DIFFERENTIALLY EXPRESSED PROTEINS IN THE PANCREAS OF DIABETIC

MICE

A dissertation presented to

the faculty of

the College of Arts and Sciences of Ohio University

In partial fulfillment

of the requirements for the degree

Doctor of Philosophy

Linghua Qiu

June 2005 This dissertation entitled

DIFFERENTIALLY EXPRESSED PROTEINS IN THE PANCREAS OF DIABETIC

MICE

by

LINGHUA QIU

has been approved

for the Department of Biological Sciences

and the College of Arts and Sciences by

John J. Kopchick

Goll-Ohio Professor of Molecular Biology

Leslie A. Flemming

Dean, College of Arts and Sciences QIU, LINGHUA. Ph.D. June 2005. Biological Sciences

Differentially Expressed Proteins in the Pancreas of Diabetic Mice.

(222pp.)

Director of Dissertation: John J. Kopchick

C57BL/6J male mice fed a high-fat diet become obese and develop type 2 diabetes

(T2DM), which serves as a model of obesity-associated diabetes in humans. In this study,

proteins were extracted from the pancreas of diabetic and control mice and were resolved

by 2 dimensional gel electrophoresis (2-DE). The pancreatic protein profiles were compared between control and diabetic mice. Eleven protein spots were differentially expressed and 10 of them were identified by mass spectrometry (MS) analyses. REG1 and REG2 proteins, which may be involved in the regeneration of pancreatic β-cells, were up-regulated very early in the progression of obese mice to T2DM. Up-regulation of

Reg1 and Reg2 may reflect the effort by the pancreas to ameliorate the hyperglycemic condition by stimulating the proliferation of pancreatic β-cells resulting in subsequent insulin secretion. Rho GDP-dissociation inhibitor 1 (GDI-1), 1-Cys peroxiredoxin protein, and pancreatic elastase 3B were also up-regulated in the pancreas of diabetic mice relative to control. However, how these expression levels are related to the diabetic condition is unclear. Glutathione peroxidase (Gpx1), which functions in the clearance of reactive oxidative species (ROS), was down-regulated in diabetic mice. The down- regulation of glutathione peroxidase in pancreas could contribute to the progressive deterioration of β-cell function, which may be related to the hyperglycemia induced oxidative stress. Finally, the protein levels of the receptor of activated protein kinase C1, which function in many signaling cascades, was decreased in diabetic mice when

compared with normal controls.

Because of their potential importance to T2DM, Reg 2 and Gpx1 were selected as potential targets of further investigation. Generation of transgenic mice that over-express

Reg2 or Gpx1 can provide valuable information to understand the biological function of

Reg2 and Gpx1 during the development of diabetes in mice. As a part of this strategy,

expression vectors for Reg2 and Gpx1 were constructed and stable mammalian cell lines

which express the genes were established. Expression was confirmed at the mRNA and

protein levels for the two genes. Transgenic mice with the Reg2 gene under the control of

mouse metallothionien I promoter were generated. These studies will provide a means to

study the physiological function of these proteins in association with diabetes and β-cell

function.

Approved: John J. Kopchick

Goll-Ohio Professor of Molecular Biology Acknowledgments

I wish to express sincere appreciation to the many individuals who have offered

support, inspiration, and encouragement throughout my studies and research endeavors at

Ohio University. My special gratitude is extended to Dr. John J. Kopchick, my doctoral

advisor, for his guidance and encouragement throughout the course of my graduate study,

which has resulted in the research presented in this dissertation. I will always feel

inspired by his boundless enthusiasm, dedication to excellence, careful attention to detail,

and infinite patience. I feel privileged to have had the opportunity to study under his

guidance. I also would like to thank the other members of my committee; Drs. Susan

Evans, Peter Coschigano, and Calvin James, for their valuable suggestions and assistance.

I would like to acknowledge the contributions of my colleagues—Dr. Bruce Kelder for performing cell transfection to produce stable cell lines; Ms. Gayle Matheny for managing mice and obtaining physiological parameters of the mice; Dr. Shigeru Okada for collecting several of the mouse tissues; Dr. Karen Coschigano for sharing pancreas mRNA samples. I also would like to thank Debbie Holman and Dr. Maria Lozykowski for generating the transgenic mice and for the care of mice. Additionally, I would like to thank our group members for their suggestions and technical assistance.

I also would like to thank Dr. Peter Coschigano, Dr. Joan Cunningham, Dr. Mary

Chamberlin, and Dr. Tomohiko Sugiyama for the training provided to me as a teaching assistant. Finally, I would like to extend my special thanks to Dr. Robert Colvin,

Chairman of the Molecular and Cellular Biology Program, for his support and friendly advice. I would like to acknowledge the following for the financial support provided to me

during the course of my graduate work: The Department of Biological Sciences,

Molecular and Cellular Biology Program, DiAthegen LLC, the State of Ohio’s Eminent

Scholar Program that includes a gift from Milton and Lawrence Goll, and Ohio

University SEA program.

Finally, I am grateful to my parents, and to my wife -- Guili Xie, for their constant support and encouragement throughout my life. This dissertation is dedicated to them and to my two children, Fuming and John. John was born in Athens and the two will always call themselves Athenias and/or Bobcats.

7

Table of Contents

Page

Abstract 3

Acknowledgments 5

List of Tables 9

List of Figures 10

List of Abbreviations 12

Introduction to Type 2 Diabetes Mellitus 15 Definition 16 The developmental history of T2DM 19

Insulin Secretion and Action 21 Biphasic Insulin Secretion 22 24-Hour Insulin Secretion Pattern 24 Regulation of Insulin Secretion 26 Regulation of Blood Glucose 31

Causes of T2DM 36 The Primary Cause: β-Cell Dysfunction versus Insulin Resistance 37 Obesity-Related Genes and Substances 42 MODY: A Monogenic Case 48 Genes Involved in the Insulin Signaling Pathway 54 Synergistic Effect of Insulin Receptor and Insulin Receptor Substrates 63 Other Susceptibility Genes 67 Summary of Causes 72

Biology of the Pancreas and Pancreatic β-cells 75 Introduction 76 β-cell Dysfunction and Structural Damage in T2DM 79 The Decompensation Model for β-Cell Dysfunction in T2DM 80 Regulatory/Transcriptional Factors in Developmental Stages 81

Research Objectives 89

Proteomic Analysis of the Pancreas of Type 2 Diabetic Mice 92 Abstract 93 Introduction 95 Materials and Methods 98 8

Results 103 Discussion 111

Differentially Expressed Proteins in the Pancreas of Diet-Induced Obese and Diabetic Mice 115 Abstract 116 Introduction 117 Materials and Methods 120 Results 127 Discussion 133

Cloning and Expression of Reg2 and Glutathione Peroxidase in Mouse L Cells and Production of Reg2 Transgenic Mice 139 Abstract 140 Introduction 141 Materials and Methods 147 Results 162 Discussion 175

General Summary and Conclusion 176

Working Model of Type 2 Diabetes 179

Future Work 181

References 183

Appendix A: Gel Images of the Pancreas from A Control and A Diabetic Mouse 218

Appendix B: Close-Up View of Differentially Expressed Protein Spots 220 9

List of Tables

Table Page

1. The Subtypes of MODY and the Related Genetic Defects 50

2. The relative frequency and distribution of cell types in a pancreatic islet 78

3. Identification of protein spots by mass spectrometry 108

4. Quantitative analysis of differentially expressed protein spots 110

5. Identification of protein spots by mass spectrometry 130

6. Quantitative analysis of differentially expressed protein spots 131

7. Proteins or peptides identified by MS and MS/MS analyses from band A and B 172

8. Glutathione peroxidase activity in Gpx1 cell lines and control L cells 173 10

List of Figures

Figure Page

1. Pathophysiology of T2DM 18

2. Developmental history of obesity-related T2DM 20

3. Biphasic insulin secretion in response to glucose 23

4. Mean 24 h insulin profile in normal and obese subjects 25

5. Model for coupling of glucose metabolism to insulin secretion in pancreatic β-cells 28

6. The suggested model for the genesis and post-transcriptional suppression of

microRNAs and small interfering RNAs 30

7. The relationship between estimated hepatic sinusoidal insulin levels and

tracer-determined glucose production in overnight fasted humans 33

8. The relationship between arterial insulin levels and whole body glucose

utilization in overnight fasted humans 34

9. Insulin signal transduction pathway 55

10. The conversion of proinsulin to insulin 58

11. The distribution of islets in the human pancreas 77

12. Expression patterns of different transcription factors and their indispensable

roles during the distinct developmental stages of β-cells 82

13. Body weight profiles for the two groups of C57BL/6J mice on a low-fat

normal chaw (LF), and a high-fat diet (HF) 104

14. Fasting blood glucose levels at different ages for the two groups of mice on

low-fat (LF) and high-fat (HF) diets 105 11

15. Fasting serum insulin levels at different ages for the two groups of mice on

low-fat (LF) and high-fat (HF) diets 106

16. 2-DE image of the pancreas of C57BL/6J mouse fed on normal diet for 8 weeks 109

17. 2-DE image of the pancreas of C57BL/6J mouse fed on LF for 8 weeks 129

18. Northern blot analysis of Reg2 and Gpx1 132

19. Cloning strategy for the construction of pMet-Reg2-bGH expression vector 150

20. Gpx1 expression vector pCMV•SPORT6 152

21. The sequence of the Reg2 gene in the vector pMet-Reg2-bGH 163

22. Slot blot analysis for Reg2 cell lines 164

23. Slot blot analysis for Gpx1 cell lines 165

24 Northern blot analysis for Reg2 in cell lines Rg-6, -9, -13, and -15 166

25. Northern analysis for Gpx1 in cell lines Gp-1, -2, -12, and -14 168

26. 2-DE of proteins from the Gpx1 cell lines GP-1, -2, and -12 and control L cells 169

27. Analysis of protein samples of conditioned media from control L cells and

two Reg2 cell lines (Reg2-6 and Reg2-15) by SDS-PAGE 171

28. Screening of Reg2 founders mice by slot blot 174 12

List of Abbreviations

2-DE: Two-Dimensional Gel Electrophoresis

ADA: American Diabetes Association

BMI: Body Mass Index

CPH: Carboxypeptidase H

FFA: Free Fatty Acid

GCK: Glucokinase

GLUT2: Glucose Transporter 2

Gpx1/GSHPX1: Cellular Glutathione Peroxidase

HF: High-Fat Diet

HNF1α: Hepatocyte Nuclear Factor-1alpha (MODY3)

HNF1β: Hepatocyte Nuclear Factor-1beta (MODY5)

HNF4α: Hepatocyte Nuclear Factor-4alpha (MODY1)

IFG: Impaired Fasting Glucose

IGF-1: Insulin-like Growth Factor-1 (

IGT: Impaired Glucose Tolerance

IPF1: (MODY4)

IRS-1: Insulin Receptor Substrate-1

LF: Low-Fat Diet (Normal Chow)

+ KATP: ATP-Sensitive K

+ KV: Voltage-Dependent K

MAP Kinase: the Mitogen-Activated Protein Kinase 13 miRNA: MicroRNA

MODY: Maturity-Onset Diabetes of the Young

MS: Mass Spectrometry

NeuroD1: Neurogenic Differentiation (MODY6)

OGTT: Oral Glucose Tolerance Test

PC1: Prohormone Convertase 1

PC2: Prohormone Convertase 2

PH: Pleckstrin Homology pI: Iso-Electric Point

PPARγ: Peroxisome Proliferators Activated Receptor-γ

PPREs: Peroxisome Proliferator Response Elements

PTPases: Protein Tyrosine Phosphatases

PTP-1B: Protein Tyrosine Phosphatase-1B

Reg1/REG1: Regenerating Islet-Derived 1

Reg2/REG2: Regenerating Islet-Derived 2

RISC: RNA-Induced Silencing Complex

SH2: Src-Homology-2

SHIP2: SH2 Domain-Containing Inosital-5-Phosphatase

SiRNA: Small Interfering RNA

SOS: the Son-of-Sevenless

SRE: Sterol Regulatory Element

T1DM: Type 1 Diabetes Mellitus 14

T2DM: Type 2 Diabetes Mellitus

TCA: Tricarboxylic Acid

TNF-α: Tumor Necrosis Factor-alpha

TOF: Time of Flight

TZD: Thiozolidinedione 15

Introduction to Type 2 Diabetes Mellitus 16

Definition

Diabetes is a disease characterized by the body’s inability to properly regulate blood glucose, ultimately leading to high blood glucose levels (hyperglycemia) and to altered metabolism of other substances such as fat and protein. There are two major types of diabetes, type1 (also called juvenile-onset or insulin-dependent) and type 2 (also called adult-onset diabetes, late-onset diabetes, maturity-onset diabetes, non-insulin-dependent diabetes, non-insulin-dependent diabetes mellitus, or type 2 diabetes mellitus).

The criteria for diagnosing diabetes by American Diabetes Association (ADA) are stated below:

• Fasting plasma glucose above 126 mg/dl (7mM); or

• Plasma glucose equal to or above 200 mg/dl (11.1mM) during an oral glucose

tolerance test (OGTT).

A person with normal blood glucose usually has a blood glucose level below 110 mg/dl (6.1 mM) measured after a fast of 8 to 12 hours; or the blood glucose rises no higher than 140 mg/dl (7.8 mM) 2 hours after drinking a glucose-containing solution

(containing 75 grams of glucose) in an oral glucose tolerance test (OGTT). Between the normal and diabetic groups, there are individuals with impaired glucose tolerance (IGT) twho have higher blood glucose levels than normal but not high enough to be diabetic.

About 17 million people in the UnitedState have diabetes and another 20 million have

IGT, according to the National Health and Nutritional Examination Survey III

(http://www.cdc.gov/nchs/nhanes.htm). Individuals with IGT are at a high risk of developing diabetes if they become overweight and possess a sedentary lifestyle and have 17 a family history of diabetes. Type 2 diabetes mellitus (T2DM) is the most common form of diabetes, occurring primarily in people who are over 40, overweight, and have a family history of diabetes. According to ADA, about 17 million people in the United States have diabetes, with more than 90% of diabetic population (~16 million) affected by T2DM.

Type 1 diabetes mellitus (T1DM) is caused by the severe to complete disruption of pancreatic insulin-secreting β-cells. Type 1 diabetics, therefore, lack insulin, which is the major hormone that regulates blood glucose levels after absorption of glucose from the digestive system. The pathological changes underlying T2DM are the relative insufficient secretion of insulin in response to glucose stimulation and/or insulin insensitivity of target tissues due to peripheral insulin resistance (Figure 1).

Hyperglycemia in diabetic patients increases risk for many serious complications, which include macro- and micro-cardiovascular diseases, blindness (diabetic retinopathy), nerve damage (neuropathy), and kidney damage (nephropathy). For T2DM, in addition to diet management and physical exercise, many medical treatments, such as insulin, insulin sensitizers, and insulin secretagogues, are available. However, despite all the medical efforts and lifestyle adjustments, ideal glucose control is difficult to achieve and maintain. The disease inevitably deteriorates as a function of time and is accompanied by increasing insensitivity to drugs. 18

Figure 1. Pathophysiology of T2DM. After a meal, glucose and other sugars are absorbed into blood stream through the digestive system, leading to an increase in the blood glucose level. The pancreatic β cells sense the increase in plasma glucose concentration and are induced to secrete insulin into the blood. Circulating insulin then acts on various target tissues by stopping endogenous glucose production and secretion by the liver, increasing glucose uptake in the muscle and adipose tissue, and reducing lipolysis in adipose tissue, resulting in normalization of blood glucose levels. In the disease state, however, these target tissues display resistance to insulin action, leading to insufficient disposal of glucose by the muscle and fat tissue and un-regulated production of glucose by the liver. 19

The Developmental History of T2DM

There are two distinct types of T2DM in our population: obesity-related and non- obesity-related. Some diabetic subjects exhibit overt diabetes after many years of obesity while others diagnosed diabetics are lean. Lean diabetic patients are usually associated with insufficient insulin secretion (1-3), while obese diabetic individuals are accompanied by peripheral insulin resistance and a relative defect in insulin secretion.

The overview of the history of T2DM can provide a general idea of what is taking place longitudinally in the long time period of disease development. The general course of disease development for obesity-related diabetes is illustrated in Figure 2. During the time period from obesity to impaired fasting glucose (IFG), increased insulin resistance is compensated by increased secretion of insulin due to the adaptation of β-cells of the pancreas. The blood glucose level remains normal until β-cells can no longer meet the ever-increasing demand of insulin secretion imposed by the increasing peripheral insulin resistance. Then, the subject would be in a state of IGT. Symptoms of diabetes become manifest after β cells start to deteriorate and therefore can not secrete sufficient quantities of insulin. Usually, it is a relatively long time from the onset of T2DM to the diagnosis of the disease due to the symptomless nature of this period. Most non-obese diabetic subjects show an insulin secretion defect in addition to peripheral insulin resistance (4,5). 20

Figure 2. Developmental history of obesity-related T2DM. (Adapted from Dr. Kathleen

Wyne, University of Texas, Southwestern Medical Center. See: http://www.insulinclass.com/addendum_a.pdf ) 21

Insulin Secretion and Action 22

Biphasic Insulin Secretion

One of the frequently used methods to study the characteristics of glucose-induced insulin secretion from β-cells is the square-wave stimulation test in which the glucose concentration is rapidly raised to a high level and then kept constant for a desired duration. Insulin release is featured by an acute, rapid and brief secretion lasting about 10 minutes followed by a nadir and then a sustained second-phase secretion. Figure 3 shows a typical response of insulin release to the square-wave glucose stimulation test.

The mechanism underlying biphasic insulin secretion is not well understood though several models have been suggested, such as the pool-related model (6) and the signal- modulation hypothesis (7). The pool-related model assumes that β-cells contain two distinct pools of insulin granules: a small, labile pool ready for immediate release and a larger backup pool that slowly refills the small pool (6). The signal-modulation hypothesis postulates that changes in insulin secretion rate reflect kinetic modulations of insulinotropic signal stimulated by glucose and other stimuli (7). In β cells of the pancreatic islets, insulin is synthesized in the endoplasmic reticulum and then processed to its active form during post-translational modification reactions. Before insulin secretion, the hormone is stored in the secretory granules. Ultrastructural studies indicate that each mouse β cell contains about 10,000 insulin granules, with ~5% of the granules in direct contact (docked) with the plasma membrane and another ~2,000 granules near the membrane (9). These docked granules are readily releasable pools of insulin which are responsible for the acute phase insulin secretion (10,11). The second phase of insulin 23

Figure 3. Biphasic insulin secretion in response to glucose. The isolated rat pancreas was perfused with 3.3 mM glucose throughout, except during the 0- to 30-min period, when the concentration was raised to 6.9 mM. (Adapted from (8).) 24 secretion occurs with the exocytosis of newly arrived granules at the plasma membrane

(12).

In diabetic patients, a loss of the first phase insulin secretion and a reduction of the second phase are apparent. The physiological significance and the impairment of the acute-phase and the second-phase insulin secretion in normal and diabetic subjects will be addressed later in the section on “Regulation of Blood Glucose”.

24-Hour Insulin Secretion Pattern

Insulin secretion in response to food uptake is illustrated in Figure 4. In normal subjects, the insulin secretion rate increases from basal level after each meal and returns to the baseline between meals. The insulin secretion rate after each meal in obese subjects does not return to baseline. The basal level of insulin secretion rate and the magnitude of secretion after stimulation are greatly increased in obese subjects compared with those in normal ones. This is due to the β-cell compensation in response to peripheral insulin resistance in obese subjects.

The abnormally high levels of plasma glucose in diabetic subjects result from the relatively deficient secretion of insulin and/or the peripheral resistance to insulin stimulation. Compared with normal controls, the diabetic subjects lose or have a diminished first-phase insulin response and have a decreased second-phase insulin release

(14). Since the disposal of blood glucose is coordinated by the action of insulin on peripheral tissues, the deficiency of insulin secretion would result in corresponding high plasma glucose levels. Insulin resistance is closely associated with obesity. Peripheral 25

Figure 4. Mean 24 h insulin profile in normal and obese subjects. Meals were consumed at 0900,1300, and 1800 (Adapted from (13)). 26 insulin resistance is manifested by decreased glucose uptake and utilization, decreased glycogen synthesis, and increased hepatic glucose production. The state of insulin resistance requires increased insulin secretion in order to counteract its resistance.

Otherwise, diabetes or IGT would occur if β-cells can not meet this demand even though the insulin level is higher than that found in normal persons. The dynamic changes of β- cells in diabetic subjects and peripheral insulin resistance will be covered later in the section on “β-cell Dysfunction and Structural Damage in T2DM”.

Regulation of Insulin Secretion

Although insulin secretion is regulated by many nutrients, hormones, and neural stimuli, glucose is considered the major physiological regulator of insulin synthesis and release. The release of insulin induced by an increase in blood glucose level, as discussed before, is characterized by biphasic secretion, a prompt and transient first-phase release and a slowly increasing and prolonged second-phase release in a square-wave glucose stimulation test (Figure 3). In T2DM, insulin secretion deficiency is displayed by a loss of first phase insulin response and a decrease in second phase.

An understanding of the cellular mechanism underlying the biphasic secretion is

+ important. The first phase of release is due to the ATP-sensitive K (KATP) channel-

dependent pathway (15,16). The pathways responsible for the second phase secretion

include the KATP channel-dependent pathway and additional signals from KATP channel- independent pathways (17,18). 27

A model for the KATP channel-dependent pathway is illustrated in Figure 5 (19). In

β-cells, glucose enters through glucose transporter 2 (GLUT2) and is phosphorylated by

glucokinase upon entry. This phosphorylation step is the rate-limiting reaction for

glycolysis. Pyruvate, the product of glycolysis in cytosol, enters into mitochondrion and is further broken down through the tricarboxylic acid (TCA) cycle with coupled electron transport chain activation resulting in the product of ATP. The increase in cytosolic

ATP/ADP ratio promotes the closure of KATP channels which leads to depolarization of

the plasma membrane. As a result, the opening of voltage-dependent Ca2+-channels raises

cytosolic Ca2+ concentration ([Ca2+]c). The increase in [Ca2+]c stimulates insulin

exocytosis. Some mediators, including nucleotides and metabolites possibly involved in

the KATP channel-independent pathways, are also shown in this model.

The KATP channel-independent pathways work in synergy with the KATP channel-

2+ dependent pathway by augmenting the response to the increased [Ca ]c which is critical

to the stimulation of insulin release (17,18). The underlying electrogenic mechanism for

the KATP channel-independent pathways is unknown.

In summary, in glucose-stimulated insulin secretion regulated by the KATP channel

pathway, increased glucose metabolism results in an increase in the ratio of ATP/ADP in

β-cells, which in turn closes the KATP channel, thus depolarizing the cell membrane. β-

cell membrane depolarization leads to the opening of voltage-dependent Ca2+ channels

and subsequent influx of Ca2+ into β-cells, triggering insulin secretion from small

secretory granules by exocytosis. Insulin secretion is also regulated by the voltage- 28

Figure 5. Model for coupling of glucose metabolism to insulin secretion in pancreatic β- cells (GK:glucokinase; TCA: tricarboxylic acid; ∆ψ: membrane potential.) (Adapted from (19)). 29 dependent K+ (Kv) channels which repolarize the cell membrane in a voltage-dependent way.

Sulphonylureas, a class of drugs that are used for glucose regulation in diabetic patients, can increase insulin secretion by acting on the KATP channel. These

sulphonylureas bind to a specific site on the KATP channel, resulting in inhibition of the

channels and subsequent opening of the calcium channels, leading to the influx of Ca2+

into the cell that triggers secretion of insulin.

Insulin secretion also can be regulated by many other factors, such as autoregulation

by insulin and microRNA (miRNA). The autoregulation of insulin expression and

secretion by insulin will be discussed in the section on “Genes Involved in the Insulin

Signaling Pathway”. Insulin secretion regulated by miRNA is a newly discovered

phenomenon (20). miRNAs are a growing family of non-coding RNAs that regulate the

expression of homologous target genes at the post-transcriptional level (21). The mature

miRNAs, with the size of about 22 nucleotides, repress gene expression by inhibiting

translation and/or enhancing mRNA cleavage through the RNA interference process

(Figure 6) (21). Over expression of miR-375, an islet-specific miRNA identified from

murine β-cell lines can suppress the glucose-induced insulin exocytosis and secretion,

while inhibition of miRNA-375 function by antisense oligonucleotides can improve

insulin secretion (20). The underlying mechanism for the regulation of insulin secretion

by miR-375 may be independent of glucose metabolism through the glucokinase pathway

or intracellular Ca2+-mediated secretion. Mtpn and Vti1a are target genes of miR-375 30

Figure 6. The suggested model for the genesis and post-transcriptional suppression of microRNAs and small interfering RNAs. The primary miRNA transcripts (pri-miRNAs) are processed to generate the intermediate stem loop precursor miRNAs (pre-miRNAs) by a complex, which contains Drosha, in the nucleus. Pre-miRNAs are transported to the cytoplasm by Exportin 5-dependent mechanism. In cytoplasma, pre-miRNAs and long dsRNA molecules are recognized and processed into mature ~22-nt duplexes by Dicer.

Mature miRNAs or siRNAs then join the RNA-induced silencing complex (RISC) in an asymmetric way in which only one strand of the miRNA:miRNA duplex or the siRNA duplex is preferentially enabled to act on its target gene by translational repression or mRNA cleavage. (Adapted from (21).) 31

(20). Mtpn and Vti1a are involved in neurotransmitter release. Whether miR-375 and possibly other miRNAs play a role in the pathogenesis of diabetes remains to be determined.

Regulation of Blood Glucose

Blood glucose levels are controlled within a narrow physiological range (80 to 120 mg/dl in the morning before a meal) in normal subjects. After meals, the glucose level rises. The increased blood glucose level then stimulates the secretion of insulin from pancreatic β-cells. The increased level of insulin then represses the production and output of glucose from liver and stimulates the glucose uptake by muscle and adipose tissue so that a normal glucose level is restored and maintained. On the other hand, if the glucose level drops too low, the secretion of another endocrine hormone, glucagon, by α-cells of the pancreatic islets, is stimulated. Glucagon enhances glucose production and release from the liver so that the normal glucose level is maintained. Since almost all the problems with T2DM on the regulation of blood glucose are associated with the secretion and physiological function of insulin, no further discussion on glucagon will be given.

As shown in Figure1, the major target tissues of insulin in the regulation of glucose homeostasis are liver, muscle, and fat. These three tissues respond to insulin differently in terms of their half-maximal effective concentration and the rapidity of response. Liver is the site for glucose production through processes of gluconeogenesis and glycogenolysis.

For liver, the increased insulin level has an inhibitory effect on glucose production and output by suppressing hepatic gluconeogenesis and glycogenolysis and facilitating 32 hepatic glycogen synthesis. The half-maximal effective liver sinusoidal insulin concentration is slightly below the basal insulin level after an overnight fast (Figure 7)

(22). A three-fold increase in insulin above the basal level would almost completely inhibit the production and release of glucose from liver. Small changes in plasma insulin levels, both up and down, would greatly affect the output of hepatic glucose as it is evident from the dose-response curve of glucose production as a function of hepatic sinusoidal insulin concentration (Figure 7). Studies show that the effect of insulin on hepatic glucose production is mainly directed through the inhibition of the glycogenolytic rate and rapid in onset with a response time within several minutes (23).

Insulin also regulates the uptake of blood glucose by muscle and fat. These tissues, compared to liver, are much less sensitive in response to insulin and slower in action due to the need for insulin to cross the capillary endothelial barrier. The half-maximally effective plasma insulin level for muscle is 80-100 µU/ml, which is much greater than the concentration for the maximal suppression of hepatic glucose output (Figure 8) (24).

However, while liver decreases its glucose production and output by 2.5mg• kg-1• min-1

maximally, muscle can uptake glucose from blood at a rate of ~8mg• kg-1• min-1 in

humans.

As mentioned above, insulin secretion by β-cells in response to glucose stimulation is biphasic in nature. Because of the sensitivity (the low half-maximal concentration) of liver in response to insulin and the rapid accessibility of insulin to the liver through liver sinusoids, the first-phase insulin secretion provides a rapid pulse of insulin to liver so that the hepatic glucose production can be quickly repressed. In fact, the first tissue that 33

GLUCOSE PRODUCTION (mg• m-2• min-1)

.

Figure 7. The relationship between estimated hepatic sinusoidal insulin levels and glucose production in overnight fasted humans. (Adapted from (22).) 34

GLUCOSE UTILIZATION (mg• kg-1• min-1)

(µU/ml)

Figure 8. The relationship between arterial insulin levels and whole body glucose utilization in overnight fasted humans. (Adapted from (24).) 35 insulin encounters following secretion by the pancreas is the liver. The first-phase can also involve the disposal of glucose by stimulating muscle and fat tissues, but only when it is large and the overall insulin concentration is increased by more than 50% (25). The second-phase insulin release has significant effects on both the glucose output and utilization (26).

In summary, subjects with T2DM are characterized with loss of the first phase insulin release and impaired second phase insulin secretion. The loss of the acute phase insulin secretion mainly causes insufficient regulation of glucose production and release from liver. The reduced second phase insulin secretion leads to inefficient disposal of glucose by muscle and fat. 36

Causes of T2DM 37

The Primary Cause: β-Cell Dysfunction versus Insulin Resistance

Clinically, insulin resistance is a characteristic feature of a syndrome, called the insulin resistance syndrome, or the metabolic syndrome, that includes a cluster of cardiovascular risk factors linked to insulin resistance (27,28). The syndrome is typically featured by high levels of blood insulin, varying degrees of glucose intolerance, high blood cholesterol and/or triglyceride levels, high blood pressure, and upper body obesity, all independent risk factors for cardiac diseases. Insulin resistance, which is closely related to central obesity, induces compensatory state of hyperinsulinemia in subjects with this syndrome. The development of T2DM occurs when the pancreas fails to sustain increased insulin secretion. In fact, the metabolic syndrome is shown to precede frank diabetes in a substantial number of diabetics. It is estimated that β-cell dysfunction and consequent clinical manifestation of diabetes mellitus is present in about 20% of patients with metabolic syndrome.

The theory that insulin resistance is the primary cause of T2DM is based on studies of obesity-related T2DM and some prospective studies. Obesity is a well-known risk factor for the development of T2DM. It is well established that insulin resistance is closely related to obesity. A study on a group of 1,146 nondiabetic, normotensive caucasians showed that the incidence of insulin resistance is associated with the degree of obesity (29). In that group which were further defined into a lean subgroup with a body mass index (BMI) of less than 25Kg·m-2 and an obese subgroup with a BMI of greater

than 25Kg·m-2, 10% of the lean subgroup and 26% of the obese subgroup were insulin

resistant. Furthermore, in the obese subgroup, the frequencies of insulin resistance were 38

19%, 34%, and 60% in different subgroups with a BMI < 30Kg·m-2, <35Kg·m-2 and

>35Kg·m-2 respectively.

Since the majority of subjects with T2DM are obese and the association between

obesity and insulin resistance is well-established (30), insulin resistance is considered by

many researchers to be the primary defect in these obese patients. Also, during the

impaired glucose tolerance stage of the disease (see Figure 2), the increased secretion of

insulin is considered the compensatory response of β-cells, i.e. the “normal range” of β-

cell function. In this glucose intolerance phase, it is thought that insulin resistance is

present in the absence of β-cell dysfunction although the β-cell response deteriorates

later. One example cited to support this hypothesis is a study on a population with a wide

range of glucose tolerance (31). In that study, a correlation between the insulin

concentrations measured during an oral glucose tolerance test and the plasma glucose

concentrations was established in subjects with normal glucose tolerance. This

correlation was used to define insulin concentrations in subjects with impaired glucose

tolerance. The results show there is no significant difference between the actual

concentrations of insulin measured in individuals with IGT and the predicted values from

the normal subjects. The results also show that subjects with IGT have normal secretion

of insulin. As IGT indicates an increased risk for the development of T2DM, insulin

resistance is regarded to precede β-cell dysfunction in these subjects.

A similar conclusion is derived from another study measuring changes in serum

insulin concentrations in 81 Pima Indians who deteriorated from normal to IGT; 44 who

changed from IGT to type 2 diabetes; 27 who were type 2 diabetics; and 11 subjects who 39 were seen at each of these stages (32). In this study, subjects who developed T2DM had higher fasting and post-load insulin concentrations before the onset of IGT than found in normal controls that did not become diabetic with age and body mass index matched. The fasting insulin concentrations increased further during transition to IGT and later to

T2DM. It is suggested that these subjects who developed diabetes during the later stage of the study had the compensatory response of insulin secretion to impaired glucose tolerance because they had increased levels of plasma insulin.

Are these conclusions correct? Actually a question as how to evaluate the β-cell function in the normal and insulin resistant states is raised. It is argued that the increased insulin secretion in response to peripheral insulin resistance is relatively insufficient when comparing insulin secretion in obese subjects that do not develop T2DM and in obese ones that develop the disease later in their lives.

In fact, insulin secretion and insulin sensitivity are closely linked. β-cell function can not be estimated when isolated from insulin action (33). The basic idea is that β-cell defects can be masked by concomitant insulin resistance. If subjects with normally functioning β-cells are insulin resistant to the same degree as that in subjects with IGT, a higher acute insulin secretion would be expected in the former subjects. Thus, those subjects with IGT should not be considered to have normal β-cell function if the effect of insulin resistance on insulin response is not compensated as it is in normal subjects. It is noteworthy that a specific ethnic group upon which studies have been conducted may have unknown genetic predisposition which is unique to this population. Therefore, cautions should be taken when interpretation and extrapolation are made. 40

Is there a genetic factor or an environmental factor that can directly cause insulin resistance, which in turn leads to IGT with a secondary β-cell dysfunction and final development of T2DM? The fact that there are a significant number of people who are obese and insulin resistant, but do not develop diabetes mellitus during their lives suggests that a damage to β-cell function, either by a genetic defect or by an environmental factor, is required for the onset of diabetes.

In contrast, there are increasing lines of evidence supporting the hypothesis that β- cell dysfunction is the primary defect in the development of T2DM. Obesity-related

T2DM, in most instances, is associated with genetically predetermined β-cell defect. β- cell dysfunction is considered by some to be the primary cause of the disease (34). In this scenario, the β-cells with genetic dysfunction can not meet the increasing requirement of compensatory insulin secretion imposed by obesity-related insulin resistance in order to maintain normoglycemia. The prevalence of diabetes is 2.9 times higher in overweight than in non-overweight persons in the NHANES data (Health Implications of Obesity.

NIH Consensus Statement Online 1985 Feb 11-13 [accessed on 6-14-2002 at http://hstat.nlm.nih.gov/hq/Hquest/db/local.nih.cdc.nihcdc79. cdc49/ screen/DLTocDisplay/s/54532/action/DLToc]). In subjects with insulin resistance but normal glucose tolerance, plasma glucose levels are maintained in a normal range due to the compensation of β-cell function. As mentioned before, the idea that insulin resistance is the primary causative factor is challenged in those non-obesity-related diabetic subjects. 41

An important supporting fact for β-cell dysfunction as the primary cause of T2DM is from studies on first degree relatives of patients with the disease (35-37). These individuals, with normal glucose tolerance, show impaired insulin secretion instead of insulin resistance. These results support the appearance of predetermined β-cell dysfunction prior to insulin resistance. Data from studies on identical twins also indicate the same results. The concordant rate of developing T2DM in monozygotic twins reaches

~80% (38,39). In a study of twins, where one is diabetic while the other has normal glucose tolerance, the results indicate that those with glucose intolerance display defective β-cell function without insulin resistance (40). β-cell dysfunction predetermined by genetic defects is considered to be the primary defect in these subjects. On the other hand, there are examples where non-obesity-related diabetes develops in individuals in the absence of insulin resistance (4,5,41). Therefore, insulin resistance is not a requirement for these diabetic subjects. The contribution of obesity in obesity-induced

T2DM lies in the increased demand of insulin secretion which is unmet by β-cells with inherent genetic deficiency.

