Morphological and Molecular Identification of an Endemic Species from Tamil Nadu, India: Wrightia Indica Ngan (Apocynaceae)
Total Page：16
File Type：pdf, Size：1020Kb
J. Indian bot. Soc. e-ISSN:2455-7218, ISSN:0019 - 4468 Vol. 101 (1&2) 2021: 49-57 MORPHOLOGICAL AND MOLECULAR IDENTIFICATION OF AN ENDEMIC SPECIES FROM TAMIL NADU, INDIA: WRIGHTIA INDICA NGAN (APOCYNACEAE) SATHYA ELAVARASAN1, MUTHULAKSHMIPECHIAMMAL PECHIMUTHU, RAJENDRAN ARUMUGAM AND SEKAR THANGAVEL1 Phytochemistry Laboratory1, Department of Botany, Bharathiar University, Coimbatore 641046, Tamilnadu, India. E-mail:[email protected] Date of online publication: 31st March 2021 DOI:10.5958/2455-7218.2021.00013.9 Wrightia indica Ngan is an endemic Apocynaceae species collected from Sitheri hills of Dharmapuri district in the Southern Eastern Ghats of Tamil Nadu. Morphological and molecular identification of species was observed by analyzing the chloroplast DNA regions using ITS marker and generated sequences. The present study confirms the molecular sequence of Wrightia indica for the first time and voucher specimen deposited in NCBI. They allow us to infer the phylogenetic relationships among other taxa within the same genus and those of other genera detailed description, ecological notes, and photographs of the species are provided for a better understanding of this little known endemic taxa. Keywords: DNA barcoding, Endemic, Morphology, Tamil Nadu, Wrightia indica. The Apocynaceae was first explained as savannas and sandy thickets on the strand "Apocinae" (de Jussieu, 1789). They are (Middleton 2007a). Many of these taxa are commonly known as the Dogbane family local endemics from karst limestone habitats (Gentianales) usually consisting of trees, and several others are threatened due to shrubs, vines, relatives with white latex or quarrying for cement (Clements et al. 2006). hardly ever watery juice, smooth margined and DNA based identification is a high through out opposite or whorled leaves. The flowers are technology that reduces processing time and large, colorful, and slightly fragrant with five can discriminate at species level without contorted lobes in clusters (rarely solitary) and taxonomic expertise (Laube et al. 2010). DNA fruits are in pairs. The plants are mostly barcodes are short DNA sequences of a laticiferous and generate various alkaloids and standardized portion of the genome that can be carotenoids with more medicinal properties. used in the identification and differentiation of Apocynaceae comprises of around 375 genera a species. DNA barcoding supports species and 5100 species (Endress et al. 2007) in identification, discover vegetation, and tropical and subtropical areas, with lower floristic species surveys in addition to representation in temperate regions (Endress ecological forensics studies which are critical and Bruyns 2000, Potgieter and Albert 2001). to biodiversity management. For the success of The circle of acquaintance has been extended DNA barcode, the barcode loci must have to five sub-families such as Apocynoideae, sufficient information to differentiate between A s c l e p i a d o i d e a e , P e r i p l o c o i d e a e , closely related plant species and discover new Rauvolfioideae and Secamonoideae (Wong et cryptic species. For herbal plant identification, al. 2013). matK, rbcL, trnH-psbA, ITS, trnL-F, 5S- It is interesting to note that, within the genus a rRNA, and 18S-rRNA have been used as number of widespread species occur in successful DNA barcodes. seasonal or evergreen forest and several other Plant taxa identification is an important issue in species within the local distribution, especially plant science where contemporary molecular occurring on limestone. Their habitats are quite markers help to overcome the limitation of varied from rain forests, deciduous dry forests, classical species identification and Received on December 20, 2020 www.indianbotsoc.org Accepted on January 05, 2021 Morphological and molecular identification of endemic Wrightia indica J. Indian bot. Soc. Vol. 101 (1&2) 2021: 50 recognition. Amplification of PCR products namely evergreen, riparian, dry deciduous using primers can detect SNPs of targets taxa scrub, and thorn scrub forests. The mean showing high specificity and accuracy for the annual temperature in the study area ranges molecular identification of plant species. The from 12°C to 35°C during Mar-Jun and primary advantage of this technique is that averages between 10°C to 25°C during Oct-Jan amplification and authentication are combined with an average rainfall of 200 mm annually. and a plant species can be identified based on the amplification of a product which indicates Field survey: Survey and field visit were the presence of a particular allele and vice versa conducted in the Sitheri hills of Eastern Ghats (Wang et al. 2010). Characterization of plants from 2017-2018. The specimens were with the use of morphological and molecular collected, poisoned, processed, and labelled markers is an ideal approach for the based on standard herbarium method. Habit, conservation of plant