four Another method to determine genetic variation is using known mismatches. 'gene chips. The use of microarrays comprising a multi In one embodiment, a long-range PCR (LR-PCR) is used plicity of sequences is becoming increasingly common in to detect mutations or polymorphisms. LR-PCR products are 65 the art. Accordingly, a microarray having at least one oli genotyped for mutations or polymorphisms using any geno gonucleotide probe, as described above, appended thereon, typing methods known to one skilled in the art, and haplo can be used for SNP genotyping to interrogate the presence US 9,540,691 B2 51 52 or absence of at least one SNP described herein and/or molecules having at least one antigen binding determinant additional alleles associated with responsiveness to a folate derived from an antibody molecule. In some embodiments, containing compound. the antibody-based binding moiety can be detectably Probes can be affixed to surfaces for use as “gene chips.” labeled. Such gene chips can be used to detect genetic variations by 5 “Labeled antibody', as used herein, includes antibodies a number of techniques known to one of skill in the art. In that are labeled by a detectable means and include, but are one technique, oligonucleotides are arrayed on a gene chip not limited to, antibodies that are enzymatically, radioac for determining the DNA sequence of a by the sequencing by tively, fluorescently, and chemiluminescently labeled. Anti hybridization approach, such as that outlined in U.S. Pat. bodies can also be labeled with a detectable tag, such as Nos. 6,025,136 and 6,018,041. The probes can also be used 10 c-Myc, HA, VSV-G, HSV, FLAG, V5, or HIS. The detection for fluorescent detection of a genetic sequence. Such tech and quantification of the serum/plasma proteins (e.g., SAM, niques have been described, for example, in U.S. Pat. Nos. SAH, 4-HNE and/or hsCRP) in test samples correlate to the 5,968,740 and 5,858,659. A probe also can be affixed to an intensity of the signal emitted from the detectably labeled electrode surface for the electrochemical detection of antibody. nucleic acid sequences such as described by Kayyem et al. 15 In some embodiments, the antibody-based binding moiety U.S. Pat. No. 5,952,172 and by Kelley, S. O. et al. (1999) can be detectably labeled by linking the antibody to an Nucleic Acids Res. 27:4830-4837. enzyme. The enzyme, in turn, when exposed to its Substrate, Examples of identifying polymorphisms and applying will react with the Substrate in Such a manner as to produce that information in a way that yields useful information a chemical moiety which can be detected, for example, by regarding patients can be found, for example, in U.S. Pat. spectrophotometric, fluorometric or by visual means. No. 6,472,157: U.S. Patent Application Publications Enzymes which can be used to detectably label the antibod 20020016293, 200300.99960, 20040203034; WO 0180896, ies against the serum/plasma proteins (e.g., SAM, SAH. all of which are hereby incorporated by reference. 4-HNE and/or hsCRP) can include, but are not limited to, Determination of Expression Levels of Serum/Plasma Bio malate dehydrogenase, staphylococcal nuclease, delta-V- markers (e.g., SAM, SAH, 4-HNE, hsCRP) 25 steroid isomerase, yeast alcohol dehydrogenase, alpha-glyc At least one of serum/plasma biomarkers as described erophosphate dehydrogenase, triose phosphate isomerase, herein (e.g., SAM, SAH, 4-HNE, and/or hsCRP) can be horseradish peroxidase, alkaline phosphatase, asparaginase, measured according to methods to one skilled in the art. In glucose oxidase, beta-galactosidase, ribonuclease, urease, Some embodiments, expression levels of serum/plasma bio catalase, glucose-VI-phosphate dehydrogenase, glucoamy markers (e.g., SAM, SAH, 4-HNE and/or hsCRP) can be 30 lase and acetylcholinesterase. determined by measuring protein levels. In some embodi Detection can also be accomplished using any of a variety ments, expression levels of serum/plasma biomarkers (e.g., of other immunoassays. For example, by radioactively label hsCRP) can be determined by measuring mRNA levels. ing an antibody, it is possible to detect the antibody through Determining Expression Level by Measuring Protein: the use of radioimmune assays. The radioactive isotope can By way of example only, the levels of serum/plasma 35 be detected by Such means as the use of a gamma counter or biomarkers (e.g., SAM, SAH, 4-HNE and/or hsCRP) can be a Scintillation counter or by autoradiography. Isotopes which measured by contacting a test sample with an antibody are particularly useful for the purpose of detection are H. based binding moiety that specifically binds to at least one 13 II, 35s, 14C, and I. of the serum/plasma biomarkers described herein, or to a It is also possible to label an antibody with a fluorescent fragment thereof. Formation of the antibody-protein com 40 compound. When the fluorescently labeled antibody is plex is then detected by a variety of methods known in the exposed to light of the proper wavelength, its presence can art. then be detected due to fluorescence. Examples of the most The term “antibody-based binding moiety' or “antibody” commonly used fluorescent labeling compounds include, but can include immunoglobulin molecules and immunologi not limited to, CYE dyes, fluorescein isothiocyanate, rhod cally active determinants of immunoglobulin molecules, 45 amine, phycoerytherin, phycocyanin, allophycocyanin, e.g., molecules that contain an antigen binding site which o-phthaldehyde and fluorescamine. specifically binds (immunoreacts with) to the serum/plasma An antibody can also be detectably labeled using fluo proteins (e.g., SAM, SAH, 4-HNE and/or hsCRP). The term rescence emitting metals such as "Eu, or others of the “antibody-based binding moiety' is intended to include lanthanide series. These metals can be attached to the whole antibodies, e.g., of any isotype (IgG, IgA, IgM, IgE, 50 antibody using such metal chelating groups as diethylen etc), and includes fragments thereof which are also specifi etriaminepentaacetic acid (DTPA) or ethylenediaminetet cally reactive with the serum/plasma proteins (e.g., SAM, raacetic acid (EDTA). SAH, 4-HNE and/or hsCRP). Antibodies can be fragmented An antibody also can be detectably labeled by coupling it using conventional techniques. Thus, the term includes to a chemiluminescent compound. The presence of the segments of proteolytically-cleaved or recombinantly-pre 55 chemiluminescent-antibody is then determined by detecting pared portions of an antibody molecule that are capable of the presence of luminescence that arises during the course of selectively reacting with a certain protein. Non-limiting a chemical reaction. Examples of chemiluminescent labeling examples of Such proteolytic and/or recombinant fragments compounds can include, but not limited to, luminol, include Fab, F(ab')2, Fab'. Fv, dAbs and single chain anti luciferin, isoluminol, theromatic acridinium ester, imida bodies (sclv) containing a VL and VH domain joined by a 60 Zole, acridinium salt and oxalate ester. peptide linker. The scFv's can be covalently or non-cova Without limitations, levels of the serum/plasma proteins lently linked to form antibodies having two or more binding (e.g., SAM, SAH, 4-HNE and/or hsCRP) can be detected by sites. Thus, “antibody-base binding moiety' includes poly immunoassays, such as enzyme linked immunoabsorbant clonal, monoclonal, or other purified preparations of anti assay (ELISA), radioimmunoassay (RIA), Immunoradio bodies and recombinant antibodies. The term “antibody 65 metric assay (IRMA), Western blotting, immunocytochem base binding moiety' is further intended to include istry or immunohistochemistry, each of which are described humanized antibodies, bispecific antibodies, and chimeric in more detail below. In some embodiments, immunoassays US 9,540,691 B2 53 54 such as ELISA or RIA can be used for determining expres body to the antigen. To ensure competitive binding between sion levels of the serum/plasma proteins (e.g., SAM, SAH, the labeled antigen and the unlabeled antigen, the labeled 4-HNE and/or hsCRP). Antibody arrays or protein chips can antigen is present in a concentration Sufficient to saturate the also be employed, see for example U.S. Patent Application binding sites of the antibody. The higher the concentration of Nos: 2003/0013208A1: 2002/0155493A1; 2003/0017515 5 antigen in the sample, the lower the concentration of labeled and U.S. Pat. Nos. 6,329,209; 6,365,418, which are herein antigen that will bind to the antibody. incorporated by reference. Commercially available antibod In a radioimmunoassay, to determine the concentration of ies and/or immunoassays (such as ELISA) for detecting the labeled antigen bound to antibody, the antigen-antibody serum/plasma proteins (e.g., SAM, SAH, 4-HNE and/or complex must be separated from the free antigen. One hsCRP), e.g., from Cell BioLabs, Abcam, Novus Biologi 10 method for separating the antigen-antibody complex from cals, and Thermo Scientific Pierce Antibodies, can be used the free antigen is by precipitating the antigen-antibody in the assays and/or methods described herein. Immunoassays: complex with an anti-isotype antiserum. Another method for separating the antigen-antibody complex from the free anti The most common enzyme immunoassay is the “Enzyme gen is by performing a "solid-phase radioimmunoassay” Linked Immunosorbent Assay (ELISA).” ELISA is a tech 15 nique for detecting and measuring the concentration of an where the antibody is linked (e.g., covalently) to Sepharose antigen using a labeled (e.g. enzyme linked) form of the beads, polystyrene wells, polyvinylchloride wells, or micro antibody. There are different forms of ELISA, which are titer wells. By comparing the concentration of labeled anti well known to those skilled in the art. The standard tech gen bound to antibody to a standard curve based on Samples niques known in the art for ELISA are described in “Meth having a known concentration of antigen, the concentration ods in Immunodiagnosis, 2nd Edition, Rose and Bigazzi, of antigen in the biological sample can be determined. eds. John Wiley & Sons, 1980; Campbell et al., “Methods An “Immunoradiometric assay” (IRMA) is an immuno and Immunology”. W. A. Benjamin, Inc., 1964; and Oeller assay in which the antibody reagent is radioactively labeled. ich, M. 1984, J. Clin. Chem. Clin. Biochem., 22:895-904. An IRMA requires the production of a multivalent antigen In a “sandwich ELISA, an antibody (e.g. anti-enzyme) is 25 conjugate, by techniques such as conjugation to a protein linked to a solid phase (i.e. a microtiter plate) and exposed e.g., rabbit serum albumin (RSA). The multivalent antigen to a biological sample containing antigen (e.g. enzyme). The conjugate must have at least 2 antigen residues per molecule Solid phase is then washed to remove unbound antigen. A and the antigen residues must be of Sufficient distance apart labeled antibody (e.g. enzyme linked) is then bound to the to allow binding by at least two antibodies to the antigen. For bound-antigen (if present) forming an antibody-antigen 30 antibody sandwich. Examples of enzymes that can be linked example, in an IRMA the multivalent antigen conjugate can to the antibody are alkaline phosphatase, horseradish per be attached to a solid surface such as a plastic sphere. oxidase, luciferase, urease, and B-galactosidase. The Unlabeled “sample' antigen and antibody to antigen which enzyme linked antibody reacts with a Substrate to generate is radioactively labeled are added to a test tube containing a colored reaction product that can be measured. 35 the multivalent antigen conjugate coated sphere. The antigen In a “competitive ELISA', antibody is incubated with a in the sample competes with the multivalent antigen conju sample containing antigen (i.e. enzyme). The antigen-anti gate for antigen antibody binding sites. After an appropriate body mixture is then contacted with a solid phase (e.g. a incubation period, the unbound reactants are removed by microtiter plate) that is coated with antigen (i.e., enzyme). washing and the amount of radioactivity on the solid phase The more antigen present in the sample, the less free 40 is determined. The amount of bound radioactive antibody is antibody that will be available to bind to the solid phase. A inversely proportional to the concentration of antigen in the labeled (e.g., enzyme linked) secondary antibody is then sample. added to the solid phase to determine the amount of primary In some embodiments, Western blotting (Towbin et at. antibody bound to the solid phase. Proc. Nat. Acad. Sci. 76:4350 (1979)) can be used to In an “immunohistochemistry assay’ a test sample is 45 measure expression levels of the serum/plasma proteins tested for specific proteins by exposing the test sample to (e.g., SAM, SAH, 4-HNE and/or hsCRP, wherein a suitably antibodies that are specific for the protein that is being treated sample is run on an SDS-PAGE gel before being assayed. The antibodies are then visualized by any of a transferred to a solid Support, Such as a nitrocellulose filter. number of methods to determine the presence and amount of Detectably labeled anti-enzyme antibodies can then be used the protein present. Examples of methods used to visualize 50 to assess enzyme levels, where the intensity of the signal antibodies are, for example, through enzymes linked to the from the detectable label corresponds to the amount of antibodies (e.g., luciferase, alkaline phosphatase, horserad enzyme present. Levels can be quantified, for example by ish peroxidase, or beta-galactosidase), or chemical methods densitometry. (e.g., DAB/Substrate chromagen). The sample is then ana In addition to immunoassays, the expression level of at lysed microscopically, for example, by light microscopy of 55 least one of the serum/plasma biomarkers can be determined a sample stained with a stain that is detected in the visible by mass spectrometry such as MALDI/TOF (time-of-flight), spectrum, using any of a variety of Such staining methods SELDI/TOF, liquid chromatography-mass spectrometry and reagents known to those skilled in the art. (LC-MS), gas chromatography-mass spectrometry (GC Alternatively, “Radioimmunoassays’ can be employed. A MS), high performance liquid chromatography-mass spec radioimmunoassay is a technique for detecting and measur 60 trometry (HPLC-MS), capillary electrophoresis-mass spec ing the concentration of an antigen using a labeled (e.g. trometry, nuclear magnetic resonance spectrometry, or radioactively or fluorescently labeled) form of the antigen. tandem mass spectrometry (e.g., MS/MS, MS/MS/MS, ESI Examples of radioactive labels for antigens include H. ''C, MS/MS, etc.). See for example, U.S. Patent Application and 'I. The concentration of antigen enzyme in a test Nos: 20030199001, 20030134304, 20030077616, which are sample or a biological sample can be measured by having 65 herein incorporated by reference. Mass spectrometry meth the antigen in the biological sample compete with the ods are well known in the art and have been used to quantify labeled (e.g. radioactively) antigen for binding to an anti and/or identify molecules (see, e.g., Li et al. (2000) Tibtech US 9,540,691 B2 55 56 18:151-160; Rowley et al. (2000) Methods 20:383-397; and initially determined by those of ordinary skill in the art, and Kuster and Mann (1998) Curr. Opin. Structural Biol. 8: control (for example, beta-actin) primers and probes can be 393-400). obtained commercially from, for example, Perkin Elmer/ In certain embodiments, a gas phase ion spectrophotom Applied Biosystems (Foster City, Calif.). To quantitate the eter is used. In other embodiments, laser-desorption/ioniza amount of the specific nucleic acid of interest in a sample, tion mass spectrometry is used to analyze the sample. a standard curve is generated using a control. Standard Modern laser desorption/ionization mass spectrometry curves can be generated using the Ct values determined in (“LDI-MS) can be practiced in two main variations: matrix the real-time PCR, which are related to the initial concen assisted laser desorption/ionization ("MALDI) mass spec tration of the nucleic acid of interest used in the assay. trometry and Surface-enhanced laser desorption/ionization 10 Standard dilutions ranging from 10'-10 copies of the gene (“SELDI). In MALDI, the analyte is mixed with a solution of interest are generally sufficient. In addition, a standard containing a matrix, and a drop of the liquid is placed on the curve is generated for the control sequence. This permits Surface of a Substrate. The matrix solution then co-crystal standardization of initial content of the nucleic acid of lizes with the biological molecules. The substrate is inserted interest in a test sample to the amount of control for into the mass spectrometer. Laser energy is directed to the 15 comparison purposes. substrate surface where it desorbs and ionizes the biological Methods of real-time quantitative PCR using TaqMan molecules without significantly fragmenting them. See, e.g., probes are well known in the art. Detailed protocols for U.S. Pat. No. 5,118,937 (Hillenkamp et al.), and U.S. Pat. real-time quantitative PCR are provided, for example, for No. 5,045,694 (Beavis & Chait). RNA in: Gibson et al., 1996. A novel method for real time In SELDI, the substrate surface is modified so that it is an quantitative RT-PCR. Genome Res., 10:995-1001; and for active participant in the desorption process. In one variant, DNA in: Heid et al., 1996, Real time quantitative PCR. the surface is derivatized with adsorbent and/or capture Genome Res., 10:986-994. reagents that selectively bind the protein of interest. In The TaqMan based assays use a fluorogenic oligonucle another variant, the Surface is derivatized with energy otide probe that contains a 5' fluorescent dye and a 3' absorbing molecules that are not desorbed when struck with 25 quenching agent. The probe hybridizes to a PCR product, the laser. In another variant, the surface is derivatized with but cannot itself be extended due to a blocking agent at the molecules that bind the protein of interest and that contain 3' end. When the PCR product is amplified in subsequent a photolytic bond that is broken upon application of the cycles, the 5' nuclease activity of the polymerase, for laser. In each of these methods, the derivatizing agent example, AmpliTaq, results in the cleavage of the TaqMan generally is localized to a specific location on the Substrate 30 probe. This cleavage separates the 5' fluorescent dye and the surface where the sample is applied. See, e.g., U.S. Pat. No. 3' quenching agent, thereby resulting in an increase in 5,719,060 and WO 98/59361. The two methods can be fluorescence as a function of amplification (see, for example, combined by, for example, using a SELDI affinity surface to Perkin-Elmer). capture an analyte and adding matrix-containing liquid to In another embodiment, detection of RNA transcripts can the captured analyte to provide the energy absorbing mate 35 be achieved by Northern blotting, wherein a preparation of rial. RNA is run on a denaturing agarose gel, and transferred to For additional information regarding mass spectrometers, a Suitable Support, such as activated cellulose, nitrocellulose see, e.g., Principles of Instrumental Analysis, 3rd edition. or glass or nylon membranes. Labeled (e.g., radiolabeled) Skoog. Saunders College Publishing, Philadelphia, 1985; cDNA or RNA is then hybridized to the preparation, washed and Kirk-Othmer Encyclopedia of Chemical Technology, 40 and analyzed by methods such as autoradiography. 4.sup.thed. Vol. 15 (John Wiley & Sons, New York 1995), Detection of RNA transcripts can further be accomplished pp. 1071-1094. Software programs such as the Biomarker using known amplification methods. For example, mRNA Wizard program (Ciphergen Biosystems, Inc., Fremont, can be reverse-transcribed into cDNA followed by poly Calif.) can be used to aid in analyzing mass spectra, e.g., merase chain reaction (RT-PCR); or, to use a single enzyme comparing the signal strength of peak values from spectra of 45 for both steps as described in U.S. Pat. No. 5,322,770, or a test Subject sample and a control sample (e.g., a normal reverse transcribe mRNA into cDNA followed by symmetric healthy person). The mass spectrometers and their tech gap lipase chain reaction (RT-AGLCR) as described by R. L. niques are well known to those of skill in the art. Marshall, et al., PCR Methods and Applications 4: 80-84 Determining Expression Level of a Gene or Protein by (1994). One suitable method for detecting enzyme mRNA Measuring mRNA: 50 transcripts is described in reference Pabic et. al. Hepatology, Real time PCR is an amplification technique that can be 37(5): 1056-1066, 2003, which is herein incorporated by used to determine expression levels of mRNA corresponding reference. to a protein of interest (e.g., hSCRP). (See, e.g., Gibson et al., In situ hybridization visualization can also be employed, Genome Research 6:995-1001, 1996; Heid et al., Genome wherein a radioactively labeled antisense RNA probe is Research 6:986-994, 1996). Real-time PCR evaluates the 55 hybridized with target biomarkers in a test sample, washed, level of PCR product accumulation during amplification. cleaved with RNase and exposed to a sensitive emulsion for This technique permits quantitative evaluation of mRNA autoradiography. The samples can be stained with haema levels in multiple samples. For mRNA levels, mRNA can be toxylin to demonstrate the histological composition of the extracted from a biological sample, e.g. a blood sample sample, and dark field imaging with a Suitable light filter (such as white blood cells and/or platelets) and cDNA is 60 shows the developed emulsion. Non-radioactive labels such prepared using standard techniques. Real-time PCR can be as digoxigenin can also be used. performed, for example, using a Perkin Elmer/Applied Bio Alternatively, mRNA expression can be detected on a systems (Foster City, Calif.) 7700 Prism instrument. Match DNA array, chip or a microarray. Oligonucleotides corre ing primers and fluorescent probes can be designed for genes sponding to enzyme are immobilized on a chip which is then of interest using, for example, the primer express program 65 hybridized with labeled nucleic acids of a test sample provided by PerkinElmer/Applied Biosystems (Foster City, obtained from a patient. Positive hybridization signal is Calif.). Optimal concentrations of primers and probes can be obtained with the sample containing biomarker transcripts. US 9,540,691 B2 57 58 Methods of preparing DNA arrays and their use are well the Examples, e.g., HAMD-17, HAMD-28, CGI, Maier or known in the art. (See, for example U.S. Pat. Nos. 6,618, HAMD-7, after treatment. In one embodiment, at least one 6796; 6,379,897; 6,664,377; 6,451,536; 548,257; U.S. symptom of depression is alleviated by at least about 10%, 20030157485 and Schena et al. 1995 Science 20:467-470; at least about 15%, at least about 20%, at least about 30%, Gerhold et al. 1999 Trends in Biochem. Sci. 24, 168-173; at least about 40%, or at least about 50%. In another and Lennon et al. 2000 Drug discovery Today 5: 59-65. embodiment, at least one symptom is alleviated by more which are herein incorporated by reference). Serial Analysis than 50%, e.g., at least about 60%, or at least about 70%. In of Gene Expression (SAGE) can also be performed (See for one embodiment, at least one symptom is alleviated by at example U.S. Patent Application 20030215858). least about 80%, at least about 90% or greater, as compared Methods for Treating a Human Subject with Depression 10 to a control (e.g., a Subject having the same or similar degree In accordance with various aspects described herein, if a of depression as the treated subject is administered without subject with depression is detected to have the presence of a folate-containing compound, or a subject who has met at least one of the conditions (A)-(X) determined in the assay none of the conditions described herein is administered with described herein, the subject is recommended for and/or treatment regimen comprising a folate-containing com administered with a treatment regimen comprising a folate 15 pound). In some embodiments, at least one neuropsycho containing compound. In Such embodiments, the Subject can logical test is improved (e.g., HAMD-17 rating is decreased) be further administered or prescribed with a treatment by at least about 10%, at least about 15%, at least about 20%, regimen comprising an anti-depressant drug and a folate at least about 30%, at least about 40%, or at least about 50%. containing compound. Accordingly, provided herein are also In another embodiment, at least one neuropsychological test methods for treating a Subject with depression. In some is improved (e.g., HAMD-17 rating is decreased) by more embodiments, the method comprises performing any than 50%, e.g., at least about 60%, or at least about 70%. In embodiments of the assay for selecting a treatment regimen one embodiment, at least one neuropsychological test is for a subject with depression described herein. In some improved (e.g., HAMD-17 rating is decreased) by at least embodiments, the method can further comprise prescribing about 80%, at least about 90% or greater, as compared to a and/or administering a treatment regimen comprising a 25 control (e.g., a subject having the same or similar degree of folate-containing compound to the selected human Subject. depression as the treated Subject is administered without a In some embodiments, a method for treating a human folate-containing compound, or a Subject who has met none Subject with depression can comprise administering a com of the conditions described herein is administered with position comprising an effective amount of a folate-contain treatment regimen comprising a folate-containing com ing compound to the human Subject, who is diagnosed as 30 pound). In some embodiments, at least one symptom of having, or having a risk for, depression, and is further depression can be alleviated by at least about 10%, at least determined to carry at least one or more (including at least about 15%, at least about 20%, at least about 30%, at least two, at least three, at least four or more), or any combina about 40%, or at least about 50% or higher within a period tions of the conditions (A)-(X) described herein. of at least about 10 days, including, e.g., at least about 20 In certain embodiments, the method can comprise admin 35 days, at least about 30 days, at least about 40 days, or longer. istering a composition comprising an effective amount of a In some embodiments, at least one neuropsychological test folate-containing compound to the human Subject, who is is improved (e.g., HAMD-17 rating is decreased) by at least diagnosed as having, or having a risk for, depression, and is about 10%, at least about 15%, at least about 20%, at least further determined to carry at least one of the following about 30%, at least about 40%, or at least about 50% or SNPs or a combination thereof: (i) a SNP at position 677 of 40 higher within a period of at least about 10 days, including, SEQ ID NO. 1 or position 27 of SEQ ID NO. 7 (identified e.g., at least about 20 days, at least about 30 days, at least by rs1801133) comprising at least one thymine “T” allele, about 40 days, or longer. and (ii) a SNP at position 2756 of SEQID NO. 2 or position In some embodiments of this aspect and all other aspects 27 of SEQ ID NO. 9 comprising at least one guanine “G” described herein, a folate-containing compound can be allele. In these embodiments, the method can further com 45 administered in an amount effective to reduce at least one prise determining the presence or absence of any of the symptom (e.g., but not limited to, low mood, anhedonia, low conditions (A)-(X) described herein. energy, insomnia, agitation, anxiety and/or weight loss) In some embodiments, the Subject administered with a associated with depression, e.g., major depressive disorders. treatment regimen comprising a folate-containing com In some embodiments, the effective amount of a folate pound can be further determined to be obese (e.g., with a 50 containing compound can provide at least about 0.1 to about BMI value of at least about 30 kg/m or higher). 1 mg/kg body weight per day administration to the human The terms “treatment” and “treating as used herein, with subject. In some embodiments, the effective amount of a respect to treatment of a disease, means preventing the folate-containing compound can provide at least about 7.5 progression of the disease, or altering the course of the mg/day to about 50 mg/day administration to the human disorder (for example, but are not limited to, slowing the 55 subject. In one embodiment, the effective amount of a progression of the disorder), or reversing a symptom of the folate-containing compound can provide at least about 15 disorder or reducing one or more symptoms and/or one or mg/day of folate administration to the human Subject. more biochemical markers in a Subject, preventing one or The effective amount of the folate-containing compound more symptoms from worsening or progressing, promoting can be administered to a selected human Subject as a single recovery or improving prognosis. For example, in the case 60 daily dose, or alternatively, in more than one divided doses of treating depression, therapeutic treatment refers to alle per day via any Suitable administration route, e.g., oral viation of at least one symptom associated with depression. administration. Measurable lessening includes any statistically significant In some embodiments of this aspect and all other aspects decline in a measurable marker or symptom, Such as mea described herein, the treatment regimen can further com suring markers for depression in the blood as described later 65 prise selecting and optionally administering an antidepres or assessing the degree of depression, e.g., using the criteria sant drug. In some embodiments, the anti-depressant drug listed in DSM-IV or the efficacy measures as described in can include a selective serotonin reuptake inhibitor, includ US 9,540,691 B2 59 60 ing, but not limited to, fluoxetine, citalopram, paroxetine, sant drug, as compared to efficacy of the antidepressant drug escitalopram, Sertraline, and any combinations thereof. alone (e.g., in the absence of the folate-containing com The subject with depression being treated with the meth pound). ods described herein can be a subject currently taking an In some embodiments, the folate-containing compound antidepressant. Accordingly, the methods of treating a can be administered only a few minutes (e.g., 1, 2, 5, 10, 30, human subject with depression described herein can also be or 60 min) before or after administration of the antidepres used to select a human subject to be treated with the sant. Alternatively, the folate-containing compound can be combination of a folate-containing compound and an anti administered several hours (e.g., 2, 4, 6, 10, 12, 24, or 36 hr) depressant to improve the effectiveness of an anti-depressant before or after administration of the antidepressant. Depend drug currently taken by a Subject accordingly. Accordingly, 10 ing on the half-lives of the antidepressant and the folate if the human Subject currently taking an antidepressant is containing compound, in certain embodiments, it can be determined to have at least one (including, e.g., at least two, advantageous to administer more than one dosage of the at least three or more) of the conditions (A)-(X) described folate-containing compound between administrations of the herein, the subject can be further administered or prescribed 15 antidepressant. For example, the folate-containing com with a folate-containing compound as an adjuvant to the pound can be administered at 3 hours and then again at 6 anti-depressant he/she is currently taking. hours following administration of the antidepressant. Alter In other embodiments, if the Subject currently taking an natively, it can be advantageous to administer more than one antidepressant is determined to have at least one (including, dosage of the antidepressant between administrations of the e.g., at least two, at least three or more) of the conditions folate-containing compound. Importantly, in Some embodi (A)-(X) described herein, the subject can be administered to ments, the therapeutic effect of each antidepressant and a treatment regimen comprising a folate-containing com folate-containing compound can overlap for at least a por pound without the antidepressant. tion of the duration of each therapeutic agent so that the In some embodiments, the methods described herein can overall therapeutic effect of the combination therapy is be used to treat at least one or more core symptoms of 25 attributable in part to the combined of the combination depression (e.g., but not limited to low or depressed mood, therapy. In some embodiments, the folate-containing com anhedonia (e.g., loss of interest or pleasure in nearly all pound and the antidepressant can be administered in a pulse activities), low energy levels) in a Subject who is determined administration. In other embodiments, they can be admin to have at least one (including, e.g., at least two, at least three istered as a pulse-chase administration, e.g., where a folate or more) of the conditions (A)-(X) described herein. 30 containing compound is administered for a brief period of Treatment Regimen Comprising a Folate-Containing Com time (pulse), followed by administration of the antidepres pound sant for a longer period of time (e.g., chase). A folate-containing compound included in a treatment In some embodiments where the antidepressant and the regimen can be administered can be administered together folate-containing compound are administered in separate via a single dosage form or by separate administration. In 35 compositions, the antidepressant and the folate-containing certain embodiments, the folate-containing compound can compound can be administrated by the same or different be administered in a single dosage form. For example, the routes. For example, the antidepressant can be administered single dosage form can be administered as a single tablet, by intravenous injection while the folate-containing com pill, capsule for oral administration or a solution for paren pound can be administered orally, or vice versa. Alterna teral administration. Alternatively, the folate-containing 40 tively, for example, both the antidepressant and folate compound can be administered as separate compositions, containing compound can be administered together by e.g., as separate tablets or solutions. The length of time intravenous injection or by oral administration. between administration of a Sub-dose of a folate-containing In any embodiments of the methods described herein, the compound can be adjusted to achieve the desired therapeutic adjuvant effect of the folate-containing compound adminis effect. 45 tered in combination with an antidepressant can be additive. In some embodiments, a treatment regimen comprising a The term “additive' as used herein in the context of one folate-containing compound further comprise at least one agent has an additive effect on a second agent, refers to an anti-depressant (e.g., 1, 2, 3 or more antidepressants). A increase in effectiveness of a first agent in the presence of a treatment regimen comprising a folate-containing com second agent as compared to the use of the first agent alone. pound and at least one anti-depressant can be administered 50 Stated in another way, the second agent can function as an together via a single dosage form or by separate adminis agent which enhances the physiological response of an tration. In certain embodiments, the antidepressant and the organ or organism to the presence of a first agent. Thus, a folate-containing compound are administered together in a second agent will increase the effectiveness of the first agent single dosage form. For example, the single dosage form can by increasing an individual’s response to the presence of the be administered as a single tablet, pill, capsule for oral 55 first agent. administration or a solution for parenteral administration. In any embodiments of the methods described herein, the Alternatively, the antidepressant and the folate-containing adjuvant effect of the folate-containing compound adminis compound can be administered as separate compositions, tered in combination with an antidepressant can be syner e.g., as separate tablets or Solutions. The antidepressant can gistic. The term "synergy' or “synergistic' as used herein be administered at the same time as the folate-containing 60 refers to the interaction of two or more agents so that their compound, or the antidepressant can be administered inter combined effect is greater than each of their individual mittently with the folate-containing compound. The length effects at the same dose alone. of time between administration of the antidepressant and the In some embodiments, the treatment regimen can further folate-containing compound can be adjusted to achieve the comprise life-style advice, including, e.g., prescribing an desired therapeutic effect. In particular, the folate-containing 65 exercise regime, dietary advice, and/or administering compound can be administered at any frequency or admin another pharmaceutical agent effective in treatment of istration protocol to enhance the efficacy of the antidepres depression. US 9,540,691 B2 61 62 Folate or Folate-Containing Compounds single-carbon-transfer reactions and also are involved in the Any art-recognized folate-containing compound can be synthesis of dTMP (2'-deoxythymidine-5'-phosphate) from selected and/or optionally administered to a human Subject dUMP (2'-deoxyuridine-5'-phosphate). selected to carry at least one or more conditions (A)-(X) The pathway leading to the formation of methylfolate described herein. The term “folate-containing compound as such as tetrahydrofolate (THF) begins when folic acid (F), used herein refers to a compound containing an effective as folate, is reduced to dihydrofolate (DHF), which is then amount of at least one folate for use in the methods reduced to tetrahydrofolate (THF). The enzyme dihydrofo described herein. Folate is a form of the water-soluble late reductase catalyses the last step. Accordingly, in some vitamin B9. The term “folate” as used herein encompasses embodiments, for a subject with depression who is deficient the naturally-occurring form offolate, folic acid (also known 10 in the enzyme dihydrofolate reductase, methyl folate, also as vitamin B9 or folacin) and metabolites or derivatives known as Me-THF, N5-Methyl-THF, MTHF, 5-MTHF, thereof such as methylfolate, tetrahydrofolate, and methyl L-methylfolate, and Levomefolic acid, or a pharmaceuti tetrahydrofolate. The term “folate” as used herein can also cally acceptable salt thereof (e.g., sodium salt, potassium refer to both pteroic acid monoglutamate (folic acid) and salt, magnesium salt, calcium salt, glucosamine salt, or reduced forms such as dihydrofolates and tetrahydrofolates, 15 galactosamine salt), is more desirable for use as a folate e.g. 5-formyltetrahydrofolic acid, 5-methyltetrahydrofolic containing compound. For example, methyl folate calcium acid, 5,10-methylenetetrahydrofolic acid, 5,10-methenyltet salt is available by prescription in the United States as rahydrofolic acid, 10-formyltetrahydrofolic acid and tetra DEPLINR) (L-methylfolate calcium salt). Methyl folate cal hydrofolic acid, polyglutamates thereof, optical isomers cium salt is also available outside of the United States as thereof (e.g., optically pure natural isomers thereof, and also METAFOLINR), BODYFOLINR, and NUTRIFOLINR). mixtures of optical isomers such as racemic mixtures), Additional examples of folates or folate-containing com derivatives thereof, pharmaceutically acceptable salts and pounds that can be administered to a subject in the methods esters thereof glucosamine salts thereof, and galactosamine or included in the compositions described herein can salts thereof. include, but not limited to, the ones described in the U.S. Pat. As used herein, the term “pharmaceutically acceptable 25 Nos.: U.S. Pat. No. 4,336,185; U.S. Pat. No. 6,921,754; and salts and esters' refers to pharmacologically acceptable and U.S. Pat. No. 7,947,662; and U.S. Pat. App. No.: US pharmaceutically acceptable salts and esters. Pharmacologi 2008/0064702, the contents of which are incorporated cally and pharmaceutically acceptable salts can include, but herein by reference. are not limited to, alkali metal or alkaline earth metal salts, Biological Effects of Folate on the Central Nervous e.g., sodium, potassium, magnesium or calcium salts. Phar 30 System: macologically and pharmaceutically acceptable esters can The role of folate in central-nervous-system function has include, but are not limited to, C1-C4 alkyl, C5 cycloalkyl been previously discussed, including the essential role of oder C6 cycloalkyl, phenyl, C1-C4 alkylphenyl, benzyl or folate in the one-carbon cycle that furnishes SAMe, the C1-C4-alkylbenzyl esters. The esters can be monoesters or principal methyl donor for a broad range of reactions diesters. Diesters can be homogeneous or heterogeneous. In 35 involving the synthesis of neuroactive Substances, the for Some embodiments, pharmacologically and pharmaceuti mation of membrane phospholipids, and the metabolism of cally acceptable esters can be homogeneous diesters such as nucleic acids 10. When administered in parenteral and C1-C4 dialkylesters, for example dimethyl- or diethylesters. certain oral forms, SAM has been reported in European In some embodiments, the folate-containing compound studies to have antidepressant efficacy greater than placebo can include at least one (including at least two, at least three 40 and comparable to that of antidepressants 41. or more) alkaline metal or alkaline earth metal salt of folate, Folate also appears to influence the rate of synthesis of e.g., but not limited to, a calcium salt of folate. tetrahydrobiopterin I21, a cofactor in the hydroxylation of In some embodiments, the folate-containing compound phenylalanine and , rate-limiting steps in the can include at least one (including at least two, at least three biosynthesis of dopamine, norepinephrine, and serotonin, or more) glucosamine salt and/or galactosamine salt of 45 neurotransmitters postulated to play a role in the pathogen folate (including, e.g., folic acid and reduced folate, e.g., but esis of depression. In addition, MTHF has been shown to not limited to, tetrahydrofolate, and derivatives thereof). bind to presynaptic glutamate receptors 42, where it may Examples of glucosamine-folate and/or galactosamine-fo potentially modulate the release of other neurotransmitters, late and derivatives there of, e.g., disclosed in U.S. Pat. No. including the monoamines. Elevated levels of homocyste 7.947,662, can be administered to a human subject in the 50 ine, resulting from folate deficiency, can play a role in methods or included in the compositions described herein. mediating some of its neuropsychiatric complications by In one embodiment, QUATREFOLICR) (Gnosis S.p.A, both generating elevated levels of S-adenosyl-homocyste Milan, IT) or N-4-(6S)-2-amino-1,4,5,6,7,8-hexahydro ine, which broadly inhibits methylation reactions 43, and 5-methyl-4-oxo-6-pteridinylmethylaminobenzoyl-L-glu also possibly exerting direct excitoxic effects via activity at tamic acid, glucosamine salt can be administered to a human 55 the N-methyl-aspartate glutamate receptors 44. Subject in the methods or included in the compositions Low cerebrospinal fluid levels of the serotonin metabolite described herein. 