Lycopodiaceae) Weston Testo University of Vermont

Home , Alsophila spinulosa, Arcytophyllum, Austrolycopodium, Calceolaria serrata, Dendrolycopodium, Diphasiastrum digitatum

University of Vermont ScholarWorks @ UVM

Graduate College Dissertations and Theses Dissertations and Theses

2018 Devonian origin and Cenozoic radiation in the clubmosses (Lycopodiaceae) Weston Testo University of Vermont

Follow this and additional works at: https://scholarworks.uvm.edu/graddis Part of the Systems Biology Commons

Recommended Citation Testo, Weston, "Devonian origin and Cenozoic radiation in the clubmosses (Lycopodiaceae)" (2018). Graduate College Dissertations and Theses. 838. https://scholarworks.uvm.edu/graddis/838

This Dissertation is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected].

DEVONIAN ORIGIN AND CENOZOIC RADIATION IN THE CLUBMOSSES (LYCOPODIACEAE)

A Dissertation Presented

Weston Testo

The Faculty of the Graduate College

The University of Vermont

In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Specializing in Plant Biology

January, 2018

Defense Date: November 13, 2017 Dissertation Examination Committee:

David S. Barrington, Ph.D., Advisor Ingi Agnarsson, Ph.D., Chairperson Jill Preston, Ph.D. Cathy Paris, Ph.D. Cynthia J. Forehand, Ph.D., Dean of the Graduate College

ABSTRACT

Together with the heterosporous lycophytes, the clubmoss family (Lycopodiaceae) is the sister lineage to all other vascular land plants. Given the family’s important position in the land-plant phylogeny, studying the evolutionary history of this group is an important step towards a better understanding of plant evolution. Despite this, little is known about the Lycopodiaceae, and a well-sampled, robust phylogeny of the group is lacking. The goal of this dissertation is to resolve the relationships among evolutionary lineages in the Lycopodiaceae and provide insight into the timing and drivers of diversification in the family.

First, to place the evolution of the family within a global and historical context, I generated a densely sampled, time-calibrated phylogeny of the family. I sampled 50% of the estimated 400 extant species in the Lycopodiaceae and used eight fossils to calibrate the age of major divergence events in the family and across the land-plant phylogeny. Further, we used a probabilistic biogeographic model to infer the historical biogeography of the family. Together, these analyses indicate that the Lycopodiaceae originated in the late Devonian, began its early diversification in the Carboniferous, and accumulated much of its extant diversity during the Cenozoic. From a geographical perspective, major cladogenesis events in the family’s history appear to be linked to the breakup of the Pangaean and Gondwanan supercontinents, with long-distance dispersal playing a role in the establishment of younger evolutionary lineages.

Second, I examined the drivers of diversification in the species-rich genus Phlegmariurus in the Neotropics. This clade includes an estimated 150 species and is most diverse in high-elevation habitats in the tropical Andes of South America. Using a time-calibrated phylogeny of the group and species distribution and niche data, I demonstrate a strong positive association between lineage diversification rates and the mean elevation of species’ distributions as well as a strong negative correlation between diversification rates and the size of species’ ranges. Further, we employ a paleoelevation- dependent diversification model to test for an association between the uplift of the Andes and diversification in the clade and demonstrate that speciation rates in Neotropical Phlegmariurus are positively associated with increasing elevations in the Andes.

Third, I use a phylogenetic framework to test the monophyly of morphology- based species groups in Neotropical Phlegmariurus . I demonstrate that most groups are not monophyletic, and that convergent evolution is widespread in the genus. We use ancestral character-state reconstruction methods for six morphological traits to elucidate patterns of trait evolution and to circumscribe new species groups. A total of eleven new monophyletic species groups are proposed and defined.

ACKNOWLEDGEMENTS

This work was made possible in large part by the help and support of many people, some of whom I thank here. I am indebted to my advisor, David Barrington, who provided me with ceaseless encouragement and insight into plant evolution, morphology, and bigeogeography. It was a great pleasure to work with Michael Sundue on a wide- ranging array of projects; our discussions of the future of botany will not be forgotten. I am deeply thankful for the guidance of Benjamin Øllgaard, whose immense research accomplishments and profound knowledge of the Lycopodiaceae stand as foundations of this work. I thank Art Gilman for encouraging me to study these plants and for sharing his knowledge with me. Ashley Field has been an invaluable collaborator and wealth of knowledge about Old World lycophytes. Eddie Watkins, Robbin Moran, and Alan Smith all helped me to better understand the ecology and evolution of ferns and lycophytes; that knowledge base was critical for completing this work. I am grateful to Alejandra Vasco for her friendship and support of my field work, especially in Colombia. Many thanks to the faculty of the Plant Biology Department at the University of Vermont and especially the members of the Barrington lab for their support over the years. I am also thankful for the support of family and friends outside of the research community. Christina, thank you for your enthusiasm and encouragement. Most importantly, I thank my parents for their unconditional love and support. Finally—good boy, Curtis.

TABLE OF CONTENTS

LIST OF TABLES ...... III LIST OF FIGURES ...... IV CHAPTER 1: COMPREHENSIVE LITERATURE REVIEW ...... 1

ANDEAN GEOGRAPHY AND OROGENY ...... 1 ORIGINS OF ALPINE ANDEAN TAXA ...... 6 PATTERNS OF INTRA-ANDEAN MIGRATION ...... 12 DIVERSIFICATION RATES AMONG ALPINE ANDEAN PLANT LINEAGES ...... 15 CONCLUSIONS...... 16 LYCOPODIACEAE IN THE ANDES ...... 19 LITERATURE CITED ...... 21 CHAPTER 2: DIVERGENCE TIMES AND HISTORICAL BIOGEOGRAPHY OF THE LYCOPODIACEAE ...... 31 INTRODUCTION ...... 31 MATERIALS AND METHODS ...... 33 RESULTS ...... 38 DISCUSSION ...... 41 LITERATURE CITED ...... 50 CHAPTER 3: PHYLOGENETIC SYSTEMATICS, MORPHOLOGICAL EVOLUTION, AND NATURAL GROUPS IN NEOTROPICAL PHLEGMARIURUS (LYCOPODIACEAE) ...... 59 INTRODUCTION ...... 59 MATERIALS AND METHODS ...... 62 RESULTS ...... 65 DISCUSSION ...... 69 CONCLUSIONS...... 83 LITERATURE CITED ...... 84 CHAPTER 4: THE RISE OF THE ANDES PROMOTED RAPID DIVERSIFICATION IN NEOTROPICAL PHLEGMARIURUS (LYCOPODIACEAE) ...... 87 INTRODUCTION ...... 87 MATERIALS AND METHODS ...... 90 RESULTS ...... 93 DISCUSSION ...... 94 LITERATURE CITED ...... 101 COMPREHENSIVE LITERATURE CITED ...... 122 APPENDIX 1...... 145 APPENDIX 2...... 150

iii

LIST OF TABLES

Table 1. Nucleotide substitution model parameters for each marker used, primers used for PCR and sequencing, and PCR conditions. PCR conditions include time in seconds on the top row and temperature in degrees Celsius on the bottom row of each cell...... 108.

Table 2. Comparison of paleoelevation-dependent diversification models implemented in RPANDA...... 109.

iii

LIST OF FIGURES

Figure 1. Comparison of divergence time estimates obtained using random local clock and uncorrelated lognormal clock models. Branch colors designate major land plant clades, and colored circles indicate the position of fossil node calibrations………...... 110.

Figure 2. Comparison of crown age distributions from select clades in the Lycopodiaceae. Distributions are kernel-density plots of mean ages obtained across the MCMC runs under each clock model………...... ……….....111.

Figure 3. Historical biogeography of the Lycopodiaceae, as inferred using the DEC + J model implemented in BioGeoBEARS. Colored blocks represent current (at branch tips) and inferred historical (at nodes) distributions of Lycopodiaceae taxa. Arrows represent inferred long-distance dispersal events and are color-coded to the area to which the lineage is inferred to have dispersed...... 112.

Figure 4. Major vicariance events and the biogeography of Lycopodiaceae subfamily Huperzioideae from 200 MYA to the present...... 113.

Figure 5. Representative diversity of Neotropical Phlegmariurus . A. P. myrsinites (Phlegmariurus aqualupianus group), B. P. taxifolius (Phlegmariurus taxifolius group), C. P. mooreanus (Phlegmariurus ruber group), D. P. hippurideus (Phlegmariurus dichotomus group), E. P. talamancanus (Phlegmariurus crassus group), F. P. linifolius (Phlegmariurus linifolius group), G. P. brevifolius (Phlegmariurus crassus group), H. P. acerosus (Phlegmariurus acerosus group). Photos credits: A, B, D: Michael Sundue; C, F, H: Fernando Matos; E, G: Weston Testo……………………………………………...... 114. Figure 6. Best-scoring ML phylogeny of Neotropical Phlegmariurus . Support values above branches are Bayesian posterior probabilities (PP); values below branches are ML bootstrap percentages (BS). Asterisks indicate PP = 1.0 and BS = 100%; branches without support values indicate nodes with PP < 0.5 or BS < 50%. Dashed branches have branch lengths that are scaled down by a factor of 10 for visualization purposes…...... 115.

Figure 7. Species groups described by Øllgaard (1987, 1992) and those proposed here mapped onto our best-scoring ML phylogeny of Neotropical Phlegmariurus …116.

Figure 8. Phylogenetic reconstruction of discrete morphological traits in Neotropical Phlegmariurus . Pie charts represent probability of each character state at the corresponding node, as inferred under maximum-likelihood using the Mk1 model of evolution. Traits are: A. fertile-sterile leaf dimorphy, B. leaf margin toothiness, C. growth habit, D. stem coloration…………...... ………117.

Figure 9. Phylogenetic reconstruction of continuous morphological traits in Neotropical Phlegmariurus as inferred under maximum-likelihood and mapped with continuous change along branches. Values were log-transformed and traits are: A. stem thickness, B. leaf length/width ratio………………...... ……118.

Figure 10. Elevation and diversity in species groups of Neotropical Phlegmariurus . Circles represent species groups in the genus, circle size is relative to group species richness. Species group elevation and net diversification rate values are means obtained from all representatives in the group that were included in this study……………...... …...119.

Figure 11. Diversification dynamics of Neotropical Phlegmariurus . The clade highlighted in red on the time-calibrated phylogeny is the Phlegmariurus crassus species group. The green dotted line represents the spline of paleoelevational estimates obtained from geological data, as described in the Methods. The red and blue lines are log-lineage-through-time plots simulated under birth-death and pure birth (Yule) models of diversification, respectively. The yellow line is a log-lineage-through-time plot for the time-calibrated phylogeny of Neotropical Phlegmariurus used in this study. The horizontal gray dotted line marks the approximate current elevation of treeline in the tropical Andes……...... ….120.

Figure 12. Phylogeny of Neotropical Phlegmariurus with diversification rates and (A) range size, (B) elevational range, (C), niche breadth, and (D) mean elevation provided for each species. Bar lengths represent values for given species attributes; bar color represents species net diversification rate…………………...... 121.

Figure 13. Association between net diversification rates and (A) range size, (B) elevational range, (C), niche breadth, and (D) mean elevation provided for Neotropical Phlegmariurus species. R 2 and P-values provided are from phylogenetic independent contrasts……………..…………………………………...... 122.

CHAPTER 1: COMPREHENSIVE LITERATURE REVIEW

ANDEAN GEOGRAPHY AND OROGENY

Spanning more than 67 degrees of latitude and the entire length of the South American continent, the Andes are the most ecologically diverse and species-rich region on Earth

(Mittermeier et al., 1999, Myers et al., 2000). Replete with areas of contact with the similarly diverse Amazon basin on their eastern periphery and attaining heights of 7 km, this mountain range is the second highest in the world and presents the most extensive climatic gradient of any terrestrial bioregion. Assembled along this steep temperature and precipitation gradient (Colwell et al., 2008), diverse habitat types are juxtaposed within close geographic proximity throughout the Andes, together, these habitats harbor immense biological diversity — an estimated 45,000 plant species are found in the tropical portion of the Andes; nearly half of these taxa are endemic (Myers et al., 2000).

These remarkable levels of richness and endemism make the Andes an exceptional region in which to examine important evolutionary questions about processes of speciation and patterns of diversification; they have been studied extensively in the region, especially among birds (Brumfield and Edwards, 2007; Miller et al., 2008; Sedano and Burns, 2010;

DuBay and Witt, 2012; Chaves et al., 2013; McGuire et al., 2014), reptiles (e.g. Schulte et al., 2000; Doan, 2003; Torres-Carvajal, 2007, 2016) and angiosperms (e.g. Emshwiller,

2002; von Hagen and Kadereit, 2003; Hughes and Eastwood, 2006; Scherson et al., 2008;

Emadzade et al., 2010; Jabaily and Sytsma, 2010; Sanín et al., 2016; Diazgranados and

Barber, 2017).

Most studies of the geology, geography, and biodiversity of the Andes divide the region into three latitudinal segments: the northern Andes, central Andes, and southern Andes.

These regions are recognized primarily on the basis of their unique orogenic histories

(Graham, 2009) and conveniently correspond roughly to political boundaries, with the northern Andes comprising Venezuela, Colombia, and Ecuador; the central Andes spanning Bolivia and Peru; and the southern Andes running through Argentina and Chile to the southern tip of the continent. The northern and central Andes together comprise a larger, climatically defined sub-region known as the tropical Andes, whereas the southern

Andes are primarily temperate. Most of the region’s biodiversity, especially among vascular plants (Myers et al., 2000) is concentrated in the tropical Andes; this review will deal primarily with this region.

Discussion of the patterns of diversification underlying current Andean biodiversity and endemism must be grounded in consideration of the history of mountain-building events.

The Andean orogeny exerted a powerful effect on the biogeographic history of the region’s biota by altering climate, changing habitat availability, and alternatingly isolating populations and forming new migration corridors. Recently, renewed study of the processes underlying the uplift of the Andes has improved our understanding of the timing of these events; the findings of these studies are summarized here.

It is generally understood that rise of the Andes occurred as a series of related but independent uplift events progressing in a generally south-to-north direction. Uplift of the central Andes is thought to have begun in the late Cretaceous (~85 MYA) following a series of tectonic collision and subduction events (Gregory-Wodzicki, 2000; Schellart et al., 2010). During the late Cretaceous, the oceanic Farallon Plate began subducting under 2 the southwestern portion of the North American plate and eventually fragmented into five smaller plates, one of which (the Nazca Plate) would continue to play an important part in the orogeny of the Andes (Sigloch and Mihalynuk, 2013). The Nazca Plate, which split from the remnants of the Farallon Plate around the Oligocene-Miocene boundary

(Lonsdale, 2005) began subducting under the South American Plate, accelerating uplift in this region. Recent studies suggest that the initial period of uplift corresponds closely with these geological events, with the Western Cordillera attaining half of its current height around the time of the divergence of the Nazca and Farallon plates (~25 MYA;

Gregory-Wodzicki, 2000; Graham et al., 2001; Garzione et al., 2008; Sigloch and

Mihalynuk, 2013). Following this initial period of uplift, the continued subduction of the

Nazca Plate resulted in accelerated rates of mountain-building in the Miocene and

Pliocene, with the central Andes gaining at least 2 km in elevation during this period

(Gregory-Wodzicki, 2000; Lonsdale, 2005; Sigloch and Mihalynuk, 2013) and attaining their modern elevation by the late Pliocene (Hooghiemstra and van der Hammen, 2004;

Mora et al., 2010).

The orogeny of the northern Andes is more complicated than that of the central Andes and was driven by a different plate subduction event. The Caribbean Plate, a mostly oceanic plate of contested origin (Frisch et al., 1992; Meschede and Frisch, 2002; Kennan and Pindell, 2009) began to drift eastward across the Caribbean basin in the Cretaceous and started the subduction of the South American Plate, causing a series of volcanic events which resulted in the formation of the Aves Islands and the Greater and Lesser

Antilles (Iturralde-Vinent and Gahagan, 2002; Garcia-Casco et al., 2008). As this subduction of the Caribbean Plate continued, mountain-building events in northwestern 3

South America followed, forming the northern Andes (Iturralde-Vinent and Gahagan,

2002). Numerous studies have suggested that the orogenesis of the northern Andes was recent and rapid relative to that of the central Andes; estimates by Gregory-Wodzicki

(2000) for the Eastern Cordillera in Colombia indicate that this region attained half of its modern elevation 10 MYA, during the late Miocene. Rapid uplift (~600 m MY -1) in this region occurred during the early Pliocene (Hooghiemstra and van der Hammen, 2004;

Hoorn et al., 2010) until the mountains attained their current elevation around the

Pliocene-Pleistocene boundary (2.5 MYA). In both the central and northern Andes, these relatively recent periods of rapid uplift in the Pliocene lead to the appearance of extensive alpine grassland habitats, especially in the northern Andes, about 5-3 MYA (van der

Hammen et al., 1973; van der Hammen, 1974).

The uplift of the Andes shifted the climate and ecosystem composition of the South

American continent dramatically; these shifts coincided with the most rapid species diversification events known (Madriñan et al., 2013). Prior to the uplift of the Andes, the

South American continent was mostly flat and dominated by tropical forest comprised of taxa with Gondwanan affinities (Gentry, 1982; van der Hammen, 1974, 1989). The

Andean orogenesis events of the Miocene allowed for the development of montane forests like those which currently dominate middle elevations in the Andes (Simpson,

1983; Hooghiemstra et al., 2006). At this time, mountain development also resulted in greater geographic and temporal variation in regional precipitation, with a general trend towards aridity on the western edge of the Andes and increased precipitation on the eastern face of the Andes by this period (Hartley, 2003; Houston and Hartley, 2003); additional ecoclimatic diversity was generated by later uplift, which resulted in further 4 elevational stratification of forest types, especially in the northern Andes (van der

Hammen, 1974). Rapid elevational turnover in species composition and narrow niche spaces in these habitats are critical in maintaining the region’s unparalleled biodiversity and endemism (Mittermeier et al., 1999; Myers et al., 2000; Swenson et al., 2012). By the late Pliocene (5-3 MYA), the northern Andes had emerged above tree-line, establishing proto-páramo habitats—these expanded considerably during the following 2 MYA

(Sklenár et al., 2011) and palynological evidence indicates the development of a modern páramo flora by the Pliocene-Pleistocene boundary (van der Hammen, 1974; Gómez et al., 2007). Subsequent cycles of glaciation altered elevational zonation of vegetation by as much as 2 km and causing isolated páramos to merge for periods of time, only to again be separated during interglacial periods which precipitated upward shifts in the elevational limits of the páramo (van der Hammen, 1974; Hooghiemstra et al., 2006;

Rutter et al., 2012; Villota et al., 2012). These patterns of habitat expansion and contraction are thought to have had an important effect on the distribution and diversification of páramo lineages (Hewitt, 2000; Hooghiemstra et al., 2006; Giarla and

Jansa, 2015; Riberio et al., 2016), though it is difficult to ascertain the precise impacts of these episodes given their recent occurrence and the uncertain boundaries of these shifts.

Along with these eco-climatic factors, basic features of the geography of the Andes have influenced the biogeographic history of South American flora and fauna. The Andean uplift created an effective barrier for east-west dispersal, especially in taxonomic groups with limited dispersibility (Pirie et al., 2006; Miller et al., 2008; Smith et al., 2014; Pérez-

Escobar et al., 2017) resulting in isolation of populations which had formerly been widely distributed. This isolation facilitated divergence on either side of this longitudinal barrier 5 and, in many cases, subsequent radiations in the unique habitats on each side of the

Andean cordilleras. Conversely, the Andean uplift facilitated range expansion for some taxa, primarily along north-south habitat corridors. In particular, the formation of contiguous montane habitats by the Miocene is thought to have allowed for intra-Andean north-south migrations and provided extensive novel habitat for temperate taxa, which comprise an estimated 1/3 of extant tropical Andean diversity (Smith and Cleef, 1988;

Sklenár et al., 2011).

ORIGINS OF ALPINE ANDEAN TAXA

Numerous studies have investigated the impact of this complex and dynamic geo-climatic history on the diversification and current distribution of Andean taxa. These studies utilize time-calibrated, species-level phylogenies and explicit biogeographic models to infer historical distributions and patterns of migration and have provided insight into both the geographical origin of Andean taxa and the direction of migration following colonization. Here I present the summary of a review of relevant literature in Andean plant biogeography, which is a divided into two general topics: 1) the origin of alpine

Andean plant taxa and 2) patterns of intra-Andean migration following colonization.

In his seminal work on Andean biogeography, Chardón (1933) presented two hypotheses for colonization of the tropical Andes: 1) long-distance dispersal from temperate regions, and 2) range expansion of lineages already present in adjacent lowland regions. Later, surveys of the taxonomic affinities of Andean plant lineages generated evidence in support for both hypotheses. Studies by Simpson (1975), Cleef (1979) and Smith and

Cleef (1988) demonstrated that the affinities of most high-elevation Andean plants are to 6 lineages that are North or South temperate, or both. They suggested that colonization of

“tropicalpine” habitats (sensu Smith, 1975) by temperate plant lineages occurred primarily during the Pleistocene, when dispersal distances to newly formed Andean alpine habitats were considerably reduced due to climate-driven range shifts among temperate taxa. Conversely, Gentry (1982) suggested a Gondwanan origin for most South

American plant groups, with lowland taxa radiating into montane regions as they became available.

More recently, the integration of molecular phylogenetics into biogeographic studies has provided further insight into the origin of Andean plant lineages and has provided support for both of Chardón’s (1933) hypotheses. I summarize these studies here, including only those with sufficient sampling and phylogenetic resolution to securely demonstrate the study taxa’s biogeographic history.

Dispersal from temperate regions

Here I present the 14 examples of prominent high-elevation plant groups in the tropical

Andean which have been demonstrated to have dispersed from temperate regions. Of these, 10 are derived from north temperate regions whereas four originated in the south temperate zone.

Summarizing the vascular flora of Andean páramo habitats, Cleef (1979) reported that

30% of all species were derived from North American lineages. More recently, an array of biogeographic studies have demonstrated the prevalence of north temperate and

7 especially North American origins among high-elevation Andean taxa; ten of these are presented here.

In a study of the primarily north temperate genus Erigeron (Asteraceae), Noyes (2000) used nuclear ITS sequence data to infer the group’s global biogeography and found that the Andean representatives of the group were nested within a clade of North American species. He concluded that the Andean diversity in the genus was likely the product of a recent radiation following long-distance dispersal from North America, likely from

Mexico. Similar scenarios involving dispersal by southwestern North American representatives of primarily north temperate lineages have been demonstrated for numerous groups, including: Cerastium (Sheen et al., 2004), Draba (Koch and Shehbaz,

2002), Lupinus (Hughes and Eastwood, 2006), Polystichum (McHenry and Barrington,

2014), Astragalus (Scherson et al., 2008), Valeriana (Bell and Donoghue, 2005),

Gentianella (von Hagen and Kadereit, 2001), Halenia (von Hagen and Kadereit, 2003) and Ranunculus (Emadzade et al., 2011). Of these studies, all but that of Koch and

Shehbaz (2002) include explicit estimates of dispersal times for their respective lineages, and in all but one case, the relevant dispersal event(s) occurred after the cessation of major Andean uplift and concurrent formation of alpine habitats therein during the

Pliocene. Using a simple molecular clock technique to date a three-marker plastid phylogeny of the primarily Holarctic Cerastium (Caryophyllaceae), Sheen et al. (2004) estimated the group’s arrival in the Andes at 2.22-1.31ma and suggested that the recently developed Isthmus of Panama may have acted as a “stepping stone” for plants migrating from southwestern North America. Using a dated phylogeny inferred from a combined nuclear/chloroplast DNA sequence data set, Scherson et al. (2008) recovered similar 8 times of arrival (1.89 and 0.98ma) for two dispersal events within Astragalus (Fabaceae) into Andean alpine habitats, with rapid subsequent diversification in both cases. In an investigation of the rapid radiation of Lupinus (Fabaceae) in the Andes, Hughes and

Eastwood (2006) estimated the genus’ arrival in South America from Mexico at 1.76-

1.18ma. von Hagen and Kadereit (2001, 2003) utilized a molecular clock on a total evidence phylogeny of the Gentianaceae genera Gentianella and Halenia (Gentianaceae) to determine that both genera arrived in the Andes after alpine habitats became available, inferring Pleistocene long-distance dispersal events for both genera. Multiple long- distance dispersal events from North America, Asia, and Europe during the Pleistocene are thought to underlie the diversity of the primarily North-temperate Ranunculus

(Ranunculaceae) in the southern Andes, as shown by a robust series of analyses by

Emadzade et al. (2011).

Building on the earlier work of Cleef (1979) which illustrated the prevalence of North

American lineages among high-elevation Andean floras, Smith and Cleef (1988) suggested that south temperate regions—especially southern South America— may have served as even more important sources of diversity, with colonization of Andean alpine habitats occurring during the Pleistocene, after these habitats became established. Here I present five examples from recent studies which support this south temperate-Andean pattern of dispersal.

In a phylogenetic study of the primarily south temperate sedge genus Oreobolus

(Cyperaceae) based on nuclear ITS sequence data, Chacón et al. (2006) demonstrated that the South American representatives of the genus arrived from Australia 6–5.5 MYA, during the late Miocene. Andersson et al. (2006) utilized a three-gene plastid phylogeny 9 of the prominent South American cushion-plant genus Azorella (Apiaceae) to show that the taxa dispersed northward from temperate South America into the Andes; estimates of the timing of this migration were not produced. A similar origin and pattern of migration is thought to underlie the distribution of the diverse Calceolaria (Calceolariaceae) in the

Andes. In a pair of studies, Cosacov et al. (2009, 2010) demonstrated that Calceolaria migrated northward through South America from an ancestral range in the Patagonian steppe, arriving in the northern Andes approximately 11 MYA with a later divergence between Patagonian and southern Andean taxa occurring at approximately 7.7 MYA.

Among the most conspicuous and charismatic constituents of the Andean páramo flora is the bromeliad genus Puya , which is distributed along nearly the entire Andean cordillera, with additional species in lowland Chile and páramos of Panama and Costa Rica. Jabaily and Sytsma (2010, 2013) demonstrated that the genus, which diverged from its sister lineage approximately 10 MYA (Givnish et al., 2011) originated in lowland habitats in

Chile and subsequently radiated north into the Andes in the mid-Pliocene. In a series of studies on focusing on the centropogonid clade of the hyper-diverse cosmopolitan family

Campanulaceae, Lagomarsino and colleagues (Lagomarsino et al., 2014; 2016) demonstrated that group’s remarkable richness in Andean montane habitats was the result of rapid diversification concurrent with the uplift of the Andes; the tropical Andean clades appear to be derived from temperate lineages from the southern Andes. A similar pattern was reported by Sanín et al. (2016) for the palm genus Ceroxylon , which is thought to have originated in the Central Andes and radiated northwards during the past

10 million years, with species segregating along elevation-driven climatic gradients.

Within-tropics origins

A series of recent biogeographic studies focusing on high-elevation Andean vascular plants support Chardón’s (1933) hypothesis of colonization of alpine habitats from nearby lowland tropical regions. In a study of the Oxalis tuberosa group (Oxalidaceae) which is broadly distributed in high-elevation regions of Central and South America,

Emshwiller (2002) utilized a dataset comprised of two nuclear loci to show that the O. tuberosa alliance diverged from a clade of species distributed on the eastern foothills of the southern Andes. This phylogeny lacked divergence time estimates, though the author suggested that the group’s radiation likely corresponded with the south-to-north formation of alpine habitats during the Pliocene. The Rubiaceae subfamily

Cinchonoideae, a widespread Neotropical clade comprising an estimated 130 species, are thought to have colonized the Andes by gradual migration from the Amazon Basin during the mid-Miocene (Antonelli et al., 2009). Using a phylogeny inferred from one nuclear and four chloroplast markers, they showed that this lineage dispersed from North

America to northeastern Amazonia in the early Eocene and subsequently diversified into the Northern Andes during rapid mountain-building in that region ~15 MYA.

Diazgranados and Barber (2017) recently demonstrated that the iconic páramo genus

Espeletia underwent a recent, rapid burst of diversification in the North Andes following the lineage’s divergence from a clade comprised of the genera Icthyothere and

Rumfordia , both of which are widespread in mid-elevation habitats in the Neotropics

(Rauscher, 2002).

Several studies have indicated southeastern Brazil as an ancestral area for lineages that subsequently underwent rapid diversification in the high-elevation Andes. Multiple colonization events of montane habitats in the Andes from various regions of Central and

South America were inferred in a recent study of the biogeography of Neotropical

Gesneriaceae by Perret et al. (2013). They demonstrated that all major clades of high- elevation Andean Gesneriaceae species resulted from independent migration events from

Central America, northern Amazonia, and southeastern Brazil primarily in the mid-

Miocene, followed by subsequent rapid radiations in the Andes. A southeastern Brazilian origin was also inferred for three high-elevation Andean fern genera. Kreier et al. (2008) demonstrated that the epiphytic genus Serpocaulon (Kreier et al., 2008) which is widespread throughout Central and South America, with most species distributed in the tropical Andes (Smith et al., 2006) originated in montane forests of southeastern Brazil and Bolivia and subsequently radiated northward; however, divergence times were not estimated in that study. In a study of the fern genus Jamesonia , which primarily occupies paramos and other open high-elevation habitats in the Andes, Sanchez-Baracaldo (2004) demonstrated that the genus originated southeastern Brazil and subsequently radiated into the Andes.

PATTERNS OF INTRA-ANDEAN MIGRATION

In addition to elucidating the origin of prominent Andean vascular plant lineages, a central goal of many of the studies discussed herein was to determine patterns of post- colonization diversification within the Andes. A prominent biogeographic hypothesis proposed to explain observed patterns of distribution within the context of the Andean 12 orogeny is the south-to-north-speciation hypothesis (SNSH) used by Doan et al., (2003) in a study of the lizard genus Proctoporus . This hypothesis suggests that species diverged along the Andes in a northerly direction as alpine habitats became available, in concert with the south-to-north progression of mountain uplift. Within a phylogenetic context, this hypothesis indicates that within a given lineage distributed throughout the Andes, the species with the southernmost distribution would be the earliest-divergent, with more derived species being distributed consecutively to the north. Though this model may be overly simple in light of the complexity of Andean geologic history (Torres-Carvajal,

2007) and others have indicated that the original SNSH example (Andean Proctoporus ) did not diversify in a strictly south-to-north pattern (Castoe et al., 2004; Doan and Castoe,

2005; Goicoechea, 2012) the SNSH presents a reasonable and easily tested hypothesis for the diversification of Andean biota, including vascular plants. Here, patterns of intra-

Andean migration inferred from phylogenies of vascular plant clades are discussed with reference to the SNSH.

An array of studies of prominent angiosperm genera and three studies of ferns support

Doan’s (2003) intra-Andean diversification hypothesis. Gentianella (von Hagen and

Kadereit, 2001), Halenia (von Hagen and Kadereit, 2003), Oxalis (Emshwiller, 2002) and

Valeriana (Bell and Donoghue, 2005) all followed essentially the same path, dispersing from North America to the south-central Andes in the Plio-Pleistocene and subsequently engaging in a rapid radiation into the northern Andes as new alpine habitats became available. The Andean clade of the fern genus Polystichum arrived earlier (mid-Miocene) than the other north temperate lineages discussed here but followed a similar pattern of diversification from the central Andes northward, as montane forest habitats became 13 available (McHenry and Barrington, 2014). Among genera from south temperate and tropical elements, the general pattern of south-to-north diversification is shared: after arriving in the south-central Andes during the Miocene as a result of either long distance dispersal (e.g. Oreobolus , Jamesonia /Eriosorus ) or incremental range expansion from adjacent low- to mid-elevation regions (e.g. Puya , Serpocaulon, centropogonids,

Ceroxylon ), these genera diversified into the central and northern Andes during the same period as north temperate taxa, which were altogether absent from the Andes for several million years after the appearance of tropical and south temperate lineages in the region.

A north-to-south pattern of diversification is also known from some examples among prominent montane vascular plant groups. Hedyosmum , a genus of montane shrubs and trees in the Chloranthaceae, dispersed from the Northern to the Central Andes several times during the Pliocene and Pleistocene (Antonelli and Sanmartín, 2011). The Andes served as a corridor of suitable habitat for the grass genus Festuca , which dispersed from

North America to the Northern Andes, and subsequently dispersed southward to temperate South America, where they underwent a significant radiation (Inda et al.,

2008). A similar pattern was reported by Feodorova et al. (2010) for Cleome ; a large clade appears to have originated in the Northern Andes and the adjacent Guiana Shield and subsequently migrated southwards into the Central and Southern Andes. Though they did not include a time-calibrated phylogeny in their study, Diazgranados and Barber

(2017) demonstrated that early divergent lineages of Espeletia s.l. are distributed in páramos of northwestern Venezuela and northern Colombia, with more recently derived lineages being distributed progressively further south.

