DOCSLIB.ORG

Human Foamy Virus Integrase Fails to Catalyse the Integration of a Circular DNA Molecule Containing an LTR Junction Sequence

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Human Foamy Virus Integrase Fails to Catalyse the Integration of a Circular DNA Molecule Containing an LTR Junction Sequence Gene Therapy (2002) 9, 1326–1332 2002 Nature Publishing Group All rights reserved 0969-7128/02 $25.00 www.nature.com/gt BRIEF COMMUNICATION Human foamy virus integrase fails to catalyse the integration of a circular DNA molecule containing an LTR junction sequence RA Russell1, R Critchley2, G Vassaux2 and MO McClure1 1Jefferiss Research Trust Laboratories, Wright-Fleming Institute, Imperial College School of Medicine at St Mary’s Hospital, London, UK; and 2Molecular Therapy Laboratory, ICRF Molecular Oncology Unit, ICSM at Hammersmith Hospital, London, UK The presence of closed circular forms of the linear DNA gen- ing transfection of both 293 and 293T cells indicated that the ome of human foamy virus (HFV) has not been established. level of integration was not significantly increased by the The ability of the HFV integrase (IN) to catalyse the inte- HFV IN. Moreover, correctly integrated provirus-like forms gration of these circular forms (termed 2 long terminal repeat of the input plasmid could not be detected by PCR. Taken (LTR) circles) was investigated, with a view to producing a together, these results show that the HFV IN is not able to novel hybrid vector. To this end, a construct was made con- integrate a circular molecule containing an LTR junction and, taining, in addition to the enhanced green fluorescent protein hence, the technique is not exploitable as a tool to produce (eGFP) marker gene, the last 27 bp of the 3’ U5 LTR region hybrid vectors for gene therapy. of HFV fused to the first 28 bp of the 5’ U3 LTR, the latter Gene Therapy (2002) 9, 1326–1332. doi:10.1038/sj.gt.3301795 representing a 2LTR circle. Marker gene expression follow- Keywords: human foamy virus; 2LTR circles; integration; gene therapy; Cre recombinase Production of terminally redundant DNA from the RNA vitro,11,12 however, they appear to be entirely non-patho- genome and the subsequent integration of this DNA into genic in vivo.13–15 The apparent lack of associated disease, the host chromosome are key stages in the retroviral in conjunction with their integrative element,16 has led to lifecycle. Early in infection in most retroviruses virally interest in the use of foamy viruses as vectors for the encoded reverse transcriptase (RT) copies the RNA into delivery of therapeutic genes in vivo. Most work has been the DNA form, adding terminal redundancies in the pro- carried out with the prototype human foamy virus (HFV) cess, termed long terminal repeat (LTR) sequences.1 This which is now known to be of chimpanzee origin.17,18 Dur- linear molecule then enters the nucleus where it inte- ing HFV integration, the presence of closed circular forms grates randomly into the host genome by means of the of the proviral DNA has not been established. We con- retroviral integrase (IN), in a precise mechanism involv- sidered whether the HFV IN could efficiently integrate a ing the removal of the terminal two base pairs (bp) of closed circular molecule containing a 5’–3’ LTR junction each LTR.2–5 In a number of retroviruses, for example sequence: the long-term aim being to exploit this in the murine leukaemia virus (MLV), spleen necrosis virus design of a hybrid vector combining HFV with an aden- (SNV), Rous sarcoma virus (RSV) and avian sarcoma and ovirus (Ad) by means of the bacteriophage P1 cre/loxP leukosis viruses (ASV,ALV), circularised forms of the lin- system.19–23 ear DNA molecule (2LTR circles) have been ident- Ad vectors have been developed extensively due to the ified.3,4,6–9 In the case of MLV, these closed circular forms large packaging capacity and broad host-range of the par- are unnecessary for integration and the direct precursor ent virus. Furthermore, they can infect both dividing and to integration of the MLV provirus is the linear mol- non-dividing cells, are produced to high titres with com- ecule.3,4,10 However, in SNV, RSV, ASV and ALV, closed parative ease and have a high in vivo transduction circular forms were shown to act as targets for efficiency. However, following infection, the genome integration,7–9 although