5-hydroxyindole acetic acid and the dopamine metabolite Folic acid, folate and their metabolites or reduced folates, homoVanillic acid have been detected, though not always e.g., methylfolate, are Substances that are characterized as 45, among folate-deficient patients with epilepsy 46. Vitamins, essential nutrients available in Small amounts in 60 other neuropsychiatric disorders 47, and congenital folate leafy vegetables and other foods. Folic acid is itself not deficiency states 48. Whether folate supplementation actu biologically active, but it can be biologically converted to ally enhances monoamine synthesis or release or furnishes tetrahydrofolate and other derivatives after its conversion to additional SAMe has not yet been established. Human dihydrofolic acid in the liver in the presence of appropriate studies examining the impact of Supraphysiologic doses of enzymes. 65 folate on cerebrospinal-fluid metabolites are lacking. In the form of a series of tetrahydrofolate (THF) com Indeed, a previous study in rats yielded the paradoxical pounds, folate derivatives are substrates in a number of finding that folate Supplementation and folate deficiency US 9,540,691 B2 63 64 lowered brain serotonin. 47, which can in turn indicate the Somewhat less dramatic, response to MTHF among compa possibility of a similarly complex pattern in humans. rably treated patients with Schizophrenia, indicating that the Folate and Depression: positive effects of MTHF may not have been specific to Neuropsychiatric and depressive symptoms, including depression. The prior reports extended previous work on apathy, fatigue, insomnia, irritability, and impaired concen 5 folate replacement, reporting improved long-term neurop tration, have been discussed in clinical descriptions of sychiatric outcome among folate-deficient patients with psy folate-deficiency states associated with malabsorption, 13 chiatric 32 and gastrointestinal 13 disorders and in Some, anticonvulsant-treated epilepsy, 14, 15 megaloblastic ane although not all, studies on anticonvulsant-treated patients mia, 16 and dietary folate restriction 1. Previous studies with epilepsy (14. have reported that as many as one-third of patients among 10 The actual clinical relevance of these previous studies, psychiatric cohorts, mainly from the United Kingdom, however, is likely to be increasingly limited. Recent work exhibited low or deficient serum folate values, with gener has reported that the prevalence of folate deficiency or ally comparable findings in the few studies that have borderline low values is lower among contemporary psy assessed red blood cell (RBC) folate as a more accurate chiatric cohorts than originally believed 28 and also that reflection of tissue folate stores 12, 17, 18. In the subset of 15 Western estimates may not be comparable to other parts of the studies in which depressed patients were compared with the world including Asia 33. Moreover, most of the studies psychiatric or non-psychiatric control Subjects, depressed on folate and depression are based on data gathered before patients were reported to have serum folate 2, 19, RBC implementation of folic-acid-fortification programs and the folate 21, or serum methyltetrahydrofolate (MTHF) 22 widespread public awareness about the possible health ben levels that were lower than levels in all other groups except efits of folate. In the United States, the Food and Drug for patients with alcoholism who had a similar prevalence of Administration mandate requiring folic-acid fortification of low folate 20. Furthermore, low serum or RBC folate and all enriched grain products by 1998 appears to have exerted serum MTHF were often associated with greater symptom a rapid and Substantial impact on the prevalence of low and severity among depressed patients 22, 23, 24, 25. Among deficient folate in the community, nearly eradicating low studies that failed to demonstrate such relationship between 25 serum-folate values (<3 ng/mL) among 350 middle-aged low folate and depression severity, an inverse relationship and older adults in the Framingham Offspring Study Cohort between folate and the duration of the depressive episode 34. 26 or the length of hospitalization 27 was observed. A comparable study is needed on the prevalence of low Folate Levels and Response to Antidepressant Treatment: folate among carefully diagnosed depressed cohorts in this The inventors have previously assessed serum folate and 30 postfortification era, particularly because the extent to which response to the selective serotonin reuptake inhibitor anti dietary intake contributes to low folate among depressed depressant, fluoxetine, among 213 adults with major depres individuals is not well established 2, 24, 25, 28, 35, 36. sion 28. Among those depressed, but otherwise healthy, Nevertheless, the prevalence of low folate among depressed outpatients, the prevalence of actual folate deficiency (de sample subjects is believed to be reduced well below the fined as <1.5 ng/mL) was low (2%), whereas borderline low 35 estimates prior to implementation of the folic-acid fortifi values (1.5-2.5 ng/mL) were more common (17%). Indi cation programs. If so, the more compelling clinical focus viduals with low or deficient serum folate exhibited a 35% for clinicians who treat depression shifts from folate replace rate of non-response to an adequate course of fluoxetine ment to folate Supplementation and to the question of compared with a 20% rate of non-response among those whether Supraphysiologic doses of folate, as monotherapy or with serum folate levels in the normal range. A similar result 40 augmentation of conventional agents, may confer antide was reported among 22 depressed patients older than 60 pressant benefit among depressed, normofolatemic patients. years old treated with or sertraline for whom Despite tremendous advances in the development of safe there was an inverse relationship between RBC folate and and effective antidepressants, as many as 30-40% of antidepressant response 29. Consistent with this finding, in depressed patients continue to be symptomatic and func an earlier study of 101 depressed inpatients receiving a 45 tionally impaired despite an adequate course of antidepres variety of treatments, including electroconvulsive therapy, sant therapy 30. Thus, the development of novel treatment antidepressants, or tryptophan, outcome was significantly strategies has considerable public-health significance. poorer for patients with low serum folate 24. However, for Correlational analyses had reported that, among individu a small number of patients undergoing electroconvulsive als with major mood disorders, higher folate values pre therapy, serum MTHF did not appear to correlate with 50 dicted better acute 25 and long-term outcome 37. In the response 22. Thus, accurate and sensitive predictors of latter study, individuals with unipolar-depression or bipolar refractoriness to antidepressant treatment have remained disorder folate levels were boosted with daily low-dose elusive 30. folate Supplementation (200 ug) together with pharmaco Folate and MTHF Supplementation/Augmentation: logic prophylaxis of affective symptoms. Further demon Godfrey et al. 31 administered MTHF (15 mg), an oral 55 stration of the potential antidepressant benefit of folate form of folate actively transported across the blood-brain comes from a double-blind study of 96 non-folate-deficient barrier, to 24 patients with major depression and low or patients with senile dementia and depressive symptoms in deficient folate (RBC folate <200 ug/L). In this 6-month, which significant improvement of depression was reported randomized, double-blind trial, those 13 depressed patients among patients randomized to MTHF (50 mg), similar to who received methylfolate were rated globally as having 60 that observed on the active antidepressant comparator, tra Superior symptom improvement and social adjustment at 3 Zodone (100 mg/d) 38. Among 16 elderly non-demented and 6 months when compared with the 11 patients who were subjects with major depression, an open trial of MTHF (50 assigned to placebo. However, this report was inconclusive, mg) also resulted in Substantial improvement in depressive based on the relatively small sample and need for replica symptoms, even among the 14 Subjects who had normal tion, non-systematic concomitant treatments (e.g., antide 65 baseline serum folate 39. pressants, , or no medications), symptom improve The inventors have also previously assessed the efficacy ment on Some but not all measures, and similar, although of methylfolate as an adjunctive treatment among adults US 9,540,691 B2 65 66 with MDD and inadequate response to an SSRI I40. In some embodiments, the term “effective amount’ as Twenty-two adults (59% female; mean age 45.2+/-11.0 used herein refers to an amount of folate or a folate years) with DSM-IV MDD, partial or nonresponse to an containing compound, when administered to a selected SSRI after at least 4 weeks of treatment, and a 17-item Subject in combination with an antidepressant, can increase Hamilton Depression Rating Scale (HAM-D-17) score the effect (e.g., efficacy or therapeutic effect) of the antide greater than or equal to 12 were enrolled in this 8-week pressant, e.g., by at least about 5%, at least about 10%, at prospective open trial. Exclusion criteria included current least about 20%, at least about 30%, at least about 40%, at use of anticonvulsants or psychotropics other than an SSRI, least about 50%, at least about 60%, at least about 70%, at or B12 deficiency. Folinic acid was selected as an oral, least about 80%, at least about 90% or more, as compared to 10 the treatment with antidepressant alone. Stated another way, synthetic, highly bioavailable form of folate that is metabo the term “effective amount as used herein refers to an lized to MTHF after absorption and, unlike MTHF, is amount of folate or a folate-containing compound, when available for prescription in the United States. Thus, folinic administered to a selected Subject in combination with an acid was added to SSRIs at 15-30 mg/day. Folate levels rose antidepressant, can reduce at least one symptom associated from 28+/-19 ng/mL to 301 +/-203 ng/mL (p<0.001). 15 with depression as described later, e.g., by at least about 5%, HAM-D-17 scores among the 16 completers decreased from at least about 10%, at least about 20%, at least about 30%, 19.1+/-3.9 to 12.8+/-7.0 (p<0.01). 31% of completers and at least about 40%, at least about 50%, at least about 60%, 27% of the intent-to-treat (ITT) sample achieved response at least about 70%, at least about 80%, at least about 90% or (with at least 50% reduction in HAM-D-17 scores), and 19% more, as compared to the treatment with antidepressant of completers and 18% of the ITT sample achieved remis alone. sion (HAM-D-17 no greater than 7). In this report, folinic In some embodiments, the effective amount of folate in acid appeared to be only modestly effective as an adjunct in the treatment regimen as described herein can range from SSRI-refractory depressed individuals with normal folate about 1 mg/day to about 70 mg/day, from about 1 mg/day to levels, and Surprisingly a significant portion of depressed about 50 mg/day, from about 2.5 mg/day to about 40 mg/day, individuals still did not respond to the folinic acid as an 25 from about 5 mg/day to about 40 mg/day, from about 5 adjunct to an antidepressant. Thus, folate augmentation in mg/day to about 30 mg/day or from about 7 mg/day to about treatment-resistant depression does not produce an effective 15 mg/day. In some embodiments, the effective amount of response in all individuals 49, and in particular, as many as folate in the treatment regimen as described herein can range 29% to 46% of MDD patients show only partial or non from about 7.5 mg/day to about 50 mg/day. In some embodi response to an adequate course of an antidepressant 50. In 30 ments, the effective amount of folate in the treatment regi particular, these reports did not identify in which patients the men as described herein can range from about 7.5 mg/day to folate argumentation was effective or those patients where about 40 mg/day. In some embodiments, the effective the antidepressant drug efficacy was not enhanced by folate. amount of folate in a treatment regimen can be about 15 In fact, none of these reports identify biomarkers or a screen mg/day. method to identify those subjects in where folate can 35 Antidepressants enhance the efficacy of the antidepressant drug. As used herein, unless otherwise noted, the term “anti The assays and/or methods described herein can be used depressant’ or “anti-depressant’ or “antidepressant drug’ as a screen to identify and select for particular patients with refers to any pharmaceutical agent which treats depression. depression, where a treatment regimen comprising an anti In some embodiments, the anti-depressant drug adminis depressant and a folate-containing compound will be ben 40 tered to the subject in accordance with the methods eficial to enhance the therapeutic effect of the antidepressant described herein can be any conventional pharmaceutical drug. agent which is commonly indicated for treating depression. In accordance with the assays and/or methods described Examples of antidepressants or antidepressant drugs can herein, subjects with depression who have been determined include, but are not limited to, mono-amine oxidase inhibi to have the presence of at least one of the conditions 45 tors such as , , and ; described herein (e.g., SNPs and/or plasma/serum biomark such as , , , ers described herein) can benefit from the therapeutic effect nortriptyline, , , , chlomip of an antidepressant administered in combination with an ramine, and ; tetracyclics such as ; effective amount of a folate-containing compound. In some non-cyclics such as ; triazolopyridines Such as embodiments, the folate-containing compound can comprise 50 ; serotonin reuptake inhibitors such as fluoxetine, L-methylfolate. In some embodiments, the folate-containing Sertraline, paroxetine, citalopram, and ; sero compound can comprise 6(S)-5-methyltetrahydrofolate tonin receptor antagonists such as nefazadone; serotonin (also known as 6(S)-5-MTHF) or DEPLINR). noradrenergic reuptake inhibitors such as , and The effective amount of folate for use in the treatment ; noradrenergic and specific serotonergic agents methods described herein can vary, depending upon the 55 Such as ; noradrenaline reuptake inhibitors such types and/or dosage of the antidepressant (if any), types of as . Additional antidepressants that can be used in folate, severity of depression, physical conditions of a the methods described herein can include, but are not limited Subject (e.g., ages, genders, weights). The term “effective to, ; natural products such as Kava-Kava, and St. amount as used herein generally refers to an amount of John's Wort; dietary Supplements such as S-adenosylmethio folate or a folate-containing compound that, when admin 60 nine; neuropeptides such as thyrotropin-releasing hormone; istered to a selected Subject, can reduce at least one symptom compounds targeting neuropeptide receptors such as neuro associated with depression as described later, e.g., by at least kinin receptor antagonists; and hormones such as triiodo about 5%, at least about 10%, at least about 20%, at least thyronine. about 30%, at least about 40%, at least about 50%, at least In some embodiments, the antidepressant or the antide about 60%, at least about 70%, at least about 80%, at least 65 pressant drug can be a serotonin reuptake inhibitor (SRI) or about 90% or more, as compared to the treatment in the selective serotonin reuptake inhibitor (SSRI). Examples of absence of a folate-containing compound. SRIs and/or SSRIs include, without limitations, citalopram, US 9,540,691 B2 67 68 escitalopram, fluoxetine, R-fluoxetine, Sertraline, paroX measured by HAMD-17, HAMD-28 or other efficacy mea etine, fluvoxamine, Venlafaxine, dulloxetine, dapoxetine, sures as described in the Examples, by at least about 5%, at , imipramine, imipramine N-oxide, desipramine, least about 10%, at least about 20%, at least about 30%, at pirandamine, dazepinil, nefopam, befuraline, fezolamine, least about 40%, at least about 50%, at least about 60%, at femoxetine, , cianoimipramine, litoxetine, least about 70%, at least about 80%, or at least about 90%, cericlamine, seproxetine, WY 27587, WY 27866, imeldine, as compared to the degree of improvement obtained in the ifoxetine, tiflucarbine, Vicqualine, milnacipran, bazinaprine, absence of the folate-containing compound (e.g., with or YM 922, S 33005, F 98214TA, OPC 14523, alaproclate, without the antidepressant monotherapy). In some embodi cyanodothepine, trimipramine, , dothiepin, ments, the therapeutically effective amount of a folate amoxapine, , McN 5652, McN 5707, Ol 77. 10 containing compound or folate, optionally administered with Org 6582, Org 6997. Org 6906, amitriptyline, amitriptyline an antidepressant or a pharmaceutically salt thereof, is N-oxide, nortriptyline, CL 255. 663, , indatraline, Sufficient to increase the degree of improvement in at least LY 113.821, LY214.281, CGP 6085A, RU 25.591, napa one neuropsychological test, e.g., as measured by HAMD mezole, diclofensine, trazodone, EMD 68.843, BMY 17, HAMD-28 or other efficacy measures as described in the 42.569, NS 2389, sercloremine, nitroquipazine, ademethio 15 Examples, by at least about 1-fold, at least about 2-fold, at nine, sibutramine and clovoxamine. The SRIs can be used in least about 3-fold, at least about 4-fold, at least about 5-fold the form of the base or a pharmaceutically acceptable acid or more, as compared to the degree of improvement obtained addition salt thereof. in the absence of the folate-containing compound (e.g., with In some embodiments, other therapeutic compounds that or without the antidepressant monotherapy). can cause an elevation in the extracellular level of 5-HT in In some embodiments, a dose of a folate-containing the synatic cleft, e.g., , can be used as an antide compound or folate for administration to a human can be in pressant in the methods described herein. the range of about 0.01 to about 50 mg per kilogram body In some embodiments, the antidepressant or the antide weight of the recipient per day, in the range of about 0.05 to pressant drug can be a selective serotonin reuptake inhibitor about 5 mg per kilogram body weight per day, or in the range (SSRI). The term “selective serotonin reuptake inhibitor 25 of about 0.1 to about 1 mg per kilogram body weight per day. (SSRI) as used herein, refers to an inhibitor of the mono In certain embodiments, the desired dose can be presented as amine transporters, which has stronger inhibitory effect at one single unit dosage form, e.g., containing about 0.5 mg the serotonin transporter than the dopamine and the nora to about 500 mg, about 5 mg to about 250 mg, about 10 mg drenaline transporters. Examples of selective serotonin to about 100 mg, or about 10 mg to about 50 mg. In some reuptake inhibitors (SSRIs) can include, without limitations, 30 embodiments, one single unit dosage form can provide fluoxetine, citalopram, paroxetine, escitalopram, Sertraline, about 1 mg to about 70 mg folate, about 5 mg to about 60 and any combinations thereof. mg folate, or from about 7 mg to about 50 mg folate. In some Additional SRIs and/or SSRIs that can be administered to embodiments, one single unit dosage form can provide a subject with depression in combination with a folate about 7.5 mg to about 50 mg folate. In other embodiments, containing compound can include, for example, the ones 35 the desired dose can be presented in two, three, four, five or described in the U.S. Pat. App. No.: US 2005/0054688, and more Sub-doses administered at appropriate intervals US 2008/01384.11; and U.S. Pat. Nos. 6,720,003: 6,787,560; throughout the day. These sub-doses can be administered in 7,893,261; and 7,148,238. unit dosage forms, for example, containing about 0.1 mg to One skilled in the art would be able to readily determine about 250 mg, about 1 mg to about 100 mg, about 2 mg to recommended dosage levels for known and/or marketed 40 about 20 mg. or about 2 mg to about 10 mg. antidepressant drugs by consulting appropriate references In some embodiments, the pharmaceutical composition Such as drug package inserts, FDA guidelines, and the can further comprise at least one antidepressant. In general, Physician’s Desk Reference. In some embodiments, the a dose of an antidepressant or a pharmaceutically acceptable antidepressant drug dose can range from 0.1 mg/day to about salt thereof suitable for administration to a human is in the 1000 mg/day, from about 0.5 mg/day to about 500 mg/day, 45 range of about 0.01 to 50 mg per kilogram body weight of from about 1 mg/day to about 400 mg/day, from about 5 the recipient per day, or in the range of 0.1 to 5 mg per mg/day to about 300 mg/day, or from about 10 mg/day to kilogram body weight per day. In certain embodiments, the about 200 mg/day. One of skill in the art can readily adjust desired dose can be presented as one single unit dosage dosage for each different antidepressant drug, depending on form, e.g., containing about 1 mg to about 500 mg. or about a number of factors such as types and/or potency of anti 50 5 mg to about 300 mg. In other embodiments, the desired depressants, severity of depression, physical condition of a dose can be presented in two, three, four, five or more Subject (e.g., ages, genders, and weights), administration Sub-doses administered at appropriate intervals throughout routes, other medications taken by a subject, and any com the day. These sub-doses can be administered in unit dosage binations thereof. forms, for example, containing about 0.1 mg to about 100 Pharmaceutical Compositions for Treatment of Depression 55 mg or about 1 mg to about 50 mg. For in vivo administration to subjects who have met at As used herein, the term “pharmaceutically acceptable' least one (e.g., at least two, at least three or more) of the refers to those compounds, materials, compositions, and/or conditions (A)-(X) determined in the assays described dosage forms which are, within the scope of Sound medical herein, provided herein are pharmaceutical compositions judgment, Suitable for use in contact with the tissues of comprising a therapeutically effective amount of a folate 60 human beings and animals without excessive toxicity, irri containing compound, and a pharmaceutically acceptable tation, allergic response, or other problem or complication, carrier. commensurate with a reasonable benefit/risk ratio. In various embodiments, the therapeutically effective As used herein, the term “pharmaceutically acceptable amount of a folate-containing compound or folate, option carrier” means a pharmaceutically-acceptable material, ally administered with an antidepressant or a pharmaceuti 65 composition or vehicle. Such as a liquid or Solid filler, cally salt thereof, is sufficient to increase the degree of diluent, excipient, manufacturing aid (e.g., lubricant, talc improvement in at least one neuropsychological test, e.g., as magnesium, calcium or Zinc Stearate, or steric acid), or US 9,540,691 B2 69 70 Solvent encapsulating material, involved in carrying or In some embodiments where the antidepressant and transporting the Subject compound from one organ, or folate-containing compound are formulated in a single com portion of the body, to another organ, or portion of the body. position, they can be released from the composition at the Each carrier must be “acceptable' in the sense of being same time or at different times. By way of example only, if compatible with the other ingredients of the formulation and the folate-containing compound is formulated in an outer not injurious to the patient. Some examples of materials layer of a composition (e.g., a tablet or drug-delivery par which can serve as pharmaceutically-acceptable carriers ticle) while the antidepressant is formulated in an inner layer include: (i) Sugars, such as lactose, glucose and Sucrose; (ii) of the composition, the folate-containing compound could starches, such as corn starch and potato starch; (iii) cellu be released from the composition first with a faster rate, lose, and its derivatives. Such as Sodium carboxymethyl 10 while the antidepressant could be released from the compo cellulose, methylcellulose, ethyl cellulose, microcrystalline sition later with a slower rate. On the other hand, if the cellulose and cellulose acetate; (iv) powdered tragacanth; (v) antidepressant and the folate-containing compound are malt. (vi) gelatin; (vii) lubricating agents, such as magne mixed homogenously within the composition, both can be sium Stearate, sodium lauryl Sulfate and talc.; (viii) excipi released simultaneously from the composition. ents, such as cocoa butter and Suppository waxes; (ix) oils, 15 In other embodiments, an antidepressant and a folate Such as peanut oil, cottonseed oil, safflower oil, Sesame oil, containing compound can be formulated in separate phar olive oil, corn oil and soybean oil: (X) glycols, such as maceutical compositions for the same or different routes of propylene glycol, (xi) polyols, such as glycerin, Sorbitol, administration during a therapy course. For example, an mannitol and polyethylene glycol (PEG); (xii) esters, such antidepressant can be formulated for inhalation administra as ethyl oleate and ethyl laurate; (xiii) agar; (xiv) buffering tion while a folate-containing compound can be formulated agents, such as magnesium hydroxide and aluminum for oral administration. In other embodiments, both the hydroxide: (XV) alginic acid; (Xvi) pyrogen-free water, (Xvii) antidepressant and folate-containing compound can be for isotonic saline; (Xviii) Ringer's solution; (XiX) ethyl alcohol; mulated for oral administration, e.g., in separate tablets. (XX) pH buffered solutions; (xxi) polyesters, polycarbonates The effective amount of folate administered to a selected and/or polyanhydrides; (XXii) bulking agents, such as poly 25 human Subject for treatment of depression as described peptides and amino acids (XXiii) serum component, such as herein is significantly higher than the typical amount taken serum albumin, HDL and LDL; (xxiv) C2-C12 alchols, such as a dietary supplement (between 50-600 ug/day). In some as ethanol; and (XXV) other non-toxic compatible Substances embodiments, the effective amount of folate administered to employed in pharmaceutical formulations. Wetting agents, a selected human Subject is at least about 2-fold, at least coloring agents, release agents, coating agents, Sweetening 30 about 5-fold, at least about 10-fold, at least about 25-fold, at agents, flavoring agents, perfuming agents, preservative and least about 50-fold, at least about 100-fold, at least about antioxidants can also be present in the formulation. 250-fold, at least about 500-fold, at least about 1000-fold or Pharmaceutically acceptable carriers can vary in a com more than the typical amount taken as a dietary Supplement. position described herein, depending on the administration Accordingly, in Some embodiments, the folate-containing route and formulation. For example, the pharmaceutically 35 compound is desirable to be formulated in slow-release or acceptable composition described herein can be delivered Sustained release composition. via injection. These routes for administration (delivery) Accordingly, in Some embodiments, the pharmaceutical include, but are not limited to, Subcutaneous or parenteral compositions comprising a folate-containing compound including intravenous, intraarterial, intramuscular, intraperi (with or without an anti-depressant) can be formulated for toneal, intramyocardial, and infusion techniques. In one 40 Sustained release or Sustained delivery. In some embodi embodiment, the pharmaceutical acceptable composition is ments, the pharmaceutical compositions can be formulated in a form that is suitable for injection. In another embodi in controlled-release drug-delivery systems, e.g., to provide ment, the pharmaceutical composition is formulated for Sustained release of a folate-containing compound (and delivery by a catheter. optionally an anti-depressant). As used herein, the term When administering a pharmaceutical composition par 45 “sustained release' or “sustained delivery” refers to con enterally, it can be generally formulated in a unit dosage tinual delivery of a therapeutic agent in vivo over a period injectable form (Solution, Suspension, emulsion). The phar of time following administration. For example, Sustained maceutical formulations suitable for injection include sterile release can occur over a period of at least about 1 hour, at aqueous solutions or dispersions. The carrier can be a least about 2 hours, at least about 3 hours, at least about 4 Solvent or dispersing medium containing, for example, 50 hours, at least about 5 hours, at least about 6 hours, at least water, cell culture medium, buffers (e.g., phosphate buffered about 9 hours, at least about 12 hours, at least about 16 saline), polyol (for example, glycerol, propylene glycol, hours, at least about 24 hours following administration. In liquid polyethylene glycol, and the like), Suitable mixtures Some embodiments, Sustained release can occur over a thereof. In some embodiments, the pharmaceutical carrier period of at least about 1 day, at least about 2 days, at least can be a buffered solution (e.g. PBS). 55 about 3 days, at least about 4 days, at least about 5 days, at In some embodiments, the pharmaceutical composition least about 6 days, at least about 7 days following admin can be formulated in an emulsion or a gel. istration. In some embodiments, the release of a folate In some embodiments, the pharmaceutical compositions containing compound from a drug-delivery system can be described herein can be formulated for oral administration or steady state (zero-order kinetics) with at least about 30% for inhalation. For oral administration, Suitable dosage forms 60 (e.g., including at least about 40%, at least about 50%, at can include tablets, troches, cachets, caplets, and capsules, least about 60%, at least about 70%, at least about 80%, at including hard and soft gelatin capsules. least about 90%, at least about 95% or more) of the In some embodiments, both an antidepressant and a folate-containing compound (and optionally an anti-depres folate-containing compound can be formulated in a single sant) released between about 3-6 hours post administration, pharmaceutical composition. For example, both an antide 65 or between about 4-5 hours post administration. In one pressant and a folate-containing compound can be formu embodiment, the release of a folate-containing compound lated in a single tablet for oral administration. (and optionally an anti-depressant) from a drug-delivery US 9,540,691 B2 71 72 system can be steady state (Zero-order kinetics) with Sub ors, binders, and the like, depending upon the route of stantially full release (e.g., ~100%) of the folate-containing administration and the preparation desired. Standard texts, compound released between about 3-6 hours post adminis Such as REMINGTON'S PHARMACEUTICAL SCI tration, or between about 4-5 hours post administration. In ENCE, 17th edition, 1985, incorporated herein by refer Some embodiments, the folate-containing compound can be ence, may be consulted to prepare Suitable preparations, released from a drug-delivery system at a rate that is slow without undue experimentation. With respect to composi enough not to overload the intestinal absorption capacity of tions described herein, however, any vehicle, diluent, or a patient’s duodenum (first /3 of the small intestines where additive used should have to be biocompatible with the ~90% of the absorption occurs for a folate-containing com antidepressant or a pharmaceutically acceptable salt thereof pound, e.g., L-MTHF). In some embodiments, the folate 10 and/or a folate-containing compound. containing compound and an anti-depressant (if any) can be The pharmaceutical compositions can be isotonic, i.e., released from a drug-delivery system concurrently or sepa they can have the same osmotic pressure as blood and rately, with the same or a different release rate. lacrimal fluid. The desired isotonicity of the compositions of Any drug delivery system (e.g., but not limited to poly the composition described herein can be accomplished using mer-based) that provides a Sustained release of a folate 15 Sodium chloride, or other pharmaceutically acceptable containing compound (and optionally an anti-depressant) agents such as dextrose, boric acid, Sodium tartrate, propyl over a pre-determined period of time can be used for ene glycol or other inorganic or organic solutes. In one administration of a folate-containing compound (and option embodiment, sodium chloride is used in buffers containing ally an anti-depressant). In one embodiment, the drug Sodium ions. delivery system can be a caplet design large enough to be Viscosity of the compositions can be maintained at the blocked by a pyloric valve between the stomach and the selected level using a pharmaceutically acceptable thicken duodenum, thus allowing the caplet to slowly and partially ing agent. In one embodiment, methylcellulose is used dissolve over a desirable period of time, e.g., over a period because it is readily and economically available and is easy of about 2-3 hours, during which the folate-containing to work with. Other suitable thickening agents include, for compound is steadily released from the caplet. As the caplet 25 example, Xanthan gum, carboxymethyl cellulose, hydroxy dissolves to a size that can get through the pyloric valve at propyl cellulose, carbomer, and the like. The preferred which time it completes its steady state release (e.g., an concentration of the thickener will depend upon the agent additional period of time, e.g., an additional 2 hours), the selected. The important point is to use an amount which will caplet can continue to travel into the jejunum (the second achieve the selected viscosity. Viscous compositions are third of the small intestines) where absorption is minimal. 30 normally prepared from solutions by the addition of such In some embodiments, a drug delivery system can use a thickening agents. blend of hydrophilic and hydrophobic polymers to control Typically, any additives (in addition to the antidepressant release of a folate-containing compound (and optionally an and/or folate-containing compound) can be present in an anti-depressant) via diffusion through, and erosion of a amount of 0.001 to 50 wt % solution in phosphate buffered polymer matrix. 35 saline, and the active ingredient is present in the order of In some embodiments, a drug delivery system can com micrograms to milligrams to grams, such as about 0.0001 to prise a folate-containing compound (and optionally an anti about 5 wt %, about 0.0001 to about 1 wt %, about 0.0001 depressant) encapsulated in polymer-based particles. These to about 0.05 wt % or about 0.001 to about 20 wt %, about folate-containing polymer-based particles can be filled into 0.01 to about 10 wt %, and about 0.05 to about 5 wt %. For capsules or single-dose Sachets for additional control of 40 any therapeutic composition to be administered to a subject release. with compression, and for any particular method of admin Controlled-release (e.g., Sustained release) drug delivery istration, it is preferred to determine toxicity, Such as by systems for different administration methods (e.g., oral determining the lethal dose (LD) and LD50 in a suitable administration, injection, implantation, inhalation) are animal model e.g., rodent such as mouse; and, the dosage of known in the art and can be adopted to deliver a folate 45 the composition(s), concentration of components therein and containing compound (and optionally an antidepressant) for timing of administering the composition(s), which elicit a the treatment methods described herein. See, e.g., Interna Suitable response. Such determinations do not require undue tional Pat. App. Nos. WO 2012/11 1961 (oral formulation), experimentation from the knowledge of the skilled artisan. WO 2012/131678 (injectable formulation): U.S. Pat. App. Those skilled in the art will recognize that the components Nos. US 2012/0258161 (implantable formulation), US 50 of the compositions should be selected to be biocompatible 2001/0038854, US 2001/0033866; and U.S. Pat. No. 8,268, with respect to the active agent, e.g., the antidepressant 347 (inhalation formulation), the content of which are incor and/or folate-containing compound. This will present no porated herein by reference, for various types of drug problem to those skilled in chemical and pharmaceutical delivery systems to deliver an active agent via various principles, or problems can be readily avoided by reference administration routes. 