A rare, monogenic type of T2DM, called maturity-onset diabetes of the young

(MODY), is characterized by non-obesity related, early-onset of the disease, and autosomal dominance (42). Each subtype of MODY has a specific underlying genetic defect that causes corresponding change in insulin synthesis and/or secretion. In these patients, the defective genes impair β-cell function. Therefore, β-cell dysfunction is considered to be the primary defect in subjects with MODY. 42

In answering the question, “what is the initial defect in the development of T2DM?”, the literature better supports the hypothesis that impaired insulin secretion is the initial and the main genetic factor that predisposes one to type 2 diabetes. However, the fact that insulin resistance may be largely a secondary problem does not lessen its importance in the pathogenesis of T2DM.

Obesity-Related Genes and Substances

Because of firm links established among obesity, insulin resistance and type 2 diabetes, some interesting results have been derived from studies of adipose cells. Fat cells were once regarded as cells that only accumulate fat. However, recent evidence shows that these cells are capable of secreting many hormone-like substances such as leptin, tumor necrosis factor-α (TNF-α), resistin, and adiponectin (43). These molecules play an important role in regulating a variety of physiological functions including satiety and energy metabolism, as well as development and differentiation of the adipose tissue.

Some of these that are related to type 2 dibetes are discussed below.

Leptin Leptin is one of the first hormonal molecules identified to be produced and secreted from adipocytes. Leptin is the product of the ob gene (44). Leptin inhibits food intake and regulates obesity (45). Leptin acts on a specific receptor, the leptin receptor (db), found in the hypothalamus (46). The plasma levels of leptin are proportional to adipose tissue mass. Leptin also inhibits lipogenesis and stimulates fatty acid utilization. Based on its effect in suppressing appetite, leptin was assumed to inhibit 43 obesity. However, leptin does not show anti-obesity effects in obese humans. Most obese subjects have high circulating concentrations of leptin that are raised in proportion to fat mass (47). Administration of exogenous leptin is not an effective approach for the treatment of obesity and obesity-related diseases, except in those individuals that have genetic defects of the leptin gene (48).

Resistin Resistin is a newly discovered adipose hormone composed of 94 amino acids (49,50). Resistin is expressed and secreted by white and brown adipose tissues but also is found in several other tissues, such as the hypothalamus, pituitary and adrenal glands, pancreas, gastrointestinal tract, spleen, white blood cells and plasma.

Exogenous resistin treatment can cause decreased sensitivity to insulin leading to increased blood glucose levels and glucose production in mice (51). Neutralization of resistin by antibodies can reduce hyperglycemia in mice with diet-induced obesity. These results suggest that resistin may play a role in glucose homeostasis and may act as a physiologic antagonist to insulin action.

Thiazolidinediones (TZDs), a new class of anti-diabetic drugs, are known to increase the tissue sensitivity to insulin in vivo. TZDs may act on fat cells through binding to a nuclear receptor, perixisome proliferators activated receptor-γ (PPARγ), which is highly expressed in fat cells (52,53). The expression of resistin protein is down- regulated in mature adipose cells exposed to TZDs (51). Also, circulating resistin levels are down-regulated by the treatment of rosigitazone, a TZD anti-diabetic drug, and up- 44 regulated in diet-induced and genetically obese mice. These results suggest that resistin is associated with insulin resistance.

Mice with the resistin gene disrupted displayed normal glucose levels and insulin sensitivity with lower fasting glucose levels (54). These ‘knockout’ mice, when fed with a high-fat diet, showed improved glucose tolerance with decreased glucose production by the liver. Transgenic C57BL/6 mice that over-express the resistin gene show normal fasting glucose but impaired glucose tolerance, with significantly higher plasma cholesterol and triglyceride levels when compared with the control mice (55).

However, whether resistin plays a significant role in insulin resistance and, therefore, obesity and diabetes is controversial. Resistin expression levels are low in various genetically obese or diet-induced obese mouse models (56,57). The coding sequence of the resistin gene and its flanking regions when examined for mutation analysis have not shown mutations or significant variations that are associated with the state of obesity or type 2 diabetes (58). Also, the expression levels of resistin in subcutaneous abdominal adipocytes have not displayed a positive relationship with body weight and insulin sensitivity (59). These results do not support the etiologic significance of resistin in the pathogenesis of type 2 diabetes.

Acrp30/Adiponectin Acrp30/Adiponectin is another newly discovered adipocyte- specific protein which has a role in obesity-related insulin resistance and atherosclerosis

(60). While all of other currently known adipocyte-specific hormones associated with insulin resistance are increased in obese subjects, adiponectin production and 45 concentrations decrease (61). In contrast to resistin, Acrp30 promotes insulin’s action. It has been shown that the expression of Acrp30 is induced over 100-fold during adipocyte differentiation. However, it also has been found that the plasma levels of adiponectin are lower in obese than in lean humans (62). Also, the circulating levels of adiponectin in diabetic patients are lower than in non-diabetic subjects (63). Interestingly, plasma levels of Acrp30 have been found to increase significantly in both diabetic and non-diabetic subjects who lost 10% of body weight after a weight-loss program. Also, circulating levels of Acrp30 are decreased in parallel with the progression of insulin resistance (64).

Therefore, a strong correlation between Acrp30 levels and the diabetic state has been suggested.

Reduced level of adiponectin associated with obesity may contribute to insulin resistance. Adiponectin knockout mice (adipo-/-) show moderate insulin resistance while heterozygous adiponectin deficient (adipo+/-) mice show mild insulin resistance without significant body weight gain compared to wild-type animals, supporting the role of adiponectin in the regulation of insulin resistance (65). A study of single nucleotide polymorphisms of the adiponectin gene (APM1), which is located in a diabetes susceptibility locus in genome-wide scans, show that certain genetic variants at positions

45 and 276 are associated with a higher insulin resistance index and a lower plasma adiponectin level, respectively, in a Japanese population (66). These results together with the evidence of decreased circulating levels of adiponectin in type 2 diabetic patients suggest that adiponectin may be a susceptibility gene for type 2 diabetes. The molecular 46 target of Acrp30 and molecules involved in the downstream of Acrp30 action are not known.

Also, it is shown that adiponectin can improve insulin sensitivity in animal models.

The in vivo administration to mice of truncated Acrp30, which corresponds to the globular domain of Acrp30, results in a short-term decrease in post-prandial plasma-free fatty acids and long-term body-weight loss without affecting food intake (67).

Administration of full-length Acrp30 to wild-type C57BL/6J and ob/ob mice leads to a decreased plasma glucose level without a significant change in plasma insulin levels (68).

Adiponectin may function through stimulating muscle fatty acid oxidation (67) and repressing hepatic glucose output (68).

11β Hydroxysteroid Dehydrogenase Type 1 (11β HSD-1) Recent studies suggest that increased levels of locally produced glucocorticoid hormones may be the cause of visceral obesity and hence obesity-related metabolic complications. This was first found in patients with Cushing’s syndrome who are characterized by central obesity, diabetes, hyperlipidemia and hypertension (69,70). Cushing's syndrome is a disease caused by increased production of cortisol or by excessive use of cortisol or other steroid hormones. However, circulating glucocorticoid levels are normal in subjects with typical obesity (70). Nevertheless, intracellular glucocorticoid or cortisol concentrations can be regulated greatly by 11β hydroxysteroid dehydrogenase type 1 (11β HSD-1) which generates active forms of cortisol from inactive cortisone. The activity of 11β HSD-1 is increased in visceral adipose tissue compared with subcutaneous fat in humans and obese 47

Zucker rats (71,72) while it is impaired in the livers of Zucker rats (71). Mice with 11β

HSD-1 deficiency demonstrate attenuated activation of gluconeogenesis in response to stress or high-fat diet and a diabetes-resistant phenotype (73). Transgenic mice that over- express the 11β HSD-1 gene specifically in adipose tissue have visceral obesity with hyperlipidemia, insulin-resistant diabetes, and hyperphagia, despite high levels of plasma leptin (74). These findings strongly suggest that increased activity of 11β HSD-1 in visceral fat tissue is a molecular mechanism responsible for central obesity, insulin resistance and diabetes and make it a potential pharmaceutical target for the treatment of obesity and obesity-related disease.

Free Fatty Acids With the association between obesity and insulin resistance/diabetes established, candidates of molecules/substances that mediate the linkage have been extensively studied. Among many molecules, free fatty acids (FFAs) whose levels are elevated in most obese subjects are known to play a major role in mediating obesity-induced insulin resistance (75,76).

Insulin regulates the uptake of circulating glucose by muscle. Free fatty acids released by adipocytes may have a significant role in causing insulin resistance in muscle.

Insulin resistance in skeletal muscle is shown to have a strong association with increased intramuscular triglyceride content (77-79). An in vivo study demonstrates that a rise in plasma fatty acid concentration induced by infusion of lipid emulsions can cause significant insulin resistance in rat and human skeletal muscle within 4-6 hours (80).

Intramyocellular triglyceride contents are also increased with the development of insulin 48 resistance. A recent study in a rat model shows that fatty acids inhibit insulin-stimulated glucose transport activity in skeletal muscle by activating insulin receptor substrate-1 associated phosphatidylinositol 3 kinase (PI 3-kinase) (81). The inhibited glucose transport activity in skeletal muscle would result in a high level of plasma glucose, a characteristic of type 2 diabetes. These studies shed light on the understanding of the mechanism by which fatty acids induce insulin resistance in skeletal muscle.

FFAs also cause hepatic insulin resistance by inhibiting insulin-induced suppression of glucose production (82-84). Several studies suggest that impaired inhibition of glycogenolysis is involved in the FFA-mediated hepatic insulin resistance (85-87). FFAs are also toxic to β-cells as manifested by the evidence of apoptosis of β cells in islets of fa/fa ZDF rats (88). FFAs, when accumulated and converted to toxic compounds in β cells in the form of ceramides and/or nitric oxide (NO), have detrimental effects on these cells.

Since many obese people do not ultimately develop type 2 diabetes in their life time

(89-91), other factors, such as the capacity of β-cells to compensate for the insulin resistance by increasing insulin output, are important in the pathogenesis of diabetes. The significance of the lipotoxic etiology in obesity-associated diabetic patients still needs to

be clarified.

MODY: A Monogenic Case

As stated above, MODY, a subtype of diabetes characterized by early onset,

autosomal-dominant inheritance and defective insulin secretion, accounts for about 2% to 49

5% of patients with T2DM (92). Patients with MODY usually are lean and develop the appearance of symptoms in their thirties. They are different from common T2DM subjects because they exhibit normal insulin sensitivity but defective glucose-stimulated insulin secretion (93). Genetic studies have identified mutations in at least 6 different genes with a single causative mutated gene underlying each subtype of MODY (see

Table 1) (42). Five of these six MODY genes, i.e. HNF4α (MODY1) (94), HNF1α

(MODY3) (95), IPF1 (MODY4) (96), HNF1β (MODY5) (97), and NeuroD1 (MODY6)

(98), encode transcription factors, while GCK (glucokinase) (MODY2) (99) is a glycolytic enzyme gene. Mutations in these genes primarily result in defective glucose- stimulated insulin secretion. MODY2 and MODY3 are the two most common types, with mutations in GCK and HNF1α, respectively. Knowledge on these monogenic diabetes types provides important insights into disease mechanisms though the common type of

T2DM may have different causes. The complexity of the disease is shown by the diversity of genetic mutations even in this form of diabetes.

For assessing the attributions of impaired glucokinase gene in liver and β-cells to hyperglycemia in MODY2, global and β cell-specific and hepatocyte-specific glucokinase gene knock-out mice have been generated (100). Mice with homozygous null glucokinase gene (gkdel/del ) either globally or only in β-cells die a few days after birth from severe diabetes. Mice with heterozygous null gene (gkdel/w ) , either globally or only in β-cells, display moderate hyperglycemia. Mice with deficient glucokinase gene in the

liver cells are only slightly hyperglycemic. Interestingly, these hepatic glucokinase 50

Table 1: The Subtypes of MODY and the Related Genetic Defects (Adapted from (42)).

* dependent on the population studied.

MODY Type Gene Distribution* Primary Defect

MODY1 HNF4α Rare Pancreas/Liver

MODY2 Glucokinase 8-63% Pancreas/Liver

MODY3 HNF1α 21-64% Pancreas/Kidney/Other?

MODY4 IPF-1 Rare Pancreas/Other?

MODY5 HNF-1β Unknown Pancreas/Kidney/Other?

MODY6 NeuroD1 Rare Pancreas/Other?

MODYX Unknown 16-45% Pancreas/Other?

51 deficient mice have demonstrated impaired insulin secretion in addition to impaired glycogen synthesis. These results have shown the contribution of hepatic glucokinase to hyperglycemia found in MODY2 patients.

Mutations of glucokinase detected in the MODY2 individuals include more than 130 different types (101). Impaired glucokinase activity in β-cells in patients with mutations in glucokinase results in decreased glycolytic flux. This defect causes a glucose-sensing defect and a raised blood glucose threshold that triggers insulin secretion (102,103). An average reduction of 60% in insulin secretion for a given glucose level is detected in

MODY2 patients (102). The ability of β-cells to secrete insulin in response to arginine, an insulin secretagogue, is usually normal in these patients, which indicates that the impaired insulin secretion is related to a relative glucose insensitivity of β-cells (104). In liver, defective glucose metabolism results in decreased hepatic glycogen synthesis and increased gluconeogenesis which also contribute to mild chronic hyperglycemia, impaired glucose tolerance and/or diabetes in these subjects (105).

HNF1α HNF1α is a transcription factor, which is necessary for the expression of many genes in tissues such as the liver and pancreas. HNF1α binds to its target DNA sequences as a homodimer or a heterodimer with HNF1β (106,107). In pancreatic β-cells,

HNF-1-α regulates expression of many genes, such as the glut2 and L-type pyruvate kinase, that are involved in the glucose-stimulated insulin secretion (108).

It is shown by many studies that mutations in HNF1α are the most frequent cause of

MODY in most populations. More than 120 mutations, including missense, nonsense, 52 frameshift, and splice-site, are detected in this gene (101). Most mutations of HNF1α show conformational changes that impair dimerization and DNA binding and, therefore, the transactivation activities (109,110). Interestingly, a mutation in HNF-1-α , G319S, is strongly associated with typical adult-onset insulin resistant obesity-related diabetes in a small indigenous population of Oji-Cree indians in northwestern Ontario (111,112). At the time of the study, about 40% of the type 2 diabetic subjects in an isolated community from this region were affected by the G319S mutation. Since the remaining 60% of diabetic individuals were homozygous for wild-type HNF1α, other genetic factors must be involved in the development of Oji-Cree type 2 diabetes. The degree to which this mutation contributes to the disease needs to be further characterized.

HNF4α HNF4α is a member of the nuclear receptor family of transcription factors. HNF4α is expressed in the liver, gut, kidney and pancreas (113,114). The expression of TNF4α gene is regulated by a proximal promoter, P1, and a distant promoter, P2, which is 46kb upstream of P1 (115,116). It has been suggested that the transcription of the gene is controlled by P1 in the liver and by P2 in the β-cell (115,116).

Using loss of function mutation of HNF4α, Stoffel and colleagues demonstrated that in embryonic stem cells, the expression of genes such as glucose transporter 2, and the glycolytic enzymes aldolase B and glyceraldehyde-3-phosphate dehydrogenase, and liver pyruvate kinase, are impaired (117). The results indicate that TNF4α is pivotal in the regulation of glucose transport and glycolysis and hence the maintenance of glucose homeostasis. Odom and colleagues used genome-scale location analysis to identify the 53 promoters bound by HNF4α in human hepatocytes and pancreatic islets (118). Their results show that TNF4α binds directly to almost half of the promoters of actively transcribed genes in both the liver and pancreatic islets, which suggests its importance in the regulation of a large fraction of the liver and pancreatic islet transcriptomes and in developing and maintaining the proper function of these tissues.

Other MODY Genes IPF1 (MODY4) regulates the transcription of insulin in response to glucose stimulation, and the transcription of GLUT-2, glucokinase, and amyloid peptides (119-122). IPF1 is very important in the embryonic development of the pancreatic islets. Absence of IPF1 in mice arrests the development of the pancreas at the bud stage, resulting in pancreatic agenesis (123).

NeuroD1 (MODY6) is also required for the development of the pancreas. It regulates the expression of insulin by binding to the insulin promoter after forming a heterodimer with the protein E47 (124). Mice with NeuroD1 disrupted exhibit abnormal endocrine pancreas development (125).

HNF1β (MODY5) is expressed in liver, pancreatic islets, kidney, and uterus

(126,127). Genital abnormalities are associated with mutations in HNF1β in some families. These mutations are also associated with non-diabetic renal dysfunction and other developmental disorders (128). Despite sequence homology and functional similarity, patients with HNF1β mutations are different phenotypically from those with mutations in HNF1α (129). These MODY5 patients show a decreased response to glucose stimulation and hyperinsulinemia. 54

The remaining 16-45% of MODY patients (MODYX) displaying characteristics of

MODY do not have known genetic defects. Further studies on these subjects will identify other genes that are crucial for normal β-cell function.

Other than the glucokinase gene, the MODY genes code for transcription factors that are critical in the development of the fetal pancreas, the differentiation and proliferation of β-cells, and the regulation of genes that are involved in glucose metabolism and insulin expression and secretion. Mutations in these genes result in impaired glucose-stimulated signal transduction and insulin secretion in the affected subjects. These MODY genes are part of an integrated regulatory network which controls the development, differentiation, and functional maintenance of β-cells. HNF4α is an activator of HNF1α. Further studies on these known and unidentified MODY genes will enhance our understanding of T2DM and help develop new therapeutic strategies.

Genes Involved in the Insulin Signaling Pathway

Insulin/IGF-1 signaling pathway is a complex network (Figure 9) (130). The insulin receptor, insulin-like growth factor-1 (IGF-1) receptor, and insulin receptor-related receptor are members of a subfamily of receptor tyrosine kinases (131).

The insulin receptor is a tetramer of 2 α and 2 β subunits with the β subunits having tyrosine kinase activity. The binding of insulin to insulin receptors on the cell surface is followed by de-repression of the tyrosine kinase activity of the β subunits leading to transphosphorylation of the β subunits and a conformational change (Figure 9). 55

Figure 9. Insulin signal transduction pathway. The binding of insulin to insulin receptor leads to de-repression of the tyrosine kinase activity of the β-subunits of insulin receptor, which results in autophosphorylation of the receptor and subsequent catalytic phosphorylation of cellular proteins such as members of the IRS family, Shc and Cbl.

Upon tyrosine phosphorylation, these proteins bind to signaling molecules through their

SH2 domains, resulting in a diverse series of signaling pathways, including the PI(3)K- dependent pathway, the MAP kinase cascade, and the Cbl/CAP pathway. These pathways act in a concerted fashion to promote glucose uptake by enhancing vesicle trafficking, glycogen synthesis in liver and muscle, protein synthesis, and lipogenesis, and to inhibit gluconeogenesis and glycogenolysis in liver, and lipolysis in fat tissue (Adapted from

(130).) 56

Substrates for the insulin receptor include the family of insulin-receptor substrates, Gab-1 and Cbl (132,133). Several of these substrates also serve as substrates for other family members of receptor tyrosine kinases. For instance, insulin receptor substrate-1 (IRS-1) and IRS-2 are also substrates for IGF-1 receptors. After phosphorylation of tyrosine residues in these substrates, they bind to proteins that have SH2 (Src-homology-2) domains such as Grb2 and p85 subunit of PI3K. Insulin action is also attenuated by the dephosphorylation of the receptor and its substances by protein tyrosine phosphatases

(PTPases) such as PTP1B.

The activation of PI3K may have multiple effects (134). The activated PI3K catalyses the phosphorylation of phosphoinositides resulting in production of phosphatidylinositol-3-phosphates. Phosphatidylinositol-3-phosphates bind to the pleckstrin homology (PH) domains of many signaling proteins and regulate their activities. Akt/PKB (135) and the atypical PKCs (136) such as PKC-ζ and -γ are among the downstream target molecules of PI3K and are considered to be involved in the regulation of glucose transport. PI3K also has serine kinase activity which is suggested to be important in insulin signal transduction. The activity of this PI3K-dependent pathway is negatively regulated by the SH2 domain-containing inosital-5-phosphatase SHIP2

(137).

In addition to the above PI3K pathway, the CAP/Cbl pathway is also suggested to be involved in insulin-stimulated glucose uptake (138-140). Upon phosphorylation, the

Cbl/CAP complex translocates to the plasma membrane. This translocation leads to the recruitment of CrkII and C3G. C3G, a guanyl nucleotide-exchange protein, then activates 57 the G-protein TC10. The activated TC10 seems to act as a second signal in the translocation of GLUT4 to plasma membrane.

Insulin also stimulates the mitogen-activated protein (MAP) kinase pathway (141).

This pathway involves the phosphorylation of Grb2 by IRS proteins, which results in the recruitment of the Son-of-sevenless (SOS) exchange protein to the plasma membrane for activation of Ras. The subsequent stepwise activation of Raf, MEK and ERK augments the insulin signal and finally regulates transcription of many genes that are involved in a variety of metabolic and growth-promoting responses.

Type 2 diabetes is characterized by impaired peripheral glucose disposal, defective regulation of glucose output from liver and dysfunction of β-cells. Any possible defects involving the signaling of insulin play important roles in the pathogenesis of type 2 diabetes. Even in pancreatic β-cells, insulin signaling is critical in the regulation of its secretion. Moreover, there are distal interactions between the targets of insulin as illustrated by tissue-specific GLUT4 gene knockout models (142). Insight into these data will provide knowledge for deep understanding of the complexity of these signaling pathways and suggestions for further research as well.

Insulin Proinsulin is converted to insulin in secretory granules of β-cell.

Endoproteolytic cleavage of proinsulin by two endoproteases, PC1 (Prohormone

Convertase 1) and PC2, and exoproteolytic cleavage by Carboxypeptidase H (CPH) produce insulin and a C-peptide (Figure 10) (143). In humans, PC1 cleaves proinsulin preferentially on the carboxyl side of Arg32 at the chain B/chain C junction of proinsulin.

The exposed basic residues Arg32 and Arg31 are removed by CPH. PC2 specifically 58

Figure 10. The conversion of proinsulin to insulin. Proinsulin is converted to insulin and a C-peptide by endoproteolytic and exoproteolytic cleavage. 59 cleaves on the carboxyl side of Arg65 at the chain C/chain A junction. Again, the exposed basic residues, Arg65 and Lys64, are rapidly removed by CPH. This process results in mature insulin and released C-peptide. The majority of proinsulins undergo this route of conversion with a few (less than 10%) being cleaved by PC2 first.

Rare mutations in the insulin gene result in either normally processed insulin with impaired physiological function or high plasma proinsulin levels due to incomplete processing from proinsulin to insulin. An abnormal form of insulin, Val3Leu, only has about 5% of the normal binding activity and about 8% of the normal biological activity

(144). Usually, subjects with the insulin gene mutation and the symptoms collectively called insulin mutant syndromes, maintain normal response to exogenously administrated insulin. These subjects are characterized by hyperinsulinemia or hyperproinsulinemia, with variable hyperglycemia or type 2 diabetes if the loss of physiological function is severe (145,146). However, neither insulin gene mutations nor DNA polymorphisms are a major determinant in the majority of type 2 diabetic individuals.

Insulin Receptor As stated above, the insulin receptor is a member of a subfamily of receptor tyrosine kinases (131). The insulin receptor is a tetramer of 2 α and

2 β subunits with the β subunits having tyrosine kinase activity. The binding of insulin to insulin receptors re-activates the tyrosine kinase activity of the β subunits which leads to autophosphorylation of the β subunits and a conformational change (Figure 9). The interaction between insulin and insulin receptor is the first step in insulin signal transduction. 60

Heterogeneity of insulin receptors is found in different tissues (147). Differences in molecular weight, carbohydrate composition, and antigenicity are found between the insulin receptor α subunits in liver, muscle, and adipose tissue. As mentioned before, the responses to insulin in different tissues are different, with liver having the lowest half- maximal effective insulin concentration. Interestingly, different subtypes of insulin receptors are involved in response to insulin stimulation for different downstream targets

(148). For instance, in β-cells the activation of the insulin gene by insulin stimulation is promoted through insulin receptor type A (without exon 11), while that of the glucokinase gene is through insulin receptor type B (with exon 11). The heterogeneity of insulin receptors in different tissues and even in the same type of cells may provide a molecular basis for the functional heterogeneity of insulin action. Though more than 30 insulin receptor mutations are associated with insulin resistance to various degrees, these mutations are not the common causation for typical type 2 diabetes.

With many tissue specific insulin receptor deficient animal models constructed, the roles of insulin signaling in the regulation of both metabolism and cell growth in different tissues have been assessed. In insulin receptor gene disrupted mice, the homozygous null mice died within 48 to 72 hours of birth due to severe hyperglycemia and hyperketonemia although with normal prenatal growth and development. The function of insulin receptor is considered primarily for the metabolic action of insulin (149).

Despite the fact that muscle is responsible for the uptake of about 75% of blood glucose (including both insulin-induced and non-insulin-induced uptakes), skeletal muscle specific insulin receptor knockout mice displayed normoglycemia, 61 normoinsulinemia and normal glucose tolerance (150). However, fat metabolism in these mice is abnormal with high levels of serum triglycerides and free fatty acids and elevated fat mass. It was a surprise to find that the insulin resistance in skeletal muscle is not as important as it had been thought in T2DM. While the glucose transport and glycogen synthesis were greatly reduced in these mice, the rate of glucose transport in fat was increased threefold (151). This research demonstrates the redistribution of nutrients to adipose in these mice, which therefore causes obesity and subsequent development of the prediabetic syndrome.

Insulin acts not only as an endocrine hormone, but also as an autocrine hormone.

Although the mechanism of the insulin’s action on β cells is not known, its importance is demonstrated by the results of disruption of insulin receptor, specifically in β-cells (152).

These β-cell specific insulin receptor-deficient mice show a selective loss of acute insulin response to glucose stimulation, a common defect in type 2 diabetic humans. These mice also exhibit a progressively impaired glucose tolerance over 6 months. These results indicate the importance of glucose sensing through insulin signaling in β-cells in the regulation of insulin secretion.

Liver is the primary target of insulin action for the regulation of glucose output and hence the regulation of blood glucose level. Also, as stated several times, the response of liver to insulin stimulation is much more direct and sensitive than that of muscle or fat.

Mice with the liver-specific disruption of insulin receptor gene exhibited non- suppressible hepatic glucose output in response to insulin. These mice showed severe glucose intolerance, dramatic insulin resistance, and long-term morphological and 62 functional changes (153). The results confirm the role of liver in the regulation of blood glucose levels by insulin-mediated mechanism.

Mice with neuronal-specific insulin receptor gene knockout show no difference in brain development or morphology (154). Both female and male mice demonstrate increased adipose tissue mass and elevated plasma leptin levels accompanied by an increase in food intake only in females. These mice also show normal glucose tolerance and normoglycemia, but mild insulin resistance and hypertriglyceridemia.

Together from these tissue specific insulin receptor ‘knock-out’ studies, one can infer that insulin regulates the glucose homeostasis in a systematic way so that many tissues such as endocrine pancreas, liver, and muscle respond to insulin stimulation properly.

Any defects in insulin signaling in these tissues may affect the glucose and fat metabolism. The resulting imbalances may in a long-term or a short-term, impair glucose tolerance and insulin sensitivity, then finally contribute to the development of type 2 diabetes.

Insulin-Receptor Substrates (IRSs) The IRSs, although highly homologous, have structural differences which affect their tyrosine phosphorylation and selective affinity with SH2 domain-containing proteins (155-158). IRS1 and IRS2 are ubiquitously expressed in many tissues at relatively high levels, while the expression of IRS-3 and

IRS-4 are more restricted to selected tissues and at relatively lower levels. IRS-1 plays an important role in cell growth and insulin-regulated metabolism, while IRS-2 plays an important role in insulin-regulated glucose metabolism and β cell proliferation (155). 63

Homozygous null mice with a targeted disruption of the IRS-1 gene show retarded growth during both prenatal and postnatal development, along with mild insulin resistance (159,160). However, fasting blood glucose levels and glucose tolerance are normal in these animals. These mice do not develop type 2 diabetes due to the increased secretion of insulin to compensate for the mild insulin resistance. IRS-2 knockout mice display a type 2 diabetes phenotype characterized by impaired glucose tolerance, insulin resistance, and hyperglycemia (161). The IRS-2 deficient mice show both impaired insulin secretion and peripheral insulin resistance which result in overt diabetes. Mice with the IRS-3 gene disrupted show no defects in growth and glucose homeostasis (162).

Mice lacking IRS-4 only exhibit a slight impaired response to the glucose tolerance test and mild defects in growth and reproduction (163). The fasting blood glucose levels are slightly decreased and the plasma insulin levels are normal in these mice. Therefore, neither IRS-3 nor IRS-4 has demonstrated importance in T2DM. These knockout mice support the different roles of these IRSs in mediating responses to signal stimulation.

Moreover, IRS2 tends to be the major ‘player’ in insulin’s action related to glucose homeostasis.

Synergistic Effect of Insulin Receptor and Insulin Receptor Substrates

T2DM is considered to be a multigenic disease as manifested by its complex pattern of inheritance. Another characteristic of this disease is its progressive nature of onset over a long period of time. These features are reflected in mouse models with multiple heterogeneous null mutations in insulin receptor (IR) and insulin receptor substrates 64

(IRS-1 and/or IRS-2) (164). Mice with IR/IRS-1/IRS-2+/-, IR/IRS-1+/-, IR/IRS-2+/-, or IR+/-

were generated. At 2 months of age, there is no significant difference in blood glucose levels among these mice of different genotypes when compared to wild-type controls.

However, at 6 months, diabetes developed in 40% of IR/IRS-1/IRS-2+/-, 20% of IR/IRS-

1+/-, 17% of IR/IRS-2+/-, and 5% of IR+/- mice (164). All these diabetic mice show hyperinsulinemia, with the increase in the β-cell mass. In these double or triple heterozygous null mice, severe insulin resistance develops due to genetically deficient insulin action. A study of mice with β-cell specific insulin receptor gene disruption shows that β-cell dysfunction may play a role in the pathogenesis of T2DM (152).

Protein Tyrosine Phosphatase-1B (PTP-1B) PTP-1B is thought to be a negative regulator in insulin signaling that acts by dephosphorylating the activated

(tyrosine phosphorylated) insulin receptor and/or insulin receptor substrates. Mice with the PTP-1B gene disrupted exhibit a normal growth phenotype with enhanced insulin sensitivity as demonstrated by slight hypoglycemia and hypoinsulinemia (165). The increased tyrosine phosphorylation of insulin receptor in homozygous null mice is detected in muscle and liver but not in adipose tissue. Moreover, the PTP-1B deficient mice show resistance to high fat diet-induced weight gain and enhanced insulin sensitivity compared with their wild-type littermates. The fasting blood triglyceride levels are significantly lower in the homozygous null mice as compared with those of heterozygous mice or wide-type control mice.

65

Phosphatidylinositol 3-Kinase (PI3K), Akt2 and SHIP2 After phosphorylated by insulin receptors, the IRSs can serve as docking sites for SH2- containing proteins, such as the regulatory subunits of PI3K. The catalytic products of

PI3K, 3’-phosporylated phosphoinositides, act as a secondary messenger in the insulin/IGF-1 signaling pathway. p85α is an isoform of the regulatory subunits of PI3K.

Mice with targeted disruption of the p85α gene (Pik3r1) show increased insulin sensitivity and hypoglycemia that correlate with the elevated expression of other variants

(p55α and p50α) (166). Homozygous mice with all 3 variants disrupted died within days after birth (167). Still, these mice displayed hypoglycemia, hypoinsulinemia, and increased glucose tolerance, which indicate that increased expression of p55 and/or p50 is not responsible for the hypoglycemia in the mice lacking p85 only. Because p85α and its isoforms are not the only regulatory subunits of PI3K, the role of PI3K in the regulation of glucose metabolism by insulin signaling still needs to be clarified.

The role of Akt2 in mediating insulin signaling is established. The phosphoinositide- dependent serine-threonine protein kinase, Akt, also known as protein kinase B, is a signaling molecule downstream of the insulin receptor and PI3K. Akt has been shown to be critical in mediating the insulin signaling pathway in liver and muscle. Akt2 deficient mice show insulin resistance in muscle and liver with mild fasting hyperglycemia (168).

Compensatory hyperinsulinemia and the near four-fold increase in β-cell mass in response to insulin resistance suggest the normal function of β-cells in the Akt2 knockout mice. The loss of Akt2 in adipose cells result in mildly impaired glucose uptake in isolated adipocytes. 66

The role of SHIP2 as an important negative regulator in the insulin-stimulated regulation of glucose metabolism has been established. Type-II Sh2-domain-containing inositol 5-phosphatase (SHIP2), expressed in a wide range of tissues, is a member of the inositol polyphosphate 5-phosphatase family. Loss of SHIP2 in mice results in increased sensitivity to insulin, which is characterized by severe neonatal hypoglycemia, impaired regulation of gluconeogenesis, significantly low levels of plasma insulin and perinatal death (169). The heterozygous mice for the SHIP2 mutation show normal fasting blood glucose levels and insulin levels but displayed insulin hypersensitivity during a glucose tolerance test. This increased insulin sensitivity is associated with an increased recruitment of GLUT4 and increased glycogen synthesis in skeletal muscles.

Glucose Transporters Insulin-stimulated glucose transport is accomplished by the mobilization of responsive glucose transporters from intracellular storage sites to the cell surface. Muscle and fat are the two major sites for postprandial glucose disposal regulated by insulin.

GLUT4 is a transporter mainly expressed in skeletal muscle, heart and fat. However, surprisingly, GLUT4 knockout mice exhibit nearly normal fasting and fed blood glucose levels and normal glucose tolerance (170). The defects in the GLUT4 deficient mice are growth retardation, significantly reduced life span associated with cardiac hypertrophy and severely reduced adipose tissue deposits. Conversely, mice with muscle-specific

GLUT4 disruption show severe insulin resistance and glucose intolerance from an early 67 age (171). Also, in these mice, glucose transport is profoundly reduced at basal condition, and near absent with the stimulation of insulin or muscle contraction.

While the importance of glucose uptake by muscle is well established by the muscle-specific GLUT4 disruption model, the resulting insulin resistance in muscle and liver in mice with GLUT4 selectively disrupted in adipose tissue has been a surprise to many people (142). The mice show markedly impaired insulin-stimulated glucose uptake in adipocytes and develop glucose intolerance and hyperinsulinemia with normal growth and adipose mass composition. However, whereas the isolated muscle from the knockout mice respond appropriately to insulin stimulation in glucose uptake, muscle and liver cells show impaired insulin sensitivity in vivo. It is postulated that some regulatory factors secreted by fat may be responsible for the apparent insulin resistance in liver and muscle. However, the levels of FFA, tumor necrosis factor-alpha (TNF-α), leptin, as well as the triglyceride content in liver and muscle, are not significantly different when compared with that of control mice.

Other Susceptibility Genes

Calpain-10 Calpain-10 is the first putative diabetes susceptibility gene revealed by genomic scanning (172,173). Hanis et al. detected a susceptibility locus, designated NIDDM1, on chromosome 2 by means of a genome-wide screen for type 2 diabetes genes carried out in Mexican Americans (172). Horikawa et al. cloned a gene located in the NIDDM1 region that showed association with type 2 diabetes in Mexican

Americans and a northern European population from the Botnia region of Finland (173). 68

Basically, these results indicate that specific haplotypes at the CAPN10 locus are associated with an increased risk of type 2 diabetes in Mexican Americans, Finns, and

Germans. However, the conclusion is not supported by studies on other populations.