DIVERSIFICATION RATES AMONG ALPINE ANDEAN PLANT LINEAGES

A conspicuous feature of many montane vascular plant lineages in the Andes is high species richness in comparison to extra-Andean sister groups (Luebert and Weigand,

2014). Given this remarkable richness and the young age of most Andean lineages, it is not surprising that many of these groups exhibit exceptionally high rates of species diversification. In a study that included 73 dated phylogenies, Madriñan et al. (2013) demonstrated that the mean diversification rate of páramo vascular plant lineages is higher than that obtained from any other biodiversity hotspot on Earth. Using the net diversification rate of Magallón and Sanderson (2001), they reported a mean net diversification rate of 1.36 events MY -1 for páramo lineages, compared to a next-highest rate of 1.07 events MY -1 for groups from the Mediterranean hotspot. Among Andean páramo lineages, mean diversification rates ranged from 0.18 events MY -1 for

Arcytophyllum to 5.10 events MY -1 for Aragoa . Other studies report similarly high rates of diversification; to facilitate cross-study comparison, I report all rates using the zero- extinction rate metric of Magallón and Sanderson (2001). Lagomarsino et al. (2017) reported a rate of 1.15 events MY -1 for the centropogonid clade of the Campanulaceae; diversification rates among this clade were dramatically elevated in comparison to the rates observed in closely related clades. Even higher rates were reported for Andean

Lupinus (2.52 events MY -1; Hughes and Eastwood, 2006), Astragalus (2.05 events MY -1;

Scherson et al ., 2008), and Gentianella (1.48 events MY -1; von Hagen and Kadereit,

2001). Though they did not report diversification rates in their study, I calculated a mean 15 net diversification rate of ~1.05 events MY -1 for the fern genus Jamesonia from the time- calibrated phylogeny of Sanchez-Baracaldo and Thomas (2014). Sundue et al. (2015) reported a somewhat lower rate of 0.38 events MY -1 for Serpocaulon , a primarily Andean genus of epiphytic ferns that primarily occupy montane forest habitats.

Though estimation of diversification rates from molecular phylogenies remain contentious (Moore et al., 2016; Rabosky et al., 2017), the rate values provided for these groups are likely closer to true values than would be generally expected, as these lineages are young and do not appear to have experienced extensive extinction, which remains the single largest confounding factor in the calculation of these rates (Rabosky, 2010;

Beaulieu and O’Meara, 2015). Though these values may be expected to change some as divergence time estimates are revised and methods of inferring diversification rates improve, these findings demonstrate a consistent pattern of strongly elevated diversification rates in high-elevation Andean plant groups in comparison to both related extra-Andean lineages as well as assemblages from other species-rich regions on Earth.

Further study of lineage diversification dynamics of high-elevation Andean taxa should provide a more thorough understanding of the tempo of speciation in the region and how rapid diversification of many groups over the past few million years contributed to the establishment of the tropical Andes as the most diverse bioregion on Earth.

CONCLUSIONS

Along with rainforests of the Amazon basin, the Andean cordillera is the defining geographic feature of the South American continent. Moreover, the portion of the mountain range that spans the continent’s tropical latitudes comprise the most biodiverse 16 region on Earth, with more than 45,000 species of vascular plants and nearly 3400 vertebrate species known in an area covering approximately 1% of Earth’s land area

(Myers et al., 2000). Levels of endemism range from 27–28% for birds and mammals to

44% for vascular plants and more than 50% for amphibians; these values are certainly underestimates, given the prevalence of cryptic species among many groups from the tropical Andes and adjacent regions (Giraldo et al., 2008; Funk et al., 2011; Särkinen et al., 2011; Lücking et al., 2014; Gill et al., 2016). Given this outstanding level of biodiversity across an array of taxonomic groups, the region’s complex geography, and its well-documented geologic history, the Andes are an excellent study system for examining the role that mountain-building has played in driving species proliferation.

Biogeographic studies based on dated molecular phylogenies have provided valuable insight into the history of colonization and subsequent range expansion of numerous plant lineages within the Andes. Many prominent Andean plant groups dispersed from temperate regions since the Pliocene; the success of these otherwise temperate groups in the high-elevation Andes appears to be due in part to preadaptation to cold temperature, a lack of which may have precluded many tropical taxa from lower elevations from successfully invading novel alpine habitats as they arose over the past 5 million years

(Donoghue, 2008; Edwards and Donoghue, 2013). However, several tropical lineages did successfully radiate into high-elevation habitats in the Andes through gradual migration from low- and mid-elevation tropical forests; epiphytes—which are poorly represented in temperate regions—are prominent this group. Extensive intra-Andean migration following initial colonization events has been recorded for some genera, with many lineages exhibiting a northerly trajectory to their diversification, following the 17 cordillera’s south-to-north progression of uplift, which provided novel habitats into which these groups could diversify.

Along with resolving the biogeographic histories of high-elevation Andean plant lineages, phylogenetic studies have provided insight into the timing and tempo of their diversification. As expected given the young age of the Andean cordillera, most diversification events in these groups are recent, occurring primarily during the

Pleistocene. In addition to being a relatively recent phenomenon, speciation among

Andean plant groups has occurred with remarkable frequency, with the páramos of the

Northern and Central Andes being the fastest-diversifying ecosystem on Earth (Madriñan et al., 2013). Although the factors responsible for the remarkable rates of diversification observed among high-elevation Andean lineages remain difficult to elucidate, evidence from several recent studies suggests that intermittent isolation of populations due to climatic fluctuations has played an important role in promoting genetic divergence and speciation. The rise of the topographically complex high Andes created a myriad of isolated alpine “sky islands” separated by regions of montane forests. Gene flow between these distant high-elevation habitats is thought to be low during interglacial periods, but their lower elevational limits were repeatedly depressed during glacial periods, increasing connectivity of these alpine habitats and allowing intermittent gene flow among populations that inhabit them. Consequences of this history of incomplete isolation include low genetic divergence and poor morphological differentiation exhibited among many páramo species (Kolář et al., 2016; Vásquez et al., 2016; Diazgranados and Barber,

2017), which pose significant challenges to molecular phylogeneticists and alpha taxonomists alike. Next-generation sequencing approaches have revealed extensive 18 cryptic species diversity in some clades of high-elevation Andean taxa (Guarnizo et al.,

2015; Brehm et al., 2016; Gill et al., 2016); these studies suggest the true species richness of the tropical Andes is much higher than is currently thought.

The exceptional diversity of the Andes has drawn the attention of naturalists for nearly two centuries (Humboldt, 1820; Wallace, 1853; Darwin, 1909; Cuatrecasas, 1934;

Gentry, 1982), and for good reason. The region’s unparalleled species richness and high levels of endemism, coupled with its geographic complexity, history of recent uplift, and subsequent climate fluctuations, make it an excellent system for studying rapid evolutionary radiations. Though the evolutionary history of the Andean flora remains poorly understood relative to better-studied biodiversity hotspots, recent phylogenetic studies have elucidated prominent patterns of diversification in the region and provide an increasingly robust framework for evaluating the drivers of exceptional diversification in this landscape. It is within this framework that researchers progress towards a more complete understanding of how the interplay of geologic, climatic, and biotic factors contributed to the establishment of the world’s “hottest” biodiversity hotspot.

LYCOPODIACEAE IN THE ANDES

The clubmosses (Lycopodiaceae) provide an excellent group in which to study diversification of an Andean-centered group of spore-dispersed vascular plants, providing a useful point of comparison to the numerous studies on angiosperms. Comprising an estimated 400 species, the Lycopodiaceae are one of three extant lycophyte families, along with the heterosporous lycophyte families Selaginellaceae and Isoetaceae (PPG I,

2016); these three families are sister to the euphyllophyte clade. 19

Though the Lycopodiaceae is distributed worldwide, the family attains its highest species richness in the Andean region. Eight Lycopodiaceae genera are represented in the Andes; by far the most diverse of these is Phlegmariurus , which includes approximately 120

Andean representatives. This exceptionally diverse group forms a monophyletic clade, sister to a principally paleotropical clade of Phlegmariurus (Field et al., 2016) and is comprised of species that are remarkably diverse ecologically and morphologically— members of this group range from sea level to at least 5000 m elevation, and include nearly even numbers of epiphytic and terrestrial species.

The exceptional diversity of Andean Lycopodiaceae and especially that of Phlegmariurus in the region has led researchers (Ollgaard, 1992; 1995; Field et al., 2016) to hypothesize that the group has undergone a period of recent and rapid diversification in concert with the uplift of the Andes, like that observed in groups covered in this review. The principal goal of the research presented in this dissertation seeks to test this hypothesis and provide a comprehensive understanding of the evolutionary history of the Lycopodiaceae as a whole.

LITERATURE CITED

Andersson L, Kocsis M, Eriksson R . 2006 . Relationships of the genus Azorella (Apiaceae) and other hydrocotyloids inferred from sequence variation in three plastid markers. Taxon 55 : 270–280.

Antonelli A, Nylander JAA, Persson C, Sanmartín I . 2009 . Tracing the impact of the Andean uplift on Neotropical plant evolution. Proceedings of the National Academy of Sciences 106 : 9749–9754.

Antonelli A, Sanmartín I . 2011 . Why are there so many plant species in the Neotropics? Taxon 60 : 403–414.

Beaulieu JM, O’Meara BC . 2015 . Extinction can be estimated from moderately sized molecular phylogenies. Evolution 69 : 1036–1043.

Bell CD, Donoghue MJ . 2005 . Phylogeny and biogeography of Valerianaceae (Dipsacales) with special reference to the South American valerians. Organisms Diversity & Evolution 5: 147–159.

Brehm G, Hebert PDN, Colwell RK, Adams M-O, Bodner F, Friedemann K, Möckel L, Fiedler K . 2016 . Turning Up the Heat on a Hotspot: DNA Barcodes Reveal 80% More Species of Geometrid Moths along an Andean Elevational Gradient. PLOS ONE 11 : e0150327.

Brumfield RT, Edwards SV . 2007 . Evolution into and Out of the Andes: A Bayesian Analysis of Historical Diversification in Thamnophilus Antshrikes. Evolution 61 : 346– 367.

Castoe TA, Doan TM, Parkinson CL . 2004 . Data Partitions and Complex Models in Bayesian Analysis: The Phylogeny of Gymnophthalmid Lizards. Systematic Biology 53 : 448–469.

Chacón J, Madriñán S, Chase MW, Bruhl JJ . 2006 . Molecular phylogenetics of Oreobolus (Cyperaceae) and the origin and diversification of the American species. Taxon 55 : 359–366.

Chardon CE . 1933 . Life Zones in the Andes of Venezuela. Bulletin of the Pan American Union 67 : 620.

Chaves JA, Hidalgo JR, Klicka J . 2013 . Biogeography and evolutionary history of the Neotropical genus Saltator (Aves: Thraupini). Journal of Biogeography 40 : 2180–2190.

Cleef AM . 1979 . The phytogeographical position of the neotropical vascular paramo flora with special reference to the Colombian Cordillera Oriental. In: Tropical Botany. Academic Press, 175–184. 21

Colwell RK, Brehm G, Cardelús CL, Gilman AC, Longino JT . 2008 . Global Warming, Elevational Range Shifts, and Lowland Biotic Attrition in the Wet Tropics. Science 322 : 258–261.

Cosacov A, Sérsic AN, Sosa V, De-Nova JA, Nylinder S, Cocucci AA . 2009 . New insights into the phylogenetic relationships, character evolution, and phytogeographic patterns of Calceolaria (Calceolariaceae). American Journal of Botany 96 : 2240–2255.

Cosacov A, Sérsic AN, Sosa V, Johnson LA, Cocucci AA . 2010 . Multiple periglacial refugia in the Patagonian steppe and post-glacial colonization of the Andes: the phylogeography of Calceolaria polyrhiza . Journal of Biogeography 37 : 1463–1477.

Cuatrecasas J . 1934 . Observaciones geobotanicas en Colombia. Trabajos del Museos Nacional de Ciencias Naturales 27 : 1–144.

Darwin C . 1909 . The voyage of the Beagle . New York: P. F. Collier & Son.

Diazgranados M, Barber JC . 2017 . Geography shapes the phylogeny of frailejones (Espeletiinae Cuatrec., Asteraceae): a remarkable example of recent rapid radiation in sky islands. PeerJ 5: e2968.

Doan TM . 2003 . A south-to-north biogeographic hypothesis for Andean speciation: evidence from the lizard genus Proctoporus (Reptilia, Gymnophthalmidae). Journal of Biogeography 30 : 361–374.

Doan TM, Castoe TA . 2005 . Phylogenetic taxonomy of the Cercosaurini (Squamata: Gymnophthalmidae), with new genera for species of Neusticurus and Proctoporus . Zoological Journal of the Linnean Society 143 : 405–416.

Donoghue MJ . 2008 . A phylogenetic perspective on the distribution of plant diversity. Proceedings of the National Academy of Sciences 105 : 11549–11555.

DuBay SG, Witt CC . 2012 . An improved phylogeny of the Andean tit-tyrants (Aves, Tyrannidae): More characters trump sophisticated analyses. Molecular Phylogenetics and Evolution 64 : 285–296.

Edwards EJ, Donoghue MJ . 2013 . Is it easy to move and easy to evolve? Evolutionary accessibility and adaptation. Journal of Experimental Botany 64 : 4047–4052.

Emadzade K, Lehnebach C, Lockhart P, Hörandl E . 2010 . A molecular phylogeny, morphology and classification of genera of Ranunculeae (Ranunculaceae). Taxon 59 : 809–828.

Emshwiller E . 2002 . Biogeography of the Oxalis tuberosa Alliance. The Botanical Review 68 : 128–152.

Feodorova TA, Voznesenskaya EV, Edwards GE, Roalson EH . 2010 . Biogeographic Patterns of Diversification and the Origins of C4 in Cleome (Cleomaceae). Systematic Botany 35 : 811–826.

Field AR, Testo W, Bostock PD, Holtum JAM, Waycott M . 2016 . Molecular phylogenetics and the morphology of the Lycopodiaceae subfamily Huperzioideae supports three genera: Huperzia , Phlegmariurus and Phylloglossum . Molecular Phylogenetics and Evolution 94 : 635–657.

Frisch W, Meschede M, Sick M . 1992 . Origin of the Central American ophiolites: Evidence from paleomagnetic results. GSA Bulletin 104 : 1301–1314.

Funk WC, Caminer M, Ron SR . 2011 . High levels of cryptic species diversity uncovered in Amazonian frogs. Proc. R. Soc. B : rspb20111653.

García-Casco A, Iturralde-Vinent MA, Pindell J . 2008 . Latest Cretaceous Collision/Accretion between the Caribbean Plate and Caribeana: Origin of Metamorphic Terranes in the Greater Antilles. International Geology Review 50 : 781–809.

Garzione CN, Hoke GD, Libarkin JC, Withers S, MacFadden B, Eiler J, Ghosh P, Mulch A . 2008 . Rise of the Andes. Science 320 : 1304–1307.

Gentry AH . 1982 . Neotropical Floristic Diversity: Phytogeographical Connections Between Central and South America, Pleistocene Climatic Fluctuations, or an Accident of the Andean Orogeny? Annals of the Missouri Botanical Garden 69 : 557–593.

Giarla TC, Jansa SA . 2015 . The impact of Quaternary climate oscillations on divergence times and historical population sizes in Thylamys opossums from the Andes. Molecular Ecology 24 : 2495–2506.

Gill BA, Kondratieff BC, Casner KL, Encalada AC, Flecker AS, Gannon DG, Ghalambor CK, Guayasamin JM, Poff NL, Simmons MP, et al. 2016 . Cryptic species diversity reveals biogeographic support for the ‘mountain passes are higher in the tropics’ hypothesis. Proc. R. Soc. B 283 : 20160553.

Giraldo N, Salazar C, Jiggins CD, Bermingham E, Linares M . 2008 . Two sisters in the same dress: Heliconius cryptic species. BMC Evolutionary Biology 8: 324.

Goicoechea N, Padial JM, Chaparro JC, Castroviejo-Fisher S, De la Riva I . 2012 . Molecular phylogenetics, species diversity, and biogeography of the Andean lizards of the genus Proctoporus (Squamata: Gymnophthalmidae). Molecular Phylogenetics and Evolution 65 : 953–964.

Gómez A, Berrío JC, Hooghiemstra H, Becerra M, Marchant R . 2007 . A Holocene pollen record of vegetation change and human impact from Pantano de Vargas, an intra- Andean basin of Duitama, Colombia. Review of Palaeobotany and Palynology 145 : 143– 157.

Graham A . 2009 . The Andes: a geological overview from a biological perspective. Annals of the Missouri Botanical Garden 96 : 371–385.

Graham A, Gregory-Wodzicki KM, Wright KL . 2001 . Studies in Neotropical Paleobotany. XV. A Mio-Pliocene palynoflora from the Eastern Cordillera, Bolivia: implications for the uplift history of the Central Andes. American Journal of Botany 88 : 1545–1557.

Gregory-Wodzicki KM . 2000 . Uplift history of the Central and Northern Andes: A review. GSA Bulletin 112 : 1091–1105.

Guarnizo CE, Paz A, Muñoz-Ortiz A, Flechas SV, Méndez-Narváez J, Crawford AJ . 2015 . DNA Barcoding Survey of Anurans across the Eastern Cordillera of Colombia and the Impact of the Andes on Cryptic Diversity. PLOS ONE 10 : e0127312. von Hagen KB, Kadereit JW . 2001 . The phylogeny of Gentianella (Gentianaceae) and its colonization of the southern hemisphere as revealed by nuclear and chloroplast DNA sequence variation. Organisms Diversity & Evolution 1: 61–79. von Hagen KB, Kadereit JW, Williams CF . 2003 . The diversification of Halenia (Gentianaceae): ecological opportunity versus key innovation. Evolution 57 : 2507–2518. van der Hammen T . 1989 . History of the montane forests of the northern Andes. In: Woody plants — evolution and distribution since the Tertiary. Springer, Vienna, 109– 114.

Hartley A . 2003 . Andean uplift and climate change. Journal of the Geological Society 160 : 7–10.

Hooghiemstra H, van der Hammen T . 2004 . Quaternary Ice-Age dynamics in the Colombian Andes: developing an understanding of our legacy. Philosophical Transactions of the Royal Society of London B: Biological Sciences 359 : 173–181.

Hooghiemstra H, Wijninga VM, Cleef AM . 2006 . The paleobotanical record of Colombia: implications for biogeography and biodiversity. Annals of the Missouri Botanical Garden 93 : 297–325.

Hoorn C, Wesselingh FP, Steege H, Bermudez MA, Mora A, Sevink J, Sanmartín I, Sanchez-Meseguer A, Anderson CL, Figueiredo JP, et al. 2010 . Amazonia Through Time: Andean Uplift, Climate Change, Landscape Evolution, and Biodiversity. Science 330 : 927–931. 24

Houston J, Hartley AJ . 2003 . The central Andean west-slope rainshadow and its potential contribution to the origin of hyper-aridity in the Atacama Desert. International Journal of Climatology 23 : 1453–1464.

Hughes C, Eastwood R . 2006 . Island radiation on a continental scale: Exceptional rates of plant diversification after uplift of the Andes. Proceedings of the National Academy of Sciences 103 : 10334–10339.

Humboldt A . 1820 . Voyage aux regions equinoxiales de Nouveau Continent . Paris.

Inda LA, Segarra-Moragues JG, Müller J, Peterson PM, Catalán P . 2008 . Dated historical biogeography of the temperate Loliinae (Poaceae, Pooideae) grasses in the northern and southern hemispheres. Molecular Phylogenetics and Evolution 46 : 932–957.

Iturralde-Vinent MA, Gahagan L . 2002 . Latest Eocene to Middle Miocene Tectonic Evolution of the Caribbean: Some Principles and their Implications for Plate Tectonic Modelling. In: Caribbean Geology: Into the Third Millenium: Transactions of the Fifteenth Caribbean Geological Conference. University of the West Indies Press.

Jabaily RS, Sytsma KJ . 2010 . Phylogenetics of Puya (Bromeliaceae): Placement, major lineages, and evolution of Chilean species. American Journal of Botany 97 : 337–356.

Jabaily RS, Sytsma KJ . 2013 . Historical biogeography and life-history evolution of Andean Puya (Bromeliaceae). Botanical Journal of the Linnean Society 171 : 201–224.

Kennan L, Pindell JL . 2009 . Dextral shear, terrane accretion and basin formation in the Northern Andes: best explained by interaction with a Pacific-derived Caribbean Plate? Geological Society, London, Special Publications 328 : 487–531.

Koch M, Al-Shehbaz IA . 2002 . Molecular Data Indicate Complex Intra- and Intercontinental Differentiation of American Draba (Brassicaceae). Annals of the Missouri Botanical Garden 89 : 88–109.

Kolář F, Dušková E, Sklenář P . 2016 . Niche shifts and range expansions along cordilleras drove diversification in a high-elevation endemic plant genus in the tropical Andes. Molecular Ecology 25 : 4593–4610.

Kreier H-P, Rex M, Weising K, Kessler M, Smith AR, Schneider H . 2008 . Inferring the diversification of the epiphytic fern genus Serpocaulon (Polypodiaceae) in South America using chloroplast sequences and amplified fragment length polymorphisms. Plant Systematics and Evolution 274 : 1.

Lagomarsino LP, Antonelli A, Muchhala N, Timmermann A, Mathews S, Davis CC . 2014 . Phylogeny, classification, and fruit evolution of the species-rich Neotropical bellflowers (Campanulaceae: Lobelioideae). American Journal of Botany 101 : 2097– 2112. 25

Lagomarsino LP, Condamine FL, Antonelli A, Mulch A, Davis CC . 2016 . The abiotic and biotic drivers of rapid diversification in Andean bellflowers (Campanulaceae). New Phytologist 210 : 1430–1442.

Lonsdale P . 2005. Creation of the Cocos and Nazca plates by fission of the Farallon plate. Tectonophysics 404 : 237–264.

Lücking R, Dal-Forno M, Sikaroodi M, Gillevet PM, Bungartz F, Moncada B, Yánez-Ayabaca A, Chaves JL, Coca LF, Lawrey JD . 2014 . A single macrolichen constitutes hundreds of unrecognized species. Proceedings of the National Academy of Sciences 111 : 11091–11096.

Luebert F, Weigend M . 2014 . Phylogenetic insights into Andean plant diversification. Frontiers in Ecology and Evolution 2.

Madriñán S, Cortés AJ, Richardson JE . 2013 . Páramo is the world’s fastest evolving and coolest biodiversity hotspot. Frontiers in Genetics 4.

Magallón S, Sanderson MJ . 2001 . Absolute diversification rates in angiosperm clades. Evolution 55 : 1762–1780.

McGuire JA, Witt CC, Remsen JV, Corl A, Rabosky DL, Altshuler DL, Dudley R . 2014 . Molecular Phylogenetics and the Diversification of Hummingbirds. Current Biology 24 : 910–916.

McHenry MA, Barrington DS . 2014 . Phylogeny and biogeography of exindusiate Andean Polystichum (Dryopteridaceae). American Journal of Botany 101 : 365–375.

Miller MJ, Bermingham E, Klicka J, Escalante P, Amaral FSR do, Weir JT, Winker K . 2008 . Out of Amazonia again and again: episodic crossing of the Andes promotes diversification in a lowland forest flycatcher. Proceedings of the Royal Society of London B: Biological Sciences 275 : 1133–1142.

Mittermeier RA, Myers N, Mittermeier CG, Robles Gil P . 1999 . Hotspots: Earth’s biologically richest and most endangered terrestrial ecoregions. Hotspots: Earth’s biologically richest and most endangered terrestrial ecoregions.

Moore BR, Höhna S, May MR, Rannala B, Huelsenbeck JP . 2016 . Critically evaluating the theory and performance of Bayesian analysis of macroevolutionary mixtures. Proceedings of the National Academy of Sciences 113 : 9569–9574.

Mora A, Baby P, Roddaz M, Parra M, Brusset S, Hermoza W, Espurt N . 2009 . Tectonic History of the Andes and Sub-Andean Zones: Implications for the Development of the Amazon Drainage Basin. In: Hoorn C, Wesselingh FP, eds. Amazonia: Landscape and Species Evolution. Wiley-Blackwell Publishing Ltd., 38–60.

Moran RC, Smith AR . 2001 . Phytogeographic relationships between neotropical and African-Madagascan pteridophytes. Brittonia 53 : 304–351.

Myers N, Mittermeier RA, Mittermeier CG, Fonseca GAB da, Kent J . 2000 . Biodiversity hotspots for conservation priorities. Nature; London 403 : 853–8.

Noyes RD . 2000 . Biogeographical and evolutionary insights on Erigeron and allies (Asteraceae) from ITS sequence data. Plant Systematics and Evolution 220 : 93–114.

Øllgaard B . 1992 . Neotropical Lycopodiaceae-An Overview. Annals of the Missouri Botanical Garden 79 : 687–717.

Øllgaard B . 1995 . Neotropical Huperzia (Lycopodiaceae): distribution of species richness. In: Proceedins of the Holttum memorial pteridophyte symposium. Pteridology in perspective: pteridophyte symposium ’95. Kew, 93–100.

Pérez-Escobar OA, Gottschling M, Chomicki G, Condamine FL, Klitgård BB, Pansarin E, Gerlach G . 2017 . Andean Mountain Building Did not Preclude Dispersal of Lowland Epiphytic Orchids in the Neotropics. Scientific Reports 7.

Perret M, Chautems A, Araujo D, Onofre A, Salamin N. 2013 . Temporal and spatial origin of Gesneriaceae in the New World inferred from plastid DNA sequences. Botanical Journal of the Linnean Society 171 : 61–79.

Pirie MD, Chatrou LW, Mols JB, Erkens RHJ, Oosterhof J . 2006 . ‘Andean-centred’ genera in the short-branch clade of Annonaceae: testing biogeographical hypotheses using phylogeny reconstruction and molecular dating. Journal of Biogeography 33 : 31– 46.

PPG I . 2016 . A community-derived classification for extant lycophytes and ferns. Journal of Systematics and Evolution 54 : 563–603.

Rabosky DL . 2010 . Extinction Rates Should Not Be Estimated from Molecular Phylogenies. Evolution 64 : 1816–1824.

Rabosky DL, Mitchell JS, Chang J . 2017 . Is BAMM Flawed? Theoretical and Practical Concerns in the Analysis of Multi-Rate Diversification Models. Systematic Biology 66 : 477–498.

Rauscher JT . 2002 . Molecular phylogenetics of the Espeletia complex (Asteraceae): evidence from nrDNA ITS sequences on the closest relatives of an Andean adaptive radiation. American Journal of Botany 89 : 1074–1084.

Ribeiro V, Werneck FP, Machado RB . 2016 . Distribution dynamics of South American savanna birds in response to Quaternary climate change. Austral Ecology 41 : 768–777.

Rutter N, Coronato A, Helmens K, Rabassa J, Zárate M . 2012 . The Glacial Record of Northern South America. In: Glaciations in North and South America from the Miocene to the Last Glacial Maximum. Springer, Dordrecht, 25–34.

Sánchez-Baracaldo P . 2004 . Phylogenetics and biogeography of the neotropical fern genera Jamesonia and Eriosorus (Pteridaceae). American Journal of Botany 91 : 274–284.

Sánchez-Baracaldo P, Thomas GH . 2014 . Adaptation and Convergent Evolution within the Jamesonia -Eriosorus Complex in High-Elevation Biodiverse Andean Hotspots. PLOS ONE 9: e110618.

Sanín MJ, Kissling WD, Bacon CD, Borchsenius F, Galeano G, Svenning J-C, Olivera J, Ramírez R, Trénel P, Pintaud J-C. 2016 . The Neogene rise of the tropical Andes facilitated diversification of wax palms ( Ceroxylon : Arecaceae) through geographical colonization and climatic niche separation. Botanical Journal of the Linnean Society 182 : 303–317.

Särkinen TE, Marcelo-Peña JL, Yomona AD, Simon MF, Pennington RT, Hughes CE . 2011 . Underestimated endemic species diversity in the dry inter-Andean valley of the Río Marañón, northern Peru: An example from Mimosa (Leguminosae, Mimosoideae). Taxon 60 : 139–150.

Scheen A-C, Brochmann C, Brysting AK, Elven R, Morris A, Soltis DE, Soltis PS, Albert VA . 2004 . Northern hemisphere biogeography of Cerastium (Caryophyllaceae): insights from phylogenetic analysis of noncoding plastid nucleotide sequences. American Journal of Botany 91 : 943–952.

Schellart WP, Stegman DR, Farrington RJ, Freeman J, Moresi L . 2010 . Cenozoic Tectonics of Western North America Controlled by Evolving Width of Farallon Slab. Science 329 : 316–319.

Scherson RA, Vidal R, Sanderson MJ . 2008 . Phylogeny, biogeography, and rates of diversification of New World Astragalus (Leguminosae) with an emphasis on South American radiations. American Journal of Botany 95 : 1030–1039.

Schulte JA, Macey JR, Espinoza RE, Larson A . 2000 . Phylogenetic relationships in the iguanid lizard genus Liolaemus : multiple origins of viviparous reproduction and evidence for recurring Andean vicariance and dispersal. Biological Journal of the Linnean Society 69 : 75–102.

Sedano RE, Burns KJ . 2010 . Are the Northern Andes a species pump for Neotropical birds? Phylogenetics and biogeography of a clade of Neotropical tanagers (Aves: Thraupini). Journal of Biogeography 37 : 325–343.

Sigloch K, Mihalynuk MG . 2013 . Intra-oceanic subduction shaped the assembly of Cordilleran North America. Nature; London 496 : 50–6. 28

Simpson BB . 1975 . Pleistocene changes in the flora of the high tropical Andes. Paleobiology 1: 273–294.

Simpson B . 1983 . An historical phytogeography of the high Andean flora. Revista Chilena de Historia Natural 56 : 109–122.

Sklenář P, Dušková E, Balslev H . 2011 . Tropical and Temperate: Evolutionary History of Páramo Flora. The Botanical Review 77 : 71–108.

Smith JMB . 1975 . Mountain Grasslands of New Guinea. Journal of Biogeography 2: 27–44.

Smith JMB, Cleef AM . 1988 . Composition and Origins of the World’s Tropicalpine Floras. Journal of Biogeography 15 : 631–645.

Smith AR, Kreier H-P, Haufler CH, Ranker TA, Schneider H . 2006 . Serpocaulon (Polypodiaceae), a new genus segregated from Polypodium. Taxon 55 : 919–930B.

Smith BT, McCormack JE, Cuervo AM, Hickerson MJ, Aleixo A, Cadena CD, Perez-Eman J, Burney CW, Xie X, Harvey MG, et al. 2014 . The drivers of tropical speciation. Nature 515 : 406–406.

Swenson JJ, Young BE, Beck S, Comer P, Córdova JH, Dyson J, Embert D, Encarnación F, Ferreira W, Franke I, et al. 2012 . Plant and animal endemism in the eastern Andean slope: challenges to conservation. BMC Ecology 12 : 1.

Torres-Carvajal O, Lobos SE, Venegas PJ, Chávez G, Aguirre-Peñafiel V, Zurita D, Echevarría LY . 2016 . Phylogeny and biogeography of the most diverse clade of South American gymnophthalmid lizards (Squamata, Gymnophthalmidae, Cercosaurinae). Molecular Phylogenetics and Evolution 99 : 63–75.

Torres-Carvajal O, Schulte JA, Cadle JE . 2006 . Phylogenetic relationships of South American lizards of the genus Stenocercus (Squamata: Iguania): A new approach using a general mixture model for gene sequence data. Molecular Phylogenetics and Evolution 39 : 171–185.

Van der Hammen T . 1974 . The Pleistocene Changes of Vegetation and Climate in Tropical South America. Journal of Biogeography 1: 3–26.

Van der Hammen T, Werner JH, van Dommelen H . 1973 . Palynological record of the upheaval of the Northern Andes: A study of the pliocene and lower quaternary of the Colombian Eastern Cordillera and the early evolution of its high-Andean biota. Review of Palaeobotany and Palynology 16 : 1–122.

Vásquez DLA, Balslev H, Hansen MM, Sklenář P, Romoleroux K . 2016 . Low genetic variation and high differentiation across sky island populations of Lupinus alopecuroides (Fabaceae) in the northern Andes. Alpine Botany 126 : 135–142.

Villota A, León-Yánez S, Behling H . 2012. Vegetation and environmental dynamics in the Páramo of Jimbura region in the southeastern Ecuadorian Andes during the late Quaternary. Journal of South American Earth Sciences 40 : 85–93.

Wallace AR . 1853 . A narrative of travels on the Amazon and Rio Negro . New York.

CHAPTER 2: DIVERGENCE TIMES AND HISTORICAL BIOGEOGRAPHY OF THE LYCOPODIACEAE

INTRODUCTION

Comprising three extant families (Isoetaceae, Lycopodiaceae, and Selaginellaceae) the lycophytes hold an important phylogenetic position sister to all other vascular plants

(Wickett et al., 2014). This ancient lineage had its origins in the Silurian (Garratt et al.,

1984; Rickards, 2000) and dominated Earth’s ecosystems through the Carboniferous

(DiMichele et al., 2001). Though modern lycophytes’ diversity and ecological prominence pale in comparison to their Paleozoic relatives and they are today overshadowed by seed plants and ferns, understanding the evolutionary history of the group is important because it provides insight into the timing and patterns of early land plant diversification. Recent studies have examined the divergence timing and historical biogeography of the Isoetaceae (Pereira et al., 2017) and Selaginellaceae (Klaus et al.,

2016; Weststrand, 2016); however, the only dated phylogeny of the Lycopodiaceae

(Wikström and Kenrick, 2001) was published more than 15 years ago and did not include a biogeographical analysis.