genetic resources and habitat, diagnostic features of the species, genetic improvement (Rout and Mohapatha, ecological data, associated plants, phenology, 2008). Both molecular and morphological and photographs were noted during the field markers are valuable for the identification of visit. The collected plant specimens were distinct populations or genotypes for authenticated by the Botanical Survey of India conservation optimum sites for germplasm (BSI), Southern Circle, Coimbatore, India. The collection and ongoing changes in the pattern specimens were deposited at the Madras of diversity over time. Thus the present study Herbarium located in the Botanical Survey of employs morphological and molecular India, Southern circle, Coimbatore under the techniques to characterize and confirm the accession numbers MH177870-MH177872. identity of the less known endemic species The specimens were also deposited in the W.indica. Bharathi Herbarium at the Department of Botany Bharathiar University, Coimbatore MATERIALS AND METHODS under the accession no: 007755. Chemicals and reagents: Extraction buffer of Genomic DNA Isolation: Genomic DNA was p H 8 c o n s i s t i n g o f 3 % isolated from the plant samples using a cetyltrimethylammonium bromide (CTAB) modified CTAB method (Khanuja, 1999). 200 (w/v), 100 mM Tris-HCl, 2 M NaCl, 25 mM mg of leaves were grounded with preheated ethylenediaminetetraacetic acid (EDTA), 3% extraction buffer and incubated at 60°C for one β - m e r c a p t o e t h a n o l ( v / v ) , a n d 3 % hr. Followed by incubation, samples were polyvinylpyrrolidone (w/v) and was freshly prepared. Other reagents such as 24:1 Table1: PCR Reaction Mix chloroform:isoamyl alcohol (v/v), Tris-EDTA, Reagents Reaction Volume (20 10 mM Tris-HCl (pH 8), 1 mM EDTA, μL) isopropanol, 70% ethanol and all other Taq Buffer-10X (100 mM 2 μL chemicals were purchased from Alpha and TrisHCl/ 500 mM KCl) HiMedia company. MgCl2-25 mM 2 μL Study sites and sample collection: Sitheri dNTPs-100 mM 2 μL hills, one of the segments of Eastern Ghats of Forward and reverse primers (10 0.5 μL each Tamilnadu falls under Pappireddipatti Taluk in pM) Dharmapuri district with a latitude and DNA template 1 μL longitude dimension of 11.8917°N and Taq DNA polymerase (5 U/μL) 0.2 μL 78.5076°E respectively. The study site Nuclease free water Made to 20 μL comprises of various kinds of vegetation Morphological and molecular identification of endemic Wrightia indica J. Indian bot. Soc. Vol. 101 (1&2) 2021: 51 Table 2: PCR Primer Sequences and the Reaction Condition S. No Gene Primer Sequences Reaction Conditions 1 ITS2 F- 5'GAAGGAGAAGTCGTAACAAGG 3' 95 ºC 5 min, R- 3'TCCTCCGCTTATTGATAT GC5' 95 ºC 1 min 55 ºC 1 min, 30 cycles 72 ºC 1 min 72 ºC 10 min centrifuged at 10,000 rpm for 10 min. An equal using BLAST tool, showed similarity to the volume of Chloroform: Isoamyl alcohol (24:1) ITS2 gene sequence of Wrightia indica plant was added and then centrifuged at 10,000 rpm available in the database. for 10 min. To the aqueous solution, 0.6 volume of ice-cold isopropanol was added and o Phylogenetic tree analysis: This method incubated at 4 C for 1 hr. The samples were was used to construct phylogenetic trees. In the centrifuged at 10,000 rpm for 10 mins and the present study, trees constructed by Maximum pellet thus obtained was washed with 70% likelihood method meet the requirements for ethanol and finally resuspended in TE Buffer. species identifcation (Lahaye et al. 2008). The samples were then loaded onto 1% agarose gel and the DNA bands were visualized using RESULTS an Alpha imager EC®, USA. The DNA thus isolated was used as a template for PCR. Morphological identification: In the present study, morphology and DNA barcoding was PCR Amplification and DNA sequencing: employed to confirm the identity of a little PCR was performed to amplify the specific known endemic species W.indica Ngan in Ann. DNA sequence using respective barcode Missouri Bot. Gard. 52:140.1965.Fl. Tamil candidate-specific primers. PCR was carried Nadu 2:80:1987. out in a thermal cycler, Eppendorf, Germany. All the reagents for PCR were procured from Taxonomical treatment: Evergreen trees, 3-5 Fermentas, Germany. The PCR reaction m tall, bark yellowish-brown; young mixture composition is shown in Table 1 and branchlets yellowish pubescent, glabrate with the list of specific PCR primers used and the age. Leaves opposite, petiole 25 mm long; conditions are given in Table 2. The PCR lamina ovate, 5-10 × 3-4 cm, margin entire, product was separated in 1% agarose gel and apex acute to acuminate, membranous, the bands were visualized in the gel glabrous above, puberulous below; lateral documentation unit (Alpha Digidoc, USA). veins 8-12 pairs united near the margins of the lamina. Flowers actinomorphic, 5-merous, BLAST Analysis: BLAST (Basic Local white or creamy or yellowish inside, 1.5-2 cm Alignment Search Tool) is a commonly used across in 15-31 flowered terminal aggregate m e t h o d f o r i d e n t i f i c a t i o n dichasial cymes; pedicel 0.5-0.8 cm long, (www.ncbi.nlm.nih.gov/BLAST/) of puberulous.