Calpain 10, a ubiquitously expressed calpain-like cysteine protease, belongs to a family of calcium-dependent, non-lysosomal cysteine proteases which modulate the activity of substrates by partial proteolysis. However, the molecular connection between calpain-10 and type 2 diabetes is not clear. A recent study shows that over-expression of an isoform of calpain 10 in β-cells results in increased secretion of insulin (174). It is also suggested that calpain-10 is a Ca2+-sensor which acts to trigger exocytosis in pancreatic

β-cells through interaction with the secretory machinery (174).

Peroxisome Proliferators Activated Receptor-gamma (PPAR-γ) PPARs are members of the nuclear hormone receptor superfamily, a group of nuclear transcription factors that mediate the effects of small lipophilic compounds, such as steroids, retinoids, and fatty acids, on the expression of a broad range of genes in many metabolically active tissues (175). PPAR- γ contains an agonist-dependent activation domain (AF-2), an agonist-independent activation domain (AF-1), and a DNA binding domain. The expression of the gene is predominantly found in adipose tissue but in other tissues as

well (176). After binding to its agonists, PPAR-γ heterodimerizes with retinoid X

receptor-α and binds to ‘cis’ acting PPAR response elements (PPREs) resulting in

stimulation of target gene expression. 69

PPAR-γ binds to a class of anti-diabetic drugs, thiazolidinediones (TZDs). TZDs are synthetic agonists of PPAR-γ that can help to improve glucose tolerance by enhancing insulin sensitivity and improving the function of β-cells in diabetic patients (177,178).

The effect of TZDs in reducing insulin resistance in type 2 diabetic patients is thought, at least partly, via activating PPAR-γ (179). Physiologically, PPAR-γ plays an important role in adipogenesis, the process of differentiation of preadipocytes into mature fat cells, and in stimulating lipogenesis in differentiated white adipose tissue. Patients with a dominant-negative mutation in the PPAR-γ gene exhibit severe hyperglycemia, suggesting a genetic linkage between PPAR-γ and T2DM (180). Unexpectedly, heterozygous PPAR-γ mutant mice display improved insulin sensitivity on a high fat diet and enhanced insulin-induced suppression of hepatic glucose production (181,182).

Recently, PPAR-γ was shown to bind to ‘cis’ elements in the promoters of GLUT2 and

GK genes in pancreatic β-cells and liver (183), which directly connects PPAR-γ with glucose metabolism in cells other than those in adipose tissue.

IAPP As stated above, pancreatic β-cells are highly differentiated cells that can sense changes in plasma glucose levels and secrete insulin along with islet amyloid polypeptide (IAPP) in response to a rise in glucose concentration. Although the physiological function of IAPP is not well established, IAPP is thought to be an active pancreatic islet hormone important in glucose homeostasis (184). It plays a role in regulating food intake and body weight. It potently inhibits gastric emptying and partially controls the rate of adsorption of meal derived glucose (185-187). Male mice with the 70

IAPP gene ‘knocked out’ exhibit increased insulin secretion and enhanced glucose tolerance compared with normal, control mice (188).

Another characteristic of T2DM is amyloid deposition in pancreatic islets in human diabetic patients (189-191). The precursor of amyloid is IAPP or amylin which is co-secreted with insulin by β-cells (192-195). The property of amyloidogenesis of IAPP varies in different species. For example, IAPPs of human and cat are amyloidogenic and therefore toxic, while those of the rat and mouse are not toxic (196). The ability of IAPP aggregates to induce cell death is well established in isolated islets or islet cells (197-

199). It has been shown that human intermediate-sized amyloid is much more toxic than the mature amyloid deposits (199-201). Amyloid deposits in human pancreatic islets of diabetic subjects may cause cell death via a similar mechanism.

The role of islet amyloid aggregate formation in the pathogenesis of T2DM remains to be revealed. From studies of human IAPP transgenic mice, the expression of amyloidogenic IAPP is not necessary to induce amyloid formation (202). However, an increase in β-cell secretion combined with impaired β-cell function is vital in promoting islet amyloid deposition.

Uncoupling Protein 2 Glucose stimulated metabolism in β cells results in increased production of adenosine triphosphate (ATP), which in turn enhances insulin secretion from β-cells through KATP channels. Uncoupling protein 2 (UCP2), a

mitochondrial inner-membrane protein, causes “proton leaks” in the mitochondria and

therefore decreases ATP production, leading to decreased insulin secretion in β-cells. 71

Therefore, a link between glucose-stimulated insulin secretion and expression levels of

UCP2 is suggested.

Over-expression of human UCP2 in isolated islets of normal rats leads to inhibition of glucose-stimulated insulin secretion (203). However, over-expression of human UCP2 gene in isolated islets from Zucker Diabetic Fat (ZDF) rats yields conflicting results with improved glucose-stimulated insulin secretion (204). The possible explanation for the discrepancy is the obese ZDF rats lack normal leptin receptors and thus have defective glucose-stimulated insulin secretion (205). Thus in ZDF rats, the relation between insulin secretion and UCP2 expression may be different from that in normal rats. The results from a recent study of UCP gene knockout mice are consistent with the results from the normal rats (206). In this study, homozygous UCP2-deficient (-/-) mice fail to express intact UCP2 mRNA in all tissues, including pancreatic islets, while the heterozygous (+/-

) mice have reduced expression of UCP2 in their islets. No difference in body weight was detected between control and the UCP2-deficient mice. ATP levels and insulin secretion in these deficient mice are increased while glucose levels are decreased under basal level or after a glucose challenge when compared with controls. Over-expression of UCP2 in normal rat islets results in severe inhibition of glucose-stimulated insulin secretion (203).

Thus, UCP2 is a negative factor in regulating insulin secretion.

Interestingly, the expression of UCP2 is up-regulated in ob/ob mice when compared with that in controls (206). Though serum levels of insulin are elevated (~33-fold) in the obese mice, blood glucose levels are high in the diabetic range, which may suggest increased and yet incomplete compensation of insulin secretion. The deficiency of UCP2 72 in ob/ob mice significantly reduces blood glucose levels while it has no effect on body weight. The improvement in diabetes is accompanied by the increased level of insulin secretion in the UCP2-deficient ob/ob mice. These results establish the role of UCP2 in

β-cell function.

The expression of the UCP2 gene is up-regulated by free fatty acids in many tissues including skeletal muscle, adipose tissue and islets (207). Interestingly, the promoter region of UCP2 gene contains both PPREs and the sterol regulatory element (SRE)

(208,209). Therefore, it is suggested that free fatty acids may up-regulate UCP2 gene expression through its SRE and/or PPREs and UCP2 may act as a mediator for lipotoxicity and impaired insulin secretion. However, the role of Ucp2 in the pathogenesis of T2DM remains to be further investigated.

Summary of Causes

As stated before, T2DM is considered to be a multigenic disease. In addition, from the observation of increasing incidence of the disease with the concurrence of increasing rate of obesity, environmental factors also play a significant role in the development of the disease. Thus, both genetic (such as in MODY) and environmental factors (such as in obesity) contribute to the development of type 2 diabetes.

The link between obesity and diabetes is insulin resistance, a well-established risk factor for T2DM (210). However, the fact that the majority of obese subjects do not develop T2DM but are able to compensate chronic insulin resistance by increasing insulin secretion suggests that insulin resistance by itself is not sufficient to cause 73 diabetes (211). In contrast, subjects with chronic obesity develop T2DM only when they fail to increase their β-cell mass and insulin secretion for the increased demand.

However, for subjects with inherent defects in insulin secretion, the disease will develop even without peripheral insulin resistance, as in the case of MODY.

Because of the complex pathophysiological process involved in type 2 diabetes mellitus, any abnormalities in insulin secretion, tissue sensitivity to insulin regulation, and an organism’s adaptation under the pressure of obesity could be involved in causing type 2 diabetes. Over the years, researchers have found several susceptible genes that have roles in the development of insulin resistance or in the secretory response of β-cells to stimulation. Specifically, in liver, the processes of glucose metabolism, including gluconeogenesis, glycogen synthesis, glycogenolysis, glycolysis, and fatty acid metabolism, and their regulations and interactions with signals such as insulin and glucagon, and glucose absorption from circulating sources would be closely associated with type 2 diabetes. In muscle, the processes of insulin-regulated glucose disposal and the development of insulin insensitivity would be related to the progress of the disease.

Likewise, in adipose tissue, the processes involving metabolism of fatty acids and carbohydrates and their regulations by insulin and other signals and the secretion of adipocyte-specific proteins could be important to obesity-related diabetes. Obviously, in pancreatic islets, the processes of secretion of hormones such as insulin and glucagon and the regulatory factors would be the key to understanding the dysfunction of islets and the relative deficiency of insulin secretion that are frequently detected as the disease develops. 74

From animal model studies, the roles of some genetic defects in the pathogenesis of

T2DM has been found as in the cases of mice with over-expressed 11β HSD-1, specifically in adipose tissue (74), muscle-specific GLUT4 disruption (171), and the double and triple heterozygous null insulin receptor and insulin receptor substrate genes

(164). While the association between genetic defects in MODY genes and β-cell dysfunction is well recognized and accepted, other studies suggest the primary genetic defects in insulin resistance as in the case of over-expressed 11β HSD-1 in adipose tissue

(74), and possibly in the multiple heterozygous null mice (164). Caution should be taken in implicating the defects in animal models with human clinical cases as no clinical evidence found supports the association of these defects in human types of T2DM. The role of fat tissue in the development of T2DM gained recent prominence and should be given adequate attention since many circulating hormones as well as free fatty acids have been found to impact glucose homeostatis. 75

Biology of the Pancreas and Pancreatic β-cells 76

Introduction

Structural and Functional Heterogeneity of Pancreas The pancreas is a mixture of exocrine gland and endocrine gland. The exocrine gland, which comprises

98% to 99% of the pancreas, is composed of tubulo-acinar gland cells. About 20 digestive enzymes, such as amylase, lipase, phospholipase A, and trypsin, are produced by the exocrine gland and released into the digestive duct. The endocrine gland, which is only about 1% to 2% of the pancreas, is composed of islets of Langerhans (or islets) which secrete hormones such as insulin and glucagon. Figure 11 illustrates the distribution of islets in the human pancreas and the composition of islets. The islets of

Langerhans are not uniform in terms of cell-type and function. The islets are composed of

α-cells, β-cells, δ-cells, and PP-cells which are classified by the hormones they synthesize and secrete (Table 2). The cell type that secretes insulin is the β-cell whose functional abnormality and structural damage are critical for the pathogenesis of T2DM.

Postnatal Growth One feature of β-cell biology is found in its postnatal development (212). In C57Bl/6J/129J mice, the β cell mass increases at least 10-fold from 4 weeks to 6 months of age and is linearly correlated with body weight. During the neonatal period, β-cell mass in a growing rat does not increase for several days due to increased apoptosis for a remolding of endocrine pancreas.

β-Cell Renewal Based on the fact that the replication rate (2-3%/24h) in 77

Figure 11. The distribution of islets in the human pancreas (modified from the Diabetes

Handbook produced by the University of Massachusetts) 78

Table 2. The relative frequency and distribution of cell types in a pancreatic islet.

Cell Type Relative Frequency Hormone(s) Distribution

Alpha 20-25% Glucagon Peripheral

Beta 65-75% Insulin, Islet Amyloid Central

Polypeptide

Delta 5-10% Somatostatin Scattered

F or PP 1-2% Pancreatic Polypeptide Peripheral

79 adult rodent pancreatic β-cells approaches the rate of β-cell death, it is estimated by mathematic modeling that a complete replacement of the β-cell population in rats could occur in about a month (213). β-cell replication from existing β-cells and neogenesis from adult duct epithelial cells does occur (214,215).

β-cell Dysfunction and Structural Damage in T2DM

The earliest detectable defect of insulin secretion associated with T2DM is impaired or lost acute-phase release of insulin in response to a square-wave increase in arterial glucose concentration (216). The second-phase insulin release is usually considered

“normal” or “enhanced”. However, as stated before, this second-phase response is still inadequate in individuals with impaired glucose tolerance when compared with that of individuals with normal glucose tolerance and insulin sensitivity (217,218).

Disproportionate hyperproinsulinemia (elevated proinsulin/insulin) is another abnormality in type 2 diabetes (219,220). Whether it is due to the demand of quick release of secretory granules before proinsulin is fully processed in an insulin resistant state or due to genetic defects of proinsulin processing is unknown. As mentioned before, the biological activity of proinsulin is much lower than the mature insulin.

A significant decrease in β-cell mass during the later phase of T2DM occurs as a consequence of increased frequency of β-cell apoptosis in both lean and obese cases of diabetes when compared with age and BMI matched controls (91). Strategies of arresting apoptosis or stimulating replication of β-cells may be feasible in the treatment of T2DM.

80

The Decompensation Model for β-Cell Dysfunction in T2DM

The compensatory increase in β-cell mass is common in insulin resistant and diabetic subjects (89,214). It has been shown that the β-cell mass can increase 50% in 96 hours in the chronic glucose infused rat (221). While many factors have been implicated in stimulating β-cell expansion, glucose is one of the best stimuli for β-cell replication in vitro and in vivo (221). However, as stated above, the dysfunction of β-cells is unanimously found during the progression of T2DM. Weir et al. suggests a decompensation model for β-cell dysfunction in diabetic subjects (222). It is speculated that the loss of β-cell differentiation due to exposure of β-cells to diabetic milieu, especially hyperglycemia, causes the dysfunction of β-cells. Whereas normally functional

β-cells are characterized by their ability of secreting insulin sufficiently and timely in response to a rise of blood glucose, the dedifferentiated β-cells are marked by the decreased expression of many genes important for glucose-stimulated insulin secretion and for β-cell development and differentiation as seen in the rat partial pancreatectomy model for diabetes (223,224). In this rat model of diabetes caused by 85%-95% partial pancreatectomy, genes involved in the synthesis and secretion of insulin and the insulin signaling pathway, such as insulin, GLUT2, glucokinase, mitochondrial glycerol phosphate dehydrogenase, pyruvate carboxylase, the voltage-dependent calcium channel

α1D, PDX-1, and HNF1α, are downregulated. In direct contrast, a group of suppressed genes, including hexokinase 1, glucose-6-phosphatase, and LDH-A, are markedly upregulated (224).

81

Regulatory/Transcriptional Factors in Developmental Stages

As stated above, the mammalian pancreas is comprised of exocrine and endocrine cells, with the endocrine cells forming islets of Langerhans. The exocrine part, which is composed of acini and ducts, produces and secretes digestive enzymes into the duodenum. The endocrine part contains four cell types, alpha-, beta-, delta-, and PP-cells, and secretes hormones into blood to regulate glucose metabolism and other physiological processes. These four types of cells form the islets of Langerhans, which are distributed throughout the whole pancreas.

During endocrine pancreatic development, early pancreatic progenitor cells, endocrine progenitor cells, and adult islets of Langerhans, use several signaling pathways and transcription factors. Hnf1α (225,226), Hnf1β, Foxa2/HNF3β (227), Hnf4α, Hnf6,

Hb9/Hlxb9 (228,229), Nkx6.1 (230), Nkx2.2 (231), Isl1 (232), Pdx1/Ipf1,

NeuroD1/BETA2 (125,233,234), Ngn3 (235-237), Pax4 (238), and Pax6 (239,240), have been identified to be important for pancreatic development (see Figure 12) (241). Among these transcription factors, Hb9 is required for the development of the dorsal pancreas as inactivation of Hb9 leads to the selective agenesis of the dorsal bud (228,229). Some of these genes are also involved in the maintenance and function of β-cells. Mutations in

Hnf4α, Hnf1α, Pdx1, Hnf1β, and NeuroD1 have been identified as causes of MODY type1, 3, 4, 5, and 6, respectively.

Recent advances in the understanding of the role of these regulatory factors in the distinct pancreatic development stages and in the maintenance of β-cell function will help in understanding the pathophysiological processes of diabetes mellitus and will also aid 82

Figure 12. Expression patterns of different transcription factors and their indispensable roles during the distinct developmental stages of β-cells. Indispensable transcription factors are defined at specific stages by gene knockout studies. (Adapted from (241).) 83 in the identification of targets for therapeutic interventions. For example, with the knowledge of β-cell development biology and the underlying transcriptional cascade, gene therapy combined with cell therapy have been successfully used in animal models of autoimmune diabetes (242).

Differentiation of endocrine and exocrine pancreas from early foregut epithelial cells results from a cascade of gene activation events controlled by a network of transcription factors. The regulatory network formed by transcription factors during pancreas development is featured by different regulatory modalities, such as, a set of transcription factors regulating another set of transcription factors which in turn affect other genes or autoregulation of some transcription factors. Some important transcription factors involved in endocrine pancreas development and β-cell function are discussed below.

Pdx1 In the mouse embryo, the pancreas develops as independent ventral and dorsal buds emerging from the primitive foregut epithelium at approximately embryonic day 9 (E9), then two pancreatic buds fuse. Transcription factors expressed in very early pancreatic cells include Pdx1 , Ptf1α, Nkx2.2, Nkx6.1, Hb9, Hex, Hnf6, and Foxa2. The first molecular marker that defines the early pancreatic epithelium is the homeodomain- containing transcription factor PDX-1 (243-245). The expression of Pdx1 is initially detected in the foregut epithelial cells that develop into pancreas. The expression is maintained during pancreatic early bud formation and development and then is down- regulated during later stages of differentiation (Figure 12). However, PDX-1 reappears primarily in the differentiated β-cells. 84

Pdx1 is one of the genes required for pancreatic bud formation and development

(123,246). Pdx1 is also indispensable for differentiation and maintenance of β-cells. In β- cells, PDX-1 regulates glucose-mediated insulin gene expression as well as other genes involved in glucose transport and metabolism. As stated many times, β-cells are responsible for producing and secreting insulin mainly in response to increased blood glucose levels. High concentrations of plasma glucose serve as a stimulatory signal to β- cells as glucose enters into β-cells through GLUT2 followed by phosphorylation by glucokinase. Both GLUT2 and glucokinase are important for the normal function of β- cells. In adult pancreatic β-cells, Pdx-1 not only regulates insulin expression in response to glucose stimulation, but also regulates the expression of GLUT2 and glucokinase by binding to the promoter regions of the respective genes (121,247). Disruption of Pdx1 in mice results in defects of early pancreatic budding and development (123,246). Specific

Pdx1 inactivation in β-cells results in late-onset diabetes characterized with decreased expression of insulin and GLUT-2 (248). Mice heterozygous for Pdx1 display abnormalities in islets as evidenced by abnormal islet architecture, reduced number of islets, increased apoptosis, and impaired glucose tolerance (248-250).

Several studies suggest that glucose-induced insulin gene expression in β-cells is primarily mediated by Pdx1 which binds to the promoter/enhancer region within the 5' flanking region of the insulin gene (251,252). This binding activity is regulated by extracellular glucose levels (253). When Psammomys obesus rats, a model of diet- responsive type 2 diabetes, are fed a high-energy diet, they exhibit diabetes with greatly reduced insulin stores in β-cells. A defect in Pdx1 expression could cause insulin 85 depletion (254,255). When an exogenous Ipf1/Pdx1 gene is over-expressed in isolated P. obesus islets, glucose-stimulated insulin gene expression is restored and a rapid depletion of insulin content after exposure to high glucose is prevented, which suggest the importance of Pdx1 in the regulation of insulin gene expression in response to glucose stimulation.

Several regulatory factors, along with distal and proximal promoter/enhancer regions controlling Pdx1 transcription, have been identified. For the regulation of β-cell specific gene expression, the distal enhancer element is required (256). In humans, transcription factors Hnf3β, Hnf1α, and SP1 activate the expression of Pdx1 (257). The expression of the gene is also auto-regulated by PDX1 (258,259). Additionally, other transcription factors such as Maf (260) and Pax6 may contribute to the regulation.

Type 2 diabetes is considered a disease caused by a combination of genetic and environmental factors. The genetic predisposition underlying the disease may involve multiple genes as suggested by the pattern of the disease occurrence and the linkage and association studies. MODY is a type of diabetes mellitus that is characterized by monogenic pattern, autosomal dominant inheretance, early onset, and insufficient insulin secretion upon stimulation. Among 6 types of MODY, type 4 is caused by mutations in

Pdx1 (Table 1). A frameshift mutation that leads to a nonfunctional truncated Pdx1 molecule was first identified (261). Other mutations, such as missense mutations resulting in reduced binding activity of the factor to the target DNA sequence, have also been identified (251,262). 86

In summary, Pdx1 plays a pivotal role not only in the development and differentiation of pancreatic islets and the specification of β-cells, but also in the regulation of insulin expression as a response to glucose stimulation. Further studies on this factor and the associated transcription factors will enhance our understanding of β- cell biology and function and pathological changes that are associated with diabetes.

Ngn3 Ngn3 is indispensable for the development of endocrine cells after bud formation as inactivation of Ngn3 disables the development of all endocrine cell types in the pancreas (235-237). Mice with null Ngn3 mutation fail to generate any pancreatic endocrine cells and die postnatally from diabetes.

NeuroD1 NeuroD1 is an important transcription factor for the development of islet cells and for the function of β-cells (125,233,234). NeuroD1 is important for terminal differentiation of islet cells including insulin- and glucagon-producing cells. As stated before, mutations in NeuroD1 cause MODY6.

Implications in the Treatment of Type 1 and Type 2 Diabetes Mellitus The understanding of the regulatory network of transcription factors that defines the development of β-cells will greatly facilitate the advance in the studies of stem-cell therapy and gene therapy for diabetes mellitus. Embryonic stem cells derived from haematopoietic organs have the potential to differentiate into insulin-secreting β-cells, which can be transplanted into patients as a promising therapeutic option for the 87 treatment of diabetes (263). A recent approach to induce islet neogenesis by transdifferentiation has been proved feasible in the rodent model of T1DM (264). Our knowledge of the underlying regulatory network is the key to the success of these promising therapeutic interventions in the future.

Human islet transplantation for the treatment of T1DM is restricted by the insufficient supply of islet tissue (265). Functional insulin-producing β-cells generated from stem/progenitor cells may provide a competent substitute for the replacement therapy in the treatment of diabetes. For stem-cell therapy, it is critical to obtain sufficient number of differentiated β-cells while the physiological function and biological properties of these cells are maintained and optimized. A recent study has shown that the efficiency of in vitro generated insulin-producing cells from undifferentiated ES cells can be significantly increased with the over-expression of Pax4 (266). The exogenous expression of Pdx-1, another transcription factor involved in the development of endocrine pancreas, has been shown to enhance the production of insulin-secreting cells from human ES cells (267). These results suggest that stepwise culture manipulations in vitro with appropriate transcription factors and growth factors can direct ES cells to differentiate towards functional endocrine islets.

Several studies have shown that transdifferentiation of cells from the liver towards insulin-secreting cells may restore glucose responsiveness in diabetic subjects via gene therapy (242,268,269). Liver and pancreas have a common embryonic origin with many common phenotype-maintaining transcription factors, which makes the liver a natural target for β-cell gene therapy. When Pdx-1/Ipf1 was introduced into streptozotocin 88

(STZ)-treated diabetic mice, hypoglycemia and severe hepatitis were observed in the transgenic mice (242,270). However, when NeuroD/Beta2, a transcription factor downstream of pdx-1, and betacellulin, a β-cell stimulating hormone, were delivered to

STZ mice, normoglycemia was achieved (242). Insulin-producing cells were detected in the liver of the transgenic mice. Thus the future possibility to generate pancreatic β cells in vivo may help in the treatment of diabetic individuals. 89

Research Objectives 90

The purpose of this study was to identify pancreatic proteins that are involved in the development of T2DM. Diet-induced obesity and resulting diabetes in C57BL/6J mice is a model of T2DM (271,272). Development of diabetes in C57BL/6J mice by high-fat diet is associated with obesity. As stated above, while obesity does not result in diabetes in normal individuals with compensated insulin secretion, it can cause insulin resistance and subsequent diabetes in susceptible subjects with an unidentified genetic predisposition. In this animal model, high-fat diets combined with a genetic predisposition are critical for the development of hyperinsulinemia and hyperglycemia (271,273,274). Defects in insulin reaction to glucose stimulation in these C57BL/6J mice suggest that they have a genetically determined impairment in their β-cell function that render them vulnerable to develop T2DM when environmental factors, such as high-fat diet induced obesity, exaggerate this predisposition (271). Since the pancreas is very important in producing hormones that regulate blood glucose and has been postulated to be a key organ in the etiology of T2DM, the hypothesis is that pancreatic protein profiles found in diabetic mice would be different than that found in normal mice.

After analysis of the pancreatic protein profiles of diabetic and control mice, several differentially expressed proteins with unknown function in association with T2DM were identified and further studied. Two of these proteins termed, REG1 and REG2, which may be involved in the regeneration of pancreatic β-cells, were up-regulated very early in the progression of obese mice to T2DM. The up-regulation of Reg1 and Reg2 may suggest the effort of the pancreas in trying to ameliorate the hyperglycemic condition by stimulating the proliferation of pancreatic β-cells and enhancing the subsequent insulin 91 secretion. Another protein, Glutathione peroxidase (Gpx1) that functions in the clearance of reactive oxidative species (ROS), was found to be down-regulated in the diabetic mice at later stages. The down-regulation of glutathione peroxidase in pancreas could contribute to the progressive deterioration of β-cell function, which is related to the hyperglycemia induced oxidative stress. In order to characterize the function of Reg2 and

Gpx1 in the development of T2DM, expression vectors for the two genes were constructed and in vitro expression studies were performed, which provided basis for subsequent in vivo transgenic mice study.

Below I have organized my results and conclusion into three manuscripts, the first of which has been submitted for publication. The two other will be submitted before my graduation. 92

Proteomic Analysis of the Pancreas of Type 2 Diabetic Mice

Linghua Qiu, Gayle E. Matheny and John J. Kopchick

Department of Biological Sciences (L.Q.), Molecular and Cellular Biology Program

(L.Q., J.J.K.), Edison Biotechnology Institute (G.E.M., J.J.K.), and Department of

Biomedical Sciences, College of Osteopathic Medicine (J.J.K.), Ohio University, Athens,

Ohio 45701

Running title: Differential pancreatic proteins in diabetes

Key words: Regenerating Islet-Derived 1, Regenerating Islet-Derived 2, Cellular

Glutathione Peroxidase, Type 2 Diabetes Mellitus, Pancreas, Two-dimensional gel electrophoresis 93

Abstract

The purpose of this study was to identify pancreatic proteins that are involved in the development of type 2 diabetes mellitus (T2DM). C57BL/6J male mice fed a high-fat diet become obese and develop T2DM, which serve as models for the disease in humans. The pancreas is important in producing hormones that regulate blood glucose and it has been postulated to be a key organ in the etiology of T2DM. In this study, proteins were extracted from the pancreas of diabetic and control mice and were resolved by a procedure termed 2 dimensional gel electrophoresis (2-DE). The pancreatic protein profiles were compared between the control and diabetic mice. Differentially expressed protein spots were identified by mass spectrometry analysis. Among 11 differential protein spots detected, the protein levels of REG1 (3 spots) and REG2 (1 spot) were higher in diabetic mice when compared with controls. Reg1 has been shown to be involved in the regeneration of pancreatic β-cells. The up-regulation of Reg1 and Reg2 in diabetic mice may reflect the effort of the pancreas to ameliorate the hyperglycemic condition by stimulating the proliferation of pancreatic β-cells, therefore, enhancing insulin secretion. Rho GDP-dissociation inhibitor 1 (GDI-1), 1-Cys peroxiredoxin protein, and pancreatic elastase 3B were also up-regulated in diabetic mice relative to controls. Glutathione peroxidase, a GSH-dependent enzyme to remove hydrogen peroxide and fatty acid hydroperoxide and the most abundant isoform in the glutathione peroxidase gene family, was found to be down-regulated in the diabetic mice at later stages. The down-regulation of glutathione peroxidase together with over-production of reactive oxidative species in the pancreas of diabetic mice could contribute to the 94 progressive deterioration of β-cell function. Also, the protein levels of the receptor of activated protein kinase C1 were decreased in diabetic mice when compared with normal controls. 95

Introduction

There are about 15 million people in the United States who have type 2 diabetes mellitus (T2DM), a metabolic disorder resulting from the body's inability to make enough or properly use insulin. At present, there is no method to prevent or cure the disease, and available treatments have only limited success in controlling its many devastating complications including kidney failure, blindness, and amputation. Many studies have shown that T2DM is caused by combination of yet to be identified genetic factors coupled with environmental factors such as obesity (275). Thus, studies elucidating the molecular defects responsible for this disease are critically important for subsequent design of treatment regimens.

The pancreas is a heterogeneous organ mixed with exocrine and endocrine cells. The exocrine cells produce digestive enzymes such as amylase, lipase, and trypsin that are secreted into small intestine to help digest carbohydrates, lipids, proteins, etc. The endocrine cells, also called the islets of Langerhans or the islets, are responsible for the secretion of hormones such as insulin and glucagon that are regulators of plasma glucose.

Extensive interactions between endocrine cells and other part of the pacreas exist. Many studies have shown that the exocrine part of the pancreas secretes proteins that are involved in the regeneration and the function of pancreatic β-cells (276-279). Ductal progenitor cells are source for endocrine islets proliferation under hyperglycemic condition (280).

During the early phase of T2DM, β-cell dysfunction is common in diabetics while a significant decrease in β-cell mass becomes apparent during the later phase of the disease 96 in both lean and obese cases (91,222,281-283). In obesity-related diabetes, affected individuals are characterized with loss of an acute-phase insulin response and progressive deterioration of β-cell function, coupled with peripheral insulin resistance.

The link between obesity and diabetes is insulin resistance, a well-established risk factor for T2DM (210). While the majority of obese subjects do not develop T2DM but are able to compensate chronic insulin resistance by increasing insulin secretion, subjects with inherent and/or acquired defects in insulin secretion develop T2DM when they fail to increase their β-cell mass and insulin secretion for the increased demand. In most cases, obesity occurs before the onset of T2DM.

Several diabetes animal models have been used to study obesity-induced diabetes.

Animals with known genetic mutations, such as ob/ob (obese) and db/db (diabetic) mice which have mutations in the leptin structural gene (ob) and the leptin receptor gene (db), respectively, are commonly used (284-286). However, the problem with these genetically induced T2DM models is lack of popularity or representativity as a cause of the disease in the human population, as these genes have not been demonstrated to contribute to obesity and T2DM in the general population. Experimental animal models of T2DM induced by chemical destruction of part of β-cells or surgical removal of part of the pancreas do not resemble T2DM in humans in which the disease is often preceded by obesity (287). C57BL/6J mice fed a high-fat diet are a model of T2DM developed by dietary manipulations and a model to study the mechanism of impaired islet adaptation in insulin resistance (271,272). In this animal model, high-fat diet and genetic predisposition are critical for the development of hyperinsulinemia and hyperglycemia (271,273,274). 97

Studies have shown that these mice have defects in insulin reaction to glucose stimulation, which suggests that they have a genetically determined impairment in their

β-cell function that render them vulnerable to develop T2DM when high-fat diet induced obesity exaggerates this predisposition (271). This diet-induced diabetes model mimics the naturally occurring type 2 diabetes in humans (271,272).

In T2DM, hyperglycemia has both global and tissue-specific effects on various tissues. The effects include intracellular signaling pathways such as IRS, MAPK, PKC, and the production of reactive oxidative species (ROS) (288-291). It is important to learn pathological changes in the pancreas during the development of T2DM.

Some researchers have used a microarray approach to study gene expression profiles in diabetes research (292). However, a lack of correlation and sometimes contradictions between transcriptional profiles and actual protein levels, necessitate the need for direct protein profiles (293-295). In the results presented here, we used a proteomic profiling technique, i.e., the 2-dimensional gel electrophoresis (2-DE) coupled with mass spectrometry analysis. This approach enables direct qualitative and quantitative analysis and profiling of proteins as the disease develops (296). Use of this animal model and the technique may help to identify genes and metabolic characteristics in the pancreas that are causal and/or closely related to the disease. In this study, we have detected 11 differential protein spots, among which 10 spots were positively identified by mass spectrometry analysis. 98

Materials and Methods

Animals Three-week old male C57BL/6J mice were purchased from the

Jackson Laboratory (Bar Harbor, ME). Upon arrival, 50 mice were weaned onto a high- fat diet with 26.6% of calories from carbohydrates, 57.6% from fat, and 15.7% from protein (#F1850, Bio-Serv, Frenchtown, NJ) (272) while 20 being weaned onto a standard rodent chow containing 60% of calories from carbohydrates, 14% from fat, and

26% from protein (Prolab RMH 3000, PMI Nutrition International, Inc., St. Louis, MO).

Mice were housed, up to two per cage, in a temperature-controlled (22 oC) room on a 14-

h light, 10-h dark cycle. Food and water were supplied ad libitum. At each time point (2,

4, 8, and 16 weeks on diet), 3 mice from each group were sacrificed by cervical

dislocation. Mice from each group were selected according to their weights, fasting blood

glucose levels and plasma insulin levels. Mice from high-fat diet displaying symptoms

such as overweight, high fasting glucose level, and high fasting plasma insulin level were

selected as diabetic mice while mice from normal diet displaying normal profile were

considered as age matched controls. The pancreata were removed and quickly frozen at -

80oC. Protocols were approved by the Ohio University Institutional Animal Care and Use

Committee and followed federal, state, and local laws. 99

Mice weight measurements Mice were weighed biweekly starting at weaning

(three weeks of age) throughout the course of the study. Means for each group on different diet at each time point were calculated and plotted.

Blood glucose and plasma insulin measurements Fasted blood glucose levels and plasma insulin concentrations were determined at different time points (2, 4, 8, and

16 weeks on diet). At the day of measurement, mice were fasted for 8 hours starting early in the morning. After fasting, the mice were shortly placed under a heat lamp for about 15 seconds to vasodilate the tail vein before obtaining the blood. Fasted blood glucose levels were measured using a Lifescan OneTouch Glucometer (Johnson & Johnson, New

Brunswick, NJ) with a drop of blood from the tip of the tail. At the same time, blood was collected into a heparinized capillary tube. After blood samples were centrifuged at

7000xg for 10 min at 4 oC, plasma samples were then obtained. Serum insulin

concentrations were determined with the Mercodia Ultrasensitive rat insulin ELISA kit

(ALPCO, Windham, NH). Values for mouse insulin were adjusted by multiplication by a factor of 1.23 according to the manufacturer’s recommendation. The intra- and interassay coefficients of variation were less than 10% and less than 5%, respectively. These data, along with weight data, were used as phenotypic parameters of the animals. 100

Protein sample preparation For protein analysis, pancreata were removed from sacrificed mice and were homogenized in a protein solubilization buffer which contained 7M urea, 2M thiourea, 4% Chaps and 2.5µl/ml of 40% (w/v) Bio-Lytes (pH3-

10) with a glass homogenizer. Sonication was used to disrupt the tissue. Cell debris and insoluble substances were removed by ultracentrifugation at 150,000Xg for 45 minutes.

The protein concentrations were determined by Bradford method.

Two-dimensional gel electrophoresis Protein samples were treated for 2 hours with 5mM tributylphosphine and 20ul/ml of 1M Tris buffer (pH8.8) to reduce disulfide bond and with 15mM iodoacetamide for 30 minutes for alkylation at room temperature.