Though the Wikström and Kenrick study was an important early application of divergence time estimation and has provided insight into the timing of lycophyte diversification, it does have significant limitations. First, fewer than 10% of described

Lycopodiaceae species were included in the phylogeny. Sparse taxon sampling can lead to biased divergence time estimates (Linder et al., 2005; Renner, 2005; Duchȇne et al.,

2014; Zheng and Wiens, 2015), especially in the absence of abundant fossils for node 31 calibration, as is the case in the Lycopodiaceae. The potential effects of this limitation on the divergence time estimates of Wikström and Kenrick (2001) are likely significant, as the divergence timing analysis used in that study—penalized likelihood—is particularly sensitive to taxon sampling biases (Linder et al., 2005). Further, the phylogeny of

Wikström and Kenrick (2001) was based on a single chloroplast gene, which is insufficiently variable to robustly resolve some relationships in the family and is known to have an anomalously high substitution rate in the Selaginellaceae, one of the sister groups of the Lycopodiaceae. Among-lineage substitution rate heterogeneity poses a significant challenge to divergence time estimation, especially when models that assume some sort of a molecular clock are used (Sanderson, 1997; Welch and Bromham, 2005;

Drummond and Suchard, 2010). Since the Wikström and Kenrick study was published, methods that explicitly permit among-lineage rate heterogeneity have been developed

(Renner, 2005; Drummond et al., 2006; Drummond and Rambaut, 2007; Drummond and

Suchard, 2010); these have provided markedly different estimates of divergence times in numerous clades of organisms (Douzery et al., 2004; Bell et al., 2010; Smith et al., 2010;

Magallón et al., 2015; Testo and Sundue, 2016). Given the demonstrated high rates of substitution in Selaginella and evidence from molecular branch lengths of similarly elevated rates in some taxa in the Lycopodiaceae itself, we expect that more sophisticated dating analyses will improve estimates of divergence times in the Lycopodiaceae.

The aim of this paper is to infer the evolutionary history of the Lycopodiaceae with improved marker and taxon sampling and more sophisticated analyses than were available to Wikström and Kenrick (2001). We increase sampling within the

Lycopodiaceae to greater than 50% of the family’s diversity, use sequence data from six chloroplast markers, and incorporate eight fossil calibrations to construct our phylogeny and infer divergence times. To understand and mitigate the effects of among-lineage rate heterogeneity on our age estimates, we carry out model comparison between two relaxed molecular clock models implemented in BEAST—an uncorrelated lognormal clock and a random local clock—and compare date estimates obtained using each method. Finally, to place the diversification of the Lycopodiaceae within the context of Earth’s complex geologic and geographic history and to infer the relative roles of vicariance and long- distance dispersal in shaping the modern distribution of the family, the historical biogeography of the family was inferred.

MATERIALS AND METHODS

Taxon sampling

Ingroup sampling included a total of 199 taxa, representing all 16 Lycopodiaceae genera

(PPG I, 2016). In some cases, multiple accessions of a given named taxon were included when that species was known to be polyphyletic and comprising multiple cryptic species.

Outgroups were selected from the sister families Selaginellaceae and Isoetaceae, as well as representatives of the other major land plant lineages; representatives of outgroups were selected with a focus on capturing the deepest divergences in their corresponding clade.

DNA extraction, PCR, and sequencing

Total genomic DNA was extracted from silica-dried leaf material or herbarium specimens using a standard CTAB extraction protocol (Doyle and Doyle, 1987). PCR was performed in 25µL mixtures of 12.5 µL Bullseye Taq mix (MIDSCI, St. Louis), 9

µL water, 1.25 µL each of 10mM forward and reverse primers, and 1 µL of 10–20 ng×µL -1 DNA. Six regions of chloroplast DNA ( rbcL, psbA -trnH , rps4 -trnS , trnL , trnL - trnF , and trnP -petG IGS) were amplified; amplification primers and reaction conditions are provided in Table 1. PCR products were purified using shrimp alkaline phosphatase and subsequently diluted to 2 ng×µL -1. DNA sequencing was performed in both forward and reverse directions using BigDye chemistry on an ABI 3730xl DNA analyzer at

Genewiz, South Plainfield, New Jersey, USA. Sequences were assembled in Geneious

10.0.3 (Biomatters, Ltd.) and were visually inspected and manually edited as needed.

Specimen voucher information and GenBank accession numbers are provided in

Appendix 1.

Divergence time analyses

Sequences for each region were aligned using the MAFFT (Katoh et al., 2002) plugin in

Geneious. We used jModelTest 2 (Darriba et al., 2012) on each marker partition to identify best-fitting substitution models for downstream phylogenetic analyses (Table 1).

To facilitate computation, we generated a starting tree for all divergence time estimation

(DTE) analyses using a Maximum Likelihood (ML) approach implemented in RAxML

8.2.10 (Stamatakis 2006; 2014) implemented in the Cipres Science Gateway portal

(Miller et al. (2010). To generate the starting tree, the GTR+Γ substitution model was 34 employed across all partitions following the suggestion of Stamatakis (2006), and the monophyly of seed plants, ferns, and lycophytes was enforced. The resulting best tree was retained for use in subsequent analyses.

We performed all DTE analyses in BEAST 2.4.5, using the Cipres Science Gateway portal (Miller et al. (2010). For all analyses, the matrix was partitioned by marker, and substitution models were assigned to each partition following from the results of our model test analysis. Because of a priori evidence of significant rate heterogeneity both between the Lycopodiaceae and its sister family Selaginellaceae as well as within the

Lycopodiaceae itself, special care was taken to consider the effect of molecular clock models on DTE. We compared the performance of two molecular clock models: an uncorrelated lognormal clock (UCLN) model (Drummond et al., 2006), in which different rates are assigned to each branch from a lognormal distribution of values, and a random local clock (RLC) model (Drummond and Suchard, 2010), which allows for a set of distinct substitution rate regimes to be applied locally across a phylogeny. The UCLN model allows for substitution rates for each branch in the phylogeny to be drawn from a single unimodal prior distribution, whereas the RLC model works by proposing and comparing various regimes of local strict clocks; each of these clocks can arise along any branch in the phylogeny and are applied to a set of descendent branches. Evidence from both real and simulated datasets suggests that RLC models outperform UCLN models when sudden shifts in substitution rates occur across a phylogeny (Dornburg et al., 2011;

Crisp et al., 2014), but it may be a poor fit in cases where rate variation is not punctuated along the phylogeny.

For all analyses, a birth-death tree prior was selected with a uniform prior from 0–10 for speciation rate and 0–1 for relative extinction rate, and with starting values of 1.0 for speciation and 0.5 for relative extinction rates. For each analysis, we performed three separate MCMC runs of 100 million generations and sampled every 40,000 generations, resulting in 2500 trees per run and 7500 trees in total. The resulting log files were inspected for convergence and adequate sampling using Tracer 1.6 (Drummond and

Rambaut, 2007); effective sample sizes all exceeded 200 and the first 20% of trees were discarded as burn-in. A majority rule consensus tree was generated from the remaining

6000 trees. The fit of alternative clock models was compared by performing path sampling analyses (Baele et al., 2012; 2013) and calculating Bayes factors.

A node-dating approach incorporating eight fossils was used to calibrate the timing of divergences across the land plant phylogeny. To constrain the MRCA of land plants, we took a conservative approach and assigned a uniform distribution from 472–444 MYA, bridging the span of time between the oldest likely land plant fossils (cryptospores from the Middle Ordovician of Argentina; Rubinstein et al., 2010) and the oldest fossils of certain affinity to the embryophyte lineage (trilete spores from the Silurian in Sweden,

Steemans et al., 2009). All other fossil calibrations were provided lognormal prior distributions defined by µ=3 and σ=1 and with the lower bound equal to the age of the fossil. The node marking the divergence of lycophytes and euphyllophytes was constrained at a minimum age of 420 MYA based on the lycophyte Baragwanathia longifolia , which dates to the Upper Silurian (Garratt and Rickards, 1987; Hueber, 1992).

The node marking the divergence of heterosporous and homosporous lycophytes was

36 constrained to a minimum age of 385 MYA, based on Leclerqia complexa , which belongs to the stem lineage subtending Selaginellaceae and Isoetaceae (Meyer-Berthaud et al., 2003). The crown node of the Selaginellaceae was given a minimum age of 311

MYA, based on Selaginella suissei , which dates to the mid-Pennsylvanian and clearly belongs to the Selaginellaceae (Thomas, 1997). The euphyllophyte crown node was assigned a minimum age of 385 MYA based on Ibyka , dating to the Middle Devonian

(Skog and Banks, 1973) which has affinities to the fern lineage (Kenrick and Crane,

1997). The divergence of the Equisetales from the remainder of the ferns was given a minimum age of 346 MYA, based on the occurrence of Equisetalean Archaeocalamites in the Lower Carboniferous (Bateman, 1991). The crown node of leptosporangiate ferns was constrained at a minimum of 299 MYA, based on Grammatopteris , which belongs to

Osmundales (Skog, 2001). The seed plant crown node was given a minimum age of 323

MYA, corresponding to the occurrence of Cordaitalean fossils from near the Lower-

Upper Carboniferous boundary, which are interpreted as members of an early divergent gymnosperm lineage, following Crane (1985).

Ancestral range estimation

We inferred the biogeographic history of the Lycopodiaceae using the R package

BioGeoBEARS (Matzke, 2013) using a dispersal-extinction-cladogenesis (DEC) model

(Ree and Smith, 2008) on the maximum credibility tree from our DTE analysis. We ran the analysis with two variants of the DEC model, one with and one without the “jump” parameter ( j) of Matzke (2014); these models were compared using a log-likelihood ratio 37 test, and the better-fitting model was selected. Species distributions were determined through examination of floras (Wagner and Beitel, 1993; Ollgaard, 1995; Mickel and

Smith, 2004; Wu et al., 2013), taxonomic treatments (Ollgaard, 1992), and examination of herbarium specimens. Nine biogeographic areas were included in the analysis: North

America, Central and tropical South America, southeastern Brazil, temperate South

America, Eurasia, Africa and Madagascar, Eastern Asia, Southeast Asia, and Oceania.

We did not impose any limits on the maximum number of areas that could be occupied by a given taxon, and all combinations of areas were allowed, as one extant species,

Lycopodium clavatum , occupies all of them. To account for change in geographic proximity of landmasses over time, we incorporated four different dispersal probability matrices in our analysis, with each corresponding to non-overlapping periods of time.

The time periods were defined as follows: 0–50 MYA, 50–100 MYA, 100–200 MYA, and more than 200 MYA; these time slices were chosen to reflect major motifs of continental drift, including the disintegration of Pangaea, the subsequent separation of both Laurasia and Gondwana, and the gradual shift of the resulting continents to their current positions.

RESULTS

Divergence time estimation

Our best ML tree had a -lnL of -17097.56 and recovered phylogenetic relationships generally concordant with those previously reported within the Lycopodiaceae and within other major lineages. Relationships among major land plant lineages were also consistent with those recovered in recent large-scale analyses (Magallón et al., 2013; Wickett et al.,

2014; Testo and Sundue, 2016). BEAST analyses generally recovered strong support for most backbone nodes in the phylogeny, though support for some relationships among recently diverged lineages in the Lycopodiaceae were weak. Path sampling analyses indicated that the best-fitting clock model was the RLC (ΔlnL = 70.06, BF = 13.7) , and we recovered three distinct substitution rate regimes across the Lycopodiaceae, with mean regime rates ranging from 1.3×10 -3 in Palhinhaea to 2.1×10 -4 in Phlegmariurus .

Apart from the background rate regime of the family, distinct elevated rate regimes were found in subfamily Lycopodielloideae and in Phylloglossum .

Divergence date estimates were different under the RLC and UCLN models (Figs. 1, 2).

Dates obtained with the RLC model were generally older and had broader confidence intervals, whereas the UCLN model tended to provide the younger ages and the narrower confidence intervals. Major differences in clade age estimates between these models were most evident for the crown age of the Lycopodiaceae, (mean age of 368.4 MYA under the RLC model and 308.8 MYA under the UCLN model) and within the subfamily

Huperzioideae. The estimates generated from the best-fitting (RLC) clock model indicate that lycophytes diverged from the euphyllophyte lineage 431.5 MYA [95% HPD 426–

440 MYA], that the homosporous and heterosporous lycophyte lineages diverged 403.3

MYA [95% HPD 394–414 MYA], and that the crown age of the Lycopodiaceae was

368.4 MYA [95% HPD 326–389 MYA]. Within the Lycopodiaceae, the mean estimate of the crown age of subfamily Huperzioideae is 199.5 MYA [95% HPD 175–223 MYA], and the divergence of subfamilies Lycopodioideae and Lycopodielloideae is estimated to have occurred at 293.6 MYA [95% HPD 262–320 MYA]. Divergence time estimates for

39 genera range from 210.4 MYA [95% HPD 202–236 MYA] for the split of

Lycopodiastrum from the rest of subfamily Lycopodioideae to 53.1 MYA [95% HPD 35–

65.5 MYA] for the divergence between Austrolycopodium and Pseudodiphasium .

Ancestral range estimation

Comparison of the DEC and DEC + j models implemented in BioGeoBEARS indicated that inclusion of the j parameter resulted in a more likely model (DEC lnL= -447.02,

DEC + j lnL= -429.03, Δ=35.98, P=0.023). Results obtained with the DEC + j model indicate that the most likely ancestral range of the Lycopodiaceae was North America +

Eurasia + East Asia + Oceania, that the ancestral range of subfamilies Lycopodioideae and Lycopodielloideae was Oceania, and that of subfamily Huperzioideae was East Asia

+ Oceania. Within the Lycopodioideae, most lineages are widespread in the north temperate region, though a clade comprising Pseudolycopodium, Pseudodiphasium, and

Austrolycopodium diversified in Oceania, with a subsequent long-distance dispersal event in Austrolycopodium to southern South America. Subfamily Lycopodielloideae appears to have radiated out of Oceania in the late Mesozoic, with a generally north temperate affinity among Lycopodiella and tropical/austral distributions in Lateristachys ,

Palhinhaea , and Pseudolycopodiella . In the Huperzioideae, we recover an ancestral range of Australasia for Phylloglossum , East Asia + tropical Asia for Huperzia , and Neotropics

+ East Asia + Africa + tropical Asia + Oceania for Phlegmariurus. Several recent long- distance dispersal events between austral regions in Huperzia were recovered, and many species are shared between North America and East Asia. In Phlegmariurus , the divergence of its two principal clades into the Neotropics and Paleotropics likely

40 occurred during the lower Cretaceous (102 MYA); several subsequent long-distance dispersal events and inferred to have occurred between these regions.

DISCUSSION

Substitution rate heterogeneity and clock model effects

We found evidence for two shifts in nucleotide substitution rate across the

Lycopodiaceae, corresponding to the subfamily Lycopodielloideae and Phylloglossum .

The shifts in substitution rate observed in these groups appear to be related to a transition in growth strategy, as both taxa are characterized by rapid life cycles in comparison to other members of the family. In particular, members of the subfamily Lycopodielloideae and Phylloglossum possess surficial, photosynthetic gametophytes that are fast-growing in comparison to the subterranean gametophytes found in other members of the family.

Though elevated rates of substitution are known to occur in groups with fast generation times in plants (Gaut et al., 1992; Clegg et al., 1994; Lanfear et al., 2013), this is the first evidence demonstrating coordinated shifts in substitution rates and gametophyte ecology.

As gametophyte growth rates and reproductive biology vary dramatically across both lycophytes (Bruce, 1976; Whittier, 1998) and ferns (Nayar and Kaur, 1971; Whittier,

1981; Raghavan, 1989; Haufler et al., 2016; Sessa et al., 2016), this finding has important implications for understanding the variation in rates of molecular evolution observed across these clades of taxa with independent gametophyte life phases. Further study of the correlation of gametophyte longevity and nucleotide substitution rates is needed, but this effect may explain the patterns of anomalous substitution rates in some fern genera 41 with either fast- (e.g., Ceratopteris ) or slow-growing (e.g., Botrychium , Ophioglossum ) gametophytes.

We demonstrate a significant effect of clock model on estimates of divergence times in the Lycopodiaceae (Figs. 1, 2), with the RLC model outperforming the UCLN model.

Better performance of a RLC model is consistent with findings from other groups that include lineages in which punctuated shifts in molecular evolution rates are known, such as the monocot family Xanthorrhoeaceae (Crisp et al. 2014) and cetaceans (Dornburg et al. 2011). Moreover, the accuracy of dates generated using the UCLN model appears to be poor in regions of the tree that lack a nearby fossil calibration (Fig. 2). Given the strong effect of clock model on divergence time estimates reported here and in other studies (Dornburg et al., 2011; Werthheim, 2012; Crisp et al., 2014; Beaulieu et al.,

2015), researchers should be cognizant of potentially misleading inferences of divergence times stemming from ill-fitting clock models, especially if their study group presents a priori evidence for among-lineage rate heterogeneity.

Divergence time estimates

Considering estimates obtained from the RLC model, our divergence time estimates for the Lycopodiaceae are generally more recent than those reported by Wikström and

Kenrick (2001), though our estimates for the initial divergences in the family are similar.

Congruence of our estimates and those of Wikström and Kenrick (2001) with respect to deep divergences may be primarily a function of similar fossil calibrations constraining the backbone of both phylogenies; the influence of fossil calibration choice on age estimates deep in the land plant phylogeny has been demonstrated previously (Magallón 42 and Sanderson, 2005; Yang and Rannala, 2006; Magallón et al., 2013). Among internal nodes of the Lycopodiaceae, which were uncalibrated by Wikström and Kenrick (2001) and constrained only at a single node in our phylogeny, our dates diverge more conspicuously, though direct comparisons are difficult to make due to much denser taxon sampling in our study. Considering the crown ages for major clades that were well- sampled in both studies, we report considerably (ca. 50–90 MY) younger ages for all three subfamilies and most genera. These differences appear to be driven by the dramatic acceleration of substitution rates found in subfamily Lycopodielloideae and

Phylloglossum , given that major among-lineage heterogeneity in rates of molecular evolution can drive artificially old age estimates under relaxed clock models (Beaulieu et al., 2015).

We place the divergence of the homosporous and heterosporous lycophyes during the early Devonian (median age = 403 MYA). This age estimate is consistent with the hypothesis of a relatively rapid diversification of the major embryophyte lineages over approximately 50-75 million years after the initial colonization of land by plants, which is corroborated both by fossil (Kenrick and Crane, 1997; Crane et al., 2004) and molecular phylogenetic (Bateman et al., 1998; Finet et al., 2010; Magallón et al., 2013; Testo and

Sundue, 2016) evidence. Consistent with the findings of Wikström and Kenrick (2001), our estimates of the divergences among subfamilies of the Lycopodiaceae date to the

Carboniferous and Permian, indicating that the initial diversification of the family was underway well before the initial breakup of Pangaea at approximately 175 MYA. The divergence of the three ecologically disparate genera comprising the Huperzioideae

(Huperzia , Phlegmariurus , and Phylloglossum ) coincided with the breakup of Pangaea, with these three lineages splitting during the lower to middle Triassic. A critical innovation that appears to have been attained during this initial burst of lineage diversification and specialization within the Lycopodiaceae is the evolution of epiphytism in Phlegmariurus , which several analyses have indicated to be the ancestral growth habit of the genus (Field et al., 2016). Assuming that epiphytism evolved in Phlegmariurus coincidentally with the divergence of the genus from the Huperzia /Phylloglossum lineage or shortly thereafter, this marks one of the earliest transitions to epiphytic growth known among vascular plants, and the earliest known record from an extant genus. Other early epiphytes, such as the ophioglossalean fern Botryopteris , grew as trunk epiphytes on

Marattiealean tree ferns (Rothwell, 1991); the earliest epiphytic Phlegmariurus may have exhibited a similar growth strategy. Given that vascular epiphytes were rare until the late

Cretaceous (Benzing, 1990; Taylor et al., 2009; Schuettpelz and Pryer, 2009; Watkins and Cardelús, 2012), the early radiation into and persisting success in the epiphytic niche by Phlegmariurus is remarkable. Altogether, it appears that the early divergence events in the Lycopodiaceae correspond to a partitioning of ecological strategies among the different subfamilies and genera of subfamily Huperzioideae; much of the family’s functional diversity appears to have been attained early in its evolutionary history.

Though the initial diversification of the family occurred during the Carboniferous and

Permian, much of the family’s generic and species richness accumulated considerably later. Apart from the early divergences in subfamily Huperzioideae and the establishment of some depauperon lineages (Donoghue and Sanderson, 2015) such as Lycopodiastrum

44 and Phylloglossum by the upper Triassic , most groups diversified primarily during the

Cretaceous and Cenozoic, coincident with the rise of modern fern (Schneider et al., 2004;

Schuettpelz and Pryer, 2009; Testo and Sundue, 2016; Lehtonen et al., 2017), gymnosperm (Won et al., 2006; Nagalingum et al., 2011; Condamine et al., 2015; Saladin et al., 2017), and angiosperm (Xi et al., 2012; Magallón et al., 2013) lineages. The rapid diversification of some of these groups, such as leptosporangiate ferns (Schneider et al.,

2004; Schuettpelz and Pryer, 2009; Watkins and Cardelús, 2012) and the angiosperm order Malpighiales (Davis et al., 2005; Xi et al., 2012) is clearly closely linked to the establishment of angiosperm-dominated rainforests by the early Cretaceous; this appears to be the case for some tropical and subtropical genera such as Phlegmariurus ,

Palhinhaea , and Pseudodiphasium , but not for other groups, such as Huperzia ,

Diphasiastrum , and Diphasium , which appear to be adapted primarily to open temperate and tropical alpine habitats. Most species-level divergences are recent; occurring within the last 15 million years.

Historical biogeography

The biogeographic history of the Lycopodiaceae is complex, and ancient vicariance events appear to have played the most important role in shaping the group’s distribution

(Figs. 3, 4). The initial divergences within the family occurred while Earth’s landmasses were united in Pangaea, when these lineages most likely were widely distributed across the supercontinent. Early divergences within each subfamily correspond with the initial breakup of Pangaea into the Laurasian and Gondwanan landmasses during the early

Jurassic; distributions of extant genera in the Lycopodielloideae and Huperzioideae

45 clearly reflect this pattern (Fig. 4). The primary divergence event in the

Lycopodielloideae split Lycopodiella , which has a primarily Laurasian distribution, from the principally Gondwanan lineage comprising the genera Lateristachys , Palhinhaea , and

Pseudolycopodiella . Similarly, the divergence of the Laurasian genus Huperzia from the otherwise Gondwanan Huperzioideae is estimated to have occurred in the mid-Jurassic, while Laurasia and Gondwana were separated yet still proximate. Similar patterns of lineage splitting concordant with the Pangaean breakup have been demonstrated for numerous animal groups (Springer et al., 2003; San Mauro et al., 2005; Wildman et al.,

2007), but appear to be exceedingly rare among plants; currently, robust phylogenetic evidence for this pattern is only known from the Cupressaceae (Mao et al., 2012) and

Selaginellaceae (Klaus et al., 2016; Weststrand, 2016). In addition to providing a rare example of Pangaean vicariance in a plant family, the geographic fidelity of these deep divergences within the Lycopodiaceae is remarkable given the group’s high potential for long-distance dispersal, which some authors (Wolf et al., 2001; Vanderpoorten et al.,

2009) suggest could obscure ancient vicariance in groups of spore-dispersed plants.

The subsequent breakup of Gondwana also had an important role shaping the geographic distribution of Phlegmariurus , the most species-rich genus in the Lycopodiaceae (Fig. 4).

Phlegmariurus comprises two clades of approximately equal size—one nearly entirely

Paleotropical, the other almost entirely Neotropical—which diverged from each other an estimated 102 MYA. Our estimate of the timing of this split is much younger than the lower Cretaceous estimate (184 MYA) reported by Wikström and Kenrick (2001) and corresponds closely to the final rifting of South America and Africa (König and Jokat,

2006; Seton et al., 2012). Both clades subsequently underwent exceptional species diversification during the Cenozoic, apparently radiating in angiosperm-dominated rainforests like most leptosporangiate fern groups (Schneider et al., 2004; Schuettpelz and Pryer, 2009; Testo and Sundue, 2016). Unlike most emblematic Gondwanan seed plant (e.g., Podocarpus , Quiroga et al., 2015; Nothofagus , Swenson et al., 2001;

Proteaceae, Barker et al., 2007) and fern lineages (e.g., Cyatheaceae, Korall and Pryer,

2013; Trichomanes , Dubuisson et al., 2003; Dicksoniaceae, Noben et al., 2017), there is no evidence of migration between South America and Oceania through Antarctica (a connection that persisted until the middle Eocene; Wilf et al., 2013) or of intercontinental long-distance dispersal leading to subsequent diversification events in Phlegmariurus .

This study confirms the finding of a recent phylogeny (Gissi, 2017) that documented the presence of an endemic clade of Brazilian species nested within the Neotropical

Phlegmariurus clade. This group is estimated to have diverged from its closest relatives approximately 37 MYA (Fig. 3), and has subsequently undergone considerable diversification in the mountains and rainforests of southeastern Brazil. Unlike the tropical

Andes, which formed primarily since the Miocene (Gregory-Wodzicki, 2000), the mountain ranges of the Brazilian Highlands were established prior to the divergence of this clade, eliminating the possibility that this clade arose following a long-distance dispersal event from the Andes, as has been documented in other plant groups (Safford,

1999; McHenry and Barrington, 2014; Luebert and Weigand, 2014). Instead, it appears that this group radiated into these habitats from adjacent lowland forests and subsequently became adapted to a diversity of available habitat types in the region.

Compared to that of vicariance, the role of long-distance dispersal in shaping the diversity and distribution of the Lycopodiaceae appears to be minor. Nonetheless, several long-distance dispersal events have important implications for understanding the evolutionary history of some genera and warrant discussion. Recent trans-Austral long- distance dispersal has occurred in both Austrolycopodium and Huperzia (Fig. 3), fitting a pattern commonly found in Austral plant groups (Richardson et al., 2004; Barker et al.,

2010; Renner et al., 2010; Noben et al., 2017). Long-distance dispersal is also responsible for both species ( Phlegmariurus saururus ) and species-pair ( Phlegmariurus phylicifolius and P. ophioglossoides ) range disjunctions between the Neotropics and southern

Africa/Madagascar, as has been reported for numerous fern and lycophyte genera by

Moran and Smith (2001). Interestingly, both P. phylicifolius (to at least 19°S) and P. saururus (to at least 31°S) have ranges that extend farther south in the Andes than most other Neotropical Phlegmariurus ; these southerly distributions may have permitted their

(or their close relatives’) dispersal to Africa via the prevailing westerly winds at south- temperate latitudes. Several long-distance dispersal events to southeastern Brazil from the

Andes have occurred since the Miocene; these dispersals did not result in subsequent radiations (Fig. 3). Long-distance dispersal certainly has played an important role in the diversification of Phlegmariurus in tropical Asia and Oceania (Field et al., 2016), but the scale of these dispersal events is too fine to be detected in our analyses, as they mostly have occurred within—rather than between—the areas defined in this study.

This study improves our understanding of the evolutionary history of the Lycopodiaceae by providing a densely sampled, time-calibrated phylogeny and inference of the family’s

48 complex biogeographic history. We demonstrate the importance of considering among- lineage rate heterogeneity when estimating lineage divergence times, and provide clade age estimates that differ considerably from previously published estimates. The

Lycopodiaceae arose during the Devonian and prominent divergence events in the family appear to be associated with major vicariance events, particularly the breakup of Pangaea and the subsequent rifting of Gondwana; most long-distance dispersal events are recent and have been of limited evolutionary consequence. Finally, though the family is ancient, most of its extant species diversity accumulated during the Cenozoic, coincident with the recent diversification of other major land plant lineages.

LITERATURE CITED

Ackerly D . 1990 . Vascular Epiphytes: General Biology and Related Biota . Cambridge, UK: Cambridge University Press.

Baele G, Lemey P, Bedford T, Rambaut A, Suchard MA, Alekseyenko AV . 2012 . Improving the Accuracy of Demographic and Molecular Clock Model Comparison While Accommodating Phylogenetic Uncertainty. Molecular Biology and Evolution 29 : 2157– 2167.

Baele G, Li WLS, Drummond AJ, Suchard MA, Lemey P . 2013 . Accurate Model Selection of Relaxed Molecular Clocks in Bayesian Phylogenetics. Molecular Biology and Evolution 30 : 239–243.

Barker NP, Weston PH, Rutschmann F, Sauquet H. 2007 . Molecular dating of the ‘Gondwanan’ plant family Proteaceae is only partially congruent with the timing of the break-up of Gondwana. Journal of Biogeography 34 : 2012–2027.

Bateman RM . 1991 . Palaeobiological and phylogenetic implications of anatomically- preserved archaeocalamites from the Dinantian of Oxroad Bay and Loch Humphrey Burn, southern Scotland. Palaeontographica Abteilung B : 1–59.

Beaulieu JM, O’Meara BC, Crane P, Donoghue MJ . 2015 . Heterogeneous Rates of Molecular Evolution and Diversification Could Explain the Triassic Age Estimate for Angiosperms. Systematic Biology 64 : 869–878.

Bruce JG . 1976 . Gametophytes and Subgeneric Concepts in Lycopodium . American Journal of Botany 63 : 919–924.

Clegg MT, Gaut BS, Learn GH, Morton BR . 1994 . Rates and patterns of chloroplast DNA evolution. Proceedings of the National Academy of Sciences 91 : 6795–6801.

Condamine FL, Nagalingum NS, Marshall CR, Morlon H . 2015 . Origin and diversification of living cycads: a cautionary tale on the impact of the branching process prior in Bayesian molecular dating. BMC Evolutionary Biology 15 : 65.

Crane PR . 1985 . Phylogenetic Relationships in Seed Plants. Cladistics 1: 329–348.

Crane PR, Herendeen P, Friis EM . 2004 . Fossils and plant phylogeny. American Journal of Botany 91 : 1683–1699.

Crisp MD, Hardy NB, Cook LG . 2014 . Clock model makes a large difference to age estimates of long-stemmed clades with no internal calibration: a test using Australian grasstrees. BMC Evolutionary Biology 14 : 263. 50

Darriba D, Taboada GL, Doallo R, Posada D . 2012 . jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: 772–772.

Davis CC, Webb CO, Wurdack KJ, Jaramillo CA, Donoghue MJ . 2005 . Explosive Radiation of Malpighiales Supports a Mid‐Cretaceous Origin of Modern Tropical Rain Forests. The American Naturalist 165 : E36–E65.

DeForest Safford H . 1999 . Brazilian Páramos I. An introduction to the physical environment and vegetation of the campos de altitude. Journal of Biogeography 26 : 693– 712.

DiMichele WA, Stein WE, Bateman RM . 2001 . Ecological Sorting of Vascular Plant Classes During the Paleozoic Evolutionary Radiation. In: Evolutionary Paleoecology: The Ecological Context of Macroevolutionary Change. Columbia University Press.

Donoghue MJ, Sanderson MJ . 2015 . Confluence, synnovation, and depauperons in plant diversification. New Phytologist 207 : 260–274.

Dornburg A, Brandley MC, McGowen MR, Near TJ . 2012 . Relaxed Clocks and Inferences of Heterogeneous Patterns of Nucleotide Substitution and Divergence Time Estimates across Whales and Dolphins (Mammalia: Cetacea). Molecular Biology and Evolution 29 : 721–736.

Douzery EJP, Snell EA, Bapteste E, Delsuc F, Philippe H . 2004 . The timing of eukaryotic evolution: Does a relaxed molecular clock reconcile proteins and fossils? Proceedings of the National Academy of Sciences of the United States of America 101 : 15386–15391.

Doyle J, Doyle J . 1987 . Genomic plant DNA preparation from fresh tissue - the CTAB method. Phytochemical Bulletin 19 : 11.

Drummond AJ, Ho SYW, Phillips MJ, Rambaut A . 2006 . Relaxed Phylogenetics and Dating with Confidence. PLOS Biology 4: e88.

Drummond AJ, Rambaut A . 2007 . BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7: 214.

Drummond AJ, Suchard MA . 2010 . Bayesian random local clocks, or one rate to rule them all. BMC Biology 8: 114.

Dubuisson J, Hennequin S, Douzery EJP, Cranfill RB, Smith AR, Pryer KM . 2003 . rbcL Phylogeny of the Fern Genus Trichomanes (Hymenophyllaceae), with Special Reference to Neotropical Taxa. International Journal of Plant Sciences 164 : 753–761.

Duchêne S, Lanfear R, Ho SYW . 2014 . The impact of calibration and clock-model choice on molecular estimates of divergence times. Molecular Phylogenetics and Evolution 78 : 277–289.

Finet C, Timme RE, Delwiche CF, Marlétaz F . 2010 . Multigene Phylogeny of the Green Lineage Reveals the Origin and Diversification of Land Plants. Current Biology 20 : 2217–2222.

Garrat MJ, Rickards RB . 1987 . Pridoli (Silurian) graptolites in association with Baragwanathia (Lycophytina). Bulletin of the Geological Society of Denmark 35 : 135– 139.

Garratt MJ, Tims JD, Rickards RB, Chambers TC, Douglas JG . 1984 . The appearance of Baragwanathia (Lycophytina) in the Silurian. Botanical Journal of the Linnean Society 89 : 355–358.

Gaut BS, Muse SV, Clark WD, Clegg MT . 1992 . Relative rates of nucleotide substitution at the rbcL locus of monocotyledonous plants. Journal of Molecular Evolution 35 : 292–303.

Gissi DS . 2017 . Phylogeny of Phlegmariurus (Lycopodiaceae) focusing on Brazilian endemic species.

Gregory-Wodzicki KM . 2000 . Uplift history of the Central and Northern Andes: A review. GSA Bulletin 112 : 1091–1105.

Haufler CH, Pryer KM, Schuettpelz E, Sessa EB, Farrar DR, Moran R, Schneller JJ, Watkins JE, Windham MD . 2016 . Sex and the Single Gametophyte: Revising the Homosporous Vascular Plant Life Cycle in Light of Contemporary Research. BioScience 66 : 928–937.

Hueber FM . 1992 . Thoughts on the Early Lycopsids and Zosterophylls. Annals of the Missouri Botanical Garden 79 : 474–499.

Katoh K, Misawa K, Kuma K, Miyata T . 2002 . MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30 : 3059–3066.

Kenrick P, Crane P . 1997 . The origin and early diversification of land plants: a cladistic study . Washington, D. C.: Smithsonian Institute Press.

