Volume 18 - Number 1 January 2014

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles (“cards”) on genes, leukaemias, solid tumours, cancer-prone diseases, and also more traditional review articles (“deep insights”) on the above subjects and on surrounding topics. It also present case reports in hematology and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Carol Moreau, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008.

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Editor

Jean-Loup Huret (Poitiers, France) Editorial Board

Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Yasmin Mehraein (Homburg, Germany) Cancer-Prone Diseases Section Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Volume 18, Number 1, January 2014

Table of contents

Gene Section

CDCP1 (CUB domain containing protein 1) 1 Mark Moasser, Danislav Spassov CENPW (centromere protein W) 5 Seyoung Jeon, Soojin Lee CXCR1 (chemokine (C-X-C motif) receptor 1) 8 Sivan Sapoznik, Stav Kozlovski, Gal Markel MIR133B (microRNA 133b) 12 Hiroyuki Tsuchiya, Li Wang NCR2 (natural cytotoxicity triggering receptor 2) 16 Nathan Horton, Kelly Bowen, Porunelloor Mathew PTPRR (protein tyrosine phosphatase, receptor type, R) 23 Mirthe Erkens, Hubertus Kremer, Rafael Pulido, Wiljan Hendriks TSPY1 (testis specific protein, Y-linked 1) 32 Stephanie Schubert EHMT2 (euchromatic histone-lysine N-methyltransferase 2) 38 Chandra-Prakash Chaturvedi, Marjorie Brand USP32 (ubiquitin specific peptidase 32) 46 Aysegul Sapmaz, Ayse Elif Erson-Bensan

Leukaemia Section

Chronic Myelomonocytic Leukemia (CMML) 50 Eric Solary t(3;21)(q26;q22) 53 Jean-Loup Huret

Solid Tumour Section

Soft tissue tumors: an overview 57 Paola Dal Cin

Deep Insight Section

Cell cycle, checkpoints and cancer 67 Laura Carrassa

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Case Report Section der(1;18)(q10;q10) in a pediatric patient with cytopenias 76 Adriana Zamecnikova, Soad Al Bahar

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

CDCP1 (CUB domain containing protein 1) Mark Moasser, Danislav Spassov Department of Medicine, Helen Diller Family Comprehensive Cancer Center, University of California, San Francisco, San Francisco, CA 94143, USA (MM, DS)

Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/CDCP1ID40016ch3p21.html DOI: 10.4267/2042/52068 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Review on CDCP1, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

2007). The isoform 2 encodes a truncated, secreted Identity protein of 343 amino acids, that contains the N- Other names: CD318, SIMA135, TRASK terminal part of the extracellular domain (and one CUB HGNC (Hugo): CDCP1 domain) of CDCP1 and lacks the transmembrane and intracellular modules. Currently, most studies have Location: 3p21.31 been focused on the more prominently expressed isoform 1. DNA/RNA The function and expression of isoform 2 remains Note poorly understood. CDCP1 (CUB Domain Containing Protein) was Pseudogene independently identified by several research groups. CDCP1 was initially isolated as a gene expressed in No pseudogenes, related to CDCP1 are present in the colorectal cancer (Scherl-Mostageer et al.,2001). The human genome. CDCP1 gene product was independently identified as a protein phosphorylated during mitosis and cellular Protein detachment by Src kinases (Bhatt et al., 2005) and it is Note also known as Trask (Transmembrane and Associated The full-length CDCP1 protein consists of 836 amino with Src Kinases). acids. The SDS PAGE migration of CDCP1 protein is Description approximately 140 kDa, which differs from its The CDCP1 gene comprises 9 verified exons. calculated molecular weight (approximately 90 kDa) due to extensive glycosylation (Bhatt et al., 2005). Transcription CDCP1 is cleaved by serine proteases at the Two alternative transcripts have been described (Perry extracellular domain next to Arg368 to generate a et al., 2007). truncated molecule of 80 kDa size (Bhatt et al., 2005) The full length transcript (isoform 1) is approximately (in some cases it is referred as 70kDa). Different cell 6.4 kb in length, spans all 9 exons and encodes a lines express different amounts of p140 and p80, transmembrane protein. The isoform 2 transcript is 1.4 depending on the activity of endogenous serine kb in length, contains the first four 5'exons of the proteases (Spassov et al., 2012). In vivo, CDCP1 is not CDCP1 gene. The isoform 2 transcript continues from cleaved during normal physiological circumstances, but the exon 4 end into the adjacent intron, where it its cleavage can be induced during tumorigenesis or terminates shortly at an alternative polyadenylation tissue injury. (Spassov et al., 2011; Spassov et al., signal, giving rise to a truncated transcript (Perry et al., 2013).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 1 CDCP1 (CUB domain containing protein 1) Moasser M, Spassov D

CDCP1 contains a signal peptide and a transmembrane region for proper membrane localization. The larger extracellular domain contains two or three CUB domains. The triangles indicate the naturally occurring cleavage sites after the signal peptide and at Arg368 of the extracellular domain. Abbreviations indicate the signal peptide (SP), CUB domains, transmembrane region (TM), proline-rich region (PRR). The intracellular domain contains 5 tyrosine residues (indicated by Y) all of which can be specifically phosphorylated by Src family kinases.

Description dismantling of focal adhesions (Spassov et al., 2011). Contrary, during cellular attachment CDCP1 is The full-length CDCP1 protein is a type I dephosphorylated, allowing the phosphorylation of transmembrane protein. The proper membrane focal adhesion proteins. Knockdown of CDCP1 leads localization is ensured by the presence of a signal to increased adhesiveness and experimentally induced peptide and a transmembrane domain (Bhatt et al., over-expression and phosphorylation of CDCP1 2005). decreases cell adhesion and leads to cell rounding and a The extracellular region is large and it is reported to detached phenotype (Spassov et al., 2011). CDCP1 contain two or three CUB domains. This difference regulates cellular migration and both loss of function arises because one of the Cub domains has a very weak and gain of functions of CDCP1 can lead to inhibition degree of homology and may not be recognized readily of migration (Spassov et al., 2011). The knockdown of as a Cub domain depending on the software used. CDCP1 leads to permanent cell attachment to The CUB (Complement protein components C1, substratum, while its excessive phosphorylation inhibits Urchin embryonic growth factor and Bone cell spreading and cell motility. The anti-adhesion and morphogenic protein 1) domains are characterized by anti-migratory functions of CDCP1 are mediated immunoglobulin-like folds and are involved in protein- through negative regulation on integrin receptors protein interactions and are found in functionally (Spassov et al., 2011). When phosphorylated by Src diverse, mostly developmentally regulated proteins and kinases, CDCP1 appears in complexes containing β1 in peptidases. The intracellular domain of CDCP1 integrin, interfering with integrin clustering and contains five tyrosine residues - Y707, Y734, Y743, preventing the mechanical and signaling events that Y762 and Y806. Phosphorylation of CDCP1 is link the intracellular cytoskeleton with the extracellular exclusively mediated by Src kinases (Bhatt et al., matrix. This is mediated through the inhibition of 2005). integrin clustering without affecting integrin affinity Expression state or ligand binding activity (Spassov et al., 2011). CDCP1 is predominantly expressed in epithelial tissues Homology and its expression is not detectable in fibroblasts and other mesenchymal cells (Spassov et al., 2009). CDCP1 The human genome does not contain other genes also has been reported to be expressed in hematopoietic related to CDCP1. The degree of homology within the progenitor cells but not in mature blood cell types CUB domains of other proteins is low (maximum 20% (Bühring et al., 2004). identity). More importantly other CUB domain containing proteins do not contain the intracellular Localisation module that is regulated and phosphorylated by Src CDCP1 is a transmembrane protein and is located on kinases. This indicates that there is no other related the cell membrane. gene in the human genome that may play a redundant role with CDCP1. CDCP1 homologs are present only Function in the vertebrate species, including zebra fish, Xenopus, CDCP1, when phosphorylated, functions to inhibit chicken and mammals. CDCP1 is not present in integrin signaling, disrupt focal adhesions and oppose invertebrates and lower organisms. cell adhesion (Spassov et al., 2011). Phosphorylation of CDCP1 depends on the adherence state of the cells Mutations (Spassov et al., 2009). The loss of anchorage or cellular detachment is associated with the phosphorylation of Note CDCP1 as well as the concomitant dephosphorylation CDCP1 is localized on chromosomal region (3p21.31), of focal adhesion proteins, consistent with the which is very frequently deleted in human cancers (Ji et

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 2 CDCP1 (CUB domain containing protein 1) Moasser M, Spassov D

al., 2005). LOH of CDCP1 is frequent (90-100%) in in CDCP1 null mice, establishing a tumor suppressing lung cancers and has been observed in breast cancers function for this gene during cancer initiation and and other cancer types. evolution (Spassov et al., 2013). Mechanistic Germinal investigations in mammary tumor cell lines derived from CDCP1-deficient mice revealed a de-repression of Germinal mutations associated with disease have not integrin signaling and an enhancement of integrin- been described yet. Several polymorphic sites are growth factor receptor cross-talk; hence increased described in the gene databases. The role of these growth factor signaling and cell proliferation of polymorphic sites is currently unknown. CDCP1 null cancer cells (Spassov et al., 2013). Somatic Metastasis Somatic mutations in cancer are infrequent. According The role of CDCP1 in cellular migration may suggest a to COSMIC database (http://cancer.sanger.ac.uk) potential role of this gene in cancer metastasis. currently (June 2013) 38 somatic cancer mutations However, this role may be a complex one, considering have been identified from 7080 tumor samples (0.5%). that both loss of function and gain of function of Some cancer types show somewhat elevated mutational CDCP1 inhibit migratory capacity of the cells. frequency; for instance 2.4% in melanoma and 1.4 % in Inducible expression and phosphorylation of CDCP1 in colon cancer. It is unclear at this moment if these breast cancer MCF7 cell line decreased the number of mutations have functional significance or represent lymph node metastasis after orthotopic mammary fat passenger mutations. pad implantation (Spassov et al., 2012). Similarly, the inducible expression of CDCP1 in v-src transformed Implicated in NIH3T3 cells significantly decreased the lung colonization capacity of the cells after tail vein Tumorigenesis inoculation (Spassov et al., 2012). Knockdown of CDCP1 have also been reported to decrease Note experimental metastasis of lung and melanoma cell Expression and phosphorylation in tumors lines (Uekita et al., 2007; Liu et al., 2011). Future work The expression of CDCP1 relative to the normal is required to elucidate the functions of CDCP1 in epithelium is reduced or lost in some tumors, cancer metastasis and whether there will be clinical particularly in breast, colon, prostate and lung cancers benefits of targeting this gene. Several efforts have (Wong et al., 2009; Spassov et al., 2012). This is due to been made to target CDCP1 with monoclonal antibody loss of heterozygosity in CDCP1 genomic region that recognizes the extracellular domain of the protein. and/or promoter methylation (Spassov et al., 2012). Such antibodies induce the phosphorylation of CDCP1 CDCP1 is widely and abundantly expressed in human and have been shown to suppress experimental epithelial tissues, but its phosphorylation is not metastasis in preclinical models (Siva at al., 2008; detectable in normally anchored epithelial layers Casar et al., 2012). It is unclear if this is due to effects (Spassov et al., 2009). However, phosphorylation of on CDCP1 function or if it is mediated through CDCP1 is seen in many epithelial tumors from all immunological mechanisms. stages including early stage carcinomas, invasive, and metastatic tumors (Wong et al., 2009). The Hybrid/Mutated gene phosphorylation of CDCP1 in tumors suggests that they No hybrid genes, containing CDCP1 are known. may exist at an abnormal or deficient state of Abnormal protein anchorage in vivo (Spassov et al., 2011). This may be No fusions with CDCP1 have been reported. due to abnormalities in the composition of the Oncogenesis surrounding matrix, defective assembly of adhesion CDCP1 null mice show accelerated oncogenesis in complexes, or defective signaling through the integrin genetically modified experimental models of skin and adhesion complex. Specifically, this may be due to the breast cancers. absence of a continuous basal lamina which typically underlies the basal surface of epithelial cells in the normal epithelium but is highly abnormal or missing in References epithelial tumors. Scherl-Mostageer M, Sommergruber W, Abseher R, Animal model Hauptmann R, Ambros P, Schweifer N. Identification of a novel gene, CDCP1, overexpressed in human colorectal cancer. Mice lacking CDCP1 do not exhibit gross morphologic, Oncogene. 2001 Jul 19;20(32):4402-8 reproductive or behavioral abnormalities compared with wild-type mice, and histologic examination of Bühring HJ, Kuçi S, Conze T, Rathke G, Bartolovi ć K, Grünebach F, Scherl-Mostageer M, Brümmendorf TH, multiple organ systems found no significant pathology Schweifer N, Lammers R. CDCP1 identifies a broad spectrum and no observed histologic differences (Spassov et al., of normal and malignant stem/progenitor cell subsets of 2013). Mammary tumors driven by the PyMT hematopoietic and nonhematopoietic origin. Stem Cells. oncogene and skin tumors driven by activation of 2004;22(3):334-43 Hedgehog pathway developed with accelerated kinetics

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 3 CDCP1 (CUB domain containing protein 1) Moasser M, Spassov D

Bhatt AS, Erdjument-Bromage H, Tempst P, Craik CS, Liu H, Ong SE, Badu-Nkansah K, Schindler J, White FM, Moasser MM. Adhesion signaling by a novel mitotic substrate Hynes RO. CUB-domain-containing protein 1 (CDCP1) of src kinases. Oncogene. 2005 Aug 11;24(34):5333-43 activates Src to promote melanoma metastasis. Proc Natl Acad Sci U S A. 2011 Jan 25;108(4):1379-84 Ji L, Minna JD, Roth JA. 3p21.3 tumor suppressor cluster: prospects for translational applications. Future Oncol. 2005 Spassov DS, Wong CH, Sergina N, Ahuja D, Fried M, Feb;1(1):79-92 Sheppard D, Moasser MM. Phosphorylation of Trask by Src kinases inhibits integrin clustering and functions in exclusion Perry SE, Robinson P, Melcher A, Quirke P, Bühring HJ, Cook with focal adhesion signaling. Mol Cell Biol. 2011 GP, Blair GE. Expression of the CUB domain containing Feb;31(4):766-82 protein 1 (CDCP1) gene in colorectal tumour cells. FEBS Lett. 2007 Mar 20;581(6):1137-42 Casar B, He Y, Iconomou M, Hooper JD, Quigley JP, Deryugina EI. Blocking of CDCP1 cleavage in vivo prevents Uekita T, Jia L, Narisawa-Saito M, Yokota J, Kiyono T, Sakai Akt-dependent survival and inhibits metastatic colonization R. CUB domain-containing protein 1 is a novel regulator of through PARP1-mediated apoptosis of cancer cells. anoikis resistance in lung adenocarcinoma. Mol Cell Biol. 2007 Oncogene. 2012 Aug 30;31(35):3924-38 Nov;27(21):7649-60 Spassov DS, Wong CH, Harris G, McDonough S, Phojanakong Siva AC, Wild MA, Kirkland RE, Nolan MJ, Lin B, Maruyama T, P, Wang D, Hann B, Bazarov AV, Yaswen P, Khanafshar E, Yantiri-Wernimont F, Frederickson S, Bowdish KS, Xin H. Moasser MM. A tumor-suppressing function in the epithelial Targeting CUB domain-containing protein 1 with a monoclonal adhesion protein Trask. Oncogene. 2012 Jan 26;31(4):419-31 antibody inhibits metastasis in a prostate cancer model. Cancer Res. 2008 May 15;68(10):3759-66 Spassov DS, Wong CH, Wong SY, Reiter JF, Moasser MM. Trask loss enhances tumorigenic growth by liberating integrin Spassov DS, Baehner FL, Wong CH, McDonough S, Moasser signaling and growth factor receptor cross-talk in unanchored MM. The transmembrane src substrate Trask is an epithelial cells. Cancer Res. 2013 Feb 1;73(3):1168-79 protein that signals during anchorage deprivation. Am J Pathol. 2009 May;174(5):1756-65 This article should be referenced as such: Wong CH, Baehner FL, Spassov DS, Ahuja D, Wang D, Hann Moasser M, Spassov D. CDCP1 (CUB domain containing B, Blair J, Shokat K, Welm AL, Moasser MM. Phosphorylation protein 1). Atlas Genet Cytogenet Oncol Haematol. 2014; of the SRC epithelial substrate Trask is tightly regulated in 18(1):1-4. normal epithelia but widespread in many human epithelial cancers. Clin Cancer Res. 2009 Apr 1;15(7):2311-22

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 4 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

CENPW (centromere protein W) Seyoung Jeon, Soojin Lee Department of Microbiology and Molecular Biology, Chungnam National Institute, 305-764, Daejeon, Republic of Korea (SJ, SL)

Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/CENPWID51452ch6q22.html DOI: 10.4267/2042/52069 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Short communication on CENPW, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

It contains a typical NLS sequence and histone fold Identity region which is critical for binding to centromeric Other names: C6orf173, CUG2 DNA. HGNC (Hugo): CENPW Expression Location: 6q22.32 Widely expressed; kidney, colon, breast, liver, lung, DNA/RNA ovary, prostate, thyroid, etc. Localisation Description Intracellular, nucleus, centromere, kinetochore, nucleus Exons: 3, coding exons: 3, introns: 2. matrix, nucleolus. Transcription Function Transcript length: 750 bps, open reading frame: 264 CENP-W was originally identified as a cancer- bps. upregulated gene 2 (CUG2) which is commonly Pseudogene overexpressed in various human cancer tissues. Although it has high oncogenic activities, CENP-W No pseudogene. also induces cell apoptosis when overexpressed in certain cell lines. After it was revealed that CENP-W Protein forms a stable heterodimer with CENP-T and is localized in kinetochores during mitosis, CENP-W Description become recognized as a new member of the inner CENP-W gene encodes 88-amino acid protein which centromere protein complex. Subsequent studies have shows ~27% of amino acid sequence similarity to a also shown that CENP-T-W-S-X forms a unique general transcription repressor, human DR1. centromeric nucleosome-like heterotetramer structure which binds to and supercoils DNA.

Figure 1. A genomic structure of the CENPW gene.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 5 CENPW (centromere protein W) Jeon S, Lee S

Figure 2. Schematic representation of CENPW protein. Each domain is represented with the unique color and name. One nuclear localization signal (NLS) sequence of 17 amino acids starts at amino acid 13.

Figure 3. mRNA expression of CUG2 in various tumors. DNA chip microarray profile in tumors (closed bar) and normal (open bar) tissues from the Gene Express Oncology Datasuite TM of Gene Logic Inc.

As a nucleolus-associated protein, CENP-W may play critical role in the formation of functional kinetochore, Implicated in possibly by facilitating the recruitment of other Various human cancers centromeric components during interphase, which is required for proper chromosome segregation during Oncogenesis mitosis. CENP-W has been found to be upregulated in several tumor tissues. When the expression level of CENP-W Homology was examined by DNA chip microarray and RT-PCR According to NCBI-HomoloGene: in tumors, six tissues (ovary, liver, lung, pancreas, Pan troglodytes (chimpanzee): centromere protein W colon, and stomach) showed high-fold increases in (NP_001012525.1, 88 aa) expression profiles. Also, CENP-W-transformed Macacamulatta (Rhesus monkey): centromere protein NIH3T3 cells exhibited exceptionally prominent W (XP_001107034.2, 88 aa) cancerous phenotypes in vitro as well as in vivo tumor Canis lupus familiaris (dog): centromere protein W-like forming assays. (XP_003638832.1, 88 aa) Bostaurus (cattle): centromere protein W References (NP_001104731.1, 88 aa) Lee S, Gang J, Jeon SB, Choo SH, Lee B, Kim YG, Lee YS, Mus musculus (house mouse): centromere protein W Jung J, Song SY, Koh SS. Molecular cloning and functional (NP_001103217.1, 86 aa) analysis of a novel oncogene, cancer-upregulated gene 2 Rattus norvegicus (Norway rat): centromere protein W (CUG2). Biochem Biophys Res Commun. 2007 Aug (XP_001070657.1, 86 aa). 31;360(3):633-9 Kim H, Lee M, Lee S, Park B, Koh W, Lee DJ, Lim DS, Lee S. Mutations Cancer-upregulated gene 2 (CUG2), a new component of centromere complex, is required for kinetochore function. Mol Note Cells. 2009 Jun 30;27(6):697-701 Over expressed in various cancer tissues; notably high Kim H, Lee S, Park B, Che L, Lee S. Sp1 and Sp3 mediate in the ovary (6.3-fold), liver (6.0), lung (4.9), and basal and serum-induced expression of human CENP-W. Mol pancreas (3.8). Biol Rep. 2010 Oct;37(7):3593-600

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 6 CENPW (centromere protein W) Jeon S, Lee S

Lee S, Koh W, Kim HT, Kim CH, Lee S. Cancer-upregulated CNS development in zebrafish. BMC Dev Biol. 2011 Aug gene 2 (CUG2) overexpression induces apoptosis in SKOV-3 15;11:49 cells. Cell Biochem Funct. 2010 Aug;28(6):461-8 Prendergast L, van Vuuren C, Kaczmarczyk A, Doering V, Park EH, Park EH, Cho IR, Srisuttee R, Min HJ, Oh MJ, Jeong Hellwig D, Quinn N, Hoischen C, Diekmann S, Sullivan KF. YJ, Jhun BH, Johnston RN, Lee S, Koh SS, Chung YH. CUG2, Premitotic assembly of human CENPs -T and -W switches a novel oncogene confers reoviral replication through Ras and centromeric chromatin to a mitotic state. PLoS Biol. 2011 p38 signaling pathway. Cancer Gene Ther. 2010 Jun;9(6):e1001082 May;17(5):307-14 Nishino T, Takeuchi K, Gascoigne KE, Suzuki A, Hori T, Chun Y, Park B, Koh W, Lee S, Cheon Y, Kim R, Che L, Lee Oyama T, Morikawa K, Cheeseman IM, Fukagawa T. CENP-T- S. New centromeric component CENP-W is an RNA- W-S-X forms a unique centromeric chromatin structure with a associated nuclear matrix protein that interacts with histone-like fold. Cell. 2012 Feb 3;148(3):487-501 nucleophosmin/B23 protein. J Biol Chem. 2011 Dec 9;286(49):42758-69 This article should be referenced as such: Kim HT, So JH, Jung SH, Ahn DG, Koh W, Kim NS, Kim SH, Jeon S, Lee S. CENPW (centromere protein W). Atlas Genet Lee S, Kim CH. Cug2 is essential for normal mitotic control and Cytogenet Oncol Haematol. 2014; 18(1):5-7.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 7 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

CXCR1 (chemokine (C-X-C motif) receptor 1) Sivan Sapoznik, Stav Kozlovski, Gal Markel The Ella Institute for Melanoma Research and Treatment, Cancer Research Center, Sheba Medical Center, Israel (SS), The Ella Institute for Melanoma Research and Treatment, Cancer Research Center, Sheba Medical Center, Israel and Clinical Microbiology and Immunology, The Sackler School of Medicine of the Tel Aviv University, Israel (SK), The Ella Institute for Melanoma Research and Treatment, Cancer Research Center, and Talpiot Medical Leadership Program, Sheba Medical Center, Israel and Clinical Microbiology and Immunology, The Sackler School of Medicine of the Tel Aviv University, Israel (GM)

Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/CXCR1ID40966ch2q35.html DOI: 10.4267/2042/52070 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Review on CXCR1, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

Identity Transcription Transcripts: primer extension analysis revealed two Other names: C-C, C-C-CKR-1, CD128, CD181, start sites for CXCR1 (Sprenger et al., 1995). In CDw128a, CKR-1, CMKAR1, IL8R1, IL8RA, addition, neutrophils contain two transcripts of CXCR1 IL8RBA (2.0 and 4.0 kb) which result from the usage of HGNC (Hugo): CXCR1 alternative poly adenylation signals. Location: 2q35 Transcription regulators: PU.1, which belongs to the ets family of transcription factors, is a major activator of Local order: Orientation: minus strand. CXCR1 expression (Wilkinson and Navarro, 1999). Note HIF1 and NF-kappaB mediate the transcription of CXCR1 together with IL8RB, another high affinity IL- CXCR1 under hypoxia in prostate cancer cells 8 receptor, and its pseudogene (IL8RBP), form a gene (Maxwell et al., 2007). cluster in chromosome 2q33-q36 (provided by RefSeq, CXCR1 mRNA expression is also regulated by G-CSF Jul 2008). (Lloyd et al., 1995). DNA/RNA Pseudogene Conservation during evolution: the CXCR1 gene was Description present in the common ancestor of chordates and has The CXCR1 gene (il8ra) is 4149 bp long and is orthologs in diverse species, from lizards and Xenopus composed of two exons, one of them included in the to primates. coding region (1053 bp) CXCR1 has 165 known SNPs; There is a high level of homology between CXCR1 many of them correlate with disease states. from human, rabbit, rat, and mouse. The sequencing of Genetic locus: CXCR1, together with its homolog the coding region of CXCR1 in worldwide human CXCR2 (76% amino acids identity) and its pseudogene populations and 5 representative nonhuman primate (il8rp), reside in chromosome 2q34-35. The high species revealed accelerated protein evolution in the homology and close chromosomal localization between human lineage, mainly at the N-terminal the three genes suggest gene duplications. ligand/receptor recognition domain (Liu et al., 2005).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 8 CXCR1 (chemokine (C-X-C motif) receptor 1) Sapoznik S, et al.

Figure 1.

inflammation. IL-8 (CXCL8), the main ligand of Protein CXCR1, is a powerful neutrophil chemotactic factor Description and its binding to CXCR1 induces activation and migration of neutrophils (Holmes et al., 1991; Liu et 350 amino acids, 39791 Da. al., 2005). CXCR1 is a G protein coupled receptor (GPCR), In neutrophils, receptor activation also stimulates the composed of seven transmembrane (TM) helices, an N- release of granule enzymes and the generation of terminal ligand binding domain and a signaling superoxide in respiratory burst (Jones et al., 1996). cytoplasmic tail. In addition to its effect on immune cells, CXCR1 may Expression be important in regulating vasculogenesis and Expression in tissues: according to SAGE (serial consequent tumor growth (Strieter et al., 1995). analysis of gene expression), CXCR1 is mainly The signaling pathway of CXCR1 as a G protein expressed in the bone marrow, retina, heart, lungs and coupled receptor is presented in figure 1. Noteworthy, in the placenta. CXCR1 signaling also activates monomeric, low Expression in cell types: CXCR1 is expressed on a molecular weight G proteins of the Ras and Rho wide variety of cell types, including neutrophils, families (Laudanna et al., 1996). monocytes, CD8 T cells, mast cells, basophils, natural Ligand selectivity: CXCR1 displays a relatively narrow killer cells, keratinocytes, fibroblasts, neurons, selectivity and high preference for IL-8. At low affinity endothelial cells, and melanocytes. it also binds MGSA/GRO. Expression regulators: CXCR1 was found to be upregulated by IL6, by a yet-unknown mechanism Implicated in (Eikawa et al., 2010). Melanoma Localisation Note CXCR1 resides in the plasma membrane and Highly expressed by melanoma cells and and mediates transduces signals into the cell (figure 1). their proliferation and invasiveness in vitro and tumor growth in mice experiments (Singh et al., 2009). Function Recently, it was shown as a potential target for T cell Upon binding to its ligands, CXCR1 transduces signals engineering, a finding which highly impacts on via the phosphatidylinositol-calcium second messenger adoptive cell immune-therapy for melanoma patients system and plays an important role in acute (Sapoznik et al., 2012).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 9 CXCR1 (chemokine (C-X-C motif) receptor 1) Sapoznik S, et al.

Breast cancer negatively correlated with the inflammatory infiltrate in the airways (Pignatti et al., 2005). Note CXCR1 is over-expressed in tumor and cascular Urinary tract infection recurrent endothelial cells, as shown by immunohistochemistry Note studies on a cohort of 50 breast cancer patients CXCR1 was first identified as a candidate gene for performed by Miller et al. (Miller et al., 1998). urinary tract infections when Godaly et al showed that Recently, Singh and his colleagues showed that mIL-8Rh mutant mice developed acute pyelonephiritis CXCR1 as well as CXCR2 are important mediators of with severe renal scattering (Godaly et al., 2001). breast cancer stem-like cells activity. Lundstedt et al. have afterwards identified two Furthermore, blockade of CXCR1 and CXCR2 adds to sequence variants which were shown to impair the inhibitory effect of HER2-targeted therapy on these transcription of CXCR1 and led to reduced levels of the cells and may potentially serve as a novel therapeutic CXCR1 protein in children prone to urinary tract strategy for breast cancer (Singh et al., 2013). infections (Lundstedt et al., 2007). Colorectal cancer Psoriasis Note Note CXCR1 is over-expressed in colorectal cancer cells A single study by Arenberger et al showed in a small (Abolhassani et al., 2008) and antagonists of CXCR1 cohort of psoriasis patients that CXCR1 is slightly and CXCR2 inhibit liver metastases of human colon though significantly over-expressed in cancer in a murine model (Varney et al., 2011). polymorphonuclear leukocyte infiltration in the Interestingly, based on two large cohorts of population epidermis as compared to normal volunteers incident studies, Bondurant and his colleagues were (Arenberger et al., 1992). recently able to show that SNPs in genes connected with the IL8 pathway (including CXCR1 and CXCR2) References are associated with higher risk of both colon and rectal cancers (Bondurant et al., 2013). Holmes WE, Lee J, Kuang WJ, Rice GC, Wood WI. Structure and functional expression of a human interleukin-8 receptor. Prostate cancer Science. 1991 Sep 13;253(5025):1278-80 Note Arenberger P, Kemény L, Süss R, Michel G, Peter RU, CXCR1 is over-expressed in tumor cells from human Ruzicka T. Interleukin-8 receptors in normal and psoriatic polymorphonuclear leukocytes. Acta Derm Venereol. 1992 prostate biopsies (Murphy et al., 2005). Depletion of Sep;72(5):334-6 CXCR1 by RNA interference in androgen-independent human prostate cancer cells induces cell death and Lloyd AR, Biragyn A, Johnston JA, Taub DD, Xu L, Michiel D, Sprenger H, Oppenheim JJ, Kelvin DJ. Granulocyte-colony reduced proliferation in vitro (Shamaladevi et al., stimulating factor and lipopolysaccharide regulate the 2009). expression of interleukin 8 receptors on polymorphonuclear In consistence with that, downregulation of CXCR1 leukocytes. J Biol Chem. 1995 Nov 24;270(47):28188-92 by shRNA or by a specific antagonist lead to inhibition Sprenger H, Lloyd AR, Kelvin DJ. Promoter analysis of the of human xenograft growth in immune-deficient mice human interleukin-8 receptor genes, IL-8RA and IL-8RB. (Shamaladevi et al., 2009; Liu et al., 2012). Immunobiology. 1995 Jul;193(2-4):334-40 Strieter RM, Polverini PJ, Arenberg DA, Walz A, Opdenakker Nasopharyngeal carcinoma G, Van Damme J, Kunkel SL. Role of C-X-C chemokines as Note regulators of angiogenesis in lung cancer. J Leukoc Biol. 1995 Immune-histochemical analysis of 30 patients with May;57(5):752-62 nasopharyngeal carcinoma proved that its expression in Jones SA, Wolf M, Qin S, Mackay CR, Baggiolini M. Different tumor tissue significantly correlates with a shorter functions for the interleukin 8 receptors (IL-8R) of human neutrophil leukocytes: NADPH oxidase and phospholipase D overall survival rate. are activated through IL-8R1 but not IL-8R2. Proc Natl Acad Thus it is an indicator of poor prognosis in Sci U S A. 1996 Jun 25;93(13):6682-6 nasopharyngeal carcinoma (Horikawa et al., 2005). Laudanna C, Campbell JJ, Butcher EC. Role of Rho in Chronic obstractive pulmonary disease chemoattractant-activated leukocyte adhesion through (COPD) integrins. Science. 1996 Feb 16;271(5251):981-3 Miller LJ, Kurtzman SH, Wang Y, Anderson KH, Lindquist RR, Note Kreutzer DL. Expression of interleukin-8 receptors on tumor CXCR1 polymorphisms are identified polymorphisms cells and vascular endothelial cells in human breast cancer associated with COPD and asthma, as shown by tissue. Anticancer Res. 1998 Jan-Feb;18(1A):77-81 Stemmler et al. by screening 50 COPD patients Wilkinson NC, Navarro J. PU.1 regulates the CXCR1 promoter. (Stemmler et al., 2005). J Biol Chem. 1999 Jan 1;274(1):438-43 Pignatti and colleagues found that neutrophilic asthma Godaly G, Bergsten G, Hang L, Fischer H, Frendéus B, patients have similar expression levels of CXCR1 as Lundstedt AC, Samuelsson M, Samuelsson P, Svanborg C. COPD patients and that CXCR1 expression is

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 10 CXCR1 (chemokine (C-X-C motif) receptor 1) Sapoznik S, et al.

Neutrophil recruitment, chemokine receptors, and resistance to Shamaladevi N, Lyn DA, Escudero DO, Lokeshwar BL. CXC mucosal infection. J Leukoc Biol. 2001 Jun;69(6):899-906 receptor-1 silencing inhibits androgen-independent prostate cancer. Cancer Res. 2009 Nov 1;69(21):8265-74 Horikawa T, Kaizaki Y, Kato H, Furukawa M, Yoshizaki T. Expression of interleukin-8 receptor A predicts poor outcome in Singh S, Nannuru KC, Sadanandam A, Varney ML, Singh RK. patients with nasopharyngeal carcinoma. Laryngoscope. 2005 CXCR1 and CXCR2 enhances human melanoma Jan;115(1):62-7 tumourigenesis, growth and invasion. Br J Cancer. 2009 May 19;100(10):1638-46 Liu Y, Yang S, Lin AA, Cavalli-Sforza LL, Su B. Molecular evolution of CXCR1, a G protein-coupled receptor involved in Eikawa S, Ohue Y, Kitaoka K, Aji T, Uenaka A, Oka M, signal transduction of neutrophils. J Mol Evol. 2005 Nakayama E. Enrichment of Foxp3+ CD4 regulatory T cells in Nov;61(5):691-6 migrated T cells to IL-6- and IL-8-expressing tumors through predominant induction of CXCR1 by IL-6. J Immunol. 2010 Dec Murphy C, McGurk M, Pettigrew J, Santinelli A, Mazzucchelli 1;185(11):6734-40 R, Johnston PG, Montironi R, Waugh DJ. Nonapical and cytoplasmic expression of interleukin-8, CXCR1, and CXCR2 Varney ML, Singh S, Li A, Mayer-Ezell R, Bond R, Singh RK. correlates with cell proliferation and microvessel density in Small molecule antagonists for CXCR2 and CXCR1 inhibit prostate cancer. Clin Cancer Res. 2005 Jun 1;11(11):4117-27 human colon cancer liver metastases. Cancer Lett. 2011 Jan 28;300(2):180-8 Pignatti P, Moscato G, Casarini S, Delmastro M, Poppa M, Brunetti G, Pisati P, Balbi B. Downmodulation of CXCL8/IL-8 Liu X, Peng J, Sun W, Yang S, Deng G, Li F, Cheng JW, receptors on neutrophils after recruitment in the airways. J Gordon JR. G31P, an antagonist against CXC chemokine Allergy Clin Immunol. 2005 Jan;115(1):88-94 receptors 1 and 2, inhibits growth of human prostate cancer cells in nude mice. Tohoku J Exp Med. 2012;228(2):147-56 Stemmler S, Arinir U, Klein W, Rohde G, Hoffjan S, Wirkus N, Reinitz-Rademacher K, Bufe A, Schultze-Werninghaus G, Sapoznik S, Ortenberg R, Galore-Haskel G, Kozlovski S, Levy Epplen JT. Association of interleukin-8 receptor alpha D, Avivi C, Barshack I, Cohen CJ, Besser MJ, Schachter J, polymorphisms with chronic obstructive pulmonary disease Markel G. CXCR1 as a novel target for directing reactive T and asthma. Genes Immun. 2005 May;6(3):225-30 cells toward melanoma: implications for adoptive cell transfer immunotherapy. Cancer Immunol Immunother. 2012 Lundstedt AC, McCarthy S, Gustafsson MC, Godaly G, Jodal Oct;61(10):1833-47 U, Karpman D, Leijonhufvud I, Lindén C, Martinell J, Ragnarsdottir B, Samuelsson M, Truedsson L, Andersson B, Bondurant KL, Lundgreen A, Herrick JS, Kadlubar S, Wolff RK, Svanborg C. A genetic basis of susceptibility to acute Slattery ML. Interleukin genes and associations with colon and pyelonephritis. PLoS One. 2007 Sep 5;2(9):e825 rectal cancer risk and overall survival. Int J Cancer. 2013 Feb 15;132(4):905-15 Maxwell PJ, Gallagher R, Seaton A, Wilson C, Scullin P, Pettigrew J, Stratford IJ, Williams KJ, Johnston PG, Waugh DJ. Singh JK, Farnie G, Bundred NJ, Simões BM, Shergill A, HIF-1 and NF-kappaB-mediated upregulation of CXCR1 and Landberg G, Howell SJ, Clarke RB. Targeting CXCR1/2 CXCR2 expression promotes cell survival in hypoxic prostate significantly reduces breast cancer stem cell activity and cancer cells. Oncogene. 2007 Nov 15;26(52):7333-45 increases the efficacy of inhibiting HER2 via HER2-dependent and -independent mechanisms. Clin Cancer Res. 2013 Feb Abolhassani M, Aloulou N, Chaumette MT, Aparicio T, Martin- 1;19(3):643-56 Garcia N, Mansour H, Le Gouvello S, Delchier JC, Sobhani I. Leptin receptor-related immune response in colorectal tumors: This article should be referenced as such: the role of colonocytes and interleukin-8. Cancer Res. 2008 Nov 15;68(22):9423-32 Sapoznik S, Kozlovski S, Markel G. CXCR1 (chemokine (C-X- C motif) receptor 1). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1):8-11.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 11 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

MIR133B (microRNA 133b) Hiroyuki Tsuchiya, Li Wang Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, Utah, USA (HT, LW)

Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR133BID52086ch6p12.html DOI: 10.4267/2042/52071 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Review on MIR133B, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

beginning and the end of the pri-miR133B sequence are Identity unknown. Other names: MIRN133B, miRNA133B, mir-133b Pre-miR133B HGNC (Hugo): MIR133B miRBase accession number: MI0000822. Length: 119 nucleotides. Location: 6p12.2 Sequence: Local order: Based on MapViewer, gene flanking 5'- MIR133B oriented from centromere to telomere on CCTCAGAAGAAAGATGCCCCCTGCTCTGGCTG 6p12.2 are: GTCAAACGGAACCAAGTCCGTCTTCCTGAGAG - MCM3: minichromosome maintenance complex GTTTGGTCCCCTTCAACCAGCTACAGCAGGGCT component 3 GGCAATGCCCAGTCCTTGGAGA-3' - IL17F: interleukin 17F Mature miR133B - IL17A: interleukin 17A miRBase accession number: MIMAT0000770. - MIR133B: microRNA 133B Length: 22 nucleotides. - MIR206: microRNA 206 Sequence: - PKHD1: polycystic kidney and hepatic disease 1 5'-TTTGGTCCCCTTCAACCAGCTA-3' (autosomal recessive). Pseudogene DNA/RNA Pseudogenes were not reported. Description Protein Homologues have been discovered in several other species including invertebrates, most of which has Note multiple miR133 family members. For example, the MicroRNAs are not translated into aminoacids. human genome encodes three miR133 genes: miR133A1, miR133A2 and miR133B on chromosomes Mutations 18, 20 and 6, respectively. Note Transcription A single nucleotide variation was reported (Reference MiR133B is specifically modestly expressed in the SNP ID: rs112599381). The variation is T>C at substantia nigra pars compacta as well as in position 52013754 (according to hg19-Feb_2009) with GABAergic neurons of cortex and cerebellum. The unknown frequency.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 12 MIR133B (microRNA 133b) Tsuchiya H, Wang L

A. Homo sapiens stem-loop structure of pre-miR133B. Red characters indicate mature miR133B sequence. B. The human miR133 family members.