The first dimensional analysis by isoelectric focusing (IEF) was carried out after protein samples were passively rehydrated on 17CM immobilized pH gradient (IPG) strips with a broad pI range of 3 to 10 (Bio-Rad, Hercules, CA). The voltage was linearly increased from 0 to 6000 V during first 10 hours, followed by 10 hours at 6000 V with a current limit of 50 µA/strip. Following IEF, the strips were equilibrated in a buffer containing 6

M urea, 2%W/V SDS, 0.375 M tris/HCl (pH8.8), 20% v/v glycerol, for 15 minutes before loading for secondary SDS-PAGE analysis. The strips were sealed on the borderline of the SDS-PAGE gel by 0.5% low-melting point agarose gel. Proteins were separated by size in 15% SDS-polyacrylamide gels (200X200X1mm) at 26mA/gel with maximum voltage of 300V for 9 hours at 4oC. The first and second dimensions were performed using a 2-DE system (Bio-Rad, Hercules, CA). After electrophoresis, gels were then

fixed in a fixing solution containing 40%EtOH, 2% acetic acid, 0.0005% SDS overnight 101 followed by washing three times in a buffer of 2% acetic acid and 0.0005% SDS. Gels were stained using the fluorescent dye, sypro orange (1:5000) (Molecular Probes,

Eugene, OR), adapted from Malone et al (297).

Quantitative analysis of gel images Gel images were captured by a laser- scanning device (Fuji FLA-3000G). The densities of protein spots, which were normalized by the total densities of all matched spots in a set of gels, were quantitatively compared between diabetic and normal control groups using the PDQuest program (Bio-

Rad).

Spot identification by mass spectrometry Protein spots of interest were excised from the gels. Mass spectrometric analyses of the spots were performed by the

Proteome Mapping Laboratory at the University of Michigan

(www.proteomeconsortium.org). The Applied Biosystems 4700 Proteomics Analyzer

(TOF/TOF) was used to obtain mass spectra which were queried by using the Mascot program (http://www.matrixscience.com/) for identification. Prior to the generation of peak lists, MS spectra were processed for calibration by trypsin auto-digestion peaks, smoothing. The signal-to-noise criterion was set to 25-30. The mono-isotopic masses were processed for identification. For MS/MS spectra, the peaks were calibrated by default and smoothed. All peaks were de-isotoped.

102

The Mascot program has the “Peptide Mass Fingerprint Search” engine for a probability-based peptide mass fingerprint (PMF) database search and the “MS/MS Ions

Search” for an MS/MS search. The general parameters for searching are NCBI Database, all species, trypsin digestion, 1 missed cleavage, fixed Carbamidomethylation of Cys, variable modifications of acetyl-N-term, oxidation-M (methionine), and Pyro-glu, ±50 ppm of Peptide Mass or Parent Tolerance. Peptide Charge State of 1+ and Fragment

Mass Tolerance of ± 0.5 Da were used for the MS/MS Ion search.

Statistical analysis Results were presented as mean±SE. Data were analyzed by

ANOVA. Difference was considered statistically significant if P < 0.05. 103

Results

Comparisons of weight gains The weight profiles of the mice on high-fat diet and their control littermates on a normal diet were obtained and assessed biweekly from weaning at age of 3 weeks throughout the course of the study (Figure 13). The difference of body weights between these two groups of mice showed differences that were significant after two weeks and beyond while on diet.

Comparisons of fasting glucose and insulin levels Fasting blood glucose levels in the group of mice fed on high-fat diet (HF) were significantly higher, compared with that in the controls (LF) at all time points (Figure 14). The fasting plasma insulin levels in the HF group were significantly higher than those of the control LF group kept increasing as a function of time (Figure 15). Interestingly, these data showed that

C57BL/6J mice display hyperglycemia from early stage and hyperinsulinemia during later stage while they were gaining weight after exposure to the high-fat diet.

Identification of differential protein spots Proteins from pancreata of high-fat fed diabetic and control mice were resolved by 2-DE. Protein spots were considered differential if the spots showed a 50% or greater increase or a 33% or greater decrease in 104

50

40

30 LF

20 HF Weight (g) Weight 10

0 0246810121416 Weeks on Diet

Figure 13. Body weight profiles for the two groups of C57BL/6J mice on a low-fat normal chaw (LF, n=20), and a high-fat diet (HF, n=50). Weights were obtained biweekly and plotted for each group. It was shown a tendency that the HF group were increasingly gaining more weight than the LF group even from 2 weeks on diet and onward (P < 0.01 at 2 week on diet and onward). Values are means±SE. 105

250 200 150 LF 100 HF 50

Glucose (mg/dl) Glucose 0 24816 Weeks on Diet

Figure 14. Fasting blood glucose levels at different ages for the two groups of mice on low-fat (LF) and high-fat (HF) diets. Means were obtained for blood glucose levels after an 8-h fast of the two groups of mice at different ages and were plotted for each group.

Values are means±SE. Significant difference from control (P < 0.01) was shown at all time points. 106

3.0 2.5 2.0 LF 1.5 1.0 HF 0.5 Insulin (ng/ml) 0.0 24816 Weeks on diet

Figure 15. Fasting serum insulin levels at different ages for the two groups of mice on low-fat (LF) and high-fat (HF) diets. Means obtained for palsma insulin levels after an 8- h fast of the two groups of mice at different ages were plotted for each group. Values are means±SE. Significant difference from control (P < 0.01) was shown at all time points but at 2 weeks on diet. 107 response to high-fat feeding. The identifications of these spots by MS analysis are shown in Table 3. The locations of these spots on a 2-DE gel are shown in Figure 16. For spots

A7 and B6, which are identified as Reg1, 2 out of four peaks were significantly identified by MS/MS analysis (both p<0.05). The sequences of these two peptides are

WHWSSGSLFLYK and ISCPEGSNAYSSYCYYFTEDR. For Reg2 (spot A6), one out of four peaks was identified with p< 0.05. Its sequence is WKDENCEAQYSFVCK.

Expression profile of differentially expressed protein spots Eight spots showed a 50% or greater increase in response to high-fat feeding and the subsequent diabetic condition. Spots A7, B6 and B5 are the same protein with possible different post- translational charging/modification states. Three spots showed a 33% or greater decrease in response to high-fat feeding. Table 4 summaries these spots and their relative levels at four different time points studied. 108

Table 3. Identification of protein spots by mass spectrometry.

*: Protein score for MS peaks being significant (p<0.05). ¹: The identity of B5 was confirmed by MS/MS analysis. Two sequences that were positively identified are

WKDDNCDAQYSFVCK and ISCPEGSNAYSSYCYYFTEDR. ²: The identities of A1 and B2 were identified by MS/MS analysis. . Two sequences that were positively identified are GVEEGQEQVIPINAGDLFVHPK and LQQALLPVVDYEHCSR.

Spot Protein Database Theoretiacal Sequence Prt # of Masses No. Acc. no. pI/MW Coverage Score (Matched/Non- Matched A7 REG1 6677703 6.09/18519 47% 64* 6/45 B6 REG1 6677703 6.09/18519 40% 63* 6/47 B5 REG1¹ 6677703 6.09/18519 40% 44 5/26 A6 REG2 6677705 5.90/19407 44 % 80* 6/21 A4 GDI-1 21759130 5.1/23450 23% 68* 5/11 A1 Elastase 3B² 13385916 5.5/28905 / / / A2 Elastase 3B² 13385916 5.5/28905 / / / A5 1-Cys 3219774 5.7/24969 26% 98* 7/10 Peroxiredox in B7 GSHPX1 121666 6.73/22282 23% 69* 5/11 B1 RACK1 12848861 7.7/31398 39% 112* 9/18 A3 Unidentified / / / / /

109

Figure 16. 2-DE image of the pancreas of C57BL/6J mouse fed on normal diet for 8 weeks. The gel was stained by fluorescent dye Sypro Orange and scanned by a laser scanning device. 1.0 mg of total proteins was loaded on a 17-cm IPG stripe with a non- linear pH range of 3-10 (Bio-Rad). The second dimension was performed on a 15% SDS-

PAGE gel. The locations of differentially expressed genes were indicated by arrows. 110

Table 4. Quantitative analysis of differentially expressed protein spots. GDI-1, Rho GDP-dissociation inhibitor 1; RACK1, receptor of activated protein kinase C1.

Spot Protein Ratio of Averages (Diabetic/Control) ______No. Name 2-wk 4-wk 8-wk 16-wk

A7 REG1 2.0 0.99 0.92 1.5

B6 REG1 2.2 1.2 0.71 1.1

B5 REG1 1.37 1.14 0.83 1.75

A6 REG2 3.1 1.5 1.2 4.6

A4 GDI-1 0.92 1.76 1.38 1.11

A1 Elastase 3B 1.98 1.07 1.24 1.42

A2 Elastase 3B 1.77 0.93 1.05 1.01

A5 1-Cys 0.85 1.09 1.02 1.53 Peroxiredoxin

B7 GSHPX1 0.97 0.67 1.2 0.30

B1 RACK1 1.04 0.67 1.02 0.91

A3 Unidentified 0.78 0.78 0.76 0.58

111

Discussion

Among these identified differential proteins, the levels of both REG1 and REG2 proteins were increased in the pancreas of hyperglycemic C57BL/6J male mice compared with controls. We previously reported the up-regulation of Reg proteins (manuscript submitted). Reg1 and Reg2 belong to the same Reg gene family (298,299). Both

Pancreatic Stone Protein (PSP) (277,300-302) and Pancreatic Thread Protein (PTP) (303) are believed to be encoded by the same human Reg1 gene. Mouse has Reg1 and Reg2 genes, with the mouse Reg1 gene having higher homology to rat and human Reg1 gene than Reg2 (304).

The sites of Reg1 expression have been restricted to the exocrine pancreas

(276,277,305), regenerating and hyperplastic islets (306,307), gastric mucosa, kidney

(300), and gallbladder (304). Reg1 and Reg2 mRNAs have not been detected in the islets of normal mice (308). Whether Reg genes were expressed in the islets of C57BL/6J mice with hyperglycemia in our study remains to be revealed.

Over-expression of Reg1 and/or Reg2 in the pancreas of mice has been associated with diabetes (309-311). Several studies suggest that the expression of these two non- allelic genes may be differential with different physiological functions (308,309). With

Reg1- and Reg2- specific cDNA probes, it has been shown that the increased expression of Reg genes in NOD mice is mainly due to increased expression of the Reg2 gene, not the Reg1 gene (309). In normal C57BL/6J mice, a decline in expression of Reg1, but unchanged expression of Reg2, has been observed during aging (308). In this study, with

2-DE, we were able to determine the levels of REG1 and REG2 separately. It is 112 interesting to know that Reg2 expression in the pancreas also showed a 2-fold or greater increase in the diabetic state than in normal state, suggesting the involvement of Reg2 during the disease progression.

Administration of Reg protein in several animal models of diabetes results in remarkably decreased blood glucose levels with a concurrent increase in β-cell mass

(278,279). Transgenic mice that overexpress Reg1 specifically in β-cells exhibit a significant delay in developing diabetes as compared to control non-transgenic mice

(312). The Reg1 gene knockout mice have shown a significantly smaller average size of islets compared with wild-type littermates under chemically induced hyperplastic condition (312).

In the adult pancreas, neogenesis of islets from ductal cells occurs under both physiological and pathological conditions. It has been suggested that REG1 protein plays an important role in both β-cell proliferation from existing islets and neogenesis from ductal cells (313,314). Based on its possible growth-promoting effects on β-cells, the up- regulation of Reg1 gene in diabetic mice may indicate that islets are in an active proliferative state. Though Reg2 shows high homology to Reg1, the specific function of

REG2 protein in association with diabetes and β-cell growth has not been studied.

To a much less degree than REG1 and REG2, Rho GDP-dissociation inhibitor 1

(GDI-1), 1-Cys peroxiredoxin protein, and pancreatic elastase 3B were also up-regulated in diabetic mice relative to controls. GDI-1, which belongs to the Rho GDI family, is a modulator of rho family G proteins. Rho GDP-dissociation inhibitors bind these G proteins and regulate the GDP/GTP exchange reaction of the G proteins by inhibiting the 113 dissociation of GDP from them, and subsequently binding of GTP to them (315).

However, the significance of GDI-1 in association with diabetes needs to be determined.

1-Cys peroxiredoxin has been shown to be a bifunctional enzyme with both the acidic

2+ Ca -independent phospholipase A2 (aiPLA2) and non-selenium glutathione peroxidase

(NSGPx) activities (316). As discussed below, GSHPX1, a selenium-containing

glutathione peroxidase, was down-regulated in diabetic mice. The correlation between

these two enzymes needs further studies. Elastase 3B is a serine protease that

preferentially cleaves proteins after alanine residues. Elastase 3B may also function in

the intestinal transport and metabolism of cholesterol (317). The increased expression of

pancreatic elastase 3B in high-fat diet induced diabetic mice may be due to their specific

diet that is higher in unidentified component(s) than in normal low-fat diet, resulting in

stimulation of the enzyme.

GSHPX1 is considered the most abundant isoform in the glutathione peroxidase

gene family. It functions as a GSH-dependent enzyme to remove hydrogen peroxide and

fatty acid hydroperoxide. Over production of ROS induced by chronic hyperglycemia in

diabetes has adverse effects on major molecules and cellular structures (289-291). High

concentrations of glucose can cause overproduction of intracellular peroxide in isolated

human islets (318). To minimize the cellular damages caused by toxic ROS, cells use the enzymatic antioxidant system which includes various forms of superoxide dismutases, catalase, and glutathione peroxidases.

Over-expression of Gpx1 gene in islets can prevent the adverse effects caused by

ROS over-production (319). While Gpx1 transgenic mice are more resistant to oxidative 114 damage, the Gpx1 knockout mice are more vulnerable to the toxicity of ROS compared to wild-type controls (320-322). These studies supported the role of Gpx1 in the protection against oxidative stress.

While the production of toxic ROS is increased in the pancreas of diabetic mice, the expression of intrinsic antioxidant enzymes in pancreatic islets, such as catalase and glutathione peroxidase, is extremely low when compared to that in other tissues, resulting in raised vulnerability of the tissue to ROS-induced damage (323,324). Interestingly, lower levels of GSHPX1 in the pancreas of diabetic mice relative to normal controls were found in this study. This imbalance between the demand and supply may contribute to the progressive deterioration of β-cell function in diabetic mice with chronic hyperglycemia.

Also, the protein levels of the receptor of activated protein kinase C1 were decreased in diabetic mice when compared with normal controls. The biological significance of this kinase and its related pathway in the disease development needs to be clarified.

Our results suggest that maintenance of the balance between β-cell proliferation and apoptosis is very important for β-cell function. Also, amelioration of the oxidative stress on β-cells may have significant benefit for diabetics. Our results merit further investigation into the roles of Reg2 and Gpx1 in the pathogenesis of T2DM. 115

Differentially Expressed Proteins in the Pancreas of Diet-Induced Obese and

Diabetic Mice

Linghua Qiu1,2, Edward O. List3, and John J. Kopchick2,3,4*

1Department of Biological Sciences, 2Molecular and Cellular Biology Program, 3Edison

Biotechnology Institute, and 4Department of Biomedical Sciences, College of

Osteopathic Medicine, Ohio University, Athens, Ohio 45701, USA.

Running title: Differential pancreatic proteins in diabetes

116

Abstract

The pancreas is a heterogeneous organ mixed with both exocrine and endocrine cells. It is involved in the metabolic activities with the endocrine cells participating in the regulation of blood glucose while the exocrine portion provides a compatible environment for the pancreatic islets and is responsible for secretion of digestive enzymes. The purpose of this study was to identify pancreatic proteins that are differentially expressed in normal mice and those with diet-induced type 2 diabetes

(T2DM). In this study, C57BL/6J male mice fed a high-fat diet became obese and developed T2DM. The pancreatic protein profiles were compared between control and diabetic mice using two-dimensional gel electrophoresis (2-DE). Differentially expressed protein spots were identified by mass spectrometry. REG1 and REG2 proteins, which may be involved in the proliferation of pancreatic β-cells, were up-regulated very early in the progression of obese mice to T2DM. Glutathione peroxidase, which functions in the clearance of reactive oxidative species (ROS), was found to be down-regulated in the diabetic mice at later stages. The transcriptional levels of Reg2 and glutathione peroxidase were compared by northern blot analysis and were consistent to the changes in protein levels between diabetic and control mice. The up-regulation of Reg1 and Reg2 suggests the effort of the pancreas to ameliorate the hyperglycemic condition by stimulating the proliferation of pancreatic β-cells and enhancing the subsequent insulin secretion. The down-regulation of glutathione peroxidase in pancreas could contribute to the progressive deterioration of β-cell function, due to the hyperglycemia induced oxidative stress. 117

Introduction

The pancreas is composed of exocrine and endocrine cells. The endocrine portion of the pancreas, also called the islets of Langerhans, is distributed throughout the whole tissue and regulates blood glucose levels through insulin and glucagon secreted by β- and

α-cells, respectively. Exocrine pancreatic cells have been shown to be important in providing a compatible environment for the islets. Many studies have shown that the exocrine part of the pancreas secretes proteins that are important in the function and regeneration/replication of β-cells (276-279).

Type 2 diabetes mellitus (T2DM) is a disease characterized by the body’s inability to properly regulate blood glucose, leading to high blood glucose levels and also disturbed metabolism of other substances such as fat and protein. Obesity and T2DM are closely linked (30). Obesity is caused by a combination of diet, sedentary lifestyle and genetic factors. In most cases, obesity occurs before the onset of T2DM. While obesity does not result in diabetes in normal individuals with compensated insulin secretion, it can cause insulin resistance, hyperinsulinemia, and subsequent diabetes in susceptible subjects with an unidentified genetic predisposition. The purpose of this study was to detect any differential pancreatic proteins that are associated with obesity/diabetes in a mouse model of diet-induced diabetes.

Several animal models of diabetes have been used to study obesity-induced diabetes.

The commonly used genetic models, such as ob/ob (obese) and db/db (diabetic) mice, have mutations in the leptin structural gene (ob) and in the leptin receptor gene (db), respectively (284-286). The Zucker diabetic fatty rats (fa/fa) also possess mutations in the 118 leptin receptor gene (325). However, none of these models of diabetes with known genetic defects reflects the disease in humans, as these gene mutations are rare in the general population. Experimental animal models of T2DM also can be induced by chemical destruction of part of β-cells or surgical removal of part of the pancreas (287).

But these models do not resemble T2DM in humans in which the disease is often preceded by obesity. Diet-induced diabetes in C57BL/6J mice is a model of T2DM developed by dietary manipulations in otherwise healthy animals (271,272). In a hope to detect pathological changes in the pancreas that may represent common conditions associated with T2DM in humans, C57BL/6J mice with diet-induced diabetes were studied.

The pathological changes involved in T2DM with respect to pancreatic islets include hormone secretion dysfunction, proliferation of islet cells during the early phase and exhaustion and death of islet cells during the later phase of the disease (91,222). During early phase of hyperglycemia, the islets undergo intensive proliferation from ductal progenitor cells and existing islets (280). Loss of an acute-phase insulin response and progressive deterioration of β-cell function, coupled with peripheral insulin resistance, are common in diabetic subjects with chronic hyperglycemia. In T2DM, the toxicity of hyperglycemia, known as glucotoxicity, has both global and tissue-specific effects, including those on the pancreas. However, these functional studies have not provided information on molecular events that underlie the tissue-specific pathological changes.

In this study, we used a proteomic profiling technique; i.e. 2-dimensional gel electrophoresis (2-DE) followed by protein identification with mass spectrometry 119 analysis. Use of the technique and the diet-induced diabetes model may help to identify genes and metabolic characteristics in the pancreas that are causal and/or associated with the disease. 120

Materials and Methods

Animals Three-week old male C57BL/6J mice were purchased from the

Jackson Laboratory (Bar Harbor, ME). Upon arrival, 50 mice were weaned onto a high- fat diet with 26.6% of calories from carbohydrates, 57.6% from fat, and 15.7% from protein (#F1850, Bio-Serv, Frenchtown, NJ) (272) while 20 were weaned onto a standard rodent chow containing 60% of calories from carbohydrates, 14% from fat, and 26% from protein (Prolab RMH 3000, PMI Nutrition International, Inc., St. Louis, MO). Mice were housed, up to two per cage, in a temperature-controlled (22 oC) room on a 14-h

light, 10-h dark cycle. Food and water were supplied ad libitum. At each time point (2, 4,

8, and 16 weeks on diet), 2-3 mice from each group were sacrificed by cervical

dislocation. Mice from each group were selected according to their weights, fasting blood

glucose and plasma insulin levels. Mice from the high-fat diet displaying the following

symptoms; overweight, high fasting glucose levels, and high fasting plasma insulin

levels, were selected as diabetic mice while mice from normal diet displaying normal

profiles were considered as age matched controls. The pancreata were removed and

immediately snap-frozen in liquid nitrogen and then stored at -80oC until further

processing. Protocols were approved by the Ohio University Institutional Animal Care

and Use Committee and followed federal, state, and local laws. 121

Mice weight measurements Mice were weighed biweekly starting at weaning

(three weeks of age) throughout the course of the study. Means for each group at each time point were calculated and plotted.

Fasting glucose and insulin measurements Fasted blood glucose and plasma insulin concentrations were determined at different time points (2, 4, 8, and 16 weeks on diet). At the day of measurement, mice were fasted for 8 hours starting early in the morning. After fasting, the mice were placed under a heat lamp for about 15 seconds to vasodilate the tail vein before obtaining the blood. Fasting blood glucose levels were measured using a Lifescan OneTouch Glucometer (Johnson & Johnson, New Brunswick,

NJ) with a drop of blood from the tip of the tail. At the same time, blood was collected into a heparinized capillary tube. After blood samples were centrifuged at 7000xg for 10 min at 4 oC, plasma insulin concentrations were determined with the Mercodia

Ultrasensitive rat insulin ELISA kit (ALPCO, Windham, NH). Values for mouse insulin

were adjusted by multiplication by a factor of 1.23 according to the manufacturer’s

recommendation. The intra- and interassay coefficients of variation were less than 10%

and less than 5%, respectively. These data, along with weight data, were used as

phenotypic parameters of the animals. 122

Protein and RNA extractions For protein analysis, mice were sacrificed and pancreata were removed and homogenized in a protein solubilization buffer (326) containing 7M urea, 2M thiourea, 4% Chaps and 2.5µl/ml of 40% (w/v) Bio-Lytes (pH3-

10) with a glass homogenizer. Sonication was used to disrupt the tissue. Cell debris and insoluble substances were removed by ultracentrifugation at 150,000×g for 45 minutes.

Protein concentrations were determined by Bradford method. All chemicals for protein solubilization and 2-DE were purchased from Bio-Rad (Bio-Rad, Hercules,CA) unless indicated otherwise. Total RNA was extracted using RNA STAT-60 Total RNA/mRNA

Isolation Reagent (Tel-Test, Friendswood, TX) (327). The quantity of extracted RNA was determined by spectrophotometry at an absorbance of 260nm.

Two-dimensional gel electrophoresis Protein samples were treated for 2 hours at room temperature with 5mM tributylphosphine and 20µl/ml of 1M Tris buffer (pH8.8) to reduce disulfide bonds and with 15mM iodoacetamide for 30 minutes for alkylation

(328,329). 2-DE was performed as previously described with slight modifications

(296,330).The first dimensional isoelectric focusing (IEF) was carried out after protein samples were passively rehydrated on 17cm immobilized pH gradient (IPG) strips with a broad pI range of 3 to 10 (Bio-Rad). The voltage was linearly increased from 0 to 6000 V during first 10 hours, followed by 10 hours at 6000 V with a current limit of 50 µA/strip.

Following IEF, the strips were equilibrated in a buffer containing 6 M urea, 2% (w/v)

SDS, 0.375 M tris/HCl (pH8.8), 20% (v/v) glycerol, for 15 minutes before loading for secondary SDS-PAGE analysis. The strips were sealed on the border of the SDS-PAGE 123 gel using 0.5% low-melting point agarose gel. Proteins were separated by size in 15%

SDS-polyacrylamide gels (20cm×20cm) at 26mA/gel with maximum voltage of 300V for

9 hours at 4oC. After electrophoresis, the gels were fixed in a solution containing

40%EtOH, 2% acetic acid, 0.0005% SDS overnight followed by washing three times in a

buffer of 2% acetic acid and 0.0005% SDS. The gels were stained using a fluorescent

dye, sypro orange (1:5000) (Molecular Probes, Eugene, OR), as previously described

(296,297).

Quantitative analysis of gel images Gel images were captured by a laser- scanning device (FLA-3000G, Fuji). The densities of protein spots, which were normalized by the total densities of all valid and matched spots in a set of gels, were quantitatively compared between diabetic and normal control groups using the PDQuest

7.0.1 program (Bio-Rad). For each time point (2-week, 4-week, 8-week, 16-week on

diet), pancreatic protein samples from three diabetic mice and from three control mice

were analyzed. Protein “spots” were considered to be differential if the difference

between the averages of spot densities from the diabetic mice and the control mice was 2-

fold or greater at any time point (295,331,332).

Spot identification by mass spectrometry Protein spots of interest were

excised from the gels and transferred to a 96-well plate with addition of 40µl H2O. These

samples were delivered to the Proteome Mapping Laboratory at the University of

Michigan (www.proteomeconsortium.org). Proteins in gel plugs were digested with 124 trypsin. A fraction of the resulting solution was spotted onto a MALDI target plate for

Mass Spectrometric analysis. If the concentration of sample was too low to obtain a usable spectrum, the solution was purified and concentrated using micro C18 cartridges.

The concentrated sample was then utilized. The Applied Biosystems 4700 Proteomics

Analyzer (TOF/TOF) was used to obtain mass spectra which were queried against the

NCBI database using the Mascot program (http://www.matrixscience.com/) for identification. Prior to peak list generation, MS spectra were calibrated by trypsin auto- digestion peaks and smoothed. The signal-to-noise criterion was set to 25 or greater. The mono-isotopic masses were processed for identification. For MS/MS spectra, the peaks were calibrated by default and smoothed. All peaks were de-isotoped. The Mascot program has the “Peptide Mass Fingerprint Search” engine for a probability-based peptide mass fingerprint (PMF) database search and the “MS/MS Ions Search” for an

MS/MS search. The general parameters for searching are NCBI Database, all species, trypsin digestion, maximum 1 missed cleavage, fixed Carbamidomethylation of Cys, variable modifications of acetyl-N-term, oxidation-M (methionine), and Pyro-glu, ±50 ppm of Peptide Mass or Parent Tolerance. Peptide Charge State of 1+ and Fragment

Mass Tolerance of ± 0.5 Da were used for the MS/MS Ion search. At the time of searching (9/21/2004), NCBInr 20040916 database contains 2,026,219 sequences and

679,922,428 residues. 125

Northern blot analysis Equal amounts of total RNA (15µg) from different samples were resolved by a 1% agarose gel in 3[N-morpholino]propanesulfonic acid/formaldehyde solution and transferred to a positively charged nylon membrane using the NorthernMax kit (Ambion, Austin, TX) according to the manufacturer’s instruction.

All reagents for probe labeling and northern blot detection were purchased from Roche

(Roche Applied Science, Indianapolis, IN) unless stated otherwise. Probe preparation and signal detection were carried out using a DIG labeling and detection kit following the manufacturer’s instructions. Primers (synthesized by Sigma-Genosys, The Woodlands,

TX) for probe synthesis were derived from clones that contain mouse Reg2 and Gpx1 cDNAs (Clones BM053708 and BI145182, Open Biosystems, Huntsville, AL). Plasmid

DNA was isolated using a miniprep kit (Qiagen, Valencia, CA) according to the instruction of the manufacturer. DIG-labeled probes were synthesized using the Roche

PCR DIG Probe Synthesis Kit. Labeling and subsequent mRNA signal detection were performed according to Roche’s protocols. 5’-AGCGGATAACAATTTCACACAGG

(sense) and 5’-CCCAGTCACGACGTTGTAAAACG (antisense) were used for 700bp

Reg2 probe synthesis. 5’-TGGCAGGAGATCAGGCGTCT (sense) and 5’-

GGCTCTGAACTTGCAGACAAAG (antisense) were used for 1000bp Gpx1 probe synthesis. The membranes were hybridized with DIG-labeled probes (50ng/mL hybridization solution) overnight at 42oC. The membranes were then washed twice with

2×SSC/0.1% SDS at room temperature followed by two washes with 0.1×SSC/0.1% SDS

at 68oC. After treatment in 1× blocking solution, the membranes were incubated with

anti-digoxigenin-AP Fab fragment for 30 minutes at room temperature and finally 126 detected using CDP-Star chemiluminescent substrate. Images were obtained with

VersaDoc (Bio-Rad) and densitometric analysis was then performed using the Quantity

One software (Bio-Rad).

Statistical analysis Results were presented as mean±SE. Data were analyzed by single factor ANOVA (Microsoft Excel). Differences were considered statistically significant if P < 0.05. 127

Results

High-fat diet induces obesity The weights of the mice on the high-fat diet (HF) and their control littermates on the normal diet (LF) were recorded biweekly from weaning at age of 3 weeks throughout the course of the study (Figure 13). Significant differences of body weights between these two groups of mice were observed at two weeks and throughout the study.

Glucose homeostasis is altered by high-fat diet Fasting blood glucose levels in the HF group of mice were significantly higher, compared with those in the LF controls at all time points (Figure 14). At each time point, three obese/diabetic and three control mice were chosen in this study. At the time these mice were sacrificed, their fasting glucose concentrations were 216.1±12.3 (mg/dl) and 133.6±4.0 (mg/dl) for the obese/diabetic mice and the control mice, respectively.

The fasting plasma insulin levels in the HF group were significantly higher than those of the control LF group and showed a significant increase throughout the time course of the study (Figure 15).

Differential protein expression as a consequence of high-fat diet Proteins from pancreata of high-fat fed diabetic and control mice were resolved by 2-DE. Out of approximately 450 spots analyzed in the MW range of 5-45 KDa, four protein spots showed a difference of two-fold or greater when comparing spots from 128 obese/hyperglycemic mice with those from normal controls. The locations of these four spots on a 2-DE gel are shown in Figure 17. The identifications of these spots by MS analysis are listed in Table 5. For spots A7 and B6, which were identified as Reg1 by MS analysis, 2 out of four peaks were significantly identified by MS/MS analysis (both

P<0.05). The sequences of these two peptides are WHWSSGSLFLYK and

ISCPEGSNAYSSYCYYFTEDR. For spot A6 (Reg2), one out of four peaks was positively identified with P< 0.05. Its sequence is WKDENCEAQYSFVCK.

Three spots showed a 2-fold or greater increase in response to high-fat feeding and subsequent diabetic condition. Spot A7 and B6 are the same protein with possible different post-translational modification states. Only one spot (B7, GSHPX1) showed a

2-fold or greater decrease in response to high-fat feeding. Table 6 summaries these spots and their relative levels at four different time points studied.

Reg2 and Glutathione Peroxidase expression by northern blot Reg2 and

Gpx1 mRNA levels in the pancreata of diabetic and control mice were determined by northern blot analysis (Figure 18). Consistent with the protein levels, the Reg2 mRNA levels were substantially higher while those of Gpx1 were relatively lower in the pancreas of diabetic mice compared to those in the controls. The average ratios of diabetics/controls were 15 and 0.46 for Reg2 and Gpx1, respectively, as determined by the signal densities. 129

Figure 17. 2-DE image of the pancreas of C57BL/6J mouse fed on LF for 8 weeks. The gel was stained by a fluorescent dye (Sypro Orange) and scanned by a laser scanning device. 1.0 mg of total proteins was loaded on a 17-cm IPG strip with a non-linear pH range of 3-10 (Bio-Rad). The second dimension was performed on a 15% SDS-PAGE gel. The locations of differentially expressed genes are indicated by arrows. 130

Table 5. Identification of protein spots by mass spectrometry.

*: Protein score for MS peaks being significant (P<0.05). ψ: Derived from ExPASy web

site (http://us.expasy.org/). The theoretical signal peptides in REG1 and REG2 are not

excluded from the calculations.

Spot No. A7 B6 A6 B7

Protein REG1 REG1 REG2 GSHPX1

Database Accession No. 6677703 6677703 6677705 121666

Theopretical (pI/MWψ) 6.09/18519 6.09/18519 5.90/19407 6.73/22282

% Sequence Coverage 47 40 44 23

Protein Score 64* 63* 80* 69*

No. of Masses 6/45 6/47 6/21 5/11

(Matched/Non-Matched)

131

Table 6. Quantitative analysis of differentially expressed protein spots.

Spot Protein Ratio of Averages (Diabetic/Control) _

No. Name 2-wk 4-wk 8-wk 16-wk

A7 REG1 2.0 0.99 0.92 1.5

B6 REG1 2.2 1.2 0.71 1.1

A6 REG2 3.1 1.5 1.2 4.6

B7 GSHPX1 0.97 0.67 1.2 0.30

132

Figure 18. Northern blot analysis of Reg2 and Gpx1. Expression analysis of Reg2 (left panel) and Gpx1 (right panel) in pancreata of two control mice (C1 and C2) fed on LF diet and two diabetic mice (D1 and D2) fed on HF diet for 2 weeks are shown. Also shown at the bottom of each panel are bands of 18S and 28S rRNA stained by ethidium bromide to show the integrity of the RNA. 133

Discussion

Diet-induced obesity and diabetes was successfully established in C57BL/6J mice fed a high-fat diet. It was unexpectedly observed that some of the mice exhibited hyperglycemia after only two weeks on the diet. At each of the four different time points studied, three mice from each group were selected for proteomic analysis based on their weights, fasting glucose and insulin levels that were representative for either obese/diabetic or normal controls.

Several studies have shown that high-fat diet and genetic predisposition are critical for the development of hyperinsulinemia and hyperglycemia in these C57BL/6J mice

(271,273,274). Defects in insulin reaction to glucose stimulation in these mice suggest that they have a genetically determined impairment in their β-cell function that render them vulnerable to develop T2DM when environmental factors, such as high-fat diet induced obesity, exaggerate this predisposition (271). Thus, C57BL/6J mice can serve as a valuable animal model mimicking the human condition of obesity-induced diabetes.

To study altered gene expressions associated with a certain disease state, different methodologies can be employed. Others have used a microarray-based approach to ascertain gene expression as a function of progression of an individual from a state of obesity to that of T2DM (292). In the results presented here, a proteomic profiling technique, 2-DE analysis coupled with mass spectrometry, was employed. This approach enables direct qualitative and quantitative analysis of proteins as the disease develops

(296). Also, the documented lack of correlation between mRNA levels and protein levels, 134 which may be due to post-transcriptional and translational regulations, necessitates the need for direct protein profiles (293-296).

We reported 3 proteins (REG1, REG2, and GSHPX1) that were differentially expressed in the pancreas between normal and obese/diabetic mice. We also observed variations on the magnitude of the difference at various time points for each of the three proteins. We have repeated a set of mice with the same treatment and similar results were observed.

REG1 and REG2 were two pancreatic proteins that showed an increased level of expression in diabetic C57BL/6J male mice versus controls. Reg genes belong to a gene family that have 4 subclasses consisting of Reg1 to Reg4 (298,299). It is believed that

Pancreatic Stone Protein (PSP) (277,300-302) and Pancreatic Thread Protein (PTP) (303) are also encoded by the same human Reg1 gene. The mouse Reg genes are located in a contiguous region in chromosome 6 (333). The mouse has two Reg genes, Reg1 and

Reg2, with the mouse Reg1 gene having slightly higher homology to the rat and human

Reg1 gene than Reg2 (304).

Several studies have been conducted to locate sites of gene expression for Reg1 and

Reg2. Reg1 has been found to be expressed in the exocrine pancreas by acinar cells and secreted into pancreatic ducts (276,277,305). Reg1 is also expressed specifically in regenerating and hyperplastic islets, but not in normal islets, liver, or brain (306,307).

Low expression of Reg1 has also been found in gastric mucosa, kidney (300), and gallbladder (304). In C57BL/6J mice, Reg1 and Reg2 mRNAs have not been detected in islets of normal mice (308). The question whether the expression of Reg1 and Reg2 in 135 islets of C57BL/6J mice can be induced by the obese/diabetic state remains to be answered. It is likely that the increased expression of Reg1 and Reg2 observed in this study is mainly, if not totally, due to their up-regulated expression in the exocrine pancreas. Future histoimmunological studies will resolve the site (sites) of expression.