55 to standard texts or by simple experiments (not involving Additionally, various additives which enhance the stabil undue experimentation). ity, Sterility, and isotonicity of the compositions, including The compositions described herein can be prepared by antimicrobial preservatives, antioxidants, chelating agents, mixing the ingredients following generally-accepted proce and buffers, can be added. Prevention of the action of dures. For example, the ingredients can be mixed in an microorganisms can be ensured by various antibacterial and 60 appropriate pharmaceutically acceptable carrier and the antifungal agents, for example, parabens, chlorobutanol, mixture can be adjusted to the final concentration and phenol, Sorbic acid, and the like. In many cases, it may be Viscosity by the addition of water or thickening agent and desirable to include isotonic agents, for example, Sugars, possibly a buffer to control pH or an additional solute to sodium chloride, and the like. control tonicity. Generally the pH can vary from about 3 to The compositions can also contain auxiliary Substances 65 about 7.5. In some embodiments, the pH of the composition Such as wetting or emulsifying agents, pH buffering agents, can be about 6.5 to about 7.5. Compositions can be admin gelling or viscosity enhancing additives, preservatives, col istered in dosages and by techniques well known to those US 9,540,691 B2 73 74 skilled in the medical and veterinary arts taking into con As used herein, the term “depression' generally refers to sideration Such factors as the age, sex, weight, and condition a mental state of depressed mood characterized by feelings of the particular patient, and the composition form used for of sadness, despair and discouragement. In some embodi administration (e.g., liquid). Dosages for humans or other ments, depression is a clinical symptom, and can include, mammals can be determined without undue experimentation but not limited to, major depressive disorder (including by a skilled artisan. single episode and recurrent), unipolar depression, treat A still further aspect provided herein relates to uses of a ment-refractory depression, resistant depression, anxious folate-comprising composition in the treatment of depres depression and dysthymia (also referred to as dysthymic sion in a human Subject who carries at least one of the disorder). Further, the term "depression' can encompass any 10 major depressive disorder, dysthymic disorder, mood disor conditions (A)-(X) described herein (e.g., but not limited to, ders due to medical conditions with depressive features, either one or both conditions (A) and (C)). Another aspect mood disorders due to medical conditions with major provided herein relates to a folate-comprising composition depressive-like episodes, Substance-induced mood disorders in combination with an anti-depressant for use in the treat with depressive features and depressive disorder not other ment of depression in a human Subject who carries at least 15 wise specific as defined by their diagnostic criteria, as listed one of the conditions (A)-(X) described herein (e.g., but not in the American Psychiatric Association's Diagnostic and limited to, either one or both conditions (A) and (C)). In Statistical Manual of Mental Disorders, 4th Edition (DSM some embodiments of these aspects described herein, the IV) or any later edition thereof, or the World Health Orga folate-comprising composition can comprise at least about 5 nization's International Statistical Classification of Diseases mg of folate (e.g., about 7.5 mg to about 50 mg of folate). and Related Health Problems (ICD-10). In one embodiment, In some embodiments, the folate-comprising composition depression is major depressive disorder. can be formulated for a pre-determined release profile (e.g., The DSM-IV and ICD-10 provides a common language a Sustained release). In some embodiments, the human and standard criteria for the classification of mental disor Subject is an adult. ders, and have been commonly used by a Suitably trained Selection of Subjects with Depression 25 general practitioner, or by a psychiatrist or psychologist for In some embodiments, Subjects amenable to assays, meth diagnosis of depression including major depressive disor ods and compositions described herein can be subjects that ders. Symptoms of depression can include, but are not have been diagnosed with or Suspected of having or devel limited to, problems concentrating, remembering, and/or oping depression. Accordingly, in some embodiments, Sub making decisions, changes in eating and/or sleeping habits, jects that have been diagnosed or Suspected of having or 30 a loss of interest in enjoyable activities, difficulty going to developing with depression are selected prior to Subjecting work or taking care of daily responsibilities, feelings of guilt them to the assays, methods and/or compositions described and/or hopelessness, slowed thoughts and/or speech, and herein. In some embodiments, a Subject is selected for a preoccupation with thoughts of death or suicide. One of skill treatment regimen comprising a folate-containing com in the art can determine the score or rating of depression pound is being treated for depression. In some embodiments, 35 based on DSM-IV or ICD-10. the subject is specifically administered with a folate-con Other scales or criteria for classification of mental disor taining compound to enhance (or as an adjuvant) the effect ders known in the art, e.g., Maier or HAMD-7 scale, or of the antidepressant drug, and not for another reason. For Social functioning questionnaire (SFQ), visual analogue example, a female with depression wishing to become scale (VAS), and/or cognitive and physical function ques pregnant, or who is pregnant, or is lactating may take 40 tionnaire (CPFO) can also be used to determine the degree prenatal Supplements containing folic acid in combination of depression. with an antidepressant drug. In such instance, a human During diagnosis for depression, the practitioner can also Subject amenable to the assays, methods and/or composi assess the patient's medical history, discuss the Subjects tions described herein is specifically selected for depression current ways of regulating their mood (healthy or otherwise) before performing the assays and/or methods described 45 Such as alcohol and drug use, and/or perform a mental state herein and/or administering the compositions described examination, which is an assessment of the person’s current herein. mood and thought content, in particular the presence of In some embodiments, the Subject is specifically admin themes of hopelessness or pessimism, self-harm or Suicide, istered with a folate-containing compound for treatment of and an absence of positive thoughts or plans. Additionally, depression, and not for another reason. For example, a 50 a practitioner can generally perform a medical examination human Subject diagnosed as having, or have a risk for, to rule out other non-cognitive causes of depressive symp depression may take an effective amount of a folate-con toms. For example, blood tests measuring TSH and thyrox taining compound (with or without an anti-depressant). In ine can be used to exclude hypothyroidism; basic electro Such instance, a human Subject amenable to the assays, lytes and serum calcium to rule out a metabolic disturbance; methods, and/or compositions described herein is specifi 55 and a full blood count including ESR to rule out a systemic cally selected for depression before performing the assays infection or chronic disease. Testosterone levels can also be and/or methods described herein and/or administering the evaluated to diagnose hypogonadism, a cause of depression compositions described herein. in men. The phrase “having a risk for depression” or “suspected of Any genetic or biomarker methods known in the art can having or developing depression' or 'suspected of having or 60 also be used for diagnosis of depression. For example, U.S. developing major depressive disorder” refers to a subject Pat. App. No. US 2010/0273153 describes that the presence that presents one or more symptoms indicative of a depres of TG 7AT haplotype can be indicative of predisposition to sion including major depressive disorder (e.g., unexplained major depressive disorder. Additional marker gene for insomnia, fatigue, irritability, etc.) or is being screened for depression such as ATP2A2, SCYA5, STIP1, EEF1A1, depression including major depressive disorder (e.g., during 65 GRB10, CASP6, TSSC1, RAB9, NFATC3, TPR, and any a routine physical), for example, in accordance with the others listed in, for example, U.S. Pat. App. No. US 2005/ criteria listed in DSM-IV or ICD-10 as discussed below. 02391 10 can also be used for diagnosing depression. US 9,540,691 B2 75 76 In some embodiments, Subjects amenable to assays, meth be African American Subjects. In some embodiments, the ods and compositions described herein are subjects that have human Subjects amenable to the assays, methods and/or been diagnosed with or Suspected of having or developing compositions described herein can be Asian Subjects. In major depressive disorder. A major depressive episode is Some embodiments, the human Subjects amenable to the characterized by the presence of a severely depressed mood assays, methods and/or compositions described herein can that persists for at least two weeks. Episodes can be isolated be Hispanic Subjects. or recurrent and can be categorized by a skilled practitioner In some embodiments, the human Subjects amenable to as mild (few symptoms in excess of minimum criteria), the assays, methods and compositions described herein can moderate, or severe (marked impact on Social or occupa be of any age. In some embodiments, the human Subjects tional functioning). 10 amenable to the assays, methods and/or compositions In some embodiments, Subjects amenable to assays, meth described can be at an age of at least 18 years old. In other ods and compositions described herein are subjects that have embodiments, human Subjects below 18 years can also be been diagnosed with major depressive disorder (MDD) and Subjected to the assays, methods and/or compositions are resistant to antidepressant monotherapy, i.e., a treatment described herein. for depression with a single antidepressant only. The phrase 15 Systems and Computer Readable Media for Use in the “resistant to antidepressant monotherapy' is used herein in Assays and/or Methods Described Herein reference to a Subject with depression being resistant to at Embodiments of a further aspect also provide for systems least one antidepressant in one or more classes. This (and computer readable media for causing computer sys includes Subjects with depression that are resistant to at least tems) to perform an assay for selecting a treatment regimen two, at least three, at least four or more antidepressants in for a Subject with depression based on at least sequence one or more classes. In some embodiments, Subjects ame information of the SNP biomarkers (i)-(xxi) described nable to assays, methods and compositions described herein herein and/or expression levels of the peripheral biomarkers are Subjects that have been diagnosed with major depressive (XXii)-(XXiv). disorder (MDD) and are resistant to at least one serotonin A computer system for obtaining data from at least one reuptake inhibitors (SRI), including at least one, at least two, 25 test sample obtained from at least one subject is provided. at least three, at least four or more SRIs. In some embodi The system comprises: (a) a determination module config ments, Subjects amenable to assays, methods and composi ured to receive at least one test sample and perform at least tions described herein are subjects that have been diagnosed one analysis on at least one test sample to determine with major depressive disorder (MDD) and are resistant to parameters of at least two biomarkers (i) to (xxiv) described at least one selective serotonin reuptake inhibitor (SSRI), 30 herein; (b) a storage device configured to store output data including at least two, at least three, at least four or SSRIs. from the determination module; (c) a computing module, In some embodiments, the subject selected for the assays, e.g., a non-human machine, comprising specifically-pro methods and compositions described herein have been in grammed instructions to determine from the output data the remission from depression and is now diagnosed with a presence of at least one condition (A) to (X) described relapse or a predisposition to a relapse. In other embodi 35 herein; and (d) a display module for displaying a content ments, the Subject selected for the assays, methods and based in part on the data output from the computing module, compositions described herein have been diagnosed with wherein the content comprises a signal indicative of the depression and is currently taking at least an antidepressant. presence of at least one condition (A) to (X) described As used herein, a 'subject' can mean a human or an herein, and optionally the absence of any one of the condi animal. Examples of Subjects include primates (e.g., 40 tions (A) to (X) described herein, or a signal indicative of the humans, and monkeys). Generally, the animal is a vertebrate absence of all of the conditions (A) to (X) described herein. Such as a primate, rodent, domestic animal or game animal. In some embodiments, the determination module can be Primates include chimpanzees, cynomologous monkeys, configured to perform at least one genotyping analysis on at spider monkeys, and macaques, e.g., Rhesus. Rodents least one test sample to determine the genotypes of at least include mice, rats, woodchucks, ferrets, rabbits and ham 45 two loci comprising position 677 of SEQ ID NO. 1 (or sters. A patient or a Subject includes any Subset of the position 27 of SEQID NO. 7) and position 2756 of SEQ ID foregoing, e.g., all of the above, or includes one or more NO. 2 (or position 27 of SEQ ID NO. 9). In these embodi groups or species such as humans, primates or rodents. In ments, the computing module can be configured to deter certain embodiments of the aspects described herein, the mine the presence of at least one SNP located at position 677 Subject is a mammal, e.g., a primate, e.g., a human. The 50 of SEQ ID NO. 1 (or position 27 of SEQ ID NO. 7) terms, “patient”, “individual', and “subject” are used inter comprising at least one thymine “Tallele, and/or at position changeably herein. A subject can be male or female. In some 2756 of SEQ ID NO. 2 (or position 27 of SEQ ID NO. 9) embodiments, the Subjects amenable to the assays, methods comprising at least one guanine "G” allele. and/or compositions described herein can be female sub In another embodiment, the determination module can be jects. 55 configured to perform at least one analysis on at least one In certain embodiments, the Subject is a human Subject. test sample to determine the presence or absence of at least Human Subjects can come from any ethnicity or race, e.g., one of the following conditions: including, but not limited to, Caucasian, African American, i. an expression ratio of S-adenosyl methionine (SAM) to Asian and Hispanic, African Indian and Alaska Native, S-adenosyl homocysteine (SAH) Smaller than a pre Native Hawaiian and other Pacific Islander. In some 60 determined reference ratio: embodiments, the human Subjects amenable to the assays, ii. expression of 4-hydroxynonenal (4-HNE) greater than methods and/or compositions described herein can be Cau a pre-determined reference value: casian Subjects. As used herein, the term “Caucasian refers iii. a single nucleotide polymorphism (SNP) at position to a member of the white race consisting of individuals of 677 of SEQID NO: 1 comprising at least one thymine European, north African, or Southwest Asian ancestry. In 65 “T” allele, wherein the SEQ ID NO: 1 is a portion of Some embodiments, the human Subjects amenable to the a genomic nucleic acid sequence of methylenetetrahy assays, methods and/or compositions described herein can drofolate reductase (MTHFR): US 9,540,691 B2 77 78 iv. a SNP at position 2756 of SEQID NO: 2 comprising data to provide a comparison result, wherein the comparison at least one guanine “G” allele, wherein the SEQ ID identifies the presence or absence of at least one condition NO: 2 is a portion of a genomic nucleic acid sequence (A)-(X) described herein; and (b) instructions for displaying of methionine synthase (MTR); and a content based in part on the data output from the deter v. a SNP at position 66 of SEQ ID NO:3 comprising at 5 mination module, wherein the content comprises a signal least one guanine “G” allele, wherein the SEQID NO: indicative of the presence of at least one of the conditions 3 is a portion of a genomic nucleic acid sequence of (A)-(X) described herein, and optionally the absence of any methionine synthase reductase (MTRR). one of these conditions (A)-(X) described herein. In other In these embodiments, the determination module can be embodiments, the content can comprise a signal indicative further configured to determine the presence or absence of at 10 of the absence of all of the conditions (A)-(X) described least one other condition (A)-(X) described herein. For herein. example, in some embodiments, the determination module In some embodiments, the instructions can be specifically can be further configured to determine expression of high programmed to perform a comparison to identify the pres sensitivity c-reactive protein (hsCRP). In some embodi ence of at least one SNP located at position 677 of SEQ ID ments, the determination module can be further configured 15 NO. 1 (or position 27 of SEQID NO. 7) comprising at least to determine the presence or absence of a SNP at position one thymine “T” allele, and/or at position 2756 of SEQ ID 1298 of the SEQID NO. 1 comprising at least one cytosine NO. 2 (or position 27 of SEQID NO. 9) comprising at least “Callele. one guanine “G” allele. In some embodiments, the determination module of the In other embodiments, the instructions can be specifically computer system can be configured to analyze at least one programmed to perform a comparison to identify one of the test sample to determine the presence or absence of at least following conditions: two of the conditions (i)-(v) described above and expression i. an expression ratio of S-adenosyl methionine (SAM) to of hSCRP. S-adenosyl homocysteine (SAH) Smaller than a pre In some embodiments, the determination module of the determined reference ratio: computer system can further comprise a comparison module 25 ii. expression of 4-hydroxynonenal (4 HNE) greater than adapted to compare the data output from the determination a pre-determined reference value: module with reference data stored on the storage device. In iii. a single nucleotide polymorphism (SNP) at position Some embodiments, the reference data can include, but not 677 of SEQID NO: 1 comprising at least one thymine limited to, major and/or rare variants of alleles correspond “T” allele, wherein the SEQ ID NO: 1 is a portion of ing to the SNPs described herein, a pre-determined reference 30 a genomic nucleic acid sequence of methylenetetrahy value of 4-HNE (e.g., at least 3.2 mg/L or above as measured drofolate reductase (MTHFR): in a plasma sample), a pre-determined reference value of iv. a SNP at position 2756 of SEQID NO: 2 comprising hSCRP (e.g., greater than 2.3 mg/L as measured in a plasma at least one guanine “G” allele, wherein the SEQ ID sample), a pre-determined reference ratio of SAM/SAH NO: 2 is a portion of a genomic nucleic acid sequence (e.g., less than 2.8 as measured in a plasma sample), and any 35 of methionine synthase (MTR); and combinations thereof. v. a SNP at position 66 of SEQ ID NO: 3 comprising at Embodiments of the computer system described herein least one guanine “G” allele, wherein the SEQID NO: also comprises a storage device configured to store data 3 is a portion of a genomic nucleic acid sequence of output from the determination module; and a display module methionine synthase reductase (MTRR): for displaying a content based in part on the data output from 40 In these embodiments, the computer readable medium can the determination module, wherein the content comprises a further comprise instructions to identify the presence or signal indicative of the presence of at least one of the absence of at least one other condition (A)-(X) described conditions (i)-(V) described above, or a signal indicative of herein. For example, in one embodiment, the computer the absence of at least one of these conditions. In some readable medium can further comprise instructions to iden embodiments, the content displayed on the display module 45 tify the presence or absence of a SNP at position 1298 of the can further comprise a signal indicative of the Subject SEQ ID NO: 1 comprising at least one cytosine “C” allele. recommended to receive a treatment regimen comprising a In some embodiments, the computer readable medium can folate-containing compound, or a signal indicative of the further comprise instructions to compare expression of high Subject recommended to receive an alternative treatment sensitivity c-reactive protein (hsCRP) with the reference regimen. 50 data, e.g., pre-determined reference value of hsCRP expres In some embodiments, the storage device of the computer sion level greater than 2.3 mg/L as measured in a plasma system can be further configured to store physical informa sample. tion of at least one subject to be tested. Examples of the Embodiments of the display module of the computer physical information can include obesity indicator (e.g., readable medium described herein also comprise instruc BMI) and/or gender of at least one tested subject. In such 55 tions for displaying a content based in part on the data output embodiments, the content displayed on the display module from the comparison module, wherein the content comprises of the computer system can further comprise the obesity a signal indicative of the presence of at least one of the indicator (e.g., the BMI value) or a signal indicative of conditions, or a signal indicative of the absence of at least whether the human subject is obese or not (e.g., whether the one of the conditions. In some embodiments, the display BMI value is at least 30 kg/m or not). 60 module can further comprises instructions to display a signal A tangible and non-transitory (e.g., no transitory forms of indicative of the subject recommended to receive a treatment signal transmission) computer readable medium having regimen comprising a folate-containing compound, or a computer readable instructions recorded thereon to define signal indicative of the Subject recommended to receive an Software modules for implementing a method on a computer alternative treatment regimen. is also provided herein. In one embodiment, the computer 65 In some embodiments, the comparison module of the readable storage medium comprises: (a) instructions for computer readable medium can further comprise instruc comparing the data stored on a storage device with reference tions to determine if a human subject is obese (e.g., if BMI US 9,540,691 B2 79 80 of at least one subject is at least 30 kg/m or not). In such may be embodied as any type of computer code (e.g., embodiments, the display module can further comprise Software or microcode) that can be employed to program a instructions to display the obesity indicator (e.g., the BMI computer to implement the assays and/or methods described value) or a signal indicative of whether the subject is obese herein. The computer executable instructions may be written (e.g., whether the BMI value is at least 30 kg/m or not). in a Suitable computer language or combination of several Embodiments of the systems described herein have been languages. Basic computational biology methods are known described through functional modules, which are defined by to those of ordinary skill in the art and are described in, for computer executable instructions recorded on computer example, Setubal and Meidanis et al., Introduction to Com readable media and which cause a computer to perform putational Biology Methods (PWS Publishing Company, method steps when executed. The modules have been seg 10 Boston, 1997); Salzberg, Searles, Kasif, (Ed.). Computa regated by function for the sake of clarity. However, it tional Methods in Molecular Biology, (Elsevier, Amsterdam, should be understood that the modules need not correspond 1998); Rashidi and Buehler, Bioinformatics Basics: Appli to discrete blocks of code and the described functions can be cation in Biological Science and Medicine (CRC Press, carried out by the execution of various code portions stored London, 2000) and Ouelette and BZevanis Bioinformatics: A on various media and executed at various times. Further 15 Practical Guide for Analysis of Gene and Proteins (Wiley & more, it should be appreciated that the modules may perform Sons, Inc., 2nd ed., 2001). other functions, thus the modules are not limited to having The functional modules of certain embodiments of the any particular functions or set of functions. system described herein can include a determination mod The computer readable media can be any available tan ule, a storage device, and a display module. In some gible media that can be accessed by a computer. Computer embodiments, the system can further include a comparison readable media includes volatile and nonvolatile, removable module. The functional modules can be executed on one, or and non-removable tangible media implemented in any multiple, computers, or by using one, or multiple, computer method or technology for storage of information Such as networks. The determination module 602 has computer computer readable instructions, data structures, program executable instructions to provide sequence information in modules or other data. Computer readable media includes, 25 computer readable form. As used herein, "sequence infor but is not limited to, RAM (random access memory), ROM mation” refers to any nucleotide and/or amino acid (read only memory), EPROM (eraseable programmable read sequence, including but not limited to full-length nucleotide only memory), EEPROM (electrically eraseable program and/or amino acid sequences, partial nucleotide and/or mable read only memory), flash memory or other memory amino acid sequences, or mutated sequences. Moreover, technology, CD-ROM (compact disc read only memory), 30 information “related to the sequence information includes DVDs (digital versatile disks) or other optical storage detection of the presence or absence of a sequence (e.g., media, magnetic cassettes, magnetic tape, magnetic disk detection of a mutation or deletion), determination of the storage or other magnetic storage media, other types of concentration of a sequence in the sample (e.g., amino acid Volatile and non-volatile memory, and any other tangible sequence expression levels, or nucleotide (RNA or DNA) medium which can be used to store the desired information 35 expression levels), and the like. The term “sequence infor and which can accessed by a computer including and any mation' is intended to include the presence or absence of Suitable combination of the foregoing. post-translational modifications (e.g. phosphorylation, gly In some embodiments, the computer readable storage cosylation, Summylation, farnesylation, and the like). media 700 can include the “cloud' system, in which a user As an example, determination modules 602 for determin can store data on a remote server, and later access the data 40 ing sequence information may include known systems for or perform further analysis of the data from the remote automated sequence analysis including but not limited to SeVe. Hitachi FMBIO(R) and Hitachi FMBIOR) II Fluorescent Computer-readable data embodied on one or more com Scanners (available from Hitachi Genetic Systems, puter-readable media, or computer readable medium 700, Alameda, Calif); Spectrumedix R SCE 9610 Fully Auto may define instructions, for example, as part of one or more 45 mated 96-Capillary Electrophoresis Genetic Analysis Sys programs, that, as a result of being executed by a computer, tems (available from SpectruMedix LLC, State College, instruct the computer to perform one or more of the func Pa.); ABI PRISMR 377 DNA Sequencer, ABIR 373 DNA tions described herein (e.g., in relation to system 600, or Sequencer, ABI PRISM(R) 310 Genetic Analyzer, ABI computer readable medium 700), and/or various embodi PRISM(R) 3100 Genetic Analyzer, and ABI PRISM(R) 3700 ments, variations and combinations thereof. Such instruc 50 DNA Analyzer (available from Applied Biosystems, Foster tions may be written in any of a plurality of programming City, Calif.); Molecular Dynamics FluorlmagerTM 575, SI languages, for example, Java, Ji, Visual Basic, C, C#, C++, Fluorescent Scanners, and Molecular Dynamics Fluorl Fortran, Pascal, Eiffel, Basic, COBOL assembly language, magerTM 595 Fluorescent Scanners (available from Amer and the like, or any of a variety of combinations thereof. The sham Biosciences UK Limited, Little Chalfont, Bucking computer-readable media on which Such instructions are 55 hamshire, England); GenomyxSCTM DNA Sequencing embodied may reside on one or more of the components of System (available from Genomyx Corporation (Foster City, either of system 600, or computer readable medium 700 Calif); and Pharmacia ALFTM DNA Sequencer and Phar described herein, may be distributed across one or more of macia ALFexpressTM (available from Amersham Biosci Such components, and may be in transition there between. ences UK Limited, Little Chalfont, Buckinghamshire, Eng The computer-readable media can be transportable such 60 land). that the instructions stored thereon can be loaded onto any Alternative methods for determining sequence informa computer resource to implement the assays and/or methods tion, i.e. determination modules 602, include systems for described herein. In addition, it should be appreciated that protein and DNA analysis. For example, mass spectrometry the instructions stored on the computer readable media, or systems including Matrix Assisted Laser Desorption Ioniza computer-readable medium 200, described above, are not 65 tion-Time of Flight (MALDI-TOF) systems and SELDI limited to instructions embodied as part of an application TOF-MS ProteinChip array profiling systems; systems for program running on a host computer. Rather, the instructions analyzing gene expression data (see, for example, published US 9,540,691 B2 81 82 U.S. Patent Application, Pub. No. U.S. 2003/0194711): As used herein, “stored refers to a process for encoding systems for array based expression analysis: e.g., HT array information on the storage device 604. Those skilled in the systems and cartridge array systems such as GeneChip(R) art can readily adopt any of the presently known methods for AutoLoader, Complete GeneChip(R) Instrument System, recording information on known media to generate manu GeneChip(R) Fluidics Station 450, GeneChip(R) Hybridization 5 factures comprising the sequence information or expression Oven 645, GeneChip(R) QC Toolbox Software Kit, level information. GeneChip(R) Scanner 3000 7 G plus Targeted Genotyping A variety of Software programs and formats can be used System, GeneChip R. Scanner 3000 7 G Whole-Genome to store the sequence information or expression level infor Association System, GeneTitanTM Instrument, and mation on the storage device. Any number of data processor 10 structuring formats (e.g., text file or database) can be GeneChip(R) Array Station (each available from Affymetrix, employed to obtain or create a medium having recorded Santa Clara, Calif.); automated ELISA systems (e.g., DSX(R) thereon the sequence information or expression level infor or DS2(R) (available from Dynax, Chantilly, Va.) or the mation. Triturus(R) (available from Grifols USA, Los Angeles, By providing sequence information and/or expression Calif.), The MagoR Plus (available from Diamedix Corpo 15 level information in computer-readable form, one can use ration, Miami, Fla.); Densitometers (e.g. X-Rite-508-Spec the sequence information and/or expression level informa tro Densitometer(R) (available from RP ImagingTM, Tucson, tion in readable form in the comparison module 606 to Ariz.), The HYRSTM 2 HIT densitometer (available from compare a specific sequence or expression profile with the Sebia Electrophoresis, Norcross, Ga.); automated Fluores reference data within the storage device 604. For example, cence insitu hybridization systems (see for example, U.S. search programs can be used to identify fragments or regions Pat. No. 6,136,540): 2D gel imaging systems coupled with of the sequences that match a particular sequence (reference 2-D imaging Software; microplate readers; Fluorescence data, e.g., sequence information of major or rare alleles activated cell sorters (FACS) (e.g. Flow Cytometer corresponding to the SNPs described herein) or direct com FACSVantage SE, (available from Becton Dickinson, parison of the determined expression level can be compared Franklin Lakes, N.J.); and radio isotope analyzers (e.g. 25 to the reference data expression level (e.g., median expres Scintillation counters). sion level information obtained from a population of sub The sequence information of SNPs and/or expression jects). The comparison made in computer-readable form level information of plasma/serum biomarkers determined provides a computer readable comparison result which can in the determination module can be read by the storage be processed by a variety of means. Content 608 based on device 604. As used herein the “storage device'' 604 is 30 the comparison result can be retrieved from the determina intended to include any suitable computing or processing tion module 600 or the comparison module 606 to indicate apparatus or other device configured or adapted for storing the presence or absence of at least one SNP and serum/ data or information. Examples of electronic apparatus Suit plasma biomarkers described herein. able for use with the system described herein can include In one embodiment the reference data stored in the stand-alone computing apparatus, data telecommunications 35 storage device 604 to be read by the determination module networks, including local area networks (LAN), wide area 600 or the comparison module 606 is sequence information networks (WAN). Internet, Intranet, and Extranet, and local data obtained from a control biological sample of the same and distributed computer processing systems. Storage type as the biological sample to be tested. Alternatively, the devices 604 also include, but are not limited to: magnetic reference data are a database, e.g., a part of the entire storage media, such as floppy discs, hard disc storage media, 40 genome sequence of an organism, or a protein family of magnetic tape, optical storage media Such as CD-ROM, sequences, or an expression level profile (RNA, protein or DVD, electronic storage media such as RAM, ROM, peptide). In one embodiment, the reference data are EPROM, EEPROM and the like, general hard disks and sequence information and/or expression level profiles that hybrids of these categories such as magnetic/optical storage are used to facilitate determining whether a subject with media. The storage device 604 is adapted or configured for 45 depression should be recommended for a treatment regimen having recorded thereon sequence information or expression comprising a folate-containing compound. level information. Such information may be provided in In one embodiment, the reference data are one or more digital form that can be transmitted and read electronically, reference polynucleotide, or polypeptide sequences. In some e.g., via the Internet, on diskette, via USB (universal serial embodiments, the reference polynucleotide sequences can bus) or via any other suitable mode of communication, e.g., 50 be derived from nucleotide sequences selected from the the “cloud. group consisting of SEQID NO: 1, SEQID NO: 2, SEQID As used herein, “expression level information” refers to NO: 3, and a portion there of comprising the nucleotide at any nucleotide and/or amino acid expression level informa the corresponding SNP location, and complements thereof. tion, including but not limited to full-length nucleotide In some embodiments, the reference polypeptide sequences and/or amino acid sequences, partial nucleotide and/or 55 can be derived from amino acid sequences selected from the amino acid sequences, or mutated sequences. Moreover, group consisting of SEQID NO: 4, SEQID NO: 5, SEQID information “related to the expression level information NO: 6, and a portion thereof comprising an amino acid includes detection of the presence or absence of a sequence residue at the corresponding mutation location. (e.g., presence or absence of an amino acid sequence, In one embodiment, the reference data are electronically nucleotide sequence, or post translational modification), 60 or digitally recorded and annotated from databases includ determination of the concentration of a sequence in the ing, but not limited to GenBank (NCBI) protein and DNA sample (e.g., amino acid sequence levels, or nucleotide databases such as genome. ESTs, SNPS, Traces, Celara, (RNA or DNA) expression levels, or level of post transla Ventor Reads, Watson reads, HGTS, and the like: Swiss tional modification), and the like. In some embodiments, the Institute of Bioinformatics databases, such as ENZYME, expression level information also includes arithmetic 65 PROSITE, SWISS-2DPAGE, Swiss-Prot and TrEMBL data manipulation of expression levels of at least two or more bases; the Melanie software package or the ExPASy WWW biomarkers (e.g., expression ratio of SAM to SAH). server, and the like; the SWISS-MODEL, Swiss-Shop and US 9,540,691 B2 83 84 other network-based computational tools; the Comprehen Thus, in a particular embodiment, users can directly access sive Microbial Resource database (available from The Insti data (via Hypertext links for example) residing on Internet tute of Genomic Research). The resulting information can be databases using a HTML interface provided by Web brows stored in a relational data base that may be employed to ers and Web servers. In another embodiment, users can determine homologies between the reference data or genes directly access data residing on the "cloud provided by the or proteins within and among genomes. cloud computing service providers. The “comparison module 606 can use a variety of In one embodiment, the comparison module 606 performs available Software programs and formats for the comparison comparisons with mass-spectrometry spectra, for example operative to compare sequence information determined in comparisons of peptide fragment sequence information can 10 be carried out using spectra processed in MATLAB with the determination module 602 to reference data. In one script called “Qcealign” (see for example WO2007/022248, embodiment, the comparison module 606 is configured to herein incorporated by reference) and “Qpeaks” (Spectrum use pattern recognition techniques to compare sequence Square Associates, Ithaca, N.Y.), or Ciphergen Peaks 2.1TM information from one or more entries to one or more Software. The processed spectra can then be aligned using reference data patterns. The comparison module 606 may be 15 alignment algorithms that align sample data to the control configured using existing commercially-available or freely data using minimum entropy algorithm by taking baseline available software for comparing patterns, and may be corrected data (see for example WIPO Publication WO2007/ optimized for particular data comparisons that are con 022248, herein incorporated by reference). The comparison ducted. The comparison module 606 provides computer result can be further processed by calculating ratios. Protein readable information related to the sequence information expression profiles can be discerned. that can include, for example, detection of the presence or In one embodiment, computational algorithms are used in absence of a sequence (e.g., detection of a mutation or the comparison module 606 Such as expectation-maximiza deletion (protein or DNA), information regarding distinct tion (EM), subtraction and PHASE are used in methods for alleles, detection of post-translational modification, or omis statistical estimation of haplotypes (see, e.g., Clark, A. G. sion or repetition of sequences); determination of the con 25 Mol Biol Evol 7:111-22 (1990); Stephens, M., Smith, centration of a sequence in the sample (e.g., amino acid N. J. & Donnelly, P. Am J Hum Genet. 