Implicated in Colorectal cancer Note Bladder cancer Downregulation of miR-133b expression was Note significant in human colorectal cancer tissues compared A subset of 7 miRNAs (miR-145, miR-30a-3p, miR- with adjacent normal tissues. 133a, miR-133b, miR-195, miR-125b and miR-199a*) Ectopic expression of miR-133b potently affected were found to be significantly downregulated in colorectal cancer cell proliferation and apoptosis in bladder cancers (Ichimi et al., 2009). vitro and in vivo by direct targeting of the receptor Prognosis tyrosine kinase MET (Hu et al., 2010). Overexpression of miR-145, miR-1, miR-146a, miR-576-5p, miR-126*, Dyrskjøt et al. identified several miRNAs with HS287, miR-28-5p, miR-143, miR-199b-5p, miR- prognostic potential for predicting bladder tumor 199a-5p, miR-10b, miR-22, miR-133b, miR-145*, progression (e.g., miR-129, miR-133b, and miR-518c*) miR-199a, miR-133a, miR-125b and downregulation of (Dyrskjøt et al., 2009). miR-31 and HS170 were observed in brain-metastatic miR-133a and miR-133b were found to inhibit cell colorectal carcinomas (Li et al., 2012). proliferation, migration and invasion in T24 and EJ cells. Prognosis The first evidence was provided that miR-133a and High expression of miR-185 and low expression of miR-133b may directly target the epidermal growth miR-133b were correlated with poor survival (p=0.001 factor receptor in bladder cancer (Zhou et al., 2012). and 0.028, respectively) and metastasis (p=0.007 and 0.036, respectively) in colorectal cancer. (Akçakaya et Cervical carcinoma al., 2011). Note Gastric cancer Transfection with miR-133b rendered HeLa cells Note sensitive to TNF-a, TRAIL and FasL-induced cell The most highly expressed miRNAs in non-tumorous death, by targeting the antiapoptotic protein Fas tissues were miR-133b as well as miR-768-3p, miR- apoptosis inhibitory molecule (FAIM) (Patron et al., 139-5p, miR-378, miR-31, miR-195, miR-497, 2012). compared to in gastric cancer tissues (Guo et al., 2009). Oncogenesis miR-133b was downregulated in high-grade miR-133b enhances cell proliferation and colony gastrointestinal stromal tumors. Fascin-1 mRNA was formation by targeting mammalian sterile 20-like upregulated in accordance with miR-133b kinase 2 (MST2), cell division control protein 42 downregulation in high-grade gastrointestinal stromal homolog (CDC42) and ras homolog gene family tumors; this result was consistent with a previous report member A (RHOA), which subsequently results in showing that fascin-1 might be a direct target of miR- activation of the tumorigenic protein kinase B alpha 133b (Yamamoto et al., 2013). miR-133b targets (AKT1) and mitogen-activated protein kinase (ERK1 FGFR1 and inhibits gastric cancer cell growth (Wen et and ERK2, here abbreviated as ERK) signaling al., 2013). pathways. Lung cancer Upregulation of miR-133b in cervical carcinoma cells strongly promotes both in vivo tumorigenesis and Prognosis independent metastasis to the mouse lung (Qin et al., MiR-133B had the lowest expression of miRNA in 2012). lung tumor tissue compared to adjacent uninvolved

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 13 MIR133B (microRNA 133b) Tsuchiya H, Wang L

tissue. Selective over-expression of miR-133B in reduction in proliferation rate possibly through the adenocarcinoma (H2009) cell lines resulted in reduced downregulation of pyruvate kinase type M2 (Wong et expression of MCL-1 and BCL2L2. MiR-133B directly al., 2008a). Gain-of-function analysis revealed that 3 targets the 3'UTRs of both MCL-1 and BCL2L2. transfectants (miR-145, miR-133a and miR-133b) Lastly, over-expression of miR-133B induced apoptosis inhibit cell proliferation and cell invasion in esophageal following gemcitabine exposure in these tumor cells squamous cell carcinoma cells (Kano et al., 2010). (Crawford et al., 2009). miR-133b can inhibit cell miR-133b, was downregulated in esophageal squamous growth of NSCLC through targeting EGFR and cell carcinoma tissue compared with the adjacent regulating its downstream signaling pathway (Liu et al., normal tissue. Bioinformatics analyses identified that 2012). miR-133b was found to be involved in invasion and Oncogenesis metastasis of esophageal squamous cell carcinoma (Fu Serum miR-206 and miR-133b were significantly up- et al., 2013). regulated in the early stage of 4-(methylnitrosamino)-1- Muscular development (3-pyridyl)-1-butanone-induced lung carcinogenesis. Note miR-206 and miR-133b exhibited low-expression in miR-133b as well as miR-1, miR-133a, and miR-206 lung cancer tissues (Wu et al., 2013). levels were found increased during late stages of Osteosarcoma human foetal muscle development. Increases in the Note expression levels of these miRNAs were proportional A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, to the capacity of myoblasts to form myotubes. miR-31, miR-126, miR-142-3p, miR-133b, miR-144, Changes in miRNA levels during human foetal miR-195, miR-223, miR-451 and miR-497 was development were accompanied by endogenous identified with an intermediate expression level in alterations in their known targets and also in their osteosarcoma clinical samples compared to osteoblasts inducer, MyoD. Ectopic MyoD expression caused an and bone (Namløs et al., 2012). induction of muscle cell differentiation in vitro, accompanied by an increase in the levels of miR-1, Prostate cancer miR-133a, miR-133b and miR-206 (Koutsoulidou et Note al., 2011). miR-133a and miR-133b are expressed at the detection Myocardial hypertrophy and heart limit in two hormone-insensitive prostate cancer cell failure. lines, PC3 and DU145. Ectopic expression of miR-133 inhibited cell proliferation, migration and invasion in Note these cells, possibly by targeting EGFR (Tao et al., MiR133B expression was downregulated in the heart 2012). A significant lower expression of miR-1, miR- obtained from idiopathic cardiomyopathy and ischemic 133b and miR-378* was observed in osteosarcomas patients (Sucharov et al., 2008). with respect to control, and also in 31 high-grade Disease osteosarcomas than in 25 low-grade and in metastatic Down-regulation of miR-133b induced an increase in versus non-metastatic patients. The expression of miR- cardiomyocyte size while over-expression of miR-133b 1 and miR-133b may control cell proliferation and cell dramatically reduced the cell size, suggesting that miR- cycle through MET protein expression modulation 133b may be a global regulator of cardiomyocyte (Novello et al., 2013). hypertrophy (Sucharov et al., 2008). Oncogenesis Xiao et al. quantified the muscle-specific microRNA miR-133b is directly up-regulated by androgen subtypes miR-133a and miR-133b, which can receptor, represses CDC2L5, PTPRK, RB1CC1, and posttranscriptionally regulate and repress KvLQT1 CPNE3, and, is essential to prostate cancer cell survival protein expression without affecting mRNA expression (Mo et al., 2013). (Xiao L et al., 2008). miR-1, miR-133a, miR-133b, and miR-208b were independently associated with high- Squamous cell carcinoma sensitivity troponin T levels (all P<0.001) in plasma Note samples obtained on admission from 444 patients with MiR133B expression was downregulated in laser acute coronary syndrome (Widera et al., 2011). microdissected cells of tongue squamous cell carcinoma (Wong et al., 2008b). MiR-133b as well as References miR-145, miR-30a-3p, and miR-133a are Sucharov C, Bristow MR, Port JD. miRNA expression in the downregulated in esophageal squamous cell carcinoma failing human heart: functional correlates. J Mol Cell Cardiol. (Kano et al., 2010). 2008 Aug;45(2):185-92 Oncogenesis Wong TS, Liu XB, Chung-Wai Ho A, Po-Wing Yuen A, Wai- Tongue squamous cell carcinoma cell lines transfected Man Ng R, Ignace Wei W. Identification of pyruvate kinase with miR133a and miR-133b precursors displayed type M2 as potential oncoprotein in squamous cell carcinoma

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 14 MIR133B (microRNA 133b) Tsuchiya H, Wang L

of tongue through microRNA profiling. Int J Cancer. 2008a Jul lung cancer by targeting the epidermal growth factor receptor. 15;123(2):251-7 FEBS J. 2012 Oct;279(20):3800-12 Wong TS, Liu XB, Wong BY, Ng RW, Yuen AP, Wei WI. Namløs HM, Meza-Zepeda LA, Barøy T, Østensen IH, Kresse Mature miR-184 as Potential Oncogenic microRNA of SH, Kuijjer ML, Serra M, Bürger H, Cleton-Jansen AM, Squamous Cell Carcinoma of Tongue. Clin Cancer Res. 2008b Myklebost O. Modulation of the osteosarcoma expression May 1;14(9):2588-92 phenotype by microRNAs. PLoS One. 2012;7(10):e48086 Xiao L, Xiao J, Luo X, Lin H, Wang Z, Nattel S. Feedback Patron JP, Fendler A, Bild M, Jung U, Müller H, Arntzen MØ, remodeling of cardiac potassium current expression: a novel Piso C, Stephan C, Thiede B, Mollenkopf HJ, Jung K, potential mechanism for control of repolarization reserve. Kaufmann SH, Schreiber J. MiR-133b targets antiapoptotic Circulation. 2008 Sep 2;118(10):983-92 genes and enhances death receptor-induced apoptosis. PLoS One. 2012;7(4):e35345 Crawford M, Batte K, Yu L, Wu X, Nuovo GJ, Marsh CB, Otterson GA, Nana-Sinkam SP. MicroRNA 133B targets pro- Qin W, Dong P, Ma C, Mitchelson K, Deng T, Zhang L, Sun Y, survival molecules MCL-1 and BCL2L2 in lung cancer. Feng X, Ding Y, Lu X, He J, Wen H, Cheng J. MicroRNA-133b Biochem Biophys Res Commun. 2009 Oct 23;388(3):483-9 is a key promoter of cervical carcinoma development through the activation of the ERK and AKT1 pathways. Oncogene. Dyrskjøt L, Ostenfeld MS, Bramsen JB, Silahtaroglu AN, Lamy 2012 Sep 6;31(36):4067-75 P, Ramanathan R, Fristrup N, Jensen JL, Andersen CL, Zieger K, Kauppinen S, Ulhøi BP, Kjems J, Borre M, Orntoft TF. Tao J, Wu D, Xu B, Qian W, Li P, Lu Q, Yin C, Zhang W. Genomic profiling of microRNAs in bladder cancer: miR-129 is microRNA-133 inhibits cell proliferation, migration and invasion associated with poor outcome and promotes cell death in vitro. in prostate cancer cells by targeting the epidermal growth Cancer Res. 2009 Jun 1;69(11):4851-60 factor receptor. Oncol Rep. 2012 Jun;27(6):1967-75 Guo J, Miao Y, Xiao B, Huan R, Jiang Z, Meng D, Wang Y. Zhou Y, Wu D, Tao J, Qu P, Zhou Z, Hou J. MicroRNA-133 Differential expression of microRNA species in human gastric inhibits cell proliferation, migration and invasion by targeting cancer versus non-tumorous tissues. J Gastroenterol Hepatol. epidermal growth factor receptor and its downstream effector 2009 Apr;24(4):652-7 proteins in bladder cancer. Scand J Urol. 2013 Oct;47(5):423- 32 Ichimi T, Enokida H, Okuno Y, Kunimoto R, Chiyomaru T, Kawamoto K, Kawahara K, Toki K, Kawakami K, Nishiyama K, Fu HL, Wu DP, Wang XF, Wang JG, Jiao F, Song LL, Xie H, Tsujimoto G, Nakagawa M, Seki N. Identification of novel Wen XY, Shan HS, Du YX, Zhao YP. Altered miRNA microRNA targets based on microRNA signatures in bladder Expression is Associated with Differentiation, Invasion, and cancer. Int J Cancer. 2009 Jul 15;125(2):345-52 Metastasis of Esophageal Squamous Cell Carcinoma (ESCC) in Patients from Huaian, China. Cell Biochem Biophys. 2013 Hu G, Chen D, Li X, Yang K, Wang H, Wu W. miR-133b Mar 21; regulates the MET proto-oncogene and inhibits the growth of colorectal cancer cells in vitro and in vivo. Cancer Biol Ther. Mo W, Zhang J, Li X, Meng D, Gao Y, Yang S, Wan X, Zhou 2010 Jul 15;10(2):190-7 C, Guo F, Huang Y, Amente S, Avvedimento EV, Xie Y, Li Y. Identification of novel AR-targeted microRNAs mediating Kano M, Seki N, Kikkawa N, Fujimura L, Hoshino I, Akutsu Y, androgen signalling through critical pathways to regulate cell Chiyomaru T, Enokida H, Nakagawa M, Matsubara H. miR- viability in prostate cancer. PLoS One. 2013;8(2):e56592 145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Novello C, Pazzaglia L, Cingolani C, Conti A, Quattrini I, Cancer. 2010 Dec 15;127(12):2804-14 Manara MC, Tognon M, Picci P, Benassi MS. miRNA expression profile in human osteosarcoma: role of miR-1 and Akçakaya P, Ekelund S, Kolosenko I, Caramuta S, Ozata DM, miR-133b in proliferation and cell cycle control. Int J Oncol. Xie H, Lindforss U, Olivecrona H, Lui WO. miR-185 and miR- 2013 Feb;42(2):667-75 133b deregulation is associated with overall survival and metastasis in colorectal cancer. Int J Oncol. 2011 Wen D, Li S, Ji F, Cao H, Jiang W, Zhu J, Fang X. miR-133b Aug;39(2):311-8 acts as a tumor suppressor and negatively regulates FGFR1 in gastric cancer. Tumour Biol. 2013 Apr;34(2):793-803 Koutsoulidou A, Mastroyiannopoulos NP, Furling D, Uney JB, Phylactou LA. Expression of miR-1, miR-133a, miR-133b and Wu J, Yang T, Li X, Yang Q, Liu R, Huang J, Li Y, Yang C, miR-206 increases during development of human skeletal Jiang Y. Alteration of serum miR-206 and miR-133b is muscle. BMC Dev Biol. 2011 Jun 7;11:34 associated with lung carcinogenesis induced by 4- (methylnitrosamino)-1-(3-pyridyl)-1-butanone. Toxicol Appl Widera C, Gupta SK, Lorenzen JM, Bang C, Bauersachs J, Pharmacol. 2013 Mar 15;267(3):238-46 Bethmann K, Kempf T, Wollert KC, Thum T. Diagnostic and prognostic impact of six circulating microRNAs in acute Yamamoto H, Kohashi K, Fujita A, Oda Y. Fascin-1 coronary syndrome. J Mol Cell Cardiol. 2011 Nov;51(5):872-5 overexpression and miR-133b downregulation in the progression of gastrointestinal stromal tumor. Mod Pathol. Li Z, Gu X, Fang Y, Xiang J, Chen Z. microRNA expression 2013 Apr;26(4):563-71 profiles in human colorectal cancers with brain metastases. Oncol Lett. 2012 Feb;3(2):346-350 This article should be referenced as such: Liu L, Shao X, Gao W, Zhang Z, Liu P, Wang R, Huang P, Yin Tsuchiya H, Wang L. MIR133B (microRNA 133b). Atlas Genet Y, Shu Y. MicroRNA-133b inhibits the growth of non-small-cell Cytogenet Oncol Haematol. 2014; 18(1):12-15.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 15 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

NCR2 (natural cytotoxicity triggering receptor 2) Nathan Horton, Kelly Bowen, Porunelloor Mathew Department of Molecular Biology and Immunology and Institute for Cancer Research, University of North Texas Health Science Center, Fort Worth Texas 76107, USA (NH, KB, PM)

Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/NCR2ID46140ch6p21.html DOI: 10.4267/2042/52072 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Review on NCR2, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

(NK) cells (Cantoni et al., 1999; de Rham et al., 2007; Identity Rosental et al., 2011; Horton et al., 2013). NKp44, Other names: CD336, LY95, NK-p44, NKP44, NKp30, and NKp46 make up the Natural Cytotoxicity dJ149M18.1 receptors of the NK cell and cooperate with each other HGNC (Hugo): NCR2 for optimal recognition and elimination of target cells (Augugliaro et al., 2003). NKp44 can either activate or Location: 6p21.1 inhibit NK cell effector function through recognition of Local order: NKp44 is centromeric to the Major separate ligands. Histocompatibility Complex on Chromosome 6 in a NKp44 recognition of its unknown activating ligand cluster of single immunoglobulin variable domain facilitates signalling through Dap 12, resulting in receptors. release of cytotoxic agents, Tumor Necrosis Factor-α, NKp44 is centromeric by 49071 bp to triggering and IFN-γ (Vitale et al., 1998). Recognition of cell receptor expressed on myeloid cells (Trem-1), located surface Proliferating Cell Nuclear Antigen (PCNA) on the negative strand, and telomeric to forkhead box colocalizing with HLA I on the cell surface inhibits NK p4 by 195539 bp. cell cytotoxicity and IFN-γ release (Rosental et al., 2011; Horton et al., 2013). Note NKp44 expression is inhibited by IL-21 (de Rham et NKp44 is a transmembrane glycoprotein of the al., 2007). Immunoglobulin (Ig) superfamily expressed on the surface of IL-2 and IL-15 activated Natural Killer

Three splice variants of NKp44. NKp44 is encoded on 5 exons (NM_004828.3). One splice variant contains an additional exon (NM_001199510.1), adding 35 amino acids resulting in a shift in the reading frame, truncating the cytoplasmic tail by 18 amino acids (Allcock et al., 2003). A second splice variant (NM_001199509.1) adds 12 amino acids, but maintains the reading frame with a 36 base pair extension on the 5' side of exon 4 (Allcock et al., 2003).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 16 NCR2 (natural cytotoxicity triggering receptor 2) Horton N, et al.

transmembrane segment and has 13 predicted O- DNA/RNA glycosylation sites and a single N-glycosylation site Note (Cantoni et al., 1999; Cantoni et al., 2003). NKp44 is located on chromosome 6, centromeric to the Crystallography of the receptor demonstrates a surface Major Histocompatibility Complex. It is located in a groove made by two facing β hairpin loops extending cluster of single immunoglobulin variable domain from the Ig fold core stabilized by a disulfide bridge receptors including Trem-1 and Trem-2 (Allcock et al., between Cystine 37 and Cystine 45 (Cantoni et al., 2003). 2003). The Ig domain contains an arrangement of positively charged residues at the groove surface, Description suggesting NKp44 ligands are anionic (Cantoni et al., NKp44 gene spans 15098 bases located on positive 2003). strand of chromosome 6 from 41303528 to 41318625 The groove appears wide enough to host a sialic acid or bp. NKp44 is centromeric to Trem-1, with its leader an elongated branched ligand. The cytoplasmic tail of sequence nearest to Trem-1 on the telomeric side and NKp44 also contains a tyrosine sequence resembling a its cytoplasmic domain encoded towards the tyrosine-based inhibitory motif (Cantoni et al., 1999; centromere (Allcock et al., 2003). NKp44 is encoded in Campbell et al., 2004). This motif is functional and 5 exons with one splice variant containing an extra inhibits the release of cytotoxic agents and IFN-γ exon (NM_001199510.1), adding 35 amino acids (Rosental et al., 2011). (Allcock et al., 2003). This addition alters the reading Expression frame which truncates the cytoplasmic tail by 18 amino acids (Allcock et al., 2003). A second splice variant NKp44 is expressed on IL-2 and IL-15 activated NK (NM_001199509.1) with an extra exon contains a 36 Cells and NK cells in the decidua (Cantoni et al., 1999; base pair extension of exon 4 on the 5' side, adding 12 de Rham et al., 2007; Manaster and Mandelboim, amino acids, but maintaining the reading frame 2010). The receptor is also expressed on isolated (Allcock et al., 2003). polyclonal γδ T cells when cultured for 2 weeks in IL- 15 and IL-2 (Cantoni et al., 1999; von Lilienfeld-Toal Transcription et al., 2006; Hudspeth et al., 2013). Natural Interferon- There are three transcript variants of NKp44. Isoform 1 producing cells located in the T-cell zone in lymph (NM_004828.3) encodes the longest isoform. Isoform 2 nodes draining a site of viral infection are reported to (NM_001199509.1) encodes a frame shift due to an express NKp44, believed to be induced by IL-3 from extra in-frame segment and an additional exon local memory CD8 T cells (Fuchs et al., 2005). NKp44 compared to isoform 1. This results in an additional is also induced in TCR αβ intestinal intraepithelial internal segment and a shorter C-terminus. Isoform 3 lymphocytes by IL-15 (Meresse et al., 2004). Cytolytic (NM001199510.1) has an additional exon with a T cells isolated from cord blood express NKp44 when shorter C-terminus similar to isoform 2. induced with IL-2 or IL-15 (Tang et al., 2008). Finally NKp44 is expressed on a subset of cells located in Protein human tonsils, similar to lymphoid tissue induce cells, which produce IL-22 and express Ror γt (Fuchs et al., Note 2005; Cella et al., 2009). NKp44 is a type I transmembrane protein belonging to the Ig Superfamily (Vitale et al., 1998; Cantoni et al., Localisation 1999; Cantoni et al., 2003). Surface expression of the NKp44 is a type I transmembrane protein expressed on receptor and signalling physically requires the the surface of IL-2 activated NK cells and induced in transmembrane accessory protein DAP12 which bears γδ T cells by IL-15 and IL-2 (Cantoni et al., 1999; von Immunoreceptor Tyrosine Activation Motifs (Cantoni Lilienfeld-Toal et al., 2006; Hudspeth et al., 2013). et al., 1999). NKp44 activates NK cells through DAP12 Expression is also reported on the cell surface of linked directly to Lysine 183 in the transmembrane natural interferon-producing cells exposed to IL-3 domain (Campbell et al., 2004). NKp44 inhibits NK (Fuchs et al., 2005). cells through a tyrosine-based inhibitory motif located Function in the cytoplasmic tail of the receptor (Rosental et al., 2011). NKp44 may functions as either an activating or inhibitory receptor on the surface of the NK cell. The Description identities of activating ligands are currently unknown, NKp44 has a molecular weight of 44 kDa and consists but bind NKp44 to induce activating signals through of a 169 amino acid extracellular domain followed by Dap12 (Vitale et al., 1998; Cantoni et al., 1999; 23 and 63 amino acid sequences in the transmembrane Campbell et al., 2004). NKp44 inhibits NK cell and cytoplasmic tail domains respectively (Cantoni et function through recognition of cell surface exosomal al., 1999; Cantoni et al., 2003). A 55 amino acid PCNA which colocalizes with HLA I (Rosental et al., domain connects the extracellular Ig domain to the 2011; Horton et al., 2013).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 17 NCR2 (natural cytotoxicity triggering receptor 2) Horton N, et al.

Homology (Spaggiari et al., 2008). Tumors may also down regulate NKp44 ligand expression to escape NK cell - NCR 2 Natural Cytotoxicity Trigger Receptor 2 [Pan killing, as is the case with acute myeloid leukemia troglodytes] NC_006473.3 (AML) (Nowbakht et al., 2005). In the case of normal - NCR 2 Natural Cytotoxicity Trigger Receptor 2 myelonocytic differentiation of bone marrow cells, a [Macaca mulatta] NC_007861.1 ligand for NKp44 is expressed upon loss of the CD34 - NCR 2 Natural Cytotoxicity Trigger Receptor 2 hematopoietic marker and acquisition of CD33 and [Canis lupus familiaris] NC_006594.3 CD14 myeloid markers (Nowbakht et al., 2005). Ligand expression if further increased by the presence Mutations of IFN-γ (Nowbakht et al., 2005). Yet in AML, ligand Note expression is absent, possibly contributing to disease None identified. manifestation. Finally, tumor cells may also induce expression of exosomal PCNA when physically Implicated in contacted by NKp44 expressing NK cells to inhibit NK cell effector function (Rosental et al., 2011). Various cancers Viral infection Note Note NKp44 is implicated in recognition of numerous types NKp44 recognizes α2,6-N¬-acetylneuraminic acid of of cancer (neuralblastoma, choriocarcinoma, hemagglutinin of Influenza and Sendai viruses and pancreatic, breast, lung adenocarcinoma, colon, cervix, hemagglutinin-neuraminidase of the Newcastle disease hepatocellular carcinoma, Burkitt lymphoma, diffuse B virus, requiring sialyation of the receptor (Arnon et al., cell lymphoma, prostate) (Sivori et al., 2000a; Sivori et 2001; Jarahian et al., 2009; Ito et al., 2012). Binding of al., 2000b; Byrd et al., 2007; Rosental et al., 2011; NKp44 to hemagglutinin enables lysis of viral infected Horton et al., 2013). Ligands for NKp44 appear to be cells. Specifically, NKp44 recognizes hemagglutinins cell cycle regulated, with down regulation of from H5-type influenza virus strains (Ho et al., 2008). expression during mitosis (Byrd et al., 2007). Two flaviviruses, Dengue and West Nile, are directly Recognition of tumor cells is partially mediated recognized by NKp44. Envelope proteins of these through charged based binding of NKp44 with heparin viruses, in particular domain III of West Nile, directly sulfate proteoglycans (HSPG) on the surface of tumor bind to NKp44, increasing lysis of infected cells and cells (Hershkovitz et al., 2007). Specifically, the 2-O- NK cell IFN-γ release (Hershkovitz et al., 2009). sulfation of iduronic acid and N-acetylation of NKp44 is also implicated in recognizing a ligand glucosamine on HSPGs are important for interaction expressed on cells infected with Vaccina virus with NKp44 (Hecht et al., 2009). Glycans containing (Chisholm and Reyburn, 2006). Viruses have also α2,6-N¬-acetylneuraminic acid are also recognized on evolved immune escape mechanisms by down the surface of cancer cells by NKp44 (Ito et al., 2012). regulating expression of the ligand for NKp44. In the HSPGs are believed to be a coligand for NKp44 and case of Kaposi's sarcoma-associated herpes virus, the the other NCRs, potentially facilitating binding with extracellular ligand expression is reduced during de other cellular ligands. Recognition of HSPG only novo infection. Interestingly, during lytic infection, evokes IFN-γ release by NK cells, not cellular only surface levels of the NKp44 ligand are reduced as cytotoxicity (Hershkovitz et al., 2007). overall cellular levels are unchanged, indicating a Tumor escape of immunosurveillance defect in cellular trafficking (Madrid and Ganem, Note 2012). Also, while the NKp44 ligand is typically Tumors employ numerous mechanisms to avoid killing located outside of the nucleus, during lytic infection the by NK cells. By engaging NKp44, as well as the other ligand is found localizing to the nucleus (Madrid and NCRs, tumors can induce NK cell death via up Ganem, 2012). This localization is concurrent with a regulation of Fas Ligand in the NK cell, inducing Fas burst of lytic gene expression, mainly consisting of mediated apoptosis (Poggi et al., 2005). NKp44 surface immune related genes (Madrid and Ganem, 2012). expression can be down regulated by soluble MHC HIV Class I chain-related molecules shed by colorectal Note tumors or by indoleamine 2,3-dioxygenase and A hallmark of HIV infection is the progressive prostaglandin E2 released by melanoma cells depletion of CD4 + T cells via destruction of both (Doubrovina et al., 2003; Pietra et al., 2012). uninfected CD4 + T cells and HIV-infected CD4 + T Mesenchymal stem cells also release indoleamine 2,3- cells. In regards to NK cells, HIV modulates both the dioxygenase and prostaglandin E2 which inhibit expression of NK cell receptors and their ligands. NKp44 induction in the tumor microenvironment, but NKp44 is no exception as it is expressed at a lower may also be harnessed as a therapeutic approach to surface density on in vitro activated NK cells from inhibit Graft-versus-host or autoimmune disease

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 18 NCR2 (natural cytotoxicity triggering receptor 2) Horton N, et al.

HIV-1 patients compared to healthy controls, resulting do not express a ligand for NKp44 (Esin et al., 2008). in decreased killing of various tumor target cells (De Furthermore, the BCG NKp44 ligand was found to be Maria et al., 2003; Mavilio et al., 2003; Fogli et al., resistant to trypsin degradation and stable at 80°C, 2004). HIV also modulates NK cell receptor ligand indicating the ligand is most likely not a protein but a expression. NKp44 cellular ligand (NKp44L) is heat stable structural component of the cell wall (Esin expressed on uninfected CD4 + T cells during an HIV et al., 2008). In a subsequent study, Esin et al. further infection, correlating with the loss of CD4 + T cells and proved NKp44 specifically binds mycolyl- increase of viral load (Vieillard et al., 2005). NKp44L arabinogalactan-peptidoglycan, mycolic acid, and is only expressed in high amounts on uninfected CD4+ arabinogalactan found in the cell wall of T cells and is not responsible for inducing NK lysis of Mycobacterium tuberculosis to maintain NK cell HIV-infected cells (Ward et al., 2007). To avoid NK activation (Esin et al., 2013). Finally, Pseudomonas killing of HIV infected CD4 + T cells, the Nef protein of aeruginosa also express a ligand for NKp44 (Esin et al., HIV-1 retains NKp44L intracellularly, preventing cell 2008). surface expression and interaction with NKp44 Formation of placenta (Fausther-Bovendo et al., 2009). Studies by Vieillard et al. have shown a highly conserved 3S peptide motif of Note the HIV-1 gp41 protein is involved in the induction of Decidual NK cells (dNK) make up 50-90% of NKp44L on the surface of uninfected CD4 + T cells. An lymphocytes in the uterine mucosa during pregnancy envelope protein of the HIV virus, gp41 is vital for and constitutively express NKp44 (Kopcow et al., viral entry into target cells (Vieillard et al., 2005). The 2005; Hanna et al., 2006; Vacca et al., 2008). In close 3S peptide of gp41 binds to its receptor gC1qR, a contact with fetal extravillous trophoblasts cells receptor for the globular domain of complement invading the maternal decidua, dNK cells exhibit component 1q, on CD4 + T cells (Fausther-Bovendo et reduced cytotoxicity but crucially produce Interleukin- al., 2010). Binding of the 3S motif to this receptor 8, Interferon-inducible protein 10, Vascular Endothelial activates a signaling cascade involving PI3K, NADPH- Growth Factor (VEGF), and Placental Growth Factor oxidase, Rho-A, and TC10 (Fausther-Bovendo et al., (PGF) in response to NKp44 triggering (Hanna et al., 2010). NKp44L is translocated from the cytoplasm to 2006; Vacca et al., 2008). the plasma membrane and is expressed on the cell Trophoblast cells and maternal stromal cells of the surface, where it can bind to NKp44 of activated NK decidua both express unidentified NKp44 ligands cells. NKp44L + expressing CD4 + T cells are more (Hanna et al., 2006; Vacca et al., 2008). This ligand susceptible to lysis by activated NK cells (Vieillard et may be PCNA as the protein is over expressed in al., 2005). Understanding the role of NKp44L during trophoblast cells during the first trimester (Korgun et HIV infection could help identify new therapeutic al., 2006). strategies to prevent the progressive loss of uninfected As an inhibitory ligand for NKp44, extracellular PCNA CD4 + T cells. Possible therapeutic strategies are to expression on trophoblast cells would help explain the inhibit the expression of NKp44L by using an anti- diminished ability of dNK cells to lyse trophoblasts gp41 Ab or an anti-gC1qR Ab to block the 3S motif despite low levels of classical HLA I expression (Vacca and gC1qR interaction (Vieillard et al., 2005; Fausther- et al., 2008). Invasion of trophoblast into decidua Bovendo et al., 2010). Anti-3S immunization has also facilitates proper placentation and NK cells help govern proven efficacious in preliminary studies in macaques how far trophoblasts infiltrate (Moffett and Loke, (Vieillard et al., 2008). 2006). dNK cells also help reorganize the spiral arteries to facilitate appropriate blood transfer between the Microbial infection mother and fetus at the placenta (Moffett and Loke, Note 2006; Vacca et al., 2008). Nkp44 is reported to directly bind to the surface of Alterations in dNK cells and invasion of fetal Mycobacterium and other related genera. After in vitro trophoblast cells are implicated in pregnancy stimulation with Mycobacterium bovis bacillus complications, such as pre-eclampsia and tubal Calmette-Guérin (BCG) for 3 to 4 days, CD56 bright NK pregnancies (Moffett and Loke, 2006). Since fetal cells significantly increase NKp44 expression (Esin et trophoblast and maternal decidual cells express a al., 2008). The Mycobacterium genus, including the NKp44 ligand, this receptor constitutively expressed on causative agent of tuberculosis, Mycobacterium dNK cell plays a crucial role in proper development of tuberculosis, express a conserved NKp44 ligand while the placenta in pregnancy that requires further study. the mycobacterium related, Gram-positive Nocardia Spontaneous abortion and Corynbacterium genera, also express a ligand (Esin et al., 2008; Esin et al., 2013). Interestingly, both Note bright Nocardia, Corynbacterium, and Mycobacterium genera NKp44 expression is increased on CD56 CD16- express mycolic acids in their cell walls, which is dNK cells in patients with spontaneous abortion, lacking in other mycobacterium related species which resulting in increased cytolytic activity of these NK cells (Zhang et al., 2008).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 19 NCR2 (natural cytotoxicity triggering receptor 2) Horton N, et al.

Crohn's disease and ankylosing De Maria A, Fogli M, Costa P, Murdaca G, Puppo F, Mavilio D, Moretta A, Moretta L. The impaired NK cell cytolytic function in spondylitis viremic HIV-1 infection is associated with a reduced surface expression of natural cytotoxicity receptors (NKp46, NKp30 Note and NKp44). Eur J Immunol. 2003 Sep;33(9):2410-8 NKp44 + NK cells (CD3 -CD56 +NKp44 +NKp46 - RORC high CD122 -CD127 +) in the intestinal lamina Doubrovina ES, Doubrovin MM, Vider E, Sisson RB, O'Reilly RJ, Dupont B, Vyas YM. Evasion from NK cell immunity by propria are significantly reduced in inflamed mucosa of MHC class I chain-related molecules expressing colon patients with Crohn's Disease (CD) while IFN-γ adenocarcinoma. J Immunol. 2003 Dec 15;171(12):6891-9 producing NKp46 + NK cells (CD3 -CD56 +NKp44 - + dull + - Mavilio D, Benjamin J, Daucher M, Lombardo G, Kottilil S, NKp46 RORC CD122 CD127 ) are dramatically Planta MA, Marcenaro E, Bottino C, Moretta L, Moretta A, increased (Takayama et al., 2010). IL-22 is produced Fauci AS. Natural killer cells in HIV-1 infection: dichotomous by NKp44 + NK cells, which is protective in the onset of effects of viremia on inhibitory and activating receptors and their functional correlates. Proc Natl Acad Sci U S A. 2003 Dec murine colitis, and possibly implicated in human 9;100(25):15011-6 colitis. Thus the imbalance of the NKp44+/NKp46+ NK cell axis in the intestinal lamina propria may play a Campbell KS, Yusa S, Kikuchi-Maki A, Catina TL. NKp44 triggers NK cell activation through DAP12 association that is role in colitis onset (Takayama et al., 2010). Contrary not influenced by a putative cytoplasmic inhibitory sequence. J + to CD, NKp44 NK cells are increased in the inflamed Immunol. 2004 Jan 15;172(2):899-906 ileum of patients with Ankylosing Spondylitis (AS) Fogli M, Costa P, Murdaca G, Setti M, Mingari MC, Moretta L, (Ciccia et al., 2012). AS Patients over express IL-23 in Moretta A, De Maria A. Significant NK cell activation the intestines which modulates IL-22 production by associated with decreased cytolytic function in peripheral blood NKp44 +IL-22 + NK cells (Ciccia et al., 2012). IL-22 of HIV-1-infected patients. Eur J Immunol. 2004 then promotes mucosal wound healing through Aug;34(8):2313-21 increased mucin production by goblet cells. Meresse B, Chen Z, Ciszewski C, Tretiakova M, Bhagat G, Krausz TN, Raulet DH, Lanier LL, Groh V, Spies T, Ebert EC, Green PH, Jabri B. Coordinated induction by IL15 of a TCR- References independent NKG2D signaling pathway converts CTL into lymphokine-activated killer cells in celiac disease. Immunity. Vitale M, Bottino C, Sivori S, Sanseverino L, Castriconi R, 2004 Sep;21(3):357-66 Marcenaro E, Augugliaro R, Moretta L, Moretta A. NKp44, a novel triggering surface molecule specifically expressed by Fuchs A, Cella M, Kondo T, Colonna M. Paradoxic inhibition of activated natural killer cells, is involved in non-major human natural interferon-producing cells by the activating histocompatibility complex-restricted tumor cell lysis. J Exp receptor NKp44. Blood. 2005 Sep 15;106(6):2076-82 Med. 1998 Jun 15;187(12):2065-72 Kopcow HD, Allan DS, Chen X, Rybalov B, Andzelm MM, Ge Cantoni C, Bottino C, Vitale M, Pessino A, Augugliaro R, B, Strominger JL. Human decidual NK cells form immature Malaspina A, Parolini S, Moretta L, Moretta A, Biassoni R. activating synapses and are not cytotoxic. Proc Natl Acad Sci NKp44, a triggering receptor involved in tumor cell lysis by U S A. 2005 Oct 25;102(43):15563-8 activated human natural killer cells, is a novel member of the immunoglobulin superfamily. J Exp Med. 1999 Mar Nowbakht P, Ionescu MC, Rohner A, Kalberer CP, Rossy E, 1;189(5):787-96 Mori L, Cosman D, De Libero G, Wodnar-Filipowicz A. Ligands for natural killer cell-activating receptors are expressed upon Sivori S, Parolini S, Marcenaro E, Castriconi R, Pende D, Millo the maturation of normal myelomonocytic cells but at low levels R, Moretta A. Involvement of natural cytotoxicity receptors in in acute myeloid leukemias. Blood. 2005 May 1;105(9):3615- human natural killer cell-mediated lysis of neuroblastoma and 22 glioblastoma cell lines. J Neuroimmunol. 2000a Jul 24;107(2):220-5 Poggi A, Massaro AM, Negrini S, Contini P, Zocchi MR. Tumor-induced apoptosis of human IL-2-activated NK cells: Sivori S, Parolini S, Marcenaro E, Millo R, Bottino C, Moretta role of natural cytotoxicity receptors. J Immunol. 2005 Mar A. Triggering receptors involved in natural killer cell-mediated 1;174(5):2653-60 cytotoxicity against choriocarcinoma cell lines. Hum Immunol. 2000b Nov;61(11):1055-8 Vieillard V, Strominger JL, Debré P. NK cytotoxicity against CD4+ T cells during HIV-1 infection: a gp41 peptide induces Arnon TI, Lev M, Katz G, Chernobrov Y, Porgador A, the expression of an NKp44 ligand. Proc Natl Acad Sci U S A. Mandelboim O. Recognition of viral hemagglutinins by NKp44 2005 Aug 2;102(31):10981-6 but not by NKp30. Eur J Immunol. 2001 Sep;31(9):2680-9 Chisholm SE, Reyburn HT. Recognition of vaccinia virus- Allcock RJ, Barrow AD, Forbes S, Beck S, Trowsdale J. The infected cells by human natural killer cells depends on natural human TREM gene cluster at 6p21.1 encodes both activating cytotoxicity receptors. J Virol. 2006 Mar;80(5):2225-33 and inhibitory single IgV domain receptors and includes NKp44. Eur J Immunol. 2003 Feb;33(2):567-77 Hanna J, Goldman-Wohl D, Hamani Y, Avraham I, Greenfield C, Natanson-Yaron S, Prus D, Cohen-Daniel L, Arnon TI, Augugliaro R, Parolini S, Castriconi R, Marcenaro E, Cantoni Manaster I, Gazit R, Yutkin V, Benharroch D, Porgador A, C, Nanni M, Moretta L, Moretta A, Bottino C. Selective cross- Keshet E, Yagel S, Mandelboim O. Decidual NK cells regulate talk among natural cytotoxicity receptors in human natural killer key developmental processes at the human fetal-maternal cells. Eur J Immunol. 2003 May;33(5):1235-41 interface. Nat Med. 2006 Sep;12(9):1065-74 Cantoni C, Ponassi M, Biassoni R, Conte R, Spallarossa A, Korgun ET, Celik-Ozenci C, Acar N, Cayli S, Desoye G, Demir Moretta A, Moretta L, Bolognesi M, Bordo D. The three- R. Location of cell cycle regulators cyclin B1, cyclin A, PCNA, dimensional structure of the human NK cell receptor NKp44, a Ki67 and cell cycle inhibitors p21, p27 and p57 in human first triggering partner in natural cytotoxicity. Structure. 2003 trimester placenta and deciduas. Histochem Cell Biol. 2006 Jun;11(6):725-34 Jun;125(6):615-24

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 20 NCR2 (natural cytotoxicity triggering receptor 2) Horton N, et al.