The expression of Reg1 and Reg2 has been previously associated with diabetes.

Overexpression of Reg1 and Reg2 in the pancreas of NOD mice at various degrees of diabetogenesis has been found (309-311). In this NOD mouse model, expressions of both

Reg1 and Reg2 mRNAs are found to be restricted to acinar cells of the exocrine tissue

(311). With Reg1- and Reg2- specific cDNA probes, it has been shown that the increased expression of Reg genes in NOD mice is mainly due to increased expression of Reg2, but not Reg1 (309). Interestingly, in normal C57BL/6J mice, when Reg1- and Reg2- specific cDNA probes are used, a decline in the expression of Reg1, but unchanged expression of

Reg2, has been observed during normal aging process (308). These results suggest that the expression of these two non-allelic genes may be differential and have different physiological functions. These results also suggest the importance of studies that discern these two genes as many studies have not separated them because of the cross-reactivity of the Reg RNA probes and the antibody used. In our study, with 2-DE, we were able to determine the levels of REG1 and REG2 separately. Out of four time points in this study,

Reg2 showed a 2-fold or greater increase in pancreas in diabetic mice at two time points

(2 and 16 weeks on diet) while Reg1 showed an increase at one time point (2 weeks on diet). It is interesting to know that Reg2 expression in the pancreas also showed a 2-fold 136 or greater increase in the diabetic state, suggesting the involvement of Reg2 during disease progression.

Several lines of evidence support that REG1 protein is a stimulator of β cell proliferation and neogenesis. Administration of Reg protein in 90% depancreatized rats results in a remarkable decrease in blood glucose levels and an increase in β-cell mass

(278). A similar proliferative effect has also been observed in NOD mice with administration of Reg1 protein alone or in combination with linomide, an immunomodalatory molecule (279). Transgenic mice that overexpress Reg1 in β-cells exhibit a significant delay in developing diabetes as compared to non-transgenic mice

(312). While Reg1 gene knockout mice appear phenotypically normal, the average size of islets is significantly smaller than that of wild-type littermates under chemically induced hyperplastic condition (312). It is worth noting that these studies only involve Reg1, not

Reg2. However, in the NOD mice study described above, Reg2, but not Reg1, was found differentially expressed (309). Both Reg1 and Reg2 were found overexpressed in our report, which suggests biological importance of Reg2. Though Reg2 shows high homology to Reg1, whether Reg2 plays a similar role as Reg1 remains to be explored.

It has been suggested that REG1 protein plays an important role in both β-cell replication from existing islets and neogenesis from ductal cells (313,314). β-cells regenerate slowly with a dynamic balance between β-cell replication/neogenesis and apoptosis (280). β-cells can compensate for insulin resistance or pregnancy by replication and hypertrophy. However, in both type 1 and later stage T2DM, pancreatic β-cells are either destroyed completely or damaged substantially (91). 137

Islet cells are derived from the epithelial cells of early pancreatic ducts during embryogenesis. In the adult pancreas, neogenesis of islets from ductal cells occurs under both physiological and pathological conditions. Due to its growth-promoting effect on β- cells, the up-regulation of Reg1 gene during disease development suggests that islets undergo active proliferation as a response to hyperglycemia. Thus, the increased expression of REG1 proteins in diabetic mice may be considered as a defense mechanism and therefore a favorable response. However, the specific role of Reg1 during the progression of animal from a normal state to that of diabetic still needs to be firmly established.

Another important result was a decreased level of GSHPX1 in the diabetic mice at later stages of T2DM. GSHPX1, a selenium-containing enzyme, is considered the most abundant isoform in the glutathione peroxidase gene family consisting of at least five genes. It functions as a GSH-dependent enzyme to remove hydrogen peroxide and fatty acid hydroperoxide. It is believed to be ubiquitously expressed in all mammalian tissues with cytosol and mitochondria subcellular localization (334,335). There is substantial evidence that shows chronic hyperglycemia in diabetes results in over production of reactive oxidative species (ROS) and subsequent adverse effects on major molecules and cellular structures, a process known as glucose toxicity (289-291). The enzymatic antioxidant system which cells utilize to minimize the cellular damages caused by toxic

ROS includes various forms of superoxide dismutases, catalase, and glutathione peroxidases. 138

It has been shown that supraphysiological glucose concentrations result in high levels of intracellular peroxide concentrations in isolated islets damaging β-cell function

(318). These adverse effects can be prevented by transient overexpression of Gpx1 gene in islets suggesting an important antioxidant role of GSHPX1. Overexpression of Gpx1 in the transgenic mice renders hearts more resistance to ischemia reperfusion injury compared to those of control mice (321,322). The Gpx1 deficient mice are remarkably more sensitive to oxidative stress (320,336,337). These studies support the role of Gpx1 in the protection against oxidative stress and in disease pathogenesis.

Of many tissues in which oxidative stress can cause damage, islets are especially vulnerable. Extremely low levels of gene expression of intrinsic antioxidant enzymes, especially catalase and glutathione peroxidase in pancreatic islets compared to those in other tissues render islets especially susceptible to ROS-induced damage (323,324).

Down-regulated expression of glutathione peroxidase in pancreas in diabetic mice may result in less capacity to clear ROS. Whereas the demand for antioxidative enzymes is high, this imbalance may contribute to the progressive deterioration of β-cell function in diabetic mice with chronic hyperglycemia.

Using the diet-induced obesity/diabetes mouse model, we discovered two proteins that may play a role in pancreatic dysfunction. Our results suggest that maintenance of the balance between β-cell proliferation and cell death is very important for β-cell function. Also, amelioration of the oxidative stress on β-cells may have significant benefit for diabetics. 139

Cloning and Expression of Reg2 and Glutathione Peroxidase in Mouse L Cells and

Production of Reg2 Transgenic Mice 140

Abstract

In our previous study, Reg2 has been shown to be up-regulated very early in the pancreas of diet-induced diabetic C57BL/6J mice relative to control, whereas the expression of Gpx1 is down-regulated in the diabetic mice. Transgenic mice that over- express Reg2 or Gpx1 would provide valuable information to determine the biological function of the Reg2 and Gpx1 during the development of diabetes in mice. As a part of this strategy, this chapter describes construction of expression vectors for Reg2 and Gpx1 in mammalian cells and confirmation of in vitro mRNA and protein expression for the two genes. For Gpx1, a ubiquitously expressed gene, expression analysis by Northern blot showed an exogenous mRNA in addition to the endogenous mRNA in stable cell lines. Enzymatic activity analysis demonstrated that the Gpx1 enzyme activity in stable cell lines was 2.6- to 8.9-fold higher than that in control cells. For Reg2, which is not expressed in the control cells, expression of Reg2 mRNA was confirmed by Northern blot analysis. Protein expression of Reg2 was demonstrated in the conditioned media of transfected cell lines by SDS-PAGE separation followed by Mass Spectrometry analysis.

To study the in vivo function of Reg2, transgenic mice were generated with the Reg2 gene under the control of mouse metallothionien I promoter. 141

Introduction

In our previous study, we used a diet-induced type 2 diabetes mouse model to detect differential proteins in the pancreas. Reg1 and Reg2, among other differential proteins, were found up-regulated in the pancreas of diabetic mice relative to control littermates.

This specific response of the pancreas occurs very soon after the mice switched to the high fat diet and is associated with hyperglycemia.

While many studies on the mouse Reg1 gene have been published, little is known about Reg2. Reg2 belongs to a gene family that has 4 subclasses consisting of Reg1 to

Reg4 (298,299). The mouse Reg family genes are located in a contiguous region in chromosome 6 (333). Reg2 is only found in mouse, with 65% homology to human Reg1 gene (304,338). Reg2 is also called lithostathine 2 precursor, pancreatic stone protein 2

(PSP2), or pancreatic thread protein 2 (PTP2) (277,300-303). With a MW of 19.4 KDa and 173 amino acids, Reg2 precursor contains a signal peptide of 22 amino acids as at its

N-terminal as determined by structural similarity with other Reg proteins.

Mouse Reg1 and Reg2 are expressed in the normal pancreatic acinar cells and hyperplastic islets, but not in the normal islets, liver, kidney, or brain (306-308,311).

Several studies suggest that Reg1 can stimulate islet β cell proliferation and reduce experimental diabetes. Administration of Reg protein in 90% depancreatized rats resulted in a remarkable decrease in blood glucose levels and an increase in β-cell mass (278). A similar proliferative effect was also obtained in NOD mice when Reg protein was administered alone or in combination with linomide, an immunomodalatory molecule 142

(279). It is also suggested that Reg protein plays an important role in both β-cell proliferation from existing islets and β-cell neogenesis from ductal cells (313,314).

Transgenic mice that over-express Reg1 under the control of rat insulin II promoter exhibited a significant delay in developing diabetes as compared to control non- transgenic mice (312). In Reg1 gene knockout mice, the average islet size of these knockout mice was significantly smaller than that of control wild-type mice under chemically induced hyperplastic condition (312).

While significant similarities between Reg1 and Reg2 exist, many studies suggest that the expression of these two non-allelic genes is differential and subjected to different regulations. It is also possible that these two genes have different physiological functions.

Using Reg1- and Reg2- specific cDNA probes, the increased expression of Reg gene in

NOD mice was mainly due to increased expression of Reg2 gene, but not Reg1 gene

(309). Reg2 expression levels were greatly higher in cyclophosphamide-treated males compared with non-treated males whereas the levels of Reg1 did not change in that study.

Due to the growth-promoting effect of Reg1 on β-cells, the increased expression of

Reg proteins in diabetic mice may be considered to be defensive devise that favors β cell proliferation and/or survival. In vitro and in vivo expression of the Reg2 gene can help to elucidate the potential role of Reg2 in the proliferation of β-cells. In both type 1 and later stage type 2 diabetes, pancreatic β-cells are either destroyed completely or damaged substantially (91). The potential of Reg proteins, possibly in combination of other proteins, in the restoration of β-cell mass and function can not be ignored. The role of 143

Reg proteins during the progression of animal from a normal state to that of diabetic needs to be further explored.

Although the mass of β-cells are greatly increased during the early phase of disease development in mice or rat as shown in some studies, these animals are still not completely compensated and experience continued hyperglycemia and later deterioration of β-cell function (91,217,218). In our previous diet-induced diabetes animal model, the mice (C57BL/6J) have defects in their β-cell function that render them vulnerable to develop T2DM when environmental factors, such as high-fat diet induced obesity, exaggerate this predisposition (271). It is interesting to know if the dysfunction of β-cells in C57BL/6J mice is associated with the over-expression of Reg proteins.

As stated above, we detected increased expression of Reg1 and Reg2 proteins in the pancreas of hyperglycemic mice fed a high-fat diet for only 2 weeks. As Reg1 has shown proliferation-stimulating activity on islets in several studies, we would like to determine whether Reg2 has similar activity. One way to answer this question is to over-express

Reg2 gene and determine if that could prevent or delay the onset of high fat diet induced diabetes in C57BL/6J mice by monitoring weight, blood glucose levels and other physiological indicators. If Reg2 can stimulate the replication of islets, we would see some protective effects on these transgenic mice then. In another scenario, the upregulation of Reg proteins could result in dysfunction of β-cells as these cells may undergo a de-differentiation process and become functionally immature (222). In this study, we constructed a Reg2 expression vector pMet-Reg2-bGH. To improve the 144 possibility of success of the transgenic study, we first need to test the in vitro expression of Reg2 in mouse L cells.

In our previous study with diet-induced diabetic mice, we discovered that the expression of Gpx1 was down-regulated in C57BL/6J mice with diet-induced obesity and diabetes relative to control littermates. The Gpx1 gene encodes for glutathione peroxidase which has 201 amino acids with MW of 22.3 KDa. The enzymatic antioxidant system, which includes various forms of superoxide dismutases, catalase, and glutathione peroxidases, is used by cells to minimize the cellular damages caused by toxic ROS resulting from various physiological and pathological metabolic processes. Among these enzymes, GSHPX-1 is considered the most abundant isoform in the glutathione peroxidase gene family. It functions as a GSH-dependent enzyme to remove hydrogen peroxide and fatty acid hydroperoxide. It is believed to be ubiquitously expressed in all mammalian tissues (334,335).

Many studies have shown that glutathione peroxidase activities in erythrocytes and plasma are siginificantly lower in diabetic patients compared with those in control subjects (339-342). In pancreastic islets, extremely low levels of gene expression of intrinsic antioxidant enzyme, especially catalase and glutathione peroxidase, have been found when compared to those in other tissues(323,324). The expression levels of Cu/Zn and Mn SOD isoenzymes in pancreatic islets were well below 50% of those in liver. The mRNAs of the hydrogen peroxide inactivating catalase and cytoplasmic glutathione peroxidase were below the detection limit (323). These results suggest that the pancreatic islets may be specifically susceptible to oxidative damages. 145

There is substantial evidence supporting that chronic hyperglycemia in diabetes results in over production of reactive oxygen species (ROS) which is harmful to cellular molecules and structures and causes subsequent adverse effects (289-291). Possible sources of oxidative stress in diabetes include glycation reactions, autooxidation of glucose, and a shift in the reduced-oxygen status of the diabetic cells. In isolated human islets, supraphysiological glucose concentrations can result in high levels of intracellular peroxide concentrations (318). Also, high concentrations of ribose increased levels of intracellular peroxide in isolated rat islets, leading to siginificantly decreased insulin mRNA levels, insulin content, and glucose-induced insulin secretion. These adverse effects could be prevented by overexpression of Gpx1 gene in islets (319). These transfected islet cells were remarkably more resistant to oxidative stress than control cells. Over-expression of Gpx1 in transgenic mice rendered hearts of the mice more resistance to ischemia reperfusion injury compared to control mice (321,322).

Down-regulated expression of glutathione peroxidase in diabetic mice may result in less capacity to clear reactive oxidative species (ROS) while the demand for antioxidative enzymes is high due to ROS overproduction caused by hyperglycemia. This imbalance may contribute to the progressive deterioration of β-cell function in diabetic mice with chronic hyperglycemia. As stated above, pancreatic β-cells have extremely low levels of these enzymes compared with other tissues (323,324). This tissue-specific low expression, in addition to decreased expression of this enzyme in diabetic state, makes the pancreatic β-cells especially vulnerable for oxidative damage (343). 146

In order to fully elucidate the role the protein plays in the pathogenesis of diabetes, we plan to over-express the Gpx1 gene in mice and challenge the mice with high-fat diet.

We would see some protective effects on the transgenic mice if Gpx1 can protect β cells against oxidative toxicity. In this study, a Gpx1 expression vector was tested for in vitro expression in L cells. 147

Materials and Methods

L-cells, cDNA plasmids and enzymes Mouse L-cells were routinely maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10%

Nu-serum (Becton Dickinson) and 50µg/ml gentamicin sulfate (Gibco). Clones

BM053708 and BI145182 that contain mouse full-length Reg2 and Gpx1 cDNAs respectively were obtained from Open Biosystems (Huntsville, AL) and the sequences for

Reg2 and Gpx1 were verified by sequencing upon arrival. Taq DNA polymerase, all restriction endonucleases, alkaline phosphotase (calf intestinal), T4 polynucleotide kinase, T4 DNA ligase, and Klenow fragment of E. coli DNA polymerase I were obtained from Promega.

DNA isolation Plasmid DNA was isolated using either the MiniPrep kit or the

MaxiPrep kit (Qiagen, Valencia, CA) for appropriate applications according to the instructions of the manufacturer. Genomic DNA was isolated from cultured cells using the Wizard Genomic DNA Purification Kit (Promega) according to the manufacturer’s recommendations. Prior to use, DNA samples were purified with the HighPure PCR

Product Purification Kit (Roche). Concentrations of DNAs were determined by measuring absorbance at 260nm and 280nm. 148

RNA isolation Total RNAs were extracted using RNA STAT-60 Total

RNA/mRNA Isolation Reagent according to the manufacturer’s recommendation (Tel-

Test, Friendswood, TX) (327). Cells grown in monolayer were lysed directly in the culture dish by adding RNA STAT-60 (5ml/250cm2 flask) and passing the cell lysate

several times through a pipette. RNA samples were dissolved in DEPC-treated water and

the concentrations were determined by spectrophotometry at an absorbance of 260nm.

Protein extraction and treatment Prior to protein extraction, cultured cells at about 90% confluence were washed twice with serum-free DMEM medium and then scraped into an appropriate buffer. For 2-DE analysis, cultured cells were homogenized in a protein solubilization buffer (326) containing 7M urea, 2M thiourea, 4% Chaps and

2.5µl/ml of 40% (w/v) Bio-Lytes (pH3-10) with sonication. Cell debris and insoluble substances were removed by ultracentrifugation at 150,000×g for 45 minutes. Protein concentrations were determined by Bradford method.

For SDS-PAGE, an extraction buffer which contains 10% (v/v) glycerol, 15% (v/v)

β-mercaptoethanol, 9% (w/v) SDS, and 30% (v/v) upper tris buffer (0.5M Tris/Cl, pH6.8 and 0.4% SDS) was used to dissolve proteins from cultured cells. The protein concentrations were measured by the RC/DC protein assay kit (Bio-Rad).

Construction of pMet-Reg2-bGH plasmid The in vitro expression vector for the Reg2 gene, pMet-Reg2-bGH, was constructed by inserting the Reg2 cDNA fragment into the mammalian cell expression vector pMET-TK-bGH (6.5kb). The vector pMet- 149

TK-bGH is derived from pBR322 plasmid and contains mouse metallothionien I (mMetI) transcriptional regulatory element, a sequence coding for thymidine kinase (TK), and a bovine growth hormone (bGH) polyadenylation signal. This expression vector has been used in a number of in vitro and in vivo mammalian expression systems in our laboratory.

The TK sequence was replaced by the Reg2 sequence to give a construct of pMet-Reg2- bGH (Figure 19).

Briefly, the Reg2 cDNA fragment with an approximate size of 760bps was prepared by digesting the plasmid DNA containing the mouse Reg2 cDNA clone BM053708 with

SmaI and SnaBI. The fragment containing Reg2 cDNA was isolated by 1% agarose gel electrophoresis and purified using the HighPure PCR Product Purification Kit (Roche).

The pMet-TK-bGH was cleaved with SmaI and PvuII and dephosphorylated with alkaline phosphotase (calf intestinal). The digestion product was purified using the

HighPure PCR Product Purification Kit. The Reg2 cDNA fragment and the dephosphorylated vector were ligated using T4 DNA ligase. The products of ligation were transformed into MAX Efficiency chemically competent DH5α E. coli cells

(Invitrogen) which were then plated on LB plates containing Ampicillin (100µg/ml).

Colonies were screened for Reg2 cDNA insertion by PCR (polymerase chain reaction). Primers 5’-TGGCAGGAGATCAGGCGTCT-3’ and 5’-

TCCAGGGTCAAGGAAGGCAC-3’ were used to amplified the insert with predicted size of approximate 900bps. Another set of primers 5’-

TGGCAGGAGATCAGGCGTCT-3’ and 5’-GGCTCTGAACTTGCAGACAAA-3’ were 150

Figure 19. Cloning strategy for the construction of pMet-Reg2-bGH expression vector.

The fragment containing Reg2 cDNA was prepared by digesting a plasmid which contains full-length mouse Reg2 cDNA with SmaI and SnaBI. The pMet-TK-bGH vector was cleaved with SmaI and PvuII and ligated with the Reg2 cDNA fragment. 151 used to verify the orientation of the insert with a predicted product size of 690bps for the insert in the correct orientation. The PCR was set as the following: 94°C, 2 min; 30 cycles of 94°C, 15 sec, 52°C, 30 sec, and 72°C, 2 min. The verified clones were further confirmed by sequencing with the forward primer 5’-TGGCAGGAGATCAGGCGTCT-

3’ and the reverse primer 5’-TCCAGGGTCAAGGAAGGCAC-3’.

Gpx1 in vitro expression vector The expression vector pCMV·SPORT6 with full-length Gpx1 cDNA sequence inserted (Figure 20) was derived from the bacterial clone BI145182. The sequence of the Gpx1 cDNA was verified by sequencing analysis with the forward primer 5’-CCCAGTCACGACGTTGTAAAACG-3’ and the reverse primer 5’-AGCGGATAACAATTTCACACAGG-3’.

Production of stable cell lines Mouse fibroblast L cells were transfected with the expression vector (either pMet-Reg2-bGH or pCMV-Gpx1) using the Ca3(PO4)2 precipitation method described previously (344). Briefly, the plasmid DNA was co- transfected with pDλAT3 with a ratio of 1:100 (w/w, plasmid of interest:pDλAT3). pDλAT3 contains the adenine phosphoribosyl-transferase (APRT) and thymidine kinase

(TK) genes which encode for the selective markers APRT and TK, respectively.

Transfected cells were first selected for APRT+ (APRT positive) phenotype with the medium which contains 15µg/ml Adenine, 4µg/ml Azaserine, 50µg/ml gentamicin sulfate, and 10% Nu-serum in DMEM. In this medium, APRT- cells were eliminated because azaserine blocks the de novo purine nucleotide synthesis. However, HPRT+ cells 152

Figure 20. Gpx1 expression vector pCMV·SPORT6. 153 in the presence of adenine can synthesize purine via a salvage pathway. After about 2 weeks of culture with change of the medium every 2 to 3 days, the cells that survived and were proliferative were selected for TK+ with DMEM medium supplemented with 10%

Nu-serum, 50µg/ml gentamicin sulfate, 15µg/ml hypoxanthine, 1µg/ml aminopterin and

5.15µg/ml thymidine (HAT). In this second selection step, aminopterin inhibits the pathway of thymidylate biosynthesis in other cells except TK+ cells which can synthesize thymidylate in the presence of thymidine. After about two weeks of culture in HAT medium, the TK+ clones were isolated after the cells were subcultured into 96-well plates at a concentration of 0.5cell/well.

Stable cell lines from the plates were then analyzed the presence of exogenous DNA and gene expression by DNA slot blot and Northern blotting respectively..

DNA sequencing DNA sequencing was performed using PRISM BigDye

Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer’s protocol. The sequencing reaction was set as the following: 96°C, 1 min;

25 cycles of 96°C, 10 sec, 55°C, 5 sec, and 60°C, 4 min. Clones BM053708 and

BI145182 that contain mouse full-length Reg2 and Gpx1 cDNAs respectively were sequenced for Reg2 and Gpx1 upon arrival. The primers 5’-

CCCAGTCACGACGTTGTAAAACG-3’ and 5’-

AGCGGATAACAATTTCACACAGG-3’ were used as the forward and reverse sequencing primers, respectively, for both Reg2 and Gpx1 cDNA plasmids. The E. coli 154 clones containing pMet-Reg2-bGH construct were confirmed with the forward primer 5’-

TGGCAGGAGATCAGGCGTCT-3’ and the reverse primer 5’-TCCAGGGTCAAGG

AAGGCAC-3’ by sequencing.

Preparation of 32P-labeled Probes for DNA blotting The template DNA for

Gpx1 with an approximate size of 890bps was prepared by digesting the plasmid DNA

from the mouse Gpx1 cDNA clone BI145182 with SmaI and XbaI. The Reg2 template

DNA with an approximate size of 760bps was prepared by digesting the plasmid DNA

from the mouse Reg2 cDNA clone BM053708 with SmaI and SnaBI. The DNA fragment

containing Gpx1 or Reg2 cDNA was isolated by agarose gel electrophoresis and purified

with the HighPure PCR Product Purification Kit (Roche) for labeling.

DNA probes were labeled by Random Primed DNA Labeling Kit (Roche) as

recommended by the manufacturer. 100ng of template DNA was used in each reaction.

Labeled probes were purified using quick spin columns of G-50 sephadex (Roche

Applied Science, Indianapolis, IN). The specific activities were determined using a

scintillation counter. Each 32P-labeled Probe in 10µl with an activity of approximately

1.0×107cpm was mixed with 200µl of sheared Salmon sperm DNA of 10mg/ml for

subsequent hybridization.

Synthesis of DIG-labeled probes Sequences for primers for probe synthesis

were derived from clones that contain mouse Reg2 and Gpx1 cDNAs (Clones BM053708

and BI145182, Open Biosystems, Huntsville, AL). The primers were synthesized (Sigma- 155

Genosys, The Woodlands, TX). DIG-labeled probes were prepared using the PCR DIG

Probe Synthesis Kit (Roche) following the manufacturer’s instructions.

The sequences for primers are: 5’-AGCGGATAACAATTTCACACAGG (sense) and 5’-CCCAGTCACGACGTTGTAAAACG (antisense) used for 700bp Reg2 probe synthesis; 5’-TGGCAGGAGATCAGGCGTCT (sense) and 5’-

GGCTCTGAACTTGCAGACAAAG (antisense) used for 1000bp Gpx1 probe synthesis.

Cycling conditions for the reaction are as following: 95C, 2min; 10 cycles of 95 C,

10sec, 68C, 30sec, and 72C, 2min; 20 cycles of: 95C, 10sec, 68C, 30sec, and 72C, 2min+

20sec with every cycle; 72C, 7min, subsequently.

After synthesis, the products were checked by 1.0% agarose gel electrophoresis and quantified by a DIG-labeled probe quantitation kit (Roche).

DNA slot blot analysis Before each genomic DNA sample was loaded onto a slot device, 10µg DNA was diluted to a total volume of 180ul with ddH2O followed by an addition of 20µl of 3N NaOH. DNA samples were then denatured by incubation at

65°C for 1 hr. After about 10 min at room temperature, 200µl of 2M Ammonia Acetate

(no pH adjustment) was added to each sample to neutralize. Samples were immediately placed on ice until loaded. Copy control standards containing 0. 1, 2, 5, 10, and 20 copies of cDNA plasmids were also treated as the genomic DNA samples.

The nitrocellulose membrane (GeneScreen Plus, Perkin-Elmer) and support papers

(two layers) were pre-wet in dH2O and then 6XSSC. The manifold system was assembled according to the instructions supplied with the system. DNA samples were 156 loaded into appropriate wells under a vacuum. The DNA blot was carefully removed and air dried overnight.

The membrane was prehybridized in hybridization solution (10 ml deionized formamide, 4 ml 50% dextran sulfate, 4 ml 5M NaCl, and 2ml 10% SDS) at 42°C for 1 hr. Each 32P-labeled Probe in 10µl was mixed with 200µl of Sheared Salmon sperm DNA

of 10mg/ml, then boiled together for 10 min and immediately quenched on ice for 5 min

before added to the hybridization solution. Hybridization was carried out at 42°C

overnight in an oven with rotation. After hybridization, the membrane was washed three

times: once with 2×SSC at room temperature for 5 min, once with 2×SSC/0.1%SDS at

56°C for 5 min, finally with 2×SSC/0.1%SDS at 56°C for 30 min. The number of cDNA

plasmid inserted into the genome was estimated compared with the copy controls after

exposure of the membrane to an autoradiographic film.

Northern blot analysis Equal amounts of total RNA (15µg) from different

samples were resolved by a 1% agarose gel in 3[N-morpholino]propanesulfonic

acid/formaldehyde solution and transferred to a positively charged nylon membrane using

the NorthernMax kit (Ambion, Austin, TX) according to the manufacturer’s instructions.

All reagents for probe labeling and northern blot detection were purchased from Roche

(Roche Applied Science, Indianapolis, IN) unless stated otherwise. The membrane was

prehybridized in 4.5ml DIG Easy Hybe solution at 50oC for approximately 1 hour. 250ng

of DIG-labeled probe in 0.5ml of DIG Easy Hybe solution was boiled for 5 minutes

followed by a quick chilling on ice. The membrane was then hybridized with DIG- 157 labeled probes (50ng/mL hybridization solution) overnight at 42oC. The membranes were

then washed twice with 2×SSC/0.1% SDS at room temperature followed by two washes

with 0.1×SSC/0.1% SDS at 68oC. After treatment in 1× blocking solution, the

membranes were incubated with anti-digoxigenin-AP Fab fragment for 30 minutes at

room temperature and finally detected using CDP-Star chemiluminescent substrate.

Images were obtained with VersaDoc (Bio-Rad) and the densitometric analysis was then

performed using the Quantity One software (Bio-Rad).

SDS-PAGE SDS-PAGE was performed as previously described (296,345).

Gels with size of 8cm×10cm, concentration of 15% and a molar ratio of 1:37.5

(bisacrylamide:acrylamide) were prepared. Gels were run at 25mA/gel for 1.5 hours.

Two-dimensional gel electrophoresis Protein samples were treated for 2 hours

at room temperature with 5mM tributylphosphine and 20µl/ml of 1M Tris buffer (pH8.8)

to reduce disulfide bond and with 15mM iodoacetamide for 30 minutes for alkylation

(328,329). 2-DE was performed as previously described with slight modifications

(330).The first dimensional isoelectric focusing (IEF) was carried out after protein

samples were passively rehydrated on 17cm immobilized pH gradient (IPG) strips with a

broad pI range of 3 to 10 (Bio-Rad). The voltage was linearly increased from 0 to 6000 V

during first 10 hours, followed by 10 hours at 6000 V with a current limit of 50 µA/strip.

Following IEF, the strips were equilibrated in a buffer containing 6 M urea, 2% (w/v)

SDS, 0.375 M tris/HCl (pH8.8), 20% (v/v) glycerol, for 15 minutes before loading for 158 secondary SDS-PAGE analysis. The strips were sealed on the border of the SDS-PAGE gel using 0.5% low-melting point agarose gel. Proteins were separated by size in 15%

SDS-polyacrylamide gels (20cm×20cm) at 26mA/gel with maximum voltage of 300V for

9 hours at 4oC.

Protein gel staining After electrophoresis, the gels were fixed in a solution

containing 40%EtOH, 2% acetic acid, 0.0005% SDS overnight followed by washing

three times in a buffer of 2% acetic acid and 0.0005% SDS. The gels were stained using a

fluorescent dye, sypro orange (1:5000) (Molecular Probes, Eugene, OR), as previously

described (297).

Analysis of 2-D gel images Gel images were captured by a laser-scanning

device (FLA-3000G, Fuji). The densities of protein spots, which were normalized by the

total densities of all valid and matched spots in a set of gels, were quantitatively

compared between experimental and normal control groups using the PDQuest 7.0.1

program (Bio-Rad).

Protein identification by mass spectrometry Protein bands of interest were

excised from gels and transferred to a 96-well plate with addition of 40µl H2O. These

samples were delivered to the Proteome Mapping Laboratory at the University of

Michigan (www.proteomeconsortium.org). Proteins in gel plugs were digested with

trypsin. A fraction of the resulting solution was spotted onto a MALDI target plate for 159

Mass Spectrometric analysis. If the concentration of sample was too low to obtain a usable spectrum, the solution was purified and concentrated using micro C18 cartridges.

The concentrated sample was then utilized. The Applied Biosystems 4700 Proteomics

Analyzer (TOF/TOF) was used to obtain mass spectra which were queried against the

NCBI database using the Mascot program (http://www.matrixscience.com/) for identification. Prior to peak list generation, MS spectra were processed for calibration by trypsin auto-digestion peaks and smoothing. The signal-to-noise criterion was set to 25 or greater. The mono-isotopic masses were processed for identification. For MS/MS spectra, the peaks were calibrated by default and smoothed. All peaks were de-isotoped. The

Mascot program has the “Peptide Mass Fingerprint Search” engine for a probability- based peptide mass fingerprint (PMF) database search and the “MS/MS Ions Search” for an MS/MS search. The general parameters for searching are NCBI Database, all species, trypsin digestion, maximum 1 missed cleavage, fixed Carbamidomethylation of Cys, variable modifications of acetyl-N-term, oxidation-M (methionine), and Pyro-glu, ±50 ppm of Peptide Mass or Parent Tolerance. Peptide Charge State of 1+ and Fragment

Mass Tolerance of ± 0.5 Da were used for the MS/MS Ion search. At the time of searching (9/21/2004), NCBInr 20040916 database contains 2,026,219 sequences and

679,922,428 residues.

Enzyme activity assay for glutathione peroxidase The catalytic activity of glutathione peroxidase from Gpx1 gene transfected L cells and control cells was determined by Bioxytech GPx-340, a colorimetric assay for cellular glutathione 160 peroxidase (OXISResearch, Portland, OR). Briefly, cultured cells at 100% confluence were washed twice with cold saline and then detached using a rubber policeman and homogenized in a buffer containing 50mM Tris/Cl (pH7.5), 5mM EDTA and 1mM β- mercaptoethanol with a short treatment of sonication (10 seconds). Supernatants were obtains after cell lysates were centrifuged for 20 minutes at 10,000×g. The protein concentrations of samples were determined by Bradford method. Prior to the enzymatic activity assay, the concentrations of protein samples were adjusted to 10mg/ml. The activity assay was performed according to the recommended protocol by the manufacturer.

Preparation of Reg2 fragment for transgenic study The vector pMet-Reg2 plasmid DNA was digested with KpnI, resulting in 2 fragments with sizes of approximately 2 and 3.5 Kb. The 2 Kb DNA fragment, Met-Reg2-bGH, which contains a mouse metallothionien I promoter, Reg2 cDNA sequence, and partial genomic sequence of bGH gene including its poly-adenylation signal sequence, was separated by agarose gel electrophoresis and subsequently purified with High Pure PCR Product Purification

Kit (Roche). The purified DNA fragment was dissolved in Rinster’s microinjection buffer containing 10mM Tris and 0.1mM EDTA (pH7.4) at a concentration of 4ng/µl.

Generation and screening of Reg2 transgenic mice The Reg2 transgenic mice were generated by the pronuclear injection of mouse embryos, which was done by Ms.

Debbie Holman and Dr. Maria Lozykowski of the Microinjection Laboratory of Edison 161

Biotechnology Institute (346,347). Founder mice with Met-Reg2-bGH DNA fragment incorporated into their genome were identified by slot blot analysis.

Statistical analysis Results were presented as mean ± SE. Data were analyzed by ANOVA. Difference was considered statistically significant if P < 0.05. 162

Results

Construction of Reg2 Expression Vector The partial sequence of Reg2 in the expression vector pMet-Reg2-bGH was given in Figure 21.

Selection of Reg2 stable cell lines Reg2 cell lines were analyzed by slot blot to estimate the number of Reg2 cDNA copies in each cell line (Figure 22). Among all positive clones, the cell lines Rg-6, -9, -13, and -15 with near 20 or more than 20 copies of Reg2 cDNA in genome were selected for mRNA and protein expression analyses.

Selection of Gpx1 stable cell lines TK+ Gpx1 cell lines were analyzed by slot blot to estimate the number of Gpx1 cDNA copies in each cell line (Figure 23). The cell lines Gp-1, -2, -12, and -14 with near 20 or more than 20 copies of Gpx1 cDNA were selected for Gpx1 mRNA and protein expression analyses.

Expression of Reg2 mRNA in Reg2 cell lines For cell lines Rg-6, -9, -13, and

-15, the Reg2 mRNA expression was detected by Northern blot analysis with the DIG- labeled anti-sense strand of Reg2 cDNA. While no endogenous Reg2 mRNA was detected in control L cells as expected, expression of Reg2 mRNA was confirmed in all the four cell lines analyzed (Figure 24). The four pancreas samples serve as positive 163

5’ATGTGTGCTGCTC……600bases……GCAGTCTGGCAACTCCTAAGGCGGCCC

Start Codon Stop Codon

TGGCATTGGCTTGGTGATTACTGGCTGCACTCTGGGGGGCGGTTCTTCCATGA

TGGTGTTTCCTCTAAATTTGCACGGAGAAACACCTGATTTCCAGGAAAATCCC

CTCAGATGGGCGCTGGTCCCATCCATTCCCGATGCCTTTCCACCTAATGAAGG

TGGTTTCACTACTAAGAATAAAGTGCTGAATATCAGAAAAAAAAAAAAAAA

Poly A Signal Poly A Site

AAGG3

Figure 21. The sequence of the Reg2 gene in the vector pMet-Reg2-bGH.