these reports have not been remains episomal and is lost during cell division. Retrovi- substantiated. ral vectors, on the other hand, are of value because of Foamy viruses are classified as one of the seven genera their ability to integrate a transgene into the host genome of retroviruses. They infect a wide variety of cell types, allowing long-term expression. However, unlike Ad vec- producing a characteristic ‘foamy’ cytopathology in tors, they are limited by production difficulties, restricted packaging capacity, reduced ability to infect non-divid- ing cells and low in vitro transduction efficiency. The respective disadvantages of either vector are best over- Correspondence: Jefferiss Research Trust Laboratories, Wright-Fleming, Institute, Imperial College School of Medicine at St Mary’s Hospital, Nor- come by producing hybrid vectors incorporating the inte- folk Place, London, W2 1PG, UK gration ability of retroviruses with the high titre, broad Received 30 January 2002; accepted 29 April 2002 host-range of Ad vectors. This has already been achieved Circular DNA with LTR junction is not integrated by HFV integrase RA Russell et al 1327 Figure 1 DNA constructs. (a) Plasmid pLTRI contains the CMV-IE pro- moter linked to the eGFP gene and the SV-40 poly A, followed by an HFV LTR junction sequence, all flanked by two loxP sites, cloned into pCRII (Invitrogen Life Technologies, UK). The first loxP site, generated by the annealing of complementary oligonucleotides, was inserted into pCRII using the TA cloning technique (Invitrogen Life Technologies, Pais- ley, UK). The LTR junction sequence and the second loxP site, also gener- ated by annealing complementary oligonucleotides, were inserted via the NotI and XhoI sites. The CMV-IE promoter, eGFP gene and poly A cas- sette were amplified from pEGFP-N1 (Clontech, Cowley, UK) by PCR, and cloned between the first loxP site and the LTR junction sequence via the EcoRV site. The HFV LTR junction sequence consists of the last 27 bases of the 3’ U5 region (underlined), followed by the first 28 bases of the 5’ U3 region (bold), the sequence of which is as follows: 5’AATCAAT ATACAAAATTCCATGACAATTGTGGTGGAATGCCACTAGAAAC TAGGG3’. The sequence of each loxP site is: 5’ATAACTTCGTAT AGCATACATTATACGAAGTTAT3’. (b) Plasmid pLTRII was created Figure 2 Western blot to confirm IN expression. 293T cells were seeded × 5 from pLTRI by cloning the puroR gene linked to the encephalomyocarditis at 4 10 cells/well in a six-well plate 1 day prior to transfection, which virus IRES and a synthetic intron from pIRESpuro (Clontech), down- was carried out using the Calcium Phosphate Profection Mammalian stream of eGFP, by restriction digestion. Transfection kit (Promega, Southampton, UK). The cells were transfected in duplicate with pRR2 and pcIN1 (a total of 5 ␮g plasmid DNA per well), and incubated in the transfection mixture for 8 h. At 40 h post- with MLV and first generation Ad vectors by a number transfection, the cells were harvested into SDS-protein sample buffer (62.5 of groups that have generated Ad vectors expressing mM Tris-HCl, pH 6.8 buffer containing 1% glycerol, 5% 2-mercaptoe- thanol, 2% SDS, 1 mM EDTA, 0.025% bromophenol blue) at a concen- either the retroviral packaging components or the retrovi- tration of 1 × 106 cells/50 ␮l buffer. The lysates were incubated at 95°C ral vector genome. In vitro and iv vivo transduction with for 3–4 min, centrifuged at 16 000 g for 5 min and 20 ␮l applied to a these vectors leads to the production of transient MLV 10% polyacrylamide gel for PAGE analysis.43 A Western blot was carried vector producing cells which, in turn, result in inte- out44 using an IN-specific antibody.39 The 127 kDa Pol precursor and the gration and long-term transgene expression.24–30 40 kDa IN are shown. The smaller bands are assumed to be the results An alternative strategy developed by Murphy et al31 of protein degradation. relies on the ability of the MLV IN to integrate a 2LTR circle. Although in natural infection only the linear gen- protein (eGFP) gene driven by the cytomegalovirus ome is integrated,3,4,10 Murphy et al31 have clearly demon- immediate–early (CMV-IE) promoter, with the simian strated that if only 2LTR circles are available in an virus 40 (SV-40) late polyadenylation (polyA) site, fol- infected cell they can be integrated in a provirus-specific lowed by the LTR junction