Klaus KV, Schulz C, Bauer DS, Stützel T . 2017 . Historical biogeography of the ancient lycophyte genus Selaginella : early adaptation to xeric habitats on Pangea. Cladistics 33 : 469–480.

König M, Jokat W . 2006 . The Mesozoic breakup of the Weddell Sea. Journal of Geophysical Research: Solid Earth 111 : B12102.

Korall P, Pryer KM . 2014 . Global biogeography of scaly tree ferns (Cyatheaceae): evidence for Gondwanan vicariance and limited transoceanic dispersal. Journal of Biogeography 41 : 402–413.

Lanfear R, Ho SYW, Jonathan Davies T, Moles AT, Aarssen L, Swenson NG, Warman L, Zanne AE, Allen AP . 2013 . Taller plants have lower rates of molecular evolution. Nature Communications; London 4: 1879.

Lehtonen S, Silvestro D, Karger DN, Scotese C, Tuomisto H, Kessler M, Peña C, Wahlberg N, Antonelli A . 2017 . Environmentally driven extinction and opportunistic origination explain fern diversification patterns. Scientific Reports 7.

Linder HP, Hardy CR, Rutschmann F . 2005 . Taxon sampling effects in molecular clock dating: An example from the African Restionaceae. Molecular Phylogenetics and Evolution 35 : 569–582.

Luebert F, Weigend M . 2014 . Phylogenetic insights into Andean plant diversification. Frontiers in Ecology and Evolution 2.

Magallón S, Gómez-Acevedo S, Sánchez-Reyes LL, Hernández-Hernández T . 2015 . A metacalibrated time-tree documents the early rise of flowering plant phylogenetic diversity. New Phytologist 207 : 437–453.

Magallón S, Hilu KW, Quandt D . 2013 . Land plant evolutionary timeline: Gene effects are secondary to fossil constraints in relaxed clock estimation of age and substitution rates. American Journal of Botany 100 : 556–573.

Magallón SA, Sanderson MJ, Soltis P . 2005 . Angiosperm divergence times: the effect of genes, codon positions, and time constraints. Evolution 59 : 1653–1670.

Mao K, Milne RI, Zhang L, Peng Y, Liu J, Thomas P, Mill RR, Renner SS . 2012 . Distribution of living Cupressaceae reflects the breakup of Pangea. Proceedings of the National Academy of Sciences 109 : 7793–7798.

Matzke NJ . 2013 . Probabilistic Historical Biogeography: New Models for Founder- Event Speciation, Imperfect Detection, and Fossils Allow Improved Accuracy and Model-Testing.

Matzke NJ . 2014 . Model Selection in Historical Biogeography Reveals that Founder- Event Speciation Is a Crucial Process in Island Clades. Systematic Biology 63 : 951–970.

McHenry MA, Barrington DS . 2014 . Phylogeny and biogeography of exindusiate Andean Polystichum (Dryopteridaceae). American Journal of Botany 101 : 365–375.

Meyer-Berthaud B, Fairon-Demaret M, Steemans P, Talent J, Gerrienne P . 2003 . The plant Leclercqia (Lycopsida) in Gondwana: implications for reconstructing Middle Devonian palaeogeography. Geological Magazine 140 : 119–130.

Mickel J, Smith AR . 2004 . Pteridophytes of Mexico . New York Botanical Garden Press.

Miller MA, Pfeiffer W, Schwartz T . 2010 . Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: 2010 Gateway Computing Environments Workshop (GCE). 1–8.

Nagalingum NS, Marshall CR, Quental TB, Rai HS, Little DP, Mathews S . 2011 . Recent Synchronous Radiation of a Living Fossil. Science 334 : 796–799.

Nayar BK, Kaur S . 1971 . Gametophytes of homosporous ferns. The Botanical Review 37 : 295.

Noben S, Kessler M, Quandt D, Weigand A, Wicke S, Krug M, Lehnert M . Biogeography of the Gondwanan tree fern family Dicksoniaceae—A tale of vicariance, dispersal and extinction. Journal of Biogeography : 2648–2659.

Øllgaard B . 1988 . Lycopodiaceae. In: Flora of Ecuador. Gothenburg, Sweden: Botanical Institute, Goteborg University, 156.

Øllgaard B . 1989 . Index of the Lycopodiaceae . Copenhagen: Royal Danish Society of Sciences and Letters.

Øllgaard B . 1995 . Lycopodiaceae. In: Flora Mesoamericana, Vol. 1. Psilotaceae a Salviniaceae. Mexico: Universidad Nacional Autonoma de Mexico.

Pereira JBS, Labiak PH, Stützel T, Schulz C . 2017 . Origin and biogeography of the ancient genus Isoëtes with focus on the Neotropics. Botanical Journal of the Linnean Society 185 : 253–271.

PPG I . 2016 . A community-derived classification for extant lycophytes and ferns. Journal of Systematics and Evolution 54 : 563–603.

Quiroga MP, Mathiasen P, Iglesias A, Mill RR, Premoli AC . 2016 . Molecular and fossil evidence disentangle the biogeographical history of Podocarpus , a key genus in plant geography. Journal of Biogeography 43 : 372–383.

Raghavan V . 1989 . Developmental Biology of Fern Gametophytes . Cambridge University Press.

Ree RH, Smith SA, Baker A . 2008 . Maximum Likelihood Inference of Geographic Range Evolution by Dispersal, Local Extinction, and Cladogenesis. Systematic Biology 57 : 4–14.

Renner SS, Strijk JS, Strasberg D, Thébaud C . 2010 . Biogeography of the Monimiaceae (Laurales): a role for East Gondwana and long-distance dispersal, but not West Gondwana. Journal of Biogeography 37 : 1227–1238.

Richard M. Bateman, Peter R. Crane, William A. DiMichele, Paul R. Kenrick, Nick P. Rowe, Thomas Speck, Stein WE . 1998 . Early evolution of land plants: Phylogeny, Physiology, and Ecology of the Primary Terrestrial Radiation. Annual Review of Ecology and Systematics 29 : 263–292.

Richardson JE, Chatrou LW, Mols JB, Erkens RHJ, Pirie MD . 2004 . Historical biogeography of two cosmopolitan families of flowering plants: Annonaceae and Rhamnaceae. Philosophical Transactions of the Royal Society of London B: Biological Sciences 359 : 1495–1508.

Rickards RB . 2000 . The age of the earliest club mosses: the Silurian Baragwanathia flora in Victoria, Australia. Geological Magazine 137 : 207–209.

Rothwell GW . 1991 . Botryopteris forensis (Botryopteridaceae), a Trunk Epiphyte of the Tree Fern Psaronius. American Journal of Botany 78 : 782–788.

Rubinstein CV, Gerrienne P, de la Puente GS, Astini RA, Steemans P . 2010 . Early Middle Ordovician evidence for land plants in Argentina (eastern Gondwana). New Phytologist 188 : 365–369.

Saladin B, Leslie AB, Wüest RO, Litsios G, Conti E, Salamin N, Zimmermann NE . 2017 . Fossils matter: improved estimates of divergence times in Pinus reveal older diversification. BMC Evolutionary Biology 17 : 95.

San Mauro D, Vences M, Alcobendas M, Zardoya R, Meyer A . 2005 . Initial Diversification of Living Amphibians Predated the Breakup of Pangaea. The American Naturalist 165 : 590–599.

Sanderson MJ . 1997 . A Nonparametric Approach to Estimating Divergence Times in the Absence of Rate Constancy. Molecular Biology and Evolution 14 : 1218–1218.

Schneider H, Schuettpelz E, Pryer KM, Cranfill R, al et . 2004 . Ferns diversified in the shadow of angiosperms. Nature; London 428 : 553–7.

Schuettpelz E, Pryer KM . 2009 . Evidence for a Cenozoic radiation of ferns in an angiosperm-dominated canopy. Proceedings of the National Academy of Sciences 106 : 11200–11205.

Sessa EB, Testo WL, Watkins JE . 2016 . On the widespread capacity for, and functional significance of, extreme inbreeding in ferns. New Phytologist 211 : 1108–1119.

Seton M, Müller RD, Zahirovic S, Gaina C, Torsvik T, Shephard G, Talsma A, Gurnis M, Turner M, Maus S, et al. 2012 . Global continental and ocean basin reconstructions since 200Ma. Earth-Science Reviews 113 : 212–270.

Skog JE . 2001 . Biogeography of Mesozoic leptosporangiate ferns related to extant ferns. Brittonia 53 : 236–269.

Skog JE, Banks HP . 1973 . Ibyka amphikoma , Gen. et sp. n., a New Protoarticulate Precursor from the Late Middle Devonian of New York State. American Journal of Botany 60 : 366–380.

Soltis DE, Moore MJ, Burleigh JG, Bell CD, Soltis PS . 2010 . Assembling the Angiosperm Tree of Life: Progress and Future Prospects. Annals of the Missouri Botanical Garden 97 : 514–526.

Springer MS, Murphy WJ, Eizirik E, O’Brien SJ . 2003 . Placental mammal diversification and the Cretaceous–Tertiary boundary. Proceedings of the National Academy of Sciences 100 : 1056–1061.

Stamatakis A . 2006 . RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22 : 2688–2690.

Steemans P, Hérissé AL, Melvin J, Miller MA, Paris F, Verniers J, Wellman CH . 2009 . Origin and Radiation of the Earliest Vascular Land Plants. Science 324 : 353–353.

Swenson U, Hill RS, McLoughlin S . 2001 . Biogeography of Nothofagus Supports the Sequence of Gondwana Break-up. Taxon 50 : 1025–1041.

Taylor EL, Taylor TN, Krings M . 2009 . Paleobotany: The Biology and Evolution of Fossil Plants . Academic Press.

Testo W, Sundue M . 2016 . A 4000-species dataset provides new insight into the evolution of ferns. Molecular Phylogenetics and Evolution 105 : 200–211.

Thomas BA . 1997 . Upper Carboniferous herbaceous lycopsids. Review of Palaeobotany and Palynology 95 : 129–153. 56

Vanderpoorten A, Gradstein SR, Carine MA, Devos N . 2010 . The ghosts of Gondwana and Laurasia in modern liverwort distributions. Biological Reviews 85 : 471– 487.

Wagner WH, Beitel JM . 1992 . Generic Classification of Modern North American Lycopodiaceae. Annals of the Missouri Botanical Garden 79 : 676–686.

Watkins JE, Cardelús CL . 2012 . Ferns in an Angiosperm World: Cretaceous Radiation into the Epiphytic Niche and Diversification on the Forest Floor. International Journal of Plant Sciences 173 : 695–710.

Welch JJ, Bromham L . 2005 . Molecular dating when rates vary. Trends in Ecology & Evolution 20 : 320–327.

Wertheim JO, Sanderson MJ . 2011 . Estimating Diversification Rates: How Useful Are Divergence Times? Evolution 65 : 309–320.

Weststrand S . 2016 . Historical biogeography of the heterosporous Selaginellaceae : A tale of pre-Pangean diversifications, Gondwanan vicariance, and Cenozoic long-distance dispersals.

Whittier P . 1981 . Spore Germination and Young Gametophyte Development of Botrychium and Ophioglossum in Axenic Culture. American Fern Journal 71 : 13–19.

Whittier P . 1998 . Germination of Spores of the Lycopodiaceae in Axenic Culture. American Fern Journal 88 : 106–113.

Wickett NJ, Mirarab S, Nguyen N, Warnow T, Carpenter E, Matasci N, Ayyampalayam S, Barker MS, Burleigh JG, Gitzendanner MA, et al. 2014 . Phylotranscriptomic analysis of the origin and early diversification of land plants. Proceedings of the National Academy of Sciences 111 : E4859–E4868.

Wikström N, Kenrick P . 2001 . Evolution of Lycopodiaceae (Lycopsida): Estimating Divergence Times from rbcL Gene Sequences by Use of Nonparametric Rate Smoothing. Molecular Phylogenetics and Evolution 19 : 177–186.

Wildman DE, Uddin M, Opazo JC, Liu G, Lefort V, Guindon S, Gascuel O, Grossman LI, Romero R, Goodman M . 2007 . Genomics, biogeography, and the diversification of placental mammals. Proceedings of the National Academy of Sciences 104 : 14395–14400.

Wilf P, Cúneo NR, Escapa IH, Pol D, Woodburne MO . 2013 . Splendid and Seldom Isolated: The Paleobiogeography of Patagonia. Annual Review of Earth and Planetary Sciences 41 : 561–603.

Wolf PG, Schneider H, Ranker TA . 2001 . Geographic distributions of homosporous ferns: does dispersal obscure evidence of vicariance? Journal of Biogeography 28 : 263– 270.

Won H, Renner SS, Linder P . 2006 . Dating Dispersal and Radiation in the Gymnosperm Gnetum (Gnetales)—Clock Calibration When Outgroup Relationships Are Uncertain. Systematic Biology 55 : 610–622.

Wu Z, Hong D, Raven PH (Eds.) . 2013 . Flora of China, Text Volume 2-3, Lycopodiaceae through Polypodiaceae . Beijing: St. Louis: Science Press.

Xi Z, Ruhfel BR, Schaefer H, Amorim AM, Sugumaran M, Wurdack KJ, Endress PK, Matthews ML, Stevens PF, Mathews S, et al. 2012 . Phylogenomics and a posteriori data partitioning resolve the Cretaceous angiosperm radiation Malpighiales. Proceedings of the National Academy of Sciences 109 : 17519–17524.

Yang Z, Rannala B . 2006 . Bayesian Estimation of Species Divergence Times Under a Molecular Clock Using Multiple Fossil Calibrations with Soft Bounds. Molecular Biology and Evolution 23 : 212–226.

Zheng Y, Wiens JJ . 2015 . Do missing data influence the accuracy of divergence-time estimation with BEAST? Molecular Phylogenetics and Evolution 85 : 41–49.

CHAPTER 3: PHYLOGENETIC SYSTEMATICS, MORPHOLOGICAL EVOLUTION, AND NATURAL GROUPS IN NEOTROPICAL PHLEGMARIURUS (LYCOPODIACEAE)

INTRODUCTION

With an estimated 250 species, Phlegmariurus is by far the most species-rich genus in the clubmoss family Lycopodiaceae (PPG I, 2016). Phlegmariurus is widely distributed in tropical and subtropical regions across the world and is mostly closely related to the temperate genus Huperzia and the monotypic Phylloglossum of Australia and New

Zealand (Wikström and Kenrick, 1997; Field et al., 2016); together, these three genera comprise Lycopodiaceae subfamily Huperzioideae (Wagner and Beitel, 1992; Øllgaard,

2015; PPG I, 2016). In addition to its remarkable species richness, Phlegmariurus also is characterized by morphological and ecological diversity that is unparalleled among extant lycophyte genera. Phlegmariurus species occupy an elevational amplitude ——from sea level to at least 5000 m above sea level— that is perhaps unsurpassed by any other genus of vascular plants, and are prominent both in montane forests and alpine grasslands. The numerous and disparate epiphytic, terrestrial, and rupicolous niches occupied by members of the genus apparently have driven the exceptional morphological differentiation observed in the group; Phlegmariurus species vary conspicuously in growth habit, size, leaf shape, phyllotaxy, and extent of fertile-sterile leaf dimorphy (Fig.

5).

The morphological variability of Phlegmariurus has presented a significant impediment to taxonomic work in the genus, from generic circumscription itself to the resolution of species complexes. Until recently, taxonomists (Holub, 1985; Øllgaard 1987; 1989a; 59

1990; 1992; Øllgaard and Windisch, 1987) generally treated members of Phlegmariurus within a broadly construed Huperzia due to their close morphological similarity.

However, this taxonomic scheme became inconsistent with that applied to the rest of the family —thirteen genera are now recognized among Lycopodiaceae subfamilies

Lycopodioideae and Lycopodielloideae— and molecular phylogenetic studies (Wikström and Kenrick, 1997; Field et al., 2016) indicated the likely paraphyly of Huperzia s.l. with respect to Phylloglossum . Thus, the tropical members of this assemblage were transferred to Phlegmariurus in a series of recent papers (Øllgaard, 2012a; 2012b; Field and

Bostock, 2013; Arana, 2016; Field et al., 2016).

To segregate the diversity of Phlegmariurus into morphologically cohesive groups,

Øllgaard (1987) proposed (then within Huperzia ) 21 species groups based on a suite of morphological characteristics, primarily pertaining to growth habit and leaf morphology.

Øllgaard (1987) stressed that these species groups were informal and that the affinities of many species remained uncertain; he later (Øllgaard, 1992) dissolved one of these groups and transferred its constituent taxa into two other groups. Under this modified informal infrageneric classification scheme, 20 species groups are recognized, 11 of which occur in the Neotropics. Subsequent molecular phylogenetic studies (Wikström and Kenrick,

1997; Wikström et al., 1999; Wikström and Kenrick, 2000; Field et al., 2016) revealed the presence of two major clades in Phlegmariurus —one Neotropical, the other

Paleotropical—thus indicating that the pantropical species groups proposed by Øllgaard were polyphyletic and that the similarity of Neotropical and Paleotropical representatives of these groups resulted from convergent evolution. Field et al. (2016) also suggested that

60 some species groups within the Neotropical clade of Phlegmariurus may also not be monophyletic; they concluded that morphological convergence was “common among species that occupy similar niches.”

Morphological variability and apparently rampant convergence also represent significant impediments to species circumscription in the genus. In the Paleotropical clade, the widespread and polymorphic Phlegmariurus phlegmaria is the most conspicuous example of the phenomenon; this name is applied to a non-monophyletic assemblage of distinct but poorly differentiated taxa sporadically distributed from western Africa to

Oceania (Field et al., 2016). Among the Neotropical species, a large number of new species —many morphologically cryptic— have been described in the past four decades in the course of extensive study by Benjamin Øllgaard (Øllgaard, 1982; 1988; 1989b;

1993; 1994; 2003; 2015; 2016a; 2016b). Despite these efforts, resolution of several widespread species complexes (e.g., Phlegmariurus brevifolius , P. crassus , P. taxifolius ) remains intractable and the existence of numerous species with unusual range disjunctions (e.g., Guatemala/Mexico and northern/central Andes in both Phlegmariurus hartwegianus and P. amentaceus ) suggests that additional cryptic species remain undetected. The challenges facing advancement of a cohesive taxonomy for Neotropical

Phlegmariurus were summarized by Øllgaard (1992), who noted: “few selective forces seem to be operating on the morphological features that are used for recognition and identification. The species therefore are often difficult to define.”

In this work, we contribute to the systematics of Neotropical Phlegmariurus by presenting a robustly supported and densely sampled phylogeny of the clade and using

61 that phylogeny to evaluate patterns of morphological evolution in the group and to examine standing taxonomic hypotheses. We test the monophyly of the informal species groups proposed by Øllgaard (1987; 1992), revise them when necessary, and attempt to characterize morphological synapomorphies of these groups.

MATERIALS AND METHODS

Taxon sampling

In order to focus on the phylogenetic relationships of the Neotropical clade of

Phlegmariurus , we sampled 106 of the estimated 150 described species in the clade, including representatives of all 11 of Øllgaard’s (1987; 1992) Neotropical species groups.

Outgroups were sampled from Paleotropical Phlegmariurus , the remaining

Lycopodiaceae subfamily Huperzioideae genera Huperzia and Phylloglossum , and

Lycopodium clavatum . Sequence data for six chloroplast markers ( psbA-trnH , rbcL , rps4 , trnL , trnL-trnF, and trnP-petG ) were obtained from Genbank, based on a recently published time-calibrated phylogeny of the Lycopodiaceae (Testo et al., in press ).

Voucher information and sequence accessions numbers are available in Appendix 1 .

Phylogenetic analyses

Sequences for each region were aligned using the MAFFT (Katoh et al., 2002) plugin in

Geneious. We used jModelTest2 (Darriba et al., 2012) to select the optimal nucleotide substitution model for each region using the corrected Akaike Information Criterion.

Maximum likelihood (ML) phylogenetic analyses were performed using RAxML 8.2.10

(Stamatakis 2006; 2014) implemented in the Cipres Science Gateway portal (Miller et al.

(2010). The GTR+Γ substitution model was employed across all partitions; 1000 ML bootstraps were performed, followed by search for the single highest-likelihood tree.

Bayesian Inference (BI) of phylogeny was performed using MrBayes 3.2.6 (Huelsenbeck and Ronquist, 2003) implemented using the Cipres portal (Miller et al., 2010).

Substitution models were employed per our jModelTest2 output and the MCMC analysis was performed with four chains run for 20 million generations, sampled every 5000 generations. The resulting log files were inspected for convergence and adequate sampling using Tracer 1.6 (Drummond and Rambaut, 2007); the first 10% of trees were discarded as burn-in. A majority rule consensus tree was generated from the remaining

3600 trees.

Morphological analyses

To reconstruct the evolution of morphological characters in Neotropical Phlegmariurus , trait measurements and observations were obtained from descriptions in the literature

(Øllgaard, 1988; 1994; 1995; Mickel and Smith, 2004), herbarium specimens, and observations of plants in the field. We scored six traits that have been proposed as taxonomically informative: growth habit, stem thickness, stem coloration, leaf margin shape, fertile/sterile leaf dimorphy, and leaf length/width ratio. A brief description of the variation of these characters among Neotropical Phlegmariurus and of the character state scoring scheme used is provided here; a complete trait matrix is provided in Appendix 2.

Roughly equal numbers of terrestrial and epiphytic species are known in Neotropical

Phlegmariurus , and growth habit has been widely used to delimit major species groups in 63 the genus. This trait was scored as binary; though we acknowledge some species occasionally exhibit both growth habits, these are exceptions and those species was scored for the growth habit they commonly exhibit. Stem thickness varies conspicuously across Neotropical Phlegmariurus , ranging from less than 1 mm thick in some delicate epiphytic species to more than 1 cm thick in some terrestrial taxa. We scored this trait as continuous, and used mean values of stem excluding leaves for all taxa. In some species of Phlegmariurus , the stems are often completely or partially reddish in color; this has been used to help characterize some species groups. We scored this trait as binary; species were scored as having reddish stems when this character state is at least commonly encountered. Although most Neotropical Phlegmariurus have smooth leaf margins, some species possess leaf margins that are prominently toothed; the presence of toothed leaves is a defining characteristic of the P. reflexus species group. We scored this trait as binary; species with rugose or weakly toothed leaf margins were scored as having smooth leaf margins, as these character states often intergrade within species. Although the highly-specialized strobili present in genera in the Lycopodiaceae subfamilies

Lycopodioideae and Lycopodielloideae are absent in Phlegmariurus , some species do possess fertile leaves that differ conspicuously from their sterile leaves in size, shape, and phyllotaxis. This fertile-sterile leaf dimorphy has been used to characterize the H. phlegmaria species group. We scored this trait as binary, and species with weak reduction in leaf size across the length of their shoots we considered to be monomorphic.

The relative length and width of leaves varies remarkably among Øllgaard’s Neotropical species groups, and in some cases (e.g., the H. brevifolia and H. verticillata groups) has been proposed as a primary defining characteristic. This trait was scored as continuous, 64 and the mean values of length and width from leaves at the middle of the shoot axis were used to calculate the ratio.

Character reconstruction was carried out in R using the package ‘phytools’ (Revell,

2012). Discrete characters were reconstructed under a continuous-time Markov chain model (Lewis, 2001) using the “ace” function from the ‘ape’ package (Paradis et al.,

2004) and the phytools function ‘lik.anc’; continuous traits were reconstructed using the phytools functions ‘fastAnc’ and ‘contMap’. For all reconstructions, the BI majority rule consensus tree was used; for visualization purposes, the tree was ultrametricized using the ‘compute.brlen’ function in ‘ape’.

RESULTS

Phylogeny and species groups

We found Phlegmariurus to be strongly supported (BS 100%, PP 1.0) as monophyletic and sister to a clade comprising Huperzia and Phylloglossum (Fig. 6). Statistical support for the position of Phylloglossum was moderate (BS 77%, PP 0.82). Within

Phlegmariurus , two principal clades were recovered, one primarily consisting of

Neotropical species and the other nearly entirely Paleotropical. Among Neotropical

Phlegmariurus , we recovered eleven clades that we treat as distinct species groups (Fig.

7). Most of these clades are strongly supported (BS > 90%, PP > 0.95) and many are largely, but not entirely, consistent with Øllgaard’s species groups. Sister to the rest of

Neotropical Phlegmariurus is a clade (the Phlegmariurus aqualupianus group) that

65 includes most of the Neotropical members of Øllgaard’s Huperzia phlegmaria group and a single Paleotropical species, Phlegmariurus ophioglossoides . At the next divergence, two clades are strongly supported as sister to the remainder of the species; one of these clades corresponds to the Neotropical members of Øllgaard’s Huperzia verticillata group, the other includes narrow-leaved members of Øllgaard’s Huperzia brongniartii group intermixed with his Huperzia dichotoma group. We name these clades as the

Phlegmariurus acerosus and Phlegmariurus dichotomus groups, respectively.

Subsequently, we recover two clades as sister to the remainder of the taxa, with moderate support (BS 74%, PP 0.83). One clade is comprised of a small number of robust, thick- leaved, primarily epiphytic species; we refer to this as the Phlegmariurus hartwegianus group. The other clade is comprised of a morphologically disparate assemblage of species that are mostly endemic to southeastern Brazil, the Phlegmariurus ruber group. At the next divergence within the tree, we recover a single taxon, Phlegmariurus lindenii , as sister to the remainder of the species, though support for the position of this taxon is low

(BS 58%, PP 0.77). We maintain this morphologically isolated taxon as its own group— the Phlegmariurus lindenii group. The next clade is a small group of epiphytic species allied to Phlegmariurus taxifolius , which we call the Phlegmariurus taxifolius group. We split the next clade recovered in our analyses into two species groups: one consisting of two morphologically similar species from high-elevation forests in the Andes, the other comprised of the widespread Phlegmariurus linifolius and allied species. We refer to these as the Phlegmariurus brongniartii group and the Phlegmariurus linifolius group, respectively. The clade comprising these two species groups is sister to a large group of terrestrial species, in which we recover two well supported clades. One is primarily 66 comprised of pioneer species of mid- to high-elevation exposed habitats and corresponds to Øllgaard’s Huperzia reflexa group; we refer to it as the Phlegmariurus reflexus group.

The other group is by far the largest species group clade resolved in our analyses and includes a diverse assemblage of taxa that are restricted to páramos and similar alpine habitats primarily in Central America and the northern and central Andes. This clade corresponds closely to Øllgaard’s Huperzia brevifolia and Huperzia saururus groups, but also includes some species previously assigned to the Huperzia brongniartii and

Huperzia reflexa groups. Though this clade is well supported as monophyletic, relationships among the many species that belong to it are not well supported and genetic differentiation among many species is weak. We refer to this large assemblage of species as the Phlegmariurus crassus group, after the most widespread and polymorphic species in the group.

Morphological evolution

Fertile/sterile leaf dimorphy

The most probable ancestral condition of leaf dimorphy for Neotropical Phlegmariurus is monomorphic (Fig. 8A), with transitions to dimorphy in the Phlegmariurus aqualupianus, Phlegmariurus hartwegianus , and Phlegmariurus ruber groups. Several parallel transitions to dimorphy are inferred to have occurred in the Paleotropical clade of

Phlegmariurus .

Leaf margin

The ancestral leaf margin condition is reconstructed as smooth, and transitions to toothed margins occurred in the Phlegmariurus reflexus group and within the Phlegmariurus crassus group (Fig. 8B).

Growth habit

Terrestrial growth is ancestral within Lycopodiaceae subfamily Huperzioideae, but the ancestral growth habit of both Phlegmariurus and for the Neotropical clade is ambiguous

(Fig. 8C). Following the evolution of epiphytism in Neotropical Phlegmariurus , we infer that reversals to terrestrial growth have occurred several times, including at least two times each in the Phlegmariurus dichotomus group, once in the Phlegmariurus acerosus group and in the Phlegmariurus ruber group, and a single time in the ancestral lineage shared by the Phlegmariurus reflexus and Phlegmariurus crassus groups.

Stem coloration

The most probable ancestral stem coloration is green/yellow (Fig. 8D); hence. reddish stem coloration has evolved numerous times among Neotropical Phlegmariurus , including in the Phlegmariurus aqualupianus group, the Phlegmariurus dichotomus group, the Phlegmariurus ruber group, and the Phlegmariurus crassus group.

Stem thickness

Stem thickness varied considerably across Neotropical Phlegmariurus , but was generally stable within species groups (Fig. 9A). A dramatic reduction in stem thickness occurred in the Phlegmariurus aqualupianus , Phlegmariurus acerosus , and Phlegmariurus 68 linifolius groups, and a general increase in stem thickness characterizes the

Phlegmariurus crassus group.

Leaf length/width ratio

Leaf length/width ratio increased dramatically in the Phlegmariurus dichotomus group and to a lesser extent in the Phlegmariurus acerosus and Phlegmariurus linifolius groups

(Fig. 9B). Significant reduction in leaf length/width ratio occurred in the Phlegmariurus aqualupianus group (especially in P. dichaeoides and allied species) and in the

Phlegmariurus crassus group.

DISCUSSION

Phylogenetic systematics

Our results corroborate the findings of Wikstrom and Kenrick (1997) and Field et al.

(2016) regarding the phylogeny of the Lycopodiaceae subfamily Huperzioideae and are consistent with the generic taxonomic scheme used by most workers in the group in recent years (Øllgaard 2012a,b; Field and Bostock, 2013, PPG 1, 2016). As found in earlier phylogenetic studies (Wikstrom and Kenrick, 1997; 2000; Field et al., 2016), our analyses indicate that Phlegmariurus is divided into two principal clades: one

Paleotropical and the other Neotropical (Fig. 6). Only a few species violate this biogeographic pattern: the widespread Neotropical epiphyte Phlegmariurus funiformis is a member of the Paleotropical clade, the African and Malagasy species Phlegmariurus ophioglossoides is a member of the Neotropical Phlegmariurus aqualupianus group, and

Phlegmariurus saururus —a member of Phlegmariurus crassus group— is known from

69 alpine grasslands in Andean South America, South Atlantic islands, southern Africa,

Madagascar, and the Mascarenes. As discussed extensively in several earlier phylogenetic studies (Wikstrom et al., 1999; Wikstrom and Kenrick, 2000; Field et al.,

2016), this deep split between Paleotropical and Neotropical lineages means that the existence of morphologically similar species in the Old World and New World tropics is due to dramatic convergence among species adapted to similar habitats in each region.

Our findings also provide insight into patterns of morphological evolution within the

Neotropical clade of Phlegmariurus and allow for the morphology-based classification system of Øllgaard (1987; 1992) to be evaluated within a phylogenetic framework.

Although our taxonomic sample (106/ca. 150 species) is not exhaustive and thus we are unable to comment on the affinities of some species, our analyses generally resolved major groups with strong support. Of the 11 Neotropical species groups recognized by

Øllgaard (1992), we find support for recognizing several (e.g., Phlegmariurus acerosus and Phlegmariurus reflexus groups) with minimal modifications. In several other cases

(e.g. Phlegmariurus hartwegianus and Phlegmariurus lindenii groups) we find support for the distinctness of lineages that Øllgaard (1987, 1992) had placed in other species groups but recognized as being at best weakly allied to those groups.

There are also several cases in which the topology of our phylogeny departs significantly from Øllgaard’s species group classification. With respect to these, the non-monophyly of some of previously recognized species groups appears to reflect a major feature in the evolutionary history of Neotropical Phlegmariurus : adaptive radiations that occurred in

70 parallel in the Andes and in southeastern Brazil, producing groups of evolutionarily distinct but morphologically similar taxa.

The most notable example of this pattern is our finding of a monophyletic clade that includes the Phlegmariurus ruber group, which together comprise an estimated 20 species (12 sampled here) that are largely endemic to southeastern Brazil. This group is an ecologically and morphologically heterogeneous assemblage of species—it includes both pendulous epiphytes and robust terrestrial taxa—and its members were assigned to three different species groups by Øllgaard (1987, 1992) on account of this variation. This presence of a morphologically diverse, monophyletic clade of Brazilian endemics was first reported in a recent phylogenetic study of Brazilian Phlegmariurus by Gissi (2017) and indicates that an adaptive radiation occurred in the Atlantic forest and campos rupestres of southeastern Brazil, in parallel with the primary Andean radiation of the group. Further study is needed to better understand the evolutionary history of this group, especially with respect to the narrow endemism found in many species.

We also find the Huperzia brongniartii group to be highly polyphyletic. Øllgaard defined this group primarily by their terrestrial growth habit (in most species), linear entire leaves, and “bottle-brush-like” growth habit, but noted that the species group was variable and suggested that several species might be allied to the Huperzia dichotoma ,

Huperzia saururus, and Huperzia taxifolia groups. Our results corroborate these concerns and indicate that members of the Huperzia brongniartii group belong to four different clades: 1) a group of species with long, linear leaves from upper elevations forests in the

Andes (e.g., P. hippurideus , P. lechleri , P. arcuatus) and one species from southeastern

Brazil ( P. nudus) belong to the Phlegmariurus dichotomus group; 2) a group of more coriaceous-leaved terrestrial species from mostly exposed montane habitats in southeastern Brazil (e.g. P. mooreanus , P. itambensis, P. deminuens ) belong to the endemic Phlegmariurus ruber group; 3) members of this groupg from alpine habitats in the Andes (e.g., P. loxensis , P. weddellii ) belong to the P. crassus group ; and 4) P. brongniartii itself is allied only to P. rosenstockianus , the two of which form the P. brongniartii group as it is recognized here.

A similarly heterogenous group in Øllgaard’s classification scheme is the Huperzia taxifolia group, in which he includes 12 slender to robust, primarily epiphytic species.

