Identification and Characterization of a Novel Human Testis-Specific

Biochemical and Biophysical Research Communications 285, 400–408 (2001) doi:10.1006/bbrc.2001.5165, available online at http://www.idealibrary.com on

Identiﬁcation and Characterization of a Novel Human Testis-Speciﬁc Kinase Substrate Gene Which Is Downregulated in Testicular Tumors

Andreas Scorilas,*,† George M. Yousef,*,† Klaus Jung,‡ Ewa Rajpert-De Meyts,§ Stephan Carsten,‡ and Eleftherios P. Diamandis*,†,1 *Department of Pathology and Laboratory Medicine, Mount Sinai Hospital, Toronto, Ontario M5G 1X5, Canada; †Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario M5G 1L5, Canada; ‡Department of Urology, University Hospital Charite, Humboldt University, Berlin, Germany; and §Department of Growth and Reproduction, Juliane Marie Centre, National University Hospital, Copenhagen, Denmark

Received June 8, 2001

physiology, most probably in the process of spermato- By using the positional candidate gene approach, we genesis or spermiogenesis. © 2001 Academic Press identified a novel putative serine/threonine kinase Key Words: kinase substrates; testis-specific genes; substrate gene that maps to chromosome 19q13.3. gene mapping; gene characterization; TSKS; testis- Screening of expressed sequence tags and reverse specific kinase substrate; RRAS; IRF3; testicular transcription–polymerase chain reaction of total RNA cancer. from human tissues allowed us to establish the expression of the gene and delineate its genomic organiza- tion (GenBank Accession No. AF200923). This gene (TSKS, for testis-specific kinase substrate) is com- Protein phosphorylation is the most common post- posed of 11 exons and 10 intervening introns and is translational protein modification in eukaryotes and a likely the human homolog of the mouse testis-specific fundamental mechanism for the direct or indirect con- serine kinase substrate gene. The predicted protein- trol of all cellular processes. Considering the integral coding region of the gene is 1779 bp, encoding for a role that protein kinases play in the control of cellular 592-amino-acid polypeptide with a calculated molecu- mechanisms and signal transduction, it is not surpris- lar mass of 65.1 kDa. Genomic analysis of the region ing that several protein kinases have been shown to be 19q13.3 placed the TSKS gene close to the known genes involved in spermatogenesis (1, 2). Nevertheless, only IRF3, RRAS, and ␣-Adaptin A. TSKS exhibits high lev- a few kinases have been characterized, whose expres- els of expression exclusively in human testicular tis- sion is restricted to either germ cells or to the testis. sue. The expression of TSKS is downregulated in can- The phosphoglycerate kinase-2 and the serine/ cerous testicular tissue, in comparison to adjacent threonine kinase MAK are predominantly expressed in normal tissue. TSKS expression was very low or unde- spermatocytes during meiosis (3). The serine/threonine tectable in seminoma, teratocarcinoma, embryonal, kinase c-MOS and the kinase NEK-1 have been impli- and Leydig cell tumors, while high expression was observed in testicular tissue adjacent to tumors which cated in the control of meiosis in both spermatocytes contain premalignant carcinoma in situ. The expres- and oocytes (4, 5). Mouse studies demonstrate that sion of the TSKS gene was very low in two human spermiogenesis, comprising cytodifferentiation and de- embryonal carcinoma cell lines, 2102Ep and NTERA-2. tachment, involves a complex pattern of interaction These observations suggest a role of TSKS in testicular between members of a novel family of serine/threonine kinases and as yet uncharacterized substrates (2). Abbreviations used: TSKS, testis-specific kinase substrate, IRF3, Other reports describe a possible role of serine/ interferon regulatory factor 3; PSA, prostate-specific antigen; tssk, testis-specific serine kinase; tssks, testis-specific serine kinase sub- threonine kinases and their substrates in the progres- strate; LLNL, Lawrence Livermore National Laboratory; EST, ex- sion of testicular tumors of germ cell origin (6, 7). pressed sequence tag; RT-PCR, reverse transcription–polymerase Recently, Kueng et al. employed the yeast two- chain reaction. hybrid system with testis-specific serine kinase (tssk) 1 1 To whom correspondence and reprint requests should be addressed at Department of Pathology and Laboratory Medicine, Mount Sinai and tssk2 cDNA as baits and a prey cDNA library from Hospital, 600 University Avenue, Toronto, Ontario M5G 1X5, Canada. mouse testis and isolated a novel cDNA which encoded Fax: (416) 586-8628. E-mail: [email protected]. for a 65-kDa protein, interacting specifically with both