68: 978-89 (2001): sequence/protein expression levels, or nucleotide (RNA or Templeton, A. R. Sing, C. F. Kessling, A. & Humphries, DNA) expression levels, or levels of post-translational Genetics 120:1145-54 (1988)). modification), or determination of an expression profile. Various algorithms are available which are useful for In one embodiment, the comparison module 606 permits 30 comparing data and identifying the predictive gene signa the prediction of protein sequences from polynucleotide tures. For example, algorithms such as those identified in Xu sequences, permits prediction of open reading frames et al., Physiol. Genomics 11:11-20 (2002). There are numer (ORF), or permits prediction of homologous sequence infor ous software available for detection of SNPs and polymor mation in comparison to reference data, i.e., homologous phisms that can be used in the comparison module, includ protein domains, homologous DNA or RNA sequences, or 35 ing, but not limited to: HaploSNPer, a web-based program homologous exons and/or introns. for detecting SNPs and alleles in user-specified input In one embodiment, the comparison module 606 uses sequences from both diploid and polyploid species (avail sequence information alignment programs such as BLAST able on the world-wide web at bioinformatics.nl/tools/hap (Basic Local Alignment Search Tool) or FAST (using the losnperf; see also Tang et al., BMC Genetics 9:23 (2008)); Smith-Waterman algorithm) may be employed individually 40 Polybayes, a tool for SNP discovery in redundant DNA or in combination. These algorithms determine the align sequences (Marth, G. T., et al., Nature Genetics 23(4):452-6 ment between similar regions of sequences and a percent (1999); SSAHA-SNP, a polymorphism detection tool that identity between sequences. For example, alignment may be uses the SSAHA alignment algorithm (available from Well calculated by matching, bases-by-base or amino acid-by come Trust Sanger Institute, Cambridge, United Kingdom, amino-acid. 45 see also Ning Z. et al., Genome Research 11 (10): 1725-9 The comparison module 606, or any other module of the (2001)); Polyphred, A SNP discovery package built on system described herein, may include an operating system phred, phrap, and consed tools (available on the world-wide (e.g., UNIX) on which runs a relational database manage web, see Nickerson, D A et al., Nucleic Acids Research ment system, a World Wide Web application, and a World 25(14):2745-51 (1997)); NovoSNP, a graphical Java-based Wide Web server. World Wide Web application includes the 50 program (PC/Mac/Linux) to identify SNPs and indels (avail executable code necessary for generation of database lan able on the world-wide web, see Weckx, S. et al., Genome guage statements (e.g., Structured Query Language (SQL) Research 15(3):436-442 (2005)); SNPdetectorTM, for auto statements). Generally, the executables will include embed mated identification of SNPs and mutations in fluorescence ded SQL statements. In addition, the World Wide Web based resequencing reads (available from Affymetrix, Santa application may include a configuration file which contains 55 Clara, Calif.), see also Zhang et al. PLoS Comput Biol pointers and addresses to the various Software entities that (5):e53 (2005). SNPdetector runs on Unix/Linux platform comprise the server as well as the various external and and is available publicly; Affymetrix (Santa Clara, Calif.) internal databases which must be accessed to service user has multiple data analysis Software that can be used, for requests. The Configuration file also directs requests for example Genotyping ConsoleTM Software, GeneChip(R) server resources to the appropriate hardware—as may be 60 Sequence Analysis Software (GSEQ), GeneChip(R) Targeted necessary should the server be distributed over two or more Genotyping Analysis Software (GTGS) and Expression separate computers. In one embodiment, the World Wide ConsoleTM Software. Web server supports a TCP/IP protocol. Local networks such In one embodiment, the comparison module 606 com as this are sometimes referred to as “Intranets.” An advan pares gene expression profiles. For example, detection of tage of Such Intranets is that they allow easy communication 65 gene expression profiles can be determined using Affymetrix with public domain databases residing on the World Wide Microarray Suite software version 5.0 (MAS 5.0) (available Web (e.g., the GenBank or Swiss Pro World WideWeb site). from Affymetrix, Santa Clara, Calif.) to analyze the relative US 9,540,691 B2 85 86 abundance of a gene or genes on the basis of the intensity of 610 can be any suitable device configured to receive from a the signal from probe sets, and the MAS 5.0 data files can computer and display computer readable information to a be transferred into a database and analyzed with Microsoft user. Non-limiting examples include, for example, general Excel and GeneSpring 6.0 software (available from Agilent purpose computers such as those based on Intel PENTIUM Technologies, Santa Clara, Calif.). The detection algorithm type processor, Motorola PowerPC, Sun UltraSPARC, of MAS 5.0 software can be used to obtain a comprehensive Hewlett-Packard PA-RISC processors, any of a variety of overview of how many transcripts are detected in given processors available from Advanced Micro Devices (AMD) samples and allow a comparative analysis of two or more of Sunnyvale, Calif., or any other type of processor, visual microarray data sets. display devices Such as flat panel displays, cathode ray tubes In one embodiment, the comparison module 606 com 10 and the like, as well as computer printers of various types. pares protein expression profiles. Any available comparison In one embodiment, a World Wide Web browser is used Software can be used, including but not limited to, the for providing a user interface for display of the content 608 Ciphergen Express (CE) and Biomarker Patterns Software based on the comparison result. It should be understood that (BPS) package (available from Ciphergen Biosystems, Inc., other modules of the system described herein can be adapted Freemont, Calif.). Comparative analysis can be done with 15 to have a web browser interface. Through the Web browser, protein chip system software (e.g., The Proteinchip Suite a user may construct requests for retrieving data from the (available from Bio-Rad Laboratories, Hercules, Calif.). comparison module. Thus, the user will typically point and Algorithms for identifying expression profiles can include click to user interface elements such as buttons, pull down the use of optimization algorithms such as the mean variance menus, Scroll bars and the like conventionally employed in algorithm (e.g. JMP Genomics algorithm available from graphical user interfaces. The requests so formulated with JMP Software Cary, N.C.). the user's Web browser are transmitted to a Web application In one embodiment, pattern comparison software can be which formats them to produce a query that can be employed used to determine whether patterns of expression or muta to extract the pertinent information related to the sequence tions are indicative of the presence or the absence of the information, e.g., display of an indication of the presence or conditions detected in a test sample of a Subject. 25 absence of mutation or deletion (DNA or protein); display of The comparison module 606 provides computer readable expression levels of an amino acid sequence (protein); comparison result that can be processed in computer read display of nucleotide (RNA or DNA) expression levels: able form by predefined criteria, or criteria defined by a user, display of expression, SNP, or mutation profiles, or haplo to provide a content based in part on the comparison result types, or display of information based thereon. In one that may be stored and output as requested by a user using 30 embodiment, the sequence information of the reference a display module 610. The display module 610 enables sample data is also displayed. display of a content 608 based in part on the comparison In any embodiments, the comparison module can be result for the user, wherein the content 608 is a signal executed by a computer implemented Software as discussed indicative of the presence of at least one of the conditions earlier. In Such embodiments, a result from the comparison described herein or a signal indicative of the absence of at 35 module can be displayed on an electronic display. The result least one of the conditions described herein. Such signal, can can be displayed by graphs, numbers, characters or words. be for example, a display of content 608 indicative of the In additional embodiments, the results from the comparison presence or absence of at least one of the conditions on a module can be transmitted from one location to at least one computer monitor, a printed page of content 608 indicating other location. For example, the comparison results can be the presence or absence of at least one of the conditions from 40 transmitted via any electronic media, e.g., internet, fax, a printer, or a light or sound indicative of the presence or phone, a "cloud' system, and any combinations thereof. absence of at least one of the conditions. Using the "cloud' system, users can store and access per In various embodiments of the computer system described Sonal files and data or perform further analysis on a remote herein, the comparison module 606 can be integrated into server rather than physically carrying around a storage the determination module 602. 45 medium such as a DVD or thumb drive. The content 608 based on the comparison result can also The system 600, and computer readable medium 700, is include an expression profile of one or more plasma/serum merely illustrative embodiments for performing assays for biomarkers described herein. In one embodiment, the con selecting a treatment regimen for a Subject with depression, tent 608 based on the comparison includes a sequence of a based on expression level information or sequence informa particular gene or protein and a determination of the pres 50 tion, and is not intended to limit the scope of the inventions ence of one or more mutations, or specific post-translational described herein. Variations of system 600, and computer modification. In one embodiment, the content 608 based on readable medium 700, are possible and are intended to fall the comparison result is merely a signal indicative of the within the scope of the inventions described herein. presence or absence of at least one of the conditions The modules of the machine, or used in the computer described herein. In some embodiments, the content 608 can 55 readable medium, may assume numerous configurations. be a signal indicative of an obesity indicator (e.g., a BMI For example, function may be provided on a single machine value) or a signal indicative of whether the subject is obese or distributed over multiple machines. (e.g., whether the BMI value is at least 30 kg/m or not). In Kits Some embodiments, the content 608 can be a signal indica Based on the identification of SNPs and/or peripheral tive of the subject recommended to receive a treatment 60 markers associated with a response to the use of a folate regimen comprising a folate-containing compound, or a containing compound, one aspect described herein also signal indicative of the Subject recommended to receive an provides for the design and preparation of detection reagents alternative treatment regimen. needed to identify the SNPs and/or peripheral markers In one embodiment, the content 608 based on the com disclosed herein in a test sample of a Subject. For example, parison result is displayed a on a computer monitor. In one 65 the detection reagents can be designed and prepared to embodiment, the content 608 based on the comparison result identify SNPs in MTHFR locus and MTR locus and option is displayed through printable media. The display module ally MTRR locus involved in assays and methods described US 9,540,691 B2 87 88 herein, and/or measure expression levels of SAM, SAH and In some embodiments, the plurality of oligonucleotide 4-HNE in a test sample. Examples of detection reagents that primers can bind to at least one allele of about 2-30 SNPs, can be used to identify the disclosed SNPs in a test sample e.g., about 3-25 SNPs, about 3-20 SNPs, about 3-10 SNPs, can include a primer and a probe, wherein the probe can or about 3-5 SNPs, wherein the SNPs comprise at least two selectively hybridize the SNP-containing nucleic acid mol or any combinations of the conditions (A)-(U) described ecules, as compared to a nucleic acid molecule which does herein (e.g., but not limited to, a combination of conditions not contain the SNP at the same nucleotide position. (A) and (C)). Examples of detection regents that can be used to measure Additional reagents included in the kit can vary with the expression levels of peripheral proteins (e.g., SAM, SAH selection of a genotyping assay, e.g., but not limited to, and/or 4-HNE) in a test sample can include antibodies 10 allele-specific probe hybridization, allele-specific primer against Such proteins, or a primer and a probe, wherein the extension, allele-specific amplification, sequencing, 5' probe specifically hybridizes to a nucleic acid molecule nuclease digestion, molecular beacon assay, DNA chip corresponding to such proteins. analysis, oligonucleotide ligation assay, size analysis, Accordingly, provided herein include kits for selecting a 15 single-stranded conformation polymorphism, polymerase treatment regimen for a subject with depression. In some chain reaction (PCR), real-time quantitative PCR, and any embodiments, the kits can be used for monitoring the combinations thereof. efficacy response of a subject treated with a combination In some embodiments, the kit can further comprise at least therapy comprising a folate-containing compound, for one reagent to determine expression of at least one bio example as shown in Example 5. The kits can include at least marker described herein (e.g., SAM, SAH, 4-HNE and one reagent specific for detecting for the presence or absence hsCRP). For example, in one embodiment, the kit can of SNP markers (i)-(xxi) described herein (e.g., MTHFR further comprise a solid substrate support affixed with at C677T. MTR A2756G, and/or MTRR A66G) and/or anti least one protein-based binding moiety (e.g., an antibody) bodies specific for detecting peripheral biomarkers (xxii)- that specifically binds to one or more of the biomarkers (xxiv) (e.g., SAM, SAH, and 4-HNE), and instructions for 25 described herein. Exemplary Solid Substrate Support can determining that the Subject is recommended for a treatment include, but not limited to, a microtiter plate for ELISA, a regimen comprising a folate-containing compound if the dipstick, a magnetic bead, or any combinations thereof. presence of at least one of the conditions described herein is Different solid substrate supports can be selected based on detected in a test sample (e.g., a blood sample, a saliva various types of expression assays, e.g., but not limited to, sample, or a buccal sample) of the Subject, for example, the 30 western blot, enzyme linked absorbance assay, mass spec procedures as shown in Example 5. The kit can optionally trometry, immunoassay, flow cytometry, immunohisto include a nucleic acid for detection of the gene of interest. chemical analysis, and any combinations thereof. In one embodiment, a kit can comprise an oligonucleotide In another embodiment, the kit can further comprise at array affixed with a plurality of oligonucleotide probes that least one primer designed to probe one or more biomarkers interrogate no more than 30 SNPs (including no more than 35 described herein. 25 SNPs, no more than 20 SNPs, no more than 15 SNPs, no Embodiments of the various aspects described herein can more than 10 SNPs, no more than 5 SNPs or less), wherein also be described by any one of the following numbered the SNPs comprise at least two or any combinations of the paragraphs. conditions (A)-(U) described herein (e.g., but not limited to, 1. An assay for selecting a treatment regimen for a human a combination of conditions (A) and (C)); and an optional 40 Subject with depression, comprising: container containing a detectable label (e.g., comprising a (a) Subjecting a test sample from a human Subject, who is fluorescent molecule) to be conjugated to a nucleotide diagnosed as having depression or having a risk for molecule derived from a test sample of a human Subject; and depression, to at least one genotyping assay adapted to at least one reagent. Examples of a reagent that can be determine the genotypes of at least two loci, wherein included in the kit can include, without limitations, a restric 45 said at least two loci are: tion enzyme, a universal adaptor to be conjugated to a i. position 677 of SEQID NO. 1 or position 27 of SEQ nucleotide molecule, a primer complementary to the univer ID NO. 7 (identified by rs18.01133), wherein the sal adaptor, a wash agent, and any combinations thereof. SEQ ID NO. 1 and SEQ ID NO. 7 are each inde In some embodiments, the plurality of oligonucleotide pendently a portion of a genomic nucleic acid probes affixed to an oligonucleotide array can interrogate 50 sequence of methylenetetrahydrofolate reductase about 2-30 SNPs, e.g., about 3-25 SNPs, about 3-20 SNPs, (MTHFR): about 3-10 SNPs, or about 3-5 SNPs, wherein the SNPs ii. position 2756 of SEQ ID NO. 2 or position 27 of comprise at least two or any combinations of the conditions SEQ ID NO. 9 (identified by rs1805087), wherein (A)-(U) described herein (e.g., but not limited to, a combi the SEQ ID NO. 2 and SEQ ID NO. 9 are each nation of conditions (A) and (C)). 55 independently a portion of a genomic nucleic acid In an alternative embodiment, a kit can comprise a sequence of methionine synthase (MTR); and plurality of oligonucleotide primers that bind to at least one (b) detecting from the genotypes of said at least two loci allele of no more than 30 SNPs (including no more than 25 the presence of a single nucleotide polymorphism SNPs, no more than 20 SNPs, no more than 15 SNPs, no (SNP) selected from the following: more than 10 SNPs, no more than 5 SNPs or less), wherein 60 i. a SNP677 at position 677 of SEQ ID NO. 1 or each Subset of oligonucleotide primers that bind to a specific position 27 of SEQID NO. 7 comprising at least one allele of a SNP is labeled with a distinct reporter, and thymine “T” allele; wherein said SNPs comprise at least two or any combina ii. a SNP2756 at position 2756 of SEQ ID NO. 2 or tions of the SNP conditions (A)-(U) described herein (e.g., position 27 of SEQID NO. 9 comprising at least one but not limited to a combination of conditions (A) and (C)); 65 guanine “G” allele; and and at least one reagent, e.g., but not limited to, free iii. a combination of at least one SNP677 Tallele and nucleotide bases, a polymerase, or both. at least one SNP2756 Gallele; and US 9,540,691 B2 89 90 if at least one of Tallele at position SNP677 or at least one iv. genotype of a SNP locus at rs1883729 (position 27 of Gallele at position SNP2756 or both at least one T SEQ ID NO. 12), wherein the SEQ ID NO. 12 is a allele at position SNP677 and at least one Gallele at portion of a genomic nucleic acid sequence of DNA position SNP2756 is detected, then selecting, and (cytosine-5)-methyltransferase 3 beta (DNMT3B); optionally administering, a treatment regimen compris v. genotype of a SNP locus at rs7163862 (position 27 of ing an effective amount of a folate-containing com SEQ ID NO. 13), wherein the SEQ ID NO. 13 is a pound. portion of a genomic nucleic acid sequence of GTP 2. The assay of paragraph 1, wherein if neither SNP677 T cyclohydrolase 1 feedback regulatory protein allele nor SNP2756 Gallele is detected then selecting a (GCHFR): treatment regimen without a folate-containing compound. 10 vi. genotype of a SNP locus at rs12659 (position 27 of 3. An assay for selecting a treatment regimen for a human SEQ ID NO. 14), wherein the SEQ ID NO. 14 is a Subject having depression, comprising: portion of a genomic nucleic acid sequence of reduced Subjecting a test sample of the human Subject, who is folate carrier protein (RCF2); diagnosed as having depression or having a risk for 15 vii. genotype of a SNP locus at rs202676 (position 27 of depression, to at least one assay to detect the presence SEQ ID NO. 15), wherein the SEQ ID NO. 15 is a or absence of at least one of the following conditions: portion of a genomic nucleic acid sequence of folate i. an expression ratio of S-adenosyl methionine (SAM) hydrolase (prostate-specific membrane antigen) 1 to S-adenosyl homocysteine (SAH) Smaller than a (FOLH1); pre-determined reference ratio: viii. genotype of a SNP locus at rs2297291 (position 27 of ii. expression of 4-hydroxynonenal (4-HNE) greater SEQ ID NO. 16), wherein the SEQ ID NO. 16 is a than a pre-determined reference value; portion of a genomic nucleic acid sequence of reduced iii. a single nucleotide polymorphism (SNP) at position folate carrier protein (RCF1): 677 of SEQID NO. 1 or position 27 of SEQID NO. ix. genotype of a SNP locus at rs1051266 (position 27 of 7 (identified by rs1801133) comprising at least one 25 SEQ ID NO. 17), wherein the SEQ ID NO. 17 is a thymine “T” allele, wherein the SEQ ID NO. 1 and portion of a genomic nucleic acid sequence of reduced SEQ ID NO. 7 are each independently a portion of folate carrier protein (RCF1): a genomic nucleic acid sequence of methylenetetra X. genotype of a SNP locus at rs8007267 (position 27 of hydrofolate reductase (MTHFR): SEQ ID NO. 18), wherein the SEQ ID NO. 18 is a iv. a SNP at position 2756 of SEQID NO. 2 or position 30 portion of a genomic nucleic acid sequence of GTP 27 of SEQID NO. 9 comprising at least one guanine cyclohydrolase 1 (GCH1); “G” allele, wherein the SEQID NO. 2 and SEQ ID NO. 9 are each independently a portion of a genomic xi. genotype of a SNP locus at rs7639752 (position 27 of nucleic acid sequence of methionine synthase SEQ ID NO. 19), wherein the SEQ ID NO. 19 is a (MTR); and 35 portion of a genomic nucleic acid sequence of choline v. a SNP at position 66 of SEQID NO. 3 or position 27 phosphate cytidylyltransferase A (PCYT1A); of SEQ ID NO. 10 comprising at least one guanine xii. genotype of a SNP locus at rs6275 (position 27 of “G” allele, wherein the SEQ ID NO. 3 and SEQ ID SEQ ID NO. 20), wherein the SEQ ID NO. 20 is a NO. 10 are each independently a portion of a portion of a genomic nucleic acid sequence of dop genomic nucleic acid sequence of methionine Syn 40 amine receptor D2 (DRD2); thase reductase (MTRR): xiii. genotype of a SNP locus at rs1079596 (position 27 of and if at least one of said conditions is detected to be SEQ ID NO. 21), wherein the SEQ ID NO. 21 is a present then recommending that a treatment regimen portion of a genomic nucleic acid sequence of dop comprising a folate-containing compound be selected; amine receptor D2 (DRD2); and if none of these conditions is determined to be 45 xiv. genotype of a SNP locus at rs11240594 (position 27 present then recommending a treatment regimen with of SEQ ID NO. 22), wherein the SEQ ID NO. 22 is a out a folate-containing compound. portion of a genomic nucleic acid sequence of dop 4. The assay of any one of the preceding paragraphs, further amine receptor D2 (DRD2); comprising determining a parameter of at least one bio XV. genotype of a SNP locus at rs4633 (position 27 of SEQ marker from the following: 50 ID NO. 23), wherein the SEQ ID NO. 23 is a portion i. genotype of a SNP locus at position 1793 of SEQ ID of a genomic nucleic acid sequence of catechol-O- NO. 1 or position 27 of SEQ ID NO. 8 (identified by methyltransferase (COMT); rs2274.976), wherein SEQID NO. 1 and SEQ ID NO. xvi. genotype of a SNP locus at rs4680 (position 27 of 8 are each independently a portion of a genomic nucleic SEQ ID NO. 24), wherein the SEQ ID NO. 24 is a acid sequence of methylenetetrahydrofolate reductase 55 portion of a genomic nucleic acid sequence of catechol (MTHFR): O-methyltransferase (COMT); ii. genotype of a SNP locus at position 66 of SEQID NO. xvii. genotype of a SNP locus at rs250682 (position 27 of 3 or position 27 of SEQ ID NO. 10 (identified by SEQ ID NO. 25, wherein the SEQ ID NO. 25 is a rs 1801394), wherein the SEQ ID NO. 3 and SEQ ID portion of a genomic nucleic acid sequence of Solute NO. 10 are each independently a portion of a genomic 60 carrier family 6 (neurotransmitted transported, dop nucleic acid sequence of methionine synthase reductase amine), member 3 (SLC6A3); (MTRR): xviii. genotype of a SNP locus at rs2277.820 (position 27 iii. genotype of a SNP locus at rs1006737 (position 27 of of SEQ ID NO. 26), wherein the SEQ ID NO. 26 is a SEQ ID NO. 11), wherein the SEQ ID NO. 11 is a portion of a genomic nucleic acid sequence of formimi portion of a genomic nucleic acid sequence of calcium 65 notransferase cyclodeaminase (FTCD); channel, Voltage-dependent, L type, alpha 1C Subunit xix. genotype of a SNP locus at rs2236225 (position 27 of (CACNA1C); SEQ ID NO. 27), wherein the SEQ ID NO. 27 is a US 9,540,691 B2 91 92 portion of a genomic nucleic acid sequence of meth (a) Subjecting a test sample of the human Subject, who is ylenetetrahydrofolate dehydrogenase (NADP+ depen diagnosed as having depression or having a risk for dent) 1 (MTHFD1); depression, to at least one analysis to determine param XX. an obesity indicator (e.g., a BMI value); eters of at least two biomarkers from: XXi. expressions of SAM and SAH; i. genotype of a SNP locus at position 677 of SEQ ID xxii. expression of 4-HNE; NO. 1 or position 27 of SEQID NO. 7 (identified by xxiii. expression of hsCRP; and any combinations rs 18.01133), wherein the SEQID NO. 1 and SEQID thereof. NO. 7 are each independently a portion of a genomic 5. The assay of paragraph 4, further comprising determining, nucleic acid sequence of methylenetetrahydrofolate from the determined parameter of said at least one bio 10 marker, the presence of at least one condition from the reductase (MTHFR): following: ii. genotype of a SNP locus at rs2274976 (position 1793 i.a SNP at position 1793 of SEQID NO. 1 or position 27 of SEQID NO. 1 or position 27 of SEQ ID NO. 8), of SEQ ID NO. 8 comprising at least one adenine “A” wherein the SEQ ID NO. 1 and SEQ ID NO. 8 are allele; 15 each independently a portion of a genomic nucleic ii. a SNP at position 66 of SEQ ID NO. 3 or position 27 acid sequence of methylenetetrahydrofolate reduc of SEQID NO. 10 comprising at least one guanine “G” tase (MTHFR): allele; iii. genotype of a SNP locus at position 2756 of SEQID iii. a SNP at rs1006737 (position 27 of SEQ ID NO. 11) NO. 2 or position 27 of SEQID NO. 9 (identified by comprising at least one adenine “A” allele; rs1805087), wherein the SEQID NO. 2 and SEQID iv. a SNP at rs1883729 (position 27 of SEQ ID NO. 12) NO. 9 are each independently a portion of a genomic comprising at least one adenine “A” allele; nucleic acid sequence of methionine synthase v. a SNP at rs7163862 (position 27 of SEQ ID NO. 13) (MTR): comprising at least one thymine “T” allele; iv. genotype of a SNP locus at position 66 of SEQ ID vi. a SNP at rs12659 (position 27 of SEQ ID NO. 14) 25 NO. 3 or position 27 of SEQ ID NO. 10 (identified comprising at least one thymine “T” allele; by rs1801394), wherein the SEQID NO. 3 and SEQ vii. a SNP at rs202676 (position 27 of SEQ ID NO. 15) ID NO. 10 are each independently a portion of a comprising at least one guanine "G” allele; genomic nucleic acid sequence of methionine Syn viii. a SNP at rs2297291 (position 27 of SEQ ID NO. 16) thase reductase (MTRR): comprising at least one adenine “A” allele; 30 v. genotype of a SNP locus at rs1006737 (position 27 ix. a SNP at rs1051266 (position 27 of SEQ ID NO. 17) of SEQ ID NO. 11, wherein the SEQ ID NO. 11 is comprising at least one adenine “A” allele; a portion of a genomic nucleic acid sequence of x. a SNP at rs8007267 (position 27 of SEQID NO. 18) calcium channel, Voltage-dependent, L type, alpha comprising at least one thymine “T” allele; 1C subunit (CACNA1C)); xi. a SNP at rs7639752 (position 27 of SEQ ID NO. 19) 35 vi. genotype of a SNP locus at rs1883729 (position 27 comprising at least one adenine “A” allele; of SEQ ID NO. 12, wherein the SEQ ID NO. 12 is xii. a SNP at rs6275 (position 27 of SEQ ID NO. 20) a portion of a genomic nucleic acid sequence of comprising at least one thymine “T” allele; DNA (cytosine-5)-methyltransferase 3 beta xiii. a SNP at rs1079596 (position 27 of SEQ ID NO. 21) (DNMT3B)); comprising at least one thymine “T” allele; 40 vii. genotype of a SNP locus at rs7163862 (position 27 xiv. a SNP at rs11240594 (position 27 of SEQID NO. 22) of SEQID NO. 13, wherein the SEQ ID NO. 13 is comprising at least one adenine “A” allele; a portion of a genomic nucleic acid sequence of GTP XV, a SNP at rs4633 (position 27 of SEQ ID NO. 23) cyclohydrolase 1 feedback regulatory protein comprising at least one cytosine “C” allele; (GCHFR)); xvi. a SNP at rs4680 (position 27 of SEQ ID NO. 24) 45 viii. genotype of a SNP locus at rs12659 (position 27 of comprising at least one guanine "G” allele; SEQ ID NO. 14, wherein the SEQ ID NO. 14 is a xvii. a SNP at rs250682 (position 27 of SEQ ID NO. 25) portion of a genomic nucleic acid sequence of comprising at least one cytosine “C” allele; reduced folate carrier protein (RCF2)); xviii. aSNP at rs2277820 (position 27 of SEQID NO. 26) ix. genotype of a SNP locus at rs202676 (position 27 of comprising at least one thymine “T” allele; and 50 SEQ ID NO. 15, wherein the SEQ ID NO. 15 is a xix. a SNP at rs2236225 (position 27 of SEQID NO. 27) portion of a genomic nucleic acid sequence of folate comprising at least one adenine “A” allele; hydrolase (prostate-specific membrane antigen) 1 XX. obesity (e.g., defined by a BMI value of 30 kg/m or (FOLH1)); greater); X. genotype of a SNP locus at rs2297291 (position 27 XXi. an expression ratio of SAM to SAH smaller than a 55 of SEQ ID NO. 16, wherein the SEQ ID NO. 16 is pre-determined reference ratio: a portion of a genomic nucleic acid sequence of xxii. an expression of 4-HNE greater than a pre-deter reduced folate carrier protein (RCF1)); mined reference value; xi. genotype of a SNP locus at rs1051266 (position 27 xxiii. an expression of hsCRP greater than about 2.3 mg of SEQID NO. 17, wherein the SEQ ID NO. 17 is per liter as measured in a plasma sample; and any 60 a portion of a genomic nucleic acid sequence of combinations thereof, and reduced folate carrier protein (RCF1)); if at least one of the condition is detected, then selecting, xii. genotype of a SNP locus at rs8007267 (position 27 and optionally administering, a treatment regimen com of SEQ ID NO. 18, wherein the SEQ ID NO. 18 is prising an effective amount of a folate-containing com a portion of a genomic nucleic acid sequence of GTP pound. 65 cyclohydrolase 1 (GCH1)); 6. An assay for selecting a treatment regimen for a human xiii. genotype of a SNP locus at rs7639752 (position 27 Subject having depression, comprising: of SEQID NO. 19, wherein the SEQ ID NO. 19 is US 9,540,691 B2 93 94 a portion of a genomic nucleic acid sequence of ix. a SNP at rs202676 (position 27 of SEQ ID NO. 15) choline-phosphate cytidylyltransferase A comprising at least one guanine "G” allele; (PCYT1A)); x. a SNP at rs2297291 (position 27 of SEQID NO. 16) xiv. genotype of a SNP locus at rs6275 (position 27 of comprising at least one adenine “A” allele; SEQ ID NO. 20, wherein the SEQ ID NO. 20 is a 5 xi. aSNP at rs1051266 (position 27 of SEQID NO. 17) portion of a genomic nucleic acid sequence of dop comprising at least one adenine “A” allele; amine receptor D2 (DRD2)); xii. a SNP at rs8007267 (position 27 of SEQ ID NO. xv. genotype of a SNP locus at rs1079596 (position 27 18) comprising at least one thymine “T” allele; of SEQ ID NO. 21), wherein the SEQ ID NO. 21 is xiii. a SNP at rs7639752 (position 27 of SEQ ID NO. a portion of a genomic nucleic acid sequence of 10 19) comprising at least one adenine “A” allele; dopamine receptor D2 (DRD2); xiv. a SNP at rs6275 (position 27 of SEQ ID NO. 20) xvi. genotype of a SNP locus at rs11240594 (position comprising at least one thymine “T” allele; 27 of SEQID NO. 22), wherein the SEQID NO. 22 xv. aSNP at rs1079596 (position 27 of SEQID NO. 21) is a portion of a genomic nucleic acid sequence of 15 comprising at least one thymine “T” allele; dopamine receptor D2 (DRD2); xvi. a SNP at rs11240594 (position 27 of SEQ ID NO. xvii. genotype of a SNP locus at rs4633 (position 27 of 22) comprising at least one adenine “A” allele; SEQ ID NO. 23, wherein the SEQ ID NO. 23 is a xvii. a SNP at rs4633 (position 27 of SEQ ID NO. 23) portion of a genomic nucleic acid sequence of cat comprising at least one cytosine “C” allele; echol-O-methyltransferase (COMT)): xviii. a SNP at rs4680 (position 27 of SEQID NO. 24) xviii. genotype of a SNP locus at rS4680 (position 27 of comprising at least one guanine "G” allele; SEQ ID NO. 24), wherein the SEQ ID NO. 24 is a xix. a SNP at rs250682 (position 27 of SEQID NO. 25) portion of a genomic nucleic acid sequence of cat comprising at least one cytosine “C” allele; echol-O-methyltransferase (COMT); xx. a SNP at rs2277820 (position 27 of SEQID NO. 26) xix. genotype of a SNP locus at rs250682 (position 27 25 comprising at least one thymine “T” allele; of SEQID NO. 25, wherein the SEQ ID NO. 25 is xxi., a SNP at rs2236225 (position 1958 of SEQID NO. a portion of a genomic nucleic acid sequence of 27) comprising at least one adenine “A” allele; Solute carrier family 6 (neurotransmitted transported, xxii. obesity (e.g., defined by a BMI value of at least 30 dopamine), member 3 (SLC6A3)); kg/m or greater); XX. genotype of a SNP locus at rs2277.820 (position 27 30 xxiii. an expression level ratio of SAM to SAH smaller of SEQ ID NO. 26, wherein the SEQ ID NO. 26 is a portion of a genomic nucleic acid sequence of than a pre-determined reference ratio: formiminotransferase cyclodeaminase (FTCD)); and xxiv. an expression level of 4-HNE greater than a xxi. genotype of a SNP locus at rs2236225 (position 27 pre-determined reference value; of SEQID NO. 27, wherein the SEQ ID NO. 27 is 35 XXV. an expression of hsCRP greater than about 2.3 mg a portion of a genomic nucleic acid sequence of per liter of plasma as measured in a plasma sample: methylenetetrahydrofolate dehydrogenase (NADP+ and any combinations thereof, and dependent) 1 (MTHFD1)); and if at least one of said conditions is detected, then XXii. an obesity indicator (e.g., a BMI value); Selecting and optionally administering a treatment regi xxiii. level of expression of SAM and SAH; 40 men comprising an effective amount of a folate-con xxiv. level of expression of 4-HNE; taining compound. XXV. level of expression of hsCRP; and any combina 7. The assay of any of the preceding paragraphs, wherein the tions thereof; pre-determined reference ratio is about 2.8 if measured in a (b) detecting, optionally with a non-human machine, from plasma sample. the parameters of said at least two biomarkers, the 45 8. The assay of any of the preceding paragraphs, wherein the presence of at least one condition selected from the pre-determined reference ratio is about 3.0 if measured in a following: plasma sample. i. a SNP at position 677 of SEQ ID NO. 1 or position 9. The assay of any of the preceding paragraphs, wherein the 27 of SEQID NO. 7 comprising at least one thymine predetermined reference value is about 3.0 mg per liter of “T allele; 50 plasma if measured in a plasma sample. ii. a SNP at rs2274.976 (position 1793 of SEQ ID NO. 10. The assay of any of the preceding paragraphs, wherein 1 or position 27 of SEQ ID NO. 8) comprising at the predetermined reference value is about 3.2 mg per liter least one adenine 'A' allele; of plasma as measured in a plasma sample. iii. a SNP at position 2756 of SEQID NO. 2 or position 11. The assay of any of the preceding paragraphs, wherein 27 of SEQID NO. 9 comprising at least one guanine 55 the test sample is analyzed to determine at least two of the “G” allele; conditions. iv. a SNP at position 66 of SEQ ID NO. 3 or position 12. The assay of any of the preceding paragraphs, wherein 27 of SEQ ID NO. 10 comprising at least one the test sample is analyzed to determine at least three of the guanine “G” allele; conditions. v. a SNP at rs1006737 (position 27 of SEQID NO. 11) 60 13. The assay of any of the preceding paragraphs, wherein comprising at least one adenine “A” allele; the test sample comprises a blood sample. vi. a SNP at rs1883729 (position 27 of SEQID NO.12) 14. The assay of any of the preceding paragraphs, wherein comprising at least one adenine “A” allele; the test sample comprises a urine sample. vii. a SNP at rs7163862 (position 27 of SEQ ID NO. 15. The assay of any of the preceding paragraphs, wherein 13) comprising at least one thymine “T” allele; 65 the test sample comprises a buccal sample. viii. a SNP at rs12659 (position 27 of SEQID NO. 14) 16. The assay of any of the preceding paragraphs, wherein comprising at least one thymine “T” allele; the test sample comprises a saliva sample. US 9,540,691 B2 95 96 17. The assay of any of the preceding paragraphs, wherein amount of a folate-containing compound, in combination the genotyping comprises the step of amplifying the test with the anti-depressant drug, to the human Subject if the sample with a set of primers flanking any one of the SNPs. human Subject is determined to carry any one of the fol 18. The assay of paragraph 17, wherein at least two sets of lowing single nucleotide polymorphisms (SNPs) or a com primers amplifying at least two of the SNPs are used in a 5 bination thereof: multiplex amplification assay. i. a SNP at position 677 of SEQ ID NO. 1 or position 27 19. The assay of any of the preceding paragraphs, wherein of SEQID NO. 7 (identified by rs1801133) comprising the test sample comprises a protein sample, and the test sample comprising a protein sample is Subjected to at least at least one thymine “T” allele, wherein the SEQ ID one analysis selected from the group consisting of western NO. 1 and SEQ ID NO. 7 are each independently a blot, enzyme linked absorbance assay, mass spectrometry, 10 portion of a genomic nucleic acid sequence of meth immunoassay, flow cytometry, immunohistochemical analy ylenetetrahydrofolate reductase (MTHFR); and sis, and any combinations thereof. ii. a SNP at position 2756 of SEQ ID NO. 2 or position 20. The assay of any of the preceding paragraphs, wherein 27 of SEQ ID NO. 9 comprising at least one guanine the treatment regimen further comprises selecting and 15 “G” allele, wherein the SEQID NO. 2 and SEQID NO. optionally administering an antidepressant drug. 9 are each independently a portion of a genomic nucleic 21. The assay of paragraph 20, wherein the anti-depressant acid sequence of methionine synthase (MTR). drug comprises a selective serotonin reuptake inhibitor. 26. The method of any of the preceding paragraphs, wherein 22. The assay of any of the preceding paragraphs, wherein the subject is further determined to carry at least one of the the depression is major depressive disorder. 