We sampled eight species from this group; only Phlegmariurus tubulosus (and

Phlegmariurus bradeorum , treated by Øllgaard in the Huperzia dichotoma group) are closely allied to Phlegmariurus taxifolius . The remaining species either are allied to the

Phlegmariurus hartwegianus group ( P. cuernavacensis , P. hartwegianus ), the

Phlegmariurus linifolius group ( P. homocarpus ), or represent isolated lineages in the

Neotropical ( P. lindenii , P. rosenstockianus ) or Paleotropical ( P. funiformis ) clades. The loose affinities of some of these taxa to P. taxifolius and were noted by Øllgaard (1992); thus, the finding that some species, such as P. lindenii and P. funiformis , are unrelated should not be surprising. As noted by Øllgaard (1992), hybridization and polyploidy appear to have played an important role in the evolution of this group; if this is the case, additional study including data from biparentally inherited nuclear genes may improve our understanding of the relationships among these species and further alter circumscription of this group.

Circumscription of species groups

In light of the results of our phylogenetic analyses and morphological character reconstructions, we can now provide an overview of the species groups we have delimited in this study, including characterization of their morphology, general ecology, distributions, and estimated species richness. We emphasize that these groups are informal and that further study will likely result in their revision; they are described here to detail our current understanding of evolutionary relationships among Neotropical

Phlegmariurus as working hypotheses for future study.

Phlegmariurus aqualupianus group

This species group corresponds with the Huperzia myrsinites and Huperzia aqualupianus subgroups of Øllgaard’s Huperzia phlegmaria group. Members of this group are characterized by their pendulous epiphytic growth habit and prominent fertile/sterile leaf dimorphy (except the monomorphic Phlegmariurus capillaris ; Fig. 8A). Reddish stems and leaf bases appears to be a synapomorphy for the group of species closely allied to

Phlegmariurus phylicifolius , which corresponds to Øllgaard’s Huperzia myrsinites subgroup (Fig 8D). The Phlegmariurus aqualupianus group is widespread in the

Neotropics; the Andean cordillera appears to have been an important barrier to dispersal in this group, especially in the group of species allied to Phlegmariurus aqualupianus .

Gissi (2017) found that two Brazilian endemics, P. biformis and P. erythrocaulon, belong in this group; the presence of these species in southeastern Brazil is likely due to

73 diversification following a single dispersal event from the Andes. This group includes approximately 16 species.

Phlegmariurus dichotomus group

This species group includes Øllgaard’s Huperzia dichotoma group (excluding P. bradeorum ) and members of the Huperzia brongniartii group. Terrestrial species and both pendulous and erect epiphytes are known; the group best characterized by spreading, filiform to linear leaves (Fig. 9B). Several species possess red coloration on their stem at the bases of their leaves (Fig. 8D); this character appears to have evolved multiple times in the clade. Several species in this group (e.g., P. dichotomus , P. hippurideus , and P. wilsonii ) are very widespread, though some narrowly distributed species (e.g., P. foliaceus , P. lechleri , and P . nudus ) exist. Perhaps a dozen species belong to this group.

Phlegmariurus acerosus group

This species group is perhaps the most morphologically uniform among Neotropical

Phlegmariurus . Members of this group are slender to extremely delicate, with narrow shoots (Fig. 9A) and very narrow leaves (Fig. 9B) that are monomorphic or nearly so

(Fig. 8A). Most species are pendulous epiphytes, although the group includes a facultative ( P. comans ) and an obligate ( P. intermedius ) rupestral species. Phlegmariurus intermedius is an atypical member of this group on account of its relatively robust shoots, rupestral growth habit, and lanceolate leaves. We suspect that this species may have arisen following hybridization between a member of this group —perhaps P. comans — and P. pungentifolius or another member of the P. ruber species group. Phlegmariurus

74 mollicomus and P. sarmentosus , which were included in the Huperzia verticillata group by Øllgaard (1987, 1992) do not belong here. Altogether, this group comprises approximately 10 species.

Phlegmariurus ruber group

This species group is a heterogeneous assemblage of terrestrial and epiphytic taxa.

Phlegmariurus ruber possesses brilliantly red stems and leaves; red stem coloration appears to be an autapomorphy in this case (Fig. 8D). Clear morphological synapomorphies for this group are lacking, but the species are geographically cohesive.

Members of this group are endemic to southeastern Brazil, and most have small geographic ranges and occupy narrow ecological niches (Almeida et al., in prep. ).

Members of this group represent a significant adaptive radiation in Brazil that parallels the Andean radiation with respect to the ecological and morphological diversity displayed by the constituent taxa. Terrestrial members of this group were treated within the

Huperzia brongniartii group by Øllgaard (1987, 1992) but as discussed previously, are not closely related to other members of that group. Additional study may result in further subdivision of this group; however, we prefer a conservative circumscription until more taxa are sampled. An estimated 20 species belong to this group.

Phlegmariurus hartwegianus group

This species group is an assemblage of robust epiphytic and terrestrial species from high- elevation habitats, with representatives distributed from Mexico to Ecuador and northern

Peru. Both monomorphic and strikingly dimorphic species are included in this group;

75 they are united by their generally large size, robust shoots (Fig. 9A), and thickly herbaceous to coriaceous leaves. Monomorphic members of this group were placed in the

Huperzia taxifolia group by Øllgaard (1987, 1992); dimorphic species were treated as members of the Huperzia phlegmaria group, but were not thought to be closely related to each other. Two rare species not sampled by us ( P. pruinosus and P. robustus ) probably belong here. Five to seven species belong to this group.

Phlegmariurus lindenii group

The sole representative of this species group is Phlegmariurus lindenii , which is a pendulous epiphyte restricted to high elevation woodlands in Colombia and Ecuador.

This species was tentatively placed in the Huperzia taxifolia group by Øllgaard (1987,

1992), who commented on its distinctness and suggested that it may be most closely related to Phlegmariurus macgregorii , which occurs in similar habitats in New Guinea.

The affinities between these species remain untested, as we did not have material of the

New Guinean plant.

Phlegmariurus taxifolius group

This species group is more narrowly circumscribed than Øllgaard’s Huperzia taxifolia group, and excludes P. cuernavacensis , P. funiformis , P. hartwegianus , P. homocarpus ,

P. lindenii , and P. rosenstockianus . Remaining in this group are P. taxifolius , P. tubulosus , and P. bradeorum . Phlegmariurus bradeorum is an erect epiphyte with narrower leaves than the other members of this group; it may represent a cross between

P. taxifolius or a related species and a member of the P. dichotomus group.

Phlegmariurus taxifolius is one of the most widespread and variable species in the genus, and many heterotypic synonyms have been published. Further study may demonstrate that some of these are sufficiently distinct to warrant recognition, though a significant portion of the observed variation appears to be in response to environmental conditions.

Hybridization and polyploidy appear to be common in the P. taxifolius group and may have played an important role in its evolutionary history. Probable hybrids between P. taxifolius and P. linifolius were reported by Øllgaard (1988), and intermediates with P. homocarpus are also known. The Costa Rican endemic Phlegmariurus oellgaardii may be an allopolyploid derived from a cross between P. taxifolius and P. tubulosus ; it is morphologically intermediate to these species and possesses large spores (Øllgaard,

1995; Rojas, 2005). Overall, the group is characterized by their epiphytic growth habit

(Fig. 8C), monomorphic to gradually dimorphic shoots (Fig. 8A) and relatively narrow, lanceolate leaves (Fig. 9B). Several species not included in our study may belong here; they include P. sotae and P. killipii . The total number of species in this group is uncertain, perhaps six.

Phlegmariurus linifolius group

This group represents a modification of Øllgaard’s Huperzia linifolia group, in which he placed pendulous epiphytes with narrow stems and alternate, subpetiolate, falcate- ascending leaves. We exclude Phlegmariurus capilliaris , which Øllgaard considered close to Phlegmariurus linifolius ; this species belongs instead to the red-stemmed clade of the Phlegmariurus aqualupianus group. Included in this group is Phlegmariurus sarmentosus (which Øllgaard considered allied to the Huperzia verticillata group) and

Phlegmariurus homocarpus , a member of the Huperzia taxifolia group that Øllgaard noted was difficult to differentiate from some material of P. linifolius . Phlegmariurus linifolius is a widespread and very polymorphic species, with four geographically and morphologically distinct varieties currently recognized. Our sampling is insufficient to robustly evaluate the relationships among these varieties, and additional study is needed to determine the species’ monophyly. With these changes in the group’s circumscription considered, we define it with a modified set of the characters used by Øllgaard (1987,

1992): epiphytic growth (Fig. 8C), narrow stems (Fig. 9A), homophyllous shoots (Fig.

8A), and falcately ascending leaves. Circumscription of this group is likely to change as additional species are sampled. Species richness is at least six and likely higher.

Phlegmariurus brongiartii group

The circumscription of this group differs from the Huperzia brongniartii group of

Øllgaard, which was rather broadly construed and included a diverse assemblage of species, nearly all of which are assigned to other groups in the present work. Here, we include two species: Phlegmariurus brongiartii and Phlegmariurus rosenstockianus , both of which are restricted to high-elevation forests in the northern Andes. Both species are rather robust plants with monomorphic shoots (Fig. 8A) that differ most notably by growth habit (Fig. 8C); P. brongniartii is a terrestrial species, whereas P. rosenstockianus is typically epiphytic. Morphologically intermediate specimens that may represent hybrids between these species have been reported (Øllgaard, 1988).

Phlegmariurus reflexus group

Included here are terrestrial species with spreading to reflexed, lanceolate to linear leaves

(Fig. 9B) with (in most species) toothed margins (Fig 8B). Most species are pioneer species in exposed medium- to high-elevation habitats; this habit is particularly characteristic of the most common and widespread species, Phlegmariurus reflexus .

Delimitation of some species is problematic, especially P. reflexus , which is highly variable and appears hybridize frequently, including with species as distantly related as P. linifolius (Øllgaard, 1985). Sampling of P. reflexus across its range (W. Testo, unpublished data) indicate that this species is monophyletic, but a broader sampling of related taxa, such as Phlegmariurus acifolius and Phlegmariurus sintenisii , is needed to confirm this hypothesis. We recover Phlegmariurus eversus as polyphyletic, with Costa

Rican specimens being allied to the Costa Rican endemic Phlegmariurus hoffmannii and

Ecuadorean material related to Phlegmariurus urbanii and Phlegmariurus unguiculatus .

The specimens of Costa Rican P. eversus included in this study were collected at localities where both P. hoffmannii and P. reflexus occur; they may possibly represent hybrids between these two species. Costa Rican P. eversus appears to be intermediate between P. hoffmannii and Costa Rican P. reflexus with respect to stem thickness (Fig.

9A), phyllotaxy, leaf margin toothiness, and stem thickness (Fig. 9B); further study is needed to test this hypothesis of a hybrid origin.

Our analyses indicate that Phlegmariurus beitelii species placed in the Huperzia reflexa group by Øllgaard (1987, 1992) belongs instead to the Phlegmariurus crassus species group. Other robust, high-elevation species treated in the Huperzia reflexa group by

Øllgaard (1987, 1992), including Phlegmariurus riobambensis and P. sieberianus , may also belong to the Phlegmariurus crassus species group. Phlegmariurus intermedius was placed in the Huperzia reflexa group, but our analyses resolve it with the Phlegmariurus acerosus group (see discussion under that group). With these species excluded, we conservatively estimate that ten species belong to this group, though taxonomic revision may lead to more species being recognized.

Phlegmariurus crassus group

This group comprises mostly robust terrestrial species that are adapted to growth in open habitats above treeline. It is by far most diverse in the páramos of the northern Andes, though some species are found in similar habitats in Central America, Mexico,

Hispaniola, and southeastern Brazil. The diversification of this group is clearly linked to the Andean orogeny, and its remarkable species richness appears to be due to its successful invasion of novel habitats that formed within the past few million years. Many species have exceedingly small ranges, reflecting the patchiness of suitable habitat in the topographically complex Andes. Since their formation, fluctuations in climate repeatedly altered the extent and connectivity of páramos (van der Hammen, 1974); this dynamic history appears to have permitted intermittent gene flow between otherwise isolated populations of species in this group. Due to this and other factors, many species appear to be weakly differentiated, and species delimitation is problematic (Øllgaard 1988, 1992).

The recentness of divergence and minimal differentiation among species in this group is reflected in the short branch lengths and low support values we recover within this clade.

Additional sequence data from more variable markers is needed to better resolve relationships among members of this group; however, we can draw some important conclusions. First, we recover two large clades with moderate support (BS 67%, PP 0.84) that are somewhat distinct in their morphology and ecology. One clade is comprised of relatively unspecialized taxa such as P. andinus , P. capellae , and P. weberbaueri (Fig. 6).

The other clade consists of species that appear more specialized for growth in exposed alpine habitats, such as P. brevifolius , P . hypogaeus , and P. talpiphilus . Further study is needed to better understand the morphological and ecological differences between these clades.

We do not find support for the recognition of Øllgaard’s Huperzia brevifolia and

Huperzia saururus groups (Fig. 7). We find that the character used to define these groups—leaf length/width ratio—varies dramatically across the Phlegmariurus crassus group, and species with broadly lanceolate to orbicular leaves —formerly the Huperzia brevifolia group— are interspersed among more narrow-leaved species in our phylogeny

(Fig 9B). The environmental factors acting on leaf shape in this group are yet unknown, though their general growth form appears to an adaptation to intense radiation and freezing experienced in the alpine habitats they occupy (Billings, 1974; Øllgaard, 1992).

Several species in this group for which we were able to sample multiple accessions appear to be polyphyletic. The most prominent example is Phlegmariurus crassus, which is perhaps the most widespread and variable species in this group and includes three varieties: P. crassus var. crassus , P. crassus var. gelida , and P. crassus var. manus- diaboli . We find that none of these three varieties are closely related to each other, and

81 that different accessions of P. crassus var. crassus do not group together. While accessions from Ecuador and Costa Rica seem closely related and may be conspecific, two collections from southern Mexico belong to a different clade altogether. These plants belong to the clade of less-specialized taxa and appear allied to P. capellae and P. talamancanus . Similarly, we find that P. brevifolius is not monophyletic as currently circumscribed: whereas Ecuadorean material is closely allied to P. sellifolius and P. rufescens , Costa Rican material appears to be rather distantly related. Increased sampling of these and related taxa is needed to improve our understanding of species boundaries in this group; sequence data from additional, variable markers should prove particularly insightful.

Reticulate evolution in this group is poorly documented but probably common. As in most Phlegmariurus , hybrids between members of this group appear to have normal spores and may be at least partly fertile, making their detection difficult. Some species

(e.g., P. tryoniorum , Øllgaard 2016; P. polydactylus , Øllgaard, 1988) appear to be of hybrid origin, but these hypotheses remain untested. As has been the case in several other

Lycopodiaceae genera (Wagner et al., 1985; Stoor et al., 1996; Aagaard et al., 2009;

Hanušová et al., 2014), characterizing the history of reticulate evolution in this and other groups of Phlegmariurus may prove to be an important step in resolving standing taxonomic problems.

This species group is characterized by a terrestrial growth habit (Fig. 8C), thick stems

(Fig. 9A), monomorphic leaves (Fig. 8A), and (in most species) entire or weakly toothed leaf margins (Fig. 8B). Two traits that have been used to help delimit species in this

82 group, the extent of developmental shoot differentiation and presence of air-filled cavities in leaf bases, appear to be highly homoplastic, but were not scored in this study. Because species in this group are so difficult to define, the total number of species is highly uncertain, but almost certainly greater than 60.

CONCLUSIONS

Phlegmariurus is by far the most species-rich genus in the Lycopodiaceae, and exhibits exceptional morphological and ecological diversity, especially in the Neotropical clade.

Despite extensive taxonomic study, relationships between many species and groups of species have remained uncertain, especially among high-elevation Andean taxa. This work provides a phylogenetic framework in which these relationships and patterns of morphological evolution in Neotropical Phlegmariurus can be better understood; we hope that the findings presented here will facilitate ongoing taxonomic work and inform future efforts towards a robust and stable infrageneric classification of Phlegmariurus .

Our results largely corroborate the standing hypotheses about species groups made by

Øllgaard (1987, 1992) but also provide new insights into evolutionary history of

Neotropical Phlegmariurus , including the documentation of parallel adaptive radiations in the Andes and southeastern Brazil and evidence suggesting the occurrence of hybridization between morphologically disparate, distantly related species. Finally, this study highlights the need for additional research to improve resolution of species relationships —especially among the Phlegmariurus crassus group— and examine the importance of reticulate evolution as a driver of diversification in the genus.

LITERATURE CITED

ARANA , M.D. 2016. Nomenclatural notes on Phlegmariurus dentatus (Lycopodiaceae). Phytotaxa 252: 298–300.

DARRIBA , D., G.L. TABOADA , R. DOALLO , and D. POSADA . 2012. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: 772–772.

DOYLE , J., and J. DOYLE . 1987. Genomic plant DNA preparation from fresh tissue - the CTAB method. Phytochemical Bulletin 19: 11.

DRUMMOND , A.J., and A. RAMBAUT . 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7: 214.

FIELD , A.R., and P.D. BOSTOCK . 2013. New and existing combinations in Palaeotropical Phlegmariurus (Lycopodiaceae) and lectotypification of the type species Phlegmariurus phlegmaria (L.) T.Sen & U.Sen. PhytoKeys 33–51.

FIELD , A.R., W. TESTO , P.D. BOSTOCK , J.A.M. HOLTUM , and M. WAYCOTT . 2016. Molecular phylogenetics and the morphology of the Lycopodiaceae subfamily Huperzioideae supports three genera: Huperzia , Phlegmariurus and Phylloglossum . Molecular Phylogenetics and Evolution 94, Part B: 635–657.

HOLUB , J. 1985. Transfers of Lycopodium species to Huperzia : with a note on generic classification in Huperziaceae. Folia Geobotanica et Phytotaxonomica 20: 67–80.

KATOH , K., K. MISAWA , K. KUMA , and T. MIYATA . 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059–3066.

MICKEL , J., and A.R. SMITH . 2004. Pteridophytes of Mexico. New York Botanical Garden Press.

ØLLGAARD , B. 1982. A new tropical American species of the genus Lycopodium . American Fern Journal 72: 53–55.

ØLLGAARD , B. 1987. A revised classification of the Lycopodiaceae s. lat. Opera Botanica 92: 153–178.

ØLLGAARD , B. 1988. Lycopodiaceae. In Flora of Ecuador, 156. Botanical Institute, Goteborg University, Gothenburg, Sweden.

ØLLGAARD , B. 1989a. Index of the Lycopodiaceae. Royal Danish Society of Sciences and Letters, Copenhagen.

ØLLGAARD , B. 1989b. New Taxa and Combinations of Venezuelan Lycopodiaceae. American Fern Journal 79: 151–154.

ØLLGAARD , B. 1990. Lycopodiaceae. In Pteridophytes and Gymnosperms, The Families and Genera of Vascular Plants, 31–39. Springer, Berlin, Heidelberg.

ØLLGAARD , B. 1992. Neotropical Lycopodiaceae-An Overview. Annals of the Missouri Botanical Garden 79: 687–717.

ØLLGAARD , B. 1993. Two new Mesoamerican species and a new combination in Huperzia (Lycopodiaceae). Novon 3: 67–72.

ØLLGAARD , B. 1995. Lycopodiaceae. In Flora Mesoamericana, Vol. 1. Psilotaceae a Salviniaceae, Universidad Nacional Autonoma de Mexico, Mexico.

ØLLGAARD , B. 2003. Novelties in Neotropical Lycopodiaceae. Nordic Journal of Botany 23: 31–47.

ØLLGAARD , B. 2012a. New combinations in Neotropical Lycopodiaceae. Phytotaxa 57: 10–22.

ØLLGAARD , B. 2012b. Nomenclatural changes in Brazilian Lycopodiaceae. Rodriguésia 63: 479–482.

ØLLGAARD , B. 2015. Six new species and some nomenclatural changes in neotropical Lycopodiaceae. Nordic Journal of Botany 33: 186–196.

ØLLGAARD , B. 2016a. Additions, deletions and changes to the Ecuadorian Lycopodiaceae. Phytotaxa 246: 93–106.

ØLLGAARD , B. 2016b. New neotropical Lycopodiaceae. Phytotaxa 277: 266–274.

ØLLGAARD , B., and P. WINDISCH . 1987. Sinopse das Licopodiaceas do Brasil. Bradea 5: 1–43.

PPG I. 2016. A community-derived classification for extant lycophytes and ferns. Journal of Systematics and Evolution 54: 563–603.

STAMATAKIS , A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–2690.

WAGNER , W.H., and J.M. BEITEL . 1992. Generic Classification of Modern North American Lycopodiaceae. Annals of the Missouri Botanical Garden 79: 676–686.

WIKSTRÖM , N., and P. KENRICK . 2000. Phylogeny of epiphytic Huperzia (Lycopodiaceae): paleotropical and neotropical clades corroborated by rbcL sequences. Nordic Journal of Botany 20: 165–171. 85

WIKSTRÖM , N., and P. KENRICK . 1997. Phylogeny of Lycopodiaceae (Lycopsida) and the Relationships of Phylloglossum drummondii Kunze Based on rbcL Sequences. International Journal of Plant Sciences 158: 862–871.

WIKSTRÖM , N., P. KENRICK , and M. CHASE . 1999. Epiphytism and terrestrialization in tropical Huperzia (Lycopodiaceae). Plant Systematics and Evolution 218: 221–243.

CHAPTER 4: THE RISE OF THE ANDES PROMOTED RAPID DIVERSIFICATION IN NEOTROPICAL PHLEGMARIURUS (LYCOPODIACEAE)

INTRODUCTION

It is well-established that mountains harbor a disproportionate share of Earth’s biodiversity (Humboldt and Bonpland, 1807; Hoorn et al ., 2013; Antonelli, 2015; Hughes and Atchison, 2015; Lagomarsino et al ., 2016; Xing and Ree, 2017). Though they cover approximately one-eighth of Earth’s land surface, mountains host approximately one- third of terrestrial species (Spehn et al ., 2012) and have supported exceptional species radiations (Hughes and Eastwood, 2006; McGuire et al ., 2007; Schwery et al ., 2015;

Lagomarsino et al ., 2016; Xing and Ree, 2017) in major lineages spanning the Tree of

Life. Given the exceptional species diversity distributed on the world’s mountains, developing a thorough understanding of the factors driving the diversification of biotic lineages in these regions is an important goal of evolutionary biologists. Though methodological advances in comparative phylogenetics and historical biogeography made in recent years have improved our capability to identify the relative roles of biotic and abiotic factors as drivers of evolutionary radiations (Matzke, 2013; Morlon, 2014), our understanding of the timing and mode of diversification in montane systems remains mostly confined to a few groups of organisms.

Among the best geographic regions in which to study the diversification of montane lineages is Andean South America. Of interest for researchers in many groups are the tropical Andes, which span western South America from Venezuela to northern

Argentina. This area is the most species-rich region on Earth, with more than 45,000 87 plant and 3,400 vertebrate species; nearly half of these are found nowhere else on Earth

(Myers et al ., 2000). The accumulation of this unparalleled diversity is due in large part to major evolutionary radiations that have occurred in a broad array of Andean lineages, including groups of fungi (Leavitt et al ., 2012; Lücking et al ., 2014), animals (Garcı́a-

Moreno et al ., 1999; Doan, et al ., 2003; Elias et al ., 2009; Chaves et al ., 2011), and plants (Hughes and Eastwood, 2006; Antonelli et al ., 2009; Luebert and Weigend, 2014;

Lagomarsino et al ., 2016). These radiations are particularly striking given that most are recent and ongoing, having started during the Pliocene and Pleistocene epochs (Madriñan et al ., 2013), in concert with the rapid uplift of the high Andes over the past 10 million years (Gregory-Wodzicki, 2000; Garzione et al ., 2008; 2014). Though the timing and geography of the Andean uplift remain topics of considerable debate, it is evident that the

Andean orogeny is a highly dynamic phenomenon that, along with climatic fluctuations and biotic interactions, has driven some of the fastest diversification rates known

(Madriñan et al ., 2013; Lagomarsino et al ., 2016).

Though the number of focused studies on the diversification of montane Andean lineages has increased substantially over the past decade, most work has focused on a few groups, such as amphibians (Gonzalez-Voyer et al ., 2011; Castroviejo-Fisher et al ., 2014), birds

(Chaves et al ., 2011; Fjeldså et al ., 2012; McGuire et al ., 2014), and flowering plants

(Hughes and Eastwood, 2006; Madriñan et al ., 2013; Lagomarsino et al ., 2016). In contrast, the evolutionary histories of other prominent tropical Andean groups, such as ferns (Kreier et al ., 2008; McHenry and Barrington, 2014; Sánchez-Baracaldo and

Thomas, 2014) and lichens (Lücking et al ., 2014) have received little attention; others yet, including lycophytes and bryophytes, remain unstudied within a phylogenetic 88 context. To better understand how the Andean uplift has impacted the diversification of the region’s biota as a whole, increased focus on understudied groups, especially those that differ in life history strategies and dispersal ability, is needed. Here, we address this gap in our knowledge by examining the role of the Andean uplift as a driver of diversification in the species-rich lycophyte genus Phlegmariurus (Lycopodiaceae). The

Neotropical clade of Phlegmariurus represents an excellent study system for examining the relationship between the Andean orogeny and species diversification in spore- dispersed vascular plants. This clade is monophyletic, comprises an estimated 150 species, and includes species that are remarkably diverse morphologically and ecologically (Øllgaard, 1992; Field et al ., 2016). Neotropical Phlegmariurus is distributed from Florida and Mexico to Argentina and southeastern Brazil and can be found from sea level to at least 5000 m elevation, but is most diverse in the northern

Andes (Øllgaard, 1995), where most species are either epiphytes in humid montane forests or clump-forming terrestrial herbs in alpine grasslands. The presence of a large (>

60 species), monophyletic group of terrestrial taxa restricted to young alpine habitats of the Andes and adjacent regions (Øllgaard, 1992) suggests that the group may have undergone a recent and rapid diversification burst, thus providing a useful comparison to angiosperm genera with similar but better-studied evolutionary histories. Using a dated phylogeny, species distribution information, and both climate and geological data, we apply comparative phylogenetic models to investigate the evolutionary history of

Neotropical Phlegmariurus within the context of the Andean orogeny.

MATERIALS AND METHODS

Taxon sampling and phylogeny

A time-calibrated phylogeny of Neotropical Phlegmariurus was obtained by pruning the clade from a larger dated phylogeny of the Lycopodiaceae based on six chloroplast loci and eight fossil calibration published by Testo et al . ( in press ). A single African species that belongs to the Neotropical clade ( Phlegmariurus ophioglossoides ) was trimmed, leaving a total of 105 species, representing approximately 70% of known species richness in the group. The final trimmed tree is available in the Supplementary Materials.

Diversification rate estimation

Lineage diversification rates were estimated using BAMM 2.5.0 (Rabosky, 2014), which uses a reverse-jump MCMC to sample a large number of possible diversification regimes from a given time-calibrated phylogeny. The MCMC was run for 100 million generations and sampled every 40,000 generations. Prior values were selected using the

‘setBAMMpriors’ function; we accounted for incomplete taxon sampling by providing a sampling file with estimated sampling proportions for each of the eleven species groups in the clade as defined by Testo et al . ( in press ). Post-run analyses were performed using the ‘BAMMtools’ (Rabosky et al ., 2014) package in R 3.4.2 (R Core Team, 2014). The initial 10% of the MCMC run was discarded as burn-in, and the remaining data were assessed for convergence and ESS values greater than 200. Net diversification rates were obtained for all taxa in the phylogeny using the ‘getTipRates’ function; these values represent the posterior distribution of rates at the tip of the tree, as described by Rabosky

90 et al . (2015). To compare diversification rates of species groups in the genus, mean clade rates were extracted using the ‘getCladeRates’ function.

Species distribution data and association with diversification rates

To estimate features of species distributions and to estimate niche space, georeferenced locality data were obtained for 4,887 collections of Neotropical Phlegmariurus .

Specimen data were obtained from the GBIF and Tropicos databases and from examination of herbarium material at AAU, COL, FMB, GH, HUA, MEXU, NY, PSO, and VT. All collection data were reviewed and both duplicate collections and specimens from beyond the known range of the species that appeared to be misidentified were deleted. Following deletion of erroneous data, 2,974 collections remained, ranging from 2 for Phlegmariurus tryoniorum to 324 for Phlegmariurus reflexus . In total, we estimated four features of species distributions and niche occupancy: mean elevation, elevational range, species range size, and niche breadth. Mean elevation and elevational range were calculated from values provided on collection labels or estimated using lat/long coordinates and the ‘elevation’ function in R. Range size was estimated by applying a 5 km buffer around each locality point using the ‘gBuffer’ function in the ‘rgeos’ (Bivand et al ., 2017) package in R, following the methodology of Anacker and Strauss (2014). To calculate niche breadth, we calculated niche models for each species using locality data and climate layers obtained from the CHELSA (Karger et al ., 2017) dataset. Using these data, we extracted four bioclimatic variables that were the strongest uncorrelated predictors of the species environmental niche model: annual temperature, annual precipitation, seasonality of temperature, and seasonality of precipitation. Niche breadth 91 was calculated using ENMTools (Warren et al ., 2010) using Levins’ (1968) B metric.

The correlations between these variables and species diversification rates were examined with phylogenetically independent contrasts (Felsenstein, 1985) implemented in the R package ‘ape’ (Paradis et al ., 2004); range-size data were log-transformed prior to analysis to overcome their skewed distribution. Trait variables were plotted on the phylogeny of Neotropical Phlegmariurus using the ‘plotTree.wBars’ function in

‘phytools’ (Revell, 2012).

Orogeny-dependent diversification

We tested for an association between the uplift of the Andes and diversification rates in

Neotropical Phlegmariurus by comparing a series of time-dependent diversification models that allow speciation and/or extinction to vary with the paleoelevation of the

Andes against constant diversification null models. Paleoelevation data were obtained from the list compiled by Lagomarsino et al . (2016); which is based on historical elevation estimates from Garzione et al . (2006; 2008; 2014), Ehlers and Poulsen (2009) and Leier et al ., 2013). These data are available in the Supplementary Materials. A smoothing line fitting these data was generated using the R package ‘pspline’ and this line was used to provide the best estimate of Andean paleoelevation at any given time point. A total of eight paleoelevation-dependent diversification models were applied; four with exponential dependency and four with linear dependency. Two null models were also generated: a Yule model and a constant-rate birth-death model. Models were compared and the best-fitting model was selected using the corrected Akaike Information

Criterion. These models were implemented in the R package ‘RPANDA’ (Morlon et al ., 92

2016) and are based on the environment-dependent birth-death model described by

Condamine et al . (2013). All models, including parameters and comparison metrics, are provided in Table 2.

To visualize the accumulation of lineage diversity in Neotropical Phlegmariurus through time and compare that rate to patterns of lineage accumulation expected under constant- rate null models, a log-lineage-through-time plot (LTT) was generated for the time- calibrated Phlegmariurus phylogeny as well as for two simulated trees of the same age and taxon richness. One simulated tree was generated under a Yule model (birth rate = 1, death rate = 0), and another was generated under a birth-death model (birth rate = 1, death rate = 0.5). Simulated trees were generated using the “LTT” function and all LTT plots were generated using the “ltt.plot” function in “ape” (Paradis et al ., 2004).

RESULTS

Net diversification tip rates varied from 0.097 events MY -1 for Phlegmariurus ericifolius to 0.308 events MY -1 for Phlegmariurus columnaris ; rates were generally lowest in members of the Phlegmariurus aqualupianus group and highest in the Phlegmariurus crassus group. The fastest diversifying and most species-rich clades in the genus tend to be present at high elevations (Figs. 10, 11); however, there are exceptions to this pattern.

Phylogenetic independent contrasts indicated a significant negative correlation between diversification rates and species range size (Figs. 12A, 13A), nonsignificant correlations between diversification rates and both elevational range and niche breadth (Figs. 12B-C,

13B-C), and a significant positive correlation between diversification rates and mean elevation (Figs. 12D, 13D). 93

LTT plots indicate that lineage accumulation in Neotropical Phlegmariurus occurred at a slower rate than would be expected under either of the constant-rate simulations (Fig. 11) until the late Miocene (ca. 10 MYA), when diversity began to rapidly accumulate. The timing of this shift corresponds closely with our paleoelevation estimates (Fig. 11, green dotted line) of the time point at which the Andes reached the approximate elevation of the modern forest/alpine ecosystem boundary, as well as the crown age of the species-rich alpine Phlegmariurus crassus species group (Fig. 11, in red).

Comparison of ten time-dependent diversification models indicated that the best-fit diversification model included a positive, exponential association between speciation rates and the paleoelevation of the Andes, with no extinction (-lnL = -298.362, AICc =

600.84). As shown in Table 2, all paleoelevation-dependent models outperformed both the Yule and birth-death null models.

DISCUSSION

With unparalleled species richness and high levels of endemism, the Andes have long been recognized as one of the world’s foremost biodiversity hotspots. In recent years, researchers have sought to understand the exceptional biodiversity of this region by studying the rapid diversification of an array of Andean lineages within a phylogenetic context. Among plants, nearly all studies on Andean radiations have focused on angiosperms (Hughes and Eastwood, 2006; Luebert et al ., 2011; Antonelli et al ., 2009;

Nürk et al ., 2013; Luebert and Weigend, 2014; Lagomarsino et al ., Salariato et al ., 2016;

Diazgranados and Barber, 2017); other groups have received little attention (but see 94

Kreier et al ., 2008; McHenry and Barrington, 2014; Sánchez-Baracaldo and Thomas,

2014). Though extensive study of angiosperms is warranted given their exceptional diversity in the Andes and elsewhere and the phenomenal radiations of some flowering plant groups (Madriñan et al ., 2013), studying other plant groups in this context is important in order to generate a more synthetic understanding of the timing and mode of diversification of plants in the Andes. By examining the drivers of diversification in

Neotropical Phlegmariurus , we partly address this taxonomic unevenness in our knowledge and provide a first step towards understanding the complex evolutionary history of one of the most diverse groups of spore-dispersed vascular plants in the tropical Andes.