164

Figure 22. Slot blot analysis for Reg2 cell lines. Bands at the left panel are copy controls with copy numbers indicated. DNA samples extracted from Reg2 clones were analyzed with equal amount (10µg) loaded. 165

Figure 23. Slot blot analysis for Gpx1 cell lines. Bands at the left panel are copy controls with copy numbers indicated. DNA samples extracted from Gpx1 clones were analyzed with equal amount (10µg) loaded. 166

Figure 24. Northern blot analysis for Reg2 in cell lines Rg-6, -9, -13, and -15. Shown at the upper panel are results for Reg2 mRNA signals in the four cell lines, the control L cells and the four pancreas samples (two from diet-induced diabetic mice L54 and L43, and two from normal control mice L54 and L43). Equal amount of total RNAs (15µg) were loaded for each sample and the membrane was hybridized with the DIG-labeled

Reg2 cDNA probe. Each of the four Reg2 cell lines showed an exogenous Reg2 mRNA band while no positive signal was detected in the control. The 18S and 28S ribosomal

RNA bands are shown at the lower panel after the RNA samples were resolved on a 1% formaldehyde agarose gel and stained with ethidium bromide. 167 controls. Each of the four transfected cell lines has a band that is the exogenous Reg2 mRNA. The size of the construct mRNA is slightly bigger than that of the native mRNA, which is possibly due to additional bases at its 5’- and 3’-untranslated region in the construct mRNA.

Expression of Gpx1 mRNA in Gpx1 cell lines For cell lines Gp-1, -2, -12, and

-14, the Gpx1 mRNA expression was detected by Northern blot analysis. While endogenous Gpx1 mRNA was detected in control L cells and the four cell lines as expected, the expression of exogenous Gpx1 mRNA with a different size was confirmed in all the four cell lines analyzed (Figure 25). The four transfected cell lines have a lower band that is equivalent to the endogenous mRNA in L cells and the four tissue samples and an upper band that is the exogenous mRNA. The construct transcript is a little bigger than the endogenous one, which is possibly due to additional bases at its 5’-untranslated region in the construct mRNA.

Protein analysis of Gpx1 expression by 2-D gel electrophoresis The spot shown in Figure 26 was detected in the three Gpx1 cell lines but not in control L cells.

The size of the spot is approximately 22.3KD which is the estimated size of Gpx1. 168

Figure 25. Northern analysis for Gpx1 in cell lines Gp-1, -2, -12, and -14. Shown at the

upper panel are results for Gpx1 mRNA signals in the four cell lines, the control L cells

and the four pancreas samples (two from diet-induced diabetic mice L54 and L43, and

two from normal control mice L54 and L43). Equal amount of total RNAs (15µg) were

loaded for each sample and the membrane was hybridized with the DIG-labeled Gpx1

cDNA probe. Each of the four Gpx1 cell lines showed an exogenous mRNA band and an endogenous Gpx1 band while only an endogenous band was detected in the control. The

18S and 28S ribosomal RNA bands are shown at the lower panel after the RNA samples were resolved on a 1% formaldehyde agarose gel and stained with ethidium bromide. 169

Figure 26. 2-DE of proteins from the Gpx1 cell lines GP-1, -2, and -12 and control L cells. 170

Protein analysis of Reg2 expression Protein samples from cell lysates and concentrated and dialyzed conditioned media from Reg2 cell lines were analyzed by 2-D gel electrophoresis and SDS-PAGE, respectively. No difference between 2-D images of cell lysates from the Reg2 cell lines and the control L cells could be detected (data not shown). When concentrated and dialyzed conditioned media from the Reg2 cell lines and the control L cells were analyzed by SDS-PAGE, more bands were detected in the samples from the Reg2 cell lines (Figure 27). The band A and B from the Figure 27 were cut out and analyzed by MS and MS/MS analyses. Reg2 protein was positively identified in the band A and B (Table 7).

Glutathione peroxidase activity in Gpx1 cell lines The enzymatic activities of glutathione peroxidase for the four Gpx1 cell lines and L cells were shown in Table 8.

The enzyme activities in all four Gpx1 cell lines were increased with a range of 2.6- to

8.9- fold relative to that of the control.

Production of Reg2 transgenic mice F0 mice were screened for founders by slot blot analysis to estimate the number of Reg2 cDNA copies in transgenic mice (Figure

28). Mice #4 and #5 have near 2 copies of Reg2 cDNA, while mice #3, #11, #13, #20,

#22, and #31 have near one copy of Reg2 cDNA in genome. These mice were selected as founders. 171

Figure 27. Analysis of protein samples of conditioned media from control L cells and two Reg2 cell lines (Reg2-6 and Reg2-15) by SDS-PAGE. 172

Table 7. Proteins or peptides identified by MS and MS/MS analyses from band A and B.

The Band A an B are shown in Figure 27. Only proteins with significant scores (>95%) by either MS or MS/MS analysis were listed in the table. *: 16.9KDa without theoretical signal peptide.

Protein Name Nucleoside- Regenerating Islet- Peptidylprolyl

Diphosphate Kinase 1 Derived 2 (Reg2) Isomerase A

Accession. No. 37700232 6677705 6679439

MW (KDa) 18.8 19.4* 18.1

MS Peptide 5 5 5

Count

MS Score C.I. % 93.3 0 24.8

MS/MS Fragment TFIAIKPDGVQR SWATGAPSTANR FEDENFILK

Sequence

MS/MS Score 99.8 99.6 99.7

C.I. %

173

Table 8. Glutathione peroxidase activity in Gpx1 cell lines and control L cells.

#:Values are presented as mean±SD. *: P<0.01, compared with L cells.

Sample Glutathione Peroxidase Relative to L Cells

Acitivity# (mU/mg)

Gp1 242±5.1* 6.4×

Gp2 141±4.5* 3.7×

Gp12 97±2.0* 2.6×

Gp14 336±5.9* 8.9×

L Cells 37.7±4.1 1×

174

Figure 28. Screening of Reg2 founders mice by slot blot. Bands at the upper left corner are copy controls with copy numbers indicated. Mice DNA samples were analyzed with equal amount (10µg) loaded. 175

Discussion

L cells were used for in vitro expression of Reg2 and Gpx1 based on several advantages of the cell line. This mouse L cell line has been proved in many studies to be a useful host for gene expression under the control of mouse metallothionein promoter.

The origin of the cell line from mouse also helps in transgenic mice study. Moreover, this cell line is suitable for exppreion of secreted proteins.

We have demonstrated that exogenous Reg2 and Gpx1 genes were successfully expressed in transfected L cell lines by detecting the expression of mRNAs and proteins.

As expected, endogenous Gpx1 gene was expressed in L cells while Reg2 gene expression was only detected in Reg2 gene transfected L cells. The difference in size between endogenous and exogenous Gpx1 and Reg2 mRNAs is possibly due to the size difference in 5’-, and/or 3’-untranslated regions of the mRNAs. This study provides valuable information for the next transgenic mice study in which the physiological function of the two genes in association with glucose metabolism and other processes can be further characterized.

Reg2 transgenic mice were generated and transgenic founders were identified. These founders will be used to produce more transgenic mice for future study.

176

General Summary and Conclusion

In this study, diet-induced obesity and diabetes was successfully established in

C57BL/6J mice fed a high-fat diet, which serves as a model of obesity-associated diabetes in humans. Hyperglycemia was observed in some of the mice only after two weeks on the diet. At each of the four different time points, i.e., 2 weeks, 4 weeks, 8 weeks or 16 weeks on the diet, three mice from each group were selected for proteomic analysis based on their weights, fasting glucose and insulin levels that were representative for either obese/diabetic or normal controls.

Proteins were extracted from the pancreas of the diabetic and control mice and were resolved by a procedure termed 2 dimensional gel electrophoresis (2-DE). The pancreatic protein profiles were compared between the control and diabetic mice. Differentially expressed protein spots were identified by MALDI-TOF and/or tandem MS/MS analysis.

Eleven differentially expressed protein spots were detected and ten of them were identified.

REG1 protein was shown to be up-regulated very early in the progression of obese mice to T2DM. Reg1, which may be involved in the regeneration of pancreatic β-cells, is detected in the exocrine pancreas by acinar cells and secreted into pancreatic ducts. Reg1 is also expressed specifically in regenerating and hyperplastic islets, but not in normal islets, liver, or brain. Low expression of Reg1 is found in gastric mucosa, kidney, and gallbladder. REG2 protein, which belongs to the Reg gene family, also was up-regulated early in the diabetic mice. The up-regulation of Reg1 and Reg2 may suggest the effort of 177 the pancreas in trying to ameliorate the hyperglycemic condition by stimulating the proliferation of pancreatic β-cells and enhancing the subsequent insulin secretion.

To a less degree than Reg1 and Reg2, Rho GDP-dissociation inhibitor 1, 1-Cys peroxiredoxin protein, and pancreatic elastase 3B were also up-regulated in diabetic mice relative to control. The significance of these proteins in the development of diabetes remains to be explored.

Glutathione peroxidase was found to be down-regulated in the diabetic mice at later stages of diabetes. Glutathione peroxidase, a selenium-containing enzyme, is considered the most abundant isoform in the glutathione peroxidase gene family and functions as a

GSH-dependent enzyme to remove hydrogen peroxide and fatty acid hydroperoxide. It is believed to be ubiquitously expressed in all mammalian tissues. Supraphysiological glucose concentrations due to hyperglycemia can result in high levels of intracellular peroxide concentrations in islets which cause damage to β-cell function. Pancreatic islets are especially vulnerable to oxidative damage due to extremely low levels of gene expression of intrinsic antioxidant enzymes, especially catalase and glutathione peroxidase, in islets relative to other tissues. Down-regulated expression of glutathione peroxidase in pancreas in diabetic mice may result in less capacity to clear ROS. Whereas the demand for antioxidative enzymes is high, this imbalance may contribute to the progressive deterioration of β-cell function in diabetic mice with chronic hyperglycemia.

The protein level of the receptor of activated protein kinase C1 also was decreased in diabetic mice when compared with normal controls. The signaling pathway of protein kinase C in the pathogenesis of diabetes needs further study. 178

Reg2 or Gpx1 transgenic mice can provide valuable information to understand the biological function of Reg2 and Gpx1 during the development of diabetes in mice. As a part of this strategy, mammalian in vitro expression vectors for Reg2 and Gpx1 were constructed and stable cell lines were established. Reg2 transgenic mice with the gene under the control of the mouse metallothionien transcriptional regulatory region currently are being generated that will provide a means to study the physiological function of the gene in association with diabetes and β-cell function.

179

Working Model of Type 2 Diabetes

Based on our results and those of others, a working model of type 2 diabetes in the animal model is proposed.

Diet-induced obesity followed by insulin resistance One of the early changes in C57Bl/6J mice fed a high-fat diet is increased mass of fat tissue. Compared with other strains, this specific strain is known to gain weight quickly. Possibly through increased concentration of circulating free fatty acid, the target tissues of insulin action, which include liver, muscle, and fat tissue, become insulin resistant.

Short-term pathological changes Obesity and insulin resistance in the mice can lead to increased level of blood glucose. Due to inherent defects of insulin secretion, the mice can not sufficiently compensate for insulin resistance by enhancing insulin secretion. Therefore, blood glucose level increases (see Figure 2).

Increased blood glucose levels can, in turn, have its own effects, such as stimulation of β-cell proliferation and up regulation of ROS gene expression. In our study, increased levels of Reg1 and Reg2 were observed in the pancreas of diabetic mice. Due to their possible function in stimulating β-cell neogenesis, increased expression of Reg1 and

Reg2 may result in increased mass of β-cells. Thus, this response is considered positive as insulin secretion could be enhanced.

180

Long-term pathological alterations However, the mice can not fully compensate for insulin resistance despite the positive responses. Hyperglycemia remains to be a problem in these mice. As shown by many studies, the pancreatic β-cells are especially vulnerable to oxidative damage caused by ROS as they have extremely low level of ROS clearing enzymes, suah as Catalase and Glutathione Peroxidase.

Furthermore, it is demonstrated by our studies that the expression of Glutathione

Peroxidase was down-regulated in the diabetic mice. In this scenario, the pancreatic β- cells experience continuing and increasing oxidative stress, leading to increasing levels of apoptosis in the pancreatic islets. Long-term effects include increasing blood glucose and other pathological changes.

Potential targets for therapeutical interventions One way to treat these mice is to inject recombinant Reg2 or Reg1 proteins. If ‘more’ regeneration of the β cells occurred, it would perhaps benefit the mice, that is, protect them from diabetes. For example, the transgenic mice that, hopefully, will express Reg 2, may be protected from obesity-induced diabetes due to increased mass of β-cells and increased secretion of insulin. Another way to protect ‘the mice’ would be to increase the activity of

Glutathione Peroxidase. This could be accomplished by suppressing the activity of inhibtor(s) of its gene expression. To do that, a transcriptional inhibitor or inhibitors need to be identified first. 181

Future Work

To determine the expression sites of Reg1 and Reg2 in the pancreas of normal and diabetic mice, in situ hybridization with specific cDNA probes and immunohistochemical staining with specific antibodies could be utilized. This study will give information to these questions--whether the genes are expressed in the exocrine or endocrine pancreas or both and where the up-regulation occurs in the diabetic mice.

Additional studies on Reg2 transgenic mice need to be conducted. Detection of the expression of exogenous Reg2 in various tissues of the transgenic mice could be performed. If over-expression of Reg2 can be successfully confirmed in the transgenic mice, the potential role of Reg2 in the development of T2DM and pancreatic β-cell proliferation and apoptosis can be characterized. The working hypothesis for the study is that Reg2 stimulates the proliferation of pancreatic β-cells, thus protecting mice from diet-induced diabetes or delaying the onset of the disease. If the hypothesis is true, the over-expression of the Reg2 gene would prevent diet-induced diabetes or delay the onset of the disease with increased mass of β-cells in transgenic animals.

Also, pancreas or pancreatic β-cell specific over-expression of the Gpx1 gene needs to be performed. The role of Gpx1 in protecting pancreatic β-cells from oxidative damage could be elucidated in transgenic mice. If apoptosis of β-cells is improved and diabetes is prevented or less severe in the Gpx1 transgenic animals, further study to find a way to up-regulate the enzyme is needed.

If the results support the protective role of Reg2 against T2DM by its capability to stimulate the proliferation of pancreatic β-cells and, therefore, to enhance insulin 182 secretion, then the, human homolog of mouse Reg2 could be explored as a therapeutic agent in the treatment of diabetes. If overexpression of Gpx1 can protect pancreatic β- cells from oxidative damage imposed by hyperglycemia, further investigations into molecules and/or chemicals involved in decreasing the rate of ROS ‘clearance’ or methods by which expression of the GPX1 gene is up regulated could lead to a candidate therapeutics that would benefit human diabetics. 183

References

1. Meneilly, G. S., Elliott, T., Tessier, D., Hards, L., and Tildesley, H. (1996) NIDDM in the elderly. Diabetes Care 19, 1320-1325

2. Kim, J., Choi, S., Kong, B., Oh, Y., and Shinn, S. (2001) Insulin secretion and sensitivity during oral glucose tolerance test in Korean lean elderly women. J Korean Med Sci 16, 592-597

3. Garcia-Estevez, D. A., Araujo-Vilar, D., Saavedra-Gonzalez, A., Fiestras-Janeiro, G., and Cabezas-Cerrato, J. (2002) Glucose metabolism in lean patients with mild type 2 diabetes mellitus: evidence for insulin-sensitive and insulin-resistant variants. Metabolism 51, 1047-1052

4. Kosaka, K., Kuzuya, T., Yoshinaga, H., and Hagura, R. (1996) A prospective study of health check examinees for the development of non-insulin-dependent diabetes mellitus: relationship of the incidence of diabetes with the initial insulinogenic index and degree of obesity. Diabet Med 13, S120-126

5. Arner, P., Pollare, T., and Lithell, H. (1991) Different aetiologies of type 2 (non- insulin-dependent) diabetes mellitus in obese and non-obese subjects. Diabetologia 34, 483-487

6. Grodsky, G. M. (1972) A threshold distribution hypothesis for packet storage of insulin and its mathematical modeling. J Clin Invest 51, 2047-2059

7. Cerasi, E., Fick, G., and Rudemo, M. (1974) A mathematical model for the glucose induced insulin release in man. Eur J Clin Invest 4, 267-278

8. Nesher, R., and Cerasi, E. (2002) Modeling phasic insulin release: immediate and time-dependent effects of glucose. Diabetes 51 Suppl 1, S53-59

9. Olofsson, C. S., Gopel, S. O., Barg, S., Galvanovskis, J., Ma, X., Salehi, A., Rorsman, P., and Eliasson, L. (2002) Fast insulin secretion reflects exocytosis of docked granules in mouse pancreatic B-cells. Pflugers Arch 444, 43-51

10. Daniel, S., Noda, M., Straub, S. G., and Sharp, G. W. (1999) Identification of the docked granule pool responsible for the first phase of glucose-stimulated insulin secretion. Diabetes 48, 1686-1690

11. Henquin, J. C., Ishiyama, N., Nenquin, M., Ravier, M. A., and Jonas, J. C. (2002) Signals and pools underlying biphasic insulin secretion. Diabetes 51 Suppl 1, S60-67

184

12. Ohara-Imaizumi, M., Nakamichi, Y., Tanaka, T., Ishida, H., and Nagamatsu, S. (2002) Imaging exocytosis of single insulin secretory granules with evanescent wave microscopy: distinct behavior of granule motion in biphasic insulin release. J Biol Chem 277, 3805-3808

13. Polonsky, K. S., Given, B. D., and Van Cauter, E. (1988) Twenty-four-hour profiles and pulsatile patterns of insulin secretion in normal and obese subjects. J Clin Invest 81, 442-448

14. Gerich, J. E. (2002) Is reduced first-phase insulin release the earliest detectable abnormality in individuals destined to develop type 2 diabetes? Diabetes 51 Suppl 1, S117-121

15. MacDonald, P. E., and Wheeler, M. B. (2003) Voltage-dependent K(+) channels in pancreatic beta cells: role, regulation and potential as therapeutic targets. Diabetologia 46, 1046-1062

16. Ashcroft, F. M., Harrison, D. E., and Ashcroft, S. J. (1984) Glucose induces closure of single potassium channels in isolated rat pancreatic beta-cells. Nature 312, 446-448

17. Sato, Y., Aizawa, T., Komatsu, M., Okada, N., and Yamada, T. (1992) Dual functional role of membrane depolarization/Ca2+ influx in rat pancreatic B-cell. Diabetes 41, 438-443

18. Gembal, M., Gilon, P., and Henquin, J. C. (1992) Evidence that glucose can control insulin release independently from its action on ATP-sensitive K+ channels in mouse B cells. J Clin Invest 89, 1288-1295

19. Wollheim, C. B., and Maechler, P. (2002) Beta-cell mitochondria and insulin secretion: messenger role of nucleotides and metabolites. Diabetes 51 Suppl 1, S37-42

20. Poy, M. N., Eliasson, L., Krutzfeldt, J., Kuwajima, S., Ma, X., MacDonald, P. E., Pfeffer, S., Tuschl, T., Rajewsky, N., Rorsman, P., and Stoffel, M. (2004) A pancreatic islet-specific microRNA regulates insulin secretion. Nature 432, 226- 230

21. He, L., and Hannon, G. J. (2004) MICRORNAS: SMALL RNAS WITH A BIG ROLE IN GENE REGULATION. Nat Rev Genet 5, 522-531

22. Hother-Nielsen, O., Henriksen, J. E., Holst, J. J., and Beck-Nielsen, H. (1996) Effects of insulin on glucose turnover rates in vivo: isotope dilution versus constant specific activity technique. Metabolism 45, 82-91 185

23. Cherrington, A. D. (1999) Banting Lecture 1997. Control of glucose uptake and release by the liver in vivo. Diabetes 48, 1198-1214

24. Yki-Jarvinen, H., Young, A. A., Lamkin, C., and Foley, J. E. (1987) Kinetics of glucose disposal in whole body and across the forearm in man. J Clin Invest 79, 1713-1719

25. Getty, L., Hamilton-Wessler, M., Ader, M., Dea, M. K., and Bergman, R. N. (1998) Biphasic insulin secretion during intravenous glucose tolerance test promotes optimal interstitial insulin profile. Diabetes 47, 1941-1947

26. Steiner, K. E., Mouton, S. M., Bowles, C. R., Williams, P. E., and Cherrington, A. D. (1982) The relative importance of first- and second-phase insulin secretion in countering the action of glucagon on glucose turnover in the conscious dog. Diabetes 31, 964-972

27. Garber, A. J. (2004) The metabolic syndrome. Med Clin North Am 88, 837-846, ix

28. Lopez-Candales, A. (2001) Metabolic syndrome X: a comprehensive review of the pathophysiology and recommended therapy. J Med 32, 283-300

29. Ferrannini, E., Natali, A., Bell, P., Cavallo-Perin, P., Lalic, N., and Mingrone, G. (1997) Insulin resistance and hypersecretion in obesity. European Group for the Study of Insulin Resistance (EGIR). J Clin Invest 100, 1166-1173

30. Bjorntorp, P. (1988) Abdominal obesity and the development of noninsulin- dependent diabetes mellitus. Diabetes Metab Rev 4, 615-622

31. Lillioja, S., Mott, D. M., Howard, B. V., Bennett, P. H., Yki-Jarvinen, H., Freymond, D., Nyomba, B. L., Zurlo, F., Swinburn, B., and Bogardus, C. (1988) Impaired glucose tolerance as a disorder of insulin action. Longitudinal and cross- sectional studies in Pima Indians. N Engl J Med 318, 1217-1225

32. Saad, M. F., Knowler, W. C., Pettitt, D. J., Nelson, R. G., Mott, D. M., and Bennett, P. H. (1989) Sequential changes in serum insulin concentration during development of non-insulin-dependent diabetes. Lancet 1, 1356-1359

33. Bergman, R. N., Ader, M., Huecking, K., and Van Citters, G. (2002) Accurate assessment of beta-cell function: the hyperbolic correction. Diabetes 51 Suppl 1, S212-220

186

34. Gerich, J. E. (2000) Insulin resistance is not necessarily an essential component of type 2 diabetes. J Clin Endocrinol Metab 85, 2113-2115

35. Pimenta, W., Korytkowski, M., Mitrakou, A., Jenssen, T., Yki-Jarvinen, H., Evron, W., Dailey, G., and Gerich, J. (1995) Pancreatic beta-cell dysfunction as the primary genetic lesion in NIDDM. Evidence from studies in normal glucose- tolerant individuals with a first-degree NIDDM relative. Jama 273, 1855-1861

36. Rich, S. S. (1990) Mapping genes in diabetes. Genetic epidemiological perspective. Diabetes 39, 1315-1319

37. van Haeften, T. W., Dubbeldam, S., Zonderland, M. L., and Erkelens, D. W. (1998) Insulin secretion in normal glucose-tolerant relatives of type 2 diabetic subjects. Assessments using hyperglycemic glucose clamps and oral glucose tolerance tests. Diabetes Care 21, 278-282

38. Medici, F., Hawa, M., Ianari, A., Pyke, D. A., and Leslie, R. D. (1999) Concordance rate for type II diabetes mellitus in monozygotic twins: actuarial analysis. Diabetologia 42, 146-150

39. Newman, B., Selby, J. V., King, M. C., Slemenda, C., Fabsitz, R., and Friedman, G. D. (1987) Concordance for type 2 (non-insulin-dependent) diabetes mellitus in male twins. Diabetologia 30, 763-768

40. Vaag, A., Henriksen, J. E., Madsbad, S., Holm, N., and Beck-Nielsen, H. (1995) Insulin secretion, insulin action, and hepatic glucose production in identical twins discordant for non-insulin-dependent diabetes mellitus. J Clin Invest 95, 690-698

41. Pigon, J., Giacca, A., Ostenson, C. G., Lam, L., Vranic, M., and Efendic, S. (1996) Normal hepatic insulin sensitivity in lean, mild noninsulin-dependent diabetic patients. J Clin Endocrinol Metab 81, 3702-3708

42. Velho, G., and Robert, J. J. (2002) Maturity-onset diabetes of the young (MODY): genetic and clinical characteristics. Horm Res 57 Suppl 1, 29-33

43. Miner, J. L. (2004) The adipocyte as an endocrine cell. J Anim Sci 82, 935-941

44. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J. M. (1994) Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425-432

45. Wilding, J. P. (2001) Leptin and the control of obesity. Curr Opin Pharmacol 1, 656-661

187

46. Tartaglia, L. A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., Richards, G. J., Campfield, L. A., Clark, F. T., Deeds, J., and et al. (1995) Identification and expression cloning of a leptin receptor, OB-R. Cell 83, 1263- 1271

47. Maffei, M., Halaas, J., Ravussin, E., Pratley, R. E., Lee, G. H., Zhang, Y., Fei, H., Kim, S., Lallone, R., Ranganathan, S., and et al. (1995) Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight- reduced subjects. Nat Med 1, 1155-1161

48. Trayhurn, P. (2001) Biology of leptin--its implications and consequences for the treatment of obesity. Int J Obes Relat Metab Disord 25 Suppl 1, S26-28

49. Holcomb, I. N., Kabakoff, R. C., Chan, B., Baker, T. W., Gurney, A., Henzel, W., Nelson, C., Lowman, H. B., Wright, B. D., Skelton, N. J., Frantz, G. D., Tumas, D. B., Peale, F. V., Jr., Shelton, D. L., and Hebert, C. C. (2000) FIZZ1, a novel cysteine-rich secreted protein associated with pulmonary inflammation, defines a new gene family. Embo J 19, 4046-4055

50. Kim, K. H., Lee, K., Moon, Y. S., and Sul, H. S. (2001) A cysteine-rich adipose tissue-specific secretory factor inhibits adipocyte differentiation. J Biol Chem 276, 11252-11256

51. Steppan, C. M., Bailey, S. T., Bhat, S., Brown, E. J., Banerjee, R. R., Wright, C. M., Patel, H. R., Ahima, R. S., and Lazar, M. A. (2001) The hormone resistin links obesity to diabetes. Nature 409, 307-312

52. Chawla, A., Schwarz, E. J., Dimaculangan, D. D., and Lazar, M. A. (1994) Peroxisome proliferator-activated receptor (PPAR) gamma: adipose-predominant expression and induction early in adipocyte differentiation. Endocrinology 135, 798-800

53. Lehmann, J. M., Moore, L. B., Smith-Oliver, T. A., Wilkison, W. O., Willson, T. M., and Kliewer, S. A. (1995) An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor gamma (PPAR gamma). J Biol Chem 270, 12953-12956

54. Banerjee, R. R., Rangwala, S. M., Shapiro, J. S., Rich, A. S., Rhoades, B., Qi, Y., Wang, J., Rajala, M. W., Pocai, A., Scherer, P. E., Steppan, C. M., Ahima, R. S., Obici, S., Rossetti, L., and Lazar, M. A. (2004) Regulation of fasted blood glucose by resistin. Science 303, 1195-1198

188

55. Sato, N., Kobayashi, K., Inoguchi, T., Sonoda, N., Imamura, M., Sekiguchi, N., Nakashima, N., and Nawata, H. (2004) Adenovirus-mediated High Expression of Resistin Causes Dyslipidemia in Mice. Endocrinology, en.2004-0985

56. Rajala, M. W., Lin, Y., Ranalletta, M., Yang, X. M., Qian, H., Gingerich, R., Barzilai, N., and Scherer, P. E. (2002) Cell type-specific expression and coregulation of murine resistin and resistin-like molecule-alpha in adipose tissue. Mol Endocrinol 16, 1920-1930

57. Maebuchi, M., Machidori, M., Urade, R., Ogawa, T., and Moriyama, T. (2003) Low resistin levels in adipose tissues and serum in high-fat fed mice and genetically obese mice: development of an ELISA system for quantification of resistin. Arch Biochem Biophys 416, 164-170

58. Sentinelli, F., Romeo, S., Arca, M., Filippi, E., Leonetti, F., Banchieri, M., Di Mario, U., and Baroni, M. G. (2002) Human resistin gene, obesity, and type 2 diabetes: mutation analysis and population study. Diabetes 51, 860-862

59. Janke, J., Engeli, S., Gorzelniak, K., Luft, F. C., and Sharma, A. M. (2002) Resistin gene expression in human adipocytes is not related to insulin resistance. Obes Res 10, 1-5

60. Scherer, P. E., Williams, S., Fogliano, M., Baldini, G., and Lodish, H. F. (1995) A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 270, 26746-26749

61. Haluzik, M., Parizkova, J., and Haluzik, M. M. (2004) Adiponectin and its role in the obesity-induced insulin resistance and related complications. Physiol Res 53, 123-129

62. Arita, Y., Kihara, S., Ouchi, N., Takahashi, M., Maeda, K., Miyagawa, J., Hotta, K., Shimomura, I., Nakamura, T., Miyaoka, K., Kuriyama, H., Nishida, M., Yamashita, S., Okubo, K., Matsubara, K., Muraguchi, M., Ohmoto, Y., Funahashi, T., and Matsuzawa, Y. (1999) Paradoxical decrease of an adipose- specific protein, adiponectin, in obesity. Biochem Biophys Res Commun 257, 79- 83

63. Hotta, K., Funahashi, T., Arita, Y., Takahashi, M., Matsuda, M., Okamoto, Y., Iwahashi, H., Kuriyama, H., Ouchi, N., Maeda, K., Nishida, M., Kihara, S., Sakai, N., Nakajima, T., Hasegawa, K., Muraguchi, M., Ohmoto, Y., Nakamura, T., Yamashita, S., Hanafusa, T., and Matsuzawa, Y. (2000) Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol 20, 1595-1599

189

64. Hotta, K., Funahashi, T., Bodkin, N. L., Ortmeyer, H. K., Arita, Y., Hansen, B. C., and Matsuzawa, Y. (2001) Circulating concentrations of the adipocyte protein adiponectin are decreased in parallel with reduced insulin sensitivity during the progression to type 2 diabetes in rhesus monkeys. Diabetes 50, 1126-1133

65. Kubota, N., Terauchi, Y., Yamauchi, T., Kubota, T., Moroi, M., Matsui, J., Eto, K., Yamashita, T., Kamon, J., Satoh, H., Yano, W., Froguel, P., Nagai, R., Kimura, S., Kadowaki, T., and Noda, T. (2002) Disruption of adiponectin causes insulin resistance and neointimal formation. J Biol Chem 277, 25863-25866

66. Hara, K., Boutin, P., Mori, Y., Tobe, K., Dina, C., Yasuda, K., Yamauchi, T., Otabe, S., Okada, T., Eto, K., Kadowaki, H., Hagura, R., Akanuma, Y., Yazaki, Y., Nagai, R., Taniyama, M., Matsubara, K., Yoda, M., Nakano, Y., Tomita, M., Kimura, S., Ito, C., Froguel, P., and Kadowaki, T. (2002) Genetic variation in the gene encoding adiponectin is associated with an increased risk of type 2 diabetes in the Japanese population. Diabetes 51, 536-540

67. Fruebis, J., Tsao, T. S., Javorschi, S., Ebbets-Reed, D., Erickson, M. R., Yen, F. T., Bihain, B. E., and Lodish, H. F. (2001) Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci U S A 98, 2005-2010

68. Berg, A. H., Combs, T. P., Du, X., Brownlee, M., and Scherer, P. E. (2001) The adipocyte-secreted protein Acrp30 enhances hepatic insulin action. Nat Med 7, 947-953

69. Bjorntorp, P., and Rosmond, R. (2000) Obesity and cortisol. Nutrition 16, 924- 936

70. Wajchenberg, B. L. (2000) Subcutaneous and visceral adipose tissue: their relation to the metabolic syndrome. Endocr Rev 21, 697-738

71. Rask, E., Olsson, T., Soderberg, S., Andrew, R., Livingstone, D. E., Johnson, O., and Walker, B. R. (2001) Tissue-specific dysregulation of cortisol metabolism in human obesity. J Clin Endocrinol Metab 86, 1418-1421

72. Bujalska, I. J., Kumar, S., and Stewart, P. M. (1997) Does central obesity reflect "Cushing's disease of the omentum"? Lancet 349, 1210-1213

73. Kotelevtsev, Y., Holmes, M. C., Burchell, A., Houston, P. M., Schmoll, D., Jamieson, P., Best, R., Brown, R., Edwards, C. R., Seckl, J. R., and Mullins, J. J. (1997) 11beta-hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity or stress. Proc Natl Acad Sci U S A 94, 14924-14929 190

74. Masuzaki, H., Paterson, J., Shinyama, H., Morton, N. M., Mullins, J. J., Seckl, J. R., and Flier, J. S. (2001) A transgenic model of visceral obesity and the metabolic syndrome. Science 294, 2166-2170

75. Boden, G. (2003) Effects of free fatty acids (FFA) on glucose metabolism: significance for insulin resistance and type 2 diabetes. Exp Clin Endocrinol Diabetes 111, 121-124

76. Wyne, K. L. (2003) Free fatty acids and type 2 diabetes mellitus. Am J Med 115 Suppl 8A, 29S-36S

77. Kraegen, E. W., Cooney, G. J., Ye, J. M., Thompson, A. L., and Furler, S. M. (2001) The role of lipids in the pathogenesis of muscle insulin resistance and beta cell failure in type II diabetes and obesity. Exp Clin Endocrinol Diabetes 109 Suppl 2, S189-201

78. Kim, J. K., Fillmore, J. J., Chen, Y., Yu, C., Moore, I. K., Pypaert, M., Lutz, E. P., Kako, Y., Velez-Carrasco, W., Goldberg, I. J., Breslow, J. L., and Shulman, G. I. (2001) Tissue-specific overexpression of lipoprotein lipase causes tissue-specific insulin resistance. Proc Natl Acad Sci U S A 98, 7522-7527

79. Krssak, M., Falk Petersen, K., Dresner, A., DiPietro, L., Vogel, S. M., Rothman, D. L., Roden, M., and Shulman, G. I. (1999) Intramyocellular lipid concentrations are correlated with insulin sensitivity in humans: a 1H NMR spectroscopy study. Diabetologia 42, 113-116

80. Boden, G., Lebed, B., Schatz, M., Homko, C., and Lemieux, S. (2001) Effects of acute changes of plasma free fatty acids on intramyocellular fat content and insulin resistance in healthy subjects. Diabetes 50, 1612-1617

81. Yu, C., Chen, Y., Cline, G. W., Zhang, D., Zong, H., Wang, Y., Bergeron, R., Kim, J. K., Cushman, S. W., Cooney, G. J., Atcheson, B., White, M. F., Kraegen, E. W., and Shulman, G. I. (2002) Mechanism by which fatty acids inhibit insulin activation of insulin receptor substrate-1 (IRS-1)-associated phosphatidylinositol 3-kinase activity in muscle. J Biol Chem 277, 50230-50236

82. Boden, G., Chen, X., Ruiz, J., White, J. V., and Rossetti, L. (1994) Mechanisms of fatty acid-induced inhibition of glucose uptake. J Clin Invest 93, 2438-2446

83. Fanelli, C., Calderone, S., Epifano, L., De Vincenzo, A., Modarelli, F., Pampanelli, S., Perriello, G., De Feo, P., Brunetti, P., Gerich, J. E., and et al. (1993) Demonstration of a critical role for free fatty acids in mediating 191

counterregulatory stimulation of gluconeogenesis and suppression of glucose utilization in humans. J Clin Invest 92, 1617-1622

84. Ferrannini, E., Barrett, E. J., Bevilacqua, S., and DeFronzo, R. A. (1983) Effect of fatty acids on glucose production and utilization in man. J Clin Invest 72, 1737- 1747

85. Boden, G., Cheung, P., Stein, T. P., Kresge, K., and Mozzoli, M. (2002) FFA cause hepatic insulin resistance by inhibiting insulin suppression of glycogenolysis. Am J Physiol Endocrinol Metab 283, E12-19

86. Edgerton, D. S., Cardin, S., Emshwiller, M., Neal, D., Chandramouli, V., Schumann, W. C., Landau, B. R., Rossetti, L., and Cherrington, A. D. (2001) Small increases in insulin inhibit hepatic glucose production solely caused by an effect on glycogen metabolism. Diabetes 50, 1872-1882

87. Gastaldelli, A., Toschi, E., Pettiti, M., Frascerra, S., Quinones-Galvan, A., Sironi, A. M., Natali, A., and Ferrannini, E. (2001) Effect of physiological hyperinsulinemia on gluconeogenesis in nondiabetic subjects and in type 2 diabetic patients. Diabetes 50, 1807-1812

88. Shimabukuro, M., Zhou, Y. T., Levi, M., and Unger, R. H. (1998) Fatty acid- induced beta cell apoptosis: a link between obesity and diabetes. Proc Natl Acad Sci U S A 95, 2498-2502

89. Kloppel, G., Lohr, M., Habich, K., Oberholzer, M., and Heitz, P. U. (1985) Islet pathology and the pathogenesis of type 1 and type 2 diabetes mellitus revisited. Surv Synth Pathol Res 4, 110-125

90. Tyrberg, B., Ustinov, J., Otonkoski, T., and Andersson, A. (2001) Stimulated Endocrine Cell Proliferation and Differentiation in Transplanted Human Pancreatic Islets: Effects of the ob Gene and Compensatory Growth of the Implantation Organ. Diabetes 50, 301-307

91. Butler, A. E., Janson, J., Bonner-Weir, S., Ritzel, R., Rizza, R. A., and Butler, P. C. (2003) Beta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes 52, 102-110

92. Ledermann, H. M. (1995) Is maturity onset diabetes at young age (MODY) more common in Europe than previously assumed? Lancet 345, 648

93. Velho, G., and Froguel, P. (1998) Genetic, metabolic and clinical characteristics of maturity onset diabetes of the young. Eur J Endocrinol 138, 233-239

192

94. Yamagata, K., Furuta, H., Oda, N., Kaisaki, P. J., Menzel, S., Cox, N. J., Fajans, S. S., Signorini, S., Stoffel, M., and Bell, G. I. (1996) Mutations in the hepatocyte nuclear factor-4alpha gene in maturity-onset diabetes of the young (MODY1). Nature 384, 458-460

95. Yamagata, K., Oda, N., Kaisaki, P. J., Menzel, S., Furuta, H., Vaxillaire, M., Southam, L., Cox, R. D., Lathrop, G. M., Boriraj, V. V., Chen, X., Cox, N. J., Oda, Y., Yano, H., Le Beau, M. M., Yamada, S., Nishigori, H., Takeda, J., Fajans, S. S., Hattersley, A. T., Iwasaki, N., Hansen, T., Pedersen, O., Polonsky, K. S., Bell, G. I., and et al. (1996) Mutations in the hepatocyte nuclear factor-1alpha gene in maturity-onset diabetes of the young (MODY3). Nature 384, 455-458

96. Stoffers, D. A., Ferrer, J., Clarke, W. L., and Habener, J. F. (1997) Early-onset type-II diabetes mellitus (MODY4) linked to IPF1. Nat Genet 17, 138-139

97. Horikawa, Y., Iwasaki, N., Hara, M., Furuta, H., Hinokio, Y., Cockburn, B. N., Lindner, T., Yamagata, K., Ogata, M., Tomonaga, O., Kuroki, H., Kasahara, T., Iwamoto, Y., and Bell, G. I. (1997) Mutation in hepatocyte nuclear factor-1 beta gene (TCF2) associated with MODY. Nat Genet 17, 384-385

98. Malecki, M. T., Jhala, U. S., Antonellis, A., Fields, L., Doria, A., Orban, T., Saad, M., Warram, J. H., Montminy, M., and Krolewski, A. S. (1999) Mutations in NEUROD1 are associated with the development of type 2 diabetes mellitus. Nat Genet 23, 323-328

99. Froguel, P., Zouali, H., Vionnet, N., Velho, G., Vaxillaire, M., Sun, F., Lesage, S., Stoffel, M., Takeda, J., Passa, P., and et al. (1993) Familial hyperglycemia due to mutations in glucokinase. Definition of a subtype of diabetes mellitus. N Engl J Med 328, 697-702

100. Postic, C., Shiota, M., Niswender, K. D., Jetton, T. L., Chen, Y., Moates, J. M., Shelton, K. D., Lindner, J., Cherrington, A. D., and Magnuson, M. A. (1999) Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase. J Biol Chem 274, 305-315

101. Fajans, S. S., Bell, G. I., and Polonsky, K. S. (2001) Molecular mechanisms and clinical pathophysiology of maturity-onset diabetes of the young. N Engl J Med 345, 971-980

102. Byrne, M. M., Sturis, J., Clement, K., Vionnet, N., Pueyo, M. E., Stoffel, M., Takeda, J., Passa, P., Cohen, D., Bell, G. I., and et al. (1994) Insulin secretory abnormalities in subjects with hyperglycemia due to glucokinase mutations. J Clin Invest 93, 1120-1130 193

103. Velho, G., Froguel, P., Clement, K., Pueyo, M. E., Rakotoambinina, B., Zouali, H., Passa, P., Cohen, D., and Robert, J. J. (1992) Primary pancreatic beta-cell secretory defect caused by mutations in glucokinase gene in kindreds of maturity onset diabetes of the young. Lancet 340, 444-448

104. Pueyo, M. E., Clement, K., Vaxillaire, M., Passa, P., Froguel, P., Robert, J. J., and Velho, G. (1994) Arginine-induced insulin release in glucokinase-deficient subjects. Diabetes Care 17, 1015-1021

105. Velho, G., Petersen, K. F., Perseghin, G., Hwang, J. H., Rothman, D. L., Pueyo, M. E., Cline, G. W., Froguel, P., and Shulman, G. I. (1996) Impaired hepatic glycogen synthesis in glucokinase-deficient (MODY-2) subjects. J Clin Invest 98, 1755-1761

106. Mendel, D. B., Hansen, L. P., Graves, M. K., Conley, P. B., and Crabtree, G. R. (1991) HNF-1 alpha and HNF-1 beta (vHNF-1) share dimerization and homeo domains, but not activation domains, and form heterodimers in vitro. Genes Dev 5, 1042-1056

107. Chouard, T., Blumenfeld, M., Bach, I., Vandekerckhove, J., Cereghini, S., and Yaniv, M. (1990) A distal dimerization domain is essential for DNA-binding by the atypical HNF1 homeodomain. Nucleic Acids Res 18, 5853-5863

108. Lehto, M., Tuomi, T., Mahtani, M. M., Widen, E., Forsblom, C., Sarelin, L., Gullstrom, M., Isomaa, B., Lehtovirta, M., Hyrkko, A., Kanninen, T., Orho, M., Manley, S., Turner, R. C., Brettin, T., Kirby, A., Thomas, J., Duyk, G., Lander, E., Taskinen, M. R., and Groop, L. (1997) Characterization of the MODY3 phenotype. Early-onset diabetes caused by an insulin secretion defect. J Clin Invest 99, 582-591

109. Busch, C. P., and Hegele, R. A. (2001) Genetic determinants of type 2 diabetes mellitus. Clin Genet 60, 243-254

110. Bach, I., and Yaniv, M. (1993) More potent transcriptional activators or a transdominant inhibitor of the HNF1 homeoprotein family are generated by alternative RNA processing. Embo J 12, 4229-4242

111. Hegele, R. A., Cao, H., Hanley, A. J., Zinman, B., Harris, S. B., and Anderson, C. M. (2000) Clinical utility of HNF1A genotyping for diabetes in aboriginal Canadians. Diabetes Care 23, 775-778

194

112. Hegele, R. A., Cao, H., Harris, S. B., Hanley, A. J., and Zinman, B. (1999) The hepatic nuclear factor-1alpha G319S variant is associated with early-onset type 2 diabetes in Canadian Oji-Cree. J Clin Endocrinol Metab 84, 1077-1082

113. Duncan, S. A., Manova, K., Chen, W. S., Hoodless, P., Weinstein, D. C., Bachvarova, R. F., and Darnell, J. E., Jr. (1994) Expression of transcription factor HNF-4 in the extraembryonic endoderm, gut, and nephrogenic tissue of the developing mouse embryo: HNF-4 is a marker for primary endoderm in the implanting blastocyst. Proc Natl Acad Sci U S A 91, 7598-7602

114. Taraviras, S., Monaghan, A. P., Schutz, G., and Kelsey, G. (1994) Characterization of the mouse HNF-4 gene and its expression during mouse embryogenesis. Mech Dev 48, 67-79

115. Thomas, H., Jaschkowitz, K., Bulman, M., Frayling, T. M., Mitchell, S. M., Roosen, S., Lingott-Frieg, A., Tack, C. J., Ellard, S., Ryffel, G. U., and Hattersley, A. T. (2001) A distant upstream promoter of the HNF-4alpha gene connects the transcription factors involved in maturity-onset diabetes of the young. Hum Mol Genet 10, 2089-2097

116. Boj, S. F., Parrizas, M., Maestro, M. A., and Ferrer, J. (2001) A transcription factor regulatory circuit in differentiated pancreatic cells. Proc Natl Acad Sci U S A 98, 14481-14486

117. Stoffel, M., and Duncan, S. A. (1997) The maturity-onset diabetes of the young (MODY1) transcription factor HNF4alpha regulates expression of genes required for glucose transport and metabolism. Proc Natl Acad Sci U S A 94, 13209-13214

118. Odom, D. T., Zizlsperger, N., Gordon, D. B., Bell, G. W., Rinaldi, N. J., Murray, H. L., Volkert, T. L., Schreiber, J., Rolfe, P. A., Gifford, D. K., Fraenkel, E., Bell, G. I., and Young, R. A. (2004) Control of Pancreas and Liver Gene Expression by HNF Transcription Factors. Science 303, 1378-1381

119. Ohlsson, H., Karlsson, K., and Edlund, T. (1993) IPF1, a homeodomain- containing transactivator of the insulin gene. Embo J 12, 4251-4259

120. Macfarlane, W. M., Smith, S. B., James, R. F., Clifton, A. D., Doza, Y. N., Cohen, P., and Docherty, K. (1997) The p38/reactivating kinase mitogen- activated protein kinase cascade mediates the activation of the transcription factor insulin upstream factor 1 and insulin gene transcription by high glucose in pancreatic beta-cells. J Biol Chem 272, 20936-20944

195

121. Waeber, G., Thompson, N., Nicod, P., and Bonny, C. (1996) Transcriptional activation of the GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor. Mol Endocrinol 10, 1327-1334

122. Watada, H., Kajimoto, Y., Miyagawa, J., Hanafusa, T., Hamaguchi, K., Matsuoka, T., Yamamoto, K., Matsuzawa, Y., Kawamori, R., and Yamasaki, Y. (1996) PDX-1 induces insulin and glucokinase gene expressions in alphaTC1 clone 6 cells in the presence of betacellulin. Diabetes 45, 1826-1831

123. Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H. (1994) Insulin-promoter- factor 1 is required for pancreas development in mice. Nature 371, 606-609

124. Naya, F. J., Stellrecht, C. M., and Tsai, M. J. (1995) Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dev 9, 1009-1019

125. Naya, F. J., Huang, H. P., Qiu, Y., Mutoh, H., DeMayo, F. J., Leiter, A. B., and Tsai, M. J. (1997) Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice. Genes Dev 11, 2323-2334

126. Lazzaro, D., De Simone, V., De Magistris, L., Lehtonen, E., and Cortese, R. (1992) LFB1 and LFB3 homeoproteins are sequentially expressed during kidney development. Development 114, 469-479

127. Cereghini, S., Ott, M. O., Power, S., and Maury, M. (1992) Expression patterns of vHNF1 and HNF1 homeoproteins in early postimplantation embryos suggest distinct and sequential developmental roles. Development 116, 783-797

128. Bingham, C., Bulman, M. P., Ellard, S., Allen, L. I., Lipkin, G. W., Hoff, W. G., Woolf, A. S., Rizzoni, G., Novelli, G., Nicholls, A. J., and Hattersley, A. T. (2001) Mutations in the hepatocyte nuclear factor-1beta gene are associated with familial hypoplastic glomerulocystic kidney disease. Am J Hum Genet 68, 219- 224

129. Pearson, E. R., Badman, M. K., Lockwood, C. R., Clark, P. M., Ellard, S., Bingham, C., and Hattersley, A. T. (2004) Contrasting diabetes phenotypes associated with hepatocyte nuclear factor-1alpha and -1beta mutations. Diabetes Care 27, 1102-1107

130. Saltiel, A. R., and Kahn, C. R. (2001) Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414, 799-806

196

131. Patti, M. E., and Kahn, C. R. (1998) The insulin receptor--a critical link in glucose homeostasis and insulin action. J Basic Clin Physiol Pharmacol 9, 89-109

132. White, M. F. (1998) The IRS-signalling system: a network of docking proteins that mediate insulin action. Mol Cell Biochem 182, 3-11

133. Pessin, J. E., and Saltiel, A. R. (2000) Signaling pathways in insulin action: molecular targets of insulin resistance. J Clin Invest 106, 165-169

134. Shepherd, P. R., Nave, B. T., and Siddle, K. (1995) Insulin stimulation of glycogen synthesis and glycogen synthase activity is blocked by wortmannin and rapamycin in 3T3-L1 adipocytes: evidence for the involvement of phosphoinositide 3-kinase and p70 ribosomal protein-S6 kinase. Biochem J 305 ( Pt 1), 25-28

135. Alessi, D. R., James, S. R., Downes, C. P., Holmes, A. B., Gaffney, P. R., Reese, C. B., and Cohen, P. (1997) Characterization of a 3-phosphoinositide-dependent protein kinase which phosphorylates and activates protein kinase Balpha. Curr Biol 7, 261-269

136. Standaert, M. L., Galloway, L., Karnam, P., Bandyopadhyay, G., Moscat, J., and Farese, R. V. (1997) Protein kinase C-zeta as a downstream effector of phosphatidylinositol 3-kinase during insulin stimulation in rat adipocytes. Potential role in glucose transport. J Biol Chem 272, 30075-30082

137. Wada, T., Sasaoka, T., Ishiki, M., Hori, H., Haruta, T., Ishihara, H., and Kobayashi, M. (1999) Role of the Src homology 2 (SH2) domain and C-terminus tyrosine phosphorylation sites of SH2-containing inositol phosphatase (SHIP) in the regulation of insulin-induced mitogenesis. Endocrinology 140, 4585-4594

138. Ribon, V., Herrera, R., Kay, B. K., and Saltiel, A. R. (1998) A role for CAP, a novel, multifunctional Src homology 3 domain-containing protein in formation of actin stress fibers and focal adhesions. J Biol Chem 273, 4073-4080

139. Ribon, V., Johnson, J. H., Camp, H. S., and Saltiel, A. R. (1998) Thiazolidinediones and insulin resistance: peroxisome proliferatoractivated receptor gamma activation stimulates expression of the CAP gene. Proc Natl Acad Sci U S A 95, 14751-14756

140. Ribon, V., and Saltiel, A. R. (1997) Insulin stimulates tyrosine phosphorylation of the proto-oncogene product of c-Cbl in 3T3-L1 adipocytes. Biochem J 324 ( Pt 3), 839-845

197

141. Skolnik, E. Y., Batzer, A., Li, N., Lee, C. H., Lowenstein, E., Mohammadi, M., Margolis, B., and Schlessinger, J. (1993) The function of GRB2 in linking the insulin receptor to Ras signaling pathways. Science 260, 1953-1955

142. Abel, E. D., Peroni, O., Kim, J. K., Kim, Y. B., Boss, O., Hadro, E., Minnemann, T., Shulman, G. I., and Kahn, B. B. (2001) Adipose-selective targeting of the GLUT4 gene impairs insulin action in muscle and liver. Nature 409, 729-733

143. Goodge, K. A., and Hutton, J. C. (2000) Translational regulation of proinsulin biosynthesis and proinsulin conversion in the pancreatic beta-cell. Semin Cell Dev Biol 11, 235-242

144. Sakura, H., Iwamoto, Y., Sakamoto, Y., Kuzuya, T., and Hirata, H. (1986) Structurally abnormal insulin in a diabetic patient. Characterization of the mutant insulin A3 (Val----Leu) isolated from the pancreas. J Clin Invest 78, 1666-1672

145. Haneda, M., Chan, S. J., Kwok, S. C., Rubenstein, A. H., and Steiner, D. F. (1983) Studies on mutant human insulin genes: identification and sequence analysis of a gene encoding [SerB24]insulin. Proc Natl Acad Sci U S A 80, 6366- 6370

146. Nanjo, K., Sanke, T., Miyano, M., Okai, K., Sowa, R., Kondo, M., Nishimura, S., Iwo, K., Miyamura, K., Given, B. D., and et al. (1986) Diabetes due to secretion of a structurally abnormal insulin (insulin Wakayama). Clinical and functional characteristics of [LeuA3] insulin. J Clin Invest 77, 514-519

147. Caro, J. F., Raju, S. M., Sinha, M. K., Goldfine, I. D., and Dohm, G. L. (1988) Heterogeneity of human liver, muscle, and adipose tissue insulin receptor. Biochem Biophys Res Commun 151, 123-129

148. Leibiger, B., Leibiger, I. B., Moede, T., Kemper, S., Kulkarni, R. N., Kahn, C. R., de Vargas, L. M., and Berggren, P. O. (2001) Selective insulin signaling through A and B insulin receptors regulates transcription of insulin and glucokinase genes in pancreatic beta cells. Mol Cell 7, 559-570

149. Accili, D., Drago, J., Lee, E. J., Johnson, M. D., Cool, M. H., Salvatore, P., Asico, L. D., Jose, P. A., Taylor, S. I., and Westphal, H. (1996) Early neonatal death in mice homozygous for a null allele of the insulin receptor gene. Nat Genet 12, 106- 109

150. Bruning, J. C., Michael, M. D., Winnay, J. N., Hayashi, T., Horsch, D., Accili, D., Goodyear, L. J., and Kahn, C. R. (1998) A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell 2, 559-569 198

151. Kim, J. K., Michael, M. D., Previs, S. F., Peroni, O. D., Mauvais-Jarvis, F., Neschen, S., Kahn, B. B., Kahn, C. R., and Shulman, G. I. (2000) Redistribution of substrates to adipose tissue promotes obesity in mice with selective insulin resistance in muscle. J Clin Invest 105, 1791-1797

152. Kulkarni, R. N., Bruning, J. C., Winnay, J. N., Postic, C., Magnuson, M. A., and Kahn, C. R. (1999) Tissue-specific knockout of the insulin receptor in pancreatic beta cells creates an insulin secretory defect similar to that in type 2 diabetes. Cell 96, 329-339

153. Michael, M. D., Kulkarni, R. N., Postic, C., Previs, S. F., Shulman, G. I., Magnuson, M. A., and Kahn, C. R. (2000) Loss of insulin signaling in hepatocytes leads to severe insulin resistance and progressive hepatic dysfunction. Mol Cell 6, 87-97

154. Bruning, J. C., Gautam, D., Burks, D. J., Gillette, J., Schubert, M., Orban, P. C., Klein, R., Krone, W., Muller-Wieland, D., and Kahn, C. R. (2000) Role of brain insulin receptor in control of body weight and reproduction. Science 289, 2122- 2125

155. Bruning, J. C., Winnay, J., Cheatham, B., and Kahn, C. R. (1997) Differential signaling by insulin receptor substrate 1 (IRS-1) and IRS-2 in IRS-1-deficient cells. Mol Cell Biol 17, 1513-1521

156. He, W., Craparo, A., Zhu, Y., O'Neill, T. J., Wang, L. M., Pierce, J. H., and Gustafson, T. A. (1996) Interaction of insulin receptor substrate-2 (IRS-2) with the insulin and insulin-like growth factor I receptors. Evidence for two distinct phosphotyrosine-dependent interaction domains within IRS-2. J Biol Chem 271, 11641-11645

157. Ross, S. A., Lienhard, G. E., and Lavan, B. E. (1998) Association of insulin receptor substrate 3 with SH2 domain-containing proteins in rat adipocytes. Biochem Biophys Res Commun 247, 487-492

158. Sawka-Verhelle, D., Baron, V., Mothe, I., Filloux, C., White, M. F., and Van Obberghen, E. (1997) Tyr624 and Tyr628 in insulin receptor substrate-2 mediate its association with the insulin receptor. J Biol Chem 272, 16414-16420

159. Araki, E., Lipes, M. A., Patti, M. E., Bruning, J. C., Haag, B., 3rd, Johnson, R. S., and Kahn, C. R. (1994) Alternative pathway of insulin signalling in mice with targeted disruption of the IRS-1 gene. Nature 372, 186-190

199

160. Tamemoto, H., Kadowaki, T., Tobe, K., Yagi, T., Sakura, H., Hayakawa, T., Terauchi, Y., Ueki, K., Kaburagi, Y., Satoh, S., and et al. (1994) Insulin resistance and growth retardation in mice lacking insulin receptor substrate-1. Nature 372, 182-186

161. Withers, D. J., Gutierrez, J. S., Towery, H., Burks, D. J., Ren, J. M., Previs, S., Zhang, Y., Bernal, D., Pons, S., Shulman, G. I., Bonner-Weir, S., and White, M. F. (1998) Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391, 900- 904

162. Liu, S. C., Wang, Q., Lienhard, G. E., and Keller, S. R. (1999) Insulin receptor substrate 3 is not essential for growth or glucose homeostasis. J Biol Chem 274, 18093-18099

163. Fantin, V. R., Wang, Q., Lienhard, G. E., and Keller, S. R. (2000) Mice lacking insulin receptor substrate 4 exhibit mild defects in growth, reproduction, and glucose homeostasis. Am J Physiol Endocrinol Metab 278, E127-133

164. Kido, Y., Burks, D. J., Withers, D., Bruning, J. C., Kahn, C. R., White, M. F., and Accili, D. (2000) Tissue-specific insulin resistance in mice with mutations in the insulin receptor, IRS-1, and IRS-2. J Clin Invest 105, 199-205

165. Elchebly, M., Payette, P., Michaliszyn, E., Cromlish, W., Collins, S., Loy, A. L., Normandin, D., Cheng, A., Himms-Hagen, J., Chan, C. C., Ramachandran, C., Gresser, M. J., Tremblay, M. L., and Kennedy, B. P. (1999) Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 283, 1544-1548

166. Terauchi, Y., Tsuji, Y., Satoh, S., Minoura, H., Murakami, K., Okuno, A., Inukai, K., Asano, T., Kaburagi, Y., Ueki, K., Nakajima, H., Hanafusa, T., Matsuzawa, Y., Sekihara, H., Yin, Y., Barrett, J. C., Oda, H., Ishikawa, T., Akanuma, Y., Komuro, I., Suzuki, M., Yamamura, K., Kodama, T., Suzuki, H., Kadowaki, T., and et al. (1999) Increased insulin sensitivity and hypoglycaemia in mice lacking the p85 alpha subunit of phosphoinositide 3-kinase. Nat Genet 21, 230-235

167. Fruman, D. A., Mauvais-Jarvis, F., Pollard, D. A., Yballe, C. M., Brazil, D., Bronson, R. T., Kahn, C. R., and Cantley, L. C. (2000) Hypoglycaemia, liver necrosis and perinatal death in mice lacking all isoforms of phosphoinositide 3- kinase p85 alpha. Nat Genet 26, 379-382

168. Cho, H., Mu, J., Kim, J. K., Thorvaldsen, J. L., Chu, Q., Crenshaw, E. B., 3rd, Kaestner, K. H., Bartolomei, M. S., Shulman, G. I., and Birnbaum, M. J. (2001) Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science 292, 1728-1731 200

169. Clement, S., Krause, U., Desmedt, F., Tanti, J. F., Behrends, J., Pesesse, X., Sasaki, T., Penninger, J., Doherty, M., Malaisse, W., Dumont, J. E., Le Marchand-Brustel, Y., Erneux, C., Hue, L., and Schurmans, S. (2001) The lipid phosphatase SHIP2 controls insulin sensitivity. Nature 409, 92-97

170. Katz, E. B., Stenbit, A. E., Hatton, K., DePinho, R., and Charron, M. J. (1995) Cardiac and adipose tissue abnormalities but not diabetes in mice deficient in GLUT4. Nature 377, 151-155

171. Zisman, A., Peroni, O. D., Abel, E. D., Michael, M. D., Mauvais-Jarvis, F., Lowell, B. B., Wojtaszewski, J. F., Hirshman, M. F., Virkamaki, A., Goodyear, L. J., Kahn, C. R., and Kahn, B. B. (2000) Targeted disruption of the glucose transporter 4 selectively in muscle causes insulin resistance and glucose intolerance. Nat Med 6, 924-928

172. Hanis, C. L., Boerwinkle, E., Chakraborty, R., Ellsworth, D. L., Concannon, P., Stirling, B., Morrison, V. A., Wapelhorst, B., Spielman, R. S., Gogolin-Ewens, K. J., Shepard, J. M., Williams, S. R., Risch, N., Hinds, D., Iwasaki, N., Ogata, M., Omori, Y., Petzold, C., Rietzch, H., Schroder, H. E., Schulze, J., Cox, N. J., Menzel, S., Boriraj, V. V., Chen, X., and et al. (1996) A genome-wide search for human non-insulin-dependent (type 2) diabetes genes reveals a major susceptibility locus on chromosome 2. Nat Genet 13, 161-166

173. Horikawa, Y., Oda, N., Cox, N. J., Li, X., Orho-Melander, M., Hara, M., Hinokio, Y., Lindner, T. H., Mashima, H., Schwarz, P. E., del Bosque-Plata, L., Oda, Y., Yoshiuchi, I., Colilla, S., Polonsky, K. S., Wei, S., Concannon, P., Iwasaki, N., Schulze, J., Baier, L. J., Bogardus, C., Groop, L., Boerwinkle, E., Hanis, C. L., and Bell, G. I. (2000) Genetic variation in the gene encoding calpain-10 is associated with type 2 diabetes mellitus. Nat Genet 26, 163-175

174. Marshall, C., Hitman, G. A., Partridge, C. J., Clark, A., Ma, H., Shearer, T. R., and Turner, M. D. (2004) Evidence that an Isoform of Calpain-10 is a Regulator of Exocytosis in Pancreatic {beta}-Cells. Mol Endocrinol, me.2004-0064

175. Shearer, B. G., and Hoekstra, W. J. (2003) Recent advances in peroxisome proliferator-activated receptor science. Curr Med Chem 10, 267-280

176. Auboeuf, D., Rieusset, J., Fajas, L., Vallier, P., Frering, V., Riou, J., Staels, B., Auwerx, J., Laville, M., and Vidal, H. (1997) Tissue distribution and quantification of the expression of mRNAs of peroxisome proliferator-activated receptors and liver X receptor-alpha in humans: no alteration in adipose tissue of obese and NIDDM patients. Diabetes 46, 1319-1327

201

177. Cavaghan, M. K., Ehrmann, D. A., Byrne, M. M., and Polonsky, K. S. (1997) Treatment with the Oral Antidiabetic Agent Troglitazone Improves beta Cell Responses to Glucose in Subjects with Impaired Glucose Tolerance. J. Clin. Invest. 100, 530-537

178. Sreenan, S., Sturis, J., Pugh, W., Burant, C. F., and Polonsky, K. S. (1996) Prevention of hyperglycemia in the Zucker diabetic fatty rat by treatment with metformin or troglitazone. Am J Physiol Endocrinol Metab 271, E742-747

179. Kersten, S. (2002) Peroxisome proliferator activated receptors and obesity. Eur J Pharmacol 440, 223-234

180. Barroso, I., Gurnell, M., Crowley, V. E., Agostini, M., Schwabe, J. W., Soos, M. A., Maslen, G. L., Williams, T. D., Lewis, H., Schafer, A. J., Chatterjee, V. K., and O'Rahilly, S. (1999) Dominant negative mutations in human PPARgamma associated with severe insulin resistance, diabetes mellitus and hypertension. Nature 402, 880-883

181. Miles, P. D., Barak, Y., He, W., Evans, R. M., and Olefsky, J. M. (2000) Improved insulin-sensitivity in mice heterozygous for PPAR-gamma deficiency. J Clin Invest 105, 287-292

182. Kubota, N., Terauchi, Y., Miki, H., Tamemoto, H., Yamauchi, T., Komeda, K., Satoh, S., Nakano, R., Ishii, C., Sugiyama, T., Eto, K., Tsubamoto, Y., Okuno, A., Murakami, K., Sekihara, H., Hasegawa, G., Naito, M., Toyoshima, Y., Tanaka, S., Shiota, K., Kitamura, T., Fujita, T., Ezaki, O., Aizawa, S., Kadowaki, T., and et al. (1999) PPAR gamma mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol Cell 4, 597-609

183. Kim, H.-i., and Ahn, Y.-h. (2004) Role of Peroxisome Proliferator-Activated Receptor-{gamma} in the Glucose-Sensing Apparatus of Liver and {beta}-Cells. Diabetes 53, S60-65

184. Hayden, M. R., and Tyagi, S. C. (2001) "A" is for amylin and amyloid in type 2 diabetes mellitus. Jop 2, 124-139

185. Kong, M. F., King, P., Macdonald, I. A., Stubbs, T. A., Perkins, A. C., Blackshaw, P. E., Moyses, C., and Tattersall, R. B. (1997) Infusion of pramlintide, a human amylin analogue, delays gastric emptying in men with IDDM. Diabetologia 40, 82-88

186. Kolterman, O., Gottlieb, A., Moyses, C., and Colburn, W. (1995) Reduction of postprandial hyperglycemia in subjects with IDDM by intravenous infusion of AC137, a human amylin analogue. Diabetes Care 18, 1179-1182 202

187. Thompson, R., Peterson, J., Gottlieb, A., and Mullane, J. (1997) Effects of pramlintide, an analog of human amylin, on plasma glucose profiles in patients with IDDM: results of a multicenter trial. Diabetes 46, 632-636

188. Gebre-Medhin, S., Mulder, H., Pekny, M., Westermark, G., Tornell, J., Westermark, P., Sundler, F., Ahren, B., and Betsholtz, C. (1998) Increased insulin secretion and glucose tolerance in mice lacking islet amyloid polypeptide (amylin). Biochem Biophys Res Commun 250, 271-277

189. Westermark, P. (1972) Quantitative studies on amyloid in the islets of Langerhans. Ups J Med Sci 77, 91-94

190. Clark, A., Wells, C. A., Buley, I. D., Cruickshank, J. K., Vanhegan, R. I., Matthews, D. R., Cooper, G. J., Holman, R. R., and Turner, R. C. (1988) Islet amyloid, increased A-cells, reduced B-cells and exocrine fibrosis: quantitative changes in the pancreas in type 2 diabetes. Diabetes Res 9, 151-159

191. Cooper, G. J. S., Willis, A. C., Clark, A., Turner, R. C., Sim, R. B., and Reid, K. B. M. (1987) Purification and Characterization of a Peptide from Amyloid-Rich Pancreases of Type 2 Diabetic Patients. PNAS 84, 8628-8632

192. Westermark, P., Wilander, E., Westermark, G. T., and Johnson, K. H. (1987) Islet amyloid polypeptide-like immunoreactivity in the islet B cells of type 2 (non- insulin-dependent) diabetic and non-diabetic individuals. Diabetologia 30, 887- 892

193. Johnson, K., O'Brien, T., Hayden, D., Jordan, K., Ghobrial, H., Mahoney, W., and Westermark, P. (1988) Immunolocalization of islet amyloid polypeptide (IAPP) in pancreatic beta cells by means of peroxidase-antiperoxidase (PAP) and protein A- gold techniques. Am J Pathol 130, 1-8

194. Lukinius, A., Wilander, E., Westermark, G. T., Engstrom, U., and Westermark, P. (1989) Co-localization of islet amyloid polypeptide and insulin in the B cell secretory granules of the human pancreatic islets. Diabetologia 32, 240-244

195. Clark, A., Edwards, C. A., Ostle, L. R., Sutton, R., Rothbard, J. B., Morris, J. F., and Turner, R. C. (1989) Localisation of islet amyloid peptide in lipofuscin bodies and secretory granules of human B-cells and in islets of type-2 diabetic subjects. Cell Tissue Res 257, 179-185

196. Westermark, P., Engstrom, U., Johnson, K. H., Westermark, G. T., and Betsholtz, C. (1990) Islet amyloid polypeptide: pinpointing amino acid residues linked to amyloid fibril formation. Proc Natl Acad Sci U S A 87, 5036-5040 203

197. Mirzabekov, T. A., Lin, M.-c., and Kagan, B. L. (1996) Pore Formation by the Cytotoxic Islet Amyloid Peptide Amylin. J. Biol. Chem. 271, 1988-1992

198. Bai, J. Z., Saafi, E. L., Zhang, S., and Cooper, G. J. (1999) Role of Ca2+ in apoptosis evoked by human amylin in pancreatic islet beta-cells. Biochem J 343 Pt 1, 53-61

199. Janson, J., Ashley, R. H., Harrison, D., McIntyre, S., and Butler, P. C. (1999) The mechanism of islet amyloid polypeptide toxicity is membrane disruption by intermediate-sized toxic amyloid particles. Diabetes 48, 491-498

200. Anguiano, M., Nowak, R. J., and Lansbury, P. T., Jr. (2002) Protofibrillar islet amyloid polypeptide permeabilizes synthetic vesicles by a pore-like mechanism that may be relevant to type II diabetes. Biochemistry 41, 11338-11343

201. Harroun, T. A., Bradshaw, J. P., and Ashley, R. H. (2001) Inhibitors can arrest the membrane activity of human islet amyloid polypeptide independently of amyloid formation. FEBS Lett 507, 200-204

202. Hull, R. L., Westermark, G. T., Westermark, P., and Kahn, S. E. (2004) Islet amyloid: a critical entity in the pathogenesis of type 2 diabetes. J Clin Endocrinol Metab 89, 3629-3643

203. Chan, C. B., MacDonald, P. E., Saleh, M. C., Johns, D. C., Marban, E., and Wheeler, M. B. (1999) Overexpression of uncoupling protein 2 inhibits glucose- stimulated insulin secretion from rat islets. Diabetes 48, 1482-1486

204. Wang, M. Y., Shimabukuro, M., Lee, Y., Trinh, K. Y., Chen, J. L., Newgard, C. B., and Unger, R. H. (1999) Adenovirus-mediated overexpression of uncoupling protein-2 in pancreatic islets of Zucker diabetic rats increases oxidative activity and improves beta-cell function. Diabetes 48, 1020-1025

205. Unger, R. H. (1995) Lipotoxicity in the pathogenesis of obesity-dependent NIDDM. Genetic and clinical implications. Diabetes 44, 863-870

206. Zhang, C. Y., Baffy, G., Perret, P., Krauss, S., Peroni, O., Grujic, D., Hagen, T., Vidal-Puig, A. J., Boss, O., Kim, Y. B., Zheng, X. X., Wheeler, M. B., Shulman, G. I., Chan, C. B., and Lowell, B. B. (2001) Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell 105, 745-755

207. Chan, C. B., Saleh, M. C., Koshkin, V., and Wheeler, M. B. (2004) Uncoupling Protein 2 and Islet Function. Diabetes 53, S136-142 204

208. Shimabukuro, M., Zhou, Y.-T., Lee, Y., and Unger, R. H. (1998) Troglitazone Lowers Islet Fat and Restores Beta Cell Function of Zucker Diabetic Fatty Rats. J. Biol. Chem. 273, 3547-3550

209. Medvedev, A. V., Robidoux, J., Bai, X., Cao, W., Floering, L. M., Daniel, K. W., and Collins, S. (2002) Regulation of the Uncoupling Protein-2 Gene in INS-1 beta -Cells by Oleic Acid. J. Biol. Chem. 277, 42639-42644

210. Ludvik, B., Nolan, J., Baloga, J., Sacks, D., and Olefsky, J. (1995) Effect of obesity on insulin resistance in normal subjects and patients with NIDDM. Diabetes 44, 1121-1125

211. Polonsky, K. S. (2000) Dynamics of insulin secretion in obesity and diabetes. Int J Obes Relat Metab Disord 24 Suppl 2, S29-31

212. Bonner-Weir, S. (2000) Islet growth and development in the adult. J Mol Endocrinol 24, 297-302

213. Finegood, D. T., Scaglia, L., and Bonner-Weir, S. (1995) Dynamics of beta-cell mass in the growing rat pancreas. Estimation with a simple mathematical model. Diabetes 44, 249-256

214. Bonner-Weir, S., Baxter, L. A., Schuppin, G. T., and Smith, F. E. (1993) A second pathway for regeneration of adult exocrine and endocrine pancreas. A possible recapitulation of embryonic development. Diabetes 42, 1715-1720

215. Ramiya, V. K., Maraist, M., Arfors, K. E., Schatz, D. A., Peck, A. B., and Cornelius, J. G. (2000) Reversal of insulin-dependent diabetes using islets generated in vitro from pancreatic stem cells. Nat Med 6, 278-282

216. Cerasi, E., and Luft, R. (1967) "What is inherited--what is added" hypothesis for the pathogenesis of diabetes mellitus. Diabetes 16, 615-627

217. Bergman, R. N., Phillips, L. S., and Cobelli, C. (1981) Physiologic evaluation of factors controlling glucose tolerance in man: measurement of insulin sensitivity and beta-cell glucose sensitivity from the response to intravenous glucose. J Clin Invest 68, 1456-1467

218. Kahn, S. E., Prigeon, R. L., McCulloch, D. K., Boyko, E. J., Bergman, R. N., Schwartz, M. W., Neifing, J. L., Ward, W. K., Beard, J. C., Palmer, J. P., and et al. (1993) Quantification of the relationship between insulin sensitivity and beta- cell function in human subjects. Evidence for a hyperbolic function. Diabetes 42, 1663-1672 205

219. Mako, M. E., Starr, J. I., and Rubenstein, A. H. (1977) Circulating proinsulin in patients with maturity onset diabetes. Am J Med 63, 865-869

220. Grill, V., Dinesen, B., Carlsson, S., Efendic, S., Pedersen, O., and Ostenson, C. G. (2002) Hyperproinsulinemia and proinsulin-to-insulin ratios in Swedish middle- aged men: association with glycemia and insulin resistance but not with family history of diabetes. Am J Epidemiol 155, 834-841

221. Bonner-Weir, S., Deery, D., Leahy, J. L., and Weir, G. C. (1989) Compensatory growth of pancreatic beta-cells in adult rats after short-term glucose infusion. Diabetes 38, 49-53

222. Weir, G. C., Laybutt, D. R., Kaneto, H., Bonner-Weir, S., and Sharma, A. (2001) Beta-cell adaptation and decompensation during the progression of diabetes. Diabetes 50 Suppl 1, S154-159

223. Bonner-Weir, S., Trent, D. F., and Weir, G. C. (1983) Partial pancreatectomy in the rat and subsequent defect in glucose-induced insulin release. J Clin Invest 71, 1544-1553

224. Jonas, J. C., Sharma, A., Hasenkamp, W., Ilkova, H., Patane, G., Laybutt, R., Bonner-Weir, S., and Weir, G. C. (1999) Chronic hyperglycemia triggers loss of pancreatic beta cell differentiation in an animal model of diabetes. J Biol Chem 274, 14112-14121

225. Pontoglio, M., Sreenan, S., Roe, M., Pugh, W., Ostrega, D., Doyen, A., Pick, A. J., Baldwin, A., Velho, G., Froguel, P., Levisetti, M., Bonner-Weir, S., Bell, G. I., Yaniv, M., and Polonsky, K. S. (1998) Defective Insulin Secretion in Hepatocyte Nuclear Factor 1alpha - deficient Mice. J. Clin. Invest. 101, 2215-2222

226. Lee, Y.-H., Sauer, B., and Gonzalez, F. J. (1998) Laron Dwarfism and Non- Insulin-Dependent Diabetes Mellitus in the Hnf-1alpha Knockout Mouse. Mol. Cell. Biol. 18, 3059-3068

227. Kaestner, K. H. (2000) The hepatocyte nuclear factor 3 (HNF3 or FOXA) family in metabolism. Trends Endocrinol Metab 11, 281-285

228. Harrison, K. A., Thaler, J., Pfaff, S. L., Gu, H., and Kehrl, J. H. (1999) Pancreas dorsal lobe agenesis and abnormal islets of Langerhans in Hlxb9-deficient mice. Nat Genet 23, 71-75

229. Li, H., Arber, S., Jessell, T. M., and Edlund, H. (1999) Selective agenesis of the dorsal pancreas in mice lacking homeobox gene Hlxb9. Nat Genet 23, 67-70 206

230. Sander, M., Sussel, L., Conners, J., Scheel, D., Kalamaras, J., Dela Cruz, F., Schwitzgebel, V., Hayes-Jordan, A., and German, M. (2000) Homeobox gene Nkx6.1 lies downstream of Nkx2.2 in the major pathway of beta-cell formation in the pancreas. Development 127, 5533-5540

231. Sussel, L., Kalamaras, J., Hartigan-O'Connor, D., Meneses, J., Pedersen, R., Rubenstein, J., and German, M. (1998) Mice lacking the homeodomain transcription factor Nkx2.2 have diabetes due to arrested differentiation of pancreatic beta cells. Development 125, 2213-2221

232. Ahlgren, U., Pfaff, S. L., Jessell, T. M., Edlund, T., and Edlund, H. (1997) Independent requirement for ISL1 in formation of pancreatic mesenchyme and islet cells. Nature 385, 257-260

233. Chu, K., Nemoz-Gaillard, E., and Tsai, M.-J. (2001) BETA2 and Pancreatic Islet Development. Recent Prog Horm Res 56, 23-46

234. Huang, H.-p., Chu, K., Nemoz-Gaillard, E., Elberg, D., and Tsai, M.-J. (2002) Neogenesis of {beta}-Cells in Adult BETA2/NeuroD-Deficient Mice. Mol Endocrinol 16, 541-551

235. Gradwohl, G., Dierich, A., LeMeur, M., and Guillemot, F. (2000) neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas. Proc Natl Acad Sci U S A 97, 1607-1611

236. Gu, G., Brown, J. R., and Melton, D. A. (2003) Direct lineage tracing reveals the ontogeny of pancreatic cell fates during mouse embryogenesis. Mech Dev 120, 35-43

237. Schwitzgebel, V., Scheel, D., Conners, J., Kalamaras, J., Lee, J., Anderson, D., Sussel, L., Johnson, J., and German, M. (2000) Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development 127, 3533-3542

238. Sosa-Pineda, B., Chowdhury, K., Torres, M., Oliver, G., and Gruss, P. (1997) The Pax4 gene is essential for differentiation of insulin-producing beta cells in the mammalian pancreas. Nature 386, 399-402

239. St-Onge, L., Sosa-Pineda, B., Chowdhury, K., Mansouri, A., and Gruss, P. (1997) Pax6 is required for differentiation of glucagon-producing alpha-cells in mouse pancreas. Nature 387, 406-409

207

240. Sander, M., Neubuser, A., Kalamaras, J., Ee, H., Martin, G., and German, M. (1997) Genetic analysis reveals that PAX6 is required for normal transcription of pancreatic hormone genes and islet development. Genes Dev. 11, 1662-1673

241. Servitja, J. M., and Ferrer, J. (2004) Transcriptional networks controlling pancreatic development and beta cell function. Diabetologia 47, 597-613

242. Kojima, H., Fujimiya, M., Matsumura, K., Younan, P., Imaeda, H., Maeda, M., and Chan, L. (2003) NeuroD-betacellulin gene therapy induces islet neogenesis in the liver and reverses diabetes in mice. Nat Med 9, 596-603

243. Guz, Y., Montminy, M., Stein, R., Leonard, J., Gamer, L., Wright, C., and Teitelman, G. (1995) Expression of murine STF-1, a putative insulin gene transcription factor, in beta cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121, 11-18

244. Slack, J. (1995) Developmental biology of the pancreas. Development 121, 1569- 1580

245. Ahlgren, U., Jonsson, J., and Edlund, H. (1996) The morphogenesis of the pancreatic mesenchyme is uncoupled from that of the pancreatic epithelium in IPF1/PDX1-deficient mice. Development 122, 1409-1416

246. Offield, M. F., Jetton, T. L., Labosky, P. A., Ray, M., Stein, R. W., Magnuson, M. A., Hogan, B. L., and Wright, C. V. (1996) PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122, 983-995

247. Watada, H., Kajimoto, Y., Umayahara, Y., Matsuoka, T., Kaneto, H., Fujitani, Y., Kamada, T., Kawamori, R., and Yamasaki, Y. (1996) The human glucokinase gene beta-cell-type promoter: an essential role of insulin promoter factor 1/PDX-1 in its activation in HIT-T15 cells. Diabetes 45, 1478-1488

248. Ahlgren, U., Jonsson, J., Jonsson, L., Simu, K., and Edlund, H. (1998) beta -Cell- specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the beta -cell phenotype and maturity onset diabetes. Genes Dev. 12, 1763-1768

249. Brissova, M., Shiota, M., Nicholson, W. E., Gannon, M., Knobel, S. M., Piston, D. W., Wright, C. V. E., and Powers, A. C. (2002) Reduction in Pancreatic Transcription Factor PDX-1 Impairs Glucose-stimulated Insulin Secretion. J. Biol. Chem. 277, 11225-11232

250. Johnson, J. D., Ahmed, N. T., Luciani, D. S., Han, Z., Tran, H., Fujita, J., Misler, S., Edlund, H., and Polonsky, K. S. (2003) Increased islet apoptosis in Pdx1+/- mice. J. Clin. Invest. 111, 1147-1160 208

251. McKinnon, C. M., and Docherty, K. (2001) Pancreatic duodenal homeobox-1, PDX-1, a major regulator of beta cell identity and function. Diabetologia 44, 1203-1214

252. Melloul, D., Marshak, S., and Cerasi, E. (2002) Regulation of insulin gene transcription. Diabetologia 45, 309-326

253. Melloul, D., Ben-Neriah, Y., and Cerasi, E. (1993) Glucose Modulates the Binding of an Islet-Specific Factor to a Conserved Sequence Within the Rat I and the Human Insulin Promoters. PNAS 90, 3865-3869

254. Leibowitz, G., Ferber, S., Apelqvist, A., Edlund, H., Gross, D. J., Cerasi, E., Melloul, D., and Kaiser, N. (2001) IPF1/PDX1 deficiency and beta-cell dysfunction in Psammomys obesus, an animal With type 2 diabetes. Diabetes 50, 1799-1806

255. Leibowitz, G., Melloul, D., Yuli, M., Gross, D. J., Apelqvist, A., Edlund, H., Cerasi, E., and Kaiser, N. (2001) Defective glucose-regulated insulin gene expression associated with PDX-1 deficiency in the Psammomys obesus model of type 2 diabetes. Diabetes 50 Suppl 1, S138-139

256. Dutta, S., Gannon, M., Peers, B., Wright, C., Bonner-Weir, S., and Montminy, M. (2001) PDX:PBX complexes are required for normal proliferation of pancreatic cells during development. PNAS 98, 1065-1070

257. Ben-Shushan, E., Marshak, S., Shoshkes, M., Cerasi, E., and Melloul, D. (2001) A Pancreatic beta -Cell-specific Enhancer in the Human PDX-1 Gene Is Regulated by Hepatocyte Nuclear Factor 3beta (HNF-3beta ), HNF-1alpha , and SPs Transcription Factors. J. Biol. Chem. 276, 17533-17540

258. Marshak, S., Benshushan, E., Shoshkes, M., Havin, L., Cerasi, E., and Melloul, D. (2000) Functional Conservation of Regulatory Elements in the pdx-1 Gene: PDX- 1 and Hepatocyte Nuclear Factor 3beta Transcription Factors Mediate beta -Cell- Specific Expression. Mol. Cell. Biol. 20, 7583-7590

259. Gerrish, K., Gannon, M., Shih, D., Henderson, E., Stoffel, M., Wright, C. V. E., and Stein, R. (2000) Pancreatic beta Cell-specific Transcription of the pdx-1 Gene. THE ROLE OF CONSERVED UPSTREAM CONTROL REGIONS AND THEIR HEPATIC NUCLEAR FACTOR 3beta SITES. J. Biol. Chem. 275, 3485- 3492

209

260. Samaras, S. E., Zhao, L., Means, A., Henderson, E., Matsuoka, T.-a., and Stein, R. (2003) The Islet beta Cell-enriched RIPE3b1/Maf Transcription Factor Regulates pdx-1 Expression. J. Biol. Chem. 278, 12263-12270

261. Stoffers, D. A., Stanojevic, V., and Habener, J. F. (1998) Insulin Promoter Factor- 1 Gene Mutation Linked to Early-Onset Type 2 Diabetes Mellitus Directs Expression of a Dominant Negative Isoprotein. J. Clin. Invest. 102, 232-241

262. Macfarlane, W. M., Frayling, T. M., Ellard, S., Evans, J. C., Allen, L. I. S., Bulman, M. P., Ayres, S., Shepherd, M., Clark, P., Millward, A., Demaine, A., Wilkin, T., Docherty, K., and Hattersley, A. T. (1999) Missense mutations in the insulin promoter factor-1 gene predispose to type 2 diabetes. J. Clin. Invest. 104, R33-39

263. Hussain, M. A., and Theise, N. D. (2004) Stem-cell therapy for diabetes mellitus. Lancet 364, 203-205

264. Chan, L., Fujimiya, M., and Kojima, H. (2003) In vivo gene therapy for diabetes mellitus. Trends Mol Med 9, 430-435

265. Ryan, E. A., Lakey, J. R. T., Rajotte, R. V., Korbutt, G. S., Kin, T., Imes, S., Rabinovitch, A., Elliott, J. F., Bigam, D., Kneteman, N. M., Warnock, G. L., Larsen, I., and Shapiro, A. M. J. (2001) Clinical Outcomes and Insulin Secretion After Islet Transplantation With the Edmonton Protocol. Diabetes 50, 710-719

266. Blyszczuk, P., Czyz, J., Kania, G., Wagner, M., Roll, U., St-Onge, L., and Wobus, A. M. (2003) Expression of Pax4 in embryonic stem cells promotes differentiation of nestin-positive progenitor and insulin-producing cells. PNAS 100, 998-1003

267. Miyazaki, S., Yamato, E., and Miyazaki, J.-i. (2004) Regulated Expression of pdx-1 Promotes In Vitro Differentiation of Insulin-Producing Cells From Embryonic Stem Cells. Diabetes 53, 1030-1037

268. Yang, L., Li, S., Hatch, H., Ahrens, K., Cornelius, J. G., Petersen, B. E., and Peck, A. B. (2002) In vitro trans-differentiation of adult hepatic stem cells into pancreatic endocrine hormone-producing cells. PNAS 99, 8078-8083

269. Tuch, B. E., Szymanska, B., Yao, M., Tabiin, M. T., Gross, D. J., Holman, S., Swan, M. A., Humphrey, R. K., Marshall, G. M., and Simpson, A. M. (2003) Function of a genetically modified human liver cell line that stores, processes and secretes insulin. Gene Ther 10, 490-503

210

270. Ferber, S., Halkin, A., Cohen, H., Ber, I., Einav, Y., Goldberg, I., Barshack, I., Seijffers, R., Kopolovic, J., Kaiser, N., and Karasik, A. (2000) Pancreatic and duodenal homeobox gene 1 induces expression of insulin genes in liver and ameliorates streptozotocin-induced hyperglycemia. Nat Med 6, 568-572

271. Wencel, H. E., Smothers, C., Opara, E. C., Kuhn, C. M., Feinglos, M. N., and Surwit, R. S. (1995) Impaired second phase insulin response of diabetes-prone C57BL/6J mouse islets. Physiol Behav 57, 1215-1220

272. Surwit, R. S., Kuhn, C. M., Cochrane, C., McCubbin, J. A., and Feinglos, M. N. (1988) Diet-induced type II diabetes in C57BL/6J mice. Diabetes 37, 1163-1167

273. Surwit, R. S., Feinglos, M. N., Rodin, J., Sutherland, A., Petro, A. E., Opara, E. C., Kuhn, C. M., and Rebuffe-Scrive, M. (1995) Differential effects of fat and sucrose on the development of obesity and diabetes in C57BL/6J and A/J mice. Metabolism 44, 645-651

274. Surwit, R. S., Seldin, M. F., Kuhn, C. M., Cochrane, C., and Feinglos, M. N. (1991) Control of expression of insulin resistance and hyperglycemia by different genetic factors in diabetic C57BL/6J mice. Diabetes 40, 82-87

275. Kobberling, J., and Tillil, H. (1990) Genetic and nutritional factors in the etiology and pathogenesis of diabetes mellitus. World Rev Nutr Diet 63, 102-115

276. De Reggi, M., Gharib, B., Patard, L., and Stoven, V. (1998) Lithostathine, the presumed pancreatic stone inhibitor, does not interact specifically with calcium carbonate crystals. J Biol Chem 273, 4967-4971

277. Rouquier, S., Verdier, J. M., Iovanna, J., Dagorn, J. C., and Giorgi, D. (1991) Rat pancreatic stone protein messenger RNA. Abundant expression in mature exocrine cells, regulation by food content, and sequence identity with the endocrine reg transcript. J Biol Chem 266, 786-791

278. Watanabe, T., Yonemura, Y., Yonekura, H., Suzuki, Y., Miyashita, H., Sugiyama, K., Moriizumi, S., Unno, M., Tanaka, O., and Kondo, H. (1994) Pancreatic beta- cell replication and amelioration of surgical diabetes by Reg protein. Proc Natl Acad Sci U S A 91, 3589-3592

279. Gross, D. J., Weiss, L., Reibstein, I., van den Brand, J., Okamoto, H., Clark, A., and Slavin, S. (1998) Amelioration of diabetes in nonobese diabetic mice with advanced disease by linomide-induced immunoregulation combined with Reg protein treatment. Endocrinology 139, 2369-2374

211

280. Bonner-Weir, S. (2001) beta-cell turnover: its assessment and implications. Diabetes 50 Suppl 1, S20-24

281. Del Prato, S., and Tiengo, A. (2001) The importance of first-phase insulin secretion: implications for the therapy of type 2 diabetes mellitus. Diabetes Metab Res Rev 17, 164-174

282. Flier, S. N., Kulkarni, R. N., and Kahn, C. R. (2001) Evidence for a circulating islet cell growth factor in insulin-resistant states. Proc Natl Acad Sci U S A 98, 7475-7480

283. Kim, D. J., Lee, M. S., Kim, K. W., and Lee, M. K. (2001) Insulin secretory dysfunction and insulin resistance in the pathogenesis of korean type 2 diabetes mellitus. Metabolism 50, 590-593

284. Surwit, R. S., Feinglos, M. N., Livingston, E. G., Kuhn, C. M., and McCubbin, J. A. (1984) Behavioral manipulation of the diabetic phenotype in ob/ob mice. Diabetes 33, 616-618

285. Kuhn, C. M., Cochrane, C., Feinglos, M. N., and Surwit, R. S. (1987) Exaggerated peripheral responses to catecholamines contributes to stress-induced hyperglycemia in the ob/ob mouse. Pharmacol Biochem Behav 26, 491-495

286. Coleman, D. L. (1978) Obese and diabetes: two mutant genes causing diabetes- obesity syndromes in mice. Diabetologia 14, 141-148

287. Portha, B., Blondel, O., Serradas, P., McEvoy, R., Giroix, M. H., Kergoat, M., and Bailbe, D. (1989) The rat models of non-insulin dependent diabetes induced by neonatal streptozotocin. Diabete Metab 15, 61-75

288. Koya, D., and King, G. L. (1998) Protein kinase C activation and the development of diabetic complications. Diabetes 47, 859-866

289. Yki-Jarvinen, H. (1992) Glucose toxicity. Endocr Rev 13, 415-431

290. Robertson, R. P., Olson, L. K., and Zhang, H. J. (1994) Differentiating glucose toxicity from glucose desensitization: a new message from the insulin gene. Diabetes 43, 1085-1089

291. Packer, L., Kraemer, K., and Rimbach, G. (2001) Molecular aspects of lipoic acid in the prevention of diabetes complications. Nutrition 17, 888-895

292. de Fourmestraux, V., Neubauer, H., Poussin, C., Farmer, P., Falquet, L., Burcelin, R., Delorenzi, M., and Thorens, B. (2004) Transcript Profiling Suggests That 212

Differential Metabolic Adaptation of Mice to a High Fat Diet Is Associated with Changes in Liver to Muscle Lipid Fluxes. J. Biol. Chem. 279, 50743-50753

293. Gygi, S. P., Rochon, Y., Franza, B. R., and Aebersold, R. (1999) Correlation between Protein and mRNA Abundance in Yeast. Mol. Cell. Biol. 19, 1720-1730

294. MacKay, V. L., Li, X., Flory, M. R., Turcott, E., Law, G. L., Serikawa, K. A., Xu, X. L., Lee, H., Goodlett, D. R., Aebersold, R., Zhao, L. P., and Morris, D. R. (2004) Gene Expression Analyzed by High-resolution State Array Analysis and Quantitative Proteomics: Response of Yeast to Mating Pheromone. Mol Cell Proteomics 3, 478-489

295. Huber, M., Bahr, I., Kratzschmar, J. R., Becker, A., Muller, E. C., Donner, P., Pohlenz, H. D., Schneider, M. R., and Sommer, A. (2004) Comparison of proteomic and genomic analyses of the human breast cancer cell line T47D and the antiestrogen-resistant derivative T47D-r. Mol Cell Proteomics 3, 43-55

296. Kopchick, J. J., List, E. O., Kohn, D. T., Keidan, G. M., Qiu, L., and Okada, S. (2002) Perspective: proteomics--see "spots" run. Endocrinology 143, 1990-1994

297. Malone, J. P., Radabaugh, M. R., Leimgruber, R. M., and Gerstenecker, G. S. (2001) Practical aspects of fluorescent staining for proteomic applications. Electrophoresis 22, 919-932

298. Hartupee, J. C., Zhang, H., Bonaldo, M. F., Soares, M. B., and Dieckgraefe, B. K. (2001) Isolation and characterization of a cDNA encoding a novel member of the human regenerating protein family: Reg IV. Biochim Biophys Acta 1518, 287-293

299. Okamoto, H. (1999) The Reg gene family and Reg proteins: with special attention to the regeneration of pancreatic beta-cells. J Hepatobiliary Pancreat Surg 6, 254- 262

300. Watanabe, T., Yonekura, H., Terazono, K., Yamamoto, H., and Okamoto, H. (1990) Complete nucleotide sequence of human reg gene and its expression in normal and tumoral tissues. The reg protein, pancreatic stone protein, and pancreatic thread protein are one and the same product of the gene. J Biol Chem 265, 7432-7439

301. De Caro, A. M., Bonicel, J. J., Rouimi, P., De Caro, J. D., Sarles, H., and Rovery, M. (1987) Complete amino acid sequence of an immunoreactive form of human pancreatic stone protein isolated from pancreatic juice. Eur J Biochem 168, 201- 207

213

302. De Caro, A. M., Adrich, Z., Fournet, B., Capon, C., Bonicel, J. J., De Caro, J. D., and Rovery, M. (1989) N-terminal sequence extension in the glycosylated forms of human pancreatic stone protein. The 5-oxoproline N-terminal chain is O- glycosylated on the 5th amino acid residue. Biochim Biophys Acta 994, 281-284

303. Gross, J., Carlson, R. I., Brauer, A. W., Margolies, M. N., Warshaw, A. L., and Wands, J. R. (1985) Isolation, characterization, and distribution of an unusual pancreatic human secretory protein. J Clin Invest 76, 2115-2126

304. Unno, M., Yonekura, H., Nakagawara, K., Watanabe, T., Miyashita, H., Moriizumi, S., Okamoto, H., Itoh, T., and Teraoka, H. (1993) Structure, chromosomal localization, and expression of mouse reg genes, reg I and reg II. A novel type of reg gene, reg II, exists in the mouse genome. J Biol Chem 268, 15974-15982

305. Miyaura, C., Chen, L., Appel, M., Alam, T., Inman, L., Hughes, S. D., Milburn, J. L., Unger, R. H., and Newgard, C. B. (1991) Expression of reg/PSP, a pancreatic exocrine gene: relationship to changes in islet beta-cell mass. Mol Endocrinol 5, 226-234

306. Terazono, K., Uchiyama, Y., Ide, M., Watanabe, T., Yonekura, H., Yamamoto, H., and Okamoto, H. (1990) Expression of reg protein in rat regenerating islets and its co-localization with insulin in the beta cell secretory granules. Diabetologia 33, 250-252

307. Terazono, K., Yamamoto, H., Takasawa, S., Shiga, K., Yonemura, Y., Tochino, Y., and Okamoto, H. (1988) A novel gene activated in regenerating islets. J Biol Chem 263, 2111-2114

308. Perfetti, R., Egan, J. M., Zenilman, M. E., and Shuldiner, A. R. (1996) Differential expression of reg-I and reg-II genes during aging in the normal mouse. J Gerontol A Biol Sci Med Sci 51, B308-315

309. Baeza, N., Sanchez, D., Vialettes, B., and Figarella, C. (1997) Specific reg II gene overexpression in the non-obese diabetic mouse pancreas during active diabetogenesis. FEBS Lett 416, 364-368

310. Baeza, N. J., Moriscot, C. I., Renaud, W. P., Okamoto, H., Figarella, C. G., and Vialettes, B. H. (1996) Pancreatic regenerating gene overexpression in the nonobese diabetic mouse during active diabetogenesis. Diabetes 45, 67-70

311. Sanchez, D., Baeza, N., Blouin, R., Devaux, C., Grondin, G., Mabrouk, K., Guy- Crotte, O., and Figarella, C. (2000) Overexpression of the reg gene in non-obese 214

diabetic mouse pancreas during active diabetogenesis is restricted to exocrine tissue. J Histochem Cytochem 48, 1401-1410

312. Unno, M., Nata, K., Noguchi, N., Narushima, Y., Akiyama, T., Ikeda, T., Nakagawa, K., Takasawa, S., and Okamoto, H. (2002) Production and characterization of Reg knockout mice: reduced proliferation of pancreatic beta- cells in Reg knockout mice. Diabetes 51 Suppl 3, S478-483

313. Anastasi, E., Ponte, E., Gradini, R., Bulotta, A., Sale, P., Tiberti, C., Okamoto, H., Dotta, F., and Mario, U. D. (1999) Expression of Reg and cytokeratin 20 during ductal cell differentiation and proliferation in a mouse model of autoimmune diabetes. Eur J Endocrinol 141, 644-652

314. Zenilman, M. E., Magnuson, T. H., Swinson, K., Egan, J., Perfetti, R., and Shuldiner, A. R. (1996) Pancreatic thread protein is mitogenic to pancreatic- derived cells in culture. Gastroenterology 110, 1208-1214

315. Keep, N. H., Barnes, M., Barsukov, I., Badii, R., Lian, L. Y., Segal, A. W., Moody, P. C., and Roberts, G. C. (1997) A modulator of rho family G proteins, rhoGDI, binds these G proteins via an immunoglobulin-like domain and a flexible N-terminal arm. Structure 5, 623-633

316. Chen, J.-W., Dodia, C., Feinstein, S. I., Jain, M. K., and Fisher, A. B. (2000) 1- Cys Peroxiredoxin, a Bifunctional Enzyme with Glutathione Peroxidase and Phospholipase A2 Activities. J. Biol. Chem. 275, 28421-28427

317. Tani, T., Ohsumi, J., Mita, K., and Takiguchi, Y. (1988) Identification of a novel class of elastase isozyme, human pancreatic elastase III, by cDNA and genomic gene cloning. J. Biol. Chem. 263, 1231-1239

318. Tanaka, Y., Tran, P. O., Harmon, J., and Robertson, R. P. (2002) A role for glutathione peroxidase in protecting pancreatic beta cells against oxidative stress in a model of glucose toxicity. Proc Natl Acad Sci U S A 99, 12363-12368

319. Mirault, M. E., Tremblay, A., Beaudoin, N., and Tremblay, M. (1991) Overexpression of seleno-glutathione peroxidase by gene transfer enhances the resistance of T47D human breast cells to clastogenic oxidants. J Biol Chem 266, 20752-20760

320. de Haan, J. B., Bladier, C., Griffiths, P., Kelner, M., O'Shea, R. D., Cheung, N. S., Bronson, R. T., Silvestro, M. J., Wild, S., Zheng, S. S., Beart, P. M., Hertzog, P. J., and Kola, I. (1998) Mice with a homozygous null mutation for the most abundant glutathione peroxidase, Gpx1, show increased susceptibility to the 215

oxidative stress-inducing agents paraquat and hydrogen peroxide. J Biol Chem 273, 22528-22536

321. Cheng, W. H., Ho, Y. S., Ross, D. A., Han, Y., Combs, G. F., Jr., and Lei, X. G. (1997) Overexpression of cellular glutathione peroxidase does not affect expression of plasma glutathione peroxidase or phospholipid hydroperoxide glutathione peroxidase in mice offered diets adequate or deficient in selenium. J Nutr 127, 675-680

322. Yoshida, T., Watanabe, M., Engelman, D. T., Engelman, R. M., Schley, J. A., Maulik, N., Ho, Y. S., Oberley, T. D., and Das, D. K. (1996) Transgenic mice overexpressing glutathione peroxidase are resistant to myocardial ischemia reperfusion injury. J Mol Cell Cardiol 28, 1759-1767

323. Tiedge, M., Lortz, S., Drinkgern, J., and Lenzen, S. (1997) Relation between antioxidant enzyme gene expression and antioxidative defense status of insulin- producing cells. Diabetes 46, 1733-1742

324. Lenzen, S., Drinkgern, J., and Tiedge, M. (1996) Low antioxidant enzyme gene expression in pancreatic islets compared with various other mouse tissues. Free Radic Biol Med 20, 463-466

325. Chua, S. C., Jr., Chung, W. K., Wu-Peng, X. S., Zhang, Y., Liu, S. M., Tartaglia, L., and Leibel, R. L. (1996) Phenotypes of mouse diabetes and rat fatty due to mutations in the OB (leptin) receptor. Science 271, 994-996

326. Chevallet, M., Santoni, V., Poinas, A., Rouquie, D., Fuchs, A., Kieffer, S., Rossignol, M., Lunardi, J., Garin, J., and Rabilloud, T. (1998) New zwitterionic detergents improve the analysis of membrane proteins by two-dimensional electrophoresis. Electrophoresis 19, 1901-1909

327. Chomczynski, P., and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162, 156-159

328. Galvani, M., Hamdan, M., Herbert, B., and Righetti, P. G. (2001) Alkylation kinetics of proteins in preparation for two-dimensional maps: a matrix assisted laser desorption/ionization-mass spectrometry investigation. Electrophoresis 22, 2058-2065

329. Herbert, B., Galvani, M., Hamdan, M., Olivieri, E., MacCarthy, J., Pedersen, S., and Righetti, P. G. (2001) Reduction and alkylation of proteins in preparation of two-dimensional map analysis: why, when, and how? Electrophoresis 22, 2046- 2057 216

330. Gorg, A., Postel, W., and Gunther, S. (1988) The current state of two-dimensional electrophoresis with immobilized pH gradients. Electrophoresis 9, 531-546

331. Cho, Y. M., Bae, S. H., Choi, B. K., Cho, S. Y., Song, C. W., Yoo, J. K., and Paik, Y. K. (2003) Differential expression of the liver proteome in senescence accelerated mice. Proteomics 3, 1883-1894

332. Page, M. J., Amess, B., Townsend, R. R., Parekh, R., Herath, A., Brusten, L., Zvelebil, M. J., Stein, R. C., Waterfield, M. D., Davies, S. C., and O'Hare, M. J. (1999) Proteomic definition of normal human luminal and myoepithelial breast cells purified from reduction mammoplasties. Proc Natl Acad Sci U S A 96, 12589-12594

333. Abe, M., Nata, K., Akiyama, T., Shervani, N. J., Kobayashi, S., Tomioka- Kumagai, T., Ito, S., Takasawa, S., and Okamoto, H. (2000) Identification of a novel Reg family gene, Reg IIIdelta, and mapping of all three types of Reg family gene in a 75 kilobase mouse genomic region. Gene 246, 111-122

334. Esworthy, R. S., Ho, Y. S., and Chu, F. F. (1997) The Gpx1 gene encodes mitochondrial glutathione peroxidase in the mouse liver. Arch Biochem Biophys 340, 59-63

335. Chambers, I., Frampton, J., Goldfarb, P., Affara, N., McBain, W., and Harrison, P. R. (1986) The structure of the mouse glutathione peroxidase gene: the selenocysteine in the active site is encoded by the 'termination' codon, TGA. Embo J 5, 1221-1227

336. Forgione, M. A., Weiss, N., Heydrick, S., Cap, A., Klings, E. S., Bierl, C., Eberhardt, R. T., Farber, H. W., and Loscalzo, J. (2002) Cellular glutathione peroxidase deficiency and endothelial dysfunction. Am J Physiol Heart Circ Physiol 282, H1255-1261

337. Dayal, S., Brown, K. L., Weydert, C. J., Oberley, L. W., Arning, E., Bottiglieri, T., Faraci, F. M., and Lentz, S. R. (2002) Deficiency of glutathione peroxidase-1 sensitizes hyperhomocysteinemic mice to endothelial dysfunction. Arterioscler Thromb Vasc Biol 22, 1996-2002

338. De Reggi, M., and Gharib, B. (2001) Protein-X, Pancreatic Stone-, Pancreatic thread-, reg-protein, P19, lithostathine, and now what? Characterization, structural analysis and putative function(s) of the major non-enzymatic protein of pancreatic secretions. Curr Protein Pept Sci 2, 19-42

217

339. Martin-Gallan, P., Carrascosa, A., Gussinye, M., and Dominguez, C. (2003) Biomarkers of diabetes-associated oxidative stress and antioxidant status in young diabetic patients with or without subclinical complications. Free Radic Biol Med 34, 1563-1574

340. Memisogullari, R., Taysi, S., Bakan, E., and Capoglu, I. (2003) Antioxidant status and lipid peroxidation in type II diabetes mellitus. Cell Biochem Funct 21, 291- 296

341. Palanduz, S., Ademoglu, E., Gokkusu, C., and Tamer, S. (2001) Plasma antioxidants and type 2 diabetes mellitus. Res Commun Mol Pathol Pharmacol 109, 309-318

342. Faure, P. (2003) Protective effects of antioxidant micronutrients (vitamin E, zinc and selenium) in type 2 diabetes mellitus. Clin Chem Lab Med 41, 995-998

343. Robertson, R. P., Harmon, J., Tran, P. O., Tanaka, Y., and Takahashi, H. (2003) Glucose toxicity in beta-cells: type 2 diabetes, good radicals gone bad, and the glutathione connection. Diabetes 52, 581-587

344. Kelder, B. (1994), Ohio University, Athens. OH

345. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685

346. Chen, W., Wight, D., Wagner, T., and Kopchick, J. (1990) Expression of a Mutated Bovine Growth Hormone Gene Suppresses Growth of Transgenic Mice. PNAS 87, 5061-5065

347. Knapp, J. R., and Kopchick, J. J. (1994) The use of transgenic mice in nutrition research. J Nutr 124, 461-468

218

Appendix A: Gel Images of the Pancreas from A Control and A Diabetic Mouse

219

220

Appendix B: Close-Up View of Differentially Expressed Protein Spots

221

222