20 following conditions or any combinations thereof: 23. A method for treating a human Subject with depression, i.a SNP at rs2274976 (position 1793 of SEQID NO. 1 or comprising administering a composition comprising an position 27 of SEQID NO. 8) comprising at least one effective amount of a folate-containing compound to a adenine 'A' allele; human Subject, who is diagnosed to have depression or have ii. a SNP at position 66 of SEQID NO. 3 or position 27 a risk for depression, and is further determined to carry at 25 of SEQID NO. 10 comprising at least one guanine “G” least one of the following single nucleotide polymorphisms allele, wherein the SEQID NO. 3 and SEQID NO. 10 (SNPs) or a combination thereof: are each independently a portion of a genomic nucleic i. a SNP at position 677 of SEQID NO. 1 or position 27 acid sequence of methionine synthase reductase of SEQID NO. 7 (identified by rs1801133) comprising (MTRR): at least one thymine “T” allele, wherein the SEQ ID 30 iii. a SNP at rs1006737 (position 27 of SEQ ID NO. 11) NO. 1 and SEQ ID NO. 7 are each independently a comprising at least one adenine “A” allele, wherein the portion of a genomic nucleic acid sequence of meth SEQID NO. 11 is a portion of a genomic nucleic acid ylenetetrahydrofolate reductase (MTHFR); and sequence of calcium channel, Voltage-dependent, L ii. a SNP at position 2756 of SEQ ID NO. 2 or position type, alpha 1C subunit (CACNA1C); 27 of SEQ ID NO. 9 comprising at least one guanine 35 iv. a SNP at rs1883729 (position 27 of SEQID NO. 12) “G” allele, wherein the SEQID NO. 2 and SEQID NO. comprising at least one adenine “A” allele, wherein the 9 are each independently a portion of a genomic nucleic SEQID NO. 12 is a portion of a genomic nucleic acid acid sequence of methionine synthase (MTR). sequence of DNA (cytosine-5)-methyltransferase 3 24. A method for treating a human Subject with depression, beta (DNMT3B); comprising 40 v. a SNP at rs7163862 (position 27 of SEQ ID NO. 13) a. determining the genotypes of at least two loci in a comprising at least one thymine “Tallele, wherein the biological sample of a subject, who is diagnosed as SEQID NO. 13 is a portion of a genomic nucleic acid having depression or having a risk for depression, sequence of GTP cyclohydrolase 1 feedback regulatory wherein said at least two loci are: protein (GCHFR): i. SNP677, wherein the SNP677 is position 677 of SEQ 45 vi. a SNP at rs12659 (position 27 of SEQ ID NO. 14) ID NO. 1 or position 27 of SEQID NO. 7 (identified comprising at least one thymine “Tallele, wherein the by rs18.01133), wherein the SEQID NO. 1 and SEQ SEQID NO. 14 is a portion of a genomic nucleic acid ID NO. 7 are each independently a portion of a sequence of reduced folate carrier protein (RCF2); genomic nucleic acid sequence of methylenetetrahy vii. a SNP at rs202676 (position 27 of SEQ ID NO. 15) drofolate reductase (MTHFR); and 50 comprising at least one guanine “G” allele, wherein the ii. SNP2756, wherein the SNP2756 is position 2756 of SEQID NO. 15 is a portion of a genomic nucleic acid SEQ ID NO. 2 or position 27 of SEQ ID NO. 9 sequence of folate hydrolase (prostate-specific mem (identified by rs1805087), wherein the SEQ ID NO. brane antigen) 1 (FOLH1); 2 and SEQ ID NO. 9 are each independently a viii. a SNP at rs2297291 (position 27 of SEQID NO. 16) portion of a genomic nucleic acid sequence of 55 comprising at least one adenine “A” allele, wherein the methionine synthase (MTR); and SEQID NO. 16 is a portion of a genomic nucleic acid b. administering a treatment regimen comprising a com sequence of reduced folate carrier protein (RCF1): position comprising an effective amount of a folate ix. a SNP at rs1051266 (position 27 of SEQ ID NO. 17) containing compound to the Subject if at least one of the comprising at least one adenine “A” allele, wherein the following conditions is detected: 60 SEQID NO. 17 is a portion of a genomic nucleic acid i. at least one thymine “T” allele at SNP677: sequence of reduced folate carrier protein (RCF1): ii. at least one guanine “G” allele at SNP2756; or x. a SNP at rs8007267 (position 27 of SEQ ID NO. 18) iii. at least one thymine “T” allele at SNP677 and at comprising at least one thymine “Tallele, wherein the least one guanine “G” allele at SNP2756. SEQID NO. 18 is a portion of a genomic nucleic acid 25. A method of improving the effectiveness of an anti 65 sequence of GTP cyclohydrolase 1 (GCH1); depressant drug administered to a human Subject, compris xi. a SNP at rs7639752 (position 27 of SEQ ID NO. 19) ing administering a composition comprising an effective comprising at least one adenine “A” allele, wherein the US 9,540,691 B2 97 98 SEQID NO. 19 is a portion of a genomic nucleic acid “G” allele, wherein the SEQID NO. 2 and SEQID NO. sequence of choline-phosphate cytidylyltransferase A 9 are each independently a portion of a genomic nucleic (PCYT1A); acid sequence of methionine synthase (MTR): xii. a SNP at rs6275 (position 27 of SEQ ID NO. 20) iv. a SNP at position 66 of SEQ ID NO. 3 or position 27 comprising at least one thymine “T” allele), wherein of SEQID NO. 10 comprising at least one guanine “G” the SEQ ID NO. 20 is a portion of a genomic nucleic allele, wherein the SEQID NO. 3 and SEQID NO. 10 acid sequence of dopamine receptor D2 (DRD2); are each independently a portion of a genomic nucleic xiii. a SNP at rs1079596 (position 27 of SEQ ID NO. 21) acid sequence of methionine synthase reductase comprising at least one thymine “T” allele), wherein (MTRR): the SEQ ID NO. 21 is a portion of a genomic nucleic 10 acid sequence of dopamine receptor D2 (DRD2); v. a SNP at rs1006737 (position 27 of SEQ ID NO. 11) xiv. a SNP at rs11240594 (position 27 of SEQID NO. 22) comprising at least one adenine “A” allele, wherein the comprising at least one adenine “A” allele.), wherein SEQID NO. 11 is a portion of a genomic nucleic acid the SEQ ID NO. 22 is a portion of a genomic nucleic sequence of calcium channel, Voltage-dependent, L acid sequence of dopamine receptor D2 (DRD2); 15 type, alpha 1C subunit (CACNA1C); XV, a SNP at rs4633 (position 27 of SEQ ID NO. 23) vi. a SNP at rs1883729 (position 27 of SEQ ID NO. 12) comprising at least one cytosine “Callele, wherein the comprising at least one adenine “A” allele, wherein the SEQID NO. 23 is a portion of a genomic nucleic acid SEQID NO. 12 is a portion of a genomic nucleic acid sequence of catechol-O-methyltransferase (COMT); sequence of DNA (cytosine-5)-methyltransferase 3 xvi. a SNP at rs4680 (position 27 of SEQ ID NO. 24) beta (DNMT3B); comprising at least one guanine “G” allele, wherein the vii. a SNP at rs7163862 (position 27 of SEQ ID NO. 13) SEQID NO. 24 is a portion of a genomic nucleic acid comprising at least one thymine “Tallele, wherein the sequence of catechol-O-methyltransferase (COMT); SEQID NO. 13 is a portion of a genomic nucleic acid xvii. a SNP at rs250682 (position 27 of SEQID NO. 25) sequence of GTP cyclohydrolase 1 feedback regulatory comprising at least one cytosine “Callele, wherein the 25 protein (GCHFR): SEQID NO. 25 is a portion of a genomic nucleic acid viii. a SNP at rs12659 (position 27 of SEQ ID NO. 14) sequence of Solute carrier family 6 (neurotransmitted comprising at least one thymine “Tallele, wherein the transported, dopamine), member 3 (SLC6A3); SEQID NO. 14 is a portion of a genomic nucleic acid xviii. aSNP at rs2277820 (position 27 of SEQID NO. 26) sequence of reduced folate carrier protein (RCF2); comprising at least one thymine “Tallele, wherein the 30 ix. a SNP at rs202676 (position 27 of SEQ ID NO. 15) SEQID NO. 26 is a portion of a genomic nucleic acid comprising at least one guanine “G” allele, wherein the sequence of formiminotransferase cyclodeaminase SEQID NO. 15 is a portion of a genomic nucleic acid (FTCD); and sequence of folate hydrolase (prostate-specific mem xix. a SNP at rs2236225 (position 27 of SEQ ID NO. 27) brane antigen) 1 (FOLH1); comprising at least one adenine “A” allele, wherein the 35 x. a SNP at rs2297291 (position 27 of SEQ ID NO. 16) SEQID NO. 27 is a portion of a genomic nucleic acid comprising at least one adenine “A” allele, wherein the sequence of methylenetetrahydrofolate dehydrogenase SEQID NO. 16 is a portion of a genomic nucleic acid (NADP+ dependent) 1 (MTHFD1): sequence of reduced folate carrier protein (RCF1): XX. obesity (e.g., defined by a BMI value of at least 30 xi. a SNP at rs1051266 (position 27 of SEQ ID NO. 17) kg/m or greater); 40 comprising at least one adenine “A” allele, wherein the XXi. an expression ratio of SAM to SAH smaller than a SEQID NO. 17 is a portion of a genomic nucleic acid pre-determined ratio: sequence of reduced folate carrier protein (RCF1): xxii. an expression of 4-HNE greater than a pre-deter xii. a SNP at rs8007267 (position 27 of SEQ ID NO. 18) mined standard; and comprising at least one thymine “Tallele, wherein the xxiii. an expression of hsCRP greater than about 2.3 mg 45 SEQID NO. 18 is a portion of a genomic nucleic acid per liter of plasma as measured in a plasma sample. sequence of GTP cyclohydrolase 1 (GCH1); 27. A method for treating a human Subject with depression, xiii. a SNP at rs7639752 (position 27 of SEQID NO.19) comprising administering a composition comprising an comprising at least one adenine “A” allele, wherein the effective amount of a folate-containing compound to the SEQID NO. 19 is a portion of a genomic nucleic acid human Subject having been diagnosed with depression or 50 sequence of choline-phosphate cytidylyltransferase A with a risk for depression, and is further determined to carry (PCYT1A); at least one of the following conditions or any combinations xiv. a SNP at rs6275 (position 27 of SEQ ID NO. 20) thereof: comprising at least one thymine “T” allele), wherein i. a SNP at position 677 of SEQID NO. 1 or position 27 the SEQ ID NO. 20 is a portion of a genomic nucleic of SEQID NO. 7 (identified by rs1801133) comprising 55 acid sequence of dopamine receptor D2 (DRD2); at least one thymine “T” allele, wherein the SEQ ID xv. a SNP at rs107.9596 (position 27 of SEQID NO. 21) NO. 1 and SEQ ID NO. 7 are each independently a comprising at least one thymine “T” allele.), wherein portion of a genomic nucleic acid sequence of meth the SEQ ID NO. 21 is a portion of a genomic nucleic ylenetetrahydrofolate reductase (MTHFR); acid sequence of dopamine receptor D2 (DRD2); ii. a SNP at rs2274.976 (position 1793 of SEQ ID NO. 1 60 xvi. a SNP at rs11240594 (position 27 of SEQID NO. 22) or position 27 of SEQ ID NO. 8) comprising at least comprising at least one adenine “A” allele.), wherein one adenine “A” allele, wherein the SEQID NO. 1 and the SEQ ID NO. 22 is a portion of a genomic nucleic SEQ ID NO. 8 are each independently a portion of a acid sequence of dopamine receptor D2 (DRD2); genomic nucleic acid sequence of methylenetetrahy xvii. a SNP at rs4633 (position 27 of SEQ ID NO. 23) drofolate reductase (MTHFR): 65 comprising at least one cytosine “Callele, wherein the iii. a SNP at position 2756 of SEQ ID NO. 2 or position SEQID NO. 23 is a portion of a genomic nucleic acid 27 of SEQ ID NO. 9 comprising at least one guanine sequence of catechol-O-methyltransferase (COMT); US 9,540,691 B2 99 100 xviii. a SNP at rs4680 (position 27 of SEQ ID NO. 24) xv. a SNP at rs107.9596 (position 27 of SEQID NO. 21) comprising at least one guanine “G” allele, wherein the comprising at least one thymine “T” allele; SEQID NO. 24 is a portion of a genomic nucleic acid xvi. a SNP at rs11240594 (position 27 of SEQID NO. 22) sequence of catechol-O-methyltransferase (COMT); comprising at least one adenine “A” allele; xix. a SNP at rs250682 (position 27 of SEQ ID NO. 25) xvii. a SNP at rs4633 (position 27 of SEQ ID NO. 23) comprising at least one cytosine “Callele, wherein the comprising at least one cytosine “C” allele; SEQID NO. 25 is a portion of a genomic nucleic acid xviii. a SNP at rs4680 (position 27 of SEQ ID NO. 24) sequence of Solute carrier family 6 (neurotransmitted comprising at least one guanine "G” allele; transported, dopamine), member 3 (SLC6A3); xix. a SNP at rs250682 (position 27 of SEQ ID NO. 25) 10 comprising at least one cytosine “C” allele; xx. a SNP at rs2277820 (position 27 of SEQID NO. 26) xx. a SNP at rs2277820 (position 27 of SEQ ID NO. 26) comprising at least one thymine “Tallele, wherein the comprising at least one thymine “T” allele; SEQID NO. 26 is a portion of a genomic nucleic acid xxi, a SNP at rs2236225 (position 1958 of SEQ ID NO. sequence of formiminotransferase cyclodeaminase 27) comprising at least one adenine “A” allele; (FTCD); and 15 xxii. obesity (e.g., defined by a BMI value of at least 30 xxi, a SNP at rs2236225 (position 27 of SEQ ID NO. 27) kg/m or greater); comprising at least one adenine “A” allele, wherein the xxiii. an expression level ratio of SAM to SAH smaller SEQID NO. 27 is a portion of a genomic nucleic acid than a pre-determined reference ratio: sequence of methylenetetrahydrofolate dehydrogenase xxiv. an expression level of 4-HNE greater than a pre (NADP+dependent) 1 (MTHFD1); determined reference value; xxii. obesity (e.g., defined by a BMI value of at least 30 XXV. an expression of hsCRP greater than about 2.3 mg per kg/m or greater); liter of plasma as measured in a plasma sample; and any xxiii. an expression ratio of SAM to SAH Smaller than a combinations thereof. pre-determined ratio: 29. The method of any of the preceding paragraphs, wherein xxiv. an expression of 4-HNE greater than a pre-deter 25 the subject is further determined to carry at least two of the mined standard; and conditions or more. XXV. an expression of hsCRP greater than about 2.3 mg per 30. The method of any of the preceding paragraphs, wherein liter of plasma as measured in a plasma sample. the effective amount of the folate-containing compound 28. A method of treating depression in a human Subject ranges from about 0.1 to about 1 mg/kg body weight per day. comprising detecting at least one of the following conditions 30 31. The method of any of the preceding paragraphs, wherein in a biological sample from the human Subject and if any one the effective amount of the folate-containing compound is of them is present then administering to the human subject about 7.5 mg/day to about 50 mg/day. a treatment regimen comprising an effective amount of a 32. The method of any of the preceding paragraphs, wherein folate-containing compound, wherein said at least one of the the effective amount of the folate-containing compound is conditions is selected from the following: 35 about 15 mg/day. i. a SNP at position 677 of SEQID NO. 1 or position 27 33. The method of any of the preceding paragraphs, wherein of SEQID NO. 7 (identified by rs1801133) comprising the effective amount of the folate-containing compound is at least one thymine “T” allele; administered as a single daily dose. ii. a SNP at rs2274.976 (position 1793 of SEQ ID NO. 1 34. The method of any of the preceding paragraphs, wherein or position 27 of SEQ ID NO. 8) comprising at least 40 the effective amount of the folate-containing compound is one adenine “A” allele; administered in more than one divided doses per day. iii. a SNP at position 2756 of SEQ ID NO. 2 or position 35. The method of any of the preceding paragraphs, wherein 27 of SEQ ID NO. 9 comprising at least one guanine the administration is oral. “G” allele; 36. The method of any of the preceding paragraphs, wherein iv. a SNP at position 66 of SEQ ID NO. 3 or position 27 45 the composition is formulated to release at least a portion of of SEQID NO. 10 comprising at least one guanine “G” the folate-containing compound over a period of at least allele; about 3-6 hours, upon the administration of the composition, v. a SNP at rs1006737 (position 27 of SEQ ID NO. 11) wherein the release is optionally a steady-state release. comprising at least one adenine “A” allele; 37. The method of any of the preceding paragraphs, further vi. a SNP at rs1883729 (position 27 of SEQ ID NO. 12) 50 comprising selecting and optionally administering an anti comprising at least one adenine “A” allele; depressant drug in combination with the folate-containing vii. a SNP at rs7163862 (position 27 of SEQID NO. 13) compound. comprising at least one thymine “T” allele; 38. The method of paragraph 37, wherein the anti-depressant viii. a SNP at rs12659 (position 27 of SEQ ID NO. 14) drug comprises a selective serotonin reuptake inhibitor. comprising at least one thymine “T” allele; 55 39. The method of paragraph 38, wherein the selective ix. a SNP at rs202676 (position 27 of SEQ ID NO. 15) serotonin reuptake inhibitor is selected from the group comprising at least one guanine "G” allele; consisting of fluoxetine, citalopram, paroxetine, escitalo x. a SNP at rs2297291 (position 27 of SEQID NO. 16) pram, Sertraline, and any combinations thereof. comprising at least one adenine “A” allele; 40. The method of any of the preceding paragraphs, wherein xi. a SNP at rs1051266 (position 27 of SEQ ID NO. 17) 60 the Subject who is diagnosed as having depression is resis comprising at least one adenine “A” allele; tant to at least one antidepressant monotherapy. xii. a SNP at rs8007267 (position 27 of SEQID NO. 18) 41. The method of any of the preceding paragraphs, wherein comprising at least one thymine “T” allele; the depression is major depressive disorder. xiii. a SNP at rs7639752 (position 27 of SEQ ID NO.19) 42. The method of any of the preceding paragraphs, wherein comprising at least one adenine “A” allele; 65 the test sample comprises a buccal sample. xiv. a SNP at rs6275 (position 27 of SEQ ID NO. 20) 43. The method of any of the preceding paragraphs, wherein comprising at least one thymine “T” allele; the test sample comprises a saliva sample. US 9,540,691 B2 101 102 44. The method of any of the preceding paragraphs, wherein pendently a portion of a genomic nucleic acid the test sample comprises a blood sample. sequence of methylenetetrahydrofolate reductase 45. The method of any of the preceding paragraphs, wherein (MTHFR): the test sample comprises a urine sample. (ii) position 2756 of SEQ ID NO. 2 or position 27 of 46. A computer system for obtaining data from at least one SEQ ID NO. 9 (identified by rs1805087), wherein test sample obtained from at least one Subject, the system the SEQ ID NO. 2 and SEQ ID NO. 9 are each comprising: independently a portion of a genomic nucleic acid (a) at least one determination module configured to sequence of methionine synthase (MTR); and receive said at least one test sample and perform at least (iii) optionally, position 66 of SEQID NO. 3 or position one analysis on said at least one test sample to deter 10 27 of SEQ ID NO. (identified by rs1801394), mine the presence or absence of at least one of the wherein the SEQ ID NO. 3 and SEQID NO. 10 are following conditions or any combinations thereof: each independently a portion of a genomic nucleic i. an expression ratio of S-adenosyl methionine (SAM) acid sequence of methionine synthase reductase to S-adenosyl homocysteine (SAH) Smaller than a 15 (MTRR): pre-determined reference ratio: (b) a storage device configured to store output data from ii. expression of 4-hydroxynonenal (4-HNE) greater said determination module: than a pre-determined reference value; (c) a computing module comprising specifically-pro iii. a single nucleotide polymorphism (SNP) at position grammed instructions to determine from the output data 677 of SEQID NO. 1 or position 27 of SEQID NO. the presence of at least one single nucleotide poly 7 (identified by rs1801133) comprising at least one phormism (SNP) from the following: thymine “T” allele, wherein the SEQ ID NO. 1 and i. a SNP at position 677 of SEQ ID NO. 1 or position SEQ ID NO. 7 are each independently a portion of 27 of SEQID NO. 7 comprising at least one thymine a genomic nucleic acid sequence of methylenetetra “T allele; hydrofolate reductase (MTHFR): 25 ii. a SNP at position 2756 of SEQID NO. 2 or position iv. a SNP at position 2756 of SEQID NO. 2 or position 27 of SEQID NO. 9 comprising at least one guanine 27 of SEQID NO. 9 comprising at least one guanine “G” allele; and “G” allele, wherein the SEQ ID NO. 2 and SEQ ID iii. optionally a SNP at the position 66 of SEQID NO. NO. 9 are each independently a portion of a genomic 3 or position 27 of SEQ ID NO. 10 comprising at nucleic acid sequence of methionine synthase 30 least one guanine “G” allele. (MTR); and (d) a display module for displaying a content based in part v. a SNP at position 66 of SEQID NO. 3 or position 27 on the data output from said computing module, of SEQ ID NO. 10 comprising at least one guanine wherein the content comprises a signal indicative of the “G” allele, wherein the SEQ ID NO. 3 and SEQ ID 35 presence of at least one of these SNPs, and optionally NO. 10 are each independently a portion of a the absence of any one of these SNPs, or a signal genomic nucleic acid sequence of methionine Syn indicative of the absence of all of these SNPs. thase reductase (MTRR): 50. The computer system of any one of the preceding (b) at least one storage device configured to store data paragraphs, wherein said determination module is further output from said determination module; and 40 determine a parameter of at least one of the following (d) at least one display module for displaying a content biomarkers or any combinations thereof: based in part on the data output from said determination i. genotype of a SNP locus at rs2274.976 (position 1793 of module, wherein the content comprises a signal indica SEQ ID NO. 1 or position 27 of SEQ ID NO. 8), tive of the presence of at least one of these conditions, wherein the SEQID NO. 1 and SEQID NO. 8 are each and optionally the absence of any one of these condi 45 independently a portion of a genomic nucleic acid tions, or a signal indicative of the absence of all of these sequence of methylenetetrahydrofolate reductase conditions. (MTHFR): 47. The computer system of paragraph 46, wherein said ii. genotype of a SNP locus at rs1006737 (position 27 of determination module is configured to analyze said at least SEQ ID NO. 11, wherein the SEQ ID NO. 11 is a one test sample to determine the presence or absence of at 50 portion of a genomic nucleic acid sequence of calcium least two of the conditions. channel, Voltage-dependent, L type, alpha 1C Subunit 48. The computer system of paragraph 46 or 47, wherein (CACNA1C)); said determination module further comprises a comparison iii. genotype of a SNP locus at rs1883729 (position 27 of module adapted to compare said data output from said SEQ ID NO. 12, wherein the SEQ ID NO. 12 is a determination module with reference data stored on said 55 portion of a genomic nucleic acid sequence of DNA storage device. (cytosine-5)-methyltransferase 3 beta (DNMT3B)); 49. A computer system for obtaining data from at least one iv. genotype of a SNP locus at rs7163862 (position 27 of test sample obtained from at least one Subject, the system SEQ ID NO. 13, wherein the SEQ ID NO. 13 is a comprising: portion of a genomic nucleic acid sequence of GTP (a) a determination module configured to receive said at 60 cyclohydrolase 1 feedback regulatory protein least one test sample and perform at least one geno (GCHFR)); typing analysis on said at least one test sample to v. genotype of a SNP locus at rs12659 (position 27 of SEQ determine the genotypes of at least two loci, wherein ID NO. 14, wherein the SEQID NO. 14 is a portion of said at least two loci comprise: a genomic nucleic acid sequence of reduced folate (i) position 677 of SEQID NO. 1 or position 27 of SEQ 65 carrier protein (RCF2)); ID NO. 7 (identified by rs1801133), wherein the vi. genotype of a SNP locus at rs202676 (position 27 of SEQ ID NO. 1 and SEQ ID NO. 7 are each inde SEQ ID NO. 20, wherein the SEQ ID NO. 15 is a US 9,540,691 B2 103 104 portion of a genomic nucleic acid sequence of folate iii. a SNP at rs1883729 (position 27 of SEQ ID NO. 12) hydrolase (prostate-specific membrane antigen) 1 comprising at least one adenine “A” allele; (FOLH1)); iv. a SNP at rs7163862 (position 27 of SEQ ID NO. 13) vii. genotype of a SNP locus at rs2297291 (position 27 of comprising at least one thymine “T” allele; SEQ ID NO. 16, wherein the SEQ ID NO. 16 is a 5 v. a SNP at rs12659 (position 27 of SEQ ID NO. 14) portion of a genomic nucleic acid sequence of reduced comprising at least one thymine “T” allele; folate carrier protein (RCF1)); vi. a SNP at rs202676 (position 27 of SEQ ID NO. 15) viii. genotype of a SNP locus at rs1051266 (position 27 of comprising at least one guanine "G” allele; SEQ ID NO. 17, wherein the SEQ ID NO. 17 is a vii. a SNP at rs2297291 (position 27 of SEQ ID NO. 16) portion of a genomic nucleic acid sequence of reduced 10 comprising at least one adenine “A” allele; folate carrier protein (RCF1)); viii. a SNP at rs1051266 (position 27 of SEQID NO. 17) ix. genotype of a SNP locus at rs8007267 (position 27 of comprising at least one adenine “A” allele; SEQ ID NO. 18, wherein the SEQ ID NO. 18 is a ix. a SNP at rs8007267 (position 27 of SEQ ID NO. 18) portion of a genomic nucleic acid sequence of GTP 15 comprising at least one thymine “T” allele; cyclohydrolase 1 (GCH1)); x. a SNP at rs7639752 (position 27 of SEQ ID NO. 19) X. genotype of a SNP locus at rs7639752 (position 27 of comprising at least one adenine “A” allele; SEQ ID NO. 19, wherein the SEQ ID NO. 19 is a xi. a SNP at rs6275 (position 27 of SEQ ID NO. 20) portion of a genomic nucleic acid sequence of choline comprising at least one thymine “T” allele; phosphate cytidylyltransferase A (PCYT1A)); xii. a SNP at rs1079596 (position 27 of SEQ ID NO. 21) xi. genotype of a SNP locus at rs6275 (position 27 of SEQ comprising at least one thymine “T” allele; ID NO. 20, wherein the SEQID NO. 20 is a portion of xiii. a SNP at rs11240594 (position 27 of SEQID NO. 22) a genomic nucleic acid sequence of dopamine receptor comprising at least one adenine “A” allele; D2 (DRD2)); xiv. a SNP at rs4633 (position 27 of SEQ ID NO. 23) xii. genotype of a SNP locus at rs1079596 (position 27 of 25 comprising at least one cytosine “C” allele; SEQ ID NO. 21), wherein the SEQ ID NO. 21 is a XV, a SNP at rs4680 (position 27 of SEQ ID NO. 24) portion of a genomic nucleic acid sequence of dop comprising at least one guanine "G” allele; amine receptor D2 (DRD2); xvi. a SNP at rs250682 (position 27 of SEQ ID NO. 25) xiii. genotype of a SNP locus at rs11240594 (position 27 comprising at least one cytosine “C” allele; of SEQ ID NO. 22), wherein the SEQ ID NO. 22 is a 30 portion of a genomic nucleic acid sequence of dop xvii. a SNP at rs2277820 (position 27 of SEQID NO. 26) amine receptor D2 (DRD2): comprising at least one thymine “T” allele; xiv. genotype of a SNP locus at rs4633 (position 27 of xviii. a SNP at rs2236225 (position 27 of SEQID NO. 27) SEQ ID NO. 23, wherein the SEQ ID NO. 23 is a comprising at least one adenine “A” allele; portion of a genomic nucleic acid sequence of catechol 35 xix. obesity (e.g., defined by a BMI value of at least 30 O-methyltransferase (COMT)): kg/m or greater); XV. genotype of a SNP locus at rs4680 (position 27 of SEQ XX. an expression level ratio of SAM to SAH Smaller than ID NO. 24), wherein the SEQ ID NO. 24 is a portion a pre-determined reference ratio: of a genomic nucleic acid sequence of catechol-O- XXi. an expression level of 4-HNE greater than a pre methyltransferase (COMT); 40 determined reference value; xvi. genotype of a SNP locus at rs250682 (position 27 of xxii. an expression of hsCRP greater than about 2.3 mg SEQ ID NO. 25, wherein the SEQ ID NO. 25 is a per liter of plasma as measured in a plasma sample. portion of a genomic nucleic acid sequence of Solute 52. A computer system for obtaining data from at least one carrier family 6 (neurotransmitted transported, dop test sample obtained from at least one Subject, the system amine), member 3 (SLC6A3)); 45 comprising: xvii. genotype of a SNP locus at rs2277.820 (position 27 (a) a determination module configured to receive said at of SEQ ID NO. 26, wherein the SEQ ID NO. 26 is a least one test sample and perform at least one analysis portion of a genomic nucleic acid sequence of formimi on said at least one test sample to determine parameters notransferase cyclodeaminase (FTCD)); and of at least two biomarkers, wherein the parameters of xviii. genotype of a SNP locus at rs2236225 (position 27 50 said at least two biomarkers are selected from the of SEQ ID NO. 27, wherein the SEQ ID NO. 27 is a following: portion of a genomic nucleic acid sequence of meth i. genotype of a single nucleotide polymorphism (SNP) ylenetetrahydrofolate dehydrogenase (NADP+ depen locus at position 677 of SEQID NO. 1 or position 27 dent) 1 (MTHFD1)); of SEQID NO. 7 (identified by rs1801133), wherein xix. an obesity indicator (e.g., a BMI value); 55 the SEQ ID NO. 1 and SEQ ID NO. 7 are each XX. level of expression of SAM and SAH; independently a portion of a genomic nucleic acid XXi. level of expression of 4-HNE; sequence of methylenetetrahydrofolate reductase xxii. level of expression of hsCRP. (MTHFR): 51. The computer system of paragraph 50, wherein said ii. genotype of a SNP locus at rs2274976 (position 1793 computing module is further adapted to determine the pres 60 of SEQID NO. 1 or position 27 of SEQ ID NO. 8), ence of at least one of the following conditions or any wherein the SEQ ID NO. 1 and SEQ ID NO. 8 are combinations thereof: each independently a portion of a genomic nucleic i.a SNP at rs2274.976 (position 1793 of SEQID NO. 1 or acid sequence of methylenetetrahydrofolate reduc position 27 of SEQID NO. 8) comprising at least one tase (MTHFR): adenine 'A' allele; 65 iii. genotype of a SNP locus at position 2756 of SEQID ii. a SNP at rs1006737 (position 27 of SEQ ID NO. 11) NO. 2 or position 27 of SEQID NO. 9 (identified by comprising at least one adenine “A” allele; rs1805087), wherein the SEQID NO. 2 and SEQID US 9,540,691 B2 105 106 NO. 9 are each independently a portion of a genomic xviii. genotype of a SNP locus at rs4680 (position 27 of nucleic acid sequence of methionine synthase SEQ ID NO. 24), wherein the SEQ ID NO. 24 is a (MTR): portion of a genomic nucleic acid sequence of cat iv. genotype of a SNP locus at position 66 of SEQ ID echol-O-methyltransferase (COMT); NO. 3 or position 27 of SEQID NO. 10 (identified xix. genotype of a SNP locus at rs250682 (position 27 by rs1801394), wherein the SEQID NO. 3 and SEQ of SEQID NO. 25), wherein the SEQ ID NO. 25 is ID NO. 10 are each independently a portion of a a portion of a genomic nucleic acid sequence of genomic nucleic acid sequence of methionine Syn Solute carrier family 6 (neurotransmitted transported, thase reductase (MTRR): dopamine), member 3 (SLC6A3); v. genotype of a SNP locus at rs1006737 (position 27 10 XX. genotype of a SNP locus at rs2277820 (position 27 of SEQ ID NO. 11), wherein the SEQID NO. 11 is of SEQ ID NO. 26), wherein the SEQ ID NO. 26 is a portion of a genomic nucleic acid sequence of a portion of a genomic nucleic acid sequence of calcium channel, Voltage-dependent, L type, alpha formiminotransferase cyclodeaminase (FTCD); 1C subunit (CACNA1C); 15 XXi. genotype of a SNP locus at rs2236225 (position 27 vi. genotype of a SNP locus at rs1883729 (position 27 of SEQID NO. 27), wherein the SEQ ID NO. 27 is of SEQ ID NO. 12), wherein the SEQ ID NO. 12 is a portion of a genomic nucleic acid sequence of a portion of a genomic nucleic acid sequence of methylenetetrahydrofolate dehydrogenase (NADP+ DNA (cytosine-5)-methyltransferase 3 beta dependent) 1 (MTHFD1): (DNMT3B); xxii. expressions of SAM and SAH; vii. genotype of a SNP locus at rs7163862 (position 27 xxiii. expression of 4-HNE; of SEQID NO. 13), wherein the SEQ ID NO. 13 is xxiv. expression of hsCRP; and any combinations a portion of a genomic nucleic acid sequence of GTP thereof. cyclohydrolase 1 feedback regulatory protein (b) a storage device configured to store output data from (GCHFR): 25 said determination module: viii. genotype of a SNP locus at rs12659 (position 27 of (c) a computing module comprising specifically-pro SEQ ID NO. 14), wherein the SEQ ID NO. 14 is a grammed instructions to determine from the output data portion of a genomic nucleic acid sequence of the presence of at least one condition from the follow reduced folate carrier protein (RCF2); 1ng: ix. genotype of a SNP locus at rs202676 (position 27 of 30 i. a SNP at position 677 of SEQ ID NO. 1 or position SEQ ID NO. 15), wherein the SEQ ID NO. 15 is a 27 of SEQID NO. 7 comprising at least one thymine portion of a genomic nucleic acid sequence of folate “T” allele; hydrolase (prostate-specific membrane antigen) 1 ii. a SNP at rs2274976 (position 1793 of SEQ ID NO. (FOLH1); 1 or position 27 of SEQ ID NO. 8) comprising at X. genotype of a SNP locus at rs2297291 (position 27 35 least one adenine 'A' allele; of SEQ ID NO. 16), wherein the SEQ ID NO. 16 is iii. a SNP at position 2756 of SEQID NO. 2 or position a portion of a genomic nucleic acid sequence of 27 of SEQID NO. 9 comprising at least one guanine reduced folate carrier protein (RCF1): “G” allele; xi. genotype of a SNP locus at rs1051266 (position 27 iv. a SNP at position 66 of SEQ ID NO. 3 or position of SEQID NO. 17), wherein the SEQ ID NO. 17 is 40 27 of SEQ ID NO. 10 comprising at least one a portion of a genomic nucleic acid sequence of guanine “G” allele; reduced folate carrier protein (RCF1): v. a SNP at rs1006737 (position 27 of SEQID NO. 11) xii. genotype of a SNP locus at rs8007267 (position 27 comprising at least one adenine “A” allele; of SEQ ID NO. 18), wherein the SEQ ID NO. 18 is vi. aSNP at rs1883729 (position 27 of SEQID NO.12) a portion of a genomic nucleic acid sequence of GTP 45 comprising at least one adenine “A” allele; cyclohydrolase 1 (GCH1); vii. a SNP at rs7163862 (position 27 of SEQ ID NO. xiii. genotype of a SNP locus at rs7639752 (position 27 13) comprising at least one thymine “T” allele; of SEQID NO. 19), wherein the SEQ ID NO. 19 is viii. a SNP at rs12659 (position 27 of SEQID NO. 14) a portion of a genomic nucleic acid sequence of comprising at least one thymine “T” allele; choline-phosphate cytidylyltransferase A 50 ix. a SNP at rs202676 (position 27 of SEQ ID NO. 15) (PCYT1A); comprising at least one guanine "G” allele; xiv. genotype of a SNP locus at rs6275 (position 27 of x. a SNP at rs2297291 (position 27 of SEQID NO. 16) SEQ ID NO. 20), wherein the SEQ ID NO. 20 is a comprising at least one adenine “A” allele; portion of a genomic nucleic acid sequence of dop xi. aSNP at rs1051266 (position 27 of SEQID NO. 17) amine receptor D2 (DRD2); 55 comprising at least one adenine “A” allele; xv. genotype of a SNP locus at rs1079596 (position 27 xii. a SNP at rs8007267 (position 27 of SEQ ID NO. of SEQ ID NO. 21), wherein the SEQ ID NO. 21 is 18) comprising at least one thymine “T” allele; a portion of a genomic nucleic acid sequence of xiii. a SNP at rs7639752 (position 27 of SEQ ID NO. dopamine receptor D2 (DRD2); 19) comprising at least one adenine “A” allele; xvi. genotype of a SNP locus at rs11240594 (position 60 xiv. a SNP at rs6275 (position 27 of SEQ ID NO. 20) 27 of SEQID NO. 22), wherein the SEQID NO. 22 comprising at least one thymine “T” allele; is a portion of a genomic nucleic acid sequence of xv. aSNP at rs1079596 (position 27 of SEQID NO. 21) dopamine receptor D2 (DRD2); comprising at least one thymine “T” allele; xvii. genotype of a SNP locus at rs4633 (position 27 of xvi. a SNP at rs11240594 (position 27 of SEQ ID NO. SEQ ID NO. 23), wherein the SEQ ID NO. 23 is a 65 22) comprising at least one adenine “A” allele; portion of a genomic nucleic acid sequence of cat xvii. a SNP at rs4633 (position 27 of SEQ ID NO. 23) echol-O-methyltransferase (COMT); comprising at least one cytosine “C” allele; US 9,540,691 B2 107 108 xviii. a SNP at rs4680 (position 27 of SEQID NO. 24) implementing a method on a computer, said computer comprising at least one guanine "G” allele; readable storage medium comprising: xix. a SNP at rs250682 (position 27 of SEQID NO. 25) (a) instructions for comparing the data stored on a storage comprising at least one cytosine “C” allele; device with reference data to provide a comparison xx. a SNP at rs2277820 (position 27 of SEQID NO. 26) result, wherein the comparison identifies the presence comprising at least one thymine “T” allele; and or absence of at least one of the following conditions or xxi. a SNP at rs2236225 (position 27 of SEQ ID NO. any combinations thereof: 27) comprising at least one adenine “A” allele; i. an expression ratio of S-adenosyl methionine (SAM) xxii. an expression ratio of SAM to SAH smaller than to S-adenosyl homocysteine (SAH) Smaller than a a pre-determined reference ratio; 10 pre-determined reference ratio: xxiii. an expression of 4-HNE greater than a pre ii. expression of 4-hydroxynonenal (4-HNE) greater determined reference value; than a pre-determined reference value; xxiv. an expression of hsCRP greater than about 2.3 mg iii. a single nucleotide polymorphism (SNP) at position per liter of plasma as measured in a plasma sample: 15 677 of SEQID NO. 1 or position 27 of SEQID NO. and any combinations thereof. 7 (identified by rs1801 133) comprising at least one (d) a display module for displaying a content based in part thymine “T” allele, wherein the SEQ ID NO. 1 and on the data output from said computing module, SEQ ID NO. 7 are each independently a portion of wherein the content comprises a signal indicative of the a genomic nucleic acid sequence of methylenetetra presence of at least one of the conditions, and option hydrofolate reductase (MTHFR): ally the absence of any one of the conditions, or a signal iv. a SNP at position 2756 of SEQID NO. 2 or position indicative of the absence of all of the conditions. 27 of SEQID NO. 9 comprising at least one guanine 53. The computer system of any of the preceding para “G” allele, wherein the SEQ ID NO. 2 and SEQ ID graphs, wherein the pre-determined reference ratio is about NO. 9 are each independently a portion of a genomic 3.0 as measured in a plasma sample. 25 nucleic acid sequence of methionine synthase 54. The computer system of any of the preceding para (MTR); and graphs, wherein the pre-determined reference ratio is about v. a SNP at position 66 of SEQID NO. 3 or position 27 2.8 as measured in a plasma sample. of SEQ ID NO. 10 comprising at least one guanine 55. The computer system of any of the preceding para “G” allele, wherein the SEQ ID NO. 3 and SEQ ID graphs, wherein the predetermined reference value is about 30 NO. 10 are each independently a portion of a 3.0 mg per liter as measured in a plasma sample. genomic nucleic acid sequence of methionine Syn 56. The computer system of any of the preceding para thase reductase (MTRR): graphs, wherein the predetermined reference value is about (b) instructions for displaying a content based in part on 3.2 mg per liter as measured in a plasma sample. the data output from said determination module, 57. The computer system of any of the preceding para 35 wherein the content comprises a signal indicative of the graphs, wherein the determination module is configured to presence of at least one of the conditions, and option determine parameters of at least three biomarkers or more. ally the absence of any one of the conditions, or a signal 58. The computer system of any of the preceding para indicative of the absence of all of the conditions. graphs, wherein the computing module is configured to 66. A computer readable medium having computer readable determine the presence of at least two conditions or more. 40 instructions recorded thereon to define software modules for 59. The computer system of any of the preceding para implementing a method on a computer, said computer graphs, wherein said computing module further comprises a readable storage medium comprising: comparison module adapted to compare said output data (a) instructions for comparing the data stored on a storage from said determination module with reference data stored device with reference data to provide a comparison on said storage device. 45 result, wherein the comparison identifies the presence 60. The computer system of any of the preceding para or absence of at least one of the following conditions: graphs, wherein the storage device is further configured to i. a single nucleotide polymorphism (SNP) at position store physical information of said at least one Subject. 677 of SEQID NO. 1 or position 27 of SEQID NO. 61. The computer system of paragraph 60, wherein the 7 (identified by rs1801 133) comprising at least one physical information comprises an obesity indicator (e.g., 50 thymine “T” allele, wherein the SEQ ID NO. 1 and BMI) of said at least one subject. SEQ ID NO. 7 are each independently a portion of 62. The computer system of any of the preceding para a genomic nucleic acid sequence of methylenetetra graphs, wherein the content displayed on said display mod hydrofolate reductase (MTHFR): ule further comprises the obesity indicator (e.g., the BMI ii. a SNP at position 2756 of SEQID NO. 2 or position value) or a signal indicative of whether the subject is obese 55 27 of SEQID NO. 9 comprising at least one guanine (e.g., whether the BMI value is at least 30 kg/m or not). “G” allele, wherein the SEQ ID NO. 2 and SEQ ID 63. The computer system of any of the preceding para NO. 9 are each independently a portion of a genomic graphs, wherein the content displayed on said display mod nucleic acid sequence of methionine synthase ule further comprises a signal indicative of the Subject (MTR); and recommended to receive a treatment regimen comprising a 60 (b) instructions for displaying a content based in part on folate-containing compound, or a signal indicative of the the data output from said determination module, Subject recommended to receive an alternative treatment wherein the content comprises a signal indicative of the regimen without a folate-containing compound. presence of at least one of the conditions, and option 64. The computer system of any of the preceding para ally the absence of any one of the conditions, or a signal graphs, wherein the depression is major depressive disorder. 