Moffett A, Loke C. Immunology of placentation in eutherian Fausther-Bovendo H, Sol-Foulon N, Candotti D, Agut H, mammals. Nat Rev Immunol. 2006 Aug;6(8):584-94 Schwartz O, Debré P, Vieillard V. HIV escape from natural killer cytotoxicity: nef inhibits NKp44L expression on CD4+ T von Lilienfeld-Toal M, Nattermann J, Feldmann G, Sievers E, cells. AIDS. 2009 Jun 1;23(9):1077-87 Frank S, Strehl J, Schmidt-Wolf IG. Activated gammadelta T cells express the natural cytotoxicity receptor natural killer p 44 Hecht ML, Rosental B, Horlacher T, Hershkovitz O, De Paz JL, and show cytotoxic activity against myeloma cells. Clin Exp Noti C, Schauer S, Porgador A, Seeberger PH. Natural Immunol. 2006 Jun;144(3):528-33 cytotoxicity receptors NKp30, NKp44 and NKp46 bind to different heparan sulfate/heparin sequences. J Proteome Res. Byrd A, Hoffmann SC, Jarahian M, Momburg F, Watzl C. 2009 Feb;8(2):712-20 Expression analysis of the ligands for the Natural Killer cell receptors NKp30 and NKp44. PLoS One. 2007 Dec Hershkovitz O, Rosental B, Rosenberg LA, Navarro-Sanchez 19;2(12):e1339 ME, Jivov S, Zilka A, Gershoni-Yahalom O, Brient-Litzler E, Bedouelle H, Ho JW, Campbell KS, Rager-Zisman B, Despres de Rham C, Ferrari-Lacraz S, Jendly S, Schneiter G, Dayer P, Porgador A. NKp44 receptor mediates interaction of the JM, Villard J. The proinflammatory cytokines IL-2, IL-15 and IL- envelope glycoproteins from the West Nile and dengue viruses 21 modulate the repertoire of mature human natural killer cell with NK cells. J Immunol. 2009 Aug 15;183(4):2610-21 receptors. Arthritis Res Ther. 2007;9(6):R125 Jarahian M, Watzl C, Fournier P, Arnold A, Djandji D, Zahedi Hershkovitz O, Jivov S, Bloushtain N, Zilka A, Landau G, Bar- S, Cerwenka A, Paschen A, Schirrmacher V, Momburg F. Ilan A, Lichtenstein RG, Campbell KS, van Kuppevelt TH, Activation of natural killer cells by newcastle disease virus Porgador A. Characterization of the recognition of tumor cells hemagglutinin-neuraminidase. J Virol. 2009 Aug;83(16):8108- by the natural cytotoxicity receptor, NKp44. Biochemistry. 2007 21 Jun 26;46(25):7426-36 Fausther-Bovendo H, Vieillard V, Sagan S, Bismuth G, Debré Ward J, Bonaparte M, Sacks J, Guterman J, Fogli M, Mavilio P. HIV gp41 engages gC1qR on CD4+ T cells to induce the D, Barker E. HIV modulates the expression of ligands expression of an NK ligand through the PIP3/H2O2 pathway. important in triggering natural killer cell cytotoxic responses on PLoS Pathog. 2010 Jul 1;6:e1000975 infected primary T-cell blasts. Blood. 2007 Aug 15;110(4):1207-14 Manaster I, Mandelboim O. The unique properties of uterine NK cells. Am J Reprod Immunol. 2010 Jun;63(6):434-44 Esin S, Batoni G, Counoupas C, Stringaro A, Brancatisano FL, Colone M, Maisetta G, Florio W, Arancia G, Campa M. Direct Takayama T, Kamada N, Chinen H, Okamoto S, Kitazume MT, binding of human NK cell natural cytotoxicity receptor NKp44 Chang J, Matuzaki Y, Suzuki S, Sugita A, Koganei K, to the surfaces of mycobacteria and other bacteria. Infect Hisamatsu T, Kanai T, Hibi T. Imbalance of NKp44(+)NKp46(-) Immun. 2008 Apr;76(4):1719-27 and NKp44(-)NKp46(+) natural killer cells in the intestinal mucosa of patients with Crohn's disease. Gastroenterology. Ho JW, Hershkovitz O, Peiris M, Zilka A, Bar-Ilan A, Nal B, 2010 Sep;139(3):882-92, 892.e1-3 Chu K, Kudelko M, Kam YW, Achdout H, Mandelboim M, Altmeyer R, Mandelboim O, Bruzzone R, Porgador A. H5-type Rosental B, Brusilovsky M, Hadad U, Oz D, Appel MY, Afergan influenza virus hemagglutinin is functionally recognized by the F, Yossef R, Rosenberg LA, Aharoni A, Cerwenka A, Campbell natural killer-activating receptor NKp44. J Virol. 2008 KS, Braiman A, Porgador A. Proliferating cell nuclear antigen is Feb;82(4):2028-32 a novel inhibitory ligand for the natural cytotoxicity receptor NKp44. J Immunol. 2011 Dec 1;187(11):5693-702 Spaggiari GM, Capobianco A, Abdelrazik H, Becchetti F, Mingari MC, Moretta L. Mesenchymal stem cells inhibit natural Ciccia F, Accardo-Palumbo A, Alessandro R, Rizzo A, Principe killer-cell proliferation, cytotoxicity, and cytokine production: S, Peralta S, Raiata F, Giardina A, De Leo G, Triolo G. role of indoleamine 2,3-dioxygenase and prostaglandin E2. Interleukin-22 and interleukin-22-producing NKp44+ natural Blood. 2008 Feb 1;111(3):1327-33 killer cells in subclinical gut inflammation in ankylosing spondylitis. Arthritis Rheum. 2012 Jun;64(6):1869-78 Tang Q, Grzywacz B, Wang H, Kataria N, Cao Q, Wagner JE, Blazar BR, Miller JS, Verneris MR. Umbilical cord blood T cells Ito K, Higai K, Shinoda C, Sakurai M, Yanai K, Azuma Y, express multiple natural cytotoxicity receptors after IL-15 Matsumoto K. Unlike natural killer (NK) p30, natural stimulation, but only NKp30 is functional. J Immunol. 2008 Oct 1;181(7):4507-15 cytotoxicity receptor NKp44 binds to multimeric α2,3-NeuNAc- containing N-glycans. Biol Pharm Bull. 2012;35(4):594-600 Vacca P, Cantoni C, Prato C, Fulcheri E, Moretta A, Moretta L, Mingari MC. Regulatory role of NKp44, NKp46, DNAM-1 and Madrid AS, Ganem D. Kaposi's sarcoma-associated NKG2D receptors in the interaction between NK cells and herpesvirus ORF54/dUTPase downregulates a ligand for the trophoblast cells. Evidence for divergent functional profiles of NK activating receptor NKp44. J Virol. 2012 Aug;86(16):8693- decidual versus peripheral NK cells. Int Immunol. 2008 704 Nov;20(11):1395-405 Pietra G, Manzini C, Rivara S, Vitale M, Cantoni C, Petretto A, Vieillard V, Le Grand R, Dausset J, Debré P. A vaccine Balsamo M, Conte R, Benelli R, Minghelli S, Solari N, Gualco strategy against AIDS: an HIV gp41 peptide immunization M, Queirolo P, Moretta L, Mingari MC. Melanoma cells inhibit prevents NKp44L expression and CD4+ T cell depletion in natural killer cell function by modulating the expression of SHIV-infected macaques. Proc Natl Acad Sci U S A. 2008 Feb activating receptors and cytolytic activity. Cancer Res. 2012 12;105(6):2100-4 Mar 15;72(6):1407-15 Zhang Y, Zhao A, Wang X, Shi G, Jin H, Lin Q. Expressions of Esin S, Counoupas C, Aulicino A, Brancatisano FL, Maisetta natural cytotoxicity receptors and NKG2D on decidual natural G, Bottai D, Di Luca M, Florio W, Campa M, Batoni G. killer cells in patients having spontaneous abortions. Fertil Interaction of Mycobacterium tuberculosis cell Steril. 2008 Nov;90(5):1931-7 wall components with the human natural killer cell receptors Cella M, Fuchs A, Vermi W, Facchetti F, Otero K, Lennerz JK, NKp44 and Toll-like receptor 2. Scand J Immunol. 2013 Doherty JM, Mills JC, Colonna M. A human natural killer cell Jun;77(6):460-9 subset provides an innate source of IL-22 for mucosal Horton NC, Mathew SO, Mathew PA. Novel interaction immunity. Nature. 2009 Feb 5;457(7230):722-5 between proliferating cell nuclear antigen and HLA I on the

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 21 NCR2 (natural cytotoxicity triggering receptor 2) Horton N, et al.

surface of tumor cells inhibits NK cell function through NKp44. This article should be referenced as such: PLoS One. 2013;8(3):e59552 Horton N, Bowen K, Mathew P. NCR2 (natural cytotoxicity Hudspeth K, Silva-Santos B, Mavilio D. Natural cytotoxicity triggering receptor 2). Atlas Genet Cytogenet Oncol Haematol. receptors: broader expression patterns and functions in innate 2014; 18(1):16-22. and adaptive immune cells. Front Immunol. 2013;4:69

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 22 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

PTPRR (protein tyrosine phosphatase, receptor type, R) Mirthe Erkens, Hubertus Kremer, Rafael Pulido, Wiljan Hendriks Department of Cell Biology, Nijmegen Centre for Molecular Life Sciences, Radboud University Nijmegen Medical Centre, Nijmegen, The Netherlands (ME, WH), Department of Neurology, University Medical Center Groningen, The Netherlands (HK), IKERBASQUE, Basque Foundation for Science, Bilbao, Spain and BioCruces Health Research Institute, Barakaldo, Spain (RP)

Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/PTPRRID41937ch12q15.html DOI: 10.4267/2042/52072 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Review on PTPRR, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

transcripts including this PTPRR exon - i.e. the isoform Identity #5 types - carry FAHD2 antisense sequences that may Other names: EC-PTP, PCPTP1, PTP-SL, PTPBR7, have a regulatory impact on transcripts from the PTPRQ functional genes FAHD2A and FAHD2B that reside on HGNC (Hugo): PTPRR chromosome 2q11. Location: 12q15 Use of the most upstream promoter results in a ~4 kilobase-long transcript variant, isoform #1, encoding DNA/RNA what Augustine and co-workers termed the human PTPPBSa isoform (Augustine et al., 2000). Description This protein is equivalent to mouse PTPBR7, a canonical receptor-type transmembrane PTP. The Like its mouse ortholog (Chirivi et al., 2004), the human PTPPBS α transcript is built from sequences human gene PTPRR represents a very complex locus as derived of 14 exons. This build-up was determined revealed by BLAST searches (Altschul et al., 1990) back in 2001 by Bektas and co-workers (Bektas et al., using the collection of deposited PTPRR cDNA query 2001) and recently confirmed and extended with sequences (schematic diagram of PTPRR DNA/RNA). isoform #2-specific exonic parts (Menigatti et al., Transcription 2009). Differentially regulated promoters drive transcription Within the distal region of the very large intron 2, a from at least four different sites within the 285 second alternative promoter is residing that leads to the kilobasepair-spanning genomic region and at five human PTPPBS β isoform (#3), which equals the mouse positions alternative splicing may occur. PTP-SL transcript. Although initially this variant was Part of the resulting alternative transcripts make up the not encountered in human cDNA libraries (Augustine NCBI-annotated isoforms #1 through #5 in the et al., 2000), the presence of four expressed sequence nucleotide database (NM_002849, NM_130846, tags and two independent cDNA deposits NM_001207015, NM_001207016 and NR_073474, (NM_001207015, AK295951) in public libraries respectively). underscore the existence of this transcript isoform in Furthermore, one of the alternative exons resides within human tissue. a region that in the reverse transcriptional orientation is Then, within intron 4 - just proximal of exon 5 - a third annotated as a fumarylacetoacetate hydrolase domain- alternative transcriptional start site is present that containing protein 2 (FAHD2) pseudogene. Thus, appears as the origin of the PTPPBS γ (#2) and PTPPBS δ (#4) variants (Augustine et al., 2000).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 23 PTPRR (protein tyrosine phosphatase, receptor type, R) Erkens M, et al.

Schematic depiction of human gene PTPRR (upper panel), derived alternative transcripts (middle panel) and corresponding protein isoforms (lower panel). Arrows in the upper panel indicate the four distinct transcriptional start sites within the 285 kBp PTPRR locus on chromosome 12q15. Exon numbers according to transcript isoform #1 (acc.nr. NM_002849) are indicated above the corresponding, green boxes. Crimson boxes reflect the alternative first exons produced from the three distal promoters. Alternative spliced exonic parts are in dark-blue. The sky-blue area within intron 11 reflects the position of a pseudogene in the opposite transcriptional orientation. In the middle panel the build-up of the nine different PTPRR transcripts, deduced based on cDNA deposits in public databases, is depicted. The respective exon-derived sequence blocks are colour-coded as indicated above and are depicted unfused, to facilitate comparison with the gene build-up. See text for more details. The accession numbers for the major database entries defining the transcript variants #6 to #9 are given. The first five mRNAs correspond to annotated reference sequences (accession numbers are mentioned in the text). In the lower panel, again to facilitate comparison with gene and transcript build-up, the exon-encoded protein contributions are depicted unfused. Moreover, flanking the open reading frames (thick boxes) the non-coding mRNA parts are shown as thin white bars. The N- terminal, salmon protein domain reflects the signal peptide (SP). The transmembrane spanning region (TM) in PTPPBS α and PTPPBSβ is shown in turquoise and the kinase-interacting motif (KIM) and protein tyrosine phosphatase catalytic domain (PTP) are coloured purple and orange, respectively. The asterisks indicate a conserved furin-like cleavage site and the black dot in the exon 13-derived amino acid sequence represents the essential catalytic site cysteine. A dashed pink box indicates the 30 aa open reading frame that is predicted based on database entry BX571751. Black arrows point to the position of methionines that may be functional as alternative starts upon PTPPBS γ/δ translation. Drawings are to scale (except for exon sizes in the top panel) and size bars are indicated.

Initially, it was thought that perhaps two different "+/-" additional alternatives that were suggested more transcription start sites at close distance were used; an than a decade ago (Augustine et al., 2000). upstream one rendering isoform #4 and a second one, RNA variants represented by isoform #5 (acc. that would yield isoform #2, just some 200 base pairs NR_073474) and database entry BC072386 also result downstream and within the part that is spliced out in from the use of the PBS γ/δ type promoter. These transcript #4. However, multiple cDNA reads in the variants are unique, however, due to the splicing out of public database (most notably BX571751) disclose that exon 7 and the inclusion of two alternative exons that transcription initiation of isoform #2 type mRNAs in reside in introns 10 and 13, respectively. Since exon 7 fact occurs at the more upstream alternative promoter contributes 187 nucleotides, its exclusion alters the as well. Thus, in- or exclusion of a single sequence PTPRR reading frame and results in the incorporation stretch just proximal of the canonical exon 5 appears of three exon 8-encoded missense amino acids the discriminating factor between isoforms #2 and #4. followed by a premature stop. Thus, although isoform Mining the non-redundant nucleotide database did not #5 is annotated as a noncoding RNA, truncated proteins provide entries that would back up the PBS γ and PBS δ that span the first 91 or 130 amino acids of PBS γ or

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 24 PTPRR (protein tyrosine phosphatase, receptor type, R) Erkens M, et al.

PBS δ, respectively, and then end with KYQ* may classical PTPs (Andersen et al., 2001), PTPN5 and exist. PTPN7, which encode for STEP and HePTP, The above-discussed alternative exon within intron 10 respectively. is the one that overlaps with pseudogene FAHD2P1 that is annotated on the complementary strand. Perhaps Protein due to remnants of transcriptional sequence elements that relate to the pseudogene, a bit more downstream in intron 11 there may be a potential promoter driving transcription of the last four PTPRR exons only. Evidence for this comes from nucleotide database entries AK091647 (#9), AL711271 and most notably CR749836 (#8). The resulting transcript, with inclusion of a few hundred nucleotides contributing its poly-A tail, may well represent the ~3 kilobase-sized mRNA that has been detected in Northern blot analyses (Augustine et al., 2000). An open reading frame that constitutes the C-terminal 87 amino acids of the PTPRR PTP domain, hence representing an enzymatically inactive N-terminal truncation mutant, is PTPRR isoforms nomenclature. * Homology depending on discernible. It remains to be investigated whether the the start codon used. intron 11 transcription start is indeed genuine and whether the resulting RNAs have coding potential. Description The cDNA in entry AK091647 (#9) yields one more From the above it is clear that human PTPRR encodes surprise for the human PTPRR locus; 110 additional many different PTPRR protein isoforms. The longest nucleotides directly upstream of exon 12 are retained one is a 657 single-pass transmembrane receptor-type within this clone. These additional bases were also PTP by virtue of its N-terminal signal peptide (SP). found in AK304672 (#7), demonstrating that an Removal of the SP from the precursor protein will yield alternative splice acceptor site for the exon 12 5' start a 71 kDa mature protein of the PTPBR7 type. This exists. human PTPRR isoform #1 may additionally be post- Usually, the distal site is used and exon 12 donates 158 translationally cleaved at an evolutionary conserved bases to the maturing transcript. In the cases just furin-like site, in analogy with the mouse ortholog mentioned, the proximal site was used and the (Dilaver et al., 2007), rendering a 59 kDa protein elongated exon 12 contributes 268 bases. If this occurs spanning 519 residues. This processing site is also in transcripts originating from the upstream promoters, present in the 545 amino acid long isoform #3 that has the PTPRR reading frame will dictate the addition of a PTP-SL as its ortholog in mouse. single lysine to the protein before a stop codon is It may well be that it is actually the second AUG codon encountered. Hence, the resulting protein will lack the that is being used for the start of translation, as it was 121 C-terminal residues of the catalytic domain and found in mouse (Chirivi et al., 2004). In that case, the will be enzymatically inactive. The predicted open PTPPBS β open reading frame would be 30 nucleotides reading frame within the transcripts dictated by the shorter, and a 535 residue-spanning protein of 60 kDa fourth, intron 11-residing promoter, however, is not would be synthesised. altered by the exon 12 splice acceptor choice since the Although isoform #3 lacks an obvious signal peptide AUG start codon is contributed by the shared exon 12 preceding the transmembrane segment, one may expect part. that like PTP-SL (Noordman et al., 2008) it will behave It is of note that directly downstream of PTPRR, in a as a type III transmembrane molecule (Spiess, 1995). head-to-tail fashion, yet another receptor-type PTP Human PTPRR transcript type #4 displays an open gene is located: reading frame that predicts the synthesis of a 451 aa PTPRB. At first sight, the expression pattern in mouse PTPRR isoform, coined PTPPBS δ (Augustine et al., brain is distinct from that of PTPRR (Lein et al., 2007; 2000), that has a unique three amino acid N-terminus Hawrylycz et al., 2012) and future research will have to before it proceeds with the exon 5-encoded PTPRR unveil whether both genes share transcriptional read. regulatory elements. Consequently, this predicted 51 kDa protein contains the TM segment and may be topologically similar to Pseudogene the PTPPBS β protein isoform #3. The original PTPRR There are no pseudogenes detectable for gene PTPRR transcript #2 was thought to have its coding region in the human genome. Its closest relatives are the other starting exactly three nucleotides before exon 6-derived two genes within the "R7" subclass of sequences, hence resulting in a 46 kDa cytosolic protein that spans 412 residues and is lacking any meaningful hydrophobic part.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 25 PTPRR (protein tyrosine phosphatase, receptor type, R) Erkens M, et al.

Ribbon (A) and surface (B) type representation of the three-dimensional structure of the PTP domain in human PTPRR, as determined by X-ray crystallograpy (PDB code: 2A8B; (Eswaran et al., 2006)). Numbers are according to PTPPBS α protein isoform #1. Relevant structural elements, mentioned in the text, are indicated. The KIM domain and the α0 helix that was observed in the mouse PTPRR structure (PDB code: 1JLN) are N-terminal of Ser375 and were absent in the human recombinant protein part used for crystallization. Blue parts represent alpha helices and red domains symbolize beta strands. Yellow portions indicate 3 10 helices and the green parts represent ramdom coil segments. Molecular graphics was created with YASARA (Krieger et al., 2002).

Multiple cDNAs now argue in favour of extending the (termed " α0") that is stabilized by hydrophobic 5' end of the type #2 transcript and by doing so the interactions with helix α5 and the loop following helix (more) full-length cDNA then only displays a rather α2' (Szedlacsek et al., 2001; Mustelin et al., 2005; short, 30 aa protein-encoding ORF due to a stop codon Eswaran et al., 2006). This results in a hydrophobic in the part that is spliced out in isoform #4-type cavity of ~16Å depth that may be instrumental in the transcripts. regulation of enzyme activity and substrate specificity Adding to the complexity is that in mouse PTPPBS γ (Szedlacsek et al., 2001). Helix α0 is located 15 mRNA it is not the first but rather the second and third residues downstream of the KIM motif, a 16 amino AUG codon that is used by the translational machinery acid sequence that is essential for PTPRR's interaction (Chirivi et al., 2004). If the same holds true in human, with the MAP kinases ERK1, ERK2, ERK5 and p38 then the PTPPBS γ/δ-type transcripts would yield 42 (Pulido et al., 1998; Zúñiga et al., 1999; Buschbeck et and 37 kDa sized cytosolic PTPs independent of the in- al., 2002; Muñoz et al., 2003). Thus, helix α0 may or exclusion of the 283 nucleotide intron preceding facilitate proper positioning of the KIM to ensue exon 5. interactions with the docking groove in MAP kinases There are two domains that are present in all PTPRR (Tárrega et al., 2005). As a consequence not only the proteins encoded by transcript isoforms #1 through #4; regulatory tyrosine in the MAP kinase's activation loop a so-called kinase interaction motif (KIM (Pulido et al., is dephosphorylated, causing its inactivation (Pulido et 1998)) and, of course, the catalytic PTP domain. This al., 1998), but additionally the physical interaction classical, strictly phosphotyrosine-specific catalytic prevents MAP kinase translocation to the nucleus PTP segment spans some 280 conserved amino acids (Blanco-Aparicio et al., 1999; Zúñiga et al., 1999). and includes the active site cysteine that is essential for Vice versa, the association of a KIM-containing PTP the nucleophile attack on the phosphorus of the with an active MAP kinase triggers specific phosphotyrosine in the substrate protein (Guan and phosphorylation of a threonine residue within the PTP's Dixon, 1991). Overall, the three-dimensional structure α0 helix (Pulido et al., 1998; Muñoz et al., 2003). The of PTP domains shows only minor differences in the consequence of this phosphorylation event, however, core elements. For instance, the structure of the remains to be investigated. Quite opposite, the effect of catalytic segment in the "R7" PTP subfamily (that is protein kinase A (PKA)-mediated phosphorylation of a comprised of PTPRR, STEP and HePTP (Andersen et conserved serine residue within the KIM motif is well al., 2001)) displays a short β sheet consisting of the N- studied since it abolishes the binding and subsequent terminal βx and C-terminal βγ strands (Eswaran et al., dephosphorylation of MAP kinases by KIM-containing 2006) that is not encountered in the founding PTP1B PTPs (Blanco-Aparicio et al., 1999; Saxena et al., structure (Barford et al., 1994). Also, this R7-type PTP 1999; Nika et al., 2004). domain structure contains several helices (Szedlacsek The predicted proteins that may result from translation et al., 2001; Mustelin et al., 2005; Eswaran et al., 2006) of the PTPRR messenger types #5 through #9 will be that are additional to the canonical structure in other enzymatically dead. The transcript #5 and #6 derived PTPs (Barr et al., 2009). Most notably, PTPRR, STEP types will lack all PTP domain residues and also the and HePTP have an additional N-terminal helix KIM segment is far from complete, all due to a reading

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 26 PTPRR (protein tyrosine phosphatase, receptor type, R) Erkens M, et al.

frame change that is caused by exon 7 skipping. type (Noordman et al., 2008). This predicts regulatory Depending on the AUG choice, a small protein that potential for any biomolecule that would bind to the would contain the TM domain might be produced, PTPBR7 and/or PTP-SL parts that are N-terminal of which could theoretically influence the multimerization the transmembrane segment. Identification of receptor- behaviour of the PTPBR7 and PTP-SL type isoforms type PTP ligands is a cumbersome process (Stoker, (Noordman et al., 2008). PTPRR splice forms that 2005; Mohebiany et al., 2013) and although mouse manage to maintain the long version of exon 12 (e.g. PTPBR7 extracellular domain displayed a clear affinity the #7 type), however, will produce protein variants for highly myelinated brain regions (Chesini et al., that only lack the C-terminal 121 amino acids. Such 2011) the corresponding PTPRR ligands still await truncated, KIM-containing proteins would be proper identification. enzymatically inactive but may compete with Function endogenous full-length PTPRR isoforms for binding to MAP kinases or other PTPRR-associating The localization of the two transmembrane mouse biomolecules. Any regulatory impact of the PTPRR isoforms on anterograde as well as retrograde hypothetical 87 amino acid long protein that endocytic vesicles (Hendriks et al., 2009) suggests corresponds to the ORF in transcript versions #8 and #9 either a role in the regulation of vesicle transport or a would be purely speculative. fate as cargo in these compartments. In line with the first option, protein interaction and transfection studies Expression pointed at a potential functional interaction with β4- Isoform-specific expression studies on human samples adaptin, an AP-4 complex subunit that participates in are limited to RT-PCR analyses (Augustine et al., vesicle sorting (Dilaver et al., 2003). Further studies are 2000) which in general point to expression patterns that needed to corroborate this finding and it remains to be are quite similar to mouse (Van Den Maagdenberg et established whether this holds for human PTPRR as al., 1999; Augustine et al., 2000) and rat (Watanabe et well. On the contrary, ample evidence now supports a al., 1998). Human PTPPBS α is expressed exclusively regulatory impact for PTPRR isoforms on MAP kinase in brain and the PTPPBS γ/δ-type transcripts are also signaling. After the initial ectopic overexpression detectable in various other tissues, most notably uterus experiments that disclosed the KIM-dependent and and intestine (Augustine et al., 2000). PTPPBS β PKA-regulated PTPRR-MAP kinase interactions isoform expression was not addressed in that study. (Pulido et al., 1998; Blanco-Aparicio et al., 1999; Given that both in mouse and in rat a developmental Ogata et al., 1999) it was surprising to find that promoter switch occurs in cerebellar Purkinje cells endogenous PTPRR apparently was dispensable for (PCs), favouring PTP-SL-type expression in mature proper EGF- and NGF-induced MAP kinase activity in PCs, it seems likely that also in human cerebellum the rat PC12 cells (Noordman et al., 2008). Findings in promoter within PTPRR intron-2 will drive postnatal PTPN7 deficient mice, however, had suggested that expression of PTPPBS β isoforms. The notion that KIM-containing PTP impact on MAP kinase cascades PTPPBS γ/δ-type isoforms are detectable outside brain might be very subtle (Gronda et al., 2001). is of importance for recent studies that implicate Furthermore, pharmacological inhibition (Paul et al., PTPRR in carcinogenic processes in cervix and colon 2003; Valjent et al., 2005) and mouse knock-out studies (Menigatti et al., 2009; Su et al., 2013). also proved PTPN5 to be a physiological regulator of MAP kinase cascades (Venkitaramani et al., 2009). Localisation Indeed, also Ptprr knock-out mice displayed MAP No detailed studies on the subcellular localization of kinase hyperphosphorylation in relevant tissues human PTPRR protein isoforms have been performed (Chirivi et al., 2007). and, again, only inference from mouse and rat data PTPRR's closest homolog, the PTPN5-encoded protein (Shiozuka et al., 1995; Ogata et al., 1999; Van Den STEP, is additionally capable of dephosphorylating the Maagdenberg et al., 1999; Dilaver et al., 2003; cytosolic tyrosine kinase Fyn, Pyk2, and subunits of Noordman et al., 2006; Noordman et al., 2008; AMPA and NMDA receptors in neuronal cells, Hendriks et al., 2009) remains. Based on this, it seems implicating KIM-containing PTPs in neuronal reasonable to postulate that isoform #1 will display a functions like synaptic transmission (Baum et al., 2010; PTPBR7-like cell surface expression and that isoform Xu et al., 2012a). There is even evidence that PTPN5 is #3 may reside on the trans-Golgi network and linked to the pathophysiology of diverse multivesicular bodies or sorting endosomes, like mouse neuropsychiatric disorders in man, including PTP-SL does. Depending on the translational start site Schizophrenia and Alzheimer's disease (Goebel-Goody choice, the other isoforms produce either PTP-SL-like et al., 2012; Xu et al., 2012b). Although direct evidence vesicle-associated versions or, more likely, cytosolic for an impact of PTPRR on Src-family kinase or proteins that resemble murine PTPPBS γ. Intriguingly, AMPA and NMDA receptor subunit phosphorylation the mouse transmembrane PTPRR isoforms form levels has not yet been obtained, it remains an multimeric complexes and their relative PTP activity is interesting possibility in view of the phenotypic significantly lower than that of the cytosolic PTPPBS γ consequences of PTPRR deficiency in mice (Chirivi et

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 27 PTPRR (protein tyrosine phosphatase, receptor type, R) Erkens M, et al.

al., 2007) and the proposed links with some human throughout the menstrual cycle, PTPRR was found to (neuro)pathological conditions (below). be increased some fifty-fold from the proliferative to the secretory phase in endometrial tissue (Sherwin et Implicated in al., 2008). Furthermore, PTPRR expression appeared an additional four-fold higher in late secretory phase inv(12)(p13q15) in acute myelogenous tissue of women with endometriosis as compared to leukemia controls, which suggests that PTPRR may prevent normal endometrial differentiation and could represent Note a predisposing factor in the aetiology of endometriosis An inv(12)(p13q15) translocation detected in an acute (Sherwin et al., 2008). myelogenous leukemia was found to result in multiple fusion transcripts spanning the first three or four exons Type 2 diabete of gene TEL in combination with the final five to eight Note exons of PTPRR (Nakamura et al., 2005). Only a single The mapping of a novel type 2 diabetes susceptibility chimeric TEL/PTPRR fusion transcript, however, locus on chromosome location 12q15, back in the dictates an open reading frame that would be in-frame former century, early on triggered the testing of PTPRR with PTPRR sequences. This fusion transcript joins the as a candidate risk gene. Although the subsequent study fourth TEL exon with the ninth of PTPRR and results provided a first snapshot of the gene and also yielded in a protein that lacks the first (exon 8-encoded) thirty- multiple polymorphisms, none of the identified odd residues of the PTP catalytic domain and thus will mutations did segregate with diabetes (Bektas et al., be enzymatically activity. It therefore seems more 2001). Thus PTPRR is excluded as a risk gene at the likely that an altered functionality of the TEL type 2 diabetes locus on chromosome 12q15. transcriptional repressor part in the chimeric protein is instrumental in the disease. Psychoneuropathologies Note Colorectal and cervical cancers In prefrontal cortex and hippocampal areas in brains of Note depressed suicide subjects a significant reduction of Recent findings, however, more directly support a role MAP kinase transcript levels and increased amounts of for PTPRR in cancer etiology. RNA expression studies a dual-specificity MAP kinase phosphatase have been in mice highlighted PTPRR isoform expression in the noted (Dwivedi et al., 2001). Intriguingly, epithelial linings of the intestine (Augustine et al., transcriptome-wide micro-array expression studies on 2000). Gene expression profile analyses revealed that postmortem orbitofrontal cortex tissue from violent PTPRR transcription was markedly downregulated in suicide victims subsequently revealed a 1,5-fold colorectal tumors as compared to normal mucosa upregulation of PTPRR mRNA levels when compared (Sabates-Bellver et al., 2007). The decreased to controls (Thalmeier et al., 2008). This suggests a expression in precancerous and cancerous colorectal picture in which the reduction of MAP kinase signals in tumors resulted from epigenetic changes, both at the distinct brain areas - for example due to PTPRR level of CpG island DNA methylation and histone-tail aberrancies - may ultimately lead to profound mood modification, that were also observed in colon cancer distortions with eventual violent or deadly cell lines and were maintained in metastases (Menigatti consequences. Such mood disorders are quite hard to et al., 2009). The finding was recently confirmed in an study in mouse models and also the subtleties in brain independent study on colon carcinomas (Laczmanska et expression patterns will severely hamper reductionistic al., 2013) and can now be extended to cervix cancer on studies on the psychopathophysiological relevance of the basis of a study that concentrated on the these findings. consequences of DNA methyltransferases 3B Recently, however, an additional correlative finding (DNMT3B) hyperactivity in invasive cervical cancer aids in building a case for involvement of PTPRR in (Su et al., 2013). It turned out that PTPRR was silenced psychoneuropathologies. It is currently well accepted through DNMT3B-mediated methylation. Given the that genetic components are contributing to major impact of the RAS/RAF/MAPK signalling axis in depressive disorder (MDD), a chronic and rather cancer cell proliferation, it is not difficult to envision common mental disease. Given that reduced MAP that PTPRR down-regulation would aid constitutive kinase activity has been noted in MDD pathogenesis activation of this key pathway. Furthermore, PTPRR (Einat et al., 2003; Chen et al., 2006) and that PTPRR re-expression was shown to inhibit the expression of proteins inhibit this signaling pathway, it made sense to the oncogenic human papillomavirus E6/E7 proteins test whether PTPRR perhaps represents an MDD risk (Su et al., 2013), providing yet another advantage for gene. By monitoring the distribution of 16 single HPV-positive cells to downregulate this PTP gene. nucleotide polymorphisms (SNPs) at the PTPRR locus PTPRR is normally not only expressed in the cervix but in a Chinese Han population indeed one (rs1513105) also in endometrial tissue. By comparing mRNA levels demonstrated allelic association with an increased risk for MDD, but primarily in the female subjects (Shi et

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 28 PTPRR (protein tyrosine phosphatase, receptor type, R) Erkens M, et al.

al., 2012). Replication in additional cohorts will be the Shiozuka K, Watanabe Y, Ikeda T, Hashimoto S, Kawashima next step. H. Cloning and expression of PCPTP1 encoding protein tyrosine phosphatase. Gene. 1995 Sep 11;162(2):279-84 Like for MDD, the heterogeneous etiology of alcohol use disorders (AUD) predicts a complex interplay of Spiess M. Heads or tails--what determines the orientation of environmental and heritable factors and the latter may proteins in the membrane. FEBS Lett. 1995 Aug 1;369(1):76-9 include impaired MAP kinase signaling circuits. By Pulido R, Zúñiga A, Ullrich A. PTP-SL and STEP protein combining genome wide association studies (GWAS) tyrosine phosphatases regulate the activation of the extracellular signal-regulated kinases ERK1 and ERK2 by and gene set enrichment analyses (GSEA) on subjects association through a kinase interaction motif. EMBO J. 1998 characterized for alcohol response level phenotypes, a Dec 15;17(24):7337-50 set of 173 genes that appear relevant for the disorder, Watanabe Y, Shiozuka K, Ikeda T, Hoshi N, Hiraki H, Suzuki T, among which PTPRR, could be extracted (Joslyn et al., Hashimoto S, Kawashima H. Cloning of PCPTP1-Ce encoding 2010). Several had a reported involvement in alcohol protein tyrosine phosphatase from the rat cerebellum and its response and addiction, and a specific enrichment for restricted expression in Purkinje cells. Brain Res Mol Brain neuronal signaling genes - especially the ones Res. 1998 Jul 15;58(1-2):83-94 impacting on glutamate signaling - was apparent Blanco-Aparicio C, Torres J, Pulido R. A novel regulatory (Joslyn et al., 2010). Analogous to STEP (Baum et al., mechanism of MAP kinases activation and nuclear translocation mediated by PKA and the PTP-SL tyrosine 2010), PTPRR may modulate AMPA and NMDA phosphatase. J Cell Biol. 1999 Dec 13;147(6):1129-36 receptor levels and as such is an appealing genetic component for the modulation of alcohol's effects. Ogata M, Oh-hora M, Kosugi A, Hamaoka T. Inactivation of mitogen-activated protein kinases by a mammalian tyrosine- Myopia specific phosphatase, PTPBR7. Biochem Biophys Res Commun. 1999 Mar 5;256(1):52-6 Note Saxena M, Williams S, Brockdorff J, Gilman J, Mustelin T. The most recent addition to the list of disease Inhibition of T cell signaling by mitogen-activated protein associations for PTPRR is that of nearsightedness, or kinase-targeted hematopoietic tyrosine phosphatase (HePTP). myopia (Hawthorne et al., 2013). For this common J Biol Chem. 1999 Apr 23;274(17):11693-700 ocular genetic disease over 20 candidate genomic loci Van Den Maagdenberg AM, Bächner D, Schepens JT, Peters have been put forward, including one on chromosome W, Fransen JA, Wieringa B, Hendriks WJ. The mouse Ptprr 12q21-23 that links to high-grade myopia. Subsequent gene encodes two protein tyrosine phosphatases, PTP-SL and genetic association studies using hundreds of SNPs PTPBR7, that display distinct patterns of expression during neural development. Eur J Neurosci. 1999 Nov;11(11):3832-44 within the linkage region yielded several that significantly associated with the disease, including Zúñiga A, Torres J, Ubeda J, Pulido R. Interaction of mitogen- rs3803036 that represents a Lys>Arg missense activated protein kinases with the kinase interaction motif of the tyrosine phosphatase PTP-SL provides substrate mutation in PTPRR (Hawthorne et al., 2013). specificity and retains ERK2 in the cytoplasm. J Biol Chem. Microarray analyses revealed that PTPRR is 1999 Jul 30;274(31):21900-7 differentially expressed in fetal and adult ocular tissue, Augustine KA, Silbiger SM, Bucay N, Ulias L, Boynton A, warranting further studies on its role in myopic Trebasky LD, Medlock ES. Protein tyrosine phosphatase development. (PC12, Br7,S1) family: expression characterization in the adult human and mouse. Anat Rec. 2000 Mar 1;258(3):221-34 To be noted Andersen JN, Mortensen OH, Peters GH, Drake PG, Iversen LF, Olsen OH, Jansen PG, Andersen HS, Tonks NK, Møller Note NP. Structural and evolutionary relationships among protein Ptprr knockout mice display mild, ataxia-like, tyrosine phosphatase domains. Mol Cell Biol. 2001 locomotive impairment (Chirivi et al., 2007) but the Nov;21(21):7117-36 gene's location in human does not match with the Bektas A, Hughes JN, Warram JH, Krolewski AS, Doria A. various ataxia loci that have been mapped thus far and Type 2 diabetes locus on 12q15. Further mapping and mutation screening of two candidate genes. Diabetes. 2001 that still await identification of the underlying gene Jan;50(1):204-8 defects (Espinós et al., 2009). Dwivedi Y, Rizavi HS, Roberts RC, Conley RC, Tamminga CA, Pandey GN. Reduced activation and expression of ERK1/2 References MAP kinase in the post-mortem brain of depressed suicide subjects. J Neurochem. 2001 May;77(3):916-28 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990 Oct 5;215(3):403-10 Gronda M, Arab S, Iafrate B, Suzuki H, Zanke BW. Hematopoietic protein tyrosine phosphatase suppresses Guan KL, Dixon JE. Evidence for protein-tyrosine-phosphatase extracellular stimulus-regulated kinase activation. Mol Cell Biol. catalysis proceeding via a cysteine-phosphate intermediate. J 2001 Oct;21(20):6851-8 Biol Chem. 1991 Sep 15;266(26):17026-30 Szedlacsek SE, Aricescu AR, Fulga TA, Renault L, Scheidig Barford D, Flint AJ, Tonks NK. Crystal structure of human AJ. Crystal structure of PTP-SL/PTPBR7 catalytic domain: protein tyrosine phosphatase 1B. Science. 1994 Mar implications for MAP kinase regulation. J Mol Biol. 2001 Aug 11;263(5152):1397-404 17;311(3):557-68

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 29 PTPRR (protein tyrosine phosphatase, receptor type, R) Erkens M, et al.

Buschbeck M, Eickhoff J, Sommer MN, Ullrich A. Crystal structures and inhibitor identification for PTPN5, Phosphotyrosine-specific phosphatase PTP-SL regulates the PTPRR and PTPN7: a family of human MAPK-specific protein ERK5 signaling pathway. J Biol Chem. 2002 Aug tyrosine phosphatases. Biochem J. 2006 May 1;395(3):483-91 16;277(33):29503-9 Noordman YE, Jansen PA, Hendriks WJ. Tyrosine-specific Krieger E, Koraimann G, Vriend G. Increasing the precision of MAPK phosphatases and the control of ERK signaling in PC12 comparative models with YASARA NOVA--a self- cells. J Mol Signal. 2006 Nov 29;1:4 parameterizing force field. Proteins. 2002 May 15;47(3):393- 402 Chirivi RG, Noordman YE, Van der Zee CE, Hendriks WJ. Altered MAP kinase phosphorylation and impaired motor Dilaver G, Schepens J, van den Maagdenberg A, Wijers M, coordination in PTPRR deficient mice. J Neurochem. 2007 Pepers B, Fransen J, Hendriks W. Colocalisation of the protein May;101(3):829-40 tyrosine phosphatases PTP-SL and PTPBR7 with beta4- adaptin in neuronal cells. Histochem Cell Biol. 2003 Dilaver G, van de Vorstenbosch R, Tárrega C, Ríos P, Pulido Jan;119(1):1-13 R, van Aerde K, Fransen J, Hendriks W. Proteolytic processing of the receptor-type protein tyrosine phosphatase PTPBR7. Einat H, Yuan P, Gould TD, Li J, Du J, Zhang L, Manji HK, FEBS J. 2007 Jan;274(1):96-108 Chen G. The role of the extracellular signal-regulated kinase signaling pathway in mood modulation. J Neurosci. 2003 Aug Lein ES, Hawrylycz MJ, Ao N, Ayres M, Bensinger A, Bernard 13;23(19):7311-6 A, Boe AF, Boguski MS, Brockway KS, Byrnes EJ, Chen L, Chen L, Chen TM, Chin MC, Chong J, Crook BE, Czaplinska Muñoz JJ, Tárrega C, Blanco-Aparicio C, Pulido R. Differential A, Dang CN, Datta S, Dee NR, Desaki AL, Desta T, Diep E, interaction of the tyrosine phosphatases PTP-SL, STEP and Dolbeare TA, Donelan MJ, Dong HW, Dougherty JG, Duncan HePTP with the mitogen-activated protein kinases ERK1/2 and BJ, Ebbert AJ, Eichele G, Estin LK, Faber C, Facer BA, Fields p38alpha is determined by a kinase specificity sequence and R, Fischer SR, Fliss TP, Frensley C, Gates SN, Glattfelder KJ, influenced by reducing agents. Biochem J. 2003 May Halverson KR, Hart MR, Hohmann JG, Howell MP, Jeung DP, 15;372(Pt 1):193-201 Johnson RA, Karr PT, Kawal R, Kidney JM, Knapik RH, Kuan CL, Lake JH, Laramee AR, Larsen KD, Lau C, Lemon TA, Paul S, Nairn AC, Wang P, Lombroso PJ. NMDA-mediated Liang AJ, Liu Y, Luong LT, Michaels J, Morgan JJ, Morgan RJ, activation of the tyrosine phosphatase STEP regulates the Mortrud MT, Mosqueda NF, Ng LL, Ng R, Orta GJ, Overly CC, duration of ERK signaling. Nat Neurosci. 2003 Jan;6(1):34-42 Pak TH, Parry SE, Pathak SD, Pearson OC, Puchalski RB, Chirivi RG, Dilaver G, van de Vorstenbosch R, Wanschers B, Riley ZL, Rockett HR, Rowland SA, Royall JJ, Ruiz MJ, Sarno Schepens J, Croes H, Fransen J, Hendriks W. NR, Schaffnit K, Shapovalova NV, Sivisay T, Slaughterbeck Characterization of multiple transcripts and isoforms derived CR, Smith SC, Smith KA, Smith BI, Sodt AJ, Stewart NN, from the mouse protein tyrosine phosphatase gene Ptprr. Stumpf KR, Sunkin SM, Sutram M, Tam A, Teemer CD, Thaller Genes Cells. 2004 Oct;9(10):919-33 C, Thompson CL, Varnam LR, Visel A, Whitlock RM, Wohnoutka PE, Wolkey CK, Wong VY, Wood M, Yaylaoglu Nika K, Hyunh H, Williams S, Paul S, Bottini N, Taskén K, MB, Young RC, Youngstrom BL, Yuan XF, Zhang B, Lombroso PJ, Mustelin T. Haematopoietic protein tyrosine Zwingman TA, Jones AR. Genome-wide atlas of gene phosphatase (HePTP) phosphorylation by cAMP-dependent expression in the adult mouse brain. Nature. 2007 Jan protein kinase in T-cells: dynamics and subcellular location. 11;445(7124):168-76 Biochem J. 2004 Mar 1;378(Pt 2):335-42 Sabates-Bellver J, Van der Flier LG, de Palo M, Cattaneo E, Mustelin T, Tautz L, Page R. Structure of the hematopoietic Maake C, Rehrauer H, Laczko E, Kurowski MA, Bujnicki JM, tyrosine phosphatase (HePTP) catalytic domain: structure of a Menigatti M, Luz J, Ranalli TV, Gomes V, Pastorelli A, KIM phosphatase with phosphate bound at the active site. J Faggiani R, Anti M, Jiricny J, Clevers H, Marra G. Mol Biol. 2005 Nov 18;354(1):150-63 Transcriptome profile of human colorectal adenomas. Mol Cancer Res. 2007 Dec;5(12):1263-75 Nakamura F, Nakamura Y, Maki K, Sato Y, Mitani K. Cloning and characterization of the novel chimeric gene TEL/PTPRR in Noordman YE, Augustus ED, Schepens JT, Chirivi RG, Ríos acute myelogenous leukemia with inv(12)(p13q13). Cancer P, Pulido R, Hendriks WJ. Multimerisation of receptor-type Res. 2005 Aug 1;65(15):6612-21 protein tyrosine phosphatases PTPBR7 and PTP-SL attenuates enzymatic activity. Biochim Biophys Acta. 2008 Stoker AW. Protein tyrosine phosphatases and signalling. J Feb;1783(2):275-86 Endocrinol. 2005 Apr;185(1):19-33 Sherwin JR, Sharkey AM, Mihalyi A, Simsa P, Catalano RD, Tárrega C, Ríos P, Cejudo-Marín R, Blanco-Aparicio C, van D'Hooghe TM. Global gene analysis of late secretory phase, den Berk L, Schepens J, Hendriks W, Tabernero L, Pulido R. eutopic endometrium does not provide the basis for a ERK2 shows a restrictive and locally selective mechanism of minimally invasive test of endometriosis. Hum Reprod. 2008 recognition by its tyrosine phosphatase inactivators not shared May;23(5):1063-8 by its activator MEK1. J Biol Chem. 2005 Nov 11;280(45):37885-94 Thalmeier A, Dickmann M, Giegling I, Schneider B, M Hartmann A, Maurer K, Schnabel A, Kauert G, Möller HJ, Valjent E, Pascoli V, Svenningsson P, Paul S, Enslen H, Rujescu D. Gene expression profiling of post-mortem Corvol JC, Stipanovich A, Caboche J, Lombroso PJ, Nairn AC, orbitofrontal cortex in violent suicide victims. Int J Greengard P, Hervé D, Girault JA. Regulation of a protein Neuropsychopharmacol. 2008 Mar;11(2):217-28 phosphatase cascade allows convergent dopamine and glutamate signals to activate ERK in the striatum. Proc Natl Barr AJ, Ugochukwu E, Lee WH, King ON, Filippakopoulos P, Acad Sci U S A. 2005 Jan 11;102(2):491-6 Alfano I, Savitsky P, Burgess-Brown NA, Müller S, Knapp S. Large-scale structural analysis of the classical human protein Chen G, Manji HK. The extracellular signal-regulated kinase tyrosine phosphatome. Cell. 2009 Jan 23;136(2):352-63 pathway: an emerging promising target for mood stabilizers. Curr Opin Psychiatry. 2006 May;19(3):313-23 Espinós C, Palau F. Genetics and pathogenesis of inherited ataxias and spastic paraplegias. Adv Exp Med Biol. Eswaran J, von Kries JP, Marsden B, Longman E, Debreczeni 2009;652:263-96 JE, Ugochukwu E, Turnbull A, Lee WH, Knapp S, Barr AJ.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 30 PTPRR (protein tyrosine phosphatase, receptor type, R) Erkens M, et al.