Lineage diversification rates vary widely across Neotropical Phlegmariurus , and these rates are strongly correlated with the size of species ranges and the mean elevation at which species are distributed. Taken together, the fastest diversifying lineages of

Neotropical Phlegmariurus tend to comprise species with narrow ranges that are distributed at high elevations (Figs. 10, 12A, D, 13A, D). The pattern of rapid diversification among high-elevation taxa is consistent with the hypothesis of a rapid recent diversification of members of the Phlegmariurus crassus species group in alpine grasslands, primarily in the tropical Andes. These high-elevation habitats only became available for colonization around the Pliocene/Pleistocene boundary (Gregory-Wodzicki,

2000), meaning that the species-rich Phlegmariurus crassus group (Fig. 10), which is specialized to these habitats, must have undergone a recent and rapid diversification.

How Neotropical Phlegmariurus colonized Andean alpine habitats can be inferred from its sister groups. The sister group to the Phlegmariurus crassus group is the 95

Phlegmariurus reflexus group, which comprises an array of generalist terrestrial species that are common in disturbed mid- and high-elevation terrestrial habitats. These two species groups are in turn sister to the large clade of mostly epiphytic species (Field et al .,

2016; Testo et al ., in press), suggesting that colonization of Andean alpine habitats likely resulted from range expansion by a lineage that had previously transitioned to terrestrial growth from epiphytism and occupied disturbed habitats near the forest limit. The strong negative correlation between diversification rates and species range size (and negative correlation between range size and mean elevation of species’ distributions) highlights another important feature of this recent diversification: the isolated nature of páramo habitats. Given the complex topography of the Andes and the restriction of alpine habitats to high (generally > 3200 m) elevations, páramos are generally small and scattered on the landscape; thus, they have often been considered habitat islands, surrounded by a “sea” of tropical forest and dry valleys. The patchiness of this habitat type thus promotes speciation, as populations are highly isolated: consequently, species turnover is high across páramos and a large proportion of taxa have narrow ranges. As in other plant groups such as lupines (Hughes and Eastwood, 2006), St. John’s worts (Nürk et al .,

2013), and frailejones (Diazgranados and Barber, 2017), recently formed and patchily distributed alpine habitats in the tropical Andes appear to be hotbeds of rapid diversification in Neotropical Phlegmariurus .

We found no evidence of significant associations between diversification rates and elevational range or niche breadth (Figs. 12B-C, 13B-C). These results were surprising, as we anticipated that species with small ranges would also have small elevational ranges and narrow niches. Instead, we found that these attributes were not strongly associated, 96 and that many species with broad ranges were restricted to rather narrow altitudinal bands and had narrow niches. Conversely, some species with medium-sized to small distributions were found along large elevational gradients and exhibited rather broad niches. Though there are many possible explanations for this pattern, a few scenarios seem likely; we consider those here.

First, given the extremely young ages of most species in the alpine-adapted and rapidly diversifying Phlegmariurus crassus clade, these lineages may simply not have persisted long enough to have engaged in niche partitioning and instead occupy the entire available niche space and elevational range available at a local scale. Species in this group therefore are segregated primarily by geographic isolation rather than ecological specialization within a given páramo system; ongoing niche differentiation may contribute to the rather unclear species boundaries in this group. In contrast, species in older, primarily forest-dwelling clades which are generally more well-defined ecologically appear to exhibit strong niche separation, and even taxa with rather broad distributions are specialists with restricted niches, such as high-canopy epiphytes (e.g.

Phlegmariurus pithyoides ) or very humid high-elevation forests (e.g., Phlegmariurus subulatus , P. tenuis ). The occupation of broad geographical distributions while maintaining narrow ecological niches may be possible for these forest-dwelling epiphytic taxa because of the continuity of their preferred habitat types in relatively narrow elevational bands throughout the American tropics, especially in comparison to the patchy distribution of alpine grasslands in the same region. This pattern is doubtlessly complemented by strong stratification within the epiphytic niche, which may allow

97 several species with distinct niches to persist locally, even on a single host tree (Krömer et al ., 2007; Watkins and Cardelús, 2009).

Second, it is almost certain that our metric of niche space incompletely represents the realized niche of the studied species. Although the climate-layer dataset we used appears to outperform earlier datasets, especially in the tropics, where orographic effects have a strong impact on local climate (Karger et al ., 2017), global-level climate datasets fail to completely characterize species niches in many cases, especially for habitat specialists and epiphytic taxa (Potter et al ., 2013; Dymytrova et al ., 2016). Given the affinities of many Phlegmariurus species to distinct microhabitats and the generally patchy distribution of individual plants within seemingly suitable habitat (Øllgaard, 1995), it may be important to include finer-scale microclimate measurements in order to accurately characterize the niches of these taxa. Incorporation of these data may prove especially important in understanding the adaptive radiation of Phlegmariurus in southeastern Brazil (Gissi, 2017), as many of the species comprising this group appear to be highly specialized and narrowly distributed.

Although most studies on the evolution of Andean taxa have recognized the importance of mountain uplift in shaping diversity in these groups, relatively few have explicitly tested for an association between the rise of the Andes and lineage diversification in their study group. We used a paleoenvironmental-dependent diversification model developed by Condamine et al . (2013), recently used in a study of the radiation of Andean bellflowers (Lagomarsino et al ., 2016) to detect such an association in Neotropical

Phlegmariurus , the presence of which was strongly supported by our analyses (Table 2).

The correlation between mountain building and diversification rates in Neotropical 98

Phlegmariurus is not surprising given the high species richness at high elevations in the

Andes, but this insight is important because it represents one of the few attempts to explicitly test for a relationship between lineage diversification and a paleoenvironmental variable. In the case of Neotropical Phlegmariurus , a sustained increase in diversification rates occurred around the late Miocene, coincident with the start of exceptionally rapid uplift in the Andes (Garzione et al ., 2008; Hoorn et al ., 2010) and the expansion of montane forests in the region. This burst of diversification matches the timing of an important event in the evolutionary history of Neotropical Phlegmariurus : a transition to terrestrial growth in the clade comprising the Phlegmariurus reflexus and Phlegmariurus crassus species groups. Thus, rapid diversification among terrestrial Phlegmariurus within the last 10 million years appears to be driven first by increased ecological opportunity as novel habitats became available, and subsequently by the proliferation of isolated alpine habitats as the uplift continued. Nevertheless, additional factors associated with the Andean uplift and habitat availability that were not detected by our analyses certainly played roles in the recent diversification of Andean Phlegmariurus . Foremost among these is the complex history of fluctuating habitat zonation in the Andes in response to cyclical glaciation during the Quaternary (Simpson, 1975; Van der Hammen and Cleef, 1986; Hooghiemstra and Van der Hammen, 2004). Given the dramatic topography of the high Andes and the rapid turnover of habitats along elevational gradients in the tropics (Janzen, 1967; Colwell et al ., 2008), glacial-interglacial cycles had profound impacts on habitat connectivity— and gene flow among populations of organisms—in the high Andes. During periods of glaciation, the lower limits of alpine habitats were depressed, connecting páramos that had previously been isolated and 99 driving compressions of up to 55% in montane forest habitats (Hooghiemstra and Van der Hammen, 2004); forest limits would expand upwards and páramos would again become isolated as glaciers retreated. An important consequence of this cycle of alternating fusion and fragmentation of alpine habitats is that populations have been in intermittent contact with each other, complicating the history of divergence among young evolutionary lineages in the Phlegmariurus crassus species group. Coupled with the slow accumulation of reproductive isolation in pteridophytes (Øllgaard, 1985; Hanušová et al .,

2014; Rothfels et al ., 2015; Sigel, 2016), this fluctuation in habitat connectivity may explain the weak differentiation observed among páramo-dwelling species of

Phlegmariurus . Nonetheless, resolving such recent, complex evolutionary scenarios is difficult (Hughes et al ., 2006; Hughes et al ., 2013), and requires levels of resolution unattainable by datasets typically used in the reconstruction of genus-level phylogenies.

Using a large nuclear dataset, Vargas et al . (2017) demonstrated widespread introgression and hybridization in a rapidly diversifying clade of Andean Diplostephium (Asteraceae) that was undetected with chloroplast and mitochondrial datasets; similar patterns have been demonstrated previously in rapidly diversifying extra-Andean groups, such as

African cichlids (Genner and Turner, 2011; Joyce et al ., 2011), North American sedges

(Escudero et al ., 2014), and Mexican frogs (Streicher et al ., 2014). Application of a similar dataset and approaches should prove illuminating for better understanding the dynamics of recent diversification of Phlegmariurus and other high Andean groups.

100

LITERATURE CITED

Anacker BL, Strauss SY . 2014 . The geography and ecology of plant speciation: range overlap and niche divergence in sister species. Proceedings of the Royal Society of London B: Biological Sciences 281 : 20132980.

Antonelli A . 2015 . Biodiversity: Multiple origins of mountain life. Nature 524 : 300–301.

Antonelli A, Nylander JAA, Persson C, Sanmartín I . 2009 . Tracing the impact of the Andean uplift on Neotropical plant evolution. Proceedings of the National Academy of Sciences 106 : 9749–9754.

Bivand R, Rundel C, Pebesma E, Hufthammer K, Bivand M . 2017 . R package ‘regeos’ .

Castroviejo-Fisher S, Guayasamin JM, Gonzalez-Voyer A, Vilà C . 2014 . Neotropical diversification seen through glassfrogs. Journal of Biogeography 41 : 66–80.

Colwell RK, Brehm G, Cardelús CL, Gilman AC, Longino JT . 2008 . Global warming, elevational range shifts, and lowland biotic attrition in the wet tropics. Science 322 : 258–261.

Condamine FL, Rolland J, Morlon H . 2013 . Macroevolutionary perspectives to environmental change. Ecology Letters 16 : 72–85.

Diazgranados M, Barber JC . 2017 . Geography shapes the phylogeny of frailejones (Espeletiinae Cuatrec., Asteraceae): a remarkable example of recent rapid radiation in sky islands. PeerJ 5: e2968.

Doan TM . 2003 . A south-to-north biogeographic hypothesis for Andean speciation: evidence from the lizard genus Proctoporus (Reptilia, Gymnophthalmidae). Journal of Biogeography 30 : 361–374.

Dymytrova L, Stofer S, Ginzler C, Breiner FT, Scheidegger C . 2016 . Forest-structure data improve distribution models of threatened habitat specialists: Implications for conservation of epiphytic lichens in forest landscapes. Biological Conservation 196 : 31– 38.

Ehlers TA, Poulsen CJ . 2009 . Influence of Andean uplift on climate and paleoaltimetry estimates. Earth and Planetary Science Letters 281 : 238–248.

Elias M, Joron M, Willmott K, Silva-Brandão KL, Kaiser V, Arias CF, Piñerez LMG, Uribe S, Brower AVZ, Freitas AVL, et al. 2009 . Out of the Andes: patterns of diversification in clearwing butterflies. Molecular Ecology 18 : 1716–1729.

101

Escudero M, Eaton DAR, Hahn M, Hipp AL . 2014 . Genotyping-by-sequencing as a tool to infer phylogeny and ancestral hybridization: A case study in Carex (Cyperaceae). Molecular Phylogenetics and Evolution 79 : 359–367.

Felsenstein J . 1985 . Phylogenies and the Comparative Method. The American Naturalist 125 : 1–15.

Fjeldså J, Bowie RCK, Rahbek C . 2012 . The Role of Mountain Ranges in the Diversification of Birds. Annual Review of Ecology, Evolution, and Systematics 43 : 249– 265.

Garcı́a-Moreno J, Arctander P, Fjeldså J . 1999 . A Case of Rapid Diversification in the Neotropics: Phylogenetic Relationships among Cranioleuca Spinetails (Aves, Furnariidae). Molecular Phylogenetics and Evolution 12 : 273–281.

Garzione CN, Auerbach DJ, Jin-Sook Smith J, Rosario JJ, Passey BH, Jordan TE, Eiler JM . 2014 . Clumped isotope evidence for diachronous surface cooling of the Altiplano and pulsed surface uplift of the Central Andes. Earth and Planetary Science Letters 393 : 173–181.

Garzione CN, Hoke GD, Libarkin JC, Withers S, MacFadden B, Eiler J, Ghosh P, Mulch A . 2008 . Rise of the Andes. Science 320 : 1304–1307.

Garzione CN, Molnar P, Libarkin JC, MacFadden BJ . 2006 . Rapid late Miocene rise of the Bolivian Altiplano: Evidence for removal of mantle lithosphere. Earth and Planetary Science Letters 241 : 543–556.

Genner MJ, Turner GF . 2012 . Ancient hybridization and phenotypic novelty within Lake Malawi’s cichlid fish radiation. Molecular Biology and Evolution 29 : 195–206.

Gissi DS . 2017 . Phylogeny of Phlegmariurus (Lycopodiaceae) focusing on Brazilian endemic species.

Gonzalez-Voyer A, Padial JM, Castroviejo-Fisher S, De La Riva I, Vilà C . 2011 . Correlates of species richness in the largest Neotropical amphibian radiation. Journal of Evolutionary Biology 24 : 931–942.

Gregory-Wodzicki KM . 2000 . Uplift history of the Central and Northern Andes: A review. GSA Bulletin 112 : 1091–1105.

102 van der Hammen T, Cleef A . 1986 . Development of the high Andean paramo flora and vegetation. In: High altitude tropical biogeography. Oxford: Oxford University Press, 153–201.

Hanušová K, Ekrt L, Vít P, Kolář F, Urfus T . 2014 . Continuous morphological variation correlated with genome size indicates frequent introgressive hybridization among Diphasiastrum species (Lycopodiaceae) in Central Europe. PLOS ONE 9: e99552.

Hoke GD, Giambiagi LB, Garzione CN, Mahoney JB, Strecker MR . 2014 . Neogene paleoelevation of intermontane basins in a narrow, compressional mountain range, southern Central Andes of Argentina. Earth and Planetary Science Letters 406 : 153–164.

Hoorn C, Mosbrugger V, Mulch A, Antonelli A . 2013 . Biodiversity from mountain building. Nature Geoscience 6: ngeo1742.

Hughes CE, Atchison GW . 2015 . The ubiquity of alpine plant radiations: from the Andes to the Hengduan Mountains. New Phytologist 207 : 275–282.

Hughes CE, Eastwood RJ, Donovan Bailey C . 2006 . From famine to feast? Selecting nuclear DNA sequence loci for plant species-level phylogeny reconstruction. Philosophical Transactions of the Royal Society B: Biological Sciences 361 : 211–225.

Hughes CE, Pennington RT, Antonelli A . 2013 . Neotropical Plant Evolution: Assembling the Big Picture. Botanical Journal of the Linnean Society 171 : 1–18.

Humboldt A, Bonpland A . 1807 . Essai sur la geographie des plantes . Paris.

Janzen DH . 1967 . Why Mountain Passes are Higher in the Tropics. The American Naturalist 101 : 233–249.

Joyce DA, Lunt DH, Genner MJ, Turner GF, Bills R, Seehausen O . 2011 . Repeated colonization and hybridization in Lake Malawi cichlids. Current Biology 21 : R108– R109.

Karger DN, Conrad O, Böhner J, Kawohl T, Kreft H, Soria-Auza RW, Zimmermann NE, Linder HP, Kessler M . 2017 . Climatologies at high resolution for the earth’s land surface areas. Scientific Data 4.

103

Krömer T, Kessler M, Gradstein SR . 2007 . Vertical stratification of vascular epiphytes in submontane and montane forest of the Bolivian Andes: the importance of the understory. Plant Ecology 189 : 261–278.

Lagomarsino LP, Condamine FL, Antonelli A, Mulch A, Davis CC . 2016 . The abiotic and biotic drivers of rapid diversification in Andean bellflowers (Campanulaceae). New Phytologist 210 : 1430–1442.

Leavitt SD, Esslinger TL, Divakar PK, Lumbsch HT . 2012 . Miocene divergence, phenotypically cryptic lineages, and contrasting distribution patterns in common lichen- forming fungi (Ascomycota: Parmeliaceae). Biological Journal of the Linnean Society 107 : 920–937.

Leier A, McQuarrie N, Garzione C, Eiler J . 2013 . Stable isotope evidence for multiple pulses of rapid surface uplift in the Central Andes, Bolivia. Earth and Planetary Science Letters 371 –372 : 49–58.

Levins R . 1968 . Evolution in Changing Environments . Princeton, New Jersey: Princeton University Press.

Luebert F, Hilger HH, Weigend M . 2011 . Diversification in the Andes: Age and origins of South American Heliotropium lineages (Heliotropiaceae, Boraginales). Molecular Phylogenetics and Evolution 61 : 90–102.

Luebert F, Weigend M . 2014 . Phylogenetic insights into Andean plant diversification. Frontiers in Ecology and Evolution 2.

Madriñán S, Cortés AJ, Richardson JE . 2013 . Páramo is the world’s fastest evolving and coolest biodiversity hotspot. Frontiers in Genetics 4.

Matzke NJ . 2013 . Probabilistic Historical Biogeography: New Models for Founder- Event Speciation, Imperfect Detection, and Fossils Allow Improved Accuracy and Model-Testing.

104

McGuire JA, Witt CC, Altshuler DL, Remsen JV, Zamudio K, Sullivan J . 2007 . Phylogenetic Systematics and Biogeography of Hummingbirds: Bayesian and Maximum Likelihood Analyses of Partitioned Data and Selection of an Appropriate Partitioning Strategy. Systematic Biology 56 : 837–856.

McGuire JA, Witt CC, Remsen JV, Corl A, Rabosky DL, Altshuler DL, Dudley R . 2014 . Molecular Phylogenetics and the Diversification of Hummingbirds. Current Biology 24 : 910–916.

McHenry MA, Barrington DS . 2014 . Phylogeny and biogeography of exindusiate Andean Polystichum (Dryopteridaceae). American Journal of Botany 101 : 365–375.

Morlon H . 2014 . Phylogenetic approaches for studying diversification. Ecology Letters 17 : 508–525.

Morlon H, Lewitus E, Condamine FL, Manceau M, Clavel J, Drury J . 2016 . RPANDA: an R package for macroevolutionary analyses on phylogenetic trees. Methods in Ecology and Evolution 7: 589–597.

Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Kent J . 2000 . Biodiversity hotspots for conservation priorities. Nature 403 : 853–858.

Nürk NM, Madriñán S, Carine MA, Chase MW, Blattner FR . 2013 . Molecular phylogenetics and morphological evolution of St. John’s wort ( Hypericum ; Hypericaceae). Molecular Phylogenetics and Evolution 66 : 1–16.

Øllgaard B . 1985 . Observations on the ecology of hybridisation in the clubmosses (Lycopodiaceae). Proceedings of the Royal Society of Edinburgh, Section B: Biological Sciences 86 : 245–251.

Øllgaard B . 1992 . Neotropical Lycopodiaceae-An Overview. Annals of the Missouri Botanical Garden 79 : 687–717.

Paradis E, Claude J, Strimmer K . 2004 . APE: Analyses of Phylogenetics and Evolution in R language. Bioinformatics 20 : 289–290.

Rabosky DL . 2014 . Automatic Detection of Key Innovations, Rate Shifts, and Diversity- Dependence on Phylogenetic Trees. PLOS ONE 9: e89543.

Rabosky DL, Title PO, Huang H . 2015 . Minimal effects of latitude on present-day speciation rates in New World birds. Proc. R. Soc. B 282 : 20142889.

105

R Core Team . 2014 . R: a language and environment for statistical computing .

Revell LJ . 2012 . Phytools: an R package for phylogenetic comparative biology (and other things). Methods in Ecology and Evolution 3: 217–223.

Rothfels CJ, Johnson AK, Hovenkamp PH, Swofford DL, Roskam HC, Fraser- Jenkins CR, Windham MD, Pryer KM . 2015 . Natural Hybridization between Genera That Diverged from Each Other Approximately 60 Million Years Ago. The American Naturalist 185 : 433–442.

Salariato DL, Zuloaga FO, Franzke A, Mummenhoff K, Al-Shehbaz IA . 2016 . Diversification patterns in the CES clade (Brassicaceae tribes Cremolobeae, Eudemeae, Schizopetaleae) in Andean South America. Botanical Journal of the Linnean Society 181 : 543–566.

Sánchez-Baracaldo P, Thomas GH . 2014 . Adaptation and Convergent Evolution within the Jamesonia -Eriosorus Complex in High-Elevation Biodiverse Andean Hotspots. PLOS ONE 9: e110618.

Schwery O, Onstein RE, Bouchenak-Khelladi Y, Xing Y, Carter RJ, Linder HP . 2015 . As old as the mountains: the radiations of the Ericaceae. New Phytologist 207 : 355–367.

Sigel EM . 2016 . Genetic and genomic aspects of hybridization in ferns. Journal of Systematics and Evolution 54 : 638–655.

Simpson BB . 1975 . Pleistocene changes in the flora of the high tropical Andes. Paleobiology 1: 273–294.

Spehn EM, Rudmann-Maurer K, Korner C, Maselli D . 2012 . Mountain biodiversity and global change . GMBA.

Streicher JW, Devitt TJ, Goldberg CS, Malone JH, Blackmon H, Fujita MK . 2014 . Diversification and asymmetrical gene flow across time and space: lineage sorting and hybridization in polytypic barking frogs. Molecular Ecology 23 : 3273–3291.

Vargas OM, Ortiz EM, Simpson BB . 2017 . Conflicting phylogenomic signals reveal a pattern of reticulate evolution in a recent high-Andean diversification (Asteraceae: Astereae: Diplostephium ). New Phytologist 214 : 1736–1750.

Watkins JE, Cardelús C . 2009 . Habitat Differentiation of Ferns in a Lowland Tropical Rain Forest. American Fern Journal 99 : 162–175.

Xing Y, Ree RH . 2017 . Uplift-driven diversification in the Hengduan Mountains, a temperate biodiversity hotspot. Proceedings of the National Academy of Sciences 114 : E3444–E3451. 106

Aligned PCR conditions Marker length Best model Primers [denat./anneal/exten.] petG-trnP 656 TIM1+I+G GATGTAGCGCAGCTTGGTAGC (f), 45/45/60 ATGGTTGAAGCTCTCTTATCCGG (r) 94/55/72 psbA-trnH 419 K80+G GTTATGCATGAACGTAATGCTC (f), 45/45/60 CGCGCATGGATTCACAATCC (r) 94/48/72 rbcL 1417 TIM1+I+G ATGTCACAAACGGAGACTAAAGC (f), 45/45/90 TCAGGACTCCACTTACTAGCTTCACG (r) 94/53/72 rps4-trnS 657 GTR+I+G ATGTCCCGTTATCGAGGACCTC (f), 45/45/60 TTACCGAGGGTTCGAATCCCTC (r) 94/55/72 trnL 510 F81+G CGAAATCGGTAGACGCTACG (f), 45/45/60 GGGGATAGAGGGACTTGAAC (r) 94/52/72 trnL-trnF 862 GTR+I+G GGTTCAAGTCCCTCTATCCC (f), 45/45/60 ATTTGAACTGGTGACACGAG (r) 94/55/72

107

Table 2. Comparison of paleoelevation-dependent diversification models implemented in

RPANDA.

Models Mode of dependency # Params. logL AICc ΔAICc Lambda Mu

1 λ with elev., no µ Exponential 2 -298.36 600.84 0.00 0.04 -

2 λ with elev., µ constant Exponential 3 -298.36 602.96 2.12 0.04 0.00

3 λ with elev., no µ Linear 2 -299.93 603.98 3.14 0.10 -

4 λ and µ with elev. Exponential 4 -298.10 604.60 3.75 0.04 0.06

5 λ with elev., µ constant Linear 3 -299.94 606.12 5.28 0.10 0.00

6 λ constant, µ with elev. Linear 3 -299.93 606.35 5.51 0.03 0.01

7 λ and µ with elev. Linear 4 -299.93 608.26 7.42 0.10 0.04

8 λ constant, µ with elev. Exponential 3 -308.22 622.68 21.84 0.20 0.09

9 λ and µ constant - 2 -322.75 644.58 43.74 0.09 0.00

10 λ constant, no µ - 1 -356.57 659.86 59.02 0.07 -

108

109

Figure 2. Comparison of crown age distributions from select clades in the

Lycopodiaceae. Distributions are kernel-density plots of mean ages obtained across the

MCMC runs under each clock model.

110

111

Figure 4. Major vicariance events and the biogeography of Lycopodiaceae subfamily

Huperzioideae from 200 MYA to the present.

112

Figure 5. Representative diversity of Neotropical Phlegmariurus . A. P. myrsinites

(Phlegmariurus aqualupianus group), B. P. taxifolius (Phlegmariurus taxifolius group),

C. P. mooreanus (Phlegmariurus ruber group), D. P. hippurideus (Phlegmariurus dichotomus group), E. P. talamancanus (Phlegmariurus crassus group), F. P. linifolius

(Phlegmariurus linifolius group), G. P. brevifolius (Phlegmariurus crassus group), H. P. acerosus (Phlegmariurus acerosus group). Photos credits: A, B, D: Michael Sundue; C,

F, H: Fernando Matos; E, G: Weston Testo.

113

Figure 6. Best-scoring ML phylogeny of Neotropical Phlegmariurus . Support values above branches are Bayesian posterior probabilities (PP); values below branches are ML bootstrap percentages (BS). Asterisks indicate PP = 1.0 and BS = 100%; branches without support values indicate nodes with PP < 0.5 or BS < 50%. Dashed branches have branch lengths that are scaled down by a factor of 10 for visualization purposes. 114

Figure 7. Species groups described by Øllgaard (1987, 1992) and those proposed here mapped onto our best-scoring ML phylogeny of Neotropical Phlegmariurus .

115

Figure 8. Phylogenetic reconstruction of discrete morphological traits in Neotropical

Phlegmariurus . Pie charts represent probability of each character state at the corresponding node, as inferred under maximum-likelihood using the Mk1 model of evolution. Traits are: A. fertile-sterile leaf dimorphy, B. leaf margin toothiness, C. growth habit, D. stem coloration.

116

Figure 9. Phylogenetic reconstruction of continuous morphological traits in Neotropical

Phlegmariurus as inferred under maximum-likelihood and mapped with continuous change along branches. Values were log-transformed and traits are: A. stem thickness, B. leaf length/width ratio.

117

Figure 10. Elevation and diversity in species groups of Neotropical Phlegmariurus .

Circles represent species groups in the genus, circle size is relative to group species richness. Species group elevation and net diversification rate values are means obtained from all representatives in the group that were included in this study.

118

Figure 11. Diversification dynamics of Neotropical Phlegmariurus . The clade highlighted in red on the time-calibrated phylogeny is the Phlegmariurus crassus species group. The green dotted line represents the spline of paleoelevational estimates obtained from geological data, as described in the Methods. The red and blue lines are log-lineage- through-time plots simulated under birth-death and pure birth (Yule) models of diversification, respectively. The yellow line is a log-lineage-through-time plot for the time-calibrated phylogeny of Neotropical Phlegmariurus used in this study. The horizontal gray dotted line marks the approximate current elevation of treeline in the tropical Andes.

119

120

Figure 13. Association between net diversification rates and (A) range size, (B) elevational range, (C), niche breadth, and (D) mean elevation provided for Neotropical

Phlegmariurus species. R 2 and P-values provided are from phylogenetic independent contrasts

121

COMPREHENSIVE LITERATURE CITED

Ackerly D . 1990 . Vascular Epiphytes: General Biology and Related Biota . Cambridge, UK: Cambridge University Press.

Andersson L, Kocsis M, Eriksson R . 2006 . Relationships of the genus Azorella (Apiaceae) and other hydrocotyloids inferred from sequence variation in three plastid markers. Taxon 55 : 270–280.

Antonelli A . 2015 . Biodiversity: Multiple origins of mountain life. Nature 524 : 300–301.

Antonelli A, Nylander JAA, Persson C, Sanmartín I. 2009 . Tracing the impact of the Andean uplift on Neotropical plant evolution. Proceedings of the National Academy of Sciences 106 : 9749–9754.

Antonelli A, Sanmartín I . 2011 . Why are there so many plant species in the Neotropics? Taxon 60 : 403–414.

Arana MD . 2016 . Nomenclatural notes on Phlegmariurus dentatus (Lycopodiaceae). Phytotaxa 252 : 298–300.

Baele G, Lemey P, Bedford T, Rambaut A, Suchard MA, Alekseyenko AV . 2012 . Improving the accuracy of demographic and molecular clock model comparison while accommodating phylogenetic uncertainty. Molecular Biology and Evolution 29 : 2157– 2167.

Baele G, Li WLS, Drummond AJ, Suchard MA, Lemey P . 2013 . Accurate model selection of relaxed molecular clocks in Bayesian phylogenetics. Molecular Biology and Evolution 30 : 239–243.

Barker NP, Weston PH, Rutschmann F, Sauquet H . 2007 . Molecular dating of the ‘Gondwanan’ plant family Proteaceae is only partially congruent with the timing of the break-up of Gondwana. Journal of Biogeography 34 : 2012–2027.

Beaulieu JM, O’Meara BC . 2015 . Extinction can be estimated from moderately sized molecular phylogenies. Evolution 69 : 1036–1043.

122

Beaulieu JM, O’Meara BC, Crane P, Donoghue MJ . 2015 . Heterogeneous rates of molecular evolution and diversification could explain the Triassic age estimate forangiosperms. Systematic Biology 64 : 869–878.

Bell CD, Donoghue MJ . 2005 . Phylogeny and biogeography of Valerianaceae (Dipsacales) with special reference to the South American valerians. Organisms Diversity & Evolution 5: 147–159.

Bivand R, Rundel C, Pebesma E, Hufthammer K, Bivand M . 2017 . R package ‘regeos’ .

Brehm G, Hebert PDN, Colwell RK, Adams M-O, Bodner F, Friedemann K, Möckel L, Fiedler K . 2016 . Turning up the heat on a hotspot: DNA barcodes reveal 80% more species of geometrid moths along an Andean elevational gradient. PLOS ONE 11 : e0150327.

Bruce JG . 1976 . Gametophytes and Subgeneric Concepts in Lycopodium . American Journal of Botany 63 : 919–924.

Brumfield RT, Edwards SV . 2007 . Evolution into and out of the Andes: a Bayesian analysis of historical diversification in Thamnophilus antshrikes. Evolution 61 : 346–367.

Castoe TA, Doan TM, Parkinson CL . 2004 . Data partitions and complex models in Bayesian analysis: the phylogeny of Gymnophthalmid lizards. Systematic Biology 53 : 448–469.

Castroviejo-Fisher S, Guayasamin JM, Gonzalez-Voyer A, Vilà C . 2014 . Neotropical diversification seen through glassfrogs. Journal of Biogeography 41 : 66–80.

Chacón J, Madriñán S, Chase MW, Bruhl JJ . 2006 . Molecular phylogenetics of Oreobolus (Cyperaceae) and the origin and diversification of the American species. Taxon 55 : 359–366.

Chardon CE . 1933 . Life zones in the Andes of Venezuela. Bulletin of the Pan American Union 67 : 620.

Chaves JA, Hidalgo JR, Klicka J . 2013 . Biogeography and evolutionary history of the Neotropical genus Saltator (Aves: Thraupini). Journal of Biogeography 40 : 2180–2190.

Cleef AM . 1979 . The phytogeographical position of the neotropical vascular paramo flora with special reference to the Colombian Cordillera Oriental. In: Tropical Botany. Academic Press, 175–184.

123

Clegg MT, Gaut BS, Learn GH, Morton BR . 1994 . Rates and patterns of chloroplast DNA evolution. Proceedings of the National Academy of Sciences 91 : 6795–6801.

Colwell RK, Brehm G, Cardelús CL, Gilman AC, Longino JT . 2008 . Global warming, elevational range shifts, and lowland biotic attrition in the wet tropics. Science 322 : 258–261.

Condamine FL, Rolland J, Morlon H . 2013 . Macroevolutionary perspectives to environmental change. Ecology Letters 16 : 72–85.

Crane PR . 1985 . Phylogenetic relationships in seed plants. Cladistics 1: 329–348.

Crane PR, Herendeen P, Friis EM . 2004 . Fossils and plant phylogeny. American Journal of Botany 91 : 1683–1699.

Cuatrecasas J . 1934 . Observaciones geobotanicas en Colombia. Trabajos del Museos Nacional de Ciencias Naturales 27 : 1–144.

Darriba D, Taboada GL, Doallo R, Posada D . 2012 . jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: 772–772.

Darwin C . 1909 . The voyage of the Beagle . New York: P. F. Collier & Son.

Davis CC, Webb CO, Wurdack KJ, Jaramillo CA, Donoghue MJ . 2005 . Explosive radiation of Malpighiales supports a Mid‐Cretaceous origin of modern tropical rain forests. The American Naturalist 165 : E36–E65.

DeForest Safford H . 1999 . Brazilian Páramos I. An introduction to the physical environment and vegetation of the campos de altitude. Journal of Biogeography 26 : 693– 712. 124

Diazgranados M, Barber JC . 2017 . Geography shapes the phylogeny of frailejones (Espeletiinae Cuatrec., Asteraceae): a remarkable example of recent rapid radiation in sky islands. PeerJ 5: e2968.

DiMichele WA, Stein WE, Bateman RM . 2001 . Ecological sorting of vascular plant classes during the Paleozoic evolutionary radiation. In: Evolutionary Paleoecology: The Ecological Context of Macroevolutionary Change. Columbia University Press.