65 indicative of the absence of all of the conditions. 65. A computer readable medium having computer readable 67. The computer readable medium of any of the preceding instructions recorded thereon to define software modules for paragraphs, further comprising instructions to identify the US 9,540,691 B2 109 110 presence or absence of at least one of the following condi XV, a SNP at rs4633 (position 27 of SEQ ID NO. 23) tions or any combinations thereof: comprising at least one cytosine “Callele, wherein the i.a SNP at rs2274.976 (position 1793 of SEQID NO. 1 or SEQID NO. 23 is a portion of a genomic nucleic acid position 27 of SEQID NO. 8) comprising at least one sequence of catechol-O-methyltransferase (COMT); adenine “A” allele, wherein the SEQ ID NO. 1 and xvi. a SNP at rs4680 (position 27 of SEQ ID NO. 24) SEQ ID NO. 8 are each independently a portion of a comprising at least one guanine “G” allele, wherein the genomic nucleic acid sequence of methylenetetrahy SEQID NO. 24 is a portion of a genomic nucleic acid drofolate reductase (MTHFR): sequence of catechol-O-methyltransferase (COMT); ii. a SNP at position 66 of SEQ ID NO. 3 or position 27 xvii. a SNP at rs250682 (position 27 of SEQ ID NO. 25) of SEQID NO. 10 comprising at least one guanine “G” 10 comprising at least one cytosine “Callele, wherein the allele, wherein the SEQID NO. 3 and SEQID NO. 10 SEQID NO. 25 is a portion of a genomic nucleic acid are each independently a portion of a genomic nucleic sequence of Solute carrier family 6 (neurotransmitted acid sequence of methionine synthase reductase transported, dopamine), member 3 (SLC6A3); (MTRR): xviii. a SNP at rs2277820 (position 27 of SEQID NO. 26) iii. a SNP at rs1006737 (position 27 of SEQ ID NO. 11) 15 comprising at least one thymine “Tallele, wherein the comprising at least one adenine “A” allele, wherein the SEQID NO. 26 is a portion of a genomic nucleic acid SEQID NO. 11 is a portion of a genomic nucleic acid sequence of formiminotransferase cyclodeaminase sequence of calcium channel, Voltage-dependent, L (FTCD); and type, alpha 1C subunit (CACNA1C); xix. a SNP at rs2236225 (position 27 of SEQ ID NO. 27) iv. a SNP at rs1883729 (position 27 of SEQ ID NO. 12) comprising at least one adenine “A” allele, wherein the comprising at least one adenine “A” allele, wherein the SEQID NO. 27 is a portion of a genomic nucleic acid SEQID NO. 12 is a portion of a genomic nucleic acid sequence of methylenetetrahydrofolate dehydrogenase sequence of DNA (cytosine-5)-methyltransferase 3 (NADP+ dependent) 1 (MTHFD1): beta (DNMT3B); XX. obesity (e.g., defined by a BMI value of at least 30 v. a SNP at rs7163862 (position 27 of SEQ ID NO. 13) 25 kg/m or greater); comprising at least one thymine “Tallele, wherein the XXi. an expression ratio of SAM to SAH smaller than a SEQID NO. 13 is a portion of a genomic nucleic acid pre-determined ratio: sequence of GTP cyclohydrolase 1 feedback regulatory xxii. an expression of 4-HNE greater than a pre-deter protein (GCHFR): mined standard; and vi. a SNP at rs12659 (position 27 of SEQ ID NO. 14) 30 xxiii. an expression of hsCRP greater than about 2.3 mg comprising at least one thymine “Tallele, wherein the per liter of plasma as measured in a plasma sample. SEQID NO. 14 is a portion of a genomic nucleic acid 68. A computer readable medium having computer readable sequence of reduced folate carrier protein (RCF2); instructions recorded thereon to define software modules for vii. a SNP at rs202676 (position 27 of SEQ ID NO. 15) implementing a method on a computer, said computer comprising at least one guanine “G” allele, wherein the 35 readable storage medium comprising: SEQID NO. 15 is a portion of a genomic nucleic acid (a) instructions for comparing the data stored on a storage sequence of folate hydrolase (prostate-specific mem device with reference data to provide a comparison brane antigen) 1 (FOLH1); result, wherein the comparison identifies the presence viii. a SNP at rs2297291 (position 27 of SEQ ID NO. 16) or absence of at least one of the following conditions: comprising at least one adenine “A” allele, wherein the 40 i. a SNP at position 677 of SEQ ID NO. 1 or position SEQID NO. 16 is a portion of a genomic nucleic acid 27 of SEQ ID NO. 7 (identified by rs1801133) sequence of reduced folate carrier protein (RCF1): comprising at least one thymine “T” allele, wherein ix. a SNP at rs1051266 (position 27 of SEQ ID NO. 17) the SEQ ID NO. 1 and SEQ ID NO. 7 are each comprising at least one adenine “A” allele, wherein the independently a portion of a genomic nucleic acid SEQID NO. 17 is a portion of a genomic nucleic acid 45 sequence of methylenetetrahydrofolate reductase sequence of reduced folate carrier protein (RCF1): (MTHFR): x. a SNP at rs8007267 (position 27 of SEQID NO. 18) ii. a SNP at rs2274976 (position 1793 of SEQ ID NO. comprising at least one thymine “Tallele, wherein the 1 or position 27 of SEQ ID NO. 8) comprising at SEQID NO. 18 is a portion of a genomic nucleic acid least one adenine “A” allele, wherein the SEQ ID sequence of GTP cyclohydrolase 1 (GCH1); 50 NO. 1 and SEQ ID NO. 8 are each independently a xi. a SNP at rs7639752 (position 27 of SEQ ID NO. 19) portion of a genomic nucleic acid sequence of meth comprising at least one adenine “A” allele, wherein the ylenetetrahydrofolate reductase (MTHFR); SEQID NO. 19 is a portion of a genomic nucleic acid iii. a SNP at position 2756 of SEQID NO. 2 or position sequence of choline-phosphate cytidylyltransferase A 27 of SEQID NO. 9 comprising at least one guanine (PCYT1A); 55 “G” allele, wherein the SEQ ID NO. 2 and SEQ ID xii. a SNP at rs6275 (position 27 of SEQ ID NO. 20) NO. 9 are each independently a portion of a genomic comprising at least one thymine “Tallele, wherein the nucleic acid sequence of methionine synthase SEQID NO. 20 is a portion of a genomic nucleic acid (MTR): sequence of dopamine receptor D2 (DRD2); iv. a SNP at position 66 of SEQ ID NO. 3 or position xiii. a SNP at rs1079596 (position 27 of SEQ ID NO. 21) 60 27 of SEQ ID NO. 10 comprising at least one comprising at least one thymine “Tallele, wherein the guanine “G” allele, wherein the SEQ ID NO. 3 and SEQID NO. 21 is a portion of a genomic nucleic acid SEQID NO. 10 are each independently a portion of sequence of dopamine receptor D2 (DRD2); a genomic nucleic acid sequence of methionine xiv. a SNP at rs11240594 (position 27 of SEQID NO. 22) synthase reductase (MTRR): comprising at least one adenine “A” allele, wherein the 65 v. a SNP at rs1006737 (position 27 of SEQID NO. 11) SEQID NO. 22 is a portion of a genomic nucleic acid comprising at least one adenine “A” allele, wherein sequence of dopamine receptor D2 (DRD2); the SEQID NO. 11 is a portion of a genomic nucleic US 9,540,691 B2 111 112 acid sequence of calcium channel, Voltage-depen the SEQID NO. 25 is a portion of a genomic nucleic dent, L type, alpha 1 C subunit (CACNA1C); acid sequence of solute carrier family 6 (neurotrans vi. a SNP at rs1883729 (position 27 of SEQID NO.12) mitted transported, dopamine), member 3 comprising at least one adenine “A” allele, wherein (SLC6A3); the SEQID NO. 12 is a portion of a genomic nucleic xx. a SNP at rs2277820 (position 27 of SEQID NO. 26) acid sequence of DNA (cytosine-5)-methyltrans comprising at least one thymine “T” allele, wherein ferase 3 beta (DNMT3B); the SEQID NO. 26 is a portion of a genomic nucleic vii. a SNP at rs7163862 (position 27 of SEQ ID NO. acid sequence of formiminotransferase cyclodeami 13) comprising at least one thymine “T” allele, nase (FTCD); and wherein the SEQID NO. 13 is a portion of a genomic 10 XXi. a SNP at rs2236225 (position 27 of SEQ ID NO. nucleic acid sequence of GTP cyclohydrolase 1 27) comprising at least one adenine “A” allele, feedback regulatory protein (GCHFR): wherein the SEQID NO. 27 is a portion of a genomic viii. a SNP at rs12659 (position 27 of SEQID NO. 14) nucleic acid sequence of methylenetetrahydrofolate comprising at least one thymine “T” allele, wherein dehydrogenase (NADP+ dependent) 1 (MTHFD1): the SEQID NO. 14 is a portion of a genomic nucleic 15 xxii. obesity (e.g., defined by a BMI value of at least 30 acid sequence of reduced folate carrier protein kg/m or greater); (RCF2); xxiii. an expression ratio of SAM to SAH smaller than ix. a SNP at rs202676 (position 27 of SEQID NO. 15) a pre-determined ratio: comprising at least one guanine "G” allele, wherein xxiv. an expression of 4-HNE greater than a pre the SEQID NO. 15 is a portion of a genomic nucleic determined standard; acid sequence of folate hydrolase (prostate-specific XXV. an expression of hsCRP greater than about 2.3 mg membrane antigen) 1 (FOLH1); per liter of plasma as measured in a plasma sample: x. a SNP at rs2297291 (position 27 of SEQID NO. 16) and any combinations thereof, and comprising at least one adenine “A” allele, wherein (b) instructions for displaying a content based in part on the SEQID NO. 16 is a portion of a genomic nucleic 25 the data output from said determination module, acid sequence of reduced folate carrier protein wherein the content comprises a signal indicative of the (RCF1): presence of at least one of the conditions, and option xi. a SNP at rs1051266 (position 27 of SEQID NO. 17) ally the absence of any one of the conditions, or a signal comprising at least one adenine “A” allele, wherein indicative of the absence of all of the conditions. the SEQID NO. 17 is a portion of a genomic nucleic 30 69. The computer readable medium of paragraph 68, further acid sequence of reduced folate carrier protein comprising instructions to display a signal indicative of the (RCF1): subject recommended to receive a treatment regimen com xii. a SNP at rs8007267 (position 27 of SEQ ID NO. prising a folate-containing compound, or a signal indicative 18) comprising at least one thymine “T” allele, of the subject recommended to receive an alternative treat wherein the SEQID NO. 18 is a portion of a genomic 35 ment regimen without a folate-containing compound. nucleic acid sequence of GTP cyclohydrolase 1 70. The computer readable medium of any of the preceding (GCH1): paragraphs, wherein the depression is major depressive xiii. a SNP at rs7639752 (position 27 of SEQ ID NO. disorder. 19) comprising at least one adenine “A” allele, 71. A kit comprising: wherein the SEQID NO.19 is a portion of a genomic 40 an oligonucleotide array affixed with a plurality of oligo nucleic acid sequence of choline-phosphate cytidy nucleotide probes that interrogate no more than 30 lyltransferase A (PCYT1A); single nucleotide polymorphisms (SNPs), wherein said xiv. a SNP at rs6275 (position 27 of SEQ ID NO. 20) SNPs comprise at least two of the following SNPs or comprising at least one thymine “T” allele, wherein any combinations thereof: the SEQID NO. 20 is a portion of a genomic nucleic 45 i. a SNP at position 677 of SEQ ID NO. 1 or position acid sequence of dopamine receptor D2 (DRD2); 27 of SEQ ID NO. 7 (identified by rs1801133) xv. aSNP at rs1079596 (position 27 of SEQID NO. 21) comprising at least one thymine “T” allele, wherein comprising at least one thymine “T” allele, wherein the SEQ ID NO. 1 and SEQ ID NO. 7 are each the SEQID NO. 21 is a portion of a genomic nucleic independently a portion of a genomic nucleic acid acid sequence of dopamine receptor D2 (DRD2); 50 sequence of methylenetetrahydrofolate reductase xvi. a SNP at rs11240594 (position 27 of SEQ ID NO. (MTHFR): 22) comprising at least one adenine “A” allele, ii. a SNP at rs2274976 (position 1793 of SEQ ID NO. wherein the SEQID NO. 22 is a portion of a genomic 1 or position 27 of SEQ ID NO. 8) comprising at nucleic acid sequence of dopamine receptor D2 least one adenine “A” allele, wherein the SEQ ID (DRD2): 55 NO. 1 and SEQ ID NO. 8 are each independently a xvii. a SNP at rs4633 (position 27 of SEQ ID NO. 23) portion of a genomic nucleic acid sequence of meth comprising at least one cytosine “C” allele, wherein ylenetetrahydrofolate reductase (MTHFR); the SEQID NO. 23 is a portion of a genomic nucleic iii. a SNP at position 2756 of SEQID NO. 2 or position acid sequence of catechol-O-methyltransferase 27 of SEQID NO. 9 comprising at least one guanine (COMT): 60 “G” allele, wherein the SEQ ID NO. 2 and SEQ ID xviii. a SNP at rs4680 (position 27 of SEQID NO. 24) NO. 9 are each independently a portion of a genomic comprising at least one guanine "G” allele, wherein nucleic acid sequence of methionine synthase the SEQID NO. 24 is a portion of a genomic nucleic (MTR): acid sequence of catechol-O-methyltransferase iv. a SNP at position 66 of SEQ ID NO. 3 or position (COMT): 65 27 of SEQ ID NO. 10 comprising at least one xix. a SNP at rs250682 (position 27 of SEQID NO. 25) guanine “G” allele, wherein the SEQ ID NO. 3 and comprising at least one cytosine “C” allele, wherein SEQID NO. 10 are each independently a portion of US 9,540,691 B2 113 114 a genomic nucleic acid sequence of methionine the SEQID NO. 24 is a portion of a genomic nucleic synthase reductase (MTRR): acid sequence of catechol-O-methyltransferase v. a SNP at rs1006737 (position 27 of SEQID NO. 11) (COMT): comprising at least one adenine “A” allele, wherein xix. a SNP at rs250682 (position 27 of SEQID NO. 25) the SEQID NO. 11 is a portion of a genomic nucleic comprising at least one cytosine “C” allele, wherein acid sequence of calcium channel, Voltage-depen the SEQID NO. 25 is a portion of a genomic nucleic dent, L type, alpha 1 C subunit (CACNA1C); acid sequence of solute carrier family 6 (neurotrans vi. a SNP at rs1883729 (position 27 of SEQID NO.12) mitted transported, dopamine), member 3 comprising at least one adenine “A” allele, wherein (SLC6A3); the SEQID NO. 12 is a portion of a genomic nucleic 10 acid sequence of DNA (cytosine-5)-methyltrans xx. a SNP at rs2277820 (position 27 of SEQID NO. 26) ferase 3 beta (DNMT3B); comprising at least one thymine “T” allele, wherein vii. a SNP at rs7163862 (position 27 of SEQ ID NO. the SEQID NO. 26 is a portion of a genomic nucleic 13) comprising at least one thymine “T” allele, acid sequence of formiminotransferase cyclodeami wherein the SEQID NO. 13 is a portion of a genomic 15 nase (FTCD); and nucleic acid sequence of GTP cyclohydrolase 1 XXi. a SNP at rs2236225 (position 27 of SEQ ID NO. feedback regulatory protein (GCHFR): 27) comprising at least one adenine “A” allele, viii. a SNP at rs12659 (position 27 of SEQID NO. 14) wherein the SEQID NO. 27 is a portion of a genomic comprising at least one thymine “T” allele, wherein nucleic acid sequence of methylenetetrahydrofolate the SEQID NO. 14 is a portion of a genomic nucleic dehydrogenase (NADP+ dependent) 1 (MTHFD1); acid sequence of reduced folate carrier protein and (RCF2); an optional container containing a detectable label to be ix. a SNP at rs202676 (position 27 of SEQID NO. 15) conjugated to a nucleotide molecule derived from a test comprising at least one guanine "G” allele, wherein sample of a Subject; and the SEQID NO. 15 is a portion of a genomic nucleic 25 at least one reagent. acid sequence of folate hydrolase (prostate-specific 72. A kit comprising: membrane antigen) 1 (FOLH1); an oligonucleotide array affixed with a plurality of oligo x. a SNP at rs2297291 (position 27 of SEQID NO. 16) nucleotide probes that interrogate no more than 5 single comprising at least one adenine “A” allele, wherein nucleotide polymorphisms (SNPs), said SNPs compris the SEQID NO. 16 is a portion of a genomic nucleic 30 1ng: acid sequence of reduced folate carrier protein (i) a SNP at position 677 of SEQID NO. 1 or position 27 (RCF1): of SEQ ID NO. 7 (identified by rs1801133), wherein xi. a SNP at rs1051266 (position 27 of SEQID NO. 17) the SEQ ID NO. 1 and SEQ ID NO. 7 are each comprising at least one adenine “A” allele, wherein independently a portion of a genomic nucleic acid the SEQID NO. 17 is a portion of a genomic nucleic 35 sequence of methylenetetrahydrofolate reductase acid sequence of reduced folate carrier protein (MTHFR): (RCF1): (ii) a SNP at position 2756 of SEQ ID NO. 2 or position xii. a SNP at rs8007267 (position 27 of SEQ ID NO. 27 of SEQID NO. 9 (identified by rs1805087), wherein 18) comprising at least one thymine “T” allele, the SEQ ID NO. 2 and SEQ ID NO. 9 are each wherein the SEQID NO. 18 is a portion of a genomic 40 independently a portion of a genomic nucleic acid nucleic acid sequence of GTP cyclohydrolase 1 sequence of methionine synthase (MTR): (GCH1): an optional container containing a detectable label to be xiii. a SNP at rs7639752 (position 27 of SEQ ID NO. conjugated to a nucleotide molecule derived from a test 19) comprising at least one adenine “A” allele, sample of a Subject; and wherein the SEQID NO.19 is a portion of a genomic 45 at least one reagent. nucleic acid sequence of choline-phosphate cytidy 73. The kit of paragraph 71 or 72, wherein the at least one lyltransferase A (PCYT1A); reagent is selected from the group consisting of a restriction xiv. a SNP at rs6275 (position 27 of SEQ ID NO. 20) enzyme, a universal adaptor to be conjugated to a nucleotide comprising at least one thymine “T” allele, wherein molecule, a primer complementary to the universal adaptor, the SEQID NO. 20 is a portion of a genomic nucleic 50 a wash agent, and any combinations thereof. acid sequence of dopamine receptor D2 (DRD2); 74. The kit of any of paragraphs 71-73, wherein the detect xv. aSNP at rs1079596 (position 27 of SEQID NO. 21) able label comprises a fluorescent molecule. comprising at least one thymine “T” allele, wherein 75. A kit comprising: the SEQID NO. 21 is a portion of a genomic nucleic a plurality of oligonucleotide primers that bind to at least acid sequence of dopamine receptor D2 (DRD2); 55 one allele of no more than 30 single nucleotide poly xvi. a SNP at rs11240594 (position 27 of SEQ ID NO. morphisms (SNPs), wherein each subset of oligonucle 22) comprising at least one adenine “A” allele, otide primers that bind to a specific allele of a SNP is wherein the SEQID NO. 22 is a portion of a genomic labeled with a distinct reporter, and wherein said SNPs nucleic acid sequence of dopamine receptor D2 comprise at least two of the following SNPs or any (DRD2): 60 combinations thereof: xvii. a SNP at rs4633 (position 27 of SEQ ID NO. 23) i. a single nucleotide polymorphism (SNP) at position comprising at least one cytosine “C” allele, wherein 677 of SEQID NO. 1 or position 27 of SEQID NO. the SEQID NO. 23 is a portion of a genomic nucleic 7 (identified by rs1801 133) comprising at least one acid sequence of catechol-O-methyltransferase thymine “T” allele, wherein the SEQ ID NO. 1 and (COMT): 65 SEQ ID NO. 7 are each independently a portion of xviii. a SNP at rs4680 (position 27 of SEQID NO. 24) a genomic nucleic acid sequence of methylenetetra comprising at least one guanine "G” allele, wherein hydrofolate reductase (MTHFR): US 9,540,691 B2 115 116 ii. a SNP at rs2274.976 (position 1793 of SEQ ID NO. xv. aSNP at rs1079596 (position 27 of SEQID NO. 21) 1 or position 27 of SEQ ID NO. 8) comprising at comprising at least one thymine “T” allele, wherein least one adenine “A” allele, wherein the SEQ ID the SEQID NO. 21 is a portion of a genomic nucleic NO. 1 and SEQ ID NO. 8 are each independently a acid sequence of dopamine receptor D2 (DRD2); portion of a genomic nucleic acid sequence of meth xvi. a SNP at rs11240594 (position 27 of SEQ ID NO. ylenetetrahydrofolate reductase (MTHFR); 22) comprising at least one adenine “A” allele, iii. a SNP at position 2756 of SEQID NO. 2 or position wherein the SEQID NO. 22 is a portion of a genomic 27 of SEQID NO. 9 comprising at least one guanine nucleic acid sequence of dopamine receptor D2 “G” allele, wherein the SEQ ID NO. 2 and SEQ ID (DRD2); NO. 9 are each independently a portion of a genomic 10 xvii. a SNP at rs4633 (position 27 of SEQ ID NO. 23) nucleic acid sequence of methionine synthase comprising at least one cytosine “C” allele, wherein (MTR): the SEQID NO. 23 is a portion of a genomic nucleic iv. a SNP at position 66 of SEQ ID NO. 3 or position acid sequence of catechol-O-methyltransferase 27 of SEQ ID NO. 10 comprising at least one (COMT): guanine “G” allele, wherein the SEQ ID NO. 3 and 15 xviii. a SNP at rs4680 (position 27 of SEQID NO. 24) SEQID NO. 10 are each independently a portion of comprising at least one guanine "G” allele, wherein a genomic nucleic acid sequence of methionine the SEQID NO. 24 is a portion of a genomic nucleic synthase reductase (MTRR): acid sequence of catechol-O-methyltransferase v. a SNP at rs1006737 (position 27 of SEQID NO. 11) (COMT): comprising at least one adenine “A” allele, wherein xix. a SNP at rs250682 (position 27 of SEQID NO. 25) the SEQID NO. 11 is a portion of a genomic nucleic comprising at least one cytosine “C” allele, wherein acid sequence of calcium channel, Voltage-depen the SEQID NO. 25 is a portion of a genomic nucleic dent, L type, alpha 1 C subunit (CACNA1C); acid sequence of solute carrier family 6 (neurotrans vi. a SNP at rs1883729 (position 27 of SEQID NO.12) mitted transported, dopamine), member 3 comprising at least one adenine “A” allele, wherein 25 (SLC6A3); the SEQID NO. 12 is a portion of a genomic nucleic xx. a SNP at rs2277820 (position 27 of SEQID NO. 26) acid sequence of DNA (cytosine-5)-methyltrans comprising at least one thymine “T” allele, wherein ferase 3 beta (DNMT3B); the SEQID NO. 26 is a portion of a genomic nucleic vii. a SNP at rs7163862 (position 27 of SEQ ID NO. acid sequence of formiminotransferase cyclodeami 13) comprising at least one thymine “T” allele, 30 nase (FTCD); and wherein the SEQID NO. 13 is a portion of a genomic XXi. a SNP at rs2236225 (position 27 of SEQ ID NO. nucleic acid sequence of GTP cyclohydrolase 1 27) comprising at least one adenine “A” allele, feedback regulatory protein (GCHFR): wherein the SEQID NO. 27 is a portion of a genomic viii. a SNP at rs12659 (position 27 of SEQID NO. 14) nucleic acid sequence of methylenetetrahydrofolate comprising at least one thymine “T” allele, wherein 35 dehydrogenase (NADP+ dependent) 1 (MTHFD1); the SEQID NO. 14 is a portion of a genomic nucleic and acid sequence of reduced folate carrier protein at least one reagent. (RCF2); 76. A kit comprising: ix. a SNP at rs202676 (position 27 of SEQID NO. 15) a plurality of oligonucleotide primers that bind to at least comprising at least one guanine "G” allele, wherein 40 one allele of no more than 5 single nucleotide poly the SEQID NO. 15 is a portion of a genomic nucleic morphisms (SNPs), wherein each subset of oligonucle acid sequence of folate hydrolase (prostate-specific otide primers that bind to a specific allele of a SNP is membrane antigen) 1 (FOLH1); labeled with a distinct reporter, and wherein said SNPs x. a SNP at rs2297291 (position 27 of SEQID NO. 16) comprise the following SNPs: comprising at least one adenine “A” allele, wherein 45 (i) a SNP at position 677 of SEQID NO. 1 or position the SEQID NO. 16 is a portion of a genomic nucleic 27 of SEQ ID NO. 7 (identified by rs1801133) acid sequence of reduced folate carrier protein comprising at least one thymine “T” allele, wherein (RCF1): the SEQ ID NO. 1 and SEQ ID NO. 7 are each xi. a SNP at rs1051266 (position 27 of SEQID NO. 17) independently a portion of a genomic nucleic acid comprising at least one adenine “A” allele, wherein 50 sequence of methylenetetrahydrofolate reductase the SEQID NO. 17 is a portion of a genomic nucleic (MTHFR): acid sequence of reduced folate carrier protein (ii) a SNP at position 2756 of SEQID NO. 2 or position (RCF1): 27 of SEQID NO. 9 comprising at least one guanine xii. a SNP at rs8007267 (position 27 of SEQ ID NO. “G” allele, wherein the SEQ ID NO. 2 and SEQ ID 18) comprising at least one thymine “T” allele, 55 NO. 9 are each independently a portion of a genomic wherein the SEQID NO. 18 is a portion of a genomic nucleic acid sequence of methionine synthase nucleic acid sequence of GTP cyclohydrolase 1 (MTR); and (GCH1): at least one reagent. xiii. a SNP at rs7639752 (position 27 of SEQ ID NO. 77. The kit of any of paragraphs 75-76, wherein said at least 19) comprising at least one adenine “A” allele, 60 one reagent comprises free nucleotide bases, a polymerase, wherein the SEQID NO.19 is a portion of a genomic or both. nucleic acid sequence of choline-phosphate cytidy 78. A kit for selecting a treatment regimen for a subject with lyltransferase A (PCYT1A); depression, comprising xiv. a SNP at rs6275 (position 27 of SEQ ID NO. 20) at least one reagent for determining in a test sample of a comprising at least one thymine “T” allele, wherein 65 human Subject diagnosed as having depression or hav the SEQID NO. 20 is a portion of a genomic nucleic ing a risk for depression, the presence or absence of the acid sequence of dopamine receptor D2 (DRD2); following SNPs: US 9,540,691 B2 117 118 i. a single nucleotide polymorphism (SNP) at position xi. a SNP at rs7639752 (position 27 of SEQ ID NO. 19) 677 of SEQID NO. 1 or position 27 of SEQID NO. comprising at least one adenine “A” allele, wherein the 7 (identified by rs1801133) comprising at least one SEQID NO. 19 is a portion of a genomic nucleic acid thymine “T” allele, wherein the SEQ ID NO. 1 and sequence of choline-phosphate cytidylyltransferase A SEQ ID NO. 7 are each independently a portion of 5 (PCYT1A); a genomic nucleic acid sequence of methylenetetra xii. a SNP at rs6275 (position 27 of SEQ ID NO. 20) hydrofolate reductase (MTHFR); and comprising at least one thymine “Tallele, wherein the ii. a SNP at position 2756 of SEQID NO. 2 or position SEQID NO. 20 is a portion of a genomic nucleic acid 27 of SEQID NO. 9 comprising at least one guanine sequence of dopamine receptor D2 (DRD2); “G” allele, wherein the SEQ ID NO. 2 and SEQ ID 10 xiii. a SNP at rs1079596 (position 27 of SEQID NO. 21) NO. 9 are each independently a portion of a genomic comprising at least one thymine “Tallele, wherein the nucleic acid sequence of methionine synthase SEQID NO. 21 is a portion of a genomic nucleic acid (MTR); and sequence of dopamine receptor D2 (DRD2); instructions for use in the assay of any of paragraphs xiv. a SNP at rs11240594 (position 27 of SEQID NO. 22) 1-69, in the method of any of paragraphs 70-129, 15 comprising at least one adenine “A” allele, wherein the or in the system of any of paragraphs 130-171, or SEQID NO. 22 is a portion of a genomic nucleic acid any combinations thereof. sequence of dopamine receptor D2 (DRD2); 79. The kit of paragraph 78, wherein said SNPs further XV, a SNP at rs4633 (position 27 of SEQ ID NO. 23) comprises one or any combination of the following: comprising at least one cytosine “Callele, wherein the i.a SNP at rs2274.976 (position 1793 of SEQID NO. 1 or SEQID NO. 23 is a portion of a genomic nucleic acid position 27 of SEQID NO. 8) comprising at least one sequence of catechol-O-methyltransferase (COMT); adenine “A” allele, wherein the SEQ ID NO. 1 and xvi. a SNP at rs4680 (position 27 of SEQ ID NO. 24) SEQ ID NO. 9 are each independently a portion of a comprising at least one guanine “G” allele, wherein the genomic nucleic acid sequence of methylenetetrahy SEQID NO. 24 is a portion of a genomic nucleic acid drofolate reductase (MTHFR): 25 sequence of catechol-O-methyltransferase (COMT); ii. a SNP at position 66 of SEQ ID NO. 3 or position 27 xvii. a SNP at rs250682 (position 27 of SEQ ID NO. 25) of SEQID NO. 10 comprising at least one guanine “G” comprising at least one cytosine “Callele, wherein the allele, wherein the SEQID NO. 3 and SEQID NO. 10 SEQID NO. 25 is a portion of a genomic nucleic acid are each independently a portion of a genomic nucleic sequence of Solute carrier family 6 (neurotransmitted acid sequence of methionine synthase reductase 30 transported, dopamine), member 3 (SLC6A3); (MTRR): xviii. a SNP at rs2277820 (position 27 of SEQID NO. 26) iii. a SNP at rs1006737 (position 27 of SEQ ID NO. 11) comprising at least one thymine “T” allele, wherein the comprising at least one adenine “A” allele, wherein the SEQID NO. 26 is a portion of a genomic nucleic acid SEQID NO. 11 is a portion of a genomic nucleic acid sequence of formiminotransferase cyclodeaminase sequence of calcium channel, Voltage-dependent, L 35 (FTCD); and type, alpha 1C subunit (CACNA1C); xix. a SNP at rs2236225 (position 27 of SEQ ID NO. 27) iv. a SNP at rs1883729 (position 27 of SEQ ID NO. 12) comprising at least one adenine “A” allele, wherein the comprising at least one adenine “A” allele, wherein the SEQID NO. 27 is a portion of a genomic nucleic acid SEQID NO. 12 is a portion of a genomic nucleic acid sequence of methylenetetrahydrofolate dehydrogenase sequence of DNA (cytosine-5)-methyltransferase 3 40 (NADP+ dependent) 1 (MTHFD1). beta (DNMT3B); 80. The kit of any of the preceding paragraphs, further v. a SNP at rs7163862 (position 27 of SEQ ID NO. 13) comprising a solid Substrate Support affixed with at least one comprising at least one thymine “Tallele, wherein the protein-based binding moiety that specifically binds to a SEQID NO. 13 is a portion of a genomic nucleic acid biomarker selected from the group consisting of SAM, SAH. sequence of GTP cyclohydrolase 1 feedback regulatory 45 4-HNE and hSCRP. protein (GCHFR): 81. The kit of paragraph 80, wherein the protein-based vi. a SNP at rs12659 (position 27 of SEQ ID NO. 14) binding moiety comprises an antibody. comprising at least one thymine “Tallele, wherein the 82. The kit of paragraph 80 or 81, wherein the solid substrate SEQID NO. 14 is a portion of a genomic nucleic acid support is a microtiter plate for ELISA. sequence of reduced folate carrier protein (RCF2); 50 83. The kit of paragraph 80 or 81, wherein the solid substrate vii. a SNP at rs202676 (position 27 of SEQ ID NO. 15) Support is a dipstick. comprising at least one guanine “G” allele, wherein the 84. The kit of paragraph 80 or 81, wherein the solid substrate SEQID NO. 15 is a portion of a genomic nucleic acid Support comprises a magnetic bead. sequence of folate hydrolase (prostate-specific mem 85. The kit of any of the preceding paragraphs, further brane antigen) 1 (FOLH1); 55 comprising at least one primer designed to probe a bio viii. a SNP at rs2297291 (position 27 of SEQ ID NO. 16) marker selected from the group consisting of SAM, SAH. comprising at least one adenine “A” allele, wherein the 4-HNE, and hsCRP. SEQID NO. 16 is a portion of a genomic nucleic acid 86. The kit of any of the preceding paragraphs, wherein the sequence of reduced folate carrier protein (RCF1): depression is major depressive disorder. ix. a SNP at rs1051266 (position 27 of SEQ ID NO. 17) 60 87. A method for selecting a treatment regimen for a human comprising at least one adenine “A” allele, wherein the Subject with depression, comprising: SEQID NO. 17 is a portion of a genomic nucleic acid a. obtaining a test sample from the human Subject diag sequence of reduced folate carrier protein (RCF1): nosed as having depression; x. a SNP at rs8007267 (position 27 of SEQID NO. 18) b. Subjecting the test sample to at least one analysis to comprising at least one thymine “Tallele, wherein the 65 determine parameters of at least two biomarkers, SEQID NO. 18 is a portion of a genomic nucleic acid wherein the parameters of said at least two biomarkers sequence of GTP cyclohydrolase 1 (GCH1); are selected from the following: US 9,540,691 B2 119 120 i. genotype of a SNP locus at position 677 of SEQ ID portion of a genomic nucleic acid sequence of dop NO. 1 or position 27 of SEQID NO. 7 (identified by amine receptor D2 (DRD2); rs 18.01133), wherein the SEQID NO. 1 and SEQID xv. genotype of a SNP locus at rs1079596 (position 27 NO. 7 are each independently a portion of a genomic of SEQ ID NO. 21), wherein the SEQ ID NO. 21 is nucleic acid sequence of methylenetetrahydrofolate a portion of a genomic nucleic acid sequence of reductase (MTHFR): dopamine receptor D2 (DRD2); ii. genotype of a SNP locus at rs2274976 (position 1793 xvi. genotype of a SNP locus at rs11240594 (position of SEQID NO. 1 or position 27 of SEQ ID NO. 8), 27 of SEQID NO. 22), wherein the SEQID NO. 22 wherein the SEQ ID NO. 1 and SEQ ID NO. 8 are is a portion of a genomic nucleic acid sequence of each independently a portion of a genomic nucleic 10 dopamine receptor D2 (DRD2); acid sequence of methylenetetrahydrofolate reduc xvii. genotype of a SNP locus at rs4633 (position 27 of tase (MTHFR): SEQ ID NO. 23), wherein the SEQ ID NO. 23 is a iii. genotype of a SNP locus at position 2756 of SEQID portion of a genomic nucleic acid sequence of cat NO. 2 or position 27 of SEQID NO. 9 (identified by echol-O-methyltransferase (COMT); rs1805087), wherein the SEQID NO. 2 and SEQID 15 NO. 9 are each independently a portion of a genomic xviii. genotype of a SNP locus at rs4680 (position 27 of nucleic acid sequence of methionine synthase SEQ ID NO. 24), wherein the SEQ ID NO. 24 is a (MTR): portion of a genomic nucleic acid sequence of cat iv. genotype of a SNP locus at position 66 of SEQ ID echol-O-methyltransferase (COMT); NO. 3 or position 27 of SEQID NO. 10 (identified xix. genotype of a SNP locus at rs250682 (position 27 by rs1801394), wherein the SEQID NO. 3 and SEQ of SEQ ID NO. 250, wherein the SEQID NO. 25 is ID NO. 10 are each independently a portion of a a portion of a genomic nucleic acid sequence of genomic nucleic acid sequence of methionine Syn Solute carrier family 6 (neurotransmitted transported, thase reductase (MTRR): dopamine), member 3 (SLC6A3); v. genotype of a SNP locus at rs1006737 (position 27 25 XX. genotype of a SNP locus at rs2277820 (position 27 of SEQ ID NO. 11), wherein the SEQID NO. 11 is of SEQ ID NO. 26), wherein the SEQ ID NO. 26 is a portion of a genomic nucleic acid sequence of a portion of a genomic nucleic acid sequence of calcium channel, Voltage-dependent, L type, alpha formiminotransferase cyclodeaminase (FTCD); 1C subunit (CACNA1C); XXi. genotype of a SNP locus at rs2236225 (position 27 vi. genotype of a SNP locus at rs1883729 (position 27 30 of SEQ ID NO. 12), wherein the SEQ ID NO. 12 is of SEQID NO. 27), wherein the SEQ ID NO. 27 is a portion of a genomic nucleic acid sequence of a portion of a genomic nucleic acid sequence of DNA (cytosine-5)-methyltransferase 3 beta methylenetetrahydrofolate dehydrogenase (NADP+ (DNMT3B); dependent) 1 (MTHFD1): vii. genotype of a SNP locus at rs7163862 (position 27 35 xxii. expressions of SAM and SAH; of SEQID NO. 13), wherein the SEQ ID NO. 13 is xxiii. expression of 4-HNE; a portion of a genomic nucleic acid sequence of GTP xxiv. expression of hsCRP; and any combinations cyclohydrolase 1 feedback regulatory protein thereof, and (GCHFR): ... determining, from the parameters of said at least two viii. genotype of a SNP locus at rs12659 (position 27 of 40 biomarkers, the presence of at least one condition SEQ ID NO. 14), wherein the SEQ ID NO. 14 is a selected from the following: portion of a genomic nucleic acid sequence of i. a SNP at position 677 of SEQ ID NO. 1 or position reduced folate carrier protein (RCF2); 27 of SEQID NO. 7 comprising at least one thymine ix. genotype of a SNP locus at rs202676 (position 27 of “T allele; SEQ ID NO. 15), wherein the SEQ ID NO. 15 is a 45 ii. a SNP at rs2274976 (position 1793 of SEQ ID NO. portion of a genomic nucleic acid sequence of folate 1 or position 27 of SEQ ID NO. 8) comprising at hydrolase (prostate-specific membrane antigen) 1 least one adenine 'A' allele; (FOLH1); iii. a SNP at position 2756 of SEQID NO. 2 or position X. genotype of a SNP locus at rs2297291 (position 27 27 of SEQID NO. 9 comprising at least one guanine of SEQ ID NO. 16), wherein the SEQ ID NO. 16 is 50 “G” allele; a portion of a genomic nucleic acid sequence of iv. a SNP at position 66 of SEQ ID NO. 3 or position reduced folate carrier protein (RCF1): 27 of SEQ ID NO. 10 comprising at least one xi. genotype of a SNP locus at rs1051266 (position 27 guanine “G” allele; of SEQID NO. 17, wherein the SEQ ID NO. 17 is v. a SNP at rs1006737 (position 27 of SEQID NO. 11) a portion of a genomic nucleic acid sequence of 55 comprising at least one adenine “A” allele; reduced folate carrier protein (RCF1)); vi. aSNP at rs1883729 (position 27 of SEQID NO.12) xii. genotype of a SNP locus at rs8007267 (position 27 comprising at least one adenine “A” allele; of SEQ ID NO. 18), wherein the SEQ ID NO. 18 is vii. a SNP at rs7163862 (position 27 of SEQ ID NO. a portion of a genomic nucleic acid sequence of GTP 13) comprising at least one thymine “T” allele; cyclohydrolase 1 (GCH1); 60 viii. a SNP at rs12659 (position 27 of SEQID NO. 14) xiii. genotype of a SNP locus at rs7639752 (position 27 comprising at least one thymine “T” allele; of SEQID NO. 19), wherein the SEQ ID NO. 19 is ix. a SNP at rs202676 (position 27 of SEQ ID NO. 15) a portion of a genomic nucleic acid sequence of comprising at least one guanine "G” allele; choline-phosphate cytidylyltransferase A x. a SNP at rs2297291 (position 27 of SEQID NO. 16) (PCYT1A); 65 comprising at least one adenine “A” allele; xiv. genotype of a SNP locus at rs6275 (position 27 of xi. aSNP at rs1051266 (position 27 of SEQID NO. 17) SEQ ID NO. 20), wherein the SEQ ID NO. 20 is a comprising at least one adenine “A” allele; US 9,540,691 B2 121 122 xii. a SNP at rs8007267 (position 27 of SEQ ID NO. 89. The method of paragraph 88, wherein the test sample is 18) comprising at least one thymine “T” allele; further subjected to determine a parameter of at least one of xiii. a SNP at rs7639752 (position 27 of SEQ ID NO. the following biomarkers or any combinations thereof: 19) comprising at least one adenine “A” allele; i. genotype of a SNP locus at rs2274.976 (position 1793 of SEQ ID NO. 1 or position 27 of SEQ ID NO. 8), xiv. a SNP at rs6275 (position 27 of SEQ ID NO. 20) wherein the SEQID NO. 1 and SEQID NO. 8 are each comprising at least one thymine “T” allele; independently a portion of a genomic nucleic acid xv. aSNP at rs1079596 (position 27 of SEQID NO. 21) sequence of methylenetetrahydrofolate reductase comprising at least one thymine “T” allele; (MTHFR): xvi. a SNP at rs11240594 (position 27 of SEQ ID NO. ii. genotype of a SNP locus at position 66 of SEQID NO. 22) comprising at least one adenine “A” allele; 10 3 or position 27 of SEQ ID NO. 10 (identified by xvii. a SNP at rs4633 (position 27 of SEQ ID NO. 23) rs 1801394), wherein the SEQ ID NO. 3 and SEQ ID comprising at least one cytosine “C” allele; NO. 10 are each independently a portion of a genomic xviii. a SNP at rs4680 (position 27 of SEQID NO. 24) nucleic acid sequence of methionine synthase reductase comprising at least one guanine "G” allele; (MTRR): 15 iii. genotype of a SNP locus at rs1006737 (position 27 of xix. a SNP at rs250682 (position 27 of SEQID NO. 25) SEQ ID NO. 11), wherein the SEQ ID NO. 11 is a comprising at least one cytosine “C” allele; portion of a genomic nucleic acid sequence of calcium xx. a SNP at rs2277820 (position 27 of SEQID NO. 26) channel, Voltage-dependent, L type, alpha 1C Subunit comprising at least one thymine “T” allele; and (CACNA1C); xxi. a SNP at rs2236225 (position 27 of SEQ ID NO. iv. genotype of a SNP locus at rs1883729 (position 27 of 27) comprising at least one adenine “A” allele; SEQ ID NO. 12), wherein the SEQ ID NO. 12 is a xxii. an expression ratio of SAM to SAH smaller than portion of a genomic nucleic acid sequence of DNA a pre-determined reference ratio; (cytosine-5)-methyltransferase 3 beta (DNMT3B); xxiii. an expression of 4-HNE greater than a pre v. genotype of a SNP locus at rs7163862 (position 27 of determined reference value; 25 SEQ ID NO. 13), wherein the SEQ ID NO. 13 is a xxiv. an expression of hsCRP greater than about 2.3 mg portion of a genomic nucleic acid sequence of GTP per liter of plasma as measured in a plasma sample: cyclohydrolase 1 feedback regulatory protein (GCHFR): and any combinations thereof; vi. genotype of a SNP locus at rs12659 (position 27 of d. providing a result output setting forth whether at least SEQ ID NO. 14), wherein the SEQ ID NO. 14 is a one of said condition is detected from the test sample 30 portion of a genomic nucleic acid sequence of reduced and if at least one condition is detected, then selecting folate carrier protein (RCF2); and optionally administering a