Hendriks WJ, Dilaver G, Noordman YE, Kremer B, Fransen JA. AJ, Sunkin SM, Swanson BE, Vawter MP, Williams D, PTPRR protein tyrosine phosphatase isoforms and locomotion Wohnoutka P, Zielke HR, Geschwind DH, Hof PR, Smith SM, of vesicles and mice. Cerebellum. 2009 Jun;8(2):80-8 Koch C, Grant SG, Jones AR. An anatomically comprehensive atlas of the adult human brain transcriptome. Nature. 2012 Sep Menigatti M, Cattaneo E, Sabates-Bellver J, Ilinsky VV, Went 20;489(7416):391-9 P, Buffoli F, Marquez VE, Jiricny J, Marra G. The protein tyrosine phosphatase receptor type R gene is an early and Shi C, Zhang K, Xu Q. Gender-specific role of the protein frequent target of silencing in human colorectal tumorigenesis. tyrosine phosphatase receptor type R gene in major Mol Cancer. 2009 Dec 16;8:124 depressive disorder. J Affect Disord. 2012 Feb;136(3):591-8 Venkitaramani DV, Paul S, Zhang Y, Kurup P, Ding L, Tressler Xu J, Kurup P, Bartos JA, Patriarchi T, Hell JW, Lombroso PJ. L, Allen M, Sacca R, Picciotto MR, Lombroso PJ. Knockout of Striatal-enriched protein-tyrosine phosphatase (STEP) striatal enriched protein tyrosine phosphatase in mice results in regulates Pyk2 kinase activity. J Biol Chem. 2012a Jun increased ERK1/2 phosphorylation. Synapse. 2009 15;287(25):20942-56 Jan;63(1):69-81 Xu J, Kurup P, Nairn AC, Lombroso PJ. Striatal-enriched Baum ML, Kurup P, Xu J, Lombroso PJ. A STEP forward in protein tyrosine phosphatase in Alzheimer's disease. Adv neural function and degeneration. Commun Integr Biol. 2010 Pharmacol. 2012b;64:303-25 Sep;3(5):419-22 Hawthorne F, Feng S, Metlapally R, Li YJ, Tran-Viet KN, Joslyn G, Ravindranathan A, Brush G, Schuckit M, White RL. Guggenheim JA, Malecaze F, Calvas P, Rosenberg T, Mackey Human variation in alcohol response is influenced by variation DA, Venturini C, Hysi PG, Hammond CJ, Young TL. in neuronal signaling genes. Alcohol Clin Exp Res. 2010 Association mapping of the high-grade myopia MYP3 locus May;34(5):800-12 reveals novel candidates UHRF1BP1L, PTPRR, and PPFIA2. Invest Ophthalmol Vis Sci. 2013 Mar 21;54(3):2076-86 Chesini IM, Debyser G, Croes H, Ten Dam GB, Devreese B, Stoker AW, Hendriks WJ. PTPBR7 binding proteins in Laczmanska I, Karpinski P, Bebenek M, Sedziak T, Ramsey D, myelinating neurons of the mouse brain. Int J Biol Sci. Szmida E, Sasiadek MM. Protein tyrosine phosphatase 2011;7(7):978-91 receptor-like genes are frequently hypermethylated in sporadic colorectal cancer. J Hum Genet. 2013 Jan;58(1):11-5 Goebel-Goody SM, Baum M, Paspalas CD, Fernandez SM, Carty NC, Kurup P, Lombroso PJ. Therapeutic implications for Mohebiany AN, Nikolaienko RM, Bouyain S, Harroch S. striatal-enriched protein tyrosine phosphatase (STEP) in Receptor-type tyrosine phosphatase ligands: looking for the neuropsychiatric disorders. Pharmacol Rev. 2012 needle in the haystack. FEBS J. 2013 Jan;280(2):388-400 Jan;64(1):65-87 Su PH, Lin YW, Huang RL, Liao YP, Lee HY, Wang HC, Chao Hawrylycz MJ, Lein ES, Guillozet-Bongaarts AL, Shen EH, Ng TK, Chen CK, Chan MW, Chu TY, Yu MH, Lai HC. Epigenetic L, Miller JA, van de Lagemaat LN, Smith KA, Ebbert A, Riley silencing of PTPRR activates MAPK signaling, promotes ZL, Abajian C, Beckmann CF, Bernard A, Bertagnolli D, Boe metastasis and serves as a biomarker of invasive cervical AF, Cartagena PM, Chakravarty MM, Chapin M, Chong J, cancer. Oncogene. 2013 Jan 3;32(1):15-26 Dalley RA, Daly BD, Dang C, Datta S, Dee N, Dolbeare TA, Faber V, Feng D, Fowler DR, Goldy J, Gregor BW, Haradon Z, This article should be referenced as such: Haynor DR, Hohmann JG, Horvath S, Howard RE, Jeromin A, Jochim JM, Kinnunen Erkens M, Kremer H, Pulido R, Hendriks W. PTPRR (protein tyrosine phosphatase, receptor type, R). Atlas Genet M, Lau C, Lazarz ET, Lee C, Lemon TA, Li L, Li Y, Morris JA, Cytogenet Oncol Haematol. 2014; 18(1):23-31. Overly CC, Parker PD, Parry SE, Reding M, Royall JJ, Schulkin J, Sequeira PA, Slaughterbeck CR, Smith SC, Sodt

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 31 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

TSPY1 (testis specific protein, Y-linked 1) Stephanie Schubert Hannover Medical School, Institute for Human Genetics, Hannover, Germany (SS)

Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/TSPY1ID42718chYp11.html DOI: 10.4267/2042/52074 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Review on TSPY1, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

array (Skaletsky et al., 2003). Especially this Identity ampliconic TSPY1 gene array on Yp11.2 is a hotspot Other names: CT78, DYS14, TSPY, pJA923 for intrachromosomal recombination likely by unequal HGNC (Hugo): TSPY1 sister chromatid exchange (Skaletsky et al., 2003) that leads to differences in copy number among men. It has Location: Yp11.2 to be mentioned that the TSPY nomenclature is far Local order: TSPY1 is a Y-chromosomal repetitive from being established right now. gene which is organized in clusters. The major TSPY1 Besides the TSPY1 and TSPY3 genes were also cluster is a constitutive part of the DYZ5-tandem array TSPY2, TSPY4, TSPY8 and TSPY10 genes and where each TSPY1 copy is surrounded by a single multiple TSPY pseudogenes (TSPYPn) annotated on DYZ5 20.4 kb repeat unit. This TSPY1 tandem array is Yp11.2 on the human Y chromosome (reference the largest and most homogeneous protein coding NC_00024.9). Controversially, TSPY1 was earlier tandem array that is known in the human genome. designated as one out of the multiple TSPY genes Note within the TSPY tandem array (Bhowmick et al., DYS14 is located within the TSPY gene and pJA923 2007). was the first isolated TSPY-cDNA clone (Arnemann et Description al., 1991). The prototypic human TSPY gene is composed of six exons and five introns and a promoter region of yet DNA/RNA unknown length. Functional TSPY genes can differ in Note sequence within coding and promoter regions of up to Human TSPY was originally identified as the first Y- 1% (Vogel and Schmidtke, 1998). chromosomal gene, which expression was exclusively Transcription restricted to the testis (Arnemann et al., 1987). Besides the TSPY1 main transcript TSPY-L Nowadays it is known that TSPY is predominantly (NM_003308.3), which was originally named as expressed in the testes and to much lesser extent major TSPY (Schnieders et al., 1996) or type 1 TSPY expressed in the native prostate and the human brain transcript (Lau et al., 2003), eleven different transcript (Kido and Lau, 2005; Lau et al., 2003). isoforms that differ in sequence and in length were The organization of human TSPY on the human Y detected in the testis, and in prostatic and testicular chromosome as a heterogeneous repetitive gene family tumors (Zhang et al., 1992; Dechend et al., 2000; with varying copy number ranging from 9-101 among Schnieders et al., 1996; Lau et al., 2003; Li et al., individuals is unusual in the human genome 2007). One of these TSPY1 minor transcripts is the (Nickkholgh et al., 2010; Giachini et al., 2009; Shen et TSPY-S variant (NM_001197242.1) which uses an al., 2013). Besides a single separate functional TSPY alternative splice acceptor site 11 bp upstream of the gene (TSPY3) on Yp are most TSPY copies (TSPY1) native intron 5/exon 5 border of the main TSPY-L embedded in 20.4 kb repeat units of the DYZ5 tandem transcript (Zhang et al., 1992).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 32 TSPY1 (testis specific protein, Y-linked 1) Schubert S

TSPY gene and TSPY transcripts that were identified in human testes [T] (Schnieders et al., 1998, Dechend et al., 2000; Li et al., 2007), testicular seminoma [TC] (Li et al., 2007) and prostatic adenoma and benign prostatic hyperplasia [P] (Lau et al., 2003) tissues. Exons 1- 6 are highlighted as colored boxes and introns 1-5 are shown as grey bars. Small vertical grey bars are showing alternative splice donor and/or splice acceptor sites. 18bp insertion: in frame insertion of 18 nucleotides within exon 1, + combined splice patterns. This figure was originally modified published in Schubert and Schmidtke (2010).

TSPY-S is translated in a shortened distinct peptide paralogs and with SET and NAP-1 a highly-conserved (NP_001184171.1) of 294 amino acids with type B cyclin binding SET/NAP domain (amino acids frameshifted ORF at amino acid position 275 in residues 121-265 according to Li and Lau, 2008). comparison to TSPY-L. The TSPY-L transcript has a For human TSPY the translation elongation factor length of 1160 bp and encodes for a TSPY-L peptide of eEF1A1 has also been identified as binding partner of 308 amino acids (NP_003299.2). the SET/NAP domain in a yeast-two-hybrid screen Pseudogene (Kido and Lau, 2008). An interaction of TSPY with eEF1A1 and eEF1A2 was also shown by in vitro GST- Multiple annotated TSPY pseudogenes (TSPYPn) are pull down assays by Kido and Lau (2008). available on the human Y chromosome. These TSPY An in vitro binding of the SET/NAP domain of TSPY pseudogenes can show a nucleotide divergence in and the calcium/calmodulin-dependent serine protein coding and promoter regions of up to 10% (Vogel and kinase (CASK), which is among other things essential Schmidtke, 1998). for synapsis formation and memory, was also demonstrated in transfected COS7 cells (Kido et al., Protein 2011). Besides the cyclin B, eEF1A1 and CASK interactive Description SET/NAP domain is TSPY-L harbouring an N- Human TSPY1 encodes the TSPY1 protein. The main terminus of 120 and a C-terminus of 43 amino acids. protein is named TSPY-L and is composed of 308 Two putative homodimer forming α-helices ( α1, aa 52- amino acids (size 33 kDa). TSPY-L occurs mainly as a 95 and α2, aa 105-141) were predicted within the N- phosphoprotein with a predicted size of 38 kDa terminal region by in silico analysis (Kido and Lau, (Schnieders et al., 1996). TSPY is sharing with its X- 2008). It was further shown by co-immunprecipitation encoded homolog TSPYL2 (designated also as TSPX, of TSPY from transfected COS7 cells that TSPY can CDA1, DENTT or NP79), autosomal TSPY-like form homodimers, which is presumably mediated

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 33 TSPY1 (testis specific protein, Y-linked 1) Schubert S

through the α-helices of its N-terminal region (Kido autosomal encoded paralogs TSPYL1, TSPYL3, and Lau, 2008). TSPYL4, TSPYL5, TSPYL6 members of this protein The N-terminal region of TSPY is also capable to bind family. Members of the SET/NAP-protein-family play to the androgen receptor (AR) AF-2 region (Akimoto et function in cell cycle regulation, transcription, al., 2010). For rat TSPY it was also shown that the N- translation, signal transduction, DNA replication and terminal region of rat TSPY is preferentially binding to chromatin condensation (Lau et al., 2009; Lau et al., core histones, although a much lower binding affinity 2011 and included references). for core histones was also observed for the acidic part - Ectopic expression of TSPY in transfected human of the SET/NAP domain of rat TSPY (Kido and Lau, HeLa and murine NIH3T3 cells stimulates cell growth 2006). by promoting the G2/M-phase transition of the cell Expression cycle (Oram et al., 2006). It was later shown in transiently transfected HeLa and HEK293 cells that this Human TSPY is mainly expressed in testicular germ effect is mediated by a direct interaction of the cells and weakly expressed in epithelial cells of the SET/NAP domain of TSPY with the activated cyclin prostate. However, some TSPY ESTs originated from B1/CDK complex. TSPY accelerates the G2/M-phase the medulla of human brains are also available in transition of host cells by stimulating the kinase activity databases (Kido and Lau, 2005). TSPY is expressed in of the activated cyclin B1/CDK complex (Li et al., gonocytes and prespermatogonia of the fetal testis and 2008). The co-localization of TSPY and cyclin B1 in in prespermatogonia of the neonatal testis (Honecker et spermatogonia and primary spermatocytes suggests a al., 2004). Within the adult testis are highest TSPY putative interaction of both proteins during expression levels observed in spermatogonia and in spermatogonial renewal and during the prophase I of primary spermatocytes of the preleptotene to zygotene the first meiotic division (Lau et al., 2011). However, stage of the meiotic prophase I, while expression level the relevance of TSPY's ability to stimulate the kinase decreases gradually during meiosis form primary activity of an activated cyclin B1/cdk complex in spermatocytes of the pachytene stage to round transiently transfected human HEK293 cells to its in spermatids (Lau et al., 2011). vivo function within the testis is still unclear. Localisation - Kido and Lau (2008) have identified the eucaryotic TSPY is predominantly localized in the cytoplasm but elongation factor 1 alpha (eEF1A) in a yeast two- also to lesser extent present in the nucleus of male germ hybrid screen as interaction partner for human and rat cells and epithelial cells of the prostate. It is supposed TSPY. It was shown by in vitro GST pull down assays that the phosphorylation status of the CK2 that eEF1A1 and eEF1A2, which both are essential for phosphorylation site (T300) at the C-terminus of the elongation phase of protein translation, can bind to human TSPY is important for its nucleo-cytoplasmatic the SET/NAP domain of human TSPY. Kido and Lau shuttling (Krick et al., 2006). (2008) have also demonstrated that ectopic expression of TSPY in HEK293 cells enhances expression of a Function cotransfected luciferase reporter transcript. Whether Currently the biological role of TSPY within the testis this effect is mediated by a synergistically interaction and in the prostate are unknown but TSPY proposed of TSPY and eEF1A in reporter gene transcription and functions are diverse. Especially the conservation of translation is currently unknown. It is also still unclear functional TSPY genes in different mammalian whether TSPY could affect the expression of specific lineages indicates an important biological role of TSPY genes in spermatogonia and spermatocytes by in spermatogenesis. Expression studies of human TSPY interaction with eEF1A. The co-expression and co- within the human testis suggest that TSPY could act as localization of TSPY and eEF1A in spermatogonia and proliferation factor of testicular germ cells, such as spermatocytes makes an interaction of both proteins in gonocytes, prespermatogonia and spermatogonia in the the human testis not unlikely. The findings of the latter fetal, neonatal, pubertal and adult testis and could act as study suggest that TSPY and eEF1A could synergistic a catalyst in meiotic differentiation and division of exert progrowth functions on germ cells by promoting spermatocytes within the pubertal and adult testis gene expression. (Schnieders et al., 1996; Honecker et al., 2004; Lau et Other TSPY proposed functions are: al., 2011). These proposed functions are founded on the - It is also supposed that rat TSPY could affect following observations: spermatogenesis by acting as histone chaperone in - TSPY shares a highly conserved SET/NAP domain elongated spermatids during the maturation process with other members of a protein family that was when histones are replaced by basic protamines (Kido designated as TSPY/TSPY-like/SET/NAP (TTSN)- and Lau, 2006). It was shown by in vitro GST pull family (Schnieders et al., 1996; Vogel and Schmidtke, down assays that human TSPY and rTSPY can both 1998). Besides TSPY itself, are its X-encoded bind to the core histones H2A, H2B, H3 and H4, homologue TSPYL2, the oncogene SET (suppressor of respectively (Kido and Lau, 2006). The non variegation, enhancer of zeste and Trithorax), the overlapping expression pattern of human TSPY and neucleosome assembly protein-1 (NAP1) and the

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 34 TSPY1 (testis specific protein, Y-linked 1) Schubert S

rTSPY in spermatids makes a function of human TSPY found no association between TSPY copy number and as histone chaperone in spermatids rather unlikely. the fertility status. Giacchini et al. (2009) showed that - TSPY is coexpressed with the androgen receptor in TSPY copy number and sperm count are positively testicular germ cell tumors (seminomas and correlated in infertile (n=154) and normozoospermic nonseminomas) and in prostatic tumors (Akimoto et al., (n=130) men, respectively, and observed a significantly 2010). TSPY can trap the androgen-bound androgen lower mean TSPY copy number in infertile men receptor in the cytoplasm of TSPY stably expressing compared to fertile controls. Interestingly, a significant NEC8-TSPY cells (a model nonseminoma cell line) difference in mean TSPY copy number among different and in TSPY endogenously expressing LNCaP cells, Y-haplogroups was also observed, which points to the thereby repressing AR mediated gene transcription susceptibility of the outcome of TSPY case-control (Akimoto et al., 2010). It is supposed that TSPY studies to population stratification bias. They estimated represses androgen dependent cell proliferation in a 1.5-fold increased risk of abnormal sperm parameters TGCTs, presumably by preventing AR nuclear in individuals with less than 33 TSPY copies. Recently, translocation. However TSPY is not coexpressed with the TSPY copy number was quantified by quantitative the human AR in testicular cells, which exclude such a PCR-analyses in a large case-control study in 2272 Han function in the native testis. Chinese, composed of 698 normozoospermic controls, - TSPY and CASK are coexpressed and co-localized in 704 men with AZFc-deletions and 870 spermatogenesis the brains of TSPY transgenic founder mice, carrying a impaired non-AZF deleted men (Shen et al., 2013). A human TSPY 12,5 kb genomic fragment, which significantly higher risk for spermatogenic failure were includes 7,1 kb TSPY promoter region, a 2,8 kb found for men with TSPY copy numbers ≤20 or ≥ 56 in structural TSPY gene and 2,6 kb 3'-region. Whether an comparison to individuals with moderate TSPY copies in vivo co-localization and interaction of both proteins ranging from 21-35. Sperm production in men with 21- exist in humans is currently unknown (Kido et al., 55 TSPY copies was significantly higher in comparison 2011). to men that harboured less than 21 or more than 55 TSPY copies. The latter study points also to a Homology modulating effect of the TSPY copy number to the Especially the SET/NAP domain of TSPY shares high spermatogenic status of AFZc-deleted men with gr/gr homology to other members of the TTSN-protein deletions (Shen et al., 2013). Especially males with family. gr/gr deletions and TSPY copy number less than 21 seems to have a high risk for spermatogenic failure and Mutations reduced sperm numbers. Further studies are indispensable to verify the putative effect of TSPY Note copy number on male idiopathic infertility, and Due to the multi-copy status of TSPY genes and the especially on the phenotypic expression of gr/gr presence of multiple TSPY pseudogenes on the Y deletion carriers. chromosome no disease associated mutations have been identified so far. Recently, multiple TSPY-variants Gonadoblastoma within the 5'-UTR, exon 1 and 3'-UTR have been Note identified in a screening approach of 72 infertile men TSPY is commonly regarded as the most reliable and 31 fertile men as controls (Svacinova et al., 2011). candidate gene for GBY, the elusive gonadoblastoma Out of these were 39 variants in exon 1 elusively locus on the human Y chromosome that fulfills a native restricted to the infertile cohort (Svacinova et al., function in the testis but predisposes the dysgenetic 2011). gonads of 46,XY-sex-revered and intersex individuals for the formation of a gonadoblastoma (Page, 1987; Implicated in Lau et al., 2011). TSPY abundant expression in germ cells of dysgenetic gonads of sex-reversed humans Male idiopathic infertility harbouring at least the GBY critical region (Cools et Note al., 2006) and in gonadoblastoma (Hildenbrand et al., Four different studies have proven a relation between 1999; Kersemaekers et al., 2005; Cools et al., 2006) the TSPY copy number and male idiopathic infertility depicts TSPY gonadoblastoma predisposing role. Apart with different outcome. Vodicka et al. (2007) assessed from this and TSPY strong expression in the the relative number of TSPY copies by RQF-PCR in an carcinoma-in situ of the testis (Schnieders et al., 1998; infertile group (84 cases) and in 40 controls, and found Li et al., 2007), in some seminomas (Hersmus et al., an association of higher number of TSPY copies with 2012) and some non-seminomatous impaired sperm production. germ cell tumors (Honecker et al., 2006), and some Nickkholgh et al. (2010) compared the absolute TSPY somatic tumors, such as prostatic tumors, melanoma copy numbers by quantitative PCR and Southern-Blot and hepatocellular carcinoma, exist no evidence for an analyses in selected cases of 100 men with idiopathic oncogenic role of TSPY in general. infertility versus 100 normozoospermic controls, and

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 35 TSPY1 (testis specific protein, Y-linked 1) Schubert S

Vogel T, Boettger-Tong H, Nanda I, Dechend F, Agulnik AI, To be noted Bishop CE, Schmid M, Schmidtke J. A murine TSPY. Chromosome Res. 1998a Jan;6(1):35-40 Note Vogel T, Dittrich O, Mehraein Y, Dechend F, Schnieders F, TSPY genes have only been identified on the Y Schmidtke J. Murine and human TSPYL genes: novel chromosomes of different placental mammals. So far members of the TSPY-SET-NAP1L1 family. Cytogenet Cell no homologue genes have been found in the genomes Genet. 1998b;81(3-4):265-70 of marsupials and monotremes (Delbridge et al., 2004). Vogel T, Schmidtke J. Structure and function of TSPY, the Y- While orthologue genes in other primates, in cattle and chromosome gene coding for the "testis-specific protein". in some rodents, such as the Syrian hamster and Mus Cytogenet Cell Genet. 1998;80(1-4):209-13 palthytrix are functionally conserved and organized in Hildenbrand R, Schröder W, Brude E, Schepler A, König R, multiple copies, a peculiar situation is observed in Stutte HJ, Arnemann J. Detection of TSPY protein in a some other muride rodents (Xue and Tyler-Smith, unilateral microscopic gonadoblastoma of a Turner mosaic 2011; Vogel et al., 1998b; Schubert et al., 2000; patient with a Y-derived marker chromosome. J Pathol. 1999 Dec;189(4):623-6 Karwacki et al., 2006). Tspy-ps degenerated as a single copy on the Y-chromosome in mice of the sugenus Dechend F, Williams G, Skawran B, Schubert S, Krawczak M, Tyler-Smith C, Schmidtke J. TSPY variants in six loci on the Mus and in the Mongolian gerbil while a unique still human Y chromosome. Cytogenet Cell Genet. 2000;91(1- functional gene copy is still retained in different 4):67-71 Apodemus species and in the rat (Vogel et al., 1998a; Schubert S, Dechend F, Skawran B, Kunze B, Winking H, Mazeyrat and Mitcheli, 1998; Schubert et al., 2000; Weile C, Römer I, Hemberger M, Fundele R, Sharma T, Karwacki et al., 2006). Schubert et al. (2003) generated Schmidtke J. Silencing of the Y-chromosomal gene tspy during a TSPY transgenic mouse line (NMRI- murine evolution. Mamm Genome. 2000 Apr;11(4):288-91 Tg(TSPY)9Jshm), carrying a human 8.2 kb genomic Lau YF, Lau HW, Kömüves LG. Expression pattern of a fragment consisting of 2.9 kb TSPY promoter region, gonadoblastoma candidate gene suggests a role of the Y 2.8 kb coding region and 2.5 bp of the TSPY 3'-region, chromosome in prostate cancer. Cytogenet Genome Res. in which the organization and expression of the human 2003;101(3-4):250-60 TSPY transgene follow the human pattern. In this line Schubert S, Skawran B, Dechend F, Nayernia K, Meinhardt A, approximately 50 copies of the human TSPY transgene Nanda I, Schmid M, Engel W, Schmidtke J. Generation and characterization of a transgenic mouse with a functional human are inserted on the mouse Y chromosome. TSPY TSPY. Biol Reprod. 2003 Sep;69(3):968-75 transgenic B6;NMRI-Ki W-v/Kit W-v mice on a mixed NMRI/C57BL/6J genetic background are able to Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, Cordum HS, Hillier L, Brown LG, Repping S, Pyntikova T, Ali J, Bieri T, partially rescue spermatogenesis and fertility of Chinwalla A, Delehaunty A, Delehaunty K, Du H, Fewell G, W-v homozygous Kit -mutant males, thereby pointing to a Fulton L, Fulton R, Graves T, Hou SF, Latrielle P, Leonard S, role of human TSPY in early fetal and adult germ cell Mardis E, Maupin R, McPherson J, Miner T, Nash W, Nguyen development (Schöner et al., 2010). C, Ozersky P, Pepin K, Rock S, Rohlfing T, Scott K, Schultz B, Strong C, Tin-Wollam A, Yang SP, Waterston RH, Wilson RK, Rozen S, Page DC. The male-specific region of the human Y References chromosome is a mosaic of discrete sequence classes. Nature. 2003 Jun 19;423(6942):825-37 Arnemann J, Epplen JT, Cooke HJ, Sauermann U, Engel W, Schmidtke J. A human Y-chromosomal DNA sequence Delbridge ML, Longepied G, Depetris D, Mattei MG, Disteche expressed in testicular tissue. Nucleic Acids Res. 1987 Nov CM, Marshall Graves JA, Mitchell MJ. TSPY, the candidate 11;15(21):8713-24 gonadoblastoma gene on the human Y chromosome, has a widely expressed homologue on the X - implications for Y Page DC. Hypothesis: a Y-chromosomal gene causes chromosome evolution. Chromosome Res. 2004;12(4):345-56 gonadoblastoma in dysgenetic gonads. Development. 1987;101 Suppl:151-5 Honecker F, Stoop H, de Krijger RR, Chris Lau YF, Bokemeyer C, Looijenga LH. Pathobiological implications of the expression Arnemann J, Jakubiczka S, Thüring S, Schmidtke J. Cloning of markers of testicular carcinoma in situ by fetal germ cells. J and sequence analysis of a human Y-chromosome-derived, Pathol. 2004 Jul;203(3):849-57 testicular cDNA, TSPY. Genomics. 1991 Sep;11(1):108-14 Kersemaekers AM, Honecker F, Stoop H, Cools M, Molier M, Zhang JS, Yang-Feng TL, Muller U, Mohandas TK, de Jong Wolffenbuttel K, Bokemeyer C, Li Y, Lau YF, Oosterhuis JW, PJ, Lau YF. Molecular isolation and characterization of an Looijenga LH. Identification of germ cells at risk for neoplastic expressed gene from the human Y chromosome. Hum Mol transformation in gonadoblastoma: an immunohistochemical Genet. 1992 Dec;1(9):717-26 study for OCT3/4 and TSPY. Hum Pathol. 2005 May;36(5):512-21 Schnieders F, Dörk T, Arnemann J, Vogel T, Werner M, Schmidtke J. Testis-specific protein, Y-encoded (TSPY) Kido T, Lau YF. A Cre gene directed by a human TSPY expression in testicular tissues. Hum Mol Genet. 1996 promoter is specific for germ cells and neurons. Genesis. 2005 Aug;42(4):263-75 Nov;5(11):1801-7 Cools M, Stoop H, Kersemaekers AM, Drop SL, Wolffenbuttel Mazeyrat S, Mitchell MJ. Rodent Y chromosome TSPY gene is KP, Bourguignon JP, Slowikowska-Hilczer J, Kula K, Faradz functional in rat and non-functional in mouse. Hum Mol Genet. SM, Oosterhuis JW, Looijenga LH. Gonadoblastoma arising in 1998 Mar;7(3):557-62 undifferentiated gonadal tissue within dysgenetic gonads. J Clin Endocrinol Metab. 2006 Jun;91(6):2404-13

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 36 TSPY1 (testis specific protein, Y-linked 1) Schubert S

Honecker F, Stoop H, Mayer F, Bokemeyer C, Castrillon DH, androgen receptor in androgen-dependent testicular germ-cell Lau YF, Looijenga LH, Oosterhuis JW. Germ cell lineage tumors. Proc Natl Acad Sci U S A. 2010 Nov differentiation in non-seminomatous germ cell tumours. J 16;107(46):19891-6 Pathol. 2006 Feb;208(3):395-400 Nickkholgh B, Noordam MJ, Hovingh SE, van Pelt AM, van der Karwacki V, Kovac J, Mauceri G, Backhaus A, Föhse L, Veen F, Repping S. Y chromosome TSPY copy numbers and Schmidtke J, Schubert S. Tspy is nonfunctional in the semen quality. Fertil Steril. 2010 Oct;94(5):1744-7 Mongolian gerbil but functional in the Syrian hamster. Genomics. 2006 Jul;88(1):65-73 Schöner A, Adham I, Mauceri G, Marohn B, Vaske B, Schmidtke J, Schubert S. Partial rescue of the KIT-deficient Kido T, Lau YF. The rat Tspy is preferentially expressed in testicular phenotype in KitW-v/KitW-v Tg(TSPY) mice. Biol elongated spermatids and interacts with the core histones. Reprod. 2010 Jul;83(1):20-6 Biochem Biophys Res Commun. 2006 Nov 10;350(1):56-67 Schubert S, Schmidtke J.. Transgenic mouse studies to Krick R, Aschrafi A, Hasgün D, Arnemann J. CK2-dependent understand the regulation, expression and function of the C-terminal phosphorylation at T300 directs the nuclear testis-specific protein Y-encoded (TSPY) gene. Genes. transport of TSPY protein. Biochem Biophys Res Commun. 2010;1(2):244-262. 2006 Mar 10;341(2):343-50 Kido T, Schubert S, Schmidtke J, Chris Lau YF.. Expression of Oram SW, Liu XX, Lee TL, Chan WY, Lau YF. TSPY the human TSPY gene in the brains of transgenic mice potentiates cell proliferation and tumorigenesis by promoting suggests a potential role of this Y chromosome gene in neural cell cycle progression in HeLa and NIH3T3 cells. BMC Cancer. functions. J Genet Genomics. 2011 May 20;38(5):181-91. doi: 2006 Jun 9;6:154 10.1016/j.jgg.2011.04.002. Epub 2011 Apr 15. Bhowmick BK, Satta Y, Takahata N. The origin and evolution Lau YF, Li Y, Kido T.. Role of the Y-located putative of human ampliconic gene families and ampliconic structure. gonadoblastoma gene in human spermatogenesis. Syst Biol Genome Res. 2007 Apr;17(4):441-50 Reprod Med. 2011 Feb;57(1-2):27-34. doi: 10.3109/19396368.2010.499157. Epub 2011 Jan 5. Li Y, Tabatabai ZL, Lee TL, Hatakeyama S, Ohyama C, Chan WY, Looijenga LH, Lau YF. The Y-encoded TSPY protein: a Svacinova V, Vodicka R, Vrtel R, Godava M, Kvapilova M, significant marker potentially plays a role in the pathogenesis Krejcirikova E, Dusek L, Bortlicek Z, Santavy J.. Sequence of testicular germ cell tumors. Hum Pathol. 2007 recombination in exon 1 of the TSPY gene in men with Oct;38(10):1470-81 impaired fertility. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2011 Sep;155(3):287-98. doi: Vodicka R, Vrtel R, Dusek L, Singh AR, Krizova K, Svacinova 10.5507/bp.2011.034. V, Horinova V, Dostal J, Oborna I, Brezinova J, Sobek A, Santavy J. TSPY gene copy number as a potential new risk Xue Y and Tyler-Smith C.. An Exceptional Gene: Evolution of factor for male infertility. Reprod Biomed Online. 2007 the TSPY Gene Family in Humans and Other Great Apes. May;14(5):579-87 Genes. 2011;2(1):36-47 Kido T, Lau YF. The human Y-encoded testis-specific protein Hersmus R, Stoop H, van de Geijn GJ, Eini R, Biermann K, interacts functionally with eukaryotic translation elongation Oosterhuis JW, Dhooge C, Schneider DT, Meijssen IC, Dinjens factor eEF1A, a putative oncoprotein. Int J Cancer. 2008 Oct WN, Dubbink HJ, Drop SL, Looijenga LH.. Prevalence of c-KIT 1;123(7):1573-85 mutations in gonadoblastoma and dysgerminomas of patients with disorders of sex development (DSD) and ovarian Li Y, Lau YF. TSPY and its X-encoded homologue interact with dysgerminomas. PLoS One. 2012;7(8):e43952. doi: cyclin B but exert contrasting functions on cyclin-dependent 10.1371/journal.pone.0043952. Epub 2012 Aug 28. kinase 1 activities. Oncogene. 2008 Oct 16;27(47):6141-50 Shen Y, Yan Y, Liu Y, Zhang S, Yang D, Zhang P, Li L, Wang Giachini C, Nuti F, Turner DJ, Laface I, Xue Y, Daguin F, Forti Y, Ma Y, Tao D, Yang Y.. A significant effect of the TSPY1 G, Tyler-Smith C, Krausz C. TSPY1 copy number variation copy number on spermatogenesis efficiency and the influences spermatogenesis and shows differences among Y phenotypic expression of the gr/gr deletion. Hum Mol Genet. lineages. J Clin Endocrinol Metab. 2009 Oct;94(10):4016-22 2013 Apr 15;22(8):1679-95. doi: 10.1093/hmg/ddt004. Epub Lau YF, Li Y, Kido T. Gonadoblastoma locus and the TSPY 2013 Jan 10. gene on the human Y chromosome. Birth Defects Res C Embryo Today. 2009 Mar;87(1):114-22 This article should be referenced as such: Akimoto C, Ueda T, Inoue K, Yamaoka I, Sakari M, Obara W, Schubert S. TSPY1 (testis specific protein, Y-linked 1). Atlas Fujioka T, Nagahara A, Nonomura N, Tsutsumi S, Aburatani H, Genet Cytogenet Oncol Haematol. 2014; 18(1):32-37. Miki T, Matsumoto T, Kitagawa H, Kato S. Testis-specific protein on Y chromosome (TSPY) represses the activity of the

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 37 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

EHMT2 (euchromatic histone -lysine N - methyltransferase 2) Chandra-Prakash Chaturvedi, Marjorie Brand The Sprott Center for Stem Cell Research, Regenerative Medicine Program, Ottawa Hospital Research Institute, Ottawa, ON K1H 8L6, Canada (CPC, MB), University of Ottawa, Department of Cellular and Molecular Medicine, University of Ottawa, ON K1H 8L6, Canada (MB)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/EHMT2ID51148ch6p21.html DOI: 10.4267/2042/52075 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Review on EHMT2, with data on DNA/RNA, on the protein encoded and where the gene is implicated.

whereas the short isoform consists of 27 exons and Identity lacks the sequence corresponding to exon 10 of the Other names: BAT8, C6orf30, G9A, GAT8, KMT1C, long isoform. NG36 Transcription HGNC (Hugo): EHMT2 EHMT2/G9a gene has two differentially spliced Location: 6p21.33 transcript variants (Brown et al., 2001). G9a transcript Local order: HSPA1A - HSPA1B - NEU1 - SLC44A4 variant I NG36/EHMT2 (accession number - EHMT2 - C2 - ZBTB12. NM_006709.3) also called long isoform or isoform a, has 3982 bps open reading frame. G9a transcript DNA/RNA variant II NG36/EHMT2-SP1 (accession number NM_025256.5) also called short Isoform or isoform b, Description has open reading frame of 3880 bps (Brown et al., The human EHMT2/G9a Gene (NC_000006.11) is 2001). located on the minus strand and spans 17929 bps of Pseudogene genomic region (31847536 - 31865464). The long isoform of EHMT2/G9a comprises 28 exons, There is no known pseudogene for EHMT2/G9a.

Genomic location of EHMT2/G9a gene along with adjustment genes on chromosome 6 (minus strand).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 38 EHMT2 (euchromatic histone-lysine N-methyltransferase 2) Chaturvedi CP, Brand M

EHMT2/G9a gene and RNA structure. Schematic representation of the human EHMT2/G9a gene organization demonstrating the relative position of each of the 28 exons (5'UTR, exons and 3'UTR are not drawn to scale). The shorter EHMT2 isoform b has missing exon 10 compared to full length EHMT2.

SET domain is responsible for the methyltransferase Protein activity of G9a (Tachibana et al., 2001; Tachibana et Description al., 2002) and is also required for interaction with GLP (Tachibana et al., 2005). EHMT2/G9a isoform a (accession number NP_006700.3) is composed of 1210 amino acid Expression residues while the shorter isoform b (accession number EHMT2/G9a RNA is present in a wide range of human NP_079532.5) comprises 1176 amino acid residues tissues and cells with high levels in fetal liver, thymus, (Figure 2). The G9a protein contains several lymph node, spleen and peripheral blood leukocytes evolutionarily conserved domains including, the N- and lower level in bone marrow (Milner and Campbell, terminus transcription activation domain (TAD), E-rich 1993; Brown et al., 2001). domain containing 24 contiguous glutamic acid residues and the cysteine (Cys) rich domain that Localisation contains 12 cysteine residues, the centrally located EHMT2/G9a is localized in the nucleus. It is mostly ankyrin (ANK) domain containing seven ankyrin associated with euchromatic regions of chromatin and repeats and the C-terminus SET domain (Milner and absent from heterochromatin (Tachibana et al., 2002). Campbell, 1993; Brown et al., 2001; Dillon et al., 2005). Functionally, the TAD domain of G9a has been Function shown to be involved in transcription activation and is The histone methyltransferase G9a mono and sufficient to activate transcription of several nuclear dimethylates 'Lys-9' of histone H3 specifically in receptor genes (Lee et al., 2006; Purcell et al., 2011, euchromatin (Tachibana et al., 2001; Tachibana et al., Bittencourt et al., 2012). 2002). Furthermore, G9a can also mono and The E-rich domain has been shown to be present in dimethylates 'Lys-27' of histone H3 and mono several proteins including the nuclear protein nucleolin, methylates histone H1 (Tachibana et al., 2001; the chromosomal protein HMG1 and the centromere Chaturvedi et al., 2009; Trojer et al 2009; Weiss et al., auto-antigen CENP-B (Milner and Campbell, 1993; 2010; Wu et al., 2011). Brown et al., 2001). In addition, G9a methylates several non-histone The Cys rich domain acts as a binding site for neuron- proteins including p53, CDYL, WIZ, CSB, ACINUS, restrictive silencing factor (NRSF) and has been shown DNMT1, HDAC1, KLF12, MyoD, DNMT3a and to be involved in repression of neuronal genes in non- MTA1 (Rathert et al., 2008; Haung et al., 2010; Chang neuronal tissue (Roopra et al., 2004). et al., 2011; Ling at al., 2012; Nair et al., 2013) and The ANK domain, which is conserved in diverse automethylates (Chin et al., 2007; Rathert et al., 2008). proteins including transcription factors has been shown G9a also plays an important role in mediating DNA to be involved in protein-protein interactions (Milner methylation through its association with DNA and Campbell, 1993; Sedgwick and Smerdon, 1999), methyltransferases (Epsztejn-Litman et al., 2008; and binding to histone mono- and dimethylated H3 Tachibana et al., 2008; Dong et al., 2008). lysine 9 marks (Collins et al., 2008). The C-terminal

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 39 EHMT2 (euchromatic histone-lysine N-methyltransferase 2) Chaturvedi CP, Brand M

Schematic representation of the domain structure of EHMT2/G9a isoform a and isoform b. Isoform b is missing amino acid sequence 373-406 (34 aa) compared to the canonical isoform a (aa 1-1210). Isoform b is numbered according to isoform a, as well as separately. The positions of known domains within G9a are displayed. Transcription activation domain (TAD), E rich, glutamine-rich domain, NRSF- binding cysteine rich domain (12Cys) and ankyrin domain with seven ankyrin repeats and Set domain containing pre and post SET domains.