Doan TM . 2003 . A south-to-north biogeographic hypothesis for Andean speciation: evidence from the lizard genus Proctoporus (Reptilia, Gymnophthalmidae). Journal of Biogeography 30 : 361–374.

Donoghue MJ . 2008 . A phylogenetic perspective on the distribution of plant diversity. Proceedings of the National Academy of Sciences 105 : 11549–11555.

Donoghue MJ, Sanderson MJ . 2015 . Confluence, synnovation, and depauperons in plant diversification. New Phytologist 207 : 260–274.

Dornburg A, Brandley MC, McGowen MR, Near TJ . 2012 . Relaxed clocks and inferences of heterogeneous patterns of nucleotide substitution and divergence time estimates across whales and dolphins (Mammalia: Cetacea). Molecular Biology and Evolution 29 : 721–736.

Doyle J, Doyle J . 1987 . Genomic plant DNA preparation from fresh tissue - the CTAB method. Phytochemical Bulletin 19 : 11.

Drummond AJ, Ho SYW, Phillips MJ, Rambaut A . 2006 . Relaxed phylogenetics and dating with confidence. PLOS Biology 4: e88.

Drummond AJ, Rambaut A . 2007 . BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7: 214.

Drummond AJ, Suchard MA . 2010 . Bayesian random local clocks, or one rate to rule them all. BMC Biology 8: 114.

125

DuBay SG, Witt CC . 2012 . An improved phylogeny of the Andean tit-tyrants (Aves, Tyrannidae): More characters trump sophisticated analyses. Molecular Phylogenetics and Evolution 64 : 285–296.

Dubuisson J, Hennequin S, Douzery EJP, Cranfill RB, Smith AR, Pryer KM . 2003 . rbcL phylogeny of the fern genus Trichomanes (Hymenophyllaceae), with special reference to Neotropical taxa. International Journal of Plant Sciences 164 : 753–761.

Duchêne S, Lanfear R, Ho SYW . 2014 . The impact of calibration and clock-model choice on molecular estimates of divergence times. Molecular Phylogenetics and Evolution 78 : 277–289.

Edwards EJ, Donoghue MJ . 2013 . Is it easy to move and easy to evolve? Evolutionary accessibility and adaptation. Journal of Experimental Botany 64 : 4047–4052.

Ehlers TA, Poulsen CJ . 2009 . Influence of Andean uplift on climate and paleoaltimetry estimates. Earth and Planetary Science Letters 281 : 238–248.

Emadzade K, Lehnebach C, Lockhart P, Hörandl E . 2010 . A molecular phylogeny, morphology and classification of genera of Ranunculeae (Ranunculaceae). Taxon 59 : 809–828.

Emshwiller E . 2002 . Biogeography of the Oxalis tuberosa alliance. The Botanical Review 68 : 128–152.

Felsenstein J . 1985 . Phylogenies and the Comparative Method. The American Naturalist 125 : 1–15.

Feodorova TA, Voznesenskaya EV, Edwards GE, Roalson EH . 2010 . Biogeographic Patterns of Diversification and the Origins of C4 in Cleome (Cleomaceae). Systematic Botany 35 : 811–826.

126

Field AR, Bostock PD . 2013 . New and existing combinations in Palaeotropical Phlegmariurus (Lycopodiaceae) and lectotypification of the type species Phlegmariurus phlegmaria (L.) T.Sen & U.Sen. PhytoKeys : 33–51.

Finet C, Timme RE, Delwiche CF, Marlétaz F . 2010 . Multigene phylogeny of the green lineage reveals the origin and diversification of land plants. Current Biology 20 : 2217–2222.

Fjeldså J, Bowie RCK, Rahbek C . 2012 . The role of mountain ranges in the diversification of birds. Annual Review of Ecology, Evolution, and Systematics 43 : 249– 265.

Frisch W, Meschede M, Sick M . 1992 . Origin of the Central American ophiolites: evidence from paleomagnetic results. GSA Bulletin 104 : 1301–1314.

Funk WC, Caminer M, Ron SR . 2011 . High levels of cryptic species diversity uncovered in Amazonian frogs. Proc. R. Soc. B : rspb20111653.

García-Casco A, Iturralde-Vinent MA, Pindell J . 2008 . Latest Cretaceous collision/accretion between the Caribbean Plate and Caribeana: origin of metamorphic terranes in the Greater Antilles. International Geology Review 50 : 781–809.

Garcı́a-Moreno J, Arctander P, Fjeldså J . 1999 . A case of rapid diversification in the Neotropics: phylogenetic relationships among Cranioleuca spinetails (Aves, Furnariidae). Molecular Phylogenetics and Evolution 12 : 273–281.

Garrat MJ, Rickards RB . 1987 . Pridoli (Silurian) graptolites in association with Baragwanathia (Lycophytina). Bulletin of the Geological Society of Denmark 35 : 135– 139.

Garratt MJ, Tims JD, Rickards RB, Chambers TC, Douglas JG . 1984 . The appearance of Baragwanathia (Lycophytina) in the Silurian. Botanical Journal of the Linnean Society 89 : 355–358.

127

Garzione CN, Auerbach DJ, Jin-Sook Smith J, Rosario JJ, Passey BH, Jordan TE, Eiler JM . 2014. Clumped isotope evidence for diachronous surface cooling of the Altiplano and pulsed surface uplift of the Central Andes. Earth and Planetary Science Letters 393 : 173–181.

Garzione CN, Hoke GD, Libarkin JC, Withers S, MacFadden B, Eiler J, Ghosh P, Mulch A . 2008 . Rise of the Andes. Science 320 : 1304–1307.

Gaut BS, Muse SV, Clark WD, Clegg MT . 1992 . Relative rates of nucleotide substitution at the rbcl locus of monocotyledonous plants. Journal of Molecular Evolution 35 : 292–303.

Genner MJ, Turner GF . 2012 . Ancient hybridization and phenotypic novelty within Lake Malawi’s cichlid fish radiation. Molecular Biology and Evolution 29 : 195–206.

Gentry AH . 1982 . Neotropical floristic diversity: phytogeographical connections between Central and South America, Pleistocene climatic fluctuations, or an accident of the Andean orogeny? Annals of the Missouri Botanical Garden 69 : 557–593.

Giarla TC, Jansa SA . 2015 . The impact of Quaternary climate oscillations on divergence times and historical population sizes in Thylamys opossums from the Andes. Molecular Ecology 24 : 2495–2506.

Giraldo N, Salazar C, Jiggins CD, Bermingham E, Linares M . 2008 . Two sisters in the same dress: Heliconius cryptic species. BMC Evolutionary Biology 8: 324.

Gissi DS . 2017 . Phylogeny of Phlegmariurus (Lycopodiaceae) focusing on Brazilian endemic species.

128

Graham A . 2009 . The andes: a geological overview from a biological perspective. Annals of the Missouri Botanical Garden 96 : 371–385.

Gregory-Wodzicki KM . 2000 . Uplift history of the Central and Northern Andes: A review. GSA Bulletin 112 : 1091–1105.

Guarnizo CE, Paz A, Muñoz-Ortiz A, Flechas SV, Méndez-Narváez J, Crawford AJ . 2015 . DNA barcoding survey of anurans across the Eastern Cordillera of Colombia and the impact of the Andes on cryptic diversity. PLOS ONE 10 : e0127312. von Hagen KB, Kadereit JW . 2001 . The phylogeny of Gentianella (Gentianaceae) and its colonization of the southern hemisphere as revealed by nuclear and chloroplast DNA sequence variation. Organisms Diversity & Evolution 1: 61–79. von Hagen KB, Kadereit JW, Williams CF . 2003 . The diversification of Halenia (Gentianaceae): ecological opportunity versus key innovation. Evolution 57 : 2507–2518.

Hammen TV der . 1989 . History of the montane forests of the northern Andes. In: Woody plants — evolution and distribution since the Tertiary. Springer, Vienna, 109– 114. van der Hammen T, Cleef A . 1986 . Development of the high Andean paramo flora and vegetation. In: High altitude tropical biogeography. Oxford: Oxford University Press, 153–201.

Hartley A . 2003 . Andean uplift and climate change. Journal of the Geological Society 160 : 7–10.

129

Haufler CH, Pryer KM, Schuettpelz E, Sessa EB, Farrar DR, Moran R, Schneller JJ, Watkins JE, Windham MD . 2016 . Sex and the single gametophyte: revising the homosporous vascular plant life cycle in light of contemporary research. BioScience 66 : 928–937.

Holub J . 1985 . Transfers of Lycopodium species to Huperzia : with a note on generic classification in Huperziaceae. Folia Geobotanica et Phytotaxonomica 20 : 67–80.

Hooghiemstra H, Wijninga VM, Cleef AM . 2006 . The paleobotanical record of colombia: implications for biogeography and biodiversity. Annals of the Missouri Botanical Garden 93 : 297–325.

Hoorn C, Mosbrugger V, Mulch A, Antonelli A . 2013 . Biodiversity from mountain building. Nature Geoscience 6: ngeo1742.

Hoorn C, Wesselingh FP, Steege H ter, Bermudez MA, Mora A, Sevink J, Sanmartín I, Sanchez-Meseguer A, Anderson CL, Figueiredo JP, et al. 2010 . Amazonia through time: Andean uplift, climate change, landscape evolution, and biodiversity. Science 330 : 927–931.

Hueber FM . 1992 . Thoughts on the early lycopsids and zosterophylls. Annals of the Missouri Botanical Garden 79 : 474–499.

Hughes CE, Atchison GW . 2015 . The ubiquity of alpine plant radiations: from the Andes to the Hengduan Mountains. New Phytologist 207 : 275–282.

130

Hughes CE, Pennington RT, Antonelli A . 2013 . Neotropical Plant Evolution: Assembling the Big Picture. Botanical Journal of the Linnean Society 171 : 1–18.

Humboldt A . 1820 . Voyage aux regions equinoxiales de Nouveau Continent . Paris.

Humboldt A, Bonpland A . 1807 . Essai sur la geographie des plantes . Paris.

Iturralde-Vinent MA, Gahagan L . 2002 . Latest Eocene to Middle Miocene tectonic evolution of the Caribbean: some principles and their implications for plate tectonic Mmodelling. In: Caribbean Geology: Into the Third Millenium : Transactions of the Fifteenth Caribbean Geological Conference. University of the West Indies Press.

Jabaily RS, Sytsma KJ . 2010 . Phylogenetics of Puya (Bromeliaceae): Placement, major lineages, and evolution of Chilean species. American Journal of Botany 97 : 337–356.

Jabaily RS, Sytsma KJ . 2013 . Historical biogeography and life-history evolution of Andean Puya (Bromeliaceae). Botanical Journal of the Linnean Society 171 : 201–224.

Janzen DH . 1967 . Why mountain passes are higher in the tropics. The American Naturalist 101 : 233–249.

Joyce DA, Lunt DH, Genner MJ, Turner GF, Bills R, Seehausen O . 2011 . Repeated colonization and hybridization in Lake Malawi cichlids. Current Biology 21 : R108– R109.

Katoh K, Misawa K, Kuma K, Miyata T . 2002 . MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30 : 3059–3066.

Kenrick P, Crane P . 1997 . The origin and early diversification of land plants: a cladistic study . Washington, D. C.: Smithsonian Institute Press.

131

Klaus KV, Schulz C, Bauer DS, Stützel T . 2017 . Historical biogeography of the ancient lycophyte genus Selaginella : early adaptation to xeric habitats on Pangea. Cladistics 33 : 469–480.

Koch M, Al-Shehbaz IA . 2002 . Molecular data indicate complex intra- and intercontinental differentiation of American Draba (Brassicaceae). Annals of the Missouri Botanical Garden 89 : 88–109.

König M, Jokat W . 2006 . The Mesozoic breakup of the Weddell Sea. Journal of Geophysical Research: Solid Earth 111 : B12102.

Korall P, Pryer KM . 2014 . Global biogeography of scaly tree ferns (Cyatheaceae): evidence for Gondwanan vicariance and limited transoceanic dispersal. Journal of Biogeography 41 : 402–413.

Lagomarsino LP, Condamine FL, Antonelli A, Mulch A, Davis CC . 2016 . The abiotic and biotic drivers of rapid diversification in Andean bellflowers (Campanulaceae). New Phytologist 210 : 1430–1442.

132

Levins R . 1968 . Evolution in Changing Environments . Princeton, New Jersey: Princeton University Press.

Linder HP, Hardy CR, Rutschmann F . 2005 . Taxon sampling effects in molecular clock dating: An example from the African Restionaceae. Molecular Phylogenetics and Evolution 35 : 569–582.

Lonsdale P . 2005 . Creation of the Cocos and Nazca plates by fission of the Farallon plate. Tectonophysics 404 : 237–264.

Luebert F, Weigend M . 2014 . Phylogenetic insights into Andean plant diversification. Frontiers in Ecology and Evolution 2.

Madriñán S, Cortés AJ, Richardson JE . 2013 . Páramo is the world’s fastest evolving and coolest biodiversity hotspot. Frontiers in Genetics 4.

Magallón S, Sanderson MJ . 2001 . Absolute diversification rates in angiosperm clades. Evolution 55 : 1762–1780.

Magallón SA, Sanderson MJ, Soltis P . 2005 . Angiosperm divergence times: the effect of genes, codon positions, and time constraints. Evolution 59 : 1653–1670. 133

Matzke NJ . 2013 . Probabilistic historical biogeography: new models for founder-event speciation, imperfect detection, and fossils allow improved accuracy and model-testing.

Matzke NJ . 2014 . Model selection in historical biogeography reveals that founder-event speciation is a crucial process in island clades. Systematic Biology 63 : 951–970.

McGuire JA, Witt CC, Altshuler DL, Remsen JV, Zamudio K, Sullivan J . 2007 . Phylogenetic systematics and biogeography of hummingbirds: Bayesian and Maximum Likelihood analyses of partitioned data and selection of an appropriate partitioning strategy. Systematic Biology 56 : 837–856.

McGuire JA, Witt CC, Remsen JV, Corl A, Rabosky DL, Altshuler DL, Dudley R . 2014 . Molecular phylogenetics and the diversification of hummingbirds. Current Biology 24 : 910–916.

McHenry MA, Barrington DS . 2014 . Phylogeny and biogeography of exindusiate Andean Polystichum (Dryopteridaceae). American Journal of Botany 101 : 365–375.

Mickel J, Smith AR . 2004 . Pteridophytes of Mexico . New York Botanical Garden Press.

Miller MA, Pfeiffer W, Schwartz T . 2010 . Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: 2010 Gateway Computing Environments Workshop (GCE). 1–8.

134

Moran RC, Smith AR . 2001 . Phytogeographic relationships between neotropical and African-Madagascan pteridophytes. Brittonia 53 : 304–351.

Morlon H . 2014 . Phylogenetic approaches for studying diversification. Ecology Letters 17 : 508–525.

Morlon H, Lewitus E, Condamine FL, Manceau M, Clavel J, Drury J . 2016 . RPANDA: an R package for macroevolutionary analyses on phylogenetic trees. Methods in Ecology and Evolution 7: 589–597.

Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Kent J . 2000 . Biodiversity hotspots for conservation priorities. Nature 403 : 853–858.

Nagalingum NS, Marshall CR, Quental TB, Rai HS, Little DP, Mathews S . 2011 . Recent Synchronous Radiation of a Living Fossil. Science 334 : 796–799.

Nayar BK, Kaur S . 1971 . Gametophytes of homosporous ferns. The Botanical Review 37 : 295.

Noyes RD . 2000 . Biogeographical and evolutionary insights on Erigeron and allies (Asteraceae) from ITS sequence data. Plant Systematics and Evolution 220 : 93–114.

Øllgaard B . 1982 . A new tropical American species of the genus Lycopodium . American Fern Journal 72 : 53–55.

Øllgaard B . 1985 . Observations on the ecology of hybridisation in the clubmosses (Lycopodiaceae). Proceedings of the Royal Society of Edinburgh, Section B: Biological Sciences 86 : 245–251.

Øllgaard B . 1987 . A revised classification of the Lycopodiaceae s. lat. Opera Botanica 92 : 153–178.

135

Øllgaard B . 1989a . Index of the Lycopodiaceae . Copenhagen: Royal Danish Society of Sciences and Letters.

Øllgaard B . 1989b . New taxa and combinations of Venezuelan Lycopodiaceae. American Fern Journal 79 : 151–154.

Øllgaard B . 1992 . Neotropical Lycopodiaceae-An Overview. Annals of the Missouri Botanical Garden 79 : 687–717.

Øllgaard B . 1993 . Two new Mesoamerican species and a new combination in Huperzia (Lycopodiaceae). Novon 3: 67–72.

Øllgaard B . 1995a . Neotropical Huperzia (Lycopodiaceae): distribution of species richness. In: Proceedings of the Holttum memorial pteridophyte symposium. Pteridology in perspective: pteridophyte symposium ’95. Kew, 93–100.

Øllgaard B . 1995b . Lycopodiaceae. In: Flora Mesoamericana, Vol. 1. Psilotaceae a Salviniaceae. Mexico: Universidad Nacional Autonoma de Mexico.

Øllgaard B . 2003 . Novelties in Neotropical Lycopodiaceae. Nordic Journal of Botany 23 : 31–47.

Øllgaard B . 2012a . Nomenclatural changes in Brazilian Lycopodiaceae. Rodriguésia 63 : 479–482.

Øllgaard B . 2012b . New combinations in Neotropical Lycopodiaceae. Phytotaxa 57 : 10– 22.

Øllgaard B . 2015 . Six new species and some nomenclatural changes in neotropical Lycopodiaceae. Nordic Journal of Botany 33 : 186–196.

Øllgaard B . 2016a . Additions, deletions and changes to the Ecuadorian Lycopodiaceae. Phytotaxa 246 : 93–106.

Øllgaard B . 2016b . New neotropical Lycopodiaceae. Phytotaxa 277 : 266–274.

Øllgaard B, Windisch P . 1987 . Sinopse das Licopodiaceas do Brasil. Bradea 5: 1–43.

Paradis E, Claude J, Strimmer K . 2004 . APE: Analyses of Phylogenetics and Evolution in R language. Bioinformatics 20 : 289–290.

Pereira JBS, Labiak PH, Stützel T, Schulz C . 2017 . Origin and biogeography of the ancient genus Isoëtes with focus on the Neotropics. Botanical Journal of the Linnean Society 185 : 253–271.

136

Pérez-Escobar OA, Gottschling M, Chomicki G, Condamine FL, Klitgård BB, Pansarin E, Gerlach G . 2017 . Andean mountain building did not preclude dispersal of lowland epiphytic orchids in the Neotropics. Scientific Reports 7.

PPG I . 2016 . A community-derived classification for extant lycophytes and ferns. Journal of Systematics and Evolution 54 : 563–603.

Rabosky DL . 2010 . Extinction rates should not be estimated from molecular phylogenies. Evolution 64 : 1816–1824.

Rabosky DL . 2014 . Automatic detection of key innovations, rate shifts, and diversity- dependence on phylogenetic Ttrees. PLOS ONE 9: e89543.

Rabosky DL, Mitchell JS, Chang J . 2017 . Is BAMM flawed? Theoretical and practical concerns in the analysis of multi-rate diversification models. Systematic Biology 66 : 477– 498.

Rabosky DL, Title PO, Huang H . 2015 . Minimal effects of latitude on present-day speciation rates in New World birds. Proc. R. Soc. B 282 : 20142889.

R Core Team . 2014 . R: a language and environment for statistical computing .

Raghavan V . 1989 . Developmental Biology of Fern Gametophytes . Cambridge University Press.

Ree RH, Smith SA, Baker A . 2008 . Maximum likelihood inference of geographic range evolution by dispersal, local extinction, and cladogenesis. Systematic Biology 57 : 4–14.

137

Revell LJ . 2012 . Phytools: an R package for phylogenetic comparative biology (and other things). Methods in Ecology and Evolution 3: 217–223.

Ribeiro V, Werneck FP, Machado RB . 2016 . Distribution dynamics of South American savanna birds in response to Quaternary climate change. Austral Ecology 41 : 768–777.

Richard M. Bateman, Peter R. Crane, William A. DiMichele, Paul R. Kenrick, Nick P. Rowe, Thomas Speck, Stein WE . 1998 . Early evolution of land plants: phylogeny, physiology, and ecology of the primary terrestrial radiation. Annual Review of Ecology and Systematics 29 : 263–292.

Rickards RB . 2000 . The age of the earliest club mosses: the Silurian Baragwanathia flora in Victoria, Australia. Geological Magazine 137 : 207–209.

Rothfels CJ, Johnson AK, Hovenkamp PH, Swofford DL, Roskam HC, Fraser- Jenkins CR, Windham MD, Pryer KM . 2015 . Natural hybridization between genera that diverged from each other approximately 60 million years ago. The American Naturalist 185 : 433–442.

Rothwell GW . 1991 . Botryopteris forensis (Botryopteridaceae), a trunk epiphyte of the tree fern Psaronius . American Journal of Botany 78 : 782–788.

Rubinstein CV, Gerrienne P, de la Puente GS, Astini RA, Steemans P . 2010 . Early Middle Ordovician evidence for land plants in Argentina (eastern Gondwana). New Phytologist 188 : 365–369.

Rutter N, Coronato A, Helmens K, Rabassa J, Zárate M . 2012 . The glacial record of northern South America. In: Springer Briefs in Earth System Sciences. Springer, Dordrecht, 25–34.

138

San Mauro D, Vences M, Alcobendas M, Zardoya R, Meyer A . 2005 . Initial diversification of living amphibians predated the breakup of Pangaea. The American Naturalist 165 : 590–599.

Sánchez-Baracaldo P . 2004 . Phylogenetics and biogeography of the neotropical fern genera Jamesonia and Eriosorus (Pteridaceae). American Journal of Botany 91 : 274–284.

Sánchez-Baracaldo P, Thomas GH . 2014 . Adaptation and convergent evolution within the Jamesonia -Eriosorus complex in high-elevation biodiverse Andean hotspots. PLOS ONE 9: e110618.

Sanderson MJ . 1997 . A nonparametric approach to estimating divergence times in the absence of rate constancy. Molecular Biology and Evolution 14 : 1218–1218.

Scheen A-C, Brochmann C, Brysting AK, Elven R, Morris A, Soltis DE, Soltis PS, Albert VA . 2004 . Northern hemisphere biogeography of Cerastium (Caryophyllaceae): insights from phylogenetic analysis of noncoding plastidnucleotide sequences. American Journal of Botany 91 : 943–952.

Schellart WP, Stegman DR, Farrington RJ, Freeman J, Moresi L . 2010 . Cenozoic tectonics of western North America controlled by evolving width of Farallon Slab. Science 329 : 316–319.

Schneider H, Schuettpelz E, Pryer KM, Cranfill R, al et . 2004 . Ferns diversified in the shadow of angiosperms. Nature; London 428 : 553–557.

139

Schuettpelz E, Pryer KM . 2009 . Evidence for a Cenozoic radiation of ferns in an angiosperm-dominated canopy. Proceedings of the National Academy of Sciences 106 : 11200–11205.

Schwery O, Onstein RE, Bouchenak-Khelladi Y, Xing Y, Carter RJ, Linder HP . 2015 . As old as the mountains: the radiations of the Ericaceae. New Phytologist 207 : 355–367.

Sessa EB, Testo WL, Watkins JE . 2016 . On the widespread capacity for, and functional significance of, extreme inbreeding in ferns. New Phytologist 211 : 1108–1119.

Sigel EM . 2016 . Genetic and genomic aspects of hybridization in ferns. Journal of Systematics and Evolution 54 : 638–655.

Sigloch K, Mihalynuk MG . 2013 . Intra-oceanic subduction shaped the assembly of Cordilleran North America. Nature; London 496 : 50–6.

Simpson BB . 1975 . Pleistocene changes in the flora of the high tropical Andes. Paleobiology 1: 273–294.

Simpson B . 1983 . An historical phytogeography of the high Andean flora. Revista Chilena de Historia Natural 56 : 109–122.

Sklenář P, Dušková E, Balslev H . 2011 . Tropical and temperate: evolutionary history of páramo flora. The Botanical Review 77 : 71–108.

Skog JE . 2001 . Biogeography of Mesozoic leptosporangiate ferns related to extant ferns. Brittonia 53 : 236–269.

Skog JE, Banks HP . 1973 . Ibyka amphikoma , Gen. et sp. n., a new protoarticulate precursor from the Late Middle Devonian of New York State. American Journal of Botany 60 : 366–380.

140

Smith JMB . 1975 . Mountain Grasslands of New Guinea. Journal of Biogeography 2: 27–44.

Smith JMB, Cleef AM . 1988 . Composition and Origins of the World’s Tropicalpine Floras. Journal of Biogeography 15 : 631–645.

Smith AR, Kreier H-P, Haufler CH, Ranker TA, Schneider H . 2006 . Serpocaulon (Polypodiaceae), a new genus segregated from Polypodium . Taxon 55 : 919–930B.

Smith BT, McCormack JE, Cuervo AM, Hickerson MJ, Aleixo A, Cadena CD, Perez-Eman J, Burney CW, Xie X, Harvey MG, et al. 2014 . The drivers of tropical speciation. Nature 515 : 406–406.

Soltis DE, Moore MJ, Burleigh JG, Bell CD, Soltis PS . 2010 . Assembling the angiosperm Tree of Life: progress and future prospects. Annals of the Missouri Botanical Garden 97 : 514–526.

Spehn EM, Rudmann-Maurer K, Korner C, Maselli D . 2012 . Mountain biodiversity and global change . GMBA/BU,BI/SDC.

Springer MS, Murphy WJ, Eizirik E, O’Brien SJ . 2003 . Placental mammal diversification and the Cretaceous–Tertiary boundary. Proceedings of the National Academy of Sciences 100 : 1056–1061.

Stamatakis A . 2006 . RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22 : 2688–2690.

Steemans P, Hérissé AL, Melvin J, Miller MA, Paris F, Verniers J, Wellman CH . 2009 . Origin and Radiation of the Earliest Vascular Land Plants. Science 324 : 353–353.

Swenson U, Hill RS, McLoughlin S . 2001 . Biogeography of Nothofagus Supports the Sequence of Gondwana Break-up. Taxon 50 : 1025–1041.

Taylor EL, Taylor TN, Krings M . 2009 . Paleobotany: The Biology and Evolution of Fossil Plants . Academic Press.

Testo W, Sundue M . 2016 . A 4000-species dataset provides new insight into the evolution of ferns. Molecular Phylogenetics and Evolution 105 : 200–211. 141

Thomas BA . 1997 . Upper Carboniferous herbaceous lycopsids. Review of Palaeobotany and Palynology 95 : 129–153.

Van der Hammen T . 1974 . The Pleistocene Changes of Vegetation and Climate in Tropical South America. Journal of Biogeography 1: 3–26.

Vanderpoorten A, Gradstein SR, Carine MA, Devos N . 2010 . The ghosts of Gondwana and Laurasia in modern liverwort distributions. Biological Reviews 85 : 471– 487.

Villota A, León-Yánez S, Behling H . 2012 . Vegetation and environmental dynamics in the Páramo of Jimbura region in the southeastern Ecuadorian Andes during the late Quaternary. Journal of South American Earth Sciences 40 : 85–93.

Wagner WH, Beitel JM . 1992 . Generic classification of modern North American Lycopodiaceae. Annals of the Missouri Botanical Garden 79 : 676–686.

Wallace AR . 1853 . A narrative of travels on the Amazon and Rio Negro . New York.

Watkins JE, Cardelús C . 2009 . Habitat Differentiation of Ferns in a Lowland Tropical Rain Forest. American Fern Journal 99 : 162–175.

142

Welch JJ, Bromham L . 2005 . Molecular dating when rates vary. Trends in Ecology & Evolution 20 : 320–327.

Wertheim JO, Sanderson MJ . 2011 . Estimating Diversification Rates: How Useful Are Divergence Times? Evolution 65 : 309–320.

Weststrand S . 2016 . Historical biogeography of the heterosporous Selaginellaceae : A tale of pre-Pangean diversifications, Gondwanan vicariance, and Cenozoic long-distance dispersals.

Whittier P . 1981 . Spore Germination and Young Gametophyte Development of Botrychium and Ophioglossum in Axenic Culture. American Fern Journal 71 : 13–19.

Whittier P . 1998 . Germination of Spores of the Lycopodiaceae in Axenic Culture. American Fern Journal 88 : 106–113.

Wikström N, Kenrick P . 1997 . Phylogeny of Lycopodiaceae (Lycopsida) and the Relationships of Phylloglossum drummondii Kunze Based on rbcL Sequences. International Journal of Plant Sciences 158 : 862–871.

Wikström N, Kenrick P, Chase M . 1999 . Epiphytism and terrestrialization in tropicalHuperzia (Lycopodiaceae). Plant Systematics and Evolution 218 : 221–243.

Wilf P, Cúneo NR, Escapa IH, Pol D, Woodburne MO . 2013 . Splendid and Seldom Isolated: The Paleobiogeography of Patagonia. Annual Review of Earth and Planetary Sciences 41 : 561–603.

143

Wolf PG, Schneider H, Ranker TA . 2001 . Geographic distributions of homosporous ferns: does dispersal obscure evidence of vicariance? Journal of Biogeography 28 : 263– 270.

Won H, Renner SS, Linder P . 2006 . Dating dispersal and radiation in the gymnosperm Gnetum (Gnetales)—clock calibration when outgroup relationships are uncertain. Systematic Biology 55 : 610–622.

Wu Z, Hong D, Raven PH (Eds.) . 2013 . Flora of China, Text Volume 2-3, Lycopodiaceae through Polypodiaceae . Beijing : St. Louis: Science Press.

Xing Y, Ree RH . 2017 . Uplift-driven diversification in the Hengduan Mountains, a temperate biodiversity hotspot. Proceedings of the National Academy of Sciences 114 : E3444–E3451.

Yang Z, Rannala B . 2006 . Bayesian estimation of species divergence times under a molecular clock using multiple fossil calibrations with soft bounds. Molecular Biology and Evolution 23 : 212–226.

Zheng Y, Wiens JJ . 2015 . Do missing data influence the accuracy of divergence-time estimation with BEAST? Molecular Phylogenetics and Evolution 85 : 41–49.

144

Appendix 1. Vouchers and GenBank accession numbers of specimens used in this study. Accessions are presented as follows: taxon, voucher, trnP -petG accession number, psbA -trnH accession number, rbcL accession number, rps4 accession number, trnL accession number, trnL -trnF accession number. Asterisks indicate missing data.