treatment regimen com vii. genotype of a SNP locus at rs202676 (position 27 of prising an effective amount of a folate-containing com SEQ ID NO. 15), wherein the SEQ ID NO. 15 is a pound to the human Subject. portion of a genomic nucleic acid sequence of folate 88. A method for selecting a treatment regimen for a subject 35 hydrolase (prostate-specific membrane antigen) 1 with depression, comprising: (FOLH1); a. obtaining a test sample from the human Subject diag viii. genotype of a SNP locus at rs2297291 (position 27 of nosed as having depression; SEQ ID NO. 16), wherein the SEQ ID NO. 16 is a b. Subjecting the test sample to at least one analysis to portion of a genomic nucleic acid sequence of reduced determine parameters of at least two biomarkers, 40 folate carrier protein (RCF1): wherein the parameters of said at least two biomarkers ix. genotype of a SNP locus at rs1051266 (position 27 of comprise the following: SEQ ID NO. 17, wherein the SEQ ID NO. 17 is a i. genotype of a SNP locus at position 677 of SEQ ID portion of a genomic nucleic acid sequence of reduced NO. 1 or position 27 of SEQID NO. 7 (identified by folate carrier protein (RCF1)); rs 18.01133), wherein the SEQID NO. 1 and SEQID 45 X. genotype of a SNP locus at rs8007267 (position 27 of NO. 7 are each independently a portion of a genomic SEQ ID NO. 18), wherein the SEQ ID NO. 18 is a nucleic acid sequence of methylenetetrahydrofolate portion of a genomic nucleic acid sequence of GTP reductase (MTHFR): cyclohydrolase 1 (GCH1); ii. genotype of a SNP locus at position 2756 of SEQID xi. genotype of a SNP locus at rs7639752 (position 27 of NO. 2 or position 27 of SEQID NO. 9 (identified by 50 SEQ ID NO. 19), wherein the SEQ ID NO. 19 is a rs1805087), wherein the SEQID NO. 2 and SEQID portion of a genomic nucleic acid sequence of choline NO. 9 are each independently a portion of a genomic phosphate cytidylyltransferase A (PCYT1A); nucleic acid sequence of methionine synthase xii. genotype of a SNP locus at rs6275 (position 27 of SEQ ID NO. 20), wherein the SEQ ID NO. 20 is a (MTR): portion of a genomic nucleic acid sequence of dop c. determining, from the determined parameters of said at 55 amine receptor D2 (DRD2); least two biomarkers, the presence of at least one xiii. genotype of a SNP locus at rs1079596 (position 27 of condition of the following or a combination thereof: SEQ ID NO. 21), wherein the SEQ ID NO. 21 is a i. a SNP at position 677 of SEQID NO. 1 comprising portion of a genomic nucleic acid sequence of dop at least one thymine “T” allele; amine receptor D2 (DRD2); ii. a SNP at position 2756 of SEQID NO. 2 comprising 60 xiv. genotype of a SNP locus at rs11240594 (position 27 at least one guanine “G” allele; of SEQ ID NO. 22), wherein the SEQ ID NO. 22 is a d. providing a result output setting forth whether at least portion of a genomic nucleic acid sequence of dop one of said condition is detected from the test sample amine receptor D2 (DRD2); and if at least one condition or both is detected, then XV. genotype of a SNP locus at rs4633 (position 27 of SEQ Selecting and optionally administering a treatment regi 65 ID NO. 23), wherein the SEQ ID NO. 23 is a portion men comprising an effective amount of a folate-con of a genomic nucleic acid sequence of catechol-O- taining compound to the human Subject. methyltransferase (COMT); US 9,540,691 B2 123 124 xvi. genotype of a SNP locus at rs4680 (position 27 of XXi. an expression of 4-HNE greater than a pre-deter SEQ ID NO. 24), wherein the SEQ ID NO. 24 is a mined reference value; and portion of a genomic nucleic acid sequence of catechol xxii. an expression of hsCRP greater than about 2.3 mg O-methyltransferase (COMT); per liter of plasma as measured in a plasma sample. xvii. genotype of a SNP locus at rs250682 (position 27 of 5 91. The method of any of the preceding paragraphs, wherein SEQ ID NO. 25), wherein the SEQ ID NO. 25 is a the predetermined reference value is about 3.0 mg per liter portion of a genomic nucleic acid sequence of Solute as measured in a plasma sample. carrier family 6 (neurotransmitted transported, dop 92. The method of any of the preceding paragraphs, wherein amine), member 3 (SLC6A3); the predetermined reference value is about 3.2 mg per liter 10 as measured in a plasma sample. xviii. genotype of a SNP locus at rs2277820 (position 27 93. The method of any of the preceding paragraphs, wherein of SEQ ID NO. 26), wherein the SEQ ID NO. 26 is a the step (b) further comprises optionally packing and ship portion of a genomic nucleic acid sequence of formimi ping the test sample to a test facility. notransferase cyclodeaminase (FTCD); 94. The method of paragraph 93, wherein the test facility is xix. genotype of a SNP locus at rs2236225 (position 27 of 15 a third-party CLIA-certified service provider. SEQ ID NO. 27), wherein the SEQ ID NO. 27 is a 95. The method of any of the preceding paragraphs, wherein portion of a genomic nucleic acid sequence of meth the step (d) is performed by a non-human machine. ylenetetrahydrofolate dehydrogenase (NADP+ depen 96. The method of any of the preceding paragraphs, further dent) 1 (MTHFD1); comprising determining an obesity indicator (e.g., measur XX. expressions of SAM and SAH; ing a BMI value) of the subject. XXi. expression of 4-HNE; and 97. The method of any of the preceding paragraphs, wherein xxii. expression of hsCRP. at least three of the foregoing biomarker parameters are 90. The method of paragraph 89, further comprising deter determined. mining the presence of at least one of the following condi 98. The method of any of the preceding paragraphs, wherein tions or any combinations thereof: 25 the depression is major depressive disorder. i.a SNP at rs2274.976 (position 1793 of SEQID NO. 1 or 99. Afolate-comprising composition for use in the treatment position 27 of SEQID NO. 8) comprising at least one of depression in a human Subject who carries at least one of adenine 'A' allele; the following single nucleotide polymorphisms or a combi ii. a SNP at position 66 of SEQ ID NO. 3 or position 27 nation thereof: of SEQID NO. 10 comprising at least one guanine “G” 30 a. at least one thymine “T” allele at SNP677, wherein the allele; SNP677 is at position 677 of SEQID NO. 1 or position iii. a SNP at rs1006737 (position 27 of SEQ ID NO. 11) 27 of SEQID NO. 7 (identified by rs1801133), wherein comprising at least one adenine “A” allele; the SEQ ID NO. 1 and SEQ ID NO. 7 are each iv. a SNP at rs1883729 (position 27 of SEQ ID NO. 12) independently a portion of a genomic nucleic acid comprising at least one adenine “A” allele; 35 sequence of methylenetetrahydrofolate reductase v. a SNP at rs7163862 (position 27 of SEQ ID NO. 13) (MTHFR); and comprising at least one thymine “T” allele; b. at least one guanine “G” allele at SNP2756, wherein the vi. a SNP at rs12659 (position 27 of SEQ ID NO. 14) SNP2756 is at position 2756 of SEQ ID NO. 2 or comprising at least one thymine “T” allele; position 27 of SEQID NO. 9 (identified by rs1805087), vii. a SNP at rs202676 (position 27 of SEQ ID NO. 15) 40 wherein the SEQID NO. 2 and SEQID NO. 9 are each comprising at least one guanine "G” allele; independently a portion of a genomic nucleic acid viii. a SNP at rs2297291 (position 27 of SEQ ID NO. 16) sequence of methionine synthase (MTR). comprising at least one adenine “A” allele; 100. A folate-comprising composition for use in the treat ix. a SNP at rs1051266 (position 27 of SEQ ID NO. 17) ment of depression in a human Subject who carries at least comprising at least one adenine “A” allele; 45 one of the following conditions or any combination thereof: x. a SNP at rs8007267 (position 27 of SEQID NO. 18) a. at least one thymine “Tallele at SNP locus at position comprising at least one thymine “T” allele; 677 of SEQID NO. 1 or position 27 of SEQID NO. 7 xi. a SNP at rs7639752 (position 27 of SEQ ID NO. 19) (identified by rs1801133), wherein the SEQ ID NO. 1 comprising at least one adenine “A” allele; and SEQID NO. 7 are each independently a portion of xii. a SNP at rs6275 (position 27 of SEQ ID NO. 20) 50 a genomic nucleic acid sequence of methylenetetrahy comprising at least one thymine “T” allele; drofolate reductase (MTHFR): xiii. a SNP at rs1079596 (position 27 of SEQ ID NO. 21) b. at least one adenine “A” allele at SNP locus at comprising at least one thymine “T” allele; rs2274.976 (position 1793 of SEQID NO. 1 or position xiv. a SNP at rs11240594 (position 27 of SEQID NO. 22) 27 of SEQ ID NO. 8), wherein the SEQID NO. 1 and comprising at least one adenine “A” allele; 55 SEQ ID NO. 8 are each independently a portion of a XV, a SNP at rs4633 (position 27 of SEQ ID NO. 23) genomic nucleic acid sequence of methylenetetrahy comprising at least one cytosine “C” allele; drofolate reductase (MTHFR): xvi. a SNP at rs4680 (position 27 of SEQ ID NO. 24) c. at least one guanine “G” allele at SNP locus at position comprising at least one guanine "G” allele; 2756 of SEQ ID NO. 2 or position 27 of SEQ ID NO. xvii. a SNP at rs250682 (position 27 of SEQ ID NO. 25) 60 9 (identified by rs1805087), wherein the SEQ ID NO. comprising at least one cytosine “C” allele; 2 and SEQID NO. 9 are each independently a portion xviii. aSNP at rs2277820 (position 27 of SEQID NO. 26) of a genomic nucleic acid sequence of methionine comprising at least one thymine “T” allele; and synthase (MTR); xix. a SNP at rs2236225 (position 27 of SEQID NO. 27) d. at least one guanine “G” allele at SNP locus at position comprising at least one adenine “A” allele; 65 66 of SEQID NO. 3 or position 27 of SEQID NO. 10 XX. an expression ratio of SAM to SAH Smaller than a (identified by rs1801394), wherein the SEQ ID NO. 3 pre-determined reference ratio: and SEQ ID NO. 10 are each independently a portion US 9,540,691 B2 125 126 of a genomic nucleic acid sequence of methionine of solute carrier family 6 (neurotransmitted transported, synthase reductase (MTRR): dopamine), member 3 (SLC6A3)); e. at least one adenine “A” allele at SNP locus at t. at least one thymine “T” allele at SNP locus at rs 1006737 (position 27 of SEQID NO. 11, wherein the rs2277820 (position 27 of SEQID NO. 26, wherein the SEQID NO. 11 is a portion of a genomic nucleic acid 5 SEQID NO. 26 is a portion of a genomic nucleic acid sequence of calcium channel, Voltage-dependent, L sequence of formiminotransferase cyclodeaminase type, alpha 1C subunit (CACNA1C)); (FTCD)); and f. at least one adenine “A” allele at SNP locus at u. at least one adenine “A” allele at SNP locus at rs 1883729 (position 27 of SEQID NO. 12, wherein the rs2236225 (position 27 of SEQID NO. 27, wherein the SEQID NO. 12 is a portion of a genomic nucleic acid 10 SEQID NO. 27 is a portion of a genomic nucleic acid sequence of DNA (cytosine-5)-methyltransferase 3 sequence of methylenetetrahydrofolate dehydrogenase beta (DNMT3B)); (NADP+ dependent) 1 (MTHFD1)); g. at least one thymine “T” allele at SNP locus at V. obesity (e.g., defined by BMI value of at least 30 kg/m2 rs7163862 (position 27 of SEQID NO. 13, wherein the 15 or greater); SEQID NO. 13 is a portion of a genomic nucleic acid w. an expression level ratio of SAM to SAH smaller than sequence of GTP cyclohydrolase 1 feedback regulatory a pre-determined reference ratio: protein (GCHFR)); X. an expression level of 4-HNE greater than a pre h. at least one thymine “Tallele at SNP locus at rs12659 determined reference value; and (position 27 of SEQ ID NO. 14, wherein the SEQ ID y. an expression of hsCRP greater than about 2.3 mg per NO. 14 is a portion of a genomic nucleic acid sequence liter of plasma as measured in a plasma sample. of reduced folate carrier protein (RCF2)); 101. A folate-comprising composition in combination with i.at least one guanine “G” allele at SNP locus at rs202676 an anti-depressant for use in the treatment of depression in (position 27 of SEQ ID NO. 15, wherein the SEQ ID a human Subject who carries at least one of the following NO. 15 is a portion of a genomic nucleic acid sequence 25 single nucleotide polymorphisms or a combination thereof: of folate hydrolase (prostate-specific membrane anti a. a SNP677 at position 677 of SEQID NO. 1 or position gen) 1 (FOLH1)); 27 of SEQ ID NO. 7 (identified by rs1801133) com j. at least one adenine “A” allele at SNP locus at prising at least one thymine “T” allele; and rs2297291 (position 27 of SEQID NO. 16, wherein the b. a SNP2756 at position 2756 of SEQ ID NO. 2 or SEQID NO. 16 is a portion of a genomic nucleic acid 30 sequence of reduced folate carrier protein (RCF1)); position 27 of SEQ ID NO. 9 comprising at least one k. at least one adenine “A” allele at SNP locus at guanine "G” allele. rs 1051266 (position 27 of SEQ ID NO. 17), wherein 102. A folate-comprising composition in combination with the SEQ ID NO. 17 is a portion of a genomic nucleic an anti-depressant for use in the treatment of depression in acid sequence of reduced folate carrier protein (RCF1): 35 a human Subject who carries at least one of the following 1. at least one thymine “T” allele at SNP locus at conditions or any combination thereof: rs8007267 (position 27 of SEQID NO. 18, wherein the a. at least one thymine “Tallele at SNP locus at position SEQID NO. 18 is a portion of a genomic nucleic acid 677 of SEQID NO. 1 or position 27 of SEQID NO. 7 sequence of GTP cyclohydrolase 1 (GCH1)); (identified by rs1801133), wherein the SEQ ID NO. 1 m. at least one adenine “A” allele at SNP locus at 40 and SEQID NO. 7 are each independently a portion of rs7639752 (position 27 of SEQID NO. 19, wherein the a genomic nucleic acid sequence of methylenetetrahy SEQID NO. 19 is a portion of a genomic nucleic acid drofolate reductase (MTHFR): sequence of choline-phosphate cytidylyltransferase A b. at least one adenine “A” allele at SNP locus at (PCYT1A)); rs2274.976 (position 1793 of SEQID NO. 1 or position n. at least one thymine “T” allele at SNP locus at rs6275 45 27 of SEQ ID NO. 8), wherein the SEQID NO. 1 and (position 27 of SEQ ID NO. 20, wherein the SEQ ID SEQ ID NO. 8 are each independently a portion of a NO. 20 is a portion of a genomic nucleic acid sequence genomic nucleic acid sequence of methylenetetrahy of dopamine receptor D2 (DRD2)); drofolate reductase (MTHFR): o. at least one thymine “T” allele at SNP locus at c. at least one guanine “G” allele at SNP locus at position rs 1079596 (position 27 of SEQ ID NO. 21), wherein 50 2756 of SEQ ID NO. 2 or position 27 of SEQ ID NO. the SEQ ID NO. 21 is a portion of a genomic nucleic 9 (identified by rs1805087), wherein the SEQ ID NO. acid sequence of dopamine receptor D2 (DRD2); 2 and SEQID NO. 9 are each independently a portion p. at least one adenine “A” allele at SNP locus at of a genomic nucleic acid sequence of methionine rs 11240594 (position 27 of SEQ ID NO. 22), wherein synthase (MTR); the SEQ ID NO. 22 is a portion of a genomic nucleic 55 d. at least one guanine “G” allele at SNP locus at position acid sequence of dopamine receptor D2 (DRD2); 66 of SEQID NO. 3 or position 27 of SEQID NO. 10 q. at least one cytosine “C” allele at SNP locus at rs4633 (identified by rs1801394), wherein the SEQ ID NO. 3 (position 27 of SEQ ID NO. 23, wherein the SEQ ID and SEQ ID NO. 10 are each independently a portion NO. 23 is a portion of a genomic nucleic acid sequence of a genomic nucleic acid sequence of methionine of catechol-O-methyltransferase (COMT)): 60 synthase reductase (MTRR): r. at least one guanine “G” allele at SNP locus at rs4680 e. at least one adenine “A” allele at SNP locus at (position 27 of SEQ ID NO. 24), wherein the SEQ ID rs 1006737 (position 27 of SEQID NO. 11, wherein the NO. 24 is a portion of a genomic nucleic acid sequence SEQID NO. 11 is a portion of a genomic nucleic acid of catechol-O-methyltransferase (COMT); sequence of calcium channel, Voltage-dependent, L S. at least one cytosine “Callele at SNP locus at rs250682 65 type, alpha 1C subunit (CACNA1C)); (position 27 of SEQ ID NO. 25, wherein the SEQ ID f. at least one adenine 'A' allele at SNP locus at NO. 25 is a portion of a genomic nucleic acid sequence rs 1883729 (position 27 of SEQID NO. 12, wherein the US 9,540,691 B2 127 128 SEQID NO. 12 is a portion of a genomic nucleic acid sequence of methylenetetrahydrofolate dehydrogenase sequence of DNA (cytosine-5)-methyltransferase 3 (NADP+ dependent) 1 (MTHFD1)); beta (DNMT3B)); v. obesity (e.g., defined by BMI value of at least 30 kg/m g. at least one thymine “T” allele at SNP locus at or greater); rs7163862 (position 27 of SEQID NO. 13, wherein the w. an expression level ratio of SAM to SAH smaller than SEQID NO. 13 is a portion of a genomic nucleic acid a pre-determined reference ratio: sequence of GTP cyclohydrolase 1 feedback regulatory X. an expression level of 4-HNE greater than a pre protein (GCHFR)); determined reference value; and h. at least one thymine “Tallele at SNP locus at rs12659 y. an expression of hsCRP greater than about 2.3 mg per (position 27 of SEQ ID NO. 14, wherein the SEQ ID 10 liter of plasma as measured in a plasma sample. NO. 14 is a portion of a genomic nucleic acid sequence 103. The composition of any one of the preceding para of reduced folate carrier protein (RCF2)); graphs, wherein the folate-comprising composition com i.at least one guanine “G” allele at SNP locus at rs202676 prises at least about 5 mg of folate. (position 27 of SEQ ID NO. 15, wherein the SEQ ID 104. The composition of any one of the preceding para NO. 15 is a portion of a genomic nucleic acid sequence 15 graphs, wherein the folate-comprising composition com of folate hydrolase (prostate-specific membrane anti prises about 7.5-50 mg of folate. gen) 1 (FOLH1)); 105. The composition of any one of the preceding para j. at least one adenine “A” allele at SNP locus at graphs, wherein the folate-comprising composition further rs2297291 (position 27 of SEQID NO. 16, wherein the comprises a pre-determined release profile. SEQID NO. 16 is a portion of a genomic nucleic acid 106. The composition of paragraph 105, wherein the pre sequence of reduced folate carrier protein (RCF1)); determined release profile comprises a Sustained release k. at least one adenine “A” allele at SNP locus at profile. rs 1051266 (position 27 of SEQ ID NO. 17), wherein 107. The composition of paragraph 106, wherein the sus the SEQ ID NO. 17 is a portion of a genomic nucleic tained release is a steady-state release. acid sequence of reduced folate carrier protein (RCF1): 25 108. The composition of paragraph 105, wherein the pre 1. at least one thymine “T” allele at SNP locus at determined release profile comprises a pulsatile release rs8007267 (position 27 of SEQID NO. 18, wherein the profile. SEQID NO. 18 is a portion of a genomic nucleic acid 109. The composition of paragraph 105, wherein the pre sequence of GTP cyclohydrolase 1 (GCH1)); determined release profile comprises a chrono-controlled m. at least one adenine “A” allele at SNP locus at 30 release profile. rs7639752 (position 27 of SEQID NO. 19, wherein the 110. The composition of any of paragraphs 105-109, SEQID NO. 19 is a portion of a genomic nucleic acid wherein the folate-comprising composition is formulated to sequence of choline-phosphate cytidylyltransferase A release at least 30% of the folate-containing compound over (PCYT1A)); a period of at least about 3-6 hours, upon the administration n. at least one thymine “T” allele at SNP locus at rs6275 35 of the composition. (position 27 of SEQ ID NO. 20, wherein the SEQ ID 111. The composition of any of the preceding paragraphs, NO. 20 is a portion of a genomic nucleic acid sequence wherein the depression is a major depressive disorder. of dopamine receptor D2 (DRD2)); o. at least one thymine “T” allele at SNP locus at Some Selected Definitions rs 1079596 (position 27 of SEQ ID NO. 21), wherein 40 the SEQ ID NO. 21 is a portion of a genomic nucleic For convenience, certain terms employed in the entire acid sequence of dopamine receptor D2 (DRD2); application (including the specification, examples, and p. at least one adenine “A” allele at SNP locus at appended claims) are collected here. Unless defined other rs 11240594 (position 27 of SEQ ID NO. 22), wherein wise, all technical and scientific terms used herein have the the SEQ ID NO. 22 is a portion of a genomic nucleic 45 same meaning as commonly understood by one of ordinary acid sequence of dopamine receptor D2 (DRD2); skill in the art to which this invention belongs. q. at least one cytosine “C” allele at SNP locus at rs4633 It should be understood that this invention is not limited (position 27 of SEQ ID NO. 23, wherein the SEQ ID to the particular methodology, protocols, and reagents, etc., NO. 23 is a portion of a genomic nucleic acid sequence described herein and as Such may vary. The terminology of catechol-O-methyltransferase (COMT)): 50 used herein is for the purpose of describing particular r. at least one guanine “G” allele at SNP locus at rs4680 embodiments only, and is not intended to limit the scope of (position 27 of SEQ ID NO. 24), wherein the SEQ ID the present invention, which is defined solely by the claims. NO. 24 is a portion of a genomic nucleic acid sequence Other than in the operating examples, or where otherwise of catechol-O-methyltransferase (COMT); indicated, all numbers expressing quantities of ingredients S. at least one cytosine “Callele at SNP locus at rs250682 55 or reaction conditions used herein should be understood as (position 27 of SEQ ID NO. 25, wherein the SEQ ID modified in all instances by the term “about.” The term NO. 25 is a portion of a genomic nucleic acid sequence “about when used to described the present invention, in of solute carrier family 6 (neurotransmitted transported, connection with percentages meansit 1%. dopamine), member 3 (SLC6A3)); In one aspect, the present invention relates to the herein t. at least one thymine “T” allele at SNP locus at 60 described compositions, methods, and respective rs2277820 (position 27 of SEQID NO. 26, wherein the component(s) thereof, as essential to the invention, yet open SEQID NO. 26 is a portion of a genomic nucleic acid to the inclusion of unspecified elements, essential or not sequence of formiminotransferase cyclodeaminase ("comprising). In some embodiments, other elements to be (FTCD)); and included in the description of the composition, method or u. at least one adenine “A” allele at SNP locus at 65 respective component thereofare limited to those that do not rs2236225 (position 27 of SEQID NO. 27, wherein the materially affect the basic and novel characteristic(s) of the SEQID NO. 27 is a portion of a genomic nucleic acid invention ("consisting essentially of). This applies equally US 9,540,691 B2 129 130 to steps within a described method as well as compositions The term “racemic mixture” refers to a mixture of the two and components therein. In other embodiments, the inven enantiomers of one compound, in any ratio. An ideal race tions, compositions, methods, and respective components mic mixture is one wherein there is a 50:50 mixture of both thereof, described herein are intended to be exclusive of any enantiomers of a compound such that the optical rotation of element not deemed an essential element to the component, 5 the (+) enantiomer cancels out the optical rotation of the (-) composition or method ("consisting of'). enantiomer. All patents, patent applications, and publications identi The term “nucleic acid' is well known in the art. A fied are expressly incorporated herein by reference for the “nucleic acid as used herein will generally refer to a purpose of describing and disclosing, for example, the molecule (i.e., strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase methodologies described in Such publications that might be 10 includes, for example, a naturally occurring purine or used in connection with the present invention. These pub pyrimidine base found in DNA (e.g. an adenine “A,” a lications are provided solely for their disclosure prior to the guanine “G” a thymine “T” or a cytosine “C”) or RNA (e.g. filing date of the present application. Nothing in this regard an A, a G. an uracil “U” or a C). The term “nucleic acid should be construed as an admission that the inventors are encompasses the terms "oligonucleotide' and “polynucle not entitled to antedate such disclosure by virtue of prior 15 otide,” each as a subgenus of the term “nucleic acid.” The invention or for any other reason. All statements as to the term "oligonucleotide' refers to a molecule of between date or representation as to the contents of these documents about 3 and about 100 nucleobases in length. The term is based on the information available to the applicants and "polynucleotide' refers to at least one molecule of greater does not constitute any admission as to the correctness of the than about 100 nucleobases in length. dates or contents of these documents. 2O The term “nucleic acid sequence” refers to a single or The term “adjuvantas used herein generally refers to any double-stranded polymer of deoxyribonucleotide or ribo agent or entity which increases the effect of another agent or nucleotide bases read from the 5'- to the 3'-end. It includes entity. In certain embodiments, the term “adjuvant” is used chromosomal DNA, self-replicating plasmids, infectious herein in reference to a folate-containing compound as an polymers of DNA or RNA and DNA or RNA that performs adjuvant to increase or enhance the effect (e.g., efficacy 25 a primarily structural role. “Nucleic acid sequence” also and/or therapeutic effect) of an antidepressant drug. refers to a consecutive list of abbreviations, letters, charac As used herein, the term “polyglutamates' refers to ters or words, which represent nucleotides. In one embodi folates that have at least two or more glutamate groups. ment, a nucleic acid can be a “probe' which is a relatively The term "derivative' as used herein refers to a chemical short nucleic acid, usually less than 100 nucleotides in Substance related structurally to another, i.e., an “original 30 length. Substance, which can be referred to as a “parent compound. The term "oligonucleotide,” as used herein refers to A "derivative” can be made from the structurally-related primers and probes described herein, and is defined as a parent compound in one or more steps. In some embodi nucleic acid molecule comprised of at least two or more ments, the general physical and chemical properties of a ribo- or deoxyribonucleotides. The exact size of the oligo derivative can be similar to or different from the parent 35 nucleotide will depend on various factors and on the par compound. ticular application and use of the oligonucleotide. The term As used here in the term "isomer refers to compounds “probe' as used herein refers to an oligonucleotide, poly having the same molecular formula but differing in structure. nucleotide or nucleic acid, either RNA or DNA, whether Isomers which differ only in configuration and/or confor occurring naturally as in a purified restriction enzyme digest mation are referred to as “stereoisomers.” The term "isomer 40 or produced synthetically, which is capable of annealing is also used to refer to an enantiomer. with or specifically hybridizing to a nucleic acid with The term “enantiomer' is used to describe one of a pair of sequences complementary to the probe. A probe may be molecular isomers which are mirror images of each other either single-stranded or double-stranded. The exact length and non-Superimposable. Other terms used to designate or of the probe will depend upon many factors, including refer to enantiomers include “stereoisomers” (because of the 45 temperature, source of probe and the method used. For different arrangement or Stereochemistry around the chiral example, for diagnostic applications, depending on the com center; although all enantiomers are stereoisomers, not all plexity of the target sequence, an oligonucleotide probe Stereoisomers are enantiomers) or “optical isomers' (be typically contains 15-25 or more nucleotides, although it cause of the optical activity of pure enantiomers, which is may contain fewer nucleotides. The probes as disclosed the ability of different pure enantiomers to rotate plane 50 herein are selected to be substantially complementary to polarized light in different directions). Enantiomers gener different strands of a particular target nucleic acid sequence. ally have identical physical properties, such as melting This means that the probes must be sufficiently complemen points and boiling points, and also have identical spectro tary so as to be able to “specifically hybridize' or anneal scopic properties. Enantiomers can differ from each other with their respective target strands. Therefore, the probe with respect to their interaction with plane polarized light 55 sequence need not reflect the exact complementary sequence and with respect to biological activity. of the target. For example, a non-complementary nucleotide The designations “R” and “S” are used to denote the fragment may be attached to the 5' or 3' end of the probe, absolute configuration of the molecule about its chiral with the remainder of the probe sequence being comple center(s). The designations may appear as a prefix or as a mentary to the target strand. Alternatively, non-complemen suffix; they may or may not be separated from the isomer by 60 tary bases or longer sequences can be interspersed into the a hyphen; they may or may not be hyphenated; and they may probe, provided that the probe sequence has sufficient or may not be surrounded by parentheses. The designations complementarily with the sequence of the target nucleic acid or prefixes “(+) and (-) are employed to designate the sign to anneal therewith specifically. of rotation of plane-polarized light by the compound, with In the context of Some embodiments of various aspects (-) meaning that the compound is levorotatory (rotates to the 65 described herein, the term “probe' refers to a molecule left). A compound prefixed with (+) is dextrorotatory (rotates which can detectably distinguish between target molecules to the right). differing in structure (e.g. nucleic acid or protein sequence). US 9,540,691 B2 131 132 Detection can be accomplished in a variety of different ways Wisconsin GCG, SEQWEB application of GAP, based on depending on the type of probe used and the type of target the algorithm of Needleman and Wunsch (Needleman and molecule. Thus, for example, detection may be based on Wunsch (1970) J MoI. Biol. 48: 443-453; as defined above). discrimination on detection of specific binding. Examples of A nucleotide sequence “substantially identical to a refer Such specific binding include antibody binding and nucleic 5 ence nucleotide sequence hybridizes to the exact comple acid, antibody binding to protein, nucleic acid binding to mentary sequence of the reference nucleotide sequence (i.e. nucleic acid, or aptamer binding to protein or nucleic acid. its corresponding strand in a double-stranded molecule) Thus, for example, probes can include enzyme substrates, under low Stringency conditions, preferably medium strin antibodies and antibody fragments, and preferably nucleic gency conditions, most preferably high Stringency condi acid hybridization probes. 10 tions (as defined above). Homologues of a specific nucleo tide sequence include nucleotide sequences that encode an The term “specifically hybridize” refers to the association amino acid sequence that is at least 24% identical, at least between two single-stranded nucleic acid molecules of Suf 35% identical, at least 50% identical, at least 65% identical ficient complementary sequence to permit Such hybridiza to the reference amino acid sequence, as measured using the tion under pre-determined conditions generally used in the 15 parameters described above, wherein the amino acid art (sometimes the sequences are referred to as “substan sequence encoded by the homolog has the same biological tially complementary'). In particular, the term specifically activity as the protein encoded by the specific nucleotide. hybridize also refers to hybridization of an oligonucleotide The term “substantially non-identical refers to a nucleotide with a Substantially complementary sequence as compared sequence that does not hybridize to the nucleic acid to non-complementary sequence. sequence under Stringent conditions. The term "substantially The term “specifically as used herein with reference to a identical, when used herein with respect to a polypeptide, probe which is used to specifically detect a sequence dif means a protein corresponding to a reference polypeptide, ference, refers to a probe that identifies a particular sequence wherein the polypeptide has Substantially the same structure difference based on exclusive hybridization to the sequence and function as the reference protein, e.g. where only difference under stringent hybridization conditions and/or 25 changes in amino acids sequence not affecting the polypep on exclusive amplification or replication of the sequence tide function occur. When used for a polypeptide or an difference. amino acid sequence, the percentage of identity between the In its broadest sense, the term “substantially' as used Substantially similar and the reference polypeptide or amino herein in respect to “substantially complementary', or when acid sequence is at least 24%, at least 30%, at least 45%, at used herein with respect to a nucleotide sequence in relation 30 least 60%, at least 75%, at least 90%, at least 95%, at least to a reference or target nucleotide sequence, means a nucleo 99%, using default GAP analysis parameters as described tide sequence having a percentage of identity between the above. Homologues are amino acid sequences that are at Substantially complementary nucleotide sequence and the least 24% identical, more preferably at least 35% identical, exact complementary sequence of the reference or target yet more preferably at least 50% identical, yet more pref nucleotide sequence of at least 60%, at least 70%, at least 35 erably at least 65% identical to the reference polypeptide or 80% or 85%, at least 90%, at least 93%, at least 95% or 96%, amino acid sequence, as measured using the parameters at least 97% or 98%, at least 99% or 100% (the later being described above, wherein the amino acid sequence encoded equivalent to the term “identical in this context). For by the homolog has the same biological activity as the example, identity is assessed over a length of at least 10 reference polypeptide. nucleotides, or at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 40 The term “primer' as used herein refers to an oligonucle 21, 22 or up to 50 nucleotides of the entire length of the otide, either RNA or DNA, either single-stranded or double nucleic acid sequence to the reference sequence (if not Stranded, either derived from a biological system, generated specified otherwise below). Sequence comparisons can be by restriction enzyme digestion, or produced synthetically carried out using default GAP analysis with the University which, when placed in the proper environment, is able to of Wisconsin GCG, SEQWEB application of GAP, based on 45 functionally act as an initiator of template-dependent nucleic the algorithm of Needleman and Wunsch (Needleman and acid synthesis. When presented with an appropriate nucleic Wunsch (1970) J MoI. Biol. 48: 443-453; as defined above). acid template, Suitable nucleoside triphosphate precursors of A nucleotide sequence “substantially complementary’ to a nucleic acids, a polymerase enzyme, Suitable cofactors and reference nucleotide sequence hybridizes to the reference conditions such as a suitable temperature and pH, the primer nucleotide sequence under low stringency conditions, pref 50 may be extended at its 3' terminus by the addition of erably medium stringency conditions, most preferably high nucleotides by the action of a polymerase or similar activity stringency conditions. to yield a primer extension product. The primer may vary in In its broadest sense, the term “substantially identical, length depending on the particular conditions and require when used herein with respect to a nucleotide sequence, ment of the application. For example, in diagnostic appli means a nucleotide sequence corresponding to a reference or 55 cations, the oligonucleotide primer is typically 15-25 or target nucleotide sequence, wherein the percentage of iden more nucleotides in length. The primer must be of sufficient tity between the substantially identical nucleotide sequence complementarity to the desired template to prime the Syn and the reference or target nucleotide sequence is at least thesis of the desired extension product, that is, to be able to 60%, at least 70%, at least 80% or 85%, at least 90%, at least anneal with the desired template strand in a manner Sufi 93%, at least 95% or 96%, at least 97% or 98%, at least 99% 60 cient to provide the 3' hydroxyl moiety of the primer in or 100% (the later being equivalent to the term “identical appropriate juxtaposition for use in the initiation of synthesis in this context). For example, identity is assessed over a by a polymerase or similar enzyme. It is not required that the length of 10-22 nucleotides, such as at least 10, 11, 12, 13, primer sequence represent an exact complement of the 14, 15, 16, 17, 18, 19, 20, 21, 22 or up to 50 nucleotides of desired template. For example, a non-complementary a nucleic acid sequence to the reference sequence (if not 65 nucleotide sequence may be attached to the 5' end of an specified otherwise below). Sequence comparisons are car otherwise complementary primer. Alternatively, non ried out using default GAP analysis with the University of complementary bases may be interspersed within the oligo US 9,540,691 B2 133 134 nucleotide primer sequence, provided that the primer When a subject has two different alleles of a gene, the sequence has sufficient complementarity with the sequence Subject is said to be heterozygous for the gene. Alleles of a of the desired template strand to functionally provide a specific gene can differ from each other in a single nucleo template-primer complex for the synthesis of the extension tide, or several nucleotides, and can include Substitutions, product. 