Transcriptionally, G9a can function both as a G9a is indispensible for early embryonic development corepressor and/or a coactivator of gene expression, (Tachibana et al., 2002; Yoichi and Tachibana, 2011). (Collins and Cheng, 2010; Yoichi and Tachibana, The G9a knockout embryonic stem cells (ESCs) show 2011; Shnakar et al., 2013; Lee et al., 2006; Chaturvedi severe defects in differentiation, suggesting that G9a et al., 2009; Purcell et al., 2011; Chaturvedi et al., positively regulates ESCs differentiation (Tachibana et 2012; Bittencourt et al., 2012). The corepressor al., 2002; Feldman et al., 2006; Kubicek et al., 2007; function of the G9a is dependent on its enzymatic Shi et al., 2008). Similarly, G9a is required for proper activity as well as on its interaction with other factors differentiation, survival and lineage commitment of that are involved in gene repression (Tachibana et al., adult or somatic stem cells i.e hematopoietic progenitor 2002; Yoichi and Tachibana, 2011; Chaturvedi et al., stem cells, retinal progenitor cells (Chen et al., 2012; 2012; Shnakar et al., 2013). G9a gets targeted to Katoh et al., 1212). Genome wide studies have revealed specific genes by associating with various the presence of G9a mediated large H3K9 transcriptional repressors and corepressors such as, dimethylation (H3K9me2) chromatin blocks (LOCKS) CDP/Cut, E2F6, Gfi1/zfp163, Blimp-1/PRDI-BF1, on large chromatin region in the genome (Wen et al., REST/NRSF, ZNF217 and PRISM/PRDM6 and 2009; Chen et al., 2012). These G9a mediated LOCKS several others (Tachibana et al., 2002; Ogawa et al., are necessary for proper differentiation as the loss of 2002; Gyory et al., 2004; Nashio and Walsh, 2004; LOCKs inhibits or delays differentiation and lineage Roopra et al., 2004; Daun et al., 2005; Davis et al., commitment of both embryonic and adult stem cells 2006; Nagano et al., 2008; Banck et al., 2009; Yoichi (Wen et al., 2009; Chen et al., 2012). In contrast to its and Tachibana, 2011; Shnakar et al., 2013). The positive regulatory role in maintaining differentiation, coactivator function of the G9a does not require its G9a has been shown to negatively regulate enzymatic activity but requires association with other differentiation by repressing differentiation specific transcriptional activators and/or coactivators factors genes in myogenesis and adipogenesis (Shankar et al., including CARM1, p300, RNA polymerases or the 2013; Ling et al., 2012a; Ling et al., 2012b; Wang and Mediator complex (Lee et al., 2006; Chaturvedi et al., Abete-Shen, 2011; Wang et al., 2013). 2009; Purcell et al., 2011; Bittencourt et al., 2012; Furthermore, G9a has been shown to regulate gene Chaturvedi et al., 2012). expression in multiple other biological processes Functionally, G9a has been shown to play important including, genomic imprinting (Nagano et al., 2008; roles in regulating the expression of genes involved in Wagschal et al., 2008), germ cells development various developmental and differentiation processes. (Tachibana et al., 2007), erythropoiesis (Chaturvedi et

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 40 EHMT2 (euchromatic histone-lysine N-methyltransferase 2) Chaturvedi CP, Brand M

al., 2009; Chaturvedi et al., 2012), T and B cell Lung cancer mediated immune response (Thomas et al., 2008; Note Lehnertz et al., 2010) and nuclear receptor mediated Lung cancer is a disease characterized by uncontrolled gene expression (Lee et al., 2006; Purcell et al., 2011; cell growth of lung tissue. G9a is highly expressed in Bittencourt et al., 2012). aggressive lung cancer cells, and its elevated level has In the brain, G9a is required for proper expression of been correlated to poor prognosis with increase in cell genes involved in lineage specific expression (Roopra migration, invasion and metastasis (Chen et al., 2010). et al., 2004, Schaefer et al., 2009), memory G9a enhances the metastasis of lung cancer cells by consolidation (Gupta et al., 2012), and cocaine induced repressing expression of the cell adhesion molecule Ep- neuronal responses and behavioural plasticity (Maze et CAM. High level of G9a in lung cancer cells promotes al., 2010). enrichment of DNA methylation and H3K9 G9a has been also shown to plays critical role in cell dimethylation marks on Ep-CAM gene promoter proliferation (Yang et al., 2012), senescence region, leading to repression of this gene (Chen et al., (Takahashi et al., 2012), DNA replication (Esteva et al., 2010). 2006; Yu et al., 2012), and in the establishment of Depletion of the G9a protein in lung cancer cells proviral gene silencing (Leung et al., 2011). reduces the levels of H3K9 dimethylation and Homology decreases recruitment of the transcriptional cofactors EHMT2/G9a homologues have been found in various HP1, DNMT1, and HDAC1 to the Ep-CAM promoter, species like chimpanzee (99.7 % homology), cow leading to de-repression of Ep-CAM gene and (98.1% homology), rat (95.97% homology), C. elegans inhibition of cell migration and invasion (Chen et al., (25 % homology) and mouse (95.5% homology). 2010). Mutations Breast cancer Note Germinal Human breast cancer is a heterogeneous disease with No mutations have been reported so far. respect to molecular alterations, incidence, survival, Somatic and response to therapy. Claudin-low breast cancer (CLBC) is characterized by the expression of markers No mutations have been reported so far. of epithelial-mesenchymal transition (EMT), which has been linked with CLBC metastasis (Dong et al., 2012). Implicated in G9a promotes EMT expression by repressing E- Various cancers cadherin expression in CLBC models. G9a associates with Snail and recruits HP1 and DNA Note methyltransferases to the E-cadherin gene promoter for EHMT2/G9a is overexpressed in various types of repression (Dong et al., 2012). tumors, which include solid and haematological tumors Knockdown of G9a in CLBC models restores E- (Cho et al., 2011). High-level expression of G9a in cadherin expression by suppressing H3K9me2 and cancerous cells has been correlated with aggressiveness DNA methylation, which results in inhibition of cell and poor prognosis in patients of lung, hepatocellular, migration, invasion, suppression of tumor growth and ovarian, colon cancer and B cell chronic lymphocytic metastasis (Dong et al., 2012). leukemia (Haung et al., 2010). Functionally, G9a has been linked to multiple cellular Prostate cancer functions associated with tumor progression including Note proliferation, adhesion, migration, invasion, and cancer Prostate cancer is one of the most frequent cancers in stem cell maintenance. men. G9a is coexpressed at high levels with Runx2, in Knockdown of G9a protein in cancer cells induces metastatic prostate cancer cells and directly regulates apoptosis suggesting that G9a plays a crucial role in the expression of several Runx2 target genes, which are cell cycle regulation of cancerous cells (Watanabe et important regulators of tumor growth, invasion and/or al., 2008). metastasis (Purcell at al., 2012). Use of G9a-specific inhibitors, had been shown to Downregulation of G9a in prostate cancer cells significantly suppress the growth of cancerous cells, represses several RUNX2 target genes including, indicating that G9a enzymatic activity plays an MMP9, CSF2, SDF1, CST7 and enhances the important role in cancer development and growth (Cho expression of others, such as MMP13 and PIP (Purcell et al., 2011). et al., 2012). A study by Kondo et al., (2008) The following paragraphs summarize the discoveries demonstrates that downregulation of G9a in prostate on the functional role of G9a in various types of cancer cancer cells, disrupts centrosome and chromosome development. stability, leading to inhibition of cancer cell growth.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 41 EHMT2 (euchromatic histone-lysine N-methyltransferase 2) Chaturvedi CP, Brand M

Another study by Yuan et al., (2012) demonstrates that Haematological malignancies treatment of pancreatic cancer cells with G9a inhibitor Note BRD4770 induces senescence and inhibits G9a is over expressed in haematological malignancies proliferation. Collectively, these studies reveal a including AML and CML (Haung et al., 2010; Cho et potential oncogenic role of G9a in prostate cancer al., 2011). progression. The oncoprotein EVI-1 (ecotropic viral integration site- Gastric cancer 1) is aberrantly expressed in myeloid leukemias and has Note been linked to a poor patient survival rate. A study by G9a is involved in gastric cancer progression by Goyama et al., (2010) demonstrates that G9a interacts inhibiting expression of the tumor suppressor gene EVI-1 and contributes to EVI-1-mediated RUNX3. In RUNX3 expressing gastric cell lines, leukemogenesis. hypoxia leads to upregulation of G9a, leading to the Depletion of G9a protein in EVI-1-expressing accumulation of H3K9me2 marks on RUNX3 promoter progenitors significantly reduces their colony-forming and repression of RUNX3 expression (Lee et al., 2009). activity, indicating a possible role of G9a in generating Knocking down G9a in hypoxia-induced gastric cancer leukemia-initiating cells by Evi-1 (Goyama et al., cells restores the expression of RUNX3 with 2010). suppression of gastric cancer progression (Lee et al., JAK2 (Janus kinase 2) mediated phosphorylation plays 2009). a critical role during normal hematopoiesis and leukemogenesis. Bladder carcinomas JAK2 induces leukemogenesis by activating the lmo2 Note leukemogenic gene through phosphorylation of histone G9a expression is upregulated in human bladder H3Y41 and exclusion of HP1 α from chromatin carcinomas compared to non-neoplastic bladder tissues (Dawson et al., 2009). (Cho et al., 2011). A recent study by Son et al., (2012) demonstrated that Enhanced expression of G9a promotes the proliferation G9a negatively regulates the expression of JAK2 and of bladder carcinomas cells by negatively regulating favors ATRA-mediated leukemia cell differentiation. the tumor suppressor gene SIAH1 (Cho et al., 2011). G9a mediated repression of JAK2, results in the G9a suppresses transcription of the SIAH1 gene by downregulation of H3Y41 phosphorylation on the binding to its promoter followed by methylation of leukemogenic oncogene lmo2 promoter, indicating a lysine 9 of histone H3. role for G9a in JAK2-H3Y41P-HP1 α transcriptional Downregulation of G9a activity by knock down or signaling during leukemogenesis (Son et al., 2012). through the use of a G9a specific inhibitor, BIX-01294, significantly suppresses the growth of cancer cells by Breakpoints de-repressing the SIAH1 gene (Cho et al., 2011). Neuroendocrine tumors Note No variables are reported for EHMT2/G9a gene so far. Note Neuroendocrine tumors (NETs) are neoplasms that To be noted arise from cells of the endocrine and nervous systems. A study by Kim et al., (2013) has revealed altered Note expression of Wnt/ β-catenin signaling components in In summary, dysregulation of EHMT2/G9a is emerging neuroendocrine tumors. as an important player in the pathobiology of various G9a contributes to the pathogenesis and growth of forms of cancer suggesting that G9a could serve as a NETs by upregulating the expression of β-catenin. promising therapeutic target for future treatments High level expression of G9a in neuroendocrine tumors notably through the use of specific chemical inhibitors. downregulates the expression of specific β-catenin For example, BIX-01294; a specific inhibitor of G9a inhibitory genes inclusing DKK-1, DKK-2, and WIF-1, methyltransferase activity has been shown to leading to overexpression of β-catenin, which in turn effectively suppress the growth of cancer cells (Cho et leads to increased cell proliferation and tumor growth al., 2011). (Kim et al., 2013). Another G9a inhibitor, BRD4770 induces senescence Use of the G9a inhibitor UNC0638 derepresses β- and inhibits proliferation of cancer cells (Yuan et al., catenin inhibitory genes and suppresses Wnt/ β-catenin 2012). Finally, a third G9a inhibitor UNC0638 showed induced cell proliferation, colony formation and tumor similar results as BIX-01294 and BRD4770 and growth, demonstrating the oncogenic potential of G9a inhibits cell proliferation, colony formation and tumor in NETs progression (Kim et al., 2013). growth (Kim et al., 2013).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 42 EHMT2 (euchromatic histone-lysine N-methyltransferase 2) Chaturvedi CP, Brand M

It will be interesting to test the effectiveness of these heterochromatin protein 1 recruitment. Mol Cell Biol. 2005 inhibitors in vivo. Further studies are required for better Apr;25(7):2525-38 understanding of the molecular mechanism of G9a Davis CA, Haberland M, Arnold MA, Sutherland LB, McDonald mediated positive and negative gene regulatory role in OG, Richardson JA, Childs G, Harris S, Owens GK, Olson EN. PRISM/PRDM6, a transcriptional repressor that promotes the cancer development and for developing efficient proliferative gene program in smooth muscle cells. Mol Cell therapy. Biol. 2006 Apr;26(7):2626-36 Estève PO, Chin HG, Smallwood A, Feehery GR, Gangisetty References O, Karpf AR, Carey MF, Pradhan S. Direct interaction between DNMT1 and G9a coordinates DNA and histone methylation Spies T, Bresnahan M, Strominger JL. Human major during replication. Genes Dev. 2006 Nov 15;20(22):3089-103 histocompatibility complex contains a minimum of 19 genes between the complement cluster and HLA-B. Proc Natl Acad Feldman N, Gerson A, Fang J, Li E, Zhang Y, Shinkai Y, Cedar Sci U S A. 1989 Nov;86(22):8955-8 H, Bergman Y. G9a-mediated irreversible epigenetic inactivation of Oct-3/4 during early embryogenesis. Nat Cell Milner CM, Campbell RD. The G9a gene in the human major Biol. 2006 Feb;8(2):188-94 histocompatibility complex encodes a novel protein containing ankyrin-like repeats. Biochem J. 1993 Mar 15;290 ( Pt 3):811-8 Lee DY, Northrop JP, Kuo MH, Stallcup MR. Histone H3 lysine 9 methyltransferase G9a is a transcriptional coactivator for Sedgwick SG, Smerdon SJ. The ankyrin repeat: a diversity of nuclear receptors. J Biol Chem. 2006 Mar 31;281(13):8476-85 interactions on a common structural framework. Trends Biochem Sci. 1999 Aug;24(8):311-6 Ueda J, Tachibana M, Ikura T, Shinkai Y. Zinc finger protein Wiz links G9a/GLP histone methyltransferases to the co- Brown SE, Campbell RD, Sanderson CM. Novel NG36/G9a repressor molecule CtBP. J Biol Chem. 2006 Jul gene products encoded within the human and mouse MHC 21;281(29):20120-8 class III regions. Mamm Genome. 2001 Dec;12(12):916-24 Chin HG, Estève PO, Pradhan M, Benner J, Patnaik D, Carey Tachibana M, Sugimoto K, Fukushima T, Shinkai Y. Set MF, Pradhan S. Automethylation of G9a and its implication in domain-containing protein, G9a, is a novel lysine-preferring wider substrate specificity and HP1 binding. Nucleic Acids Res. mammalian histone methyltransferase with hyperactivity and 2007;35(21):7313-23 specific selectivity to lysines 9 and 27 of histone H3. J Biol Chem. 2001 Jul 6;276(27):25309-17 Kubicek S, O'Sullivan RJ, August EM, Hickey ER, Zhang Q, Teodoro ML, Rea S, Mechtler K, Kowalski JA, Homon CA, Ogawa H, Ishiguro K, Gaubatz S, Livingston DM, Nakatani Y. Kelly TA, Jenuwein T. Reversal of H3K9me2 by a small- A complex with chromatin modifiers that occupies E2F- and molecule inhibitor for the G9a histone methyltransferase. Mol Myc-responsive genes in G0 cells. Science. 2002 May Cell. 2007 Feb 9;25(3):473-81 10;296(5570):1132-6 Tachibana M, Nozaki M, Takeda N, Shinkai Y. Functional Tachibana M, Sugimoto K, Nozaki M, Ueda J, Ohta T, Ohki M, dynamics of H3K9 methylation during meiotic prophase Fukuda M, Takeda N, Niida H, Kato H, Shinkai Y. G9a histone progression. EMBO J. 2007 Jul 25;26(14):3346-59 methyltransferase plays a dominant role in euchromatic histone H3 lysine 9 methylation and is essential for early Collins RE, Northrop JP, Horton JR, Lee DY, Zhang X, Stallcup embryogenesis. Genes Dev. 2002 Jul 15;16(14):1779-91 MR, Cheng X. The ankyrin repeats of G9a and GLP histone methyltransferases are mono- and dimethyllysine binding Gyory I, Wu J, Fejér G, Seto E, Wright KL. PRDI-BF1 recruits modules. Nat Struct Mol Biol. 2008 Mar;15(3):245-50 the histone H3 methyltransferase G9a in transcriptional silencing. Nat Immunol. 2004 Mar;5(3):299-308 Epsztejn-Litman S, Feldman N, Abu-Remaileh M, Shufaro Y, Gerson A, Ueda J, Deplus R, Fuks F, Shinkai Y, Cedar H, Nishio H, Walsh MJ. CCAAT displacement protein/cut homolog Bergman Y. De novo DNA methylation promoted by G9a recruits G9a histone lysine methyltransferase to repress prevents reprogramming of embryonically silenced genes. Nat transcription. Proc Natl Acad Sci U S A. 2004 Aug Struct Mol Biol. 2008 Nov;15(11):1176-83 3;101(31):11257-62 Dong KB, Maksakova IA, Mohn F, Leung D, Appanah R, Lee Roopra A, Qazi R, Schoenike B, Daley TJ, Morrison JF. S, Yang HW, Lam LL, Mager DL, Schübeler D, Tachibana M, Localized domains of G9a-mediated histone methylation are Shinkai Y, Lorincz MC. DNA methylation in ES cells requires required for silencing of neuronal genes. Mol Cell. 2004 Jun the lysine methyltransferase G9a but not its catalytic activity. 18;14(6):727-38 EMBO J. 2008 Oct 22;27(20):2691-701 Dillon SC, Zhang X, Trievel RC, Cheng X. The SET-domain Kondo Y, Shen L, Ahmed S, Boumber Y, Sekido Y, Haddad protein superfamily: protein lysine methyltransferases. BR, Issa JP. Downregulation of histone H3 lysine 9 Genome Biol. 2005;6(8):227 methyltransferase G9a induces centrosome disruption and Duan Z, Zarebski A, Montoya-Durango D, Grimes HL, Horwitz chromosome instability in cancer cells. PLoS One. 2008 Apr M. Gfi1 coordinates epigenetic repression of p21Cip/WAF1 by 30;3(4):e2037 recruitment of histone lysine methyltransferase G9a and Nagano T, Mitchell JA, Sanz LA, Pauler FM, Ferguson-Smith histone deacetylase 1. Mol Cell Biol. 2005 Dec;25(23):10338- AC, Feil R, Fraser P. The Air noncoding RNA epigenetically 51 silences transcription by targeting G9a to chromatin. Science. Tachibana M, Ueda J, Fukuda M, Takeda N, Ohta T, Iwanari 2008 Dec 12;322(5908):1717-20 H, Sakihama T, Kodama T, Hamakubo T, Shinkai Y. Histone Rathert P, Dhayalan A, Murakami M, Zhang X, Tamas R, methyltransferases G9a and GLP form heteromeric complexes and are both crucial for methylation of euchromatin at H3-K9. Jurkowska R, Komatsu Y, Shinkai Y, Cheng X, Jeltsch A. Genes Dev. 2005 Apr 1;19(7):815-26 Protein lysine methyltransferase G9a acts on non-histone targets. Nat Chem Biol. 2008 Jun;4(6):344-6 Stewart MD, Li J, Wong J. Relationship between histone H3 lysine 9 methylation, transcription repression, and Shi Y, Desponts C, Do JT, Hahm HS, Schöler HR, Ding S. Induction of pluripotent stem cells from mouse embryonic

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 43 EHMT2 (euchromatic histone-lysine N-methyltransferase 2) Chaturvedi CP, Brand M

fibroblasts by Oct4 and Klf4 with small-molecule compounds. Huang J, Dorsey J, Chuikov S, Pérez-Burgos L, Zhang X, Cell Stem Cell. 2008 Nov 6;3(5):568-74 Jenuwein T, Reinberg D, Berger SL. G9a and Glp methylate lysine 373 in the tumor suppressor p53. J Biol Chem. 2010 Mar Tachibana M, Matsumura Y, Fukuda M, Kimura H, Shinkai Y. 26;285(13):9636-41 G9a/GLP complexes independently mediate H3K9 and DNA methylation to silence transcription. EMBO J. 2008 Oct Lehnertz B, Northrop JP, Antignano F, Burrows K, Hadidi S, 22;27(20):2681-90 Mullaly SC, Rossi FM, Zaph C. Activating and inhibitory functions for the histone lysine methyltransferase G9a in T Thomas LR, Miyashita H, Cobb RM, Pierce S, Tachibana M, helper cell differentiation and function. J Exp Med. 2010 May Hobeika E, Reth M, Shinkai Y, Oltz EM. Functional analysis of 10;207(5):915-22 histone methyltransferase g9a in B and T lymphocytes. J Immunol. 2008 Jul 1;181(1):485-93 Maze I, Covington HE 3rd, Dietz DM, LaPlant Q, Renthal W, Russo SJ, Mechanic M, Mouzon E, Neve RL, Haggarty SJ, Wagschal A, Sutherland HG, Woodfine K, Henckel A, Chebli K, Ren Y, Sampath SC, Hurd YL, Greengard P, Tarakhovsky A, Schulz R, Oakey RJ, Bickmore WA, Feil R. G9a histone Schaefer A, Nestler EJ. Essential role of the histone methyltransferase contributes to imprinting in the mouse methyltransferase G9a in cocaine-induced plasticity. Science. placenta. Mol Cell Biol. 2008 Feb;28(3):1104-13 2010 Jan 8;327(5962):213-6 Watanabe H, Soejima K, Yasuda H, Kawada I, Nakachi I, Yoda Weiss T, Hergeth S, Zeissler U, Izzo A, Tropberger P, Zee BM, S, Naoki K, Ishizaka A. Deregulation of histone lysine Dundr M, Garcia BA, Daujat S, Schneider R. Histone H1 methyltransferases contributes to oncogenic transformation of variant-specific lysine methylation by G9a/KMT1C and human bronchoepithelial cells. Cancer Cell Int. 2008 Nov Glp1/KMT1D. Epigenetics Chromatin. 2010 Mar 24;3(1):7 3;8:15 Chang Y, Sun L, Kokura K, Horton JR, Fukuda M, Espejo A, Banck MS, Li S, Nishio H, Wang C, Beutler AS, Walsh MJ. The Izumi V, Koomen JM, Bedford MT, Zhang X, Shinkai Y, Fang ZNF217 oncogene is a candidate organizer of repressive J, Cheng X. MPP8 mediates the interactions between DNA histone modifiers. Epigenetics. 2009 Feb 16;4(2):100-6 methyltransferase Dnmt3a and H3K9 methyltransferase Chaturvedi CP, Hosey AM, Palii C, Perez-Iratxeta C, Nakatani GLP/G9a. Nat Commun. 2011 Nov 15;2:533 Y, Ranish JA, Dilworth FJ, Brand M. Dual role for the Cho HS, Kelly JD, Hayami S, Toyokawa G, Takawa M, methyltransferase G9a in the maintenance of beta-globin gene Yoshimatsu M, Tsunoda T, Field HI, Neal DE, Ponder BA, transcription in adult erythroid cells. Proc Natl Acad Sci U S A. Nakamura Y, Hamamoto R. Enhanced expression of EHMT2 is 2009 Oct 27;106(43):18303-8 involved in the proliferation of cancer cells through negative Dawson MA, Bannister AJ, Göttgens B, Foster SD, Bartke T, regulation of SIAH1. Neoplasia. 2011 Aug;13(8):676-84 Green AR, Kouzarides T. JAK2 phosphorylates histone H3Y41 Leung DC, Dong KB, Maksakova IA, Goyal P, Appanah R, Lee and excludes HP1alpha from chromatin. Nature. 2009 Oct S, Tachibana M, Shinkai Y, Lehnertz B, Mager DL, Rossi F, 8;461(7265):819-22 Lorincz MC. Lysine methyltransferase G9a is required for de Lee SH, Kim J, Kim WH, Lee YM. Hypoxic silencing of tumor novo DNA methylation and the establishment, but not the suppressor RUNX3 by histone modification in gastric cancer maintenance, of proviral silencing. Proc Natl Acad Sci U S A. cells. Oncogene. 2009 Jan 15;28(2):184-94 2011 Apr 5;108(14):5718-23 Schaefer A, Sampath SC, Intrator A, Min A, Gertler TS, Purcell DJ, Jeong KW, Bittencourt D, Gerke DS, Stallcup MR. Surmeier DJ, Tarakhovsky A, Greengard P. Control of A distinct mechanism for coactivator versus corepressor cognition and adaptive behavior by the GLP/G9a epigenetic function by histone methyltransferase G9a in transcriptional suppressor complex. Neuron. 2009 Dec 10;64(5):678-91 regulation. J Biol Chem. 2011 Dec 9;286(49):41963-71 Trojer P, Zhang J, Yonezawa M, Schmidt A, Zheng H, Shinkai Y, Tachibana M. H3K9 methyltransferase G9a and the Jenuwein T, Reinberg D. Dynamic Histone H1 Isotype 4 related molecule GLP. Genes Dev. 2011 Apr 15;25(8):781-8 Methylation and Demethylation by Histone Lysine Wu H, Chen X, Xiong J, Li Y, Li H, Ding X, Liu S, Chen S, Gao Methyltransferase G9a/KMT1C and the Jumonji Domain- S, Zhu B. Histone methyltransferase G9a contributes to H3K27 containing JMJD2/KDM4 Proteins. J Biol Chem. 2009 Mar methylation in vivo. Cell Res. 2011 Feb;21(2):365-7 27;284(13):8395-405 Bittencourt D, Wu DY, Jeong KW, Gerke DS, Herviou L, Wen B, Wu H, Shinkai Y, Irizarry RA, Feinberg AP. Large Ianculescu I, Chodankar R, Siegmund KD, Stallcup MR. G9a histone H3 lysine 9 dimethylated chromatin blocks distinguish functions as a molecular scaffold for assembly of differentiated from embryonic stem cells. Nat Genet. 2009 transcriptional coactivators on a subset of glucocorticoid Feb;41(2):246-50 receptor target genes. Proc Natl Acad Sci U S A. 2012 Nov Chen MW, Hua KT, Kao HJ, Chi CC, Wei LH, Johansson G, 27;109(48):19673-8 Shiah SG, Chen PS, Jeng YM, Cheng TY, Lai TC, Chang JS, Chaturvedi CP, Somasundaram B, Singh K, Carpenedo RL, Jan YH, Chien MH, Yang CJ, Huang MS, Hsiao M, Kuo ML. Stanford WL, Dilworth FJ, Brand M. Maintenance of gene H3K9 histone methyltransferase G9a promotes lung cancer silencing by the coordinate action of the H3K9 invasion and metastasis by silencing the cell adhesion methyltransferase G9a/KMT1C and the H3K4 demethylase molecule Ep-CAM. Cancer Res. 2010 Oct 15;70(20):7830-40 Jarid1a/KDM5A. Proc Natl Acad Sci U S A. 2012 Nov Collins R, Cheng X. A case study in cross-talk: the histone 13;109(46):18845-50 lysine methyltransferases G9a and GLP. Nucleic Acids Res. Chen X, Skutt-Kakaria K, Davison J, Ou YL, Choi E, Malik P, 2010 Jun;38(11):3503-11 Loeb K, Wood B, Georges G, Torok-Storb B, Paddison PJ. Goyama S, Nitta E, Yoshino T, Kako S, Watanabe-Okochi N, G9a/GLP-dependent histone H3K9me2 patterning during Shimabe M, Imai Y, Takahashi K, Kurokawa M. EVI-1 interacts human hematopoietic stem cell lineage commitment. Genes with histone methyltransferases SUV39H1 and G9a for Dev. 2012 Nov 15;26(22):2499-511 transcriptional repression and bone marrow immortalization. Dong C, Wu Y, Yao J, Wang Y, Yu Y, Rychahou PG, Evers Leukemia. 2010 Jan;24(1):81-8 BM, Zhou BP. G9a interacts with Snail and is critical for Snail- mediated E-cadherin repression in human breast cancer. J Clin Invest. 2012 Apr 2;122(4):1469-86

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 44 EHMT2 (euchromatic histone-lysine N-methyltransferase 2) Chaturvedi CP, Brand M

Gupta-Agarwal S, Franklin AV, Deramus T, Wheelock M, Davis kinase A determines timing of early differentiation through RL, McMahon LL, Lubin FD. G9a/GLP histone lysine epigenetic regulation with G9a. Cell Stem Cell. 2012 Jun dimethyltransferase complex activity in the hippocampus and 14;10(6):759-70 the entorhinal cortex is required for gene activation and silencing during memory consolidation. J Neurosci. 2012 Apr Yang Q, Lu Z, Singh D, Raj JU. BIX-01294 treatment blocks 18;32(16):5440-53 cell proliferation, migration and contractility in ovine foetal pulmonary arterial smooth muscle cells. Cell Prolif. 2012 Katoh K, Yamazaki R, Onishi A, Sanuki R, Furukawa T. G9a Aug;45(4):335-44 histone methyltransferase activity in retinal progenitors is essential for proper differentiation and survival of mouse retinal Yu Y, Song C, Zhang Q, DiMaggio PA, Garcia BA, York A, cells. J Neurosci. 2012 Dec 5;32(49):17658-70 Carey MF, Grunstein M. Histone H3 lysine 56 methylation regulates DNA replication through its interaction with PCNA. Ling BM, Bharathy N, Chung TK, Kok WK, Li S, Tan YH, Rao Mol Cell. 2012 Apr 13;46(1):7-17 VK, Gopinadhan S, Sartorelli V, Walsh MJ, Taneja R. Lysine methyltransferase G9a methylates the transcription factor Yuan Y, Wang Q, Paulk J, Kubicek S, Kemp MM, Adams DJ, MyoD and regulates skeletal muscle differentiation. Proc Natl Shamji AF, Wagner BK, Schreiber SL. A small-molecule probe Acad Sci U S A. 2012 Jan 17;109(3):841-6 of the histone methyltransferase G9a induces cellular senescence in pancreatic adenocarcinoma. ACS Chem Biol. Ling BM, Gopinadhan S, Kok WK, Shankar SR, Gopal P, 2012 Jul 20;7(7):1152-7 Bharathy N, Wang Y, Taneja R. G9a mediates Sharp-1- dependent inhibition of skeletal muscle differentiation. Mol Biol Kim JT, Li J, Jang ER, Gulhati P, Rychahou PG, Napier DL, Cell. 2012 Dec;23(24):4778-85 Wang C, Weiss HL, Lee EY, Anthony L, Townsend CM Jr, Liu C, Evers BM. Deregulation of Wnt/ β-catenin signaling through Purcell DJ, Khalid O, Ou CY, Little GH, Frenkel B, Baniwal SK, genetic or epigenetic alterations in human neuroendocrine Stallcup MR. Recruitment of coregulator G9a by Runx2 for tumors. Carcinogenesis. 2013 May;34(5):953-61 selective enhancement or suppression of transcription. J Cell Biochem. 2012 Jul;113(7):2406-14 Nair SS, Li DQ, Kumar R. A core chromatin remodeling factor instructs global chromatin signaling through multivalent reading Son HJ, Kim JY, Hahn Y, Seo SB. Negative regulation of JAK2 of nucleosome codes. Mol Cell. 2013 Feb 21;49(4):704-18 by H3K9 methyltransferase G9a in leukemia. Mol Cell Biol. 2012 Sep;32(18):3681-94 Shankar SR, Bahirvani AG, Rao VK, Bharathy N, Ow JR, Taneja R. G9a, a multipotent regulator of gene expression. Takahashi A, Imai Y, Yamakoshi K, Kuninaka S, Ohtani N, Epigenetics. 2013 Jan;8(1):16-22 Yoshimoto S, Hori S, Tachibana M, Anderton E, Takeuchi T, Shinkai Y, Peters G, Saya H, Hara E. DNA damage signaling Wang L, Xu S, Lee JE, Baldridge A, Grullon S, Peng W, Ge K. triggers degradation of histone methyltransferases through Histone H3K9 methyltransferase G9a represses PPAR γ APC/C(Cdh1) in senescent cells. Mol Cell. 2012 Jan expression and adipogenesis. EMBO J. 2013 Jan 9;32(1):45-59 13;45(1):123-31 This article should be referenced as such: Wang J, Abate-Shen C. The MSX1 homeoprotein recruits G9a methyltransferase to repressed target genes in myoblast cells. Chaturvedi CP, Brand M. EHMT2 (euchromatic histone-lysine PLoS One. 2012;7(5):e37647 N-methyltransferase 2). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1):38-45. Yamamizu K, Fujihara M, Tachibana M, Katayama S, Takahashi A, Hara E, Imai H, Shinkai Y, Yamashita JK. Protein

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 45 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

USP32 (ubiquitin specific peptidase 32) Aysegul Sapmaz, Ayse Elif Erson-Bensan Netherlands Cancer Institute-Antoni van Leeuwenhoek hospital (NKI-AVL), Amsterdam, Netherlands (AS), Department of Biological Sciences, Middle East Technical University, Ankara, Turkey (AS, AEEB)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/USP32ID52046ch17q23.html DOI: 10.4267/2042/52076 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Short communication on USP32, with data on DNA/RNA, on the protein encoded and where the gene is implicated .

- CA4 (17q23): carbonic anhydrase IV Identity - FAM106DP (Chr. 17): family with sequence Other names: NY-REN-60, USP10 similarity 106 memberD pseudogene HGNC (Hugo): USP32 - SCARNA20 (17q23.2): small cajal body specific RNA 20 Location: 17q23.1 - RPL32P32 (17q23.2): ribosomal protein L32 Local order: Based on Mapviewer (Master Map: Gene pseudogene 32 on sequence, gene flanking USP32 oriented from - LOC100418753 (Chr.17): septin 7 pseudogene centromere on 17q23.3 are: - USP32 (17q23.3): ubiquitin specific protease 32 - TBC1D3P1-DHX40P1 (17q23): TBC1D3P1- - LOC100506882 (Chr.17): uncharacterized DHX40P1 read through transcribed pseudogene LOC100506882 - MIR4737: MicroRNA 4737 - C17orf64 (17q23.2): chromosome 17 open reading - HEATR6 (17q23.1): Heat repeat containing 6 frame 64 - LOC100422693 (Chr.17): UDP-N-acetyl-alpha-D- - RPL12P38 (17q23.2): ribosomal protein L12 galactosamine :polypeptide N- pseudogene 38 acetylgalactosamyltransferase 1 (GalNAc-T1) - HMGN2P42 (Chr.17) high mobility group pseudogene nucleosomal binding domain 2 pseudogen 42 - LOC6456338 (17q23.1): WDNM1-like pseudogene - APPBP2 (17q23.2): amyloid beta precursor protein - LOC653653(17q23.1): adaptor-related protein (cytoplasmic tail binding protein 2. complex 1 sigma 2 subunit pseudogene

Figure 1. Genes flanking USP32 gene on 17q23.3. → stands for positive strand , ← stands for negative strand.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 46 USP32 (ubiquitin specific peptidase 32) Sapmaz A, Erson-Bensan AE

Figure 2. 34 exons of USP32.

molecular weight is approximately 182 kDa. The N- DNA/RNA terminal region contains calcium binding domain with Description EF-hand and DUSP domains. The EF-hand calcium binding domains, consisting of a USP32 gene is located on a prominent gene helix (E), a loop and a second helix (F) motif, are amplification region, 17q23, in breast cancers (Bärlund generally found in calcium binding proteins. et al., 1997; Erson et al., 2001) and has 34 exons DUSP domain is common among ubiquitin specific (figure 2). proteases. The function of this domain in USP32 Transcription remains unclear but is predicted be functional in USP32 mRNA is 7026 bp long. Coding sequence of protein-protein interactions. In addition, USP32 harbors USP32 starts at the 287 th bp and ends at the 5101 st bp of Cys, His and Asp triad which is common in USP the mRNA. Total length of USP32 coding sequence is subfamily of DUBs (figure 3). Recently, active 4815 bp. deubiquitination function of USP32 has been established (Akhavantabasi et al., 2010). Pseudogene Expression No pseudogene has been reported for USP32. Overexpressed transcript was detected in malignant Protein breast ephitelium (Grigoriadis et al., 2006). Another study showed overexpression of USP32 in 50% (9 of Note 18) of breast cancer cell lines and 22% (9 of 41) of Three independent studies reported USP32 to be primary breast tumors compared to mammary epithelial phosphorylated at the 1173 rd tyrosine and 1372 nd serine cells (Akhavantabasi et al., 2010). residues (Dephoure et al., 2008; Rigbolt et al., 2011; Localisation Mayya et al., 2009). Golgi (Akhavantabasi et al., 2010). Description Function USP32 (ubiquitin specific protease 32 - accession number: NT_010783 and mRNA accession number: USP32 is an active deubiquitinating enzyme NM_032582) encodes for a protein consisting of 1604 (Akhavantabasi et al., 2010). amino acids and the resulting protein's predicted

Figure 3. Domains of USP32.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 47 USP32 (ubiquitin specific peptidase 32) Sapmaz A, Erson-Bensan AE

Figure 4. Sequence homology between USP32 and USP6.

Homology (Zhang et al., 2009). Scafoglio et al. (2006) suggest USP32 to be an estrogen responsive gene. C-terminal of USP32 shows 97% nucleotide homology with USP6 (ubiquitin specific protease 6 (Tre-2 Hybrid/Mutated gene oncogene)) (Paulding et al., 2003) (figure 4). RT-PCR and transcriptome sequencing analysis determined USP32 to be one of the twelve expressed Mutations fusion genes in breast cancer cell line ZR-75-30. USP32 is found to be expressed with CCDC49 as a Note fusion transcript (Schulte et al., 2012). In the Parkinson disease, CNVs in USP32 gene were suggested. However, these variations in USP32 were References not confirmed with Multiplex ligation-dependent probe amplification (MLPA) and real time PCR (Pankratz et Bärlund M, Tirkkonen M, Forozan F, Tanner MM, Kallioniemi O, Kallioniemi A. Increased copy number at 17q22-q24 by al., 2011). CGH in breast cancer is due to high-level amplification of two separate regions. Genes Chromosomes Cancer. 1997 Implicated in Dec;20(4):372-6 Erson AE, Niell BL, DeMers SK, Rouillard JM, Hanash SM, Breast cancer Petty EM. Overexpressed genes/ESTs and characterization of Note distinct amplicons on 17q23 in breast cancer cells. Neoplasia. 2001 Nov-Dec;3(6):521-6 USP32 is located on 17q23 chromosomal region which is amplified in breast cancer (Sinclair et al., 2003; Paulding CA, Ruvolo M, Haber DA. The Tre2 (USP6) oncogene is a hominoid-specific gene. Proc Natl Acad Sci U S Haverty et al., 2008). Real-time PCR analysis in breast A. 2003 Mar 4;100(5):2507-11 cancer cell lines determined that USP32 transcript is amplified more than two-fold in 50% of breast cancer Sinclair CS, Rowley M, Naderi A, Couch FJ. The 17q23 amplicon and breast cancer. Breast Cancer Res Treat. 2003 cell lines and in 22% of (9 of 41) primary breast tumors Apr;78(3):313-22 compared to normal breast tissue samples. Moreover, Grigoriadis A, Mackay A, Reis-Filho JS, Steele D, Iseli C, silencing of USP32 leads to a decrease in the Stevenson BJ, Jongeneel CV, Valgeirsson H, Fenwick K, proliferation and migration properties of HeLa and Iravani M, Leao M, Simpson AJ, Strausberg RL, Jat PS, MCF7 cells (Akhavantabasi et al., 2010). Ashworth A, Neville AM, O'Hare MJ. Establishment of the In estrogen receptor (ER) positive tumors, USP32 may epithelial-specific transcriptome of normal and malignant human breast cells based on MPSS and array expression have a higher copy number than ER negative tumors data. Breast Cancer Res. 2006;8(5):R56

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 48 USP32 (ubiquitin specific peptidase 32) Sapmaz A, Erson-Bensan AE

Scafoglio C, Ambrosino C, Cicatiello L, Altucci L, Ardovino M, Akhavantabasi S, Akman HB, Sapmaz A, Keller J, Petty EM, Bontempo P, Medici N, Molinari AM, Nebbioso A, Facchiano A, Erson AE. USP32 is an active, membrane-bound ubiquitin Calogero RA, Elkon R, Menini N, Ponzone R, Biglia N, protease overexpressed in breast cancers. Mamm Genome. Sismondi P, De Bortoli M, Weisz A. Comparative gene 2010 Aug;21(7-8):388-97 expression profiling reveals partially overlapping but distinct genomic actions of different antiestrogens in human breast Pankratz N, Dumitriu A, Hetrick KN, Sun M, Latourelle JC, Wilk cancer cells. J Cell Biochem. 2006 Aug 1;98(5):1163-84 JB, Halter C, Doheny KF, Gusella JF, Nichols WC, Myers RH, Foroud T, DeStefano AL. Copy number variation in familial Dephoure N, Zhou C, Villén J, Beausoleil SA, Bakalarski CE, Parkinson disease. PLoS One. 2011;6(8):e20988 Elledge SJ, Gygi SP. A quantitative atlas of mitotic phosphorylation. Proc Natl Acad Sci U S A. 2008 Aug Rigbolt KT, Prokhorova TA, Akimov V, Henningsen J, 5;105(31):10762-7 Johansen PT, Kratchmarova I, Kassem M, Mann M, Olsen JV, Blagoev B. System-wide temporal characterization of the Haverty PM, Fridlyand J, Li L, Getz G, Beroukhim R, Lohr S, proteome and phosphoproteome of human embryonic stem Wu TD, Cavet G, Zhang Z, Chant J. High-resolution genomic cell differentiation. Sci Signal. 2011 Mar 15;4(164):rs3 and expression analyses of copy number alterations in breast tumors. Genes Chromosomes Cancer. 2008 Jun;47(6):530-42 Schulte I, Batty EM, Pole JC, Blood KA, Mo S, Cooke SL, Ng C, Howe KL, Chin SF, Brenton JD, Caldas C, Howarth KD, Mayya V, Lundgren DH, Hwang SI, Rezaul K, Wu L, Eng JK, Edwards PA. Structural analysis of the genome of breast Rodionov V, Han DK. Quantitative phosphoproteomic analysis cancer cell line ZR-75-30 identifies twelve expressed fusion of T cell receptor signaling reveals system-wide modulation of genes. BMC Genomics. 2012 Dec 22;13:719 protein-protein interactions. Sci Signal. 2009 Aug 18;2(84):ra46 This article should be referenced as such: Zhang Y, Martens JW, Yu JX, Jiang J, Sieuwerts AM, Smid M, Klijn JG, Wang Y, Foekens JA. Copy number alterations that Sapmaz A, Erson-Bensan AE. USP32 (ubiquitin specific predict metastatic capability of human breast cancer. Cancer peptidase 32). Atlas Genet Cytogenet Oncol Haematol. 2014; Res. 2009 May 1;69(9):3795-801 18(1):46-49.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 49 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication

Chronic Myelomonocytic Leukemia (CMML) Eric Solary Inserm UMR 1009, Institut Gustave Roussy, 114 rue Edouard Vaillant, 94805 Villejuif cedex, France (ES)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/CMMLID1098.html DOI: 10.4267/2042/52077 This article is an update of : Hess JL. Chronic Myelomonocytic Leukemia (CMML). Atlas Genet Cytogenet Oncol Haematol 2001;5(3):203-204.