Alsophila spinulosa, FJ556581, FJ556581, FJ556581, FJ556581, FJ556581, FJ556581; Amborella trichopoda, NC005086, NC005086, NC005086, NC005086, NC005086, NC005086; Ananas comosus, KR336549, KR336549, KR336549, KR336549, KR336549, KR336549; Aneura mirabilis, EU043314, EU043314, EU043314, EU043314, EU043314, EU043314; Angiopteris evecta, DQ821119, DQ821119, DQ821119, DQ821119, DQ821119, DQ821119; Austrolycopodium fastigiatum, Wikströ 246 (S), *, *, AJ133252, *, AJ224595, *; Austrolycopodium magellanicum, Øllgaard 100621 (AAU), MG560272, MG560377, AJ133251, MG560549, AJ224594, MG560698; Botrychium ternatum, KM817789, KM817789, KM817789, KM817789, KM817789, KM817789; Brassica juncea, KT581449, KT581449, KT581449, KT581449, KT581449, KT581449; Cycas debaoensis, KU743927, KU743927, KU743927, KU743927, KU743927, KU743927; Cycas revoluta, NC020319, NC020319, NC020319, NC020319, NC020319, NC020319; Dendrolycopodium dendroideum, Testo 405 (VT), MG560273, MG560378, MG560489, MG560550, MG560637, MG560699; Dendrolycopodium hickeyii, Testo 1219 (VT), *, *, *, *, *, MG560700; Dendrolycopodium obscurum, Eriksson 666 (GH), *, AB575310, AB574634, *, AJ224598, *; Diphasiastrum alpinum, Eriksson 699 (S), *, *, AJ133250, AM777778, GQ244843, *; Diphasiastrum complanatum, Testo 1465 (VT), *, AB575304, AB574627, *, *, *; Diphasiastrum digitatum, Testo 404 (VT), MG560274, MG560379, MG560490, MG560551, MG560638, *; Diphasiastrum henryanum, Wood 6544 (NTBG), *, *, *, AM777785, *, *; Diphasiastrum issleri, Aagaard & Wikströ LT1 (UPS), *, *, *, AM777787, *, *; Diphasiastrum madeirense, Rumsey MAD-3 (PT), *, *, *, AM777788, *, *; Diphasiastrum nikoense, Mishuzima P13854 (S), *, AB575309, AB574633, AM777789, *, *; Diphasiastrum oellgaardii, Aagaard & Wikströ CdFc3 (UPS), *, *, *, AM777790, *, *; Diphasiastrum sabinifolium, Vogel SAB-14 (UU), *, *, *, AM777791, *, *; Diphasiastrum sitchense, Gilman 15051 (VT), MG560275, MG560380, *, *, *, *; Diphasiastrum thyoides, Sundue 3543 (VT), MG560276, MG560381, *, *, MG560552, MG560639; Diphasiastrum tristachyum, Testo 949 (VT), *, *, *, *, *, MG560701; Diphasiastrum veitchii, Zhang 3433 (PE), *, *, *, AM777796, *, *; Diphasiastrum wightianum, Sundue 3705 (VT), *, KT749939, AJ133254, AM777797, AJ224600, *; Diphasiastrum zeilleri, Aagaard ZSK6 (UU), *, *, *, AM777800, *, *; Diphasium jussiaei, Rothfels 3601 (DUKE), MG560277, MG560382, *, MG560553, MG560640, MG560702; Diphasium scariosum, Nagalingum s.n. (DUKE), MG560278, *, MG560491, MG560554, MG560641, MG560703; Diplopterygium glaucum, NC024158, NC024158, NC024158, NC024158, NC024158, NC024158; Ephedra foeminea, NC029347, NC029347, NC029347, NC029347, NC029347, NC029347; Equisetum arvense, NC014699, NC014699, NC014699, NC014699, NC014699, NC014699; Equisetum hyemale, NC020146, NC020146, NC020146, NC020146, NC020146, NC020146; Ginkgo biloba, JN867585, JN867585, JN867585, JN867585, JN867585, JN867585; Gnetum gnemon, KR476377, KR476377, KR476377, KR476377, KR476377, KR476377; Huperzia appressa, Testo 932 (VT), MG560279, MG560383, *, MG560555, *, MG560704; Huperzia arctica, Varkonyi s.n. (H), *, KT821342, KT821252, *, *, *; Huperzia australiana, Field ARF1041 (BRI), *, JQ520368, EF469943, *, *, *; Huperzia beiteliana, Testo 847 (VT), MG560280, MG560384, MG560492, MG560556, MG560642, MG560705; Huperzia continentalis, Oldham 37843 (DAO), MG560281, MG560385, *, MG560557, *, MG560706; Huperzia crispata, Pan WJ0509023 (SHMU), *, DQ464204, DQ464221, *, *, *; Huperzia emeiensis, Pan WJ409023 (SHMU), *, DQ464205, DQ464222, *, *, *; Huperzia fuegiana, Larrain 36361 (NY), MG560282, MG560386, MG560493, MG560558, MG560643, MG560707; Huperzia jejuensis, 145

H048 (unknown), *, KT821331, KT821241, *, *, *; Huperzia lucidula, Renzaglia 3200 (UC), NC006861, NC006861, NC006861, NC006861, NC006861, NC006861; Huperzia miyoshiana, Rothfels 4483 (UC), MG560283, MG560387, *, MG560559, *, MG560708; Huperzia nanchuanensis, Pan WJ409101 (SHMU), *, DQ464209, DQ464226, *, *, *; Huperzia quasipolytrichioides, Sundue 3692 (VT), MG560284, MG560388, *, MG560560, *, MG560709; Huperzia selago, Wikströ 36 (S), *, DQ464210, AB574636, *, AJ224592, AJ224592; Huperzia serrata, Pan WJ409041 (SHMU), *, DQ464211, *, *, *, *; Huperzia somae, Anon. 776522 (TNS), *, AB575316, AB574640, *, *, *; Huperzia sutchueniana, Pan JSG0504192 (SHMU), *, DQ464212, *, *, *, *; Isoetes flaccida, GU191333, GU191333, GU191333, GU191333, GU191333, GU191333; Isoetes japonica, *, AB575325, *, *, *, *; Lateristachys diffusa, P027300 (WELT), *, *, KU295023, *, KF591278, *; Lateristachys lateralis, Bostock s.n. (BRI), *, *, AJ133262, *, AJ224609, *; Lycopodiastrum casuarinoides, Wikströ & Waantorp 134 (S), *, AB575302, AB574624, *, AJ224603, *; Lycopodiella alopecuroides, Mickel s.n. (NY), *, *, KJ773659, *, AJ224604, *; Lycopodiella appressa, Testo 952 (VT), MG560285, *, MG560494, MG560561, MG560644, MG560710; Lycopodiella inundata, Testo 951 (VT), MG560286, MG560389, *, *, *, MG560711; Lycopodium clavatum, Matos 2462 (MEXU), *, KT749941, AB574626, *, *, *; Lycopodium clavatum contiguum, Testo 695 (VT), MG560287, *, MG560495, *, MG560645, MG560712; Lycopodium lagopus, Testo 597 (VT), MG560288, MG560390, KJ841394, *, *, *; Lycopodium vestitum, Rothfels 3600 (DUKE), MG560289, MG560391, MG560496, *, MG560646, MG560713; Lygodium japonicum, NC022136, NC022136, NC022136, NC022136, NC022136, NC022136; Magnolia officinalis, JN867579, JN867579, JN867579, JN867579, JN867579, JN867579; Mankyua chejuensis, JF343520, JF343520, JF343520, JF343520, JF343520, JF343520; Nicotiana tabacum, Z00044, Z00044, Z00044, Z00044, Z00044, Z00044; Osmundastrum cinnamomeum, NC024157, NC024157, NC024157, NC024157, NC024157, NC024157; Palhinhaea cernua, Wikströ & Wanntorp 144 (S), *, GQ435339, AB574625, *, AJ224608, *; Palhinhaea glaucescens, Øllgaard 100602a (AAU), *, *, AJ133260, *, AJ224606, *; Palhinhaea pendulina, Øllgaard 10602b (AAU), *, *, AJ133259, *, AJ224607, *; Palhinhaea tomentosa, Sundue 3718 (BISH), MG560290, MG560392, MG560497, MG560562, MG560647, MG560714; Phlegmariurus acerosus, Testo 664 (VT), MG560291, MG560393, *, MG560563, *, MG560715; Phlegmariurus andinus, Renvoize 5012 (GH), MG560292, MG560394, *, MG560564, MG560648, MG560716; Phlegmariurus aqualupianus, Sundue 3302 (NY), MG560293, MG560395, *, MG560565, MG560649, MG560717; Phlegmariurus arcuatus, Øllgaard 8592 (AAU), *, *, *, *, *, MG560718; Phlegmariurus ascendens, Øllgaard 8600 (AAU), MG560294, MG560396, *, MG560566, MG560650, MG560719; Phlegmariurus attenuatus, Testo 232 (VT), *, KT749924, KT634232, *, AJ224573, AJ224573; Phlegmariurus badinianus, Almeida 3382 (VT), MG560301, MG560402, MG560502, MG560572, MG560654, MG560728; Phlegmariurus balansae, Wikströ 243 (S), *, *, *, *, AJ224553, AJ224553; Phlegmariurus beitelii, Beitel 85176 (NY), MG560295, MG560397, *, *, *, *; Phlegmariurus billardierei, Wikströ 259 (S), *, *, *, *, AJ224564, AJ224564; Phlegmariurus bradeorum, Kluge 1362 (UC), MG560296, *, *, *, *, MG560720; Phlegmariurus brassii, Field et al. 89 (BRI), *, JQ520372, *, *, *, *; Phlegmariurus brevifolius, Øllgaard 8469 (AAU), MG560297, MG560398, MG560498, MG560567, MG560651, MG560721; Phlegmariurus brongniartii, Øllgaard 2432 (AAU), *, *, *, *, *, MG560722; Phlegmariurus callitrichifolius, Holm-Nielsen 3988 (AAU), MG560298, MG560399, MG560499, MG560568, MG560652, MG560723; Phlegmariurus campianus, Øllgaard 74513 (AAU), *, *, *, MG560569, AJ224586, MG560724; Phlegmariurus capellae, Rangel et al. 11205 (US), MG560299, MG560400, MG560500, MG560570, MG560653, MG560725; Phlegmariurus capillaris, Testo 125 (VT), MG560300, MG560401, MG560501, MG560571, *, *; Phlegmariurus carinatus, Field & Field 969 (cult.), *, GU592495, DQ464229, *, *, *; Phlegmariurus cf brevifolius, Testo 1033 (VT), *, *, *, *, *, MG560726; Phlegmariurus sp nov 1, Testo 846 (VT), MG560352, MG560468, MG560534, MG560616, MG560685, MG560727; Phlegmariurus cf eversus, Testo 658 (VT), *, MG560417, *, *, *, *; Phlegmariurus columnaris, Øllgaard 91000 (AAU), MG560302, 146

MG560403, MG560503, MG560573, MG560655, MG560729; Phlegmariurus comans, Canestraro 841 (MBM), *, *, *, *, *, MG560730; Phlegmariurus compactus, Øllgaard 59554 (AAU), *, *, *, *, AJ224571, AJ224571; Phlegmariurus crassus, Testo 230 (VT), MG560303, MG560404, *, *, *, MG560731; Phlegmariurus crassus var. gelida, Øllgaard 10077 (AAU), MG560304, MG560405, *, *, MG560656, MG560732; Phlegmariurus crassus var. manus-diaboli, Øllgaard 10058 (AAU), MG560406, *, *, *, MG560657, MG560733; Phlegmariurus cryptomerinus, Anon. 763172 (TNS), *, KT821346, AB574628, *, *, *; Phlegmariurus cuernavacensis, Banda 6 (MEXU), MG560305, MG560407, MG560504, MG560574, MG560658, MG560734; Phlegmariurus cumingii, Øllgaard 100836 (AAU), *, *, Y07930, *, AJ224578, AJ224578; Phlegmariurus cuneifolius, Testo 127 (VT), MG560306, MG560408, MG560505, MG560575, MG560659, MG560735; Phlegmariurus curvifolius, Sundue 3206 (VT), MG560307, MG560409, MG560506, MG560576, MG560660, MG560736; Phlegmariurus dacrydioides, Kessler 14538 (Z) , MG560308, MG560410, *, MG560577, *, MG560737; Phlegmariurus darwinianus, Hamilton & Holligan 1243 (GH), *, MG560411, *, *, *, *; Phlegmariurus deminuens, Salino 15658 (VT), MG560309, MG560412, MG560507, MG560578, *, MG560738; Phlegmariurus dianae, Testo 977 (HUA), MG560310, MG560413, MG560508, MG560579, MG560661, MG560739; Phlegmariurus dichaeoides, Testo 701 (VT), MG560311, MG560414, *, MG560580, *, *; Phlegmariurus dichotomus, Testo 1230 (VT), *, JQ663808, *, *, AJ224567, MG560740; Phlegmariurus dielsii, Sundue 3601 (VT), MG560450, *, *, MG560605, *, MG560768; Phlegmariurus echinatus, Wurdack 1707 (NY), MG560312, MG560415, *, MG560581, MG560662, MG560741; Phlegmariurus elmeri, Field et al. 1816 (BRI), *, JQ663813, *, *, *, *; Phlegmariurus ericifolius, Wikströ 286 (S), *, *, *, *, AJ224587, AJ224587; Phlegmariurus espinosanus, Lewis & Klitgaard 3128 (GH), MG560313, MG560416, MG560509, MG560582, MG560663, MG560742; Phlegmariurus eversus, Rothfels 3574 (DUKE), MG560314, MG560418, *, MG560583, *, MG560743; Phlegmariurus fargesii, Yahara et al. 398 (TNS), *, DQ464214, AB574629, *, *, *; Phlegmariurus filiformis, Field & Field 1027 (BRI), MG560315, MG560419, *, MG560584, *, MG560744; Phlegmariurus foliaceus, Testo 1000 (PMA), *, *, *, *, *, MG560745; Phlegmariurus foliosus, Field ARF019 (BRI), *, JQ663817, *, *, *, *; Phlegmariurus fontinaloides, Canestraro 703 (MBM), *, *, *, *, *, MG560746; Phlegmariurus fordii, Anon. 763058 (TNS), *, DQ464215, AB574630, *, AJ224548, AJ224548; Phlegmariurus funiformis, Testo 704 (VT), MG560316, MG560420, *, MG560585, *, MG560747; Phlegmariurus goebelii, Testo s.n. (VT), MG560317, MG560421, *, MG560586, *, MG560748; Phlegmariurus hamiltonii, Field s.n. (BRI), *, JQ663840, *, *, *, *; Phlegmariurus hartwegianus, Holm-Nielsen 6362 (AAU), MG560318, MG560422, *, *, *, MG560749; Phlegmariurus hellwigii, Sundue 3601 (VT), MG560364, MG560475, *, MG560626, *, MG560795; Phlegmariurus heterocarpon, Pereira 428 (VT), MG560319, MG560423, MG560510, MG560587, MG560664, MG560750; Phlegmariurus heteroclitus, Lehnert 1851 (VT), MG560320, MG560424, MG560511, *, MG560665, AJ224588; Phlegmariurus hippurideus, Testo 151 (VT), *, MG560425, MG560512, MG560588, MG560666, MG560751; Phlegmariurus hippuris, Wikströ 157 (S), *, *, AJ133895, *, AJ224550, AJ224550; Phlegmariurus hoffmannii, Testo 698 (VT), MG560426, *, MG560513, *, MG560667, MG560752; Phlegmariurus holstii, Manelow 91163 (UPS), *, *, *, *, AJ224563, AJ224563; Phlegmariurus homocarpus, Testo 580 (VT), MG560321, MG560427, MG560514, MG560589, MG560668, MG560753; Phlegmariurus horizontalis, Waantorp s.n. (S), *, *, *, *, AJ224559, AJ224559; Phlegmariurus hypogaeus, Sundue 2597 (VT), MG560322, MG560428, MG560515, MG560590, MG560669, MG560754; Phlegmariurus hystrix, Wikströ 294 (S), *, *, *, *, AJ224574, AJ224574; Phlegmariurus intermedius, Almeida & Field 4578 (BHCB), MG560429, *, MG560516, *, *, *; Phlegmariurus itambensis, Almeida 4315 (BCHB), MG560430, *, MG560517, *, *, *; Phlegmariurus kuesteri, Øllgaard 9568 (AAU), MG560323, MG560431, MG560518, MG560591, MG560670, MG560755; Phlegmariurus lauterbachii, Field 770 (BRI), MG560324, MG560432, *, MG560592, *, MG560756; Phlegmariurus lechleri, Vargas 16767 (US), MG560325, MG560433, *, MG560593, *, *; 147

Phlegmariurus ledermannii, Field & Field 1001 (BRI), *, JQ663816, *, *, *, *; Phlegmariurus lindenii, Sundue 2603 (VT), MG560326, MG560434, *, MG560594, *, MG560757; Phlegmariurus linifolius var. linifolius, Testo 795 (VT), MG560327, MG560435, *, MG560595, MG560671, MG560758; Phlegmariurus linifolius var. tenuifolius, Sundue 3253 (NY), MG560436, *, MG560519, *, MG560672, MG560759; Phlegmariurus llanganatensis, Øllgaard 38748 (AAU), MG560328, MG560437, *, MG560596, *, *; Phlegmariurus lockyeri, Field & Field 1025 (BRI), *, JQ663828, *, *, AJ224551, AJ224551; Phlegmariurus loxensis, Øllgaard 74255 (AAU), MG560329, MG560438, *, *, *, *; Phlegmariurus macbridei, Jorgensen 92770 (AAU), MG560330, MG560439, *, MG560597, MG560673, MG560760; Phlegmariurus mandiocanus, Tressens 6067 (NY), MG560331, MG560440, *, MG560598, *, MG560761; Phlegmariurus marsupiiformis, Field & Field 1023 (BRI), *, JQ663811, *, *, *, *; Phlegmariurus megastachyus, van der Werff et al. s.n. (MO), *, JQ663833, *, *, *, *; Phlegmariurus mexicanus, Daniel 9880 (MEXU), MG560332, MG560441, *, MG560599, MG560674, MG560762; Phlegmariurus mingcheensis, Pan WJ112127 (SHMU), *, DQ464216, DQ464232, *, *, *; Phlegmariurus mollicomus, Lellinger 1074 (US), *, MG560442, *, *, *, *; Phlegmariurus mooreanus, Almeida 4421 (CNS), *, MG560443, MG560520, *, *, *; Phlegmariurus myrsinites, Testo 881 (MEXU), MG560333, MG560444, MG560521, MG560600, MG560675, *; Phlegmariurus nudus, Almeida 3377a (VT), MG560334, MG560445, MG560522, MG560601, MG560676, MG560763; Phlegmariurus nummulariifolius, Sundue 3854 (VT), *, JQ663824, *, *, AJ224552, AJ224552; Phlegmariurus ocananus, Dorr 8657 (US), MG560335, MG560446, MG560523, MG560602, MG560677, MG560764; Phlegmariurus ophioglossoides, Kessler 14589 (Z), MG560336, MG560447, *, *, AJ224590, MG560765; Phlegmariurus petiolatus, Pan WJ107181 (SHMU), *, DQ464217, DQ464233, *, *, *; Phlegmariurus phlegmaria, Wikströ 160 (S), MG560448, *, *, MG560603, *, MG560766; Phlegmariurus phlegmarioides, Field et al. 1005 (BRI), *, JQ663838, AJ133896, *, AJ224554, AJ224554; Phlegmariurus phylicifolius, Sundue 781 (NY), MG560337, MG560449, MG560524, MG560604, MG560678, MG560767; Phlegmariurus pinifolius, Kluge 7036 (GOET) , MG560338, MG560451, *, *, *, MG560769; Phlegmariurus pithyoides, Castillo-Hernandez 357a (MEXU), MG560339, MG560452, MG560525, MG560606, MG560679, MG560770; Phlegmariurus podocarpensis, Øllgaard 74255a (AAU), *, MG560453, *, *, *, MG560771; Phlegmariurus polycarpos, Chase 84263 (GH), MG560340, MG560454, MG560526, MG560607, *, MG560772; Phlegmariurus polydactylus, Øllgaard 8792 (AAU), *, *, *, *, AJ224575, AJ224575; Phlegmariurus polylepidetorum, Harling and Andersson 13359 (AAU), MG560341, MG560455, *, *, *, *; Phlegmariurus pringlei, Sundue 3454 (VT), MG560342, MG560456, MG560527, MG560608, MG560680, MG560773; Phlegmariurus proliferus, Wikströ 161 (S), *, *, *, *, AJ224547, AJ224547; Phlegmariurus pungentifolius, Almeida 3327 (VT), MG560343, MG560457, MG560528, MG560609, MG560681, MG560774; Phlegmariurus quadrifariatus, Pereira 264 (VT), MG560344, MG560458, *, MG560610, *, MG560775; Phlegmariurus recurvifolius, Almeida 4425 (CNS), *, MG560459, MG560529, *, *, *; Phlegmariurus reflexus, Testo 800 (VT), MG560345, MG560460, MG560530, MG560611, MG560682, MG560776; Phlegmariurus regnellii, Almeida 4290 (CNS), *, MG560461, MG560531, *, *, *; Phlegmariurus rosenstockianus, Rothfels 3548 (DUKE), MG560346, MG560462, *, MG560612, *, MG560777; Phlegmariurus ruber, Almeida 3333 (VT), *, MG560463, MG560532, *, *, *; Phlegmariurus rufescens, Holm-Nielsen 5914 (AAU), *, *, *, *, AJ224576, AJ224576; Phlegmariurus salvinioides, Field 51 (BRI), *, JQ663819, *, *, *, *; Phlegmariurus sarmentosus, Øllgaard 100816 (AAU), *, *, *, *, AJ224584, AJ224584; Phlegmariurus saururus, Arana s.n. (VT), MG560347, *, MG560533, MG560613, MG560683, MG560778; Phlegmariurus schlechteri, Ziesing et al. 63 (CBG), *, JQ663823, *, *, *, *; Phlegmariurus sellifolius, Øllgaard 2932 (AAU), MG560348, MG560464, *, *, *, MG560779; Phlegmariurus sellowianus, Canestraro 712 (MBM), MG560349, MG560465, *, MG560614, MG560684, MG560780; Phlegmariurus sieboldii, Yahara et al. 176 (TNS), *, AB575314, AB574638, *, AJ224549, AJ224549; Phlegmariurus silveirae, Pereira 428b (VT), MG560350, MG560466, *, *, *, 148

MG560781; Phlegmariurus sp cf capellae, Testo s.n. (HUA), MG560351, MG560467, *, MG560615, *, MG560782; Phlegmariurus sp nov 2, Testo 968 (HUA), MG560353, MG560469, *, MG560617, *, MG560785; Phlegmariurus sp nov 3, Testo 973 (HUA), MG560354, *, *, MG560618, *, MG560786; Phlegmariurus sp nov 4, Testo 966 (HUA), MG560355, *, *, MG560619, *, MG560787; Phlegmariurus sp nov 5, Testo 969 (HUA), MG560356, *, *, MG560620, *, MG560788; Phlegmariurus sp nov 6, Testo 967 (HUA), MG560357, *, *, *, *, MG560789; Phlegmariurus sp nov 7, Testo 971 (HUA), MG560358, *, *, *, *, *; Phlegmariurus squarrosus, Field et al. 748 (BRI), *, JQ663809, DQ464235, *, AJ224557, AJ224557; Phlegmariurus subulatus, Navarette 3040 (AAU), MG560359, MG560470, MG560535, MG560621, MG560686, MG560790; Phlegmariurus talamancanus, Testo 171 (VT), MG560360, MG560471, MG560536, MG560622, *, MG560791; Phlegmariurus talpiphilus, Sundue 822 (NY), MG560361, MG560472, MG560537, MG560623, MG560687, MG560792; Phlegmariurus tardieuae, van der Werff et al. 12764 (MO), *, JQ663812, *, *, *, *; Phlegmariurus tauri, Wikströ 151 (S), *, *, *, *, AJ224556, AJ224556; Phlegmariurus taxifolius, Matos 2468 (MEXU), MG560362, MG560473, MG560538, MG560624, MG560688, MG560793; Phlegmariurus tenuis, Lehnert 2311 (VT), MG560363, MG560474, MG560539, MG560625, MG560794, *; Phlegmariurus tetragonus, Rothfels 3512 (DUKE), MG560365, MG560476, *, MG560627, *, MG560796; Phlegmariurus tetrastichoides, Field & Field 1018 (BRI), *, JQ663834, *, *, *, *; Phlegmariurus tetrastichus, Testo s.n. (VT), MG560366, MG560477, *, MG560628, *, MG560797; Phlegmariurus transilla, Holm-Nielsen 28688 (AAU), MG560367, MG560478, *, *, MG560689, MG560798; Phlegmariurus trifoliatus, Field 984 (BRI), *, JQ663814, *, *, *, *; Phlegmariurus tryoniorum, Testo 773 (VT), MG560368, MG560479, MG560540, MG560629, MG560690, MG560799; Phlegmariurus tubulosus, Testo 989 (PMA), MG560369, MG560480, MG560541, MG560630, MG560691, MG560800; Phlegmariurus unguiculatus, Rothfels 3715 (DUKE), MG560370, MG560481, MG560542, MG560631, MG560692, MG560801; Phlegmariurus urbanii, Øllgaard 58592 (AAU), MG560371, MG560482, MG560543, MG560632, MG560693, MG560802; Phlegmariurus varius, Field & Field 1043 (BRI), *, JQ663831, JQ679089, *, *, *; Phlegmariurus venezuelanicus, Stergios 20572 (UC), MG560372, MG560483, MG560544, MG560633, MG560694, MG560803; Phlegmariurus verticillatus, Wikströ et al. 156 (S), *, *, AJ133897, *, AJ224561, AJ224561; Phlegmariurus weberbaueri, Madsen 86424 (AAU), MG560373, MG560484, MG560545, MG560634, MG560695, MG560804; Phlegmariurus weddellii, Øllgaard 38245 (AAU), MG560374, MG560485, *, *, *, *; Phlegmariurus wilsonii, Testo 1159 (JAUM), MG560375, MG560486, MG560546, MG560635, MG560696, MG560805; Phylloglossum drummondii, Crane s.n. (S), *, *, KU295021, *, AJ224593, AJ224593; Physcomitrella patens, AP005672, AP005672, AP005672, AP005672, AP005672, AP005672; Picea abies, NC021456, NC021456, NC021456, NC021456, NC021456, NC021456; Podocarpus lambertii, NC023805, NC023805, NC023805, NC023805, NC023805, NC023805; Polypodium glycyrrhiza, KP136832, KP136832, KP136832, KP136832, KP136832, KP136832; Pseudodiphasium volubile, Sundue 3614 (BISH), MG560376, MG560487, MG560547, MG560636, MG560697, MG560806; Pseudolycopodiella caroliniana, Anon. 743681 (TNS), *, *, AB574623, *, AJ133266, *; Pseudolycopodium densum, Wikströ 242 (S), *, *, AJ133249, *, AJ224597, *; Psilotum nudum, KC117179, KC117179, KC117179, KC117179, KC117179, KC117179; Selaginella moellendorffii, FJ755183, FJ755183, FJ755183, FJ755183, FJ755183, FJ755183; Selaginella selaginoides, MG560488, *, MG560548, *, *, MG560807; Selaginella uncinata, AB197035, AB197035, AB197035, AB197035, AB197035, AB197035; Sphagnum palustre, NC030198, NC030198, NC030198, NC030198, NC030198, NC030198; Spinulum annotinum, Ebihara s.n. (TNS), *, AB575301, AB574622, *, *, *; Syntrichia ruralis, FJ546412, FJ546412, FJ546412, FJ546412, FJ546412, FJ546412; Welwitschia mirabilis, EU342371, EU342371, EU342371, EU342371, EU342371, EU342371; Zea mays, NC001666 , NC001666 , NC001666 , NC001666 , NC001666 , NC001666 ;

149

Appendix 2. Character state scoring used in ancestral character state reconstruction analyses. Data are presented as follows: taxon, growth habit (0=terrestrial, 1=epiphytic), stem thickness (in mm), stem coloration (0=yellow, 1=red), leaf margin (0=smooth, 1=toothed), leaf dimorphy (0=monomorphic, 1=dimorphic), leaf length/width ratio;.

Huperzia beiteliana,0,2.3,0,0,0,3.8; Huperzia lucidula,0,2.3,0,1,0,3.5; Huperzia selago,0,2.0,0,0,0,4.5; Lycopodium clavatum,0,2.0,0,0,1,10.2; Phlegmariurus acerosus,1,0.6,0,0,0,16.7; Phlegmariurus andinus,0,2.5,0,0,0,4.3; Phlegmariurus aqualupianus,1,1.3,0,0,1,3.8; Phlegmariurus arcuatus,0,2.5,0,0,0,20; Phlegmariurus ascendens,0,2.5,0,0,0,3.8; Phlegmariurus attenuatus,0,1.8,0,1,0,4.4; Phlegmariurus badinianus,0,2.5,0,0,0,4.8; Phlegmariurus beitelii,0,3.5,0,0,0,7.8; Phlegmariurus brachiatus,1,0.7,0,0,0,13.8; Phlegmariurus bradeorum,1,1.8,0,0,0,7.4; Phlegmariurus brevifolius,0,3.5,0,0,0,0.8; Phlegmariurus brongniartii,0,3.3,0,0,0,3.8; Phlegmariurus callitrichifolius,1,1,1,0,1,1.6; Phlegmariurus campianus,1,3.0,0,0,1,3.6; Phlegmariurus capellae,0,2.8,0,0,0,4.0; Phlegmariurus capillaris,1,0.4,1,0,0,13.6; Phlegmariurus carinatus,1,1.7,0,0,0,4.0; Phlegmariurus cf eversus,0,2.5,0,1,0,5.3; Phlegmariurus columnaris,0,4.0,0,0,0,2.8; Phlegmariurus comans,0,0.9,0,0,0,11; Phlegmariurus compactus,0,2.5,0,0,0,1.6; Phlegmariurus crassus ,0,4.0,0,0,0,4.0; Phlegmariurus crassus gelida,0,7.0,0,0,0,4.4; Phlegmariurus crassus manus-diaboli,0,2.0,0,0,0,4.5; Phlegmariurus cuernavacensis,1,4.0,0,0,0,30; Phlegmariurus cumingii,0,2.3,0,0,0,4.3; Phlegmariurus cuneifolius,1,0.8,1,0,1,3.8; Phlegmariurus curvifolius,1,0.6,0,0,0,6.0; Phlegmariurus dacrydioides,1,1.9,0,0,0,10; Phlegmariurus darwinianus,0,4.0,0,0,0,5.5; Phlegmariurus deminuens,0,4.0,0,0,0,9.6; Phlegmariurus dianae,0,3.5,0,0,0,2.2; Phlegmariurus dichaeoides,1,1,0,0,1,2.1; Phlegmariurus dichotomus,1,2.5,0,0,0,14.7; Phlegmariurus echinatus,1,3.0,0,0,1,3.1; Phlegmariurus ericifolius,1,1,0,0,1,3.2; Phlegmariurus espinosanus,0,4.0,0,0,0,8.6; Phlegmariurus eversus,0,2.0,0,1,0,5.3; Phlegmariurus filiformis,1,0.8,0,0,0,4.3; Phlegmariurus foliaceus,1,3.0,1,0,0,4.6; Phlegmariurus fontinaloides,1,0.9,1,0,1,2.0; Phlegmariurus fordii,1,1.9,0,0,0,5.0; Phlegmariurus funiformis,1,2.3,0,0,0,6.4; Phlegmariurus hartwegianus,1,4.0,0,0,0,5.7; Phlegmariurus heterocarpon,1,1.8,0,0,0,8.6; Phlegmariurus heteroclitus,1,1.4,1,0,1,2.7; Phlegmariurus hippurideus,0,3.3,0,0,0,13.6; Phlegmariurus hoffmannii,0,4.0,0,1,0,2.0; Phlegmariurus homocarpus,1,1.8,0,0,0,9.6; Phlegmariurus hypogaeus,0,2.3,1,0,0,3.3; Phlegmariurus hystrix,0,7.5,0,0,0,4.3; Phlegmariurus intermedius,0,1.3,0,0,0,8.3; Phlegmariurus itambensis,0,2.5,0,0,0,2.3; Phlegmariurus kuesteri,0,5.5,0,0,0,2.3; Phlegmariurus lechleri,0,3.0,0,0,0,25.4; Phlegmariurus lindenii,1,1.3,0,0,0,5.9; Phlegmariurus linifolius,1,0.8,0,0,0,5.4; Phlegmariurus llanganatensis,0,7.0,0,0,0,1.8; Phlegmariurus loxensis,0,4.0,0,0,0,8.4; Phlegmariurus macbridei,0,3.0,0,0,0,7.1; Phlegmariurus mandiocanus,1,3.5,1,0,0,17.9; Phlegmariurus mexicanus,1,3.8,1,0,0,13.5; Phlegmariurus mollicomus,1,0.8,0,0,0,20; Phlegmariurus mooreanus,0,4.3,0,0,0,5.0; Phlegmariurus myrsinites,1,1,0,0,1,3.8; Phlegmariurus nudus,0,1.7,0,0,0,13.6; Phlegmariurus nummularifolius,1,1.2,0,0,1,1.2; Phlegmariurus ocananus,0,4.0,0,0,0,4.0; Phlegmariurus ophioglossoides,1,1.5,0,0,1,10; Phlegmariurus phlegmaria,1,2.5,0,0,1,7.0; Phlegmariurus phlegmarioides,1,1.3,0,0,1,4.5; Phlegmariurus phylicifolius,1,1,1,0,1,4.6; Phlegmariurus pithyoides,1,5.0,1,0,0,28.9; Phlegmariurus podocarpensis,0,3.5,0,0,0,3.1; Phlegmariurus 150 polycarpos,1,1.3,0,0,0,17.8; Phlegmariurus polydactylus,0,3.0,1,0,0,2.2; Phlegmariurus polylepidetorum,0,6.0,0,0,0,3.3; Phlegmariurus pringlei,1,1,0,0,0,8.8; Phlegmariurus pungentifolius,0,3.5,0,0,0,5.8; Phlegmariurus quadrifariatus,1,1.8,0,0,1,4.8; Phlegmariurus recurvifolius,0,2.4,0,0,0,6.5; Phlegmariurus reflexus,0,2.3,0,1,0,8.0; Phlegmariurus regnellii,0,4.0,0,0,0,6.0; Phlegmariurus rosenstockianus,1,2.5,0,0,0,4.2; Phlegmariurus ruber,0,4.0,1,0,0,6.0; Phlegmariurus rufescens,0,2.5,0,0,0,1.2; Phlegmariurus sarmentosus,1,1.3,0,0,0,20; Phlegmariurus saururus,0,4.0,0,0,0,7.3; Phlegmariurus sellifolius,0,3.5,0,0,0,1.3; Phlegmariurus sellowianus,0,3.0,0,0,0,5.5; Phlegmariurus silveirae,1,1.8,0,0,0,7.2; Phlegmariurus sp 1,0,3.0,0,0,0,4.8; Phlegmariurus sp 2,0,4.0,0,0,0,5.2; Phlegmariurus sp 3,0,3.5,0,0,0,4.6; Phlegmariurus sp 4,0,3.5,0,0,0,3.5; Phlegmariurus sp 5,0,4.0,0,0,0,4.0; Phlegmariurus sp 6,0,4.2,0,0,0,3.8; Phlegmariurus sp 7,0,2.8,0,0,0,4.3; Phlegmariurus squarrosus,1,3.6,0,0,0,4.3; Phlegmariurus subulatus,1,1,1,0,1,16.7; Phlegmariurus talamancanus,0,4.0,0,0,0,3.8; Phlegmariurus talpiphilus,0,4.0,0,0,0,4.7; Phlegmariurus taxifolius,0,1.8,0,0,0,8.2; Phlegmariurus tenuis,0,0.6,0,0,0,10; Phlegmariurus tetragonus,0,1.5,0,1,0,1.4; Phlegmariurus transilla,0,13.5,1,0,0,1.5; Phlegmariurus tryoniorum,0,5.0,0,0,0,2.2; Phlegmariurus tubulosus,1,4.0,0,0,0,8.0; Phlegmariurus unguiculatus,0,3.3,0,1,0,7.6; Phlegmariurus urbanii,0,3.5,0,1,0,4.7; Phlegmariurus varius,1,2.7,0,0,1,8.5; Phlegmariurus venezuelanicus,0,3.0,0,0,0,4.5; Phlegmariurus weberbaueri,0,3.0,0,0,0,3.8; Phlegmariurus weddellii,0,4.5,0,0,0,4.3; Phlegmariurus wilsonii,1,1.8,1,0,0,35.0; Phylloglossum drummondii,0,1.5,0,0,1,13.0; ;

151