5 deletions and insertions of nucleotides. An allele of a gene The term “complementary' or “complement” as used can also be a form of a gene containing a mutation. herein refers to the broad concept of sequence complemen As used herein, the term “administer refers to the place tarity between regions of two nucleic acid strands or ment of a composition into a subject by a method or route between two regions of the same nucleic acid strand. It is which results in at least partial localization of the compo known that an adenine residue of a first nucleic acid region 10 sition at a desired site such that desired effect is produced. is capable of forming specific hydrogen bonds (“base pair Routes of administration suitable for the methods described ing') with a residue of a second nucleic acid region which herein can include both local and systemic administration. Generally, local administration results in a higher amount of is anti-parallel to the first region if the residue is thymine or an antidepressant (e.g., SSRI) and/or a folate-containing uracil. Similarly, it is known that a cytosine residue of a first 15 compound being delivered to a specific location (e.g., sero nucleic acid strand is capable of base pairing with a residue tonin receptors in the central and/or peripheral nervous of a second nucleic acid strand which is anti-parallel to the systems) as compared to the entire body of the Subject, first Strand if the residue is guanine. A first region of a whereas, systemic administration results in delivery of an nucleic acid is complementary to a second region of the antidepressant (e.g., SSRI) and/or a folate-containing com same or a different nucleic acid if, when the two regions are pound to essentially the entire body of the subject. In some arranged in an anti-parallel fashion, at least one nucleotide embodiments, the compositions described herein are admin residue of the first region is capable of base pairing with a istered to subjects with depression orally. In other embodi residue of the second region. Preferably, the first region ments, the compositions described herein can be adminis comprises a first portion and the second region comprises a tered to Subjects with depression by injection. second portion, whereby, when the first and second portions 25 are arranged in an anti-parallel fashion, such that at least EXAMPLES about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% or at least 100% of the nucleotide The examples presented herein, in part, relate to the use residues of the first portion are capable of base pairing with of a folate-containing compound, e.g., 6(S)-5-MTHF, alone nucleotide residues in the second portion. More preferably, 30 or as an adjunct to an antidepressant drug for treating a all nucleotide residues of the first portion are capable of base patient with depression, e.g., major depressive disorder pairing with nucleotide residues in the second portion. (MDD). The examples presented herein also relate to meth The terms “variant”, “variance”, “mutation” or “polymor ods to identify genetic polymorphisms, peripheral biomark phism' are used interchangeably herein, and refer to a ers and clinical features involved in selecting patients with difference in nucleic acid sequence among members if a 35 depression for receiving a folate-containing compound, e.g., population of individuals. Polymorphisms can sometimes be as an adjunctive treatment to an antidepressant drug, e.g., a referred to as “single nucleotide polymorphism' or “SNP selective serotonin reuptake inhibitor (SSRI). Throughout when they vary at a single nucleotide. In some embodi this application, various publications are referenced. The ments, polymorphisms can be synonymous or nonsynony disclosures of all of the publications and those references mous. Synonymous polymorphisms when present in the 40 cited within those publications in their entireties are hereby coding region or non-coding region typically do not result in incorporated by reference into this application in order to an amino acid change, but can result in altered mRNA more fully describe the state of the art to which this stability or altered alternative splice sites. Nonsynonymous invention pertains. The following examples are not intended polymorphism, when present in the coding region, can result to limit the scope of the paragraphs to the invention, but are in the alteration of one or more codons resulting in an amino 45 rather intended to be exemplary of certain embodiments. acid replacement in the amino acid chain. Such mutations Any variations in the exemplified methods which occur to and polymorphisms may be either heterozygous or homozy the skilled artisan are intended to fall within the scope of the gous within an individual. Homozygous individuals have present invention. identical alleles at one or more corresponding loci on homologous chromosomes, while heterozygous individuals 50 Example 1 have two different alleles at one or more corresponding loci on homologous chromosomes. A polymorphism is thus said A Double-Blind, Placebo Controlled Study of a to be “allelic,” in that, due to the existence of the polymor Folate-Containing Compound Among phism, some members of a species carry a gene with one SSRI-Resistant Outpatients with Major Depressive sequence (e.g., the normal or wild-type “allele), whereas 55 Disorder (MDD) other members may have an altered sequence (e.g., the variant or, mutant “allele'). Exemplary Study Design The term “genotype' refers to the specific allelic compo Using the sequential parallel design 51 (see, for sition of an entire cell or a certain gene, whereas the term example, FIGS. 1A-1B, and 2), the 60-day, double-blind “phenotype” refers to the detectable outward manifestations 60 treatment, either administration with a folate-containing of a specific genotype. compound (e.g., a 6(S)-5-MTHF) or a placebo as an adjunct The term “allele’, as used herein, refers to one member of to an SSRI, can be divided into two phases of 30 days each, a pair of different forms of a gene. As used herein alleles with assessments performed every 10 days. During the first refer to coding and to non-coding sequences. Alleles occupy phase of the double-blind treatment, eligible patients can be the same locus or position on homologous chromosomes. 65 randomized to 30 days of treatment with either 6(S)-5- When a subject has two identical alleles of a gene, the MTHF (15 mg/day) (n=19) or placebo (n=56), with a 2:3:3 Subject is said to be homozygous for the gene or allele. ratio for random assignment to the treatment sequences US 9,540,691 B2 135 136 drug/drug (referring to 6(S)-5-MTHF), placebo/placebo, and TABLE 1. placebo/drug. By way of example only, if there is a 10% drop-out rate during the first phase, 50 patients on placebo Mean doses of SSRIs at baseline–Trial 2 would complete the first 30-day phase, 17 patients on 15 Dose (number of patients) Mean Dose mg/day 6(S)-5-MTHF would complete the first phase. Fluoxetine 20 mg (6) 40 mg (10) 60 mg (2) 35.5 mg Patients randomly assigned to the drug/drug sequence stay Citalopram 20 mg (3) 40 mg (8) 60 mg (2) 38.5 mg on the same 6(S)-5-MTHF dose (15 mg/day) during the Paroxetine 20 mg (2) 30 mg (1) 40 mg (1) 27.5 mg second phase, regardless of whether patients have responded Escitallopram 10 mg (4) 20 mg (7) 30 mg (1) 17.5 mg during the first phase or have not. For those randomly Sertraline 50 mg (4) 100 mg (9) 200 mg (1) 92.9 mg assigned to the placebo/placebo sequence, both responders 10 and non-responders to placebo during the first phase (n 25) Exclusion Criteria: remain on placebo during the second phase. On the other (1) Pregnant women or women of child bearing potential hand, for those randomly assigned to the placebo/drug who are not using a medically accepted means of contra sequence, both responders and non-responders to placebo 15 ception (to include oral contraceptive or implant, condom, during the first phase (n=25) go on to receive 15 mg/day diaphragm, spermicide, intrauterine device, tubal ligation, or 6(S)-5-MTHF during the second phase. In some embodi partner with vasectomy); (2) Patients who no longer meet ments, some of the placebo-treated patients (e.g., about 27% DSM-IV criteria for MDD during the baseline visit; (3) of the placebo-treated patients) can respond during the first Patients who demonstrate a greater than 25% decrease in phase, and that a portion of the remaining placebo non depressive symptoms as reflected by the QIDS-SR total responders (e.g., about 9% of the placebo non-responders) score-screen to baseline; (4) Patients with serious Suicide during the first phase can go on to respond during the second or homicide risk, as assessed by evaluating clinician; (5) phase, while a larger portion of 6(S)-5-MTHF-treated Patients with unstable medical illness including cardiovas patients (e.g., about 48% of the 6(S)-5-MTHF-treated cular, hepatic, renal, respiratory, endocrine, neurological, or patients) can respond during the first phase, and that a 25 hematological disease; (6) Patients with the following DSM portion of the placebo non-responders (e.g., about 35% of IV diagnoses: Substance use disorders active within the last placebo non-responders) during the first phase can go on to six months, any bipolar disorder (current or past), any respond to 15 mg/day 6(S)-5-MTHF during the second psychotic disorder (current or past); (7) Patients with a phase. Data from the previous double-blind, placebo-con history of a seizure disorder or clinical evidence of untreated trolled study (Trial 1) can be pooled into the instant study 30 hypothyroidism; (8) Patients requiring excluded medica tions (see Table 2 for details); (9) Patients with psychotic (Trial 2) to provide a more accurate estimate of the placebo features in the current episode or a history of psychotic effect size, with a weighted average from the two Phases 1 features, as assessed by SCID: (10) Patients with prior (one from Trial 1 and one from Trial 2) and two Phases 2 course of MTHF augmentation, or intolerance to MTHF at (one from Trial 1 and one from Trial 2). With 148 patients 35 any dose; (11) Patients with any investigational psychotro randomized to placebo during phase 1 or to stay on placebo pic drug within the last 3 months; (12) Patients who have during phase 2 following non-response to placebo in Trial 1: failed more than 2 adequate antidepressant trials during the and with patients randomized to placebo during phase 1 current Major Depressive Episode. Some examples of (n=56) or to stay on placebo during phase 2 following adequate dosage of an antidepressant trial include either non-response to placebo in Trial 2 (n=18) in Trial 2, and a 40 greater than 150 mg of imipramine (or its tricyclic equiva weighted average response rate of approximately 19% lent), greater than 60 mg of phenelZine (or its monoamine across Trials 1 and 2 (total n-222); and patients randomized oxidase inhibitor equivalent), greater than 20 mg of fluox to 15 mg/day 6(S)-5-MTHF during phase 1 (n=19) or to 15 etine (or its SSRI-equivalent), greater than 150 mg of mg/day 6(S)-5-MTHF during phase 2 following non-re bupropion, greater than 300 mg of traZodone (or nefa sponse to placebo (n=18) and a weighted average response 45 Zodone), or greater than 150 mg of venlafaxine. A trial of rate of approximately 41.5% (total n=37) in Trial 2, the adequate duration was defined as one during which the statistical power to show a drug-placebo difference in patient was on any given antidepressant at an adequate dose response rates is greater than 0.8. for a minimum of 6 weeks; and (13) Patients with a history Subject Selection of antidepressant-induced hypomania. Inclusion Criteria: 50 Human Subjects Involvement and Characteristics: (1) Age 18-65; (2) Written informed consent; (3) Meet A total of 75 individuals age 18-65 with MDD are DSM-IV criteria (by Structured Clinical Interview for DSM involved. Subjects must be medically stable as defined in the IV-SCID-I/P) for MDD, current patients; (4) Quick Inven protocol described herein. Patients excluded from the study tory of Depressive Symptomatology-Self-Rated (QIDS-SR) include patients at acute risk for Suicide, active Substance 55 abuse or dependence, with mild depression, inadequately 52 score of at least 12 at both screen and baseline visits; (5) treated with SSRIs or who have failed more than 2 trials, Patients treated with an SSRI at adequate doses, e.g., as who have received MTHF for depression in the past, and shown in Table 1 (defined as 20 mg/day or more of fluox those with psychosis or bipolar illness. Patients below the etine, citalopram, or paroxetine, 10 mg/day or more of age of 18 or over the age of 65 are also excluded. escitalopram, and 50 mg/day or more of Sertraline) during 60 Drugs Allowed or Excluded as Concomitant Medications the current episode for at least 8 weeks; and (6) During the During the Study baseline visit, patients must be on a stable dose of SSRI for Drugs that may be given to the patient include any the past 4 weeks. prescription or OTC medication Such as aspirin, acetamino In some embodiments, 40% of patients selected for Trial phen and cold preparations not specifically excluded by the 2 study were on starting doses. In some embodiments, 90% 65 protocol. Patients requiring concomitant drug therapy with of patients selected for Trial 2 study had not been maximized excluded drugs are discontinued from the study. Table 2 in therapeutic dose range. shows a list of drugs allowed (Y) and not allowed (N) as US 9,540,691 B2 137 138 concomitant medications. Some of the drug classes in Table atric history is taken and a physical examination is per 2 have a numeric value within parentheses, referring to formed. Screen rating scales are performed. Screened and additional notes shown below. eligible patients are asked to return two weeks later for a baseline visit when they are randomized to double-blind TABLE 2 treatment with placebo or 6(S)-5-MTHF 15 mg/day with the study design outlined above. The double-blind treatment Concomitant drug therapy lasts 60 days, during which patients are seen every 10 days (Visits 1 to 6 of Phase 1 —See Table 4 below). Subjects are Drug Class Episodic Use Chronic Use assigned randomization numbers in consecutive order. The Analgesics (non-narcotic) 10 randomization list is provided by a computer-generated Anorexiants Anxiolytic benzodiazepines (1) random-number list and is maintained by the research phar Anti-anginal agents macist. In addition, the presence of any side effect or adverse Antiarrhythmics event is carefully documented with the SAFTEE-SI (54. Anti-asthma agents Reasons for premature discontinuation, including intoler Anticoagulants Antidepressants (2) 15 able side effects, are recorded. Antihypertensives (3) All concomitant medications taken during the study is Anti-inflammatory agents (NSAIDS) recorded in the case report form, along with dosage infor Anti-nauseants mation and start and stop dates. Patients requiring excluded Cough Cold Preparations Diuretics drugs (see Table 2 for details) are discontinued from the Hormones (4) study. Medication management and clinical ratings are per H2 Blockers formed by the study clinicians. Insulin For patients randomly assigned to the drug/drug Non-benzodiazepine sedatives (1) Oral Hypoglycemic Agents sequence, the dose of 6(S)-5-MTHF is 15 mg/day during Psychotropic agents (other) (2) both phases of the study. For patients randomly assigned to Steroids 25 the placebo/drug sequence, the dose of 6(S)-5-MTHF is 15 Vitamins/Dietary Supplements (5) mg/day during the second phase of the study as well. All (1) Benzodiazepine anxiolytics and non-benzodiazepine sedative-hypnotics noted above patients are asked to take one tablet of blinded study are allowed only if subjects are on a stable regimen for at least 2 weeks prior to baseline medication in the morning, in addition to their stable dose of at doses no greater than the following or their equivalent; clonazepam 1.0 qd and Zolpidem 10 mg qhs, ongoing SSRI treatment. Each study medication tablet is (2) Patients must have been treated prior to study entry with adequate doses of SSRIs (e.g. 30 minimum doses: fluoxetine paroxetinei citalopram 20 mg day, escitalopram 10 mg day, either 15 mg of 6(S)-5-MTHF or matching placebo. There sertraline 50 mg/day) for at least 8 weeks with only non-response. They must be on an fore, for patients randomly assigned to the placebo/placebo SSRI at the time of study enrollment and they must have been at the current dose for at least 4 weeks at the baseline visit. Patients must also agree to continue to take their SSRI sequence, the tablets of study medication are placebo during medication at the same dose while being treated with 6(S)-5-MTHF. If patients are on other psychotropic drugs as well, they must have been at the current dose of the psychotropic both phases of the study. For patients randomly assigned to drug for at least 4 weeks, and they must also agree to continue to take their medication at the drug/drug sequence, the tablets are 15 mg of 6(S)-5- the same dose while being treated with 6(S)-5-MTHF. (3) , metoprolol, acebutolol, reserpine, clonidine and aldomet are excluded. 35 MTHF during both phases of the study. For patients ran (4) Adequate thyroid replacement which has been stable for 6 months or more is acceptable domly assigned to the placebo/drug sequence, the tablets are as is estrogen replacement for post-menopausal women or the use of oral contraceptives, the initiation of which does not coincide with the onset or exacerbation of depression. placebo during the first phase of the study, while the tablets (5) Standard multivitamins with or without minerals are allowed (with no more than 400 mcg folate and 6 mcg B12) if initiated at least 12 weeks prior to Baseline. Dietary are 15 mg of 6(S)-5-MTHF during the second phase of the supplements with putative CNS activity are excluded including SAMe, St. John's Wort, study. DHEA, Inositol, Ginko biloba and Omega-3-fatty acids including DHA and Flax Seed Oil. 40 Subjects unable to tolerate the study medications are withdrawn from the study. Patients need to comply with the Subject Enrollment dosage regimen and to take all medications as instructed. All Seventy-five subjects enter double-blind treatment over patients are instructed to return any excess medication at 12 months (Trial 2, total enrollment Trials 1 and 2 is 225). each visit. A pill count is done to corroborate the study drug This trial is conducted according to the FDA guidelines. 45 record. Protocol violation is defined as less than 80% Written informed consent is obtained from all patients compliance by pill count. before protocol-specified procedures are carried out. The Specimen Collection Procedure Subjects are drawn primarily from an outpatient sample of Blood samples should be taken from subjects after over patients with MDD, diagnosed by the use of the Structured night fasting. The following specimens as shown in Table 3 Clinical Interview for DSM-IV Axis I Disorders-Patient 50 are included for metabolic testing. Edition (SCID-UP). At study entry, subjects must meet SCID criteria for a depressive episode, and have a QIDS-SR TABLE 3 score of at least 12 at both the screen and baseline visits. In addition, their current major depressive episode (MDE) Specimens and metabolic tests must be considered resistant to SSRIs: during the current 55 Minimum MDE, all patients must have received at least one prior trial volume of an SSRI at an adequate dose and duration, as defined by Specimen Metabolic Test Required the MGH Antidepressant Treatment Response Questionnaire Plasma homocysteine, hs-CRP, SAMe, 2.5 ml (MGH-ATR) 53). The MGH-ATR defines an adequate trial ADMA, MDA, 4-HNE, MMA of SSRIs as 10 mg or more of escitalopram, 20 mg or more 60 Serum Folate, vitamin B12 and B6 1 ml of fluoxetine, citalopram, or paroxetine, 50 mg or more of Whole blood hemolysate Red cell folate 1 ml Sertraline for a minimum of 6 weeks. In addition, during the Whole blood MTHFR and MS genotyping 2 ml baseline visit, patients must be on a stable dose of SSRI for the past 4 weeks or more. Specimen Collection Instructions Study Procedures 65 Plasma: Once patients agree to participate in the study by signing About 5 ml of blood is withdrawn into a sodium heparin the informed consent document, a full medical and psychi vacutainer tube. Specimens should be centrifuged within US 9,540,691 B2 139 140 one hour of collection at ~2000 g for ~10 minutes. About 2 status. They measure, based on history and scores on other ml of plasma are aliquoted into 2 plastic storage vials (~ 1 ml instruments: a) Depressive severity (CGI-S) and b) Clini in each). The vials are labeled and frozen at -80° C. cal Improvement (CGI-I). Patient rated versions of both Serum: scales are also utilized (the PGI-S/I). About 5 ml of blood is withdrawn into a vacutainer tube 5 (plain red top), which contains no additive. The blood (5) QIDS-SR 52: This is a brief (16-item) self-report containing tube is left to stand at room temperature for 20 inventory of core depressive symptoms Such as sleep, about minutes and allowed to clot. The sample is then depressed mood, appetite, concentration, Suicidal ide centrifuge at ~2000 g for ~10 minutes. Approximately 2 ml ation, interest, energy, psychomotor retardation or agita of plasma is aliquoted into 2 plastic storage vials (~ 1 ml in 10 tion. each). The vials are labeled and frozen at -20°C. or -80° C. (6) The Massachusetts General Hospital Cognitive and Whole Blood Hemolysate: Physical Functioning Questionnaire: This is a brief 100 uL of fully suspended heparinized blood is accurately (7-item) self-report inventory to assess rates of significant pipetted into a test tube with a pre-made solution, followed cognitive symptoms, sleepiness, and fatigue. by vortexing and freezing at -20° C. or -80° C. 15 Whole Blood: (7) The Massachusetts General Hospital Sexual Functioning About 5 mls of blood is withdrawn into a EDTA vacu Questionnaire 56: This is a self-rating scale that mea tainer tube (lavender top). About 4 ml of whole blood is Sures common symptoms of sexual dysfunction, such as aliquoted into 2 plastic storage vials (~2 ml each). The vials reduced libido and orgasm difficulties. are labeled and frozen at -20° C. or -80° C. (8) The Visual Analog Scale 57: This is a brief (8-item) Efficacy Measures self-report scale to measure painful symptoms of depres Any neuropsychological tests can be used to measure sion during treatment with the study medication (6(S)-5- efficacy response of a patient treated with a placebo or MTHF) or placebo. 6(S)-5-MTHF in conjunction with an SSRI. The primary efficacy measure can include the change in 17-item Hamil 25 Safety Measurements ton Rating Scale for Depression (HAM-D-17) 55 score. In Once the patient has agreed to participate in the study by this study, a response is, for example, defined as a 50% or signing the informed consent document, vital signs (weight, greater reduction in HAM-D-17 score from baseline. A and Standing and Supine pulse and blood pressure) are remission is, for example, defined as a HAM-D-17 score less than 8 at endpoint. Secondary measures of efficacy can 30 recorded at each visit and a physical exam is performed at include change in CGI-severity, with “clinical response screen and visit 6 (Day 60, or Phase I endpoint). Consump defined” as CGI-S of 1 or 2 at endpoint. Patients with a tive habits (e.g., Smoking, alcohol, and caffeinated bever CGI-I score greater than 5 at any post baseline visit or a 50 percent or greater worsening of depressive symptoms from ages) are recorded at baseline, Day 30, Day 60, Day 150, baseline to that visit are discontinued from the study. Sub 35 Day 240, Day 330, and Day 420 (or endpoint)(See Tables jects are also discontinued from the study with any emer 4 & 5 below). A urine pregnancy test (for women of gence of Suicidality, homicidality, mania, or psychosis. childbearing potential) is also administered at the screen Additional exemplary instruments that can be administered according to the study schedule include the following: visit and visit 3 (day 30). Pregnant women may not enroll in (1) Structured Clinical Interview for DSM-IV: The SCID 40 this study. I/P administered by the clinician, proceeds by modules to Additionally, baseline blood samples are collected for the diagnose the different Axis I disorders. Questions are asked exactly as written, and each is based on the indi assessment of genetic polymorphism for (i) T677C allele for vidual criteria from DSM-IV. Answers are generally rated the methylenetetrahydrofolate reductase (MTHFR), (ii) on a scale of 1-3 (1=doubtful, 2 probable, 3-definite), 45 A1298Callele for the MTHFR gene, (iii) A66Gallele for the and, based on the number of positive answers, a diagnosis methionine synthase reductase gene, and (iv) A2746Gallele is determined by a clinician. While the entire SCID-UP is administered at Screen, the mood module is administered for the methionine synthase gene. at each follow up visit. Further, baseline, Day 30, Day 60, and Day 420 (or (2) The MGH Antidepressant Treatment History Question 50 endpoint) blood samples are collected for the measurement naire (MGH-ATR) 53: The MGH-ATR provides specific of plasma folate, RBC folate, plasma homocysteine, Vitamin criteria for the adequate dose and adequate length of a trial B12, MMA (methylmalonic acid), SAMe, asymmetrical for it to be considered a failure, thus allowing clinicians dimethylarginine (ADMA), malondialdehyde (MDA), 4-hy to systematically collect data aimed at assessing the droxynonenal (4-HNE), F2-Isoprostanes, and high-sensitiv degree of treatment-resistance of the current major 55 depressive episode. ity C-Reactive Protein (hs-CRP). (3) The 28-item Hamilton Depression Scale (HAM-D-28) Adverse Side Effects or Events 55: This version allows scoring of the HAM-D-17, 21-, Documentation of the presence of any side effect or 25-, and 28-item scales. This instrument is completed by adverse event is completed at every visit using the SAFTEE the clinician by using a structured interview and defined 60 SI. Subjects can contact a clinician at any time between anchor points, and aims to quantify the degree of depres sion over the past 7 days. The HAM-D is the most widely visits concerning adverse events or worsening of symptoms. studied instrument for depression, and its reliability and Suicidal ideation is assessed at each visit. Subjects who are validity are high. felt by the study clinician to be at high risk for suicide are (4) Clinical Global Impressions-Severity and Improvement 65 discontinued from the study and referred for hospitalization (CGI-S, CGI-I): These two instruments are scored 1-7 by and further treatment if clinically indicated (See Tables 4 & the clinician based on assessment of the patient’s clinical 5 below). US 9,540,691 B2 141 142 TABLE 4 Schedule of Clinician/Subiect Ratings & Plasma Tests - Double Blind Phase Visit 3 Visit 6 Day 30 Day 60 Screen Baseline Visit 1 Visit 2 Endpoint Visit 4 Visit 5 Endpoint Measurement Day - 14 Day O Day 10 Day 20 Phase 1 Day 40 Day 50 Phase 2

SCID X SCID Mood Module X X X X X X X MGHATR HAM-D-28 X X X X X X QIDS-SR X X X MGH-CPFQ X X X MGH-SFQ X X X SAFTEE-SI X X X Physical Exam X Vital Signs X X X X X X Pregnancy Test Consumptive Habits X Plasma. Folate X RBC Folate X Plasma Homoeysteine X B12 X ADMA X MDA X 4-HNE X SAMe X hS-CRP X F2-Isoprostanes X T677C A1298C

A2746G.

TABLE 5 ID's are included in the data. Study staff and subjects may have the option to enter clinical data into the database Schedule of Clinician/Subject Ratings & Plasma Tests-Follow Up Phase 35 directly, using DatStat IllumeTM, a platform for electronic Visit 10 data capture that streamlines data collection and manage Visit 7 Visit 8 Visit 9 Day 420 ment, and ensures data integrity, resulting in improved data Measurement Day 150 Day 240 Day 330 Endpoint quality. Subjects and/or research staffenter Survey responses SCID Mood Module X X X X into electronic assessment forms, and the responses are then HAM-D-28 X X X X 40 transmitted securely via encrypted connection and stored in CGI X X X X a secured database. OIDS-SR X X X X MGH-CPFQ X X X X Exemplary Statistical Analyses MGH-SFQ X X X X General Considerations: SAFTEE-SI X X X X Data are entered and error-checked at each clinical site Vital Signs X X X X Consumptive Habits X X X X 45 involved in the study. Study staff and subjects may have the RBC Folate X option to enter self-evaluations into the system directly Plasma. Folate X using DatStat IllumeTM. The process of data entry is super Plasma Homocysteine X B12 X vised by the DCRP staff. Once the data set is entered and ADMA X checked, analyses are conducted. Both a completer analysis MDA X 50 of all patients finishing the trial and an intent-to-treat analy 4-HNE X sis examining all patients enrolled into the trial are used to SAMe X hS-CRP X define the severity of depression at endpoint. Examination of F2-Isoprostanes X both study completers and all patients randomized can provide the broadest assessment of the effects of treatment 55 in trials of such kind. The data from Trial 2 can be pooled Termination with those from Trial 1 with the sequential parallel com Acceptable reasons for early discontinuation include the parison design, to provide an estimate of the placebo following: 1) request of patient, 2) decision of physician, 3) response based on a larger sample size. According to the serious adverse event, 4) protocol violation, 5) worsening of sequential parallel comparison design analytical plan, the depression or clinical deterioration requiring hospitalization. 60 effect of the active treatment is assessed using a Z-score. Exemplary Data Management Under the null hypothesis of no drug-placebo difference, the Clinical data at each visit are recorded using a standard Z score has a mean of 0. Let p1, q1 be the response rates to ized clinician assessment form and a set of patient rating the first administration of drug and placebo respectively and scales. Edited and corrected data are added to a database that let p2, q2 be the responses rates to the second treatment. To is ready to be used as input to statistical software (e.g., 65 analyze these data, a statistic based on h w(p1-q1)+(1-w) STATA) for data development and analysis. All data are (p2-q2) is used. The weight (w) and the randomization stored in locked file cabinets. No identifiers other than study fraction (a) are chosen to maximize the power of the test, US 9,540,691 B2 143 144 based on the alternative hypothesis. The randomization folate level along with treatment assignment can be entered fraction (a) can be involved in calculation of p1, q1, p2. in a 2x2, factorial ANOVA, using depression improvement scores (baseline minus endpoint HAM-D-17 scores) as the and/or q2. For example, multiplying the total sample size by dependant variable. The effect of the predictor can be the randomization fraction (a) to obtain the denominator of indicated by the interaction term, reflecting the potential the response rates, e.g., pl. The standard error for h requires 5 differential effect of 6(S)-5-MTHF on individuals with low a special formula because some of the same patients who are vs. normal folate. Similar analyses (i.e. separate 2x2 ANO included in the estimation of p2, q2 are included in the VAs) can be performed substituting the presence of low estimation of p1, q1. The computation is facilitated by folate levels for the presence of other predictors as described considering a table of outcomes, where in this case p1, p2. herein. Similarly, the effect of other predictors can be q1, q2 are the theoretical probabilities rather than the 10 indicated by the interaction term representing the potential observed relative frequencies. A more detailed description of modulating influence of those variables. the analyses is described in the Fava et al reference on the sequential parallel comparison design 51. Example 2 Analysis of Study Attrition: A detailed analysis of the number and timing of study 15 Evaluation of the Efficacy of 6(S)-5-MTHF as an dropouts is calculated. Potential differences between treat Augmentation Strategy in MDD Patients (Trial 1) ment groups in dropouts are examined with a Fisher's Exact test; if even weak trends (p<0.05) indicative of differential Using the study design and sequential parallel design as dropout are detected, a more detailed Survival analysis is described in Example 1, a 60-day, multi-center, double completed to illustrate the timing and magnitude of these blind, placebo-controlled study (Trial 1) on the efficacy of differences. These dropout analyses can be used to better oral 6(S)-5-MTHF augmentation of selective serotonin understand the outcomes depicted by the following analyses. reuptake inhibitors (SSRIs) has been completed in 148 Analyses of the Magnitude of Responses: patients with major depressive disorder (MDD) resistant to treatment with SSRIs. The study involved the enrollment of The magnitude of response between the two treatment a total of 148 patients with MDD over the course of 12 groups can be measured by a decrease in baseline HAM 25 months across 10 medical centers or hospitals in the United D-17 scores. One-way analysis of covariance (adjusting for States. Outpatients suffering from MDD were treated with baseline HAM-D-17 scores) can be used to assess differ either 7.5 mg/day of 6(S)-5-MTHF or with placebo as an ences in HAM-D-17 scores at endpoint, pooling data from adjuvant to SSRIs for 60 days using the sequential parallel Trials 1 and 2 and from both phases by using the sequential comparison design 51. In accordance with the sequential parallel design. 30 parallel design 51, the 60-day, double-blind treatment was Analyses of Percentage of Responders and Remitters: divided into two phases of 30 days each, with assessments An exemplary statistical test for analysis of differences in performed every 10 days. As shown in FIG. 1A, during the proportion of responders in the treatment conditions is a first phase of double-blind treatment, 148 eligible patients Fisher's Exact test, pooling data from Trials 1 and 2 and were randomized to 30 days of treatment with either 7.5 from both phases by using the sequential parallel design. mg/day of 6(S)-5-MTHF (“drug) or placebo, with a 2:3:3 Logistic regression analysis can also be carried out, with 35 ratio for random assignment to the treatment sequences response or non-response and remission or non-remissions drug/drug, placebo/placebo, and placebo/drug. Patients ran as the dependent variables, with the baseline HAM-D score, domly assigned to the drug/drug sequence had their 6(S)- gender, and age, as the independent variables. Exploratory 5-MTHF dose increased from 7.5 mg/day to 15 mg/day covariate analysis can be carried out to investigate any during the second phase, regardless of whether patients had differences in remission rates seen with gender, age, and 40 responded during the first phase (n=12) or had not (n=20). other variables. For those randomly assigned to the placebo/placebo Analyses of the Number of Adverse Events: sequence, both responders and non-responders to placebo One-way analysis of variance can be used to assess during the first phase remained on placebo during the second differences in total number of SAFTEE-SI AES between phase. On the other hand, for those randomly assigned to the baseline and endpoint. 45 placebo/drug sequence, both responders and non-responders Analyses of Predictors of a Greater 6(S)-5-MTHF/Pla to placebo during the first phase went on to receive 7.5 cebo Difference in Response Rates: mg/day of 6(S)-5-MTHF during the second phase. Folate levels are classified as either low (<=2.5 ng/ml) or The findings from Trial 1, as shown in Tables 6-7, indicate normal; and homocysteine levels as either normal or that the 7.5 mg/day 6(S)-5-MTHF is not effective to act as elevated (>=13.2 mmol/liter). The presence or absence of at 50 an adjunct to the SSRIs. While 6(S)-5-MTHF does not least one T677C allele for the MTHFR gene are entered as appear to cause any adverse side effect when administered a dichotomous variable (present or absent). A 2x2 Analysis with an SSRI, there was no significant difference in efficacy of Variance (ANOVA) can be used to test whether the outcome (as measured by various parameters such as presence of a low serum-folate level predicts a greater HDRS-17, QIDS-SR and CGI-S) between MDD patients drug/placebo difference in response. Using folate as an treated with an SSRI in combination with either 7.5 mg/day example predicator, the presence or absence of a low serum 6(S)-5-MTHF or placebo. TABLE 6 Efficacy results of MDD patients having 7.5 mg/day 6(S)-5-MTHF or placebo as an adjunct to an SSRI Adjunct Adjunct Adjunct Adjunct Pooled Pooled L-methylfolate Placebo L-methylfolate Placebo Adjunct L- Adjunct Scale Outcome Phase 1 Phase 1 Phase 2* Phase 2* methylfolate Placebof p-value

N 36 112 35 33 Completers (N) 91.6% (3.3) 87.8% (98) 85.7% (30) 90.9% (30) HDRS-17 Mean baseline score (SD) 18.5 (4.2) 19.9 (4.1) 16.2 (3.4) 16.8 (4.7) 12.5 18.4 HDRS-17 % Response (N) 19.8% (7) 28.9% (32) 17.1% (6) 9.0% (3) 18.3% 18.8% O.92 US 9,540,691 B2 145 146 TABLE 6-continued Efficacy results of MDD patients having 7.5 mg/day 6(S)-5-MTHF or placebo as an adiunct to an SSRI Adjunct Adjunct Adjunct Adjunct Pooled Pooled L-methylfolate Placebo L-methylfolate Placebo Adjunct L- Adjunct Scale Outcome Phase 1 Phase 1 Phase 2* Phase 2 methylfolate Placebof p-value: HDRS-17 % Remission (N) 11.1% (4) 17.0% (20) 14.2% (5) 6.0% (2) 12.7% 11.8% O.15 HDRS-17 Mean score reduction (SD) -4.3 (5.0) -6.3 (6.8) -3.1 (4.2) -2.1 (4.9) -3.70 -4.2 O.87 QIDS-SR Mean baseline scroe (SD) 20.7 (4.7) 21.0 (0.0) 15.5 (6.9) 17.0 (6.5) 18.1 19.0 QIDS-SR % Responsive (N) 25.0% (9) 28.5% (28) 8.5% (3) 9.0% (3) 19.8% 18.8% O.70 QIDS-SR % Remission (N) 0.0% (O) 0.0% (10) 8.5% (3) 9.0% (1) 4.3% 6.0% O.S8 QIDS-SR Mean score reduction (SD) -4.6 (5.1) -6.9 (6.2) 4.8 (4.1) -2.8 (4.1) -O.25 -473 O.O7 CGI-S Mean baseline score (SD) 4.1 (0.8) 4.2 (0.6) 3.8 (0.7) 3.9 (0.7) 4.0 4.1 CGI-S Mean score reduction (SD) -0.5 (0.9) -6.7 (1.0) -0.5 (0.7) -0.4 (0.8) -0.53 -0.58 O.96 *According to the SPCD model, only Phase 1 completers, non-responders (according to the HDRS-17) are analyzed in Phase 2 Pooled results from Phases 1 and 2. SPCD analysers using Fava et al method for dichoromous measures (2003) and Tamura and Huang (2007) method for continuous measures,

TABLE 7

Adverse side-effects of an SSRI administered with or without 6 (S)-5-MTHF Placebo L-methylfolate 7.5 mg L-methylfolate 16 mg Two (n = 112)* (n = 24)* (n = 30)* tailed Side Effect Category Frequency (%) Frequency (%) NNEH Frequency (%) NNEH p value Gastrointestinal 23 (20.1%) 9 (9.8%) < placebo 3 (10.0%) < placebo O.O8 Sleep 12 (10.7%) 3 (3.2%) < placebo 2 (6.7%) < placebo O.11 Paychological 12 (10.7%) 2 (2.1%) < placebo 2 (6.7%) < placebo O.OS Somatic 22 (19.8%) 9 (8.6%) < placebo 3 (10.0%) < placebo O.09 Infectious 13 (11.8%) 6 (6.4%) < placebo 2 (6.7%) < placebo O.38 Cardiovascular 4(3.6%) 0 (0%) < placebo 2 (6.7%) < placebo O.O8 Sexual 0 (0%) 0 (0%) =placebo 0 (0%) =placebo O.98 Miscellaneous 3 (2.7%) 1 (1.1%) < placebo 2 (6.7%) < placebo O.24 *n is based on total number of subjects that received placebo or L-methylfolate 7.5 mg or 15 mg at some point during the trial.

However, an increase in dose of 6(S)-5-MTHF from 7.5 35 the safety and tolerability of 6(S)-5-MTHF 15 mg/day mg/day to 15 mg/day in the patients assigned to the drug/ augmentation. The study involves the enrollment of a total drug sequence during the second phase demonstrated an of 75 patients with MDD over the course of 12 months significant increase in the response and remission rate, e.g., across 6 different medical centers or hospitals across the an increase by at least 2-fold, as compared to the group United States. Outpatients suffering from MDD were treated taking placebo with the SSRIs (24% vs 9%, p=0.1: Such 40 with either 6(S)-5-MTHF 15 mg/day or with placebo for 60 result is not included in Table 6). Accordingly, a higher dose days using the sequential parallel comparison design 51. of oral 6(S)-5-MTHF augmentation, 15 mg/day, was deter FIG. 2 shows the actual number of completers in each group mined to be used in Trial 2. by the end of the study. FIG. 3A shows that there is a statistically significant Example 3 45 difference in the percentage of responders (50% or greater reduction in HAM-D-17 at endpoint) in the two treatment Evaluation of the Efficacy of 6(S)-5-MTHF as an conditions (i.e., SSRI-15 mg/day of 6(S)-5-MTHF vs. Augmentation Strategy in MDD Patients (Trial 2) SSRI-i-placebo) after 30 days. Using the sequential parallel comparison design 51, it was determined that the response Using the study design and sequential parallel design as 50 rate is higher for the 6(S)-5-MTHF group than the placebo described in Example 1, this Example 3 shows a 60-day, group, with the response rate on placebo estimated from multi-center, double-blind, placebo-controlled pilot study Trials 1 and 2. (Trial 2) on the efficacy of a higher dose (15 mg qd) oral FIG. 3B shows that there is a statistically significant 6(S)-5-MTHF augmentation of selective serotonin reuptake difference between the two treatment conditions (i.e., SSRI-- inhibitors (SSRIs) in 75 patients with major depressive 55 15 mg/day of 6(S)-5-MTHF vs. SSRI+placebo) after 30 days disorder (MDD) resistant to treatment with SSRIs. The in the degree of improvement, as measured by the change in design of Trial 2 (as shown in FIG. 1B) was identical to that the 17-item Hamilton Depression Rating Scale (HAM-D- of Trial 1, with the exception of the dosing of 6(S)-5-MTHF, 17) score from baseline to endpoint, QID-SR, or Clinical which was 15 mg/day throughout the trial for those patients Global Impressions-Severity (CGI-S), using the sequential assigned to the placebo-drug group and to the drug-drug 60 parallel comparison design 51. Using the sequential par group. allel comparison design 51, it was determined that there is The critical clinical purpose of this study was to deter a greater degree of reduction in the scores of HAM-D-17, mine whether the use of a higher dose of oral 6(S)-5-MTHF QIDS-SR and CGI-S, respectively, in the 6(S)-5-MTHF as an adjunct to SSRIs would be more effective than placebo group than in the placebo group, with the change on placebo as an adjunct to SSRIs in reducing depressive symptoms in 65 estimated from Trials 1 and 2. outpatients with MDD with partial or no response to SSRI FIGS. 3C-3D show that there is no significant difference treatment. An additional aim of the study was to demonstrate in the percentage of remitters (HAM-D-17 score <8 at end