Abstract: Short communication on Chronic Myelomonocytic Leukemia, with data on clinics, and the genes involved.

component. When dysplasia is missing, diagnosis can Identity be made if a clonal cytogenetic or molecular Chronic Myelomonocytic Leukemia (CMML) abnormality is identified in hematopoietic cells, or if Note peripheral blood monocyte count remains elevated at least 3 months without any other explanation. Chronic myelomonocytic leukemia (CMML) is the most frequent entity among myeloproliferative / Phenotype/cell stem origin myelodysplastic syndromes, as defined by the World The cell of origin is a multipotential stem cell. Health Organization (WHO) classification of myeloid malignancies in 2008. The percentage of peripheral and Epidemiology marrow blast cells is the major prognostic factor CMML is a relatively rare disease whose incidence is identified at that time. Based on the percentage of blast around 1 case/100000 inhabitants per year. CMML is a cells in the bone marrow and peripheral blood, CMML disease of older adults, with a strong male is further stratified into CMML-1 (< 5% in blood, < predominance. The median age at diagnosis is around 10% in the bone marrow) and CMML-2 (5 - 19% in the 70 years, the disease is exceptionally diagnosed before blood; 10 to 19% in the bone marrow, or less if Auer 50 years of age. inclusions are present). Clinics Clinics and pathology The onset of the disease is usually insidious and, diagnosis is fortuitous in many cases. Symptoms, when Disease present, are the consequences of cytopenias (notably anemia, which is invalidating in a third of patients), Note and/or of extramedullary hematopoiesis, notably The WHO criteria include 1) stable increase in splenomegaly but also hepatomegaly, skin infiltration, 9 peripheral blood monocyte count (> 1 x 10 /L); 2) lack gum infiltration, and serous (notably pleural) effusions. of Philadelphia chromosome and BCR-ABL fusion Extramedullary hematopoiesis is mostly restricted to gene; 3) lack of gene rearrangement involving the patients with WBC > 13 G/L. Finally, auto-immune Platelet-Derived Growth Factor Receptor Beta gene manifestations (seronegative arthritis, vasculitis) can be (PDGFRB); 4) blast cell percentage in the blood and associated to CMML. the bone marrow lower than 20% and 5) cellular dysplasia of at least one myeloid cell line. This last Cytology criterion is not mandatory, as monocyte dysplasia can Peripheral blood count indicates monocytosis (up to 80 be difficult to assess in the bone marrow, and dysplasia x 10 9/L). Cells identified by cytologists as monocytes of other lineages is inconstant. Thus, CMML may not are heterogeneous, commonly including mature always have a cytologically identifiable dysplastic monocytes, dysplastic monocytes, and a variable

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 50 Chronic Myelomonocytic Leukemia (CMML) Solary E

fraction of dysplastic granulocytes (these cells do not By definition CMML cases do not show the express CD14 but express granulocytic markers CD15 Philadelphia chromosome. and CD24, belong to the leukemic clone, and Cases associated with eosinophilia and rearrangements demonstrate immunosuppressive properties like that fuse the platelet-derived growth factor receptor myeloid-derived suppressive cells). An increase in (PDGFRB) to another gene such as TEL in neutrophils or eosinophils can be associated, as well as t(5;12)(q33;p13) are excluded from the CMML group myelemia. Anemia is usually moderate, normocytic or by the WHO classification as this separate entity is macrocytic. Thrombocytopenia is inconstant and can be sensitive to tyrosine kinase inhibitors such as Imatinib severe. Of note, an immune mechanism can contribute mesylate. to these cytopenias. Hyperuricemia, increased B12 The recurrent aberrations observed in CMML include plasma level, increase serum and urine lysozyme, and loss of the Y chromosome, monosomy 7, trisomy 8, polyclonal hypergammaglobulinemia can be observed. and interstitial deletions of chromosomes 20q, 11q, and Bone marrow: Bone marrow smears show a 12p, all of which may be seen in other myelodysplastic hypercellular tissue in which blast cell percentage and myeloproliferative disorders. (myeloblasts and monoblasts) remains lower than 20%. The proportion of patients showing large areas of Monocyte proliferation is always present and often uniparental disomy (UPD) in their blood cells, which is moderate (10 to 15% of mononuclear cells) and about 50% and could result from mitotic dysplastic changes can be observed in one or several recombinations, is higher than in other myeloid lineages. A variable degree of myelofibrosis can be malignancies. detected in up to 30% of patients. Treatment Genes involved and proteins Allogeneic stem cell transplantation remains the only Note potentially curative option but is rarely feasible, due to Whole exome sequencing identifies a mean number of the age of patients. In those ineligible for 16 mutations in peripheral blood monocytes of patients transplantation, the mainstay of CMML treatment is with a CMML, none of which is specific of this entity. hydroxyurea, which is usually initiated when the The recurrently mutated genes encode signaling disease becomes proliferative. The overall response molecules (NRAS, KRAS, CBL, JAK2, FLT3, CSF3R, rate reaches 60% but complete response is exceptional. NOTCH, NCSTN, MAML1), epigenetic regulators The hypomethylating agent azacitidine (AZA) has been (TET2, ASXL1, EZH2, UTX, IDH1, IDH2, DNMT3A, approved in Europe for CMML with WBC < 13 G/L SETBP1), splicing factors (SF3B1, SRSF2, ZRSF2, and bone marrow blasts between 10 and 29%. U2AF1), and cohesins (STAG1, STAG2, RAD21, The other hypomethylating agent, decitabine, is SMC1A, SMC3, PDS5B). approved in US, not in Europe. An overall response Mutations in the transcription regulators RUNX1, rate of 40% is observed with these drugs. Prospective NPM1 and TP53 have also been reported in CMML. randomized comparisons of hypomethylating agents The most frequently mutated genes are TET2 (50- versus hydrxyurea have still to be performed. 60%), SRSF2 (40-50%), and ASXL1 (30-40%). Prognosis TET2 and SRSF2 mutations are often combined. Most The median survival for patients with CMML is 24-36 of the studies consistently report the poor prognosis of months. According to the WHO, the main prognostic ASXL1 mutations. factor is the percentage of blast cells in the blood and Aberrant gene expression profiles can be identified in the bone marrow. Several prognostic scores have been the absence of gene mutation. proposed that rely on peripheral blood counts, serum In particular, expression of TIF1 γ (transcription lactate deshydrogenase values, and percentage of bone intermediary factor 1 gamma) is repressed by aberrant marrow blast cells and cytogenetic abnormalities. More promoter hypermethylation in 35% of CMML patients, recent data suggest that cytogenetic and molecular and conditional invalidation of TIF1 γ leads to a information could be prognostically useful. CMML-like syndrome in aging mice. No direct link Cytogenetics is part of a recent Spanish score whereas was identified between the repression of TIF1 γ and a recent French prognostic score includes the presence other genes such as INK4B and the epigenetic gene of mutations in ASXL1 gene, which is an independent mutations. poor prognostic factor in CMML. An international staging system may be established in the coming years. References Droin N, Jacquel A, Hendra JB, Racoeur C, Truntzer C, Cytogenetics Pecqueur D, Benikhlef N, Ciudad M, Guery L, Jooste V, Dufour E, Fenaux P, Quesnel B, Kosmider O, Fontenay M, Ducoroy P, Cytogenetics morphological Solary E. Alpha-defensins secreted by dysplastic granulocytes inhibit the differentiation of monocytes in chronic Conventional metaphase karyotyping of bone marrow myelomonocytic leukemia. Blood. 2010 Jan 7;115(1):78-88 mononucleated cells is normal in two thirds of patients.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 51 Chronic Myelomonocytic Leukemia (CMML) Solary E

Aucagne R, Droin N, Paggetti J, Lagrange B, Largeot A, myelomonocytic leukemia. J Clin Oncol. 2013 Jul Hammann A, Bataille A, Martin L, Yan KP, Fenaux P, Losson 1;31(19):2428-36 R, Solary E, Bastie JN, Delva L. Transcription intermediary factor 1 γ is a tumor suppressor in mouse and human chronic myelomonocytic leukemia. J Clin Invest. 2011 Itzykson R, Kosmider O, Renneville A, Morabito M, Jun;121(6):2361-70 Preudhomme C, Berthon C, Adès L, Fenaux P, Platzbecker U, Braun T, Itzykson R, Renneville A, de Renzis B, Dreyfus F, Gagey O, Rameau P, Meurice G, Oréar C, Delhommeau F, Laribi K, Bouabdallah K, Vey N, Toma A, Recher C, Royer B, Bernard OA, Fontenay M, Vainchenker W, Droin N, Solary E. Joly B, Vekhoff A, Lafon I, Sanhes L, Meurice G, Oréar C, Clonal architecture of chronic myelomonocytic leukemias. Preudhomme C, Gardin C, Ades L, Fontenay M, Fenaux P, Blood. 2013 Mar 21;121(12):2186-98 Droin N, Solary E. Molecular predictors of response to Itzykson R, Solary E. An evolutionary perspective on chronic decitabine in advanced chronic myelomonocytic leukemia: a myelomonocytic leukemia. Leukemia. 2013 Jul;27(7):1441-50 phase 2 trial. Blood. 2011 Oct 6;118(14):3824-31 Kosmider O, Itzykson R, Chesnais V, Lasho T, Laborde R, Jankowska AM, Makishima H, Tiu RV, Szpurka H, Huang Y, Knudson R, Gauthier A, Merlevede J, Ades L, Morabito M, Traina F, Visconte V, Sugimoto Y, Prince C, O'Keefe C, Hsi Fontenay M, Tefferi A, Droin N, Solary E. Mutation of the ED, List A, Sekeres MA, Rao A, McDevitt MA, Maciejewski JP. colony-stimulating factor-3 receptor gene is a rare event with Mutational spectrum analysis of chronic myelomonocytic poor prognosis in chronic myelomonocytic leukemia. leukemia includes genes associated with epigenetic regulation: Leukemia. 2013 Sep;27(9):1946-9 UTX, EZH2, and DNMT3A. Blood. 2011 Oct 6;118(14):3932-41 Padron E, Abdel-Wahab O. Importance of genetics in the Klinakis A, Lobry C, Abdel-Wahab O, Oh P, Haeno H, clinical management of chronic myelomonocytic leukemia. J Buonamici S, van De Walle I, Cathelin S, Trimarchi T, Araldi E, Clin Oncol. 2013 Jul 1;31(19):2374-6 Liu C, Ibrahim S, Beran M, Zavadil J, Efstratiadis A, Taghon T, Michor F, Levine RL, Aifantis I. A novel tumour-suppressor Padron E, Painter JS, Kunigal S, Mailloux AW, McGraw K, function for the Notch pathway in myeloid leukaemia. Nature. McDaniel JM, Kim E, Bebbington C, Baer M, Yarranton G, 2011 May 12;473(7346):230-3 Lancet J, Komrokji RS, Abdel-Wahab O, List AF, Epling- Burnette PK. GM-CSF-dependent pSTAT5 sensitivity is a Damm F, Itzykson R, Kosmider O, Droin N, Renneville A, feature with therapeutic potential in chronic myelomonocytic Chesnais V, Gelsi-Boyer V, de Botton S, Vey N, Preudhomme leukemia. Blood. 2013 Jun 20;121(25):5068-77 C, Clavert A, Delabesse E, Park S, Birnbaum D, Fontenay M, Bernard OA, Solary E. SETBP1 mutations in 658 patients with Such E, Germing U, Malcovati L, Cervera J, Kuendgen A, myelodysplastic syndromes, chronic myelomonocytic leukemia Della Porta MG, Nomdedeu B, Arenillas L, Luño E, Xicoy B, and secondary acute myeloid leukemias. Leukemia. 2013 Amigo ML, Valcarcel D, Nachtkamp K, Ambaglio I, Hildebrandt Jun;27(6):1401-3 B, Lorenzo I, Cazzola M, Sanz G. Development and validation of a prognostic scoring system for patients with chronic Itzykson R, Kosmider O, Renneville A, Gelsi-Boyer V, myelomonocytic leukemia. Blood. 2013 Apr 11;121(15):3005-15 Meggendorfer M, Morabito M, Berthon C, Adès L, Fenaux P, Beyne-Rauzy O, Vey N, Braun T, Haferlach T, Dreyfus F, This article should be referenced as such: Cross NC, Preudhomme C, Bernard OA, Fontenay M, Vainchenker W, Schnittger S, Birnbaum D, Droin N, Solary E. Solary E. Chronic Myelomonocytic Leukemia (CMML). Atlas Prognostic score including gene mutations in chronic Genet Cytogenet Oncol Haematol. 2014; 18(1):50-52.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 52 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(3;21)(q26;q22) Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: August 2013 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0321.html DOI: 10.4267/2042/52078 This article is an update of : Huret JL, Desangles F. t(3;21)(q26;q22). Atlas Genet Cytogenet Oncol Haematol 1998;2(1):24-25. Huret JL, Desangles F. t(3;21)(q26;q22). Atlas Genet Cytogenet Oncol Haematol 1997

Abstract: Short communication on t(3;21)(q26;q22), with data on clinics, and the genes involved.

et al., 2010; Paquette et al., 2011); BC-CML cases and Clinics and pathology MDS/AML cases were separated into two distinct Disease entities for further studies; each entity was then compared with the equivalent entities from the largest Chronic myelogenous leukemia in blast crisis (BC- study (Yin et al., 2006), and, in the occurence where CML), myelodysplastic syndrome (MDS) and acute there was no discrepancy, all the cases in each entity myeloid leukemia (AML). (BC-CML and MDS/AML) were again pooled Note together. Cases of t(3;21)(q26;q22) are mostly treatment-related As a matter of fact, the only discrepancy was the sex blast crises of CML, and treatment-related ratio in MDS/AML entity: 55% male / 45% female MDS/AMLs. However, the t(3;21) may also be found patients in the 29 cases from the "large studies" vs 30% in rare instances of CML prior to the onset of blast male / 70% female patients in the 10 cases from the crisis (Coyle and Najfeld, 1988). "largest study". In selected publications (Sacchi et al., 1994; Secker- In the review herein below, we therefore study a Walker et al., 1995; Jeandidier et al., 2006; Poppe et sample of 42 cases of BC-CML, and 39 cases of al., 2006; Yin et al., 2006; see below), there were equal MDS/AML. In some instances, the whole sample of numbers of BC-CML cases and MDS/AML cases (53% cases of t(3;21) harvested in the Mitelman database was and 47% respectively, out of 60 cases). A very few taken into account (146 cases). cases of chronic myeloproliferative disease without a t(9;22) have been documented (3,4% of the 146 cases Etiology of t(3;21) collected in the Mitelman database). Most Rubin et al., 1990 noted that t(3;21) represents 3,6% of cases of AML are M2-AML or M4-AML (+ two cases therapy related MDS/AMLs (t-MDS/AML); they did of M5b, one M6, one M7). MDS cases are mostly not find one case of t(3;21) amongst 1500 de novo refractory anemia with excess of blasts (RAEB, also MDS/AMLs. including RAEB-1 and RAEB-2) (+ one case of Yin et al., 2006 noted that 15 of their 16 BC-CML refractory anemia, one case of chronic myelomonocytic patients had previously been treated with hydroxyurea, leukemia). before blast crisis. Cases of t(3;21) herein reviewed were selected and The occurrence of the t(3;21) heralded blast pooled together from the large studies (Lafage- transformation. Pochitaloff-Huvalé et al., 1989; Rubin et al., 1990; The authors conclude that prior treatment with Sacchi et al., 1994; Secker-Walker et al., 1995; hydroxyurea or other antimetabolites (fludarabine, 5- Jeandidier et al., 2006; Poppe et al., 2006; Lugthart fluorouracil) are implicated in t(3;21) malignant blood diseases.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 53 t(3;21)(q26;q22) Huret JL

t(3;21)(q26;q22). Left: G-banding - Top - Courtesy Marian Stevens-Kroef; Middle three: Courtesy Steven Richebourg; Center: R-banding - Top: Courtesy Peter Vandenberghe; Middle three: Courtesy Olivier Theisen; Bottom two: Courtesy Christine Perot; Right: FISH with EVI1 break apart probe Courtesy Olivier Theisen.

Paquette et al., 2011, report that MECOM (also known treatment related leukemia". as EVI1) translocations were seen in 12% of BC-CML before tyrosine kinase inhibitors treatments, a Epidemiology percentage reaching 35-40% with current treatments. Translocation t(3;21) represents 0,14% of AML cases The authors note that BCR-ABL1 and MECOM and 3% of 3q abnormalities cases (9 cases out of 6515 collaborate in leukemogenesis in animal models. AML patients) in Lugthart et al., 2010. Coexistence of BCR-ABL1 and MECOM translocation Median age was 58 years (range 21-77) in BC-CML is sufficient to cause evolution towards BC-CML. (n=42), and around 65 years (range 13-76, only one The interval between the diagnosis of the initial child) in MDS/AML (n=39). neoplasm and the occurrence of the t(3;21) was 24 From 146 cases extracted from the Mitelman database, months (median, range 3-154 months) in CML-->BC- sex ratio was 1,44 (59% male and 41% female CML, and 38 months (median, range 6-144 months) for patients). In the 42 cases of BC-CML herein selected MDS/AML cases (Yin et al., 2006). for study, there was 71% male and 29% female patients In our meta-analysis, 81% of 33 cases of BC-CML and (p<0.01). 87% of 31 cases of MDS/AML can be considered to be In the 39 cases of MDS/AML, no conclusion can be secondary to previous treatment. drawn, owing to conflictory data between "large Results presented herein can be compared with those of studies" and "the largest study" (see above); the oddity a study from an International Workshop on treatment of pooling heterogenous samples would result, in the related leukemia: "t(3;21)(q26;q22) in present case, in a balanced sex ratio (19M/20F), but, again this is nonsense and the issue rewards further studies.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 54 t(3;21)(q26;q22) Huret JL

Cytology with -7/del(7q) in 15%, +8 in 11%, +12 in 5%, del(5q) in 3%, and +9, +13, or del(20q) in 1% each. Secker-Walker et al., 1995 noted low platelet counts, Again from these 146 cases, when the t(3;21) was the dysmyelopoiesis, decreased number of sole anomaly, the diagnosis was AML in 84% of cases, megakaryocytes, and micromegakaryocytes in and MDS in 14%; in cases with a -7/del(7q), the MDS/AML cases; micromegakaryocytes were also diagnosis was AML in 64% of cases, MDS in 18%, and seen in BC-CML cases (Yin et al., 2006). CML in 14%; in cases with a +8, the diagnosis was Prognosis CML in two third of cases, and AML in 25%; in cases with a +12, the diagnosis was CML in half of the cases, Poor survival (see figure above). Median survival is 4 and AML in the other half. months (range 0-21 months, n=18) in the MDS/AML In the BC-CML series (with a t(9;22), indeed), the group, and 9 months (range 1-79+ months, n=30 cases, t(3;21) was accompanied with +8 in 16% of cases, +12 reports from 1995 to 2011) in the BC-CML group. in 5%, and with -7/del(7q) or -5/del(5q) in 3% each. Median survival was 13 months in the most recent The profile in MDS/AML cases is here very different: cases of BC-CML (n= 20 cases) (Yin et al., 2006; the t(3;21) was the sole anomaly in 36% of cases, Paquette et al., 2011). accompanied with -7/del(7q) in 26%, +8 in 8%, del(5q) or del(20q) in 5% each, +12 in 3%. A complex Genetics karyotype may be present. Note In a study of cases with 3q21 and/or 3q26 Genes involved and proteins abnormalities (Lugthart et al., 2010), no mutation of MECOM FLT3-TKD (tyrosine kinase domain), NPM1, CEBPA, KIT, MLL-PTD (partial tandem duplication), K-RAS Location were found in the t(3;21)(q26;q22) cases; in the whole 3q26 3q26 group (inv(3)/t(3;3) excluded), there were 11% of Note FLT3-ITD (internal tandem duplication) and 25% of N- MECOM is also known as EVI1 or PRDM3; MECOM RAS mutation. symbol means: "MDS1 and EVI1 complex locus". Protein Cytogenetics "EVI1" contains two domains of seven and three zinc Cytogenetics morphological finger motifs, respectively, a repression domain between the two sets of zinc fingers, and an acidic From the 146 cases extracted from the Mitelman domain at its C-term. database, the t(3;21) was the sole anomaly in 25% of Sequence specific DNA binding protein. cases, accompanied with a t(9;22)(q34;q11) in 40%,

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 55 t(3;21)(q26;q22) Huret JL

Interacts with transcriptional coactivators, corepressors, analysis and immunological study on five new cases. and other sequence specific transcription factors. Leukemia. 1989 Aug;3(8):554-9 MECOM ("MDS1-EVI1") also contains a PR domain Rubin CM, Larson RA, Anastasi J, Winter JN, Thangavelu M, from "MDS1" in N-term (Wieser, 2008). Vardiman JW, Rowley JD, Le Beau MM. t(3;21)(q26;q22): a recurring chromosomal abnormality in therapy-related RUNX1 myelodysplastic syndrome and acute myeloid leukemia. Blood. 1990 Dec 15;76(12):2594-8 Location 21q22 Sacchi N, Nisson PE, Watkins PC, Faustinella F, Wijsman J, Hagemeijer A. AML1 fusion transcripts in t(3;21) positive Note leukemia: evidence of molecular heterogeneity and usage of RUNX1 has also been known as AML1 or CBFA2. splicing sites frequently involved in the generation of normal AML1 transcripts. Genes Chromosomes Cancer. 1994 DNA/RNA Dec;11(4):226-36 Transcription is from telomere to centromere. Secker-Walker LM, Mehta A, Bain B. Abnormalities of 3q21 Protein and 3q26 in myeloid malignancy: a United Kingdom Cancer Cytogenetic Group study. Br J Haematol. 1995 Oct;91(2):490- Contains a Runt domain and, in the C-term, a 501 transactivation domain, an inhibition domain, and various regulatory regions; forms heterodimers; widely Huret JL.. t(3;21)(q26;q22) in treatment related leukemia. Atlas Genet Cytogenet Oncol Haematol. 2004; 8(1):26-27. expressed; nuclear localisation; transcription factor http://documents.irevues.inist.fr/bitstream/handle/2042/38047/1 (activator) for various hematopoietic-specific genes. 0-2003-t0321q26q22TreatRelID1294.pdf?sequence=3. Jeandidier E, Dastugue N, Mugneret F, Lafage-Pochitaloff M, Result of the chromosomal Mozziconacci MJ, Herens C, Michaux L, Verellen-Dumoulin C, Talmant P, Cornillet-Lefebvre P, Luquet I, Charrin C, Barin C, anomaly Collonge-Rame MA, Perot C, Van den Akker J, Gregoire MJ, Jonveaux P, Baranger L, Eclache-Saudreau V, Pages MP, Hybrid gene Cabrol C, Terre C, Berger R; Groupe Francais de Cytogenetique Hematologique (GFCH).. Abnormalities of the Note long arm of chromosome 21 in 107 patients with hematopoietic Breakpoint after exon 5 or 6 in RUNX1. Breakpoints disorders: a collaborative retrospective study of the Groupe are variable and dispersed along EVI1, MDS1 and the Fran ais de Cytogenetique Hematologique. Cancer Genet telomeric region of these two genes (Poppe et al., Cytogenet. 2006 Apr 1;166(1):1-11. 2006). Poppe B, Dastugue N, Vandesompele J, Cauwelier B, De Smet B, Yigit N, De Paepe A, Cervera J, Recher C, De Mas V, Description Hagemeijer A, Speleman F.. EVI1 is consistently expressed as Fusion gene: on the der(3); 5' RUNX1 - 3' MECOM. principal transcript in common and rare recurrent 3q26 rearrangements. Genes Chromosomes Cancer. 2006 Fusion protein Apr;45(4):349-56. Description Yin CC, Cortes J, Barkoh B, Hayes K, Kantarjian H, Jones D.. RUNX1/MECOM: 180 kDa. The translocation protein t(3;21)(q26;q22) in myeloid leukemia: an aggressive syndrome includes the N-term RUNX1 with the Runt domain and of blast transformation associated with hydroxyurea or antimetabolite therapy. Cancer. 2006 Apr 15;106(8):1730-8. most of the gene MECOM, from the second untranslated exon of EVI1 to C-term, which includes Wieser R.. MECOM (Ecotropic Viral Integration Site 1 (EVI1) the 2 zinc finger motifs, the repression domain, and the and Myelodysplastic Syndrome 1 (MDS1)-EVI1). Atlas Genet Cytogenet Oncol Haematol. 2008;12(4):306-310. acidic domain, or also including the MDS1 PR domain http://documents.irevues.inist.fr/bitstream/handle/2042/38551/1 followed by EVI1 domains as noted above. 2-2007-EVI103q26ID19.pdf?sequence=2 Oncogenesis Lugthart S, Groschel S, Beverloo HB, Kayser S et al.. Clinical, Inappropriate and ectopic expression of MECOM molecular, and prognostic significance of WHO type (either as EVI1 or as MDS1-EVI1) (Poppe et al., 2006; inv(3)(q21q26.2)/t(3;3)(q21;q26.2) and various other 3q abnormalities in acute myeloid leukemia. J Clin Oncol. 2010 Lugthart et al., 2010); interferes with RUNX1 functions Aug 20;28(24):3890-8. doi: 10.1200/JCO.2010.29.2771. Epub in a dominant negative manner. 2010 Jul 26. Paquette RL, Nicoll J, Chalukya M, Elashoff D, Shah NP, References Sawyers C, Spiteri E, Nanjangud G, Rao PN.. Frequent EVI1 translocations in myeloid blast crisis CML that evolves through Coyle T, Najfeld V. Translocation (3;21) in Philadelphia tyrosine kinase inhibitors. Cancer Genet. 2011 Jul;204(7):392-7. chromosome-positive chronic myelogenous leukemia prior to the onset of blast crisis. Am J Hematol. 1988 Jan;27(1):56-9 This article should be referenced as such: Lafage-Pochitaloff-Huvalé M, Sainty D, Adriaanssen HJ, Lopez Huret JL. t(3;21)(q26;q22). Atlas Genet Cytogenet Oncol M, Maraninchi D, Simonetti J, Mannoni P, Carcassonne Y, Haematol. 2014; 18(1):53-56. Hagemeijer A. Translocation (3;21) in Philadelphia positive chronic myeloid leukemia: high resolution chromosomal

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 56 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Solid Tumour Section Review

Soft tissue tumors: an overview Paola Dal Cin Brigham and Women's Hospital, 75 Francis Street, Boston, MA 02115, USA (PD)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Tumors/softissuTumID5042.html DOI: 10.4267/2042/52079 This article is an update of : Dal Cin P. Soft tissue tumors: an overview. Atlas Genet Cytogenet Oncol Haematol 2003;7(2):131-136.

Abstract: Review on soft tissue tumors with data on clinics, and the genes involved.

cytogenetic-molecular and histological correlations Identity have been enclosed. Note Informations and (review) references are provided for Soft tissue tumours represent a heterogeneous and well-characterized cytogenetic/molecular tumors complex group of mesenchymal lesions that may show investigated in more than a single case. For data a broad range of differentiation. Histologic regarding single case reported, the reader is referred to classification is based upon morphologic demonstration http://cgap.nci.nih.gov/Chromosomes/Mitelman; 2013. of a specific line of differentiation. But, despite the extraordinary contribution of ancillary diagnostic Clinics and pathology techniques such as electron microscopy and immunohistochemistry, classification of mesenchymal Disease neoplasms is still the subject of continuous debate. The Adipocytic tumors true incidence of soft tissue tumors is nearly impossible to determine, especially for benign tumors, because Cytogenetics many of these tumors are not biopsied. Soft tissue Lipoma. More than half the cases studied show an sarcomas compared with carcinomas and other abnormal karyotype, mostly balanced translocation, as neoplasms, constitute fewer than 1% of all cancers. single abnormality. Three distinct clustering of Their morphological appearance is kaleidoscopic and breakpoints have been distinguished: 1) the major varies. Hence, classification is often difficult and the group involving 12q13-15, with several possible subject of continuous debate among pathologists. partners, of which 3q27-28 is a preferential one; 2) a For the purpose of uniformity the new World Health deletion/translocation of 13q11-q22; 3) a Organization (WHO) Classification of Tumors of Soft rearrangement of 6p21-23. The target gene in 12q14.3, Tissue and Bone published in 2013 will be followed. A HMGA2 (HMGIC) is a family member of the High few new categories have been officially included in the Mobility Group (HMG) of protein. The most common Soft Tissue Tumour section: giant cell fibroblastoma, gene fusion is HMGA2-LPP resulting from a dermatofibrosarcoma protuberans, gastrointestinal t(3;12)(q27-28;q14.3). Other partners genes include: stromal tumours and nerves sheath tumours. CXCR7 (2q37.3), EBF1 (5q33.3), NFIB (9p22.3), Undifferentiated/unclassified sarcomas are a new entity LHFP (13q13.3) and PPAP2 (1p32). Lipoma with 13q- in this new edition. Ewing sarcoma and extraskeletal show a minimal deleted region of 3.4 Mb, where only mensechymal chondrosarcoma, originally described in the C13orf11 is expressed in significant lower level the Bone section is also included in this review. Benign compared with lipomas without 13q deletion. In lipoma uterine leiomyomas and endometrial stromal sarcoma with 6p21-23 rearrangement, the breaks occur adjacent are still included in the WHO Classification of Tumors to the coding sequences of HMGA1 (HMGIY), another Pathology and Genetics of Tumours of the Breast and member of the same HMG family. Female Genital Organs. Moreover, a few new

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 57 Soft tissue tumors: an overview Dal Cin P

Lipoblastoma. The characteristic cytogenetic feature is two genes DDIT3 (CHOP) and FUS (TLS). A rare rearrangement of 8q11-13. This rearrangement is variant translocation has been also described, associated with promoter swapping, in which the t(12;22)(q13;q12), in which DDIT3 is fused with PLAG1 promoter element is replaced by those of the EWSR1. The absence of FUS/DDIT3 fusion in other hyaluronic acid synthase 2 (HAS2) or collagen morphologic mimics, such as myxoid well (COL1A2) genes, at 8q24.3 and 7q21.3, respectively. differentiated liposarcomas of the retroperitoneum and The most common numerical is one or more extra myxofibrosarcoma, has been demonstrated. copies of chromosome 8, with or without 8q11-13 Pleomorphic liposarcoma. High chromosome rearrangement. numbers with complex structural rearrangements have Angiolipoma. All cytogenetically investigated tumors, been often described. The absence of amplification of but one, have normal karyotypes. 12q14-15 can help to distinguish pleomorphic Chondroid lipoma. C11orf95 and MLK2 genes at liposarcoma from dedifferentiated liposarcoma. 11q13 and 16p13.3, respectively, are the genes involved in the t(11;16)(q13;p12-13). Disease Spindle cell lipoma/Pleomorphic lipoma. Similar Fibroblastic/Myofibroblastic tumors cytogenetic aberrations have been described in both entities. The most frequent losses are -13/13q-, Cytogenetics followed by 16q22-qter, 6q14-21, 10p and 17p, and Nodular fasciitis. The overexpression of USP6 gene in 2q21-. this lesion prompted to the identification of a USP6- Hibernoma. Involvement of 11q13 region has been MYH9 gene fusion, as consequence of a cryptic described, with several translocation region partners, of t(17;22)(p13.3;q12.3). which 9q34 and 14q11 are the most recurrent ones. Angiofibroma of the soft tissue. Although this benign However, FISH analysis demonstrated that these lesion was not included in the WHO 2013, a rearrangements are more complex than can be detected t(5;8)(p15;q13) associated with AHRR-NCOA2 gene by conventional G-banding and interstitial deletions fusion is the hallmark of this lesion. affect the seemingly normal chromosome 11. This Proliferative fasciitis and proliferative myositis. For deletion clusters to a 3 Mb region in 11q13 of the 132 each of these entities, trisomy 2 has been reported in a genes in this 3 Mb region. Several genes showed single case. significant lower expression including MEN1, AIP, Elastofibroma. A significant chromosomal instability EHD1 and CDK2AP2. High expression was also seen has been reported. Aberrations of the short arm of with PPARA, PPARG, PPARGC1A and particularly chromosome 1 were particularly noted. with UCP1, compared with lipoma and white adipose Juvenile hyaline fibromatosis. This lesion is caused tissue. by the inactivating mutation in the ANTXR2 gene Atypical lipomatous tumor/Well-differentiated encoding capillary morphogenesis protein 2, at 4q21. liposarcoma. Supernumerary ring or/and giant marker Fibroma of the tendon sheath. A single case with chromosomes have been observed mostly as the sole t(2;11)(q31-32;q12) has been reported. This chromosome aberration. Cells containing ring and/or translocation is apparently identical to the one reported giant markers varying in size or number can be on desmoplastic fibroblastoma. observed in the same tumor sample. Telomeric Desmoplastic fibroblastoma. A t(2;11)(q31-32;q12) associations are frequently seen. Molecular cytogenetic or a 3-way variant has been observed. Deregulated techniques indicate that both ring and giant marker expression of FOSL1 gene has been proposed as the chromosomes are composed of interspersed amplified functional outcome of the 11q12 rearrangement. sequences consistently originating from the 12q14-15 Mammary-type fibroblastoma. Partial monosomy region. The most consistently amplified gene is 13q with or without partial monosomy 16q have been MDM2, usually accompanied by amplification of reported, similar to those described for spindle cell neighboring genes, such as CDK4, HMGA2, YEATS4, lipoma, and cellular angiofibroma, supporting a CPM, and FRS2. Additional chromosomal regions have pathogenic link among these entities. shown to be co-amplified with 12q14-15, and with Cellular angiofibroma. One single case reported with 1q21-q25 being the most frequent region. These ring loss of 13 and 16, Interphase FISH showing deletion of and giant marker chromosomes do not contain ana- RB1 and FOXO1 support this finding. satellite sequences, but have "neocentromere". Palmar/plantar fibromatoses. Near-diploid karyotype Dedifferentiated liposarcoma. Cytogenetic anomalies with simple numerical changes, particularly gain of similar to those seen in atypical lipomatous tumors chromosome 7 or 8 have been reported. have been reported. Moreover, co-amplification Desmoid-type fibromatoses. Trisomies for involving mainly 1p32 and 6q23, which include JUN chromosome 8 and/or 20 have been described in some and its activate kinases ASK1 as target genes, has been cases. Rearrangement of 5q is found in desmoid tumors demonstrated. from patients with familial polyposis. APC inactivation Myxoid liposarcoma. The characteristic cytogenetic has been reported in tumor arising in the setting of feature is t(12;16)(q13;p11), leading to the fusion of Gardner-type FAP. Mutations in the β-catenin

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 58 Soft tissue tumors: an overview Dal Cin P

(CTNNB1) have been detected in 85% of sporadic Over-expression of FGF8 on 10q was identified by lesions. microarray analysis, suggesting that this translocation Giant cell fibroblastoma. Only few cases have been may alter gene transcription away from the breakpoint. analyzed by karyotyping, and either t(17;22)(q22;q13) The loss of material of the chromosome region 3p is or unbalanced t(17;22), has been observed in pediatric associated with amplification of 3p11.1-12.1, cases. This chromosome rearrangement is associated containing VGLL3 gene. Similar t(1;10) abnormality with COL1A1-PDGFB chimeric gene. Similar gene has been also observed in hemosiderotic rearrangement has been identified in fibrolipomatous tumour. dermatofibrosarcoma protuberans. Infantile fibrosarcoma. A specific t(12;15)(p13;q26) Dermatofibrosarcoma protuberans. A is the hallmark of this tumor. Since the regions supernumerary ring/chromosome derived from a exchanged between chromosomes 12 and 15 are similar t(17;22)(q22;q13) is characteristic chromosome in size and banding characteristics, this translocation aberrations. This ring chromosome contains the was overlooked in early reports, in which only centromeric region of chromosome 22, more than one numerical changes i.e. trisomies 11, 8, 17 and 20 were copy of COL1A1-PDGFB gene fusion, and sometime, described. This translocation fuses the ETV6 (TEL) additional segments from other chromosomes. Clinical gene at 12p13 with the neurotrophin-3 receptor gene studies have shown a high response rate to imatinib NTRK3 (TRKS) at 15q25. therapy in both locally advanced and metastatic tumors, Notably, cellular congenital mesoblastic nephroma as imatinib blocks PDGFRB signaling. correlates with the presence of the same t(12;15) and Extrapleural solitary fibrous tumor. After the with trisomy 11, but these findings are not seen in the publication of WHO13, a NAB2-STAT6 gene fusion classical congenital mesoblastic nephroma. The same was identified by next generation sequencing and has t(12;15) has been reported in myeloid leukemia, not been encountered in other soft-tissue tumors. secretory breast carcinoma, and mammary-type This fusion result by a paracentric inversion on the secretory carcinoma and salivary glands. 12q13 region, where both NAB2 and STAT6 are genes Adult fibrosarcoma. No consistent abnormality has closely adjacently located, overlapping 58 base pairs. been detected among the complex karyotypes published Therefore this inversion is undetectable by standard G- to date. banding karyotyping, and only a minor fraction of the Myxofibrosarcoma. Highly complex karyotypes with fusion-positive cases can be identified by FISH extensive intratumoral heterogeneity have been analysis. reported. No consistent aberration has emerged. Inflammatory myofibroblastic tumor. Involvement Low grade fibromyxoid sarcoma. A t(7;16)(q33;p11) of 2p23 occurs mainly or exclusively in children and is present in approximately two third of the cases, and a young adults. Activation of the ALK receptor tyrosine 25% of the cases show a supernumerary ring kinase is accomplished by chromosomal translocation chromosome. to a wide variety of partner genes, with TPM4 Both aberrations result by a FUS-CREB3L2 gene (19p13.1), TPM3 (1q22.23), CLTCL2 (17q23), fusion. A rare variant t(11;16)(p11;p11) leading to a RANBP2 (2q13), ATIC (2q24), CARS (11p15) and FUS-CREB3L1 gene fusion have been reported. SEC31L1 (4q21), being the most frequent. Sclerosing epithelioid fibrosarcoma. FUS Of interest, the RANBP2-ALK gene fusion has an rearrangement is rarely detected in pure sclerotic aggressive clinical course and shows a ALK immuno- epithelial fibrosarcoma, but it has been detected in low- staining in a nuclear membrane pattern. Some of these grade-fibromyxoid sarcoma with sclerosing ALK fusion genes have been observed in anaplastic large cell lymphoma and in diffuse large B-cell epithelial fibrosarcoma-like loci. lymphoma. Moreover, ALK rearrangement has been Disease also reported in a subgroup of non-small lung cancer, kidney tumors, esophageal squamous cell carcinoma. So-called fibrohistiocytic tumors A fraction of all these cancer types shares activated Cytogenetics ALK as the essential growth driver and such tumors Tenosynovial giant cell tumour, localized type. The can be targeted for treatment with ALK inhibitors e.g. most frequent translocation is the t(1;2)(p13;q35) and is Crizotinib. associated with a CSF1-COL6A3 gene fusion, resulting Myxoinflammatory fibroblastic sarcoma. Most of in an over-expression of CSF1 in the neoplastic cells. these lesions share a balanced or unbalanced No other CSF1 gene partners have yet been identified. t(1;10)(p22;q24-25). The biologic evidence of a central role for CSF1 in the The breakpoints on this translocation are TGFBR3 in pathogenesis of these lesions is further supported by 1p22 and MGEA5 in 10q24. However, no chimeric clinical experience, in which they responded fusion transcript is detectable because these two genes therapeutically to imatinib. Involvement of 16q24 and are transcribed in opposite directions. trisomies 5 and/or 7 can also be observed.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 59 Soft tissue tumors: an overview Dal Cin P

Tenosynovial giant cell tumour, diffuse-type. The variant translocation has been described, structural and numerical abnormalities described are t(1;13)(p36;q14), which fuses PAX7 gene on 1p36 with similar to those observed in localized form, however FOXO1. Tumors with PAX7-FOXO1 gene fusion trisomies for chromosomes 5 and 7 are more frequently transcript show a predilection for younger patients, encountered in the diffuse form of the tumor. appear in the extremities and have a better prognosis. Deep benign fibrous histiocytoma. A An interesting distinctive feature of ARMS with the t(16;17)(p13.3;q21.3) was reported in a single case. PAX7-FOXO1 is that the fusion gene is often Plexiform fibrohistiocytic tumor. No consistent duplicated or amplified. However, 20% of cases have abnormality has been detected among the 3 tumors so neither t(2;13) nor t(1;13). Some of these cases have far reported. variant translocations involving either PAX or FOXO1 Giant cell tumors of the soft tissue. Multiple (e.g., PAX-NCOA1, PAX3-AFX, FOXO1/FGFR1). telomeric associations were reported in single case, like Pleomorphic rhabdomyosarcoma. Highly complex giant cell tumor of the bone. karyotypes have been reported. Disease Spindle cell/sclerosing rhabdomyosarcoma. PAC2/PAX7-FOXO1 fusions are virtually always Smooth muscle tumors absent. Pediatric cases of spindle cell Cytogenetics rhabdomyosarcoma have recently been found to contain fusions of the NCOA2 gene at 8q13, with SRF Leiomyosarcoma. Most karyotypes are complex and or TEAD1. Therefore, this new correlation is not no consistent aberrations have been reported. However, included in the WHO13. Adult spindle cell some common gains or losses of genetic material have rhabdomyosarcoma do not appear to contain NCOA2 been detected by cytogenetic and comparative genomic rearrangement. hybridization (CGH) studies some aberrations may be more related to the site of origin than to the Disease morphologic features of the tumors. Involvement of Vascular tumors TP53, FANCA, RB, PTEN, MYOCD and ROR2 have been reported. Cytogenetics Disease Kaposi sarcoma. No clinically relevant genetic changes have been reported. Pericytic (perivascular) tumors Pseudomyogenic hemangioendothelioma. A single Cytogenetics case with a t(7;19)(q22;q13). Epithelioid hemangioendothelioma. A Myopericytoma, including myofibroma. A small t(1;3)(p36.3;q25) has been associated with a group of tumors considered to fall within the rearrangement between CAMTA1 gene (at 1p36.3) and myopericytic category exhibits a t(7;12)(p22;q13) that WWTR1 gene (at 3q25). This rearrangement has not results in the fusion of ACTB and GLI1 genes. been detected in any of the morphological mimics of Angioleiomyoma. Simple karyotypes with non-random epithelioid hemangioendothelioma, such as structural aberration have been so far reported. hemangioendothelioma, epithelioid Genomic array analysis showed that 22q11.2 is most common lost region, while the most gain is Xq arm. angiosarcoma, or epithelioid sarcoma-like Disease hemangioendothelioma. More recently, and therefore not reported in the WHO13, a small subset of EHE, Skeletal muscle tumors with somewhat different morphology has been found to Cytogenetics harbor TFE3 rearrangement, instead of the WWTR1- Embryonal rhabdomyosarcoma. Complex karyotype CAMTA1 gene fusion. are generally reported, including extra copies of Angiosarcoma of the soft tissue. High level of MYC chromosomes 2, 8 and 13, and rearrangements of 8q24 amplification is a consistent finding in radiation - chromosome 1. However, loss of heterozygosity of induced and lymphoedema -associated angiosarcoma. 11p15 region is found in most of these tumors. Co-amplification of FLT4 (5q35) can be also observed Imprinted tumor suppressor genes i.e. IGF2, H19 and in 25% of secondary angiosarcoma. CDKN1C and HOTS have been suggested as the Disease mechanism of tumorigenesis in these tumors. Several other individual genes have been also implicated in a Chondro-osseous tumors subset of tumor e.g. RB1, TP53, RAS, GLI1, FGFR4, Cytogenetics PIK3CA, CTNNB1, ALK. Soft tissue chondroma. Three subgroups of Alveolar rhabdomyosarcoma. A specific chromosome rearrangements were observed so far: 1) t(2;13)(q35;q14) characterizes this type of rearrangement of 12q13-15, 2) trisomy 5 and 3) loss rhabdomyosarcoma. The genes involved are the PAX3 11q21-qter. Different HMGA2 involvements were gene on 2q35 and the FOXO1 gene on 13q14. A reported on those chondromas with 12q13-q15