sequence (see Figure 1 manner by the MLV IN. The MLV vector was then incor- legend). This junction sequence consists of the last 27 bp porated into an Ad vector and, in conjunction with the of the 3’ U5 region fused to the first 28 bp of the 5’ U3 MLV IN and the cre/loxP system,19–21 was integrated in a region of the HFV LTR.35 The plasmid pLTRII was provirus-like manner allowing prolonged transgene derived from pLTRI by inserting the puromycin resist- expression. Zheng et al32 have also shown that an MLV ance (puroR) gene linked to the encephalomyocarditis vector genome cloned into an Ad vector can be integrated virus internal ribosome entry site (IRES) and a synthetic in a provirus-like manner. However, an IN protein was intron downstream of the eGFP gene (Figure 1b). The loxP not included and the mechanism by which integration sites, flanking the HFV cassette will allow Cre recombi- occurred has not been established.33 IN proteins are also nase directed excision of the intervening DNA.19,36–38 In encoded by bacteriophages and the bacteriophage ␭ IN, the context of a linear DNA genome, such as that of an is able to excise circular molecules containing its recog- Ad, Cre recombinase will excise a circular proviral-like nition attP and attB sites.34 Although, not directly compa- molecule.
Load more

Recommended publications
  • Advances in the Study of Transmissible Respiratory Tumours in Small Ruminants Veterinary Microbiology
    Veterinary Microbiology 181 (2015) 170–177 Contents lists available at ScienceDirect Veterinary Microbiology journa l homepage: www.elsevier.com/locate/vetmic Advances in the study of transmissible respiratory tumours in small ruminants a a a a,b a, M. Monot , F. Archer , M. Gomes , J.-F. Mornex , C. Leroux * a INRA UMR754-Université Lyon 1, Retrovirus and Comparative Pathology, France; Université de Lyon, France b Hospices Civils de Lyon, France A R T I C L E I N F O A B S T R A C T Sheep and goats are widely infected by oncogenic retroviruses, namely Jaagsiekte Sheep RetroVirus (JSRV) Keywords: and Enzootic Nasal Tumour Virus (ENTV). Under field conditions, these viruses induce transformation of Cancer differentiated epithelial cells in the lungs for Jaagsiekte Sheep RetroVirus or the nasal cavities for Enzootic ENTV Nasal Tumour Virus. As in other vertebrates, a family of endogenous retroviruses named endogenous Goat JSRV Jaagsiekte Sheep RetroVirus (enJSRV) and closely related to exogenous Jaagsiekte Sheep RetroVirus is present Lepidic in domestic and wild small ruminants. Interestingly, Jaagsiekte Sheep RetroVirus and Enzootic Nasal Respiratory infection Tumour Virus are able to promote cell transformation, leading to cancer through their envelope Retrovirus glycoproteins. In vitro, it has been demonstrated that the envelope is able to deregulate some of the Sheep important signaling pathways that control cell proliferation. The role of the retroviral envelope in cell transformation has attracted considerable attention in the past years, but it appears to be highly dependent of the nature and origin of the cells used. Aside from its health impact in animals, it has been reported for many years that the Jaagsiekte Sheep RetroVirus-induced lung cancer is analogous to a rare, peculiar form of lung adenocarcinoma in humans, namely lepidic pulmonary adenocarcinoma.
    [Show full text]
  • 2007Murciaphd.Pdf
    https://theses.gla.ac.uk/ Theses Digitisation: https://www.gla.ac.uk/myglasgow/research/enlighten/theses/digitisation/ This is a digitised version of the original print thesis. Copyright and moral rights for this work are retained by the author A copy can be downloaded for personal non-commercial research or study, without prior permission or charge This work cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given Enlighten: Theses https://theses.gla.ac.uk/ [email protected] LATE RESTRICTION INDUCED BY AN ENDOGENOUS RETROVIRUS Pablo Ramiro Murcia August 2007 Thesis presented to the School of Veterinary Medicine at the University of Glasgow for the degree of Doctor of Philosophy Institute of Comparative Medicine 464 Bearsden Road Glasgow G61 IQH ©Pablo Murcia ProQuest Number: 10390741 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest ProQuest 10390741 Published by ProQuest LLO (2017). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code Microform Edition © ProQuest LLO.