tssk1 and tssk2 (2). This protein was phosphorylated sequences. BLAST homology searching for the proteins encoded by by both kinases (see GenBank Accession No. AF the exons were performed using the BLASTP program and the Gen- 025310). The expression of the interacting clone was Bank databases (12). also testis-specific and paralleled the developmental Structure analysis studies. Multiple alignment was performed us- expression observed for the kinases themselves (2). In ing the Clustal X multiple alignment program (16). Phylogenetic studies were performed using the Phylip software package (17). Distance the same study, tssk2 was found to be the orthologue of matrix analysis was performed using the “Neighbor-Joining/UPGMA” the human DGS-G gene, whose deletion is suspected to program and parsimony analysis was done using the “Protpars” pro- be involved in the pathogenesis of Di George and velo- gram (18). Hydrophobicity study was performed using the Baylor Col- cardiofacial syndromes (8). lege of Medicine search launcher program. Signal peptide and trans- In this report we describe analysis of an area spanning membrane regions were predicted using the SignalP (19) and Tmpred (20) software. Protein structure analysis was performed by SAPS pro- approximately 100 kb of contiguous DNA sequence on gram (21). Sequence analysis tools were utilized to detect the presence human chromosome 19 (19q13.3) for the purpose of iden- of possible sites of posttranslational modification on our putative pro- tifying new genes by the method of positional candidate tein. We used the analysis program PROSITE (22) and NetOGlyc 2.0 cloning (9–11). Our approach allowed us to clone a gene, (23) to detect N- and O-glycosylation, as well as the presence of kinase tentatively named TSKS (for testis-specific kinase sub- phosphorylation motifs. strate; GenBank Accession No. AF200923). This gene is Tissue expression of TSKS. Total RNA isolated from 28 different located closed to RRAS and the human IRF3 gene. On human tissues was purchased from Clontech (Palo Alto, CA). We prepared cDNA as described below and used it for PCRs with the homology analysis, the human TSKS gene was found to primers TSKS-F2 and TSKS-R1, described in Table 2. be similar to the Mus musculus tssk1 and tssk2 substrate Expression of TSKS in testis cancer. Included in this study tissue (tssks) gene, described by Kueng et al. (2). We here de- samples from 15 patients who had undergone radical orchiectomy for scribe the identification of the new gene, its mapping and testicular, tumors at the Charite University Hospital, Germany and its localization, in relation to other genes clustering in the the National University Hospital, Denmark. Patient age ranged same region. In addition, we describe its genomic, mRNA from 23 to 60 years with a median of 36. Matched testicular tissue and protein structure. We further present extensive tis- samples were obtained from the cancerous and non-cancerous parts of the same testis, from 10 of the patients. All patients had a sue expression studies and demonstrate that, in addition histologically-confirmed diagnosis of primary testicular cancer and to testis, which shows the highest expression, the gene is received no treatment before surgery. Of the 10 matched samples, 5 expressed at low levels in prostate, female breast, pla- tumors were seminomas, 3 were categorized as embryonal carcino- centa, ovary, and thymus. Moreover, we examined TSKS mas and 2 were teratocarcinomas. Other tissue samples included one expression in human testicular tumors and teratocar- Leydig cell tumor and two samples of testicular tissue containing pre-malignant carcinoma in situ tubules within morphologically nor- cinoma-derived cell lines and found gene downregulation mal testicular parenchyma. In addition, the expression of the TSKS in comparison to normal testicular tissue. gene was examined in two embryonal carcinoma cell lines derived from a human teratocarcinoma; pluripotet (NTERA-2) and nullipotent (2102Ep) (24). The normal and tumor tissues were immediately MATERIALS AND METHODS frozen in liquid nitrogen after surgical resection and stored at Ϫ80°C until extraction. We prepared cDNA as described below and used it Gene mapping. Large DNA sequencing data for chromosome 19 for PCRs with the primers TSKS-F2 and TSKS-R1 (Table 2). Tissue is available at the Lawrence Livermore National Laboratory (LLNL) cDNAs were amplified at a 1:10 dilution. database. We have screened approximately 100 kb of genomic se- Reverse transcription–polymerase chain reaction (RT-PCR). To- quence, encompassing a region on chromosome 19q13.3-13.4, where tal RNA was extracted from the tissues or cell lines using Trizol several cancer-associated genes are localized. These sequences were reagent (Gibco BRL, Gaithersburg, MD) following the manufactur- represented by 10 contigs of variable lengths. We performed a restriction analysis study of the available sequences using the “Web- er’s instructions. RNA concentration was determined spectrophoto- Cutter 2” computer program and with the aid of the EcoRI restriction metrically. Two micrograms of total RNA was reverse transcribed map of this area (also available from the LLNL), we were able to into first strand cDNA using the Superscript preamplification sys- ␮ construct an almost contiguous area of genomic sequences (Fig. 1). tem (Gibco BRL). The final volume was 20 l. Based on the combined By using the published sequences of the RRAS oncogene and IRF3 information obtained from the predicted genomic structure of the gene, and the alignment program BLAST 2 (12), we identified the new gene and the EST sequences, two gene-specific primers were relative positions of these genes on the contiguous map. designed (TSKS-F2 and TSKS-R1; Table 2) and PCR was carried out in a reaction mixture containing 1 ␮l of cDNA, 10 mM Tris–HCl (pH Gene prediction analysis. For exon prediction analysis of the 8.3), 50 mM KCl, 1.5 mM MgCl2, 200 ␮M dNTPs (deoxynucleoside genomic area of interest, we used a number of different computer triphosphates), 150 ng of primers and 2.5 units of AmpliTaq Gold programs as previously described (13, 14). DNA polymerase (Roche Molecular Systems, Branchburg, NJ) on a Expressed sequence tag (EST) searching. Sequence homology Perkin–Elmer 9600 thermal cycler. The cycling conditions were 95°C searching was performed using the BLASTN algorithm (12) against for 15 min to activate the Taq Gold DNA polymerase, followed by 42 the human EST database (dbEST). Clones with Ͼ95% identity were cycles of 94°C for 30 s, 67°C for 1 min and a final extension at 67°C obtained from the IMAGE consortium (15) through Research Genet- for 10 min. Equal amounts of PCR products were electrophoresed on ics Inc. (Huntsville, AL) and from the Institute for Genomic Research 2% agarose gels and visualized by ethidium bromide staining. The (TIGR). Clones were propagated and purified and then sequenced primers for RT-PCR spanned at least 2 exons to avoid contamination from both directions with an automated sequencer, using insert- by genomic DNA. flanking vector primers. All clones tested are shown in Table 1. Cloning and sequencing of the PCR products. To verify the iden- Protein homology searching. Putative exons of the newly identi- tity of the PCR products, they were cloned into the pCR 2.1-TOPO fied gene were first translated to the corresponding amino acid vector (Invitrogen, Carlsbad, CA) according to the manufacturer’s

401 Vol. 285, No. 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

TABLE 1 TABLE 2 EST Clones with Ͼ95% Identity to Exons Primers Used for Reverse Transcription–Polymerase Chain of the TSKS Gene Reaction (RT-PCR) Analysis of the TSKS Gene

GenBank Homologous Primer Product sizes accession no. Tissue IMAGE ID exons Gene name Sequencea (base pairs)

AL041339 Testis — 6–11 TSKS TSKS-F1 AAGACGATCTGGCAGTCCAA 1748 AI587014 Pancreatic 2222191 9–11 TSKS-F2 GAGCTGGAGCGCCAGGCCTT 269 adenocarcinoma TSKS-R1 GCTGAGCCCCCCTGTTTTGG H02568 Placenta 150825 10, 11 PSA PSAS TGCGCAAGTTCACCCTCA 754 AW236904 Pooled germ cell 268766 11 PSAAS CCCTCTCCTTACTTCATCC tumors Actin ACTINS ATCTGGCACCACACCTTCTA 838 AW003686 Prostate 2477783 11 ACTINAS CGTCATACTCCTGCTTGCTG

a All nucleotide sequences are given in the 5Ј 3 3Ј orientation. instructions. The inserts were sequenced from both directions using vector-specific primers, by an automated DNA sequencer. Statistical analysis. Statistical analysis was performed with SAS racy of the data. Moreover, two ESTs were found to software (SAS Institute, Cary, NC). The analyses of differences be- have a poly(A) tail which was not found in the genomic tween TSKS expression in noncancerous and cancerous tissues were sequence, verifying the 3Ј end of the gene. performed with the nonparametric McNemar test. The binomial distribution was used to compute the significance level. To verify the accuracy of the cDNA sequence, PCRs were performed using gene-specific primers for the first RESULTS and last exons of the predicted structure of the gene (TSKS-F1 and TSKS-R1; Table 2) with cDNA isolated Identification of the TSKS Gene from different human tissues as putative templates. The PCRs were performed under different optimiza- Exon prediction analysis of the 100-kb DNA se- tion conditions using the EST clones as positive con- quence around chromosome 19q13.3 identified a novel trols. A positive band of the expected size was isolated gene with a structure reminiscent of a serine/threonine from testis cDNA and fully sequenced. Its sequence kinase substrate gene. Since our gene was found to was aligned by BLAST against the genomic sequence have 73% and 81% identity at the protein and cDNA to further define and confirm the exon/intron bound- level, respectively, to the mouse tssks gene reported by aries. The genomic and cDNA sequence of the gene is Kueng et al. (2), we assume that the newly identified now deposited in GenBank (Accession No. AF200923). TSKS gene (GenBank Accession No. AF200923) is the human homolog of the mouse tssks gene. Mapping and Chromosomal Localization Cloning of the TSKS Gene of the TSKS Gene Sequence homology search of the putative exons Alignment of the sequences of TSKS and other identified by the gene prediction programs against the known genes that we found to be located within the human EST database (dbEST) revealed five EST 100-kb area of interest, on chromosome 19q13.3, en- clones with Ͼ95% identity to the putative exons of our abled us to precisely localize these genes and deter- gene (Table 1). The IMAGE clones were obtained and mine the distances between them, as shown in Fig. 1. the inserts were sequenced from both directions. Align- The TSKS gene maps between two known genes, ment was used to compare the EST sequences and the namely RRAS and the human ␣-Adaptin A gene, and exons predicted by the computer programs, and final transcribes in the opposite direction. Human selection of the exon–intron splice sites was done ac- ␣-Adaptin A is 3.7 kb more telomeric to TSKS while cording to the EST sequences. Furthermore, many of RRAS is 5.5 kb more centromeric to it. The IRF3 gene the ESTs were overlapping, further ensuring the accu- maps in the same region, and transcribes in the same

FIG. 1. Localization of the TSKS gene within an approximately 100-kb region of contiguous genomic sequence around chromosome 19q13.3. Gene lengths are presented above each arrow, and distances between genes are also shown. Arrows denote the directions of transcription. Figure is not drawn to scale. kb, kilobase; b, base. For full gene names, see abbreviations used footnote.

402 Vol. 285, No. 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 2. Genomic structure of the TSKS gene. Shown are the exon/intron boundaries, as well as the predicted protein sequence. The underlined region denotes 5Ј genomic sequences and the double underlined region 3Ј genomic sequences. The possibility for 5Ј- untranslated exons could not be excluded. Introns are shown with lower case letters and exons with capital letters. For full sequence, see GenBank Accession No. AF200923. The start and stop codons are encircled and the exon–intron junctions are boxed. The translated amino acids of the coding region are shown underneath by a single-letter abbreviation. A putative polyadenylation signal (AATAAA) is present within the stop codon.

403 Vol. 285, No. 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 3. Hydrophobicity plot of the TSKS protein. There is one hydrophobic region around residues 1–19, corresponding to the putative signal peptide. direction with RRAS. The distance between IRF3 and signal peptide is predicted with a cleavage site at the RRAS was calculated to be 19.5 kb (Fig. 1). carboxyl end of Gly19. TSKS protein is predicted to have no transmembrane region, in agreement with the Structural Characterization of the TSKS Gene and mouse homolog protein. The mouse tssks protein was Its Protein Product found to be phosphorylated on serine residues by the tssk1 and tssk2 kinase enzymes (2). We predicted 22 As shown in Fig. 2, the TSKS gene is formed of serine and 9 threonine potential phosphorylation sites, eleven exons and ten intervening introns, spanning an as well as 3 serine and 2 threonine glycosylation sites area of 23.6 kbp of genomic sequence on chromosome (Fig. 4). 19q13.3. The lengths of the coding exons are 181, 229, 96, 84, 84, 329, 195, 174, 136, 125, and 173 bp, respec- Expression of the TSKS Gene in Human Tissues tively of which there are 11 bp of 5Ј and 16 bp of 3Ј We have assessed by RT-PCR the tissues that ex- untranslated regions. All of the exon/intron splice sites press the TSKS gene. The experiments were performed conform to the consensus sequence (-mGT ...... at various dilutions of the cDNA to obtain preliminary AGm-) for eukaryotic splice sites (25). A potential information about the relative levels of expression. RT- translation initiation codon (ATG) is present at nucle- PCR for actin was used as a positive control and RT- otides 12–14 of the predicted first exon (numbers refer PCR for PSA cDNA was used as another positive con- to our GenBank Submission No. AF200923). The flank- trol with tissue restricted specificity. Positive ESTs for ing sequence of that codon (CACCATGG) matches TSKS were also used as controls. The PSA gene was closely with the Kozak consensus sequence (GCC A/G found to be highly expressed in the prostate, as ex- CCATGG) for initiation of translation (26). The stop pected, and to a much lower extent in mammary, sal- codon (TAA) is located 16 bp upstream of the poly(A) ivary glands, thyroid gland, and trachea, as also re- tail. ported recently (27, 28). The tissue expression of TSKS is summarized in Fig. Protein Analysis 5. This kinase substrate is highly expressed in the The predicted protein-coding region of the gene is testis. Much lower levels of expression are seen in formed of 1779 bp (including the stop codon), encoding prostate, placenta, fetal liver, thymus, and mammary a deduced amino acid polypeptide of 592 residues, with gland. No expression was seen for the other tested a predicted molecular mass of 65.1 kDa and a theoret- tissues. To verify the RT-PCR specificity, representa- ical isoelectric point of 5.7. tive PCR products were cloned and sequenced. A hydrophobicity study of the TSKS protein shows a TSKS Expression in Testicular Cancer hydrophobic area in the N-terminal region of the protein (Fig. 3); thus, a presumed signal peptide is Expression of the TSKS gene in testicular cancer, at present. By software analysis, a possible 19-amino-acid the mRNA level, was examined by RT-PCR, with the

404 Vol. 285, No. 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 4. Alignment of the deduced amino acid sequence of TSKS with the mouse testis speciﬁc serine kinase substrate (tssks) protein. Serine and threonine kinase potential phosphorylation motifs are represented by (*) and (ϩ) respectively. Putative N- and O-glycosylation sites are indicated by (n) and (o), respectively. The predicted cleavage site of the signal peptide is indicated by (}). Conservative amino acid substitutions are highlighted in gray. use of actin, as a positive control. We ﬁrst examined well as in pluripotent and nullipotent human embryo- the expression of this gene in three samples of morpho- nal carcinoma cell lines. High levels of expression of logically normal testicular parenchyma adjacent to TSKS in both samples of tissue with carcinoma in situ overt tumors; two with carcinoma one in situ tubules, were observed. TSKS was not expressed at all in the one without carcinoma in situ, one Leydig-cell tumor as Leydig-cell tumor, while the nullipotent and pluripo-

FIG. 5. Tissue expression proﬁle of the TSKS gene as assessed by RT-PCR. Actin and PSA are control genes. For discussion, see text.

405 Vol. 285, No. 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

1779 bp and encodes for a 592-amino-acid polypeptide with a predicted molecular weight of 65.1 kDa. The 3Ј end of the gene was verified by the presence of a poly A tail in the sequenced ESTs which was not found in the genomic sequence. The start codon was identified by the presence of a consensus Kozak sequence. The exon–intron splice junctions were identified by comparing the genomic sequence with the FIG. 6. Expression of the TSKS gene in testicular tumors and EST or cDNA sequence obtained by RT-PCR and embryonal carcinoma (EC-like) cell lines. 1, Leydig-cell tumor; 2, were further verified by the full conservation of the pluripotent EC cell line NT-2; 3, nullipotent EC cell line 2102Ep; consensus splice sequences (25). 4, 5, testicular tissue containing carcinoma in situ; 6, normal testicular tissue; M and N, molecular weight markers and nega- The human TSKS gene is located on chromosome tive control, respectively. Actin was used as a control gene. For 19q13.3, close to RRAS and IRF3. In this study, we also discussion, see text. identified the location of the IRF3 gene in relation to the RRAS gene. The distance between IRF3 and RRAS was calculated to be 19.5 kb and both of them tran- tent embryonal carcinoma-cell lines exhibited very low scribe in the same direction (Fig. 1). The connection of levels of expression (Fig. 6). the RAS genes to human malignancy is well-known To examine the expression of the TSKS gene in be- (29). IRF3 is a member of a growing family of transcrip- nign and malignant tissues we analyzed 10 pairs of tion factors. It is becoming increasingly apparent that testicular tissues (cancer/normal) and the results are IRF3 plays a pivotal role in the cell’s response to viral summarized in Fig. 7. Nine of 10 patients had signifi- infection. Phosphorylation and activation of IRF3 in cantly higher TSKS expression in the non-cancerous response to stimuli other than viral infection may re- tissue and only one had about the same levels of ex- sult in transcription of genes, in addition to the early pression in both tissues. Expression of the TSKS gene inflammatory genes (30, 31). Activation of IRF3 by was not detectable in tumor from 7 of 10 patients. growth factors can lead to a negative feedback control Analysis by the McNemar test indicated that the of cell growth (31). changes between non-cancer vs cancer tissues are sta- Kueng et al. recently found that mouse tssk2 is the tistically significant (P ϭ 0.004). Because of the small likely ortholog of the human DGS-G gene (2). The number of cases, binomial distribution was used to DGS-G gene has been characterized as one of eleven compute the significance level. putative transcription units encoded in the minimal DiGeorge critical region of 250 kb, located on the prox- DISCUSSION imal arm of human chromosome 22, whose deletion is Using linear genomic sequences of considerable suspected to be involved in the pathogenesis of the length, gene prediction programs and the available DiGeorge and velocardiofacial syndromes. Both syn- EST database, we were able to identify a new gene, dromes represent developmental disorders associated tentatively named TSKS (for testis specific kinase with a spectrum of malformations including hypopla- substrate). This gene is composed of 11 exons and ten sia of the thymus and parathyroid glands, cardiovas- introns and is likely to be the human homolog of the cular anomalies, and mild craniofacial dysmorphia. In mouse testis specific serine kinase substrate gene light of the fact that the mouse tssks protein, a sub- (tssks) (2). This is based on the considerable homol- strate for mouse tssk2, is homologous to human TSKS, ogies at the amino acid and nucleotide sequence we can speculate that the TSKS protein may be a level, and the tissue-restricted expression to the tes- substrate of the DGS-G protein. This proposal merits tis. The predicted protein-coding region of the gene is further investigation.

FIG. 7. Expression of the TSKS gene in paired (from the same patient) cancerous (C) and noncancerous (N) testicular tissue. S, seminoma; E, embryonal carcinoma; T, teratocarcinoma. Actin was used as a control gene. The TSKS gene is down-regulated in tumor vs adjacent testicular tissue in 9 of the 10 pairs. For more comments, see text.

406 Vol. 285, No. 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Our results indicate that the expression of TSKS is REFERENCES down-regulated in testicular cancer. TSKS expression was very low or undetectable in a Ledig cell tumor and 1. Hunter, T. (1996) Tyrosine phosphorylation: Past, present and in germ-cell tumors, including seminoma, teratocarci- future. Biochem. Soc. Trans. 24, 307–327. 2. Kueng, P., Nikolova, Z., Djonov, V., Hemphill, A., Rohrbach, V., noma, embryonal carcinoma as well as in a embryonal Boehlen, D., Zuercher, G., Andres, A. C., and Ziemiecki, A. (1997) carcinoma cell lines. The high TSKS expression in tis- A novel family of serine/threonine kinases participating insper- sue with carcinoma in situ is most probably due to the miogenesis. J. Cell Biol. 139, 1851–1859. presence of normal seminiferous tubules with pre- 3. Jinno, A., Tanaka, K., Matsushime, H., Haneji, T., and Shibuya, served spermatogenesis. Such tubules were seen in M. (1993) Testis-specific mak protein kinase is expressed specif- other fragments of tissue isolated from the same pa- ically in the meiotic phase in spermatogenesis and is associated with a 210-kilodalton cellular phosphoprotein. Mol. Cell Biol. 13, tients. 4146–4156. The neighboring RRAS and IRF3 genes are also in- 4. Letwin, K., Mizzen, L., Motro, B., Ben-David, Y., Bernstein, A., volved in tumorigenesis pathways and progression and Pawson, T. (1992) A mammalian dual specificity protein (29–32). The observation that TSKS is located in the kinase, Nek1, is related to the NIMA cell cycle regulator and region of chromosome 19 that is often deleted in glio- highly expressed in meiotic germ cells. EMBO J. 11, 3521–3523. mas, suggests that it should be further investigated as 5. Goldman, D. S., Kiessling, A. A., Millette, C. F., and Cooper, G. M. (1987) Expression of c-mos RNA in germ cells of male and a putative tumor suppressor (30, 31). The presence of female mice. Proc. Natl. Acad. Sci. USA 84, 4509–4513. many GC clusters in the promoter area (data not 6. Shuin, T., Misaki, H., Kubota, Y., Yao, M., and Hosaka, M. (1994) shown) of the TSKS suggests that transcription of this Differential expression of protooncogenes in human germ cell gene, similar to that of other tumor suppressor genes, tumors of the testis. Cancer 73, 1721–1727. may be inactivated through methylation. 7. Avizienyte, E., Roth, S., Loukola, A., Hemminki, A., Lothe, R. A., The mouse homolog of TSSK, tssks, was found with Stenwig, A. E., Fossa, S. D., Salovaara, R., and Aaltonen, L. A. immunohistochemistry to be expressed in the cyto- (1998) Somatic mutations in LKB1 are rare in sporadic colorectal and testicular tumors. Cancer Res. 58, 2087–2090. plasm of spermatids located in the luminal cell layer of 8. Gong, W., Emanuel, B. S., Collins, J., Kim, D. H., Wang, Z., the seminiferous tubules (2). Consistent with these Chen, F., Zhang, G., Roe, B., and Budarf, M. L. (1996) A tran- findings, we found that TSKS, aside from a putative scription map of the DiGeorge and velo-cardio-facial syndrome 19-amino-acid signal peptide, does not have any pre- minimal critical region on 22q11. Hum. Mol. Genet. 5, 789–800. dicted transmembrane regions. Interestingly, tssks 9. Birren, B., Green, E. D., and Klaphoz, S. (1998) Genome Analy- was expressed in the cytoplasm of spermatids under- sis, a Laboratory Manual, Cold Spring Harbor Laboratory Press, Plainview, NY. going nuclear condensation as well as in apparently 10. Ballabio, A. (1993) The rise and fall of positional cloning? Nat. unnuclear cytoplasmic remnants, which may later give Genet. 7, 513–520. rise to the smaller residual bodies. Mouse tssks protein 11. Collins, F. S. (1995) Positional cloning moves from perditional to is not involved in the process of chromatin condensa- traditional. Nat. Genet. 9, 347–350. tion, but rather, participates in the reconstruction of 12. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, the sperm cytoplasm and reflects the different stages of Z., Miller, W., and Lipman, D. J. (1998) Gapped BLAST and sperm maturation in the individual tubular section. PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. The human homolog may play similar roles but this 13. Murakami, K., and Takagi, T. (1998) Gene recognition by com- proposal needs further investigation when antibodies bination of several gene-finding programs. Bioinformatics 14, have become available. Nevertheless, our observation 665–675. of the high expression of the human TSKS gene in 14. Yousef, G. M., Luo, L-Y., and Diamandis, E. P. (1999) Identifi- normal tissue and morphologically normal tissue adja- cation of novel human kallikrein-like genes on chromosome cent to overt tumors (with or without carcinoma in 19q13.3-q13.4. Anticancer Res. 19, 2843–2852. situ) is consistent with the putative localization of the 15. Lennon, G., Auffray, C., Polymeropoulous, M., and Soares, M. B. (1996) The IMAGE Consortium: An integrated molecular anal- transcript to the haploid germ cells, most probably ysis of genomes and their expression. Genomics 33, 151–152. spermatids. 16. Aiyar, A. (2000) The use of CLUSTAL W and CLUSTAL X for In conclusion, we have cloned a new gene, TSKS, multiple sequence alignment. Methods Mol. Biol. 132, 221–241. which appears to be the human homolog of the mouse 17. Retief, J. D. (2000) Phylogenetic analysis using PHYLIP. Meth- tssks gene. This gene appears to be a substrate for ods Mol. Biol. 132, 243–258. testis-specific kinases and is specifically expressed in 18. Takezaki, N. (1998) Tie trees generated by distance methods of the testis. We speculate that this gene is involved in phylogenetic reconstruction. Mol. Biol. Evol. 15, 727–737. sperm formation and may play a role in the pathogen- 19. Nielsen, H., Brunak, S., and von Heijne, G. (1999) Machine esis of DiGeorge and velocardiofacial syndromes. Due learning approaches for the prediction of signal peptides and other protein sorting signals. Protein Eng. 12, 3–9. to it tissue specificity, and differential expression in 20. Hofmann, K., and Stoffel, W. (1993) TMbase—A database of testicular cancers, TSKS protein may find clinical ap- membrane spanning protein segments. Biol. Chem. Hoppe- plications in testicular pathologies and may be a target Seyler 347, 166. for future gene therapy treatments. 21. Brendel, V., Bucher, P., Nourbakhsh, I., Blaisdell, B. E., and

407 Vol. 285, No. 2, 2001 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Karlin, S. (1992) Methods and algorithms for statistical analysis 28. Ishikawa, T., Kashiwagi, H., Iwakami, Y., Hirai, M., Kawamura, of protein sequences. Proc. Natl. Acad. Sci. USA 89, 2002–2006. T., Aiyoshi, Y., Yashiro, T., Ami, Y., Uchida, K., and Miwa, M. 22. Bairoch, A., Bucher, P., and Hofmann, K. (1997) The PROSITE (1998) Expression of alpha-fetoprotein and prostate specific an- database, its status in 1997. Nucleic Acids Res. 25, 217–221. tigen genes in several tissues and detection of mRNAs in normal 23. Hansen, J. E., Lund, O., Tolstrup, N., Gooley, A. A., Williams, circulating blood by reverse transcriptase-polymerase chain re- K. L., and Brunak, S. (1998) NetOglyc: Prediction of mucin type action. Jpn. J. Oncol. 28, 723–728. O-glycosylation sites based on sequence context and surface 29. Webb, C. P., Van Aelst, L., Wigler, M. H., and Woude, G. F. accessibility. Glycoconj. J. 15, 115–130. (1998) Signaling pathways in Ras-mediated tumorigenicity and 24. Andrews, P. W., Bronson, D. L., Benham, F., Strickland, S., and metastasis. Proc. Natl. Acad. Sci. USA 95, 8773–8778. Knowles, B. B. (1982) A comparative study of eight cell lines 30. Lowther, W. J., Moore, P. A., Carter, K. C., and Pitha, P. M. derived from human testicular teratocarcinoma. Int. J. Cancer (1999) Cloning and functional analysis of the human IRF3 pro- 29, 523–531. moter. DNA Cell Biol. 18, 685–692. 25. Iida, Y. (1990) Quantification analysis of 5Ј-splice signal se- 31. Au, W. C., Moore, P. A., Lowther, W., Juang, Y. T., and Pitha, quence in mRNA precursors. Mutations in 5Ј-splice signal se- P. M. (1995) Identification of a member of the interferon regu- quence of human ␤-globin gene and ␤ thalassemia. J. Theor. latory factor family that binds to the interferon-stimulated re- Biol. 145, 523–533. sponse element and activates expression of interferon-induced 26. Kozak, M. (1991) An analysis of vertebrate mRNA sequences: genes. Proc. Natl. Acad. Sci. USA 92, 11657–11661. Intimations of translational control. J. Cell Biol. 115, 887–892. 32. Movilla, N., Crespo, P., and Bustelo, X. R. (1999) Signal 27. Diamandis, E. P., Yu, H., and Sutherland, D. J. (1994) Detection transduction elements of TC21, an oncogenic member of the of prostate-specific antigen immunoreactivity in breast tumors. R-Ras subfamily of GTP-binding proteins. Oncogene 18, 5860– Breast Cancer Res. Treat. 32, 301–310. 5869.

408