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 60 Soft tissue tumors: an overview Dal Cin P

rearrangement, varying from amplification, truncated Disease or full length HMGA2 transcript and HMGA2-LPP Nerve sheath tumors gene fusion transcript. Extraskeletal mesenchymal chondrosarcoma. A Cytogenetics HEY1-NCOA2 gene fusion was detected by a genome- Schwannoma (including variants). Monosomy wide screen of exon-level expression data in soft tissue 22/22q- is the most common chromosome aberration in as well as bone lesions. These genes are only ~10 Mb classic and cellular schwannoma. Both NF2 and apart, and this fusion can be the results of a cryptic SMARCB1 (hSNF5, INI1) have been implicated on the interstitial deletion or paracentric inversion between the tumorigenesis, as "four-hit" or "three-hit". Trisomy 17 8q13.3 and 8q21.1, that can easily be missed by G- has been observed in plexiform cellular variants. banded chromosome analysis. Melanotic schwannoma. Amplification/deletion of Extraskeletal osteosarcoma. No consistent 2p16 region was demonstrated in 80% of lesions in abnormality has been detected among the 3 tumors patient with/without Carney complex. studied to date. Neurofibroma (including variants). Inactivation of Gastrointestinal stromal tumour. Unlike the other both copies of NF1 at 17q11.2 can occur in individuals sarcomas, oncogenic mutations play a central with or without neurofibromatosis type I. 9p deletion pathogenetic role in the gastrointestinal stromal tumors containing CDKN2A, CDKN2B and MTAP has been (GIST), rather than chromosomal rearrangements. frequently detected in localized intraneural and KIT gene at 4q12 is mutated in 80-85% of cases. Most plexiform neurofibromas. mutations are in exons 11 and 9, but mutations in exons Perineurioma. Monosomy 22/22q- is observed in 13 and 17 have also been described. KIT in exon 9 these lesions targeting NF2 tumor suppressor gene. primary mutations often occur in tumors located Additional 10q abnormalities have been identified in predominantly in the small bowel and associated with sclerosing variant. an unfavorable clinical course. Malignant peripheral nerve sheath tumour. A subset of GISTs has mutations in the KIT-related Complex karyotypes have been reported with PDGF receptor-α (PDGFRA) gene (also at 4q12), and numerical and structural rearrangements including: 1p, shows a preference for gastric location, epithelioid 9p21 (CDKN2A), 10p, 11p, 13q14 (RB1), 17p13 morphology, and a more indolent clinical behavior. In (TP53), 17q11.2 (NF1), 22q12.2 (NF2) as the most about 10% of patients, no detectable mutations are frequent chromosomal losses, and 7p, 7q, 8q, and 5q identified in either KIT or PDGFRA are referred to as the most frequent chromosomal gains. These tumours wild-type GIST. A subset of wild-type GIST harbor are associated with bi-allelic inactivation of NF1, but activatiing mutations in BRAF, or loss of succinate their development requires additional mutations in dehydrogenase complex by inactivating mutations. CDKN2A or TP53, both in familial and sporadic cases. The subtype of exon 11 KIT mutations appears to have clinicopathologic relevance in GIST regarding tumor Disease biology- e.g. Exon 11 deletions affecting codons 557 Tumors of uncertain differentiation and 558 predict a poor prognosis, bust most Cytogenetics importantly, predicting reponse to therapy. Imatinib Intramuscular myxoma. No consistent aberrations mesylate (GleevecTM), is a selective tyrosine kinase were observed in the 5 cases so far karyotyped. inhibitor whose targets include KIT, PDGFRA and However, point mutations of GNAS are common in ABL1. these lesions. Imatinib treatment achieves a partial response or stable Juxta-articular myxoma. One single case reported disease in about 80% of patients with metastatic GIST. two unrelated abnormal clones. No GNAS mutations GISTs with KIT exon 11 mutations are potently have been detected so far. inhibited by imatinib, whereas those with KIT exon 9 Deep 'aggressive' angiomyxoma. Abnormalities of mutations are less responsive. chromosome 12 have been reported. The most GISTs with exon 11 mutations are most likely to frequently rearranged chromosome region is 12q13-15 respond to imatinib. However, acquired mutations, and HMGA2 is the target gene either by generation of a especially in exons 13 and 17, may confer secondary fusion transcript or alteration affecting the 3' telomeric resistance to imatinib. untranslated region. Cytogenetically, GISTs show rather simple karyotypes Angiomatoid fibrous histiocytoma. Three different with common losses of chromosomes 14 and 22, in translocations have been described: 1) most cases present as early events, regardless of the t(12;16)(q13;p11) associated with ATF1-FUS fusion, tumor site, clinical outcome, or KIT genotype. 2) t(12;22)(q13;q12) associated with EWSR1-ATF1 Additional chromosomal changes occur preferentially gene fusion and 3) t(2;22)(q34;q12) associated with in high risk and recurrent GIST, including loss of 9p EWSR1-CREB1 gene fusion. Both t(12;22) and t(2;22) and 1p, among others. have also been reported in clear cell sarcoma.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 61 Soft tissue tumors: an overview Dal Cin P

Ossifying fibromyxoid tumor. The PHF1 gene at Ewing sarcoma. The t(11;22)(q24;q12) was the first 6p21, previously shown to be involved in some specific change to be defined in sarcoma. Secondary endometrial stromal tumors, is also recurrently changes i.e. +8, +12 and der(16)t(1;16) were also rearranged in ossifying fibromyxoid lesions classified frequently reported. The t(11;22) is associated with as typical or atypical. Loss of chromosome 22 has been EWSR1-FLI1 fusion gene. However rare variant observed in malignant lesions. translocation have been reported, where the EWSR1 Myoepithelioma/Myoepithelial carcinoma/Mixed gene fuses with different ETS-family gene partners tumour. EWSR1 (22q12) rearrangement have ben such as the ERG gene at 21q22, the ETV1 at 7p22, reported in approximately 50% of cases. The E1AF at 17q12, FEV at 2q23. In addition cases with t(6;22)(p21;q12) involving EWSR1 and POU5F1 genes FUS-ERG or FUS-FEV gene fusions have been also have been identified in a subset of deep seated tumors rarely described. Variability in molecular transcripts of extremities, in children or young adults with distinct has been reported, but the initial reported survival clear cell morphology. The t(1;22)(q23;q12) involving differences are no longer apparent with current EWSR1 and PBX1 genes has been identified in a treatment protocols. Secondary changes i.e. +8, +12, subset of tumors with a deceptively bland appearance, der(16)t(1;16), +20 were also frequently reported. composed mainly of spindle cells embedded in a Clear cell sarcoma of the soft tissue. The fibrotic stroma, resembling in areas desmoid-type t(12;22)(q13;q12) is the more frequent cytogenetic fibromatosis. A third translocation, t(19;22)(q13;q12) change in this type of sarcoma and it is associated with associated with EWSR1 and ZNF444 genes has been EWSR1 (22q12) and ATF1 (12q13) genes. A also identified in less than 2% of the cases, without any t(2;22)(q34;q12) involving EWSR1 and CREB1 genes specific morphology. PLAG1 rearrangement was was detected almost exclusively in tumors of identified in a subset of EWSR1 negative myoepithelial gastrointestinal (GI) tract. However, the clear cell tumors, more often benign, superficially located, and sarcomas in GI tract with either EWSR1-ATF1 or show ductal differentiation supporting a common EWSR1-CREB1 lack melanocytic markers, in contrast pathogenesis with their salivary gland counterparts. to the EWSR1-ATF1 soft tissue clear cell sarcoma. The Hemosiderotic fibrolipomatous tumour. Similar spectrum of tumors with EWSR1-ATF1 and EWSR1- t(1;10)(p22;q24-25) and chromosome aberrations CREB1 gene fusions has further expanded to include involving chromosome 3 with amplification of 3p11.1- angiomatoid fibrous histiocytoma, hyalinizing clear cell 12 have been observed in myxoinflammatory carcinoma of the salivary gland, and primary fibroblastic sarcoma. pulmonary myxoid sarcoma. Synovial sarcoma. A specific t(X;18)(p11.2;q11.2) Extraskeletal myxoid chrondrosarcoma. A specific characterizes both monophasic and biphasic chromosomal abnormality, t(9;22)(q22;q12) morphologic variants. The vast majority of primary characterizes this entity, though variant translocations tumors show a near-diploid karyotype, while the have been also described. Variant translocations have recurring and metastasis lesions carry additional been also reported: t(9;17)(q22;q11) and chromosome aberrations. Involvement of a third (or t(9;15)(q22;q21). All three translocations result in more) chromosome has been reported. The t(X;18) fusion of the NR4A3 (CHN, TEC) gene at 9q22 with results in two gene fusions in which the SYT gene at the EWSR1 gene at 22q12, or with RBP56 gene at 18q11.2 joins either of two closely related genes at 17q11 or with TCF12 gene at 15q21. Xp11.2, designated SSX1 or SSX2. The monophasic Desmoplastic small round cell tumor. A specific variant exhibits SYT-SSX1 or SYT-SSX2 transcripts chromosomal abnormality, t(11;22)(p13;q12) and the majority of the biphasic one SSX1. The characterizes this entity, though variant translocations formation of the respective fusions is generally have been also described. The t(11;22) results in the mutually exclusive and remains constant during the fusions of two chromosomal region previously course of the disease. There is also a moderate implicated in other malignant tumors: the Wilms tumor association of SS18-SSX1 gene fusion type with earlier gene (WT1) localized to 11p13 and the Ewing sarcoma distant recurrence and poorer metastasis-free survival (EWSR1) gene localized to 22q12. in some studies, but not others. Extrarenal rhabdoid tumor. Abnormalities of Epithelioid sarcoma. Complex karyotype, with 22q11- 22q11.2, as translocations and deletions, have been 12 aberrations involving SMARCB1. Gains of 8q, e.g. described in these distinct tumors arising in any part of i(8q), have been observed in both classic and proximal the human body. Mutations and homozygous deletions types. of the SMARCB1 gene have been detected. Alveolar soft part sarcoma. A specific chromosome PEComas. These tumors are seen in the context of the aberration, der(17)t(X;17)(p11;q25), is the hallmark of Tuberous Sclerosis Complex syndrome caused by this sarcoma. This translocation fuses the TFE3 germline mutations in either TSC1 (OMIM: 191100) or transcription factor gene at Xp11.2 to a novel gene at TSC2 (OMIM: 613254). 17q25, designated as ASPL (ASPSCR1 or RCC17). Of Sporadic PEComas often show complex karyotypes interest, the balanced t(X;17)(p11.2;q25) has been also with loss of TSC2. described in renal tumors of young people.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 62 Soft tissue tumors: an overview Dal Cin P

A smaller subset of PEComas, approximately 10%, Kazmierczak B, Dal Cin P, Wanschura S, Borrmann L, Fusco harbors TFE3 fusions, but without TSC2 loss. A, Van den Berghe H, Bullerdiek J. HMGIY is the target of 6p21.3 rearrangements in various benign mesenchymal Intimal sarcoma. Gain and amplification of 12q12-15, tumors. Genes Chromosomes Cancer. 1998 Dec;23(4):279-85 containing CDK4, TSPAN31, MDM2, GLI, and of Versteege I, Sévenet N, Lange J, Rousseau-Merck MF, 4q21 containing PDGFRA and KIT (CD117) are the Ambros P, Handgretinger R, Aurias A, Delattre O. Truncating most constant genetic aberrations detected by CGH. mutations of hSNF5/INI1 in aggressive paediatric cancer. EGFR amplification/polysomy has been also detected. Nature. 1998 Jul 9;394(6689):203-6 Very frequently co-amplification or gains of PDGFRA, Rousseau-Merck MF, Versteege I, Legrand I, Couturier J, EGFR and MDM2 occur. Mairal A, Delattre O, Aurias A. hSNF5/INI1 inactivation is Disease mainly associated with homozygous deletions and mitotic recombinations in rhabdoid tumors. Cancer Res. 1999 Jul Undifferentiated/unclassified sarcomas 1;59(13):3152-6 Cytogenetics Sciot R, Rosai J, Dal Cin P, de Wever I, Fletcher CD, Mandahl N, Mertens F, Mitelman F, Rydholm A, Tallini G, van den Undifferentiated round cell and spindle cell Berghe H, Vanni R, Willén H. Analysis of 35 cases of localized sarcomas. Two different entities have been reported : and diffuse tenosynovial giant cell tumor: a report from the 1) sarcomas with fusions of EWSR1 to non-ETS family Chromosomes and Morphology (CHAMP) study group. Mod transcription factor genes such as SP3, PATZ1, Pathol. 1999 Jun;12(6):576-9 SMARCA5, POU5F1, NFATC2, often as single case; Sciot R, Samson I, van den Berghe H, Van Damme B, Dal Cin 2) Ewing sarcoma-like tumours defined as "EWSR1- P. Collagenous fibroma (desmoplastic fibroblastoma): genetic link with fibroma of tendon sheath? Mod Pathol. 1999 fusion negative". Two distinct genetic events have been Jun;12(6):565-8 so far reported, both arising in children and young adults: a) either CIC-DUX4 gene fusion, resulting from Tejpar S, Nollet F, Li C, Wunder JS, Michils G, dal Cin P, Van Cutsem E, Bapat B, van Roy F, Cassiman JJ, Alman BA. t(4;19)(q35;q13) or t(10;19)(q26.3;q13) or b) a BCOR- Predominance of beta-catenin mutations and beta-catenin CCNB3 gene fusion, as the result of a paracentric dysregulation in sporadic aggressive fibromatosis (desmoid inversion on the short arm (p) of the X-chromosome. tumor). Oncogene. 1999 Nov 11;18(47):6615-20 Undifferentiated pleomorphic sarcoma. High-grade Breiner JA, Meis-Kindblom J, Kindblom LG, McComb E, Liu J, pleomorphic sarcomas, including many tumors Nelson M, Bridge JA. Loss of 14q and 22q in gastrointestinal formerly called MFH, generally have complex and stromal tumors (pacemaker cell tumors). Cancer Genet nondistinctive karyotype and may represent the most Cytogenet. 2000 Jul 15;120(2):111-6 undifferentiated state of other sarcomas. Those De Wever I, Dal Cin P, Fletcher CD, Mandahl N, Mertens F, undifferentiated sarcomas with 12q12-15 amplification Mitelman F, Rosai J, Rydholm A, Sciot R, Tallini G, Van Den Berghe H, Vanni R, Willén H. Cytogenetic, clinical, and including MDM2 and CDK4, are now classified as morphologic correlations in 78 cases of fibromatosis: a report dedifferentiated liposarcoma. from the CHAMP Study Group. CHromosomes And Morphology. Mod Pathol. 2000 Oct;13(10):1080-5 References Debiec-Rychter M, Sciot R, Hagemeijer A. Common chromosome aberrations in the proximal type of epithelioid Bridge JA, Meloni AM, Neff JR, Deboer J, Pickering D, sarcoma. Cancer Genet Cytogenet. 2000 Dec;123(2):133-6 Dalence C, Jeffrey B, Sandberg AA. Deletion 5q in desmoid tumor and fluorescence in situ hybridization for chromosome 8 Dei Tos AP, Doglioni C, Piccinin S, Sciot R, Furlanetto A, and/or 20 copy number. Cancer Genet Cytogenet. 1996 Boiocchi M, Dal Cin P, Maestro R, Fletcher CD, Tallini G. Dec;92(2):150-1 Coordinated expression and amplification of the MDM2, CDK4, and HMGI-C genes in atypical lipomatous tumours. J Pathol. Weber-Hall S, McManus A, Anderson J, Nojima T, Abe S, 2000 Apr;190(5):531-6 Pritchard-Jones K, Shipley J. Novel formation and amplification of the PAX7-FKHR fusion gene in a case of alveolar Hibbard MK, Kozakewich HP, Dal Cin P, Sciot R, Tan X, Xiao rhabdomyosarcoma. Genes Chromosomes Cancer. 1996 S, Fletcher JA. PLAG1 fusion oncogenes in lipoblastoma. Sep;17(1):7-13 Cancer Res. 2000 Sep 1;60(17):4869-72 Sciot R, Akerman M, Dal Cin P, De Wever I, Fletcher CD, Pauwels P, Sciot R, Croiset F, Rutten H, Van den Berghe H, Mandahl N, Mertens F, Mitelman F, Rosai J, Rydholm A, Tallini Dal Cin P. Myofibroblastoma of the breast: genetic link with G, Van den Berghe H, Vanni R, Willen H. Cytogenetic analysis spindle cell lipoma. J Pathol. 2000 Jul;191(3):282-5 of subcutaneous angiolipoma: further evidence supporting its difference from ordinary pure lipomas: a report of the CHAMP Sjögren H, Wedell B, Meis-Kindblom JM, Kindblom LG, Study Group. Am J Surg Pathol. 1997 Apr;21(4):441-4 Stenman G. Fusion of the NH2-terminal domain of the basic helix-loop-helix protein TCF12 to TEC in extraskeletal myxoid Giarola M, Wells D, Mondini P, Pilotti S, Sala P, Azzarelli A, chondrosarcoma with translocation t(9;15)(q22;q21). Cancer Bertario L, Pierotti MA, Delhanty JD, Radice P. Mutations of Res. 2000 Dec 15;60(24):6832-5 adenomatous polyposis coli (APC) gene are uncommon in sporadic desmoid tumours. Br J Cancer. 1998 Sep;78(5):582-7 Waters BL, Panagopoulos I, Allen EF. Genetic characterization of angiomatoid fibrous histiocytoma identifies fusion of the FUS Hirota S, Isozaki K, Moriyama Y, Hashimoto K, Nishida T, and ATF-1 genes induced by a chromosomal translocation Ishiguro S, Kawano K, Hanada M, Kurata A, Takeda M, involving bands 12q13 and 16p11. Cancer Genet Cytogenet. Muhammad Tunio G, Matsuzawa Y, Kanakura Y, Shinomura 2000 Sep;121(2):109-16 Y, Kitamura Y. Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors. Science. 1998 Jan McComb EN, Feely MG, Neff JR, Johansson SL, Nelson M, 23;279(5350):577-80 Bridge JA. Cytogenetic instability, predominantly involving

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 63 Soft tissue tumors: an overview Dal Cin P

chromosome 1, is characteristic of elastofibroma. Cancer Abbeele AD, Druker BJ, Kiese B, Eisenberg B, Roberts PJ, Genet Cytogenet. 2001 Apr 1;126(1):68-72 Singer S, Fletcher CD, Silberman S, Dimitrijevic S, Fletcher JA. Kinase mutations and imatinib response in patients with Mendlick MR, Nelson M, Pickering D, Johansson SL, metastatic gastrointestinal stromal tumor. J Clin Oncol. 2003 Seemayer TA, Neff JR, Vergara G, Rosenthal H, Bridge JA. Dec 1;21(23):4342-9 Translocation t(1;3)(p36.3;q25) is a nonrandom aberration in epithelioid hemangioendothelioma. Am J Surg Pathol. 2001 Sandberg AA, Bridge JA. Updates on the cytogenetics and May;25(5):684-7 molecular genetics of bone and soft tissue tumors. Dermatofibrosarcoma protuberans and giant cell fibroblastoma. Nucci MR, Weremowicz S et al.. Chromosomal translocation Cancer Genet Cytogenet. 2003 Jan 1;140(1):1-12 t(8;12) induces aberrant HMGIC expression in aggressive angiomyxoma of the vulva. Genes Chromosomes Cancer. Shing DC, McMullan DJ, Roberts P, Smith K, Chin SF, 2001 Oct;32(2):172-6 Nicholson J, Tillman RM, Ramani P, Cullinane C, Coleman N. FUS/ERG gene fusions in Ewing's tumors. Cancer Res. 2003 Parham DM. Pathologic classification of rhabdomyosarcomas Aug 1;63(15):4568-76 and correlations with molecular studies. Mod Pathol. 2001 May;14(5):506-14 Storlazzi CT, Mertens F, Nascimento A, Isaksson M, Wejde J, Brosjo O, Mandahl N, Panagopoulos I. Fusion of the FUS and Rubin BP, Dal Cin P. The genetics of lipomatous tumors. BBF2H7 genes in low grade fibromyxoid sarcoma. Hum Mol Semin Diagn Pathol. 2001 Nov;18(4):286-93 Genet. 2003 Sep 15;12(18):2349-58 Sandberg AA, Bridge JA. Updates on the cytogenetics and Wardelmann E, Losen I, Hans V, Neidt I, Speidel N, Bierhoff E, molecular genetics of bone and soft tissue tumors: clear cell Heinicke T, Pietsch T, Büttner R, Merkelbach-Bruse S. sarcoma (malignant melanoma of soft parts). Cancer Genet Deletion of Trp-557 and Lys-558 in the juxtamembrane domain Cytogenet. 2001 Oct 1;130(1):1-7 of the c-kit protooncogene is associated with metastatic Demetri GD, von Mehren M, Blanke CD, Van den Abbeele AD, behavior of gastrointestinal stromal tumors. Int J Cancer. 2003 Eisenberg B, Roberts PJ, Heinrich MC, Tuveson DA, Singer S, Oct 10;106(6):887-95 Janicek M, Fletcher JA, Silverman SG, Silberman SL, Dahlén A, Fletcher CD, Mertens F, Fletcher JA, Perez-Atayde Capdeville R, Kiese B, Peng B, Dimitrijevic S, Druker BJ, AR, Hicks MJ, Debiec-Rychter M, Sciot R, Wejde J, Wedin R, Corless C, Fletcher CD, Joensuu H. Efficacy and safety of Mandahl N, Panagopoulos I. Activation of the GLI oncogene imatinib mesylate in advanced gastrointestinal stromal tumors. through fusion with the beta-actin gene (ACTB) in a group of N Engl J Med. 2002 Aug 15;347(7):472-80 distinctive pericytic neoplasms: pericytoma with t(7;12). Am J Ladanyi M, Antonescu CR, Leung DH, Woodruff JM, Kawai A, Pathol. 2004 May;164(5):1645-53 Healey JH, Brennan MF, Bridge JA, Neff JR, Barr FG, Debiec-Rychter M, Dumez H, Judson I, Wasag B, Verweij J, Goldsmith JD, Brooks JS, Goldblum JR, Ali SZ, Shipley J, Brown M, Dimitrijevic S, Sciot R, Stul M, Vranck H, Scurr M, Cooper CS, Fisher C, Skytting B, Larsson O. Impact of SYT- Hagemeijer A, van Glabbeke M, van Oosterom AT. Use of c- SSX fusion type on the clinical behavior of synovial sarcoma: a KIT/PDGFRA mutational analysis to predict the clinical multi-institutional retrospective study of 243 patients. Cancer response to imatinib in patients with advanced gastrointestinal Res. 2002 Jan 1;62(1):135-40 stromal tumours entered on phase I and II studies of the Nilsson M, Höglund M, Panagopoulos I, Sciot R, Dal Cin P, EORTC Soft Tissue and Bone Sarcoma Group. Eur J Cancer. Debiec-Rychter M, Mertens F, Mandahl N. Molecular 2004 Mar;40(5):689-95 cytogenetic mapping of recurrent chromosomal breakpoints in Lasota J, Dansonka-Mieszkowska A, Sobin LH, Miettinen M. A tenosynovial giant cell tumors. Virchows Arch. 2002 great majority of GISTs with PDGFRA mutations represent Nov;441(5):475-80 gastric tumors of low or no malignant potential. Lab Invest. Raddaoui E, Donner LR, Panagopoulos I. Fusion of the FUS 2004 Jul;84(7):874-83 and ATF1 genes in a large, deep-seated angiomatoid fibrous Wardelmann E, Hrychyk A, Merkelbach-Bruse S, Pauls K, histiocytoma. Diagn Mol Pathol. 2002 Sep;11(3):157-62 Goldstein J, Hohenberger P, Losen I, Manegold C, Büttner R, Sandberg AA, Bridge JA. Updates on the cytogenetics and Pietsch T. Association of platelet-derived growth factor molecular genetics of bone and soft tissue tumors: congenital receptor alpha mutations with gastric primary site and (infantile) fibrosarcoma and mesoblastic nephroma. Cancer epithelioid or mixed cell morphology in gastrointestinal stromal Genet Cytogenet. 2002 Jan 1;132(1):1-13 tumors. J Mol Diagn. 2004 Aug;6(3):197-204 Sandberg AA, Bridge JA. Updates on the cytogenetics and Martín J, Poveda A, Llombart-Bosch A, Ramos R, López- molecular genetics of bone and soft tissue tumors. Synovial Guerrero JA, García del Muro J, Maurel J, Calabuig S, sarcoma. Cancer Genet Cytogenet. 2002 Feb;133(1):1-23 Gutierrez A, González de Sande JL, Martínez J, De Juan A, Laínez N, Losa F, Alija V, Escudero P, Casado A, García P, Sandberg AA, Bridge JA. Updates on the cytogenetics and Blanco R, Buesa JM. Deletions affecting codons 557-558 of molecular genetics of bone and soft tissue tumors. the c-KIT gene indicate a poor prognosis in patients with desmoplastic small round-cell tumors. Cancer Genet completely resected gastrointestinal stromal tumors: a study by Cytogenet. 2002 Oct 1;138(1):1-10 the Spanish Group for Sarcoma Research (GEIS). J Clin Oncol. 2005 Sep 1;23(25):6190-8 Dahlén A, Mertens F, Rydholm A, Brosjö O, Wejde J, Mandahl N, Panagopoulos I. Fusion, disruption, and expression of Parham DM, Ellison DA. Rhabdomyosarcomas in adults and HMGA2 in bone and soft tissue chondromas. Mod Pathol. children: an update. Arch Pathol Lab Med. 2006 2003 Nov;16(11):1132-40 Oct;130(10):1454-65 Heinrich MC, Corless CL, Duensing A, McGreevey L, Chen CJ, West RB, Rubin BP, Miller MA, Subramanian S, Kaygusuz G, Joseph N, Singer S, Griffith DJ, Haley A, Town A, Demetri GD, Montgomery K, Zhu S, Marinelli RJ, De Luca A, Downs-Kelly Fletcher CD, Fletcher JA. PDGFRA activating mutations in E, Goldblum JR, Corless CL, Brown PO, Gilks CB, Nielsen TO, gastrointestinal stromal tumors. Science. 2003 Jan Huntsman D, van de Rijn M. A landscape effect in tenosynovial 31;299(5607):708-10 giant-cell tumor from activation of CSF1 expression by a translocation in a minority of tumor cells. Proc Natl Acad Sci U Heinrich MC, Corless CL, Demetri GD, Blanke CD, von S A. 2006 Jan 17;103(3):690-5 Mehren M, Joensuu H, McGreevey LS, Chen CJ, Van den

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 64 Soft tissue tumors: an overview Dal Cin P

Antonescu CR, Dal Cin P, Nafa K, Teot LA, Surti U, Fletcher Sumegi J, Streblow R, Frayer RW, Dal Cin P, Rosenberg A, CD, Ladanyi M. EWSR1-CREB1 is the predominant gene Meloni-Ehrig A, Bridge JA. Recurrent t(2;2) and t(2;8) fusion in angiomatoid fibrous histiocytoma. Genes translocations in rhabdomyosarcoma without the canonical Chromosomes Cancer. 2007 Dec;46(12):1051-60 PAX-FOXO1 fuse PAX3 to members of the nuclear receptor transcriptional coactivator family. Genes Chromosomes Guillou L, Benhattar J, Gengler C, Gallagher G, Ranchère- Cancer. 2010 Mar;49(3):224-36 Vince D, Collin F, Terrier P, Terrier-Lacombe MJ, Leroux A, Marquès B, Aubain Somerhausen Nde S, Keslair F, Pedeutour van Doorninck JA, Ji L, Schaub B, Shimada H, Wing MR, F, Coindre JM. Translocation-positive low-grade fibromyxoid Krailo MD, Lessnick SL, Marina N, Triche TJ, Sposto R, sarcoma: clinicopathologic and molecular analysis of a series Womer RB, Lawlor ER. Current treatment protocols have expanding the morphologic spectrum and suggesting potential eliminated the prognostic advantage of type 1 fusions in Ewing relationship to sclerosing epithelioid fibrosarcoma: a study from sarcoma: a report from the Children's Oncology Group. J Clin the French Sarcoma Group. Am J Surg Pathol. 2007 Oncol. 2010 Apr 20;28(12):1989-94 Sep;31(9):1387-402 Williamson D, Missiaglia E, de Reyniès A, Pierron G, Thuille B, Pan CC, Chung MY, Ng KF, Liu CY, Wang JS, Chai CY, Palenzuela G, Thway K, Orbach D, Laé M, Fréneaux P, Huang SH, Chen PC, Ho DM. Constant allelic alteration on Pritchard-Jones K, Oberlin O, Shipley J, chromosome 16p (TSC2 gene) in perivascular epithelioid cell tumour (PEComa): genetic evidence for the relationship of Delattre O. Fusion gene-negative alveolar rhabdomyosarcoma PEComa with angiomyolipoma. J Pathol. 2008 is clinically and molecularly indistinguishable from embryonal Feb;214(3):387-93 rhabdomyosarcoma. J Clin Oncol. 2010 May 1;28(13):2151-8 Hallor KH, Sciot R, Staaf J, Heidenblad M, Rydholm A, Bauer Erickson-Johnson MR, Chou MM, Evers BR, Roth CW, Seys HC, Aström K, Domanski HA, Meis JM, Kindblom LG, AR, Jin L, Ye Y, Lau AW, Wang X, Oliveira AM. Nodular Panagopoulos I, Mandahl N, Mertens F. Two genetic fasciitis: a novel model of transient neoplasia induced by pathways, t(1;10) and amplification of 3p11-12, in MYH9-USP6 gene fusion. Lab Invest. 2011 Oct;91(10):1427- myxoinflammatory fibroblastic sarcoma, haemosiderotic 33 fibrolipomatous tumour, and morphologically similar lesions. J Errani C, Zhang L, Sung YS, Hajdu M, Singer S, Maki RG, Pathol. 2009 Apr;217(5):716-27 Healey JH, Antonescu CR. A novel WWTR1-CAMTA1 gene Snyder EL, Sandstrom DJ, Law K, Fiore C, Sicinska E, Brito J, fusion is a consistent abnormality in epithelioid Bailey D, Fletcher JA, Loda M, Rodig SJ, Dal Cin P, Fletcher hemangioendothelioma of different anatomic sites. Genes CD. c-Jun amplification and overexpression are oncogenic in Chromosomes Cancer. 2011 Aug;50(8):644-53 liposarcoma but not always sufficient to inhibit the adipocytic Guo T, Zhang L, Chang NE, Singer S, Maki RG, Antonescu differentiation programme. J Pathol. 2009 Jul;218(3):292-300 CR. Consistent MYC and FLT4 gene amplification in radiation- Antonescu CR, Zhang L, Chang NE, Pawel BR, Travis W, induced angiosarcoma but not in other radiation-associated Katabi N, Edelman M, Rosenberg AE, Nielsen GP, Dal Cin P, atypical vascular lesions. Genes Chromosomes Cancer. 2011 Fletcher CD. EWSR1-POU5F1 fusion in soft tissue Jan;50(1):25-33 myoepithelial tumors. A molecular analysis of sixty-six cases, Mariño-Enríquez A, Wang WL, Roy A, Lopez-Terrada D, Lazar including soft tissue, bone, and visceral lesions, showing AJ, Fletcher CD, Coffin CM, Hornick JL. Epithelioid common involvement of the EWSR1 gene. Genes inflammatory myofibroblastic sarcoma: An aggressive intra- Chromosomes Cancer. 2010 Dec;49(12):1114-24 abdominal variant of inflammatory myofibroblastic tumor with Butrynski JE, D'Adamo DR, Hornick JL, Dal Cin P, Antonescu nuclear membrane or perinuclear ALK. Am J Surg Pathol. CR, Jhanwar SC, Ladanyi M, Capelletti M, Rodig SJ, Ramaiya 2011 Jan;35(1):135-44 N, Kwak EL, Clark JW, Wilner KD, Christensen JG, Jänne PA, Sankar S, Lessnick SL. Promiscuous partnerships in Ewing's Maki RG, Demetri GD, Shapiro GI. Crizotinib in ALK- sarcoma. Cancer Genet. 2011 Jul;204(7):351-65 rearranged inflammatory myofibroblastic tumor. N Engl J Med. 2010 Oct 28;363(18):1727-33 Tanas MR, Sboner A, Oliveira AM, Erickson-Johnson MR, Hespelt J, Hanwright PJ, Flanagan J, Luo Y, Fenwick K, Coindre JM, Pédeutour F, Aurias A. Well-differentiated and Natrajan R, Mitsopoulos C, Zvelebil M, Hoch BL, Weiss SW, dedifferentiated liposarcomas. Virchows Arch. 2010 Debiec-Rychter M, Sciot R, West RB, Lazar AJ, Ashworth A, Feb;456(2):167-79 Reis-Filho JS, Lord CJ, Gerstein MB, Rubin MA, Rubin BP. Guillou L, Aurias A. Soft tissue sarcomas with complex Identification of a disease-defining gene fusion in epithelioid genomic profiles. Virchows Arch. 2010 Feb;456(2):201-17 hemangioendothelioma. Sci Transl Med. 2011 Aug 31;3(98):98ra82 Huang D, Sumegi J, Dal Cin P, Reith JD, Yasuda T, Nelson M, Muirhead D, Bridge JA. C11orf95-MKL2 is the resulting fusion Bahrami A, Dalton JD, Krane JF, Fletcher CD. A subset of oncogene of t(11;16)(q13;p13) in chondroid lipoma. Genes cutaneous and soft tissue mixed tumors are genetically linked Chromosomes Cancer. 2010 Sep;49(9):810-8 to their salivary gland counterpart. Genes Chromosomes Cancer. 2012 Feb;51(2):140-8 Nord KH, Magnusson L, Isaksson M, Nilsson J, Lilljebjörn H, Domanski HA, Kindblom LG, Mandahl N, Mertens F. Doyle LA, Wang WL, Dal Cin P, Lopez-Terrada D, Mertens F, Concomitant deletions of tumor suppressor genes MEN1 and Lazar AJ, Fletcher CD, Hornick JL. MUC4 is a sensitive and AIP are essential for the pathogenesis of the brown fat tumor extremely useful marker for sclerosing epithelioid hibernoma. Proc Natl Acad Sci U S A. 2010 Dec fibrosarcoma: association with FUS gene rearrangement. Am J 7;107(49):21122-7 Surg Pathol. 2012 Oct;36(10):1444-51 Rutkowski P, Van Glabbeke M, Rankin CJ, Ruka W, Rubin BP, Gebre-Medhin S, Nord KH, Möller E, Mandahl N, Magnusson Debiec-Rychter M, Lazar A, Gelderblom H, Sciot R, Lopez- L, Nilsson J, Jo VY, Vult von Steyern F, Brosjö O, Larsson O, Terrada D, Hohenberger P, van Oosterom AT, Schuetze SM. Domanski HA, Sciot R, Debiec-Rychter M, Fletcher CD, Imatinib mesylate in advanced dermatofibrosarcoma Mertens F. Recurrent rearrangement of the PHF1 gene in protuberans: pooled analysis of two phase II clinical trials. J ossifying fibromyxoid tumors. Am J Pathol. 2012 Clin Oncol. 2010 Apr 1;28(10):1772-9 Sep;181(3):1069-77

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 65 Soft tissue tumors: an overview Dal Cin P

Italiano A, Sung YS, Zhang L, Singer S, Maki RG, Coindre JM, Antonescu CR, Zhang L, Shao SY, Mosquera JM, Weinreb I, Antonescu CR. High prevalence of CIC fusion with double- Katabi N, Fletcher CD. Frequent PLAG1 gene rearrangements homeobox (DUX4) transcription factors in EWSR1-negative in skin and soft tissue myoepithelioma with ductal undifferentiated small blue round cell sarcomas. Genes differentiation. Genes Chromosomes Cancer. 2013 Chromosomes Cancer. 2012 Mar;51(3):207-18 Jul;52(7):675-82 Jin Y, Möller E, Nord KH, Mandahl N, Von Steyern FV, Bianchini L, Birtwisle L, Saâda E, Bazin A, Long E, Roussel JF, Domanski HA, Mariño-Enríquez A, Magnusson L, Nilsson J, Michiels JF, Forest F, Dani C, Myklebost O, Birtwisle-Peyrottes Sciot R, Fletcher CD, Debiec-Rychter M, Mertens F. Fusion of I, Pedeutour F. Identification of PPAP2B as a novel recurrent the AHRR and NCOA2 genes through a recurrent translocation translocation partner gene of HMGA2 in lipomas. Genes t(5;8)(p15;q13) in soft tissue angiofibroma results in Chromosomes Cancer. 2013 Jun;52(6):580-90 upregulation of aryl hydrocarbon receptor target genes. Genes Chromosomes Cancer. 2012 May;51(5):510-20 Chmielecki J, Crago AM, Rosenberg M, O'Connor R, Walker SR, Ambrogio L, Auclair D, McKenna A, Heinrich MC, Frank Malinowska I, Kwiatkowski DJ, Weiss S, Martignoni G, Netto DA, Meyerson M. Whole-exome sequencing identifies a G, Argani P. Perivascular epithelioid cell tumors (PEComas) recurrent NAB2-STAT6 fusion in solitary fibrous tumors. Nat harboring TFE3 gene rearrangements lack the TSC2 Genet. 2013 Feb;45(2):131-2 alterations characteristic of conventional PEComas: further evidence for a biological distinction. Am J Surg Pathol. 2012 Fletcher CDM, Bridge JA, Hogerdoorn PCW, Mertens F.. May;36(5):783-4 World Health Organization: Classification of Tumours. Pathology and Genetics of Tumours of Soft Tissue and Bone. Missiaglia E, Williamson D, Chisholm J, Wirapati P, Pierron G, IARC Press: Lyon 2013. Petel F, Concordet JP, Thway K, Oberlin O, Pritchard-Jones K, Delattre O, Delorenzi M, Shipley J. PAX3/FOXO1 fusion gene Jo VY, Antonescu CR, Zhang L, Dal Cin P, Hornick JL, status is the key prognostic molecular marker in Fletcher CD.. Cutaneous syncytial myoepithelioma: rhabdomyosarcoma and significantly improves current risk clinicopathologic characterization in a series of 38 cases. Am J stratification. J Clin Oncol. 2012 May 10;30(14):1670-7 Surg Pathol. 2013 May;37(5):710-8. doi: 10.1097/PAS.0b013e3182772bba. Pierron G, Tirode F, Lucchesi C, Reynaud S, Ballet S, Cohen- Gogo S, Perrin V, Coindre JM, Delattre O. A new subtype of Mosquera JM, Sboner A, Zhang L, Kitabayashi N, Chen CL, bone sarcoma defined by BCOR-CCNB3 gene fusion. Nat Sung YS, Wexler LH, LaQuaglia MP, Edelman M, Genet. 2012 Mar 4;44(4):461-6 Sreekantaiah C, Rubin MA, Antonescu CR.. Recurrent NCOA2 gene rearrangements in congenital/infantile spindle cell Wang L, Motoi T, Khanin R, Olshen A, Mertens F, Bridge J, rhabdomyosarcoma. Genes Chromosomes Cancer. 2013 Dal Cin P, Antonescu CR, Singer S, Hameed M, Bovee JV, Jun;52(6):538-50. doi: 10.1002/gcc.22050. Epub 2013 Mar 5. Hogendoorn PC, Socci N, Ladanyi M. Identification of a novel, recurrent HEY1-NCOA2 fusion in mesenchymal Robinson DR, Wu YM, Kalyana-Sundaram S et al.. chondrosarcoma based on a genome-wide screen of exon- Identification of recurrent NAB2-STAT6 gene fusions in solitary level expression data. Genes Chromosomes Cancer. 2012 fibrous tumor by integrative sequencing. Nat Genet. 2013 Feb;51(2):127-39 Feb;45(2):180-5. doi: 10.1038/ng.2509. Epub 2013 Jan 13. Antonescu CR, Le Loarer F, Mosquera JM, Sboner A, Zhang This article should be referenced as such: L, Chen CL, Chen HW, Pathan N, Krausz T, Dickson BC, Weinreb I, Rubin MA, Hameed M, Fletcher CD. Novel YAP1- Dal Cin P. Soft tissue tumors: an overview. Atlas Genet TFE3 fusion defines a distinct subset of epithelioid Cytogenet Oncol Haematol. 2014; 18(1):57-66. hemangioendothelioma. Genes Chromosomes Cancer. 2013 Aug;52(8):775-84

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 66 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Deep Insight Section

Cell cycle, checkpoints and cancer Laura Carrassa Laboratory of Molecular Pharmacology Department of Oncology, IRCCS - Istituto di Ricerche Farmacologiche Mario Negri Via La Masa 19, 20156 Milan, Italy (LC)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Deep/CellCycleandCancerID20123.html DOI: 10.4267/2042/52080 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Deep insight on cell cycle, checkpoints and cancer.

Introduction S and G2 phases represent the interphase of a proliferating cell and constitute the time lapse between Maintenance of genomic integrity is a pre-requisite for two consecutive mitoses. The differentiated cells that a safe and long lasting life and prevents development of do not proliferate enter in the so called G0 phase which diseases associated with genomic instability such as is a steady state phase or resting phase (Vermeulen et cancer. DNA is constantly subjected and damaged by a al., 2003). large variety of chemical and physical agents, thus cells The progression of a cell through the cell cycle is had to set up a number of surveillance mechanisms that strictly regulated by key regulatory proteins called constantly monitor the DNA integrity and the cell cycle CDK (cyclin dependent kinase) which avoid the progression and in the presence of any type of DNA initiation of a cell cycle phase before the completion of damage activate pathways that lead to cell cycle the preceding one. The cdks are a family of checkpoints, DNA repair, apoptosis and transcription. serine/threonine protein kinases that are activated at In recent years checkpoint pathways have been specific points of the cell cycle consisting of a catalytic elucidated as an integral part of the DNA damage subunit with a low intrinsic enzymatic activity and of a response and in fact dysfunctions or mutations of these fundamental positive regulatory subunit called cyclin pathways are important in the pathogenesis of (Pavletich, 1999). Cyclin protein levels rise and fall malignant tumors. Understanding the molecular during the cell cycle, activating the corresponding cdk, mechanisms regulating the cell cycle progression and whereas the cdk protein levels are kept constant checkpoints and how these processes are altered in throughout the cell cycle. Once the complex cdk-cyclin malignant cells may be crucial to better define the is formed, it gets activated by the protein CAK (cdk events behind such a complex and devastating desease activating protein) which phosphorylates the complex like cancer (Poehlmann and Roessner, 2010; ensuring the subsequent phosphorylation of target gene Vermeulen et al., 2003; Aarts et al., 2013; Kastan and products required for the progression of the cell Bartek, 2004). through the cell cycle (Morgan, 1995). When quiescent Cell cycle regulation cells are stimulated by mitogen signals, CDK4 and The cell cycle is a succession of very well organized CDK6 are activated by association with D type cyclins. molecular events that give the ability to the cell to These above cited cdk-cyclin complexes are important produce the exact itself's copy. The DNA replication for the progression through the G1 phase and the and the segregation of replicated chromosomes are the restriction point preparing the cell to the replicative main events of the cell cycle. The DNA replication phase by phosphorylating the oncosuppressor protein occurs during the so called S phase (synthetic phase) pRb which causes the activation of the E2F family which is preceded by the DNA synthesis preparatory transcription factors. The activation of CDK4 and phase (Gap1 or G1 phase), whereas the nuclear division CDK6 is followed by the subsequent activation of occurs in mitosis (M phase) and is preceded by the CDK2 by cyclin E and cyclin A, which in turn initiates mitotic preparatory phase (gap 2 or G2 phase). The G1, DNA replication. As the DNA replication process

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 67 Cell cycle, checkpoints and cancer Carrassa L

finishes, the Cdk1/cyclin B complex is activated regulatory phosphorylation of Cdk1 prevents premature leading to mitosis (Vermeulen et al., 2003; Sherr and phosphorylation of mitotic targets and the entry in Roberts, 1999). Until the end of G2 phase, CDK1 is mitosis (Yang et al., 1998). Other examples are the phos-phorylated at Thr14 and Tyr15 by the kinases CDK inactivating kinases Wee1 and Myt1 located WEE1 and MYT1, resulting in inhibition of cyclin B- respectively in the nucleus and Golgi complex CDK1 activity. Mitotic entry is ultimately initiated by protecting the cells from premature mitosis and the 14- depho-sphorylation of these residues by the CDC25 3-3 group of proteins that regulate the intracellular family of phosphatases, initiating a positive feedback trafficking of different proteins such as the phosphatase loop that stimulates cyclin B-CDK1 activity and entry Cdc25C (Peng et al., 1997). The above mentioned into mitosis (Lindqvist et al., 2009). The activation events are very well monitored by signaling pathways status of the cdk-cyclin complexes is also monitored by called checkpoints which constantly make sure that negative regulation of the ATP binding site by upstream events are successfully completed before the phosphorylation in specific residues and subsequent initiation of the next phase. It's in fact important that reactivation by specific phosphatases which alterations in duplication of the DNA during S phase do dephosphorylate the same residues. Inhibitory proteins not occur, to avoid the segregation of aberrant genetic also contribute to negatively regulate the cdks by material to the daughter cells hence ensuring accurate forming either binary complexes with cdks or ternary genetic information's transmission throughout cellular complexes with cyclin cdk dimers (figure 1). Three generations. Lack of fidelity in cell cycle processes distinct families of these so called cyclin dependent creates a situation of genetic instability which kinase inhibitors (CKI) can be distinguished. The first contributes to the development of cancer desease. In one is called INK family and is composed by four cancer, the genetic control of cell division is altered members: p15, p16, p18 and p19. They mainly regulate resulting in a massive cell proliferation. Mutations the G1-S transition of the cell cycle targeting to CDK4 mainly occur in two classes of genes: proto-oncogenes and CDK6 by binding the cdk subunit and causing a and tumor suppressor genes. conformational change of the kinases which become In normal cells the proto oncogenes products act at inactive precluding the cyclin binding. The second different levels in pathways that stimulate proper cell family of inhibitors is the Cip/Kip family and consists proliferation while the mutated proto-oncogenes or of three members: p21 cip1 , p27 kip1 and p57 kip2 . The oncogenes can promote tumor growth due to components of this group negatively regulate the uncontrolled cell proliferation. Tumor-suppressor genes cdk2/cyclinA and cdk2/cyclinE complexes whereas normally keep cell numbers down, either by halting the they positively regulate the cdk4/6 cyclinD complexes cell cycle and thereby preventing cellular division or by by facilitating and stabilizing the association of cyclin promoting programmed cell death. When these genes and CDKs. The final class of inhibitors is the pRb are rendered non-functional through mutation, the cell protein family which consists of two members: p107 becomes malignant. Defective proto-oncogenes and and p130. These proteins, better known as tumor-suppressor genes act similarly at a physiologic transcriptional inhibitors, act as potent cyclin E/A-cdk2 level: they promote the inception of cancer by inhibitors by binding both to cyclin and to cdk sites increasing tumor cell number through the stimulation (Vermeulen et al., 2003; Cobrinik, 2005). of cell division or the inhibition of cell death or cell An additional level of cdk regulation is the control of cycle arrest. Uncontrolled cell proliferation which nuclear import/export which can be easily exemplified evolves in cancer can occur through mutation of by the cyclinB1-Cdk1 complex that is kept out of the proteins important at different levels of the cell cycle nucleus through an active nuclear export until late G2, such as CDK, cyclins, CKI and CDK substrates. when the nuclear exporting signals are inactivated by Defects in cell cycle checkpoints can also result in gene phosphorylation ensuring nuclear accumulation. The mutations, chromosome damages and aneuploidy all of regulation of the Cdk1-cyclinB1 complex via which can contribute to tumorigenesis. cytoplasmic sequestration together with the negative

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 68 Cell cycle, checkpoints and cancer Carrassa L

Figure 1. Schematic summary of the levels of regulation of the cyclin dependent kinases (Cdk). 1 and 2. Synthesis and degradation of cyclins at specific stages of the cell cycle. 3. Association of cdks to cyclins in order to be active. 4. Activation of the cdk/cyclin complexes by CAK. 5. Inactivation of cdk/cyclin complexes by phosphorylation at thr14 and tyr15 (5a) and reactivation by phosphatases acting on these sites (5b). 6. Cdk inhibitor proteins (CKI) preventing either the assembly of cdk/cyclin complexes (6a) or the activation of the cdk in the complex (6b). The activated cdk/cyclin complexes can phosphorylate substrates necessary for transition to the next cell cycle phase.

Targeting cell cycle regulators in mutation, silencing by methylation or homozygous deletion of CDKN2A (encoding p14ARF and cancer p16INK4A) (Pinyol et al., 1997). Elevated levels of Cyclins and their associated cyclin-dependent kinases phosphorylated RB and relatively low levels of (CDKs) are the key drivers of the cell cycle and p16INK4A may provide biomarkers of CDK4/6 specific transitions in the cell cycle are controlled dependence (Konecny et al., 2011). Mouse double solely by specific CDKs. When this specificity is knockout studies of CDK4 and CDK6 suggest that the maintained in tumour cells, selective inhibition of these CDK4/6 kinases are only essential in specific tissue kinases presents a potential attractive strategy to compartments (Malumbres et al., 2004), presenting a tumour therapy, suggesting that a therapeutic window therapeutic window where tumour cells are more could be achieved. In normal cells, commitment for the reliant on CDK4/6 than many proliferating normal progression through the cell cycle and beginning of tissues. CDK4/6 inhibition has great promise for the replication process is controlled by cyclin D-CDK4/6 at treatment of multiple cancer types, and multiple clinical the restriction point (Musgrove et al., 2011). CDK4 and studies are ongoing. CDK6 initiate the phosphorylation of the Cyclin B-CDK1 activity, as mentioned before, governs retinoblastoma (RB) protein family, resulting in mitotic entry and is tightly controlled by an intricate dissociation and thereby activation of E2F transcription network of feedback loops (Lindqvist et al., 2009). A factors which initiate the S phase gene expression number of potential issues make CDK1 a less attractive program, including the expression of both cyclin E and target than CDK4/6. CDK1 is essential for mitosis in CDK2, resulting in further RB phosphorylation and most normal cells, which may limit the ability to dose ultimately S phase entry (Malumbres and Barbacid, CDK1 inhibitors in the clinic. If CDK1 inhibition 2009). Deregulation of the restriction point is a causes a reversible G2 arrest in cancer cells, it is common event in cancer, yet CDK4/6 is a potential unclear whether a CDK1 inhibitor could be dosed therapeutic target in only a subset of cancers. Many sufficiently to achieve tumour control and studies are oncogenes overcome the restriction point by promoting undergoing. Polo-like kinase 1 (PLK1) and Aurora CDK4/6 activity (Huillard et al., 2012). CDK4 can be kinase A (AURKA), promote progression through activated more directly by point mutation/amplification mitosis. Inhibition of these kinases presents a potential or via amplification of CCND1 (cyclin D1) (Curtis et therapeutic opportunity through inhibiting appropriate al., 2012; Kim and Diehl, 2009), or indirectly via progression through mitosis. PLK1 is a serine/threonine

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 69 Cell cycle, checkpoints and cancer Carrassa L

kinase involved in centrosome maturation, spindle strand crosslinks. Inhibitors of DNA topoisomerase can formation, chromosome segregation and cytokinesis cause DNA lesions leading to enhanced single or (Strebhardt, 2010). Besides its mitotic functions, PLK1 double strand is essential for inactivating or removing key break depending on which topisomerase is inhibited components of the DNA damage response, such as and on the phase of the cell cycle. Different CHK1 (via Claspin), WEE1 and 53BP1, to inactivate mechanisms are required to repair the damage to the checkpoint signalling and promote cell cycle DNA backbone or to the DNA bases and the repairing resumption (Strebhardt, 2010). Inhibition of PLK1 mechanisms may also vary depending on the different causes cells to arrest in mitosis with a monopolar or phases of the cell cycle. disorganised spindle followed by mitotic cell death The DNA damage checkpoint activation pathway is the (Lens et al., 2010). The Aurora kinase family members response to a variety of internal factors (e.g. incomplete (A, B and C) each coordinate distinct processes during DNA replication due to stalled replication forks, cell division. AURKA is critical for centrosome reactive oxygen species-ROS) and external sources maturation and proper formation of the mitotic spindle. (e.g. UV light, ionizing radiation-IR, DNA-damaging Selective inhibition of AURKA leads to abnormal chemotherapeutic agents). mitotic spindles and a temporary mitotic arrest The checkpoint activation is part of the signaling followed by chromosome segregation errors as cells network (the DNA damage response) that involves exit mitosis. The amplification and overexpression of multiple pathways including checkpoints, DNA repair, AURKA has been reported in many human tumours, transcriptional regulation and apoptosis (Bartek and including breast, colon, neuroblastoma, pancreatic and Lukas, 2007; Branzei and Foiani, 2008). ovarian cancers, with high AURKA expression levels When DNA damage occurs, a signal transduction being associated with poor prognosis and genomic pathway cascade is activated in which sensor proteins instability (Lens et al., 2010). This makes AURKA an recognize the damage and transmit signals that are attractive anti-mitotic drug target and as in fact, amplified and propagated by adaptors/mediators to the AURKA inhibitors are currently being evaluated pre- downstream effectors that connect the checkpoint with clinically and in clinical trials. Clinical data with the cell cycle machinery and final cell fate. mitotic kinase inhibitors have not yet been really Generally the cell cycle progression is hampered at the promising. The AURKA-selective inhibitor MLN8237 stage in the cell cycle where the cell was at the time of (alisertib) had low levels of activity in a phase II study injury: before entry in S phase (G1/S phase in unselected ovarian cancer (Matulonis et al., 2012), checkpoint), during S phase progression (intra S phase and only modest activity was seen in initial clinical or S phase checkpoint), before mitotic entry (G2/M trials of PLK1 inhibitors (Olmos et al., 2011). phase checkpoint) or during mitosis (mitotic spindle However, none of these studies have yet selected for checkpoint). potentially sensitive tumours, so further insights in The cell cycle arrest gives cell time to fix the damage determining the most responsive tumors are required in by activating a series of DNA repair pathways. If the future trials. damage exceeds the capacity for repair, pathways leading to cell death are activated mostly by apoptosis DNA damage checkpoint (by p-53 dependent and independent pathways) (Zhou A faithful transmission of genetic informations from and Elledge, 2000). one cell to its daughters requires the ability of a cell to Chk1 protein kinase is one of the main component of survive to spontaneous and induced DNA damage to DNA damage checkpoints pathways and represent a minimize the number of heritable mutations. To vital link between the upstream sensors of the achieve this fidelity, cells have evolved surveillance checkpoints (i.e. ATM and ATR) and the cell cycle mechanisms composed by an intricate network of engine (i.e. cdk/cyclins) (Zhou and Elledge, 2000; checkpoint proteins that tells the cell to stop or delay Stracker et al., 2009). the cell cycle progression providing enough time for A brief description of its network is herein summarized DNA repair. When the damage could not be repaired to show just an example of how in general checkpoints cells undergo apoptosis. Many different lesions can proteins are strictly interconnected and inter-related occur in the cells which are coupled to different repair each others. mechanisms. First, normal metabolic processes or Chk1 regulates the checkpoints by targeting the Cdc25 exposure to external ionizing radiations generate free family of dual specificity phosphatases, Cdc25A at the oxygen radicals and can break the phospho diester G1/S and S phase checkpoints and Cdc25A and bonds in the backbone of the DNA helix (single strand Cdc25C at the G2/M checkpoint.(Peng et al., 1997; break). When two of these breaks are close to each Mailand et al., 2000) other but on opposite DNA strands, a double strand Phosphorylation of Cdc25A by Chk1 at multiple sites break (DSB) is present. Second, alkylating agents can increases proteosomal degradation of the phosphatase modify purine bases and can cause intra strand or inter and inability of Cdc25A to interact with its cyclin/cdks substrates.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 70 Cell cycle, checkpoints and cancer Carrassa L

Chk1 phosphorylates Cdc25C at ser216, leading to normal cells also depend on a functional G1 checkpoint formation af a complex with 14-3-3 proteins and (Dai and Grant, 2010; Ma et al., 2011). Experimental cytoplasmic sequestration of the phosphatase (Peng et evidence showed that inhibiting the S and G2 al., 1997; Mailand et al., 2000; Zhao et al., 2002), thus checkpoints by inactivation of ATR or CHK1 avoiding activation of the cyclinB1-CDK1 complex abrogated DNA damage-induced G2 checkpoint arrest which regulates the entry in mitosis. Chk1 is activated and sensitized cancer cells to a variety of DNA- after DNA damage, which ultimately causes single damaging chemotherapeutic agents (Carrassa et al., strand (ss) DNA breaks, by ATM- and ATR-dependent 2004; Ganzinelli et al., 2008; Massagué, 2004). phosphorylation of C-terminal residues (ser317 and Furthermore, oncogenic replicative stress may render ser345). In particular, after formation of ssDNA breaks cancer cells sensitive to inhibitors that prevent the S (induced for example by UV, replication stresses, DNA and G2 checkpoints as single agents. As mentioned damaging agents), replication protein A (RPA) binds to previously, CHK1 is a key signalling kinase involved ssDNA and recruits Rad17/9-1-1 and ATR/ATRIP in the intra-S phase and G2/M checkpoints (Kastan and complexes, leading to Chk1 phosphorylation. Chk1 Bartek, 2004). In response to replication stress or activation by ATR also requires mediators such as genotoxic insults, CHK1 is activated via ATR- claspin, BRCA1, TOBP1. Indirectly, as ssDNA breaks dependent phosphorylation. During unperturbed S also serve as an intermediate of double strand DNA phase, CHK1 controls replication fork speed and (dsDNA) breaks, ATM too is involved in Chk1 suppresses excess origin firing (Petermann et al., 2010), activation. ATM is recruited at the level of DSBs prevents premature activation of cyclin B-CDK1 and (induced by IR for example) by the MRN complex may be involved in spindle checkpoint signalling leading to Chk2 activation. ATM and MRN mediate (Zachos et al., 2007; Chilà et al., 2013, Carrassa and DSB resection leading to ssDNA formation as an Damia, 2011). Oncogene driven replication is abnormal intermediate structure of DNA repair, leading to Chk1 and results in high levels of replication stress, and activation through RPA/ATR-ATRIP recruitment inhibition of CHK1 may increase the replication stress (Bartek and Lukas, 2007; Gottifredi and Prives, 2005; to sufficiently high levels to be lethal as a single agent Jazayeri et al., 2006). in certain contexts (Jazayeri et al., 2006; Syljuåsen et Chk1 also plays a role in the mitotic spindle checkpoint al., 2005). The tyrosine kinase Wee1, together with which ensures the fidelity of mitotic segregation during Chk1, has also to be considered a crucial checkpoint mitosis, preventing chromosomal instability and protein controlling S and G2 checkpoint (Figure 2). aneuploidy (Carrassa et al., 2009; Zachos et al., 2007; The WEE1 kinase prevents mitotic entry via inhibitory Suijkerbuijk and Kops, 2008; Chilà et al., 2013). phosphorylation of CDK1 at Tyr15 (Lindqvist et al., 2009). Recently, it is becoming clear that WEE1 is also Targeting cell cycle checkpoints as required for the maintenance of genome integrity therapeutic strategy in cancer during DNA replication (Sørensen and Syljuåsen, The DNA damage response requires the integration of 2012; Beck et al., 2012). WEE1 controls CDK1 and cell cycle control via checkpoint signalling to allow CDK2 activity during S phase, thereby suppressing time for repair to prevent DNA damage before DNA excessive firing of replication origins, promoting replication and mitosis take place. The importance of homologous recombination, and preventing excessive checkpoints pathways in the cellular response to DNA resection of stalled replication forks (Beck et al., 2012; damage (both endogenous and exogenous) is at the Krajewska et al., 2013). basis of the use of checkpoint inhibitors to increase the Thus both Chk1 and Wee1 are required during normal efficacy of cancer radio- and chemo-therapy. Chemo- S phase to avoid deleterious DNA breakage, and and radio-therapy are strong inducers of the DNA thereby prevent loss of genome integrity in the absence damage response pathways being able to cause of exogenous DNA damage (Sørensen and Syljuåsen, different types of DNA damage and variably able to 2012). Several Chk1 and Wee1 inhibitors have now activate checkpoints, and the abrogation of these been developed and tested in combination with DNA checkpoints can potentiate the cytotoxic activity of damaging agents to increase their efficacy, especially in various anticancer agents (Poehlmann and Roessner, tumors with a defective G1/S checkpoint (e.g. p53 2010). Targeting the S and G2 checkpoints has been defects) (Carrassa and Damia, 2011; Stathis and Oza, considering attractive for cancer therapy because loss 2010) of G1 checkpoint control is a common feature of cancer WEE1 inhibitors have been developed, and some have cells (due to mutation of tumor suppressor protein p53), entered into clinical trials but clinical data are still making them more reliant on the S and G2 checkpoints limited. to prevent DNA damage triggering cell death, while

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 71 Cell cycle, checkpoints and cancer Carrassa L

Figure 2. Schematic representation of the role of Chk1 and Wee1 in regulation of the CDK-cyclin complexes involved in S phase and M phase entry.

The pyeazolo-pyrimidine derivative MK-1775 is the lethal, causing cells to die, if they occur most potent and highly selective inhibitor of Wee1, and simultaneously. Synthetic lethal interactions have been has recently reached phase I (in combination with widely reported for loss and gain of function mutations. gemcitabine, cisplatin, or carboplatin) and II studies (in The synthetic lethality-driven approach offers the ideal combination with paclitaxel and carboplatin in ovarian cancer therapy as it allows indirect targeting of non- cancer) (Stathis and Oza, 2010; De Witt Hamer et al., druggable cancer-promoting lesions with 2011). Most research has focused on the development pharmacological inhibition of the druggable synthetic of CHK1 inhibitors, which have entered clinical lethal interactor and as it should be exclusively studies. UCN 01 was the first of this type of inhibitor to selective for cancer cells, and well tolerated by healthy enter clinical trials, but after Phase II trials it was normal cells, that lack the cancer-specific mutation, discontinued owing to dose-limiting toxicities and a with a wide therapeutic window (Kaelin Jr, 2005; lack of convincing efficacy that was probably due to Canaani, 2009). This concept is at the basis of the poor specificity and pharmacokinetics. The newer, efficacy in preclinical systems of PARP inhibitors in more specific inhibitors of CHK1 have generally been homologous recombination defective cells, due to combined with gemcitabine in Phase I studies, in which mutation of genes such as BRCA1/BRCA2 and it has myelosuppression was the major toxicity that led to the already undergone proof-of-principle in the clinical termination of the trials, and no efficacy data have yet setting. Substantial durable antitumor activity was been presented (Carrassa and Damia, 2011; Blasina et observed after treatment with PARP inhibitors in al., 2008). Recently, a selective orally available patients with BRCA1/2-mutated cancers, including inhibitor developed from a high-throughput screening ovarian, breast and prostate cancers (Bryant et al., hit, GNE-900, gave promising pre-clinical studies and 2005; Fong et al., 2009). Chk1 inhibition has been is now undergoing Phase I clinical trials (Blackwood et proposed as a strategy for targeting FA (Fanconi al., 2013). Anemia) pathway deficient tumors. In fact, tumor cells Synthetic lethality approach in deficient in the FA pathway are hypersensitive to Chk1 inhibition, suggesting a possible use of these inhibitors cancer therapy in FA deficient tumors (Chen et al., 2009). The FA The most promising prospect for the future of cancer pathway is a DNA repair pathway required for the treatment seems to be the exploitation of dysregulated cellular response to different DNA damaging agents, DNA Damage Response, by the synthetic lethality including cross-linking agents (e.g. cis-platinum) in approach. The synthetic lethality concept states that cooperation with the homologous recombination mutations of two different genes are not lethal in the pathway. cells when they occur at once, but are synthetically

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 72 Cell cycle, checkpoints and cancer Carrassa L

Figure 3. Schematic representation of the effects of Chk1 and Wee1 inhibition on CDK-CYCLIN complex regulation, that gets more activated being unphosphorylated.

A range of sporadic tumors with genetic and epigenetic recently corroborated by other groups, suggesting that disruption of the FA genes have been reported. at least in solid tumors this drug combination could be Hyperactive growth factor signalling and oncogene- a very new promising anticancer strategy deserving induced replicative stress increase DNA breakage that clinical investigation (Russell et al., 2013; Guertin et activates the ATR-CHK1 pathway, and some examples al., 2012). Many other successful synthetic lethality of the synthetic lethality of checkpoint or DNA repair combinations exist and many more probably need to be inhibitors in cells harbouring activated oncogenes have explored and they will provide in the near future new been identified. ATR knockdown was synthetically potential effective tools for cancer therapy (Reinhardt lethal in cells transformed with mutant KRAS (Gilad et et al., 2013; Curtin, 2012). al., 2010), and inhibition of CHK1 and CHK2 significantly delayed disease progression of References transplanted MYC-overexpressing lymphoma cells in vivo (Ferrao et al., 2011). Morgan DO. Principles of CDK regulation. Nature. 1995 Mar Many recent studies with a high throughput siRNA 9;374(6518):131-4 screening approach led to identification of other Peng CY, Graves PR, Thoma RS, Wu Z, Shaw AS, Piwnica- possible target genes synthetically lethal with Chk1 Worms H. Mitotic and G2 checkpoint control: regulation of 14- 3-3 protein binding by phosphorylation of Cdc25C on serine- inhibitors. Recently two distinct siRNA high- 216. Science. 1997 Sep 5;277(5331):1501-5 throughput screening identified Wee1 as in synthetic lethality with Chk1 (Davies et al., 2011; Carrassa et al., Pinyol M, Hernandez L, Cazorla M, Balbín M, Jares P, Fernandez PL, Montserrat E, Cardesa A, Lopez-Otín C, 2012) and combined treatment of Chk1 and Wee1 Campo E. Deletions and loss of expression of p16INK4a and inhibitors showed a strong synergistic cytotoxic effect p21Waf1 genes are associated with aggressive variants of in various human cancer cell lines (ovary, breast, mantle cell lymphomas. Blood. 1997 Jan 1;89(1):272-80 prostate, colon). The strong in vitro synergistic effect of Yang J, Bardes ES, Moore JD, Brennan J, Powers MA, the combination translates to tumor growth inhibition Kornbluth S. Control of cyclin B1 localization through regulated in vivo (Carrassa et al., 2012; Russell et al., 2013). binding of the nuclear export factor CRM1. Genes Dev. 1998 Simultaneous inhibition of CHK1 and WEE1 induces Jul 15;12(14):2131-43 cell death through a general mis-coordination of the Pavletich NP. Mechanisms of cyclin-dependent kinase cell cycle (figure 3), which leads to DNA damage and regulation: structures of Cdks, their cyclin activators, and Cip and INK4 inhibitors. J Mol Biol. 1999 Apr 16;287(5):821-8 collapsed replication forks during S phase (Carrassa et al., 2012; Guertin et al., 2012), and to premature Sherr CJ, Roberts JM. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. 1999 Jun mitosis directly from S phase. These data have been 15;13(12):1501-12

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 73 Cell cycle, checkpoints and cancer Carrassa L

Mailand N, Falck J, Lukas C, Syljuâsen RG, Welcker M, Bartek tumors to treatment with 5-fluorouracil. Clin Cancer Res. 2008 J, Lukas J. Rapid destruction of human Cdc25A in response to Aug 15;14(16):5131-41 DNA damage. Science. 2000 May 26;288(5470):1425-9 Suijkerbuijk SJ, Kops GJ. Preventing aneuploidy: the Zhou BB, Elledge SJ. The DNA damage response: putting contribution of mitotic checkpoint proteins. Biochim Biophys checkpoints in perspective. Nature. 2000 Nov Acta. 2008 Sep;1786(1):24-31 23;408(6811):433-9 Canaani D. Methodological approaches in application of Zhao H, Watkins JL, Piwnica-Worms H. Disruption of the synthetic lethality screening towards anticancer therapy. Br J checkpoint kinase 1/cell division cycle 25A pathway abrogates Cancer. 2009 Apr 21;100(8):1213-8 ionizing radiation-induced S and G2 checkpoints. Proc Natl Acad Sci U S A. 2002 Nov 12;99(23):14795-800 Carrassa L, Sanchez Y, Erba E, Damia G. U2OS cells lacking Chk1 undergo aberrant mitosis and fail to activate the spindle Vermeulen K, Van Bockstaele DR, Berneman ZN. The cell checkpoint. J Cell Mol Med. 2009 Aug;13(8A):1565-76 cycle: a review of regulation, deregulation and therapeutic targets in cancer. Cell Prolif. 2003 Jun;36(3):131-49 Chen CC, Kennedy RD, Sidi S, Look AT, D'Andrea A. CHK1 inhibition as a strategy for targeting Fanconi Anemia (FA) DNA Carrassa L, Broggini M, Erba E, Damia G. Chk1, but not Chk2, repair pathway deficient tumors. Mol Cancer. 2009 Apr 16;8:24 is involved in the cellular response to DNA damaging agents: differential activity in cells expressing or not p53. Cell Cycle. Fong PC, Boss DS, Yap TA, Tutt A, Wu P, Mergui-Roelvink M, 2004 Sep;3(9):1177-81 Mortimer P, Swaisland H, Lau A, O'Connor MJ, Ashworth A, Carmichael J, Kaye SB, Schellens JH, de Bono JS. Inhibition Kastan MB, Bartek J. Cell-cycle checkpoints and cancer. of poly(ADP-ribose) polymerase in tumors from BRCA Nature. 2004 Nov 18;432(7015):316-23 mutation carriers. N Engl J Med. 2009 Jul 9;361(2):123-34 Malumbres M, Sotillo R, Santamaría D, Galán J, Cerezo A, Kim JK, Diehl JA. Nuclear cyclin D1: an oncogenic driver in Ortega S, Dubus P, Barbacid M. Mammalian cells cycle human cancer. J Cell Physiol. 2009 Aug;220(2):292-6 without the D-type cyclin-dependent kinases Cdk4 and Cdk6. Cell. 2004 Aug 20;118(4):493-504 Lindqvist A, Rodríguez-Bravo V, Medema RH. The decision to enter mitosis: feedback and redundancy in the mitotic entry Massagué J. G1 cell-cycle control and cancer. Nature. 2004 network. J Cell Biol. 2009 Apr 20;185(2):193-202 Nov 18;432(7015):298-306 Malumbres M, Barbacid M. Cell cycle, CDKs and cancer: a Bryant HE, Schultz N, Thomas HD, Parker KM, Flower D, changing paradigm. Nat Rev Cancer. 2009 Mar;9(3):153-66 Lopez E, Kyle S, Meuth M, Curtin NJ, Helleday T. Specific killing of BRCA2-deficient tumours with inhibitors of poly(ADP- Reinhardt HC, Jiang H, Hemann MT, Yaffe MB. Exploiting ribose) polymerase. Nature. 2005 Apr 14;434(7035):913-7 synthetic lethal interactions for targeted cancer therapy. Cell Cycle. 2009 Oct 1;8(19):3112-9 Cobrinik D. Pocket proteins and cell cycle control. Oncogene. 2005 Apr 18;24(17):2796-809 Stracker TH, Usui T, Petrini JH. Taking the time to make important decisions: the checkpoint effector kinases Chk1 and Gottifredi V, Prives C. The S phase checkpoint: when the Chk2 and the DNA damage response. DNA Repair (Amst). crowd meets at the fork. Semin Cell Dev Biol. 2005 2009 Sep 2;8(9):1047-54 Jun;16(3):355-68 Dai Y, Grant S. New insights into checkpoint kinase 1 in the Kaelin WG Jr. The concept of synthetic lethality in the context DNA damage response signaling network. Clin Cancer Res. of anticancer therapy. Nat Rev Cancer. 2005 Sep;5(9):689-98 2010 Jan 15;16(2):376-83 Syljuåsen RG, Sørensen CS, Hansen LT, Fugger K, Lundin C, Gilad O, Nabet BY, Ragland RL, Schoppy DW, Smith KD, Johansson F, Helleday T, Sehested M, Lukas J, Bartek J. Durham AC, Brown EJ. Combining ATR suppression with Inhibition of human Chk1 causes increased initiation of DNA oncogenic Ras synergistically increases genomic instability, replication, phosphorylation of ATR targets, and DNA causing synthetic lethality or tumorigenesis in a dosage- breakage. Mol Cell Biol. 2005 May;25(9):3553-62 dependent manner. Cancer Res. 2010 Dec 1;70(23):9693-702 Jazayeri A, Falck J, Lukas C, Bartek J, Smith GC, Lukas J, Lens SM, Voest EE, Medema RH. Shared and separate Jackson SP. ATM- and cell cycle-dependent regulation of ATR functions of polo-like kinases and aurora kinases in cancer. in response to DNA double-strand breaks. Nat Cell Biol. 2006 Nat Rev Cancer. 2010 Dec;10(12):825-41 Jan;8(1):37-45 Petermann E, Woodcock M, Helleday T. Chk1 promotes Bartek J, Lukas J. DNA damage checkpoints: from initiation to replication fork progression by controlling replication initiation. recovery or adaptation. Curr Opin Cell Biol. 2007 Proc Natl Acad Sci U S A. 2010 Sep 14;107(37):16090-5 Apr;19(2):238-45 Poehlmann A, Roessner A. Importance of DNA damage Zachos G, Black EJ, Walker M, Scott MT, Vagnarelli P, checkpoints in the pathogenesis of human cancers. Pathol Res Earnshaw WC, Gillespie DA. Chk1 is required for spindle Pract. 2010 Sep 15;206(9):591-601 checkpoint function. Dev Cell. 2007 Feb;12(2):247-60 Stathis A, Oza A. Targeting Wee1-like protein kinase to treat Blasina A, Hallin J, Chen E, Arango ME, Kraynov E, Register cancer. Drug News Perspect. 2010 Sep;23(7):425-9 J, Grant S, Ninkovic S, Chen P, Nichols T, O'Connor P, Anderes K. Breaching the DNA damage checkpoint via PF- Strebhardt K. Multifaceted polo-like kinases: drug targets and 00477736, a novel small-molecule inhibitor of checkpoint antitargets for cancer therapy. Nat Rev Drug Discov. 2010 kinase 1. Mol Cancer Ther. 2008 Aug;7(8):2394-404 Aug;9(8):643-60 Branzei D, Foiani M. Regulation of DNA repair throughout the Carrassa L, Damia G. Unleashing Chk1 in cancer therapy. Cell cell cycle. Nat Rev Mol Cell Biol. 2008 Apr;9(4):297-308 Cycle. 2011 Jul 1;10(13):2121-8 Ganzinelli M, Carrassa L, Crippa F, Tavecchio M, Broggini M, Davies KD, Cable PL, Garrus JE, Sullivan FX, von Carlowitz I, Damia G. Checkpoint kinase 1 down-regulation by an inducible Huerou YL, Wallace E, Woessner RD, Gross S. Chk1 inhibition small interfering RNA expression system sensitized in vivo and Wee1 inhibition combine synergistically to impede cellular proliferation. Cancer Biol Ther. 2011 Nov 1;12(9):788-96

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 74 Cell cycle, checkpoints and cancer Carrassa L

De Witt Hamer PC, Mir SE, Noske D, Van Noorden CJ, Guertin AD, Martin MM, Roberts B, Hurd M, Qu X, Miselis NR, Würdinger T. WEE1 kinase targeting combined with DNA- Liu Y, Li J, Feldman I, Benita Y, Bloecher A, Toniatti C, damaging cancer therapy catalyzes mitotic catastrophe. Clin Shumway SD. Unique functions of CHK1 and WEE1 underlie Cancer Res. 2011 Jul 1;17(13):4200-7 synergistic anti-tumor activity upon pharmacologic inhibition. Cancer Cell Int. 2012 Nov 13;12(1):45 Konecny GE, Winterhoff B, Kolarova T, Qi J, Manivong K, Dering J, Yang G, Chalukya M, Wang HJ, Anderson L, Kalli Huillard E, Hashizume R, Phillips JJ, Griveau A, Ihrie RA, Aoki KR, Finn RS, Ginther C, Jones S, Velculescu VE, Riehle D, Y, Nicolaides T, Perry A, Waldman T, McMahon M, Weiss WA, Cliby WA, Randolph S, Koehler M, Hartmann LC, Slamon DJ. Petritsch C, James CD, Rowitch DH. Cooperative interactions Expression of p16 and retinoblastoma determines response to of BRAFV600E kinase and CDKN2A locus deficiency in CDK4/6 inhibition in ovarian cancer. Clin Cancer Res. 2011 pediatric malignant astrocytoma as a basis for rational therapy. Mar 15;17(6):1591-602 Proc Natl Acad Sci U S A. 2012 May 29;109(22):8710-5 Ma CX, Janetka JW, Piwnica-Worms H. Death by releasing the Matulonis UA, Sharma S, Ghamande S, Gordon MS, Del Prete breaks: CHK1 inhibitors as cancer therapeutics. Trends Mol SA, Ray-Coquard I, Kutarska E, Liu H, Fingert H, Zhou X, Med. 2011 Feb;17(2):88-96 Danaee H, Schilder RJ. Phase II study of MLN8237 (alisertib), an investigational Aurora A kinase inhibitor, in patients with Musgrove EA, Caldon CE, Barraclough J, Stone A, Sutherland platinum-resistant or -refractory epithelial ovarian, fallopian RL. Cyclin D as a therapeutic target in cancer. Nat Rev tube, or primary peritoneal carcinoma. Gynecol Oncol. 2012 Cancer. 2011 Jul 7;11(8):558-72 Oct;127(1):63-9 Olmos D, Barker D, Sharma R, Brunetto AT, Yap TA, Sørensen CS, Syljuåsen RG. Safeguarding genome integrity: Taegtmeyer AB, Barriuso J, Medani H, Degenhardt YY, Allred the checkpoint kinases ATR, CHK1 and WEE1 restrain CDK AJ, Smith DA, Murray SC, Lampkin TA, Dar MM, Wilson R, de activity during normal DNA replication. Nucleic Acids Res. Bono JS, Blagden SP. Phase I study of GSK461364, a specific 2012 Jan;40(2):477-86 and competitive Polo-like kinase 1 inhibitor, in patients with advanced solid malignancies. Clin Cancer Res. 2011 May Aarts M, Linardopoulos S, Turner NC. Tumour selective 15;17(10):3420-30 targeting of cell cycle kinases for cancer treatment. Curr Opin Pharmacol. 2013 Aug;13(4):529-35 Beck H, Nähse-Kumpf V, Larsen MS, O'Hanlon KA, Patzke S, Holmberg C, Mejlvang J, Groth A, Nielsen O, Syljuåsen RG, Blackwood E, Epler J, Yen I, Flagella M, O'Brien T, Evangelista Sørensen CS. Cyclin-dependent kinase suppression by WEE1 M, Schmidt S, Xiao Y, Choi J, Kowanetz K, Ramiscal J, Wong kinase protects the genome through control of replication K, Jakubiak D, Yee S, Cain G, Gazzard L, Williams K, Halladay initiation and nucleotide consumption. Mol Cell Biol. 2012 J, Jackson PK, Malek S. Combination drug scheduling defines Oct;32(20):4226-36 a "window of opportunity" for chemopotentiation of gemcitabine by an orally bioavailable, selective ChK1 inhibitor, GNE-900. Carrassa L, Chilà R, Lupi M, Ricci F, Celenza C, Mazzoletti M, Mol Cancer Ther. 2013 Oct;12(10):1968-80 Broggini M, Damia G. Combined inhibition of Chk1 and Wee1: in vitro synergistic effect translates to tumor growth inhibition in Chilà R, Celenza C, Lupi M, Damia G, Carrassa L. Chk1-Mad2 vivo. Cell Cycle. 2012 Jul 1;11(13):2507-17 interaction: a crosslink between the DNA damage checkpoint and the mitotic spindle checkpoint. Cell Cycle. 2013 Apr Curtin NJ. DNA repair dysregulation from cancer driver to 1;12(7):1083-90 therapeutic target. Nat Rev Cancer. 2012 Dec;12(12):801-17 Krajewska M, Heijink AM, Bisselink YJ, Seinstra RI, Silljé HH, Curtis C, Shah SP, Chin SF, Turashvili G, Rueda OM, Dunning de Vries EG, van Vugt MA. Forced activation of Cdk1 via wee1 MJ, Speed D, Lynch AG, Samarajiwa S, Yuan Y, Gräf S, Ha G, inhibition impairs homologous recombination. Oncogene. 2013 Haffari G, Bashashati A, Russell R, McKinney S, Langerød A, Jun 13;32(24):3001-8 Green A, Provenzano E, Wishart G, Pinder S, Watson P, Markowetz F, Murphy L, Ellis I, Purushotham A, Børresen-Dale Russell MR, Levin K, Rader J, Belcastro L, Li Y, Martinez D, AL, Brenton JD, Tavaré S, Caldas C, Aparicio S. The genomic Pawel B, Shumway SD, Maris JM, Cole KA. Combination and transcriptomic architecture of 2,000 breast tumours therapy targeting the Chk1 and Wee1 kinases shows reveals therapeutic efficacy in neuroblastoma. Cancer Res. 2013 Jan 15;73(2):776-84 novel subgroups. Nature. 2012 Apr 18;486(7403):346-52 Ferrao PT, Bukczynska EP, Johnstone RW, McArthur GA. This article should be referenced as such: Efficacy of CHK inhibitors as single agents in MYC-driven Carrassa L. Cell cycle, checkpoints and cancer. Atlas Genet lymphoma cells. Oncogene. 2012 Mar 29;31(13):1661-72 Cytogenet Oncol Haematol. 2014; 18(1):67-75.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 75 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Case Report Section Paper co-edited with the European LeukemiaNet der(1;18)(q10;q10) in a pediatric patient with cytopenias Adriana Zamecnikova, Soad Al Bahar Kuwait Cancer Control Center, Dep of Hematology, Laboratory of Cancer Genetics, Kuwait (AZ, SA)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Reports/der0118q10q10CytZamecID100071.html DOI: 10.4267/2042/52081 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract: Case report on der(1;18)(q10;q10) in a pediatric patient with cytopenias.

Clinics Survival Age and sex Date of diagnosis: 03-2012 9 years old male patient. Treatment: No therapy Previous history Treatment related death: no No preleukemia, no previous malignancy, no inborn Relapse: no condition of note, no main items Status: Alive Organomegaly Last follow up: 06-2012 No hepatomegaly, no splenomegaly, no enlarged lymph Survival: 12 months nodes, no central nervous system involvement. Karyotype Blood Sample: Bone marrow 9 WBC: 4.5 X 10 /l (neutrophils = 55%, eosinophils = Culture time: 24h 2%, lymphocytes = 32%, monocytes = 10%, atypical lymphocytes = 1%) Banding: GTG HB: 11.6g/dl Results Platelets: 149X 10 9/l 46,XY,+1,der(1;18)(q10;q10) [5]/ 46,XY [25] Blasts: 1% Other molecular cytogenetics technics Bone marrow: Bone marrow studies showed myeloid Fluorescence in situ hybridization applying the LSI maturation arrest, intermittent neutropenia with normal 1p36/1q25 probe (Abbott). erythropoiesis and megakaryocytes. Other molecular cytogenetics results Two signals for 1p36 locus with 3 signals for 1q25 Cyto-Pathology locus in 20% of bone marrow cells. Classification Cytology NA Immunophenotype Not done Diagnosis MDS – unclassified

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(1) 76 der(1;18)(q10;q10) in a pediatric patient with cytopenias Zamecnikova A, Al Bahar S

(A) Partial karyotype of the patient showing the der(18)t(1;18)(q10;q10). (B) C-banded partial karyotype showing the der(1;18)(q10;q10) chromosome. (C) Fluorescence in situ hybridization with LSI 1p36/1q25 probe (Abott) showing 3 copies of the 1q25 locus in two nuclei (green signal; arrow).

Sawyer JR, Swanson CM, Wheeler G, Cunniff C. Chromosome Comments instability in ICF syndrome: formation of micronuclei from multibranched chromosomes 1 demonstrated by fluorescence This study reports the presence of an unbalanced in situ hybridization. Am J Med Genet. 1995 Mar 27;56(2):203- translocation between chromosome 1 and chromosome 9 18 in a in a pediatric patient with persistent Polito P, Canzonieri V, Cilia AM, Gloghini A, Carbone A, thrombocytopenia and intermittent neutropenia. Gaidano G. Centromeric instability of chromosome 1 resulting Unbalanced translocations involving the long arm of in multibranched chromosomes, telomeric fusions, and chromosome 1 and different partners are recurrent "jumping translocations" of 1q in a human immunodeficiency virus-related non-Hodgkin's lymphoma. Cancer. 1996 Sep cytogenetic abnormalities, mainly reported in myeloid 1;78(5):1142-4 neoplasms. Centromeric fusion between chromosome 1 Wan TS, Ma SK, Au WY, Chan LC. Derivative (1;18)(q10;q10): and chromosome 18, leading to a gain of 1q and loss of a recurrent and novel unbalanced translocation involving 1q in 18p, is rarely observed. This abnormality is relatively myeloid disorders. Cancer Genet Cytogenet. 2001 Jul restricted to myelodysplastic syndromes and 1;128(1):35-8 myloproliferative disorders, indicating that gain of 1q Caramazza D, Hussein K, Siragusa S, Pardanani A, Knudson and/or loss of 18p should be relevant for neoplastic RA, Ketterling RP, Tefferi A. Chromosome 1 abnormalities in transformation in these diseases. myeloid malignancies: a literature survey and karyotype- phenotype associations. Eur J Haematol. 2010 Mar;84(3):191- References 200 This article should be referenced as such: Sawyer JR, Swanson CM, Koller MA, North PE, Ross SW. Centromeric instability of chromosome 1 resulting in Zamecnikova A, Al Bahar S. der(1;18)(q10;q10) in a pediatric multibranched chromosomes, telomeric fusions, and "jumping patient with cytopenias. Atlas Genet Cytogenet Oncol translocations" of 1q in a human immunodeficiency virus- Haematol. 2014; 18(1):76-77. related non-Hodgkin's lymphoma. Cancer. 1995 Oct 1;76(7):1238-44

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas. Iconography is most welcome: there is no space restriction. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by bibliographic databases. Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction. Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with iconography of chromosomes. It is mandatory to use the specific "Submission form for Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German, Italian, and Spanish are welcome.

Subscription : The Atlas is FREE !

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose any potential conflict. Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete anonymity is difficult to achieve, informed consent should be obtained. Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org

der(1;18)(q10;q10) in a pediatric patient with cytopenias Zamecnikova A, Al Bahar S