    [Show full text]
  • Expression of Rous Sarcoma Virus-Derived Retroviral Vectors In
    Proc. Natl. Acad. Sci. USA Vol. 88, pp. 10505-10509, December 1991 Developmental Biology Expression of Rous sarcoma virus-derived retroviral vectors in the avian blastoderm: Potential as stable genetic markers (embryonic development/replication-defective virus/lineage marker/lacZ) SRINU T. REDDY, ANDREW W. STOKER, AND MINA J. BISSELL Division of Cell and Molecular Biology, Lawrence Berkeley Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 Communicated by Melvin Calvin, August 26, 1991 ABSTRACT Retroviruses are valuable tools in studies of preliminary evidence that cultured chicken blastoderm cells embryonic development, both as gene expression vectors and as could express viral proteins upon RSV infection. Because the cell lineage markers. In this study early chicken blastoderm resolution of this question has important implications for the cells are shown to be permissive for infection by Rous sarcoma use of retroviruses in studies of early avian development, we virus and derivative replication-defective vectors, and, in con- have now addressed directly the permissivity of the chicken trast to previously published data, these cells will readily blastoderm toward viral expression. express viral genes. In cultured blastoderm cells, Rous sarcoma We have asked specifically whether or not a block to viral virus stably integrates and is transcribed efficiently, producing expression occurs in cultured cells isolated from chicken infectious virus particles. Using replication-defective vectors blastoderms, and whether replication-defective vectors can encoding the bacterial lacZ gene, we further show that blas- be used to mark cells genetically at the blastoderm stage in toderms can be infected in culture and in ovo. In ovo, lacZ ovo. Using cultured chicken blastoderm cells, we demon- expression is seen within 24 hr of virus inoculation, and by 96 strate that RSV not only infects and integrates but, in contrast hr stably expressing clones of cells are observed in diverse to previous data (15), is also expressed well in these cells.
    [Show full text]
  • Oncogenic Transformation by the Jaagsiekte Sheep Retrovirus Envelope Protein
    Oncogene (2007) 26, 789–801 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW Oncogenic transformation by the jaagsiekte sheep retrovirus envelope protein S-L Liu1 and AD Miller2 1Department of Microbiology and Immunology, McGill University, Montreal, Canada and 2Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, WA, USA Retroviruses have played profound roles in our under- sarcoma virus, both of which cause tumors in chickens standing of the genetic and molecular basis of cancer. (for a comprehensive review see Rosenberg and Jaagsiekte sheep retrovirus (JSRV) is a simple retrovirus Jolicoeur (1997)). Oncogenic retroviruses are historically that causes contagious lung tumors in sheep, known as classified into acute transforming retroviruses and ovine pulmonary adenocarcinoma (OPA). Intriguingly, nonacute retroviruses. Acute transforming retroviruses OPA resembles pulmonary adenocarcinoma in humans, induce tumors through acquisition and expression of and may provide a model for this frequent human cancer. cellular proto-oncogenes – a process referred to as Distinct from the classical mechanisms of retroviral oncogene capture. These retroviruses induce tumors oncogenesis by insertional activation of or virus capture rapidly, the tumors are of polyclonal origin, and the of host oncogenes, the native envelope (Env) structural viral oncogenes in these viruses are not essential for protein of JSRV is itself the active oncogene. A major virus replication. In fact, acute transforming retro- pathway for Env transformation involves interaction of viruses are often replication-defective (Rous sarcoma the Env cytoplasmic tail with as yet unidentified cellular virus is an exception) because of the loss or disruption of adaptor(s), leading to the activation of PI3K/Akt and essential viral genes during the oncogene capture MAPK signaling cascades.
    [Show full text]
  • The Discovery of HTLV-1, the First Pathogenic Human Retrovirus John M
    PERSPECTIVE PERSPECTIVE The discovery of HTLV-1, the first pathogenic human retrovirus John M. Coffin1 Tufts University School of Medicine, Boston MA 02111 Edited by Peter K. Vogt, The Scripps Research Institute, La Jolla, CA, and approved November 11, 2015 (received for review November 2, 2015) After the discovery of retroviral reverse transcriptase in 1970, there was a flurry of activity, sparked by the “War on Cancer,” to identify human cancer retroviruses. After many false claims resulting from various artifacts, most scientists abandoned the search, but the Gallo laboratory carried on, developing both specific assays and new cell culture methods that enabled them to report, in the accompanying 1980 PNAS paper, identification and partial characterization of human T-cell leukemia virus (HTLV; now known as HTLV-1) produced by a T-cell line from a lymphoma patient. Follow-up studies, including collaboration with the group that first identified a cluster of adult T-cell leukemia (ATL) cases in Japan, provided conclusive evidence that HTLV was the cause of this disease. HTLV-1 is now known to infect at least 4–10 million people worldwide, about 5% of whom will develop ATL. Despite intensive research, knowledge of the viral etiology has not led to improvement in treatment or outcome of ATL. However, the technology for discovery of HTLV and acknowledgment of the existence of pathogenic human retroviruses laid the technical and intellectual foundation for the discovery of the cause of AIDS soon afterward. Without this advance, our ability to diagnose and treat HIV infection most likely would have been long delayed.
    [Show full text]
  • Jaagsiekte Sheep Retrovirus (JSRV)
    Jaagsiekte Sheep Retrovirus (JSRV): from virus to lung cancer in sheep Caroline Leroux, Nicolas Girard, Vincent Cottin, Timothy Greenland, Jean-François Mornex, Fabienne Archer To cite this version: Caroline Leroux, Nicolas Girard, Vincent Cottin, Timothy Greenland, Jean-François Mornex, et al.. Jaagsiekte Sheep Retrovirus (JSRV): from virus to lung cancer in sheep. Veterinary Research, BioMed Central, 2007, 38 (2), pp.211-228. 10.1051/vetres:2006060. hal-00902865 HAL Id: hal-00902865 https://hal.archives-ouvertes.fr/hal-00902865 Submitted on 1 Jan 2007 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Copyright Vet. Res. 38 (2007) 211–228 211 c INRA, EDP Sciences, 2007 DOI: 10.1051/vetres:2006060 Review article Jaagsiekte Sheep Retrovirus (JSRV): from virus to lung cancer in sheep Caroline La*,NicolasGa, Vincent Ca,b, Timothy Ga, Jean-François Ma,b, Fabienne Aa a Université de Lyon 1, INRA, UMR754, École Nationale Vétérinaire de Lyon, IFR 128, F-69007, Lyon, France b Centre de référence des maladies orphelines pulmonaires, Hôpital Louis Pradel, Hospices Civils de Lyon, Lyon, France (Received 11 September 2006; accepted 23 November 2006) Abstract – Jaagsiekte Sheep Retrovirus (JSRV) is a betaretrovirus infecting sheep.
    [Show full text]
  • Tases from Ribonucleic Acid Tumor Viruses
    JOURNAL OF VIROLOGY, Jan. 1972, p. 110-115 Vol. 9, No. I Copyright © 1972 American Society for Microbiology Printed in U.S.A. Immunological Relationships of Reverse Transcrip- tases from Ribonucleic Acid Tumor Viruses WADE P. PARKS, EDWARD M. SCOLNICK, JEFFREY ROSS, GEORGE J. TODARO, AND STUART A. AARONSON Viral Carcinogenesis Branch and Viral Leukemia and Lymphoma Branch, National Cancer Institute, Bethesda, Maryland 20014 Received for publication 12 October 1971 Antiserum to partially purified reverse transcriptase from the Schmidt-Ruppin strain of Rous sarcoma virus has been prepared and characterized. Antibody to the avian polymerase inhibited the reverse transcriptase activity of avian C-type viruses but had no effect on the polymerase activity from C-type viruses of other classes. The known mammalian C-type viral polymerases were significantly inhibited only by the antiserum to murine C-type viral polymerases; reverse transcriptases from four other mammalian viruses were immunologically distinct from both avian and mam- malian C-type viral polymerases. Partially purified murine leukemia viral DNA po- lymerase activity was comparably reduced by specific antibody regardless of the tem- plate used for enzyme detection. Antibody to the deoxyribonucleic acid (DNA) grown in a line of sheep testes cells and kindly pro- polymerase activities of murine C-type viruses vided by K. K. Takemoto and L. B. Stone (NIH, has been previously demonstrated in the sera of Bethesda, Md.). Mason-Pfizer monkey virus (MP- rats with murine leukemia virus (MuLV)-re- MV; reference 9) was grown in either monkey embryo cells or a human lymphoblastoid line (NC-37); some leasing tumors and in the sera of rabbits im- MP-MV preparations were provided by M.
    [Show full text]
  • Reverse Transcriptase, Temin & BalMore; Nobel Prize 1975
    Reverse transcrip-on and integra-on Lecture 9 Biology W3310/4310 Virology Spring 2013 “One can’t believe impossible things,” said Alice. “I dare say you haven’t had much pracce,” said the Queen. “Why, some=mes I’ve believed as many as six impossible things before breakfast.” --LEWIS CARROLL, Alice in Wonderland 1 Some history • 1908 - Discovery oF chicken leukemia virus, Bang & Ellerman • 1911 - Discovery oF Rous sarcoma virus, Peyton Rous (Nobel Prize 55 years later) • Called tumor viruses 2 Tumor viruses • Found to have RNA genomes • How could these viruses transForm cells? • 1970 - Discovery oF retroviral reverse transcriptase, Temin & BalZmore; Nobel Prize 1975 3 Reverse transcriptase • Enzyme that countered Central Dogma: DNA => RNA => protein • Retroviruses got their name because oF their ability to reverse the flow oF geneZc inFormaon 4 retroviruses hepaZs B virus reovirus Poliovirus Sindbis virus Influenza virus VSV 5 Balmore and Temin independently discovered RT in virions of RNA tumor viruses Listen to TWiV #100 (BalZmore) and TWiV #66 (Reverse transcripZon) For more insight 6 Temin’s insight • Retroviral DNA was integrated into host genome • Became permanent part oF host DNA • Provirus 7 Lessons from lambda 8 9 10 11 Reverse transcriptase Base P OH 5’- Primer -3’OH 3’- -5’ Direction Of Chain Growth • Primer can be DNA or RNA • Primer must have paired 3’-OH terminus • Template can be RNA or DNA • Only dNTPs, not rNTPs, are incorporated • Correct incoming dNTP is selected by base pairing 12 RT • Some strains oF myxobacteria, E.
    [Show full text]
  • Efficacy and Safety Analyses of a Recombinant Human Immunodeficiency Virus Type 1 Derived Vector System
    Gene Therapy (1999) 6, 715–728 1999 Stockton Press All rights reserved 0969-7128/99 $12.00 http://www.stockton-press.co.uk/gt Efficacy and safety analyses of a recombinant human immunodeficiency virus type 1 derived vector system L-J Chang1, V Urlacher1, T Iwakuma1, Y Cui1 and J Zucali2 1Department of Molecular Genetics and Microbiology, Gene Therapy Center, University of Florida Brain Institute; and 2Department of Oncology, University of Florida, Gainesville, FL, USA Lentiviruses infect both dividing and nondividing cells. In in pHP. The ability of this vector system to transduce divid- this study we characterized a lentiviral vector system con- ing and nondividing cell in vitro and in vivo was also dem- sisting of a packaging vector (pHP) and a transducing vec- onstrated. Compared with a Moloney murine leukemia tor (pTV) derived from a recombinant human immunodefi- virus (MLV) vector, the HP/TV vectors transduced human ciency virus type 1 (HIV-1). In pHP, the long terminal muscle-, kidney-, liver-derived cell lines and CD34+ primary repeats (LTRs), the 5Ј untranslated leader and portions of hematopoietic progenitor cells more efficiently. Although the env and nef genes were deleted. The leader sequence the levels of the pTV transgene expression were high soon of pHP was substituted with a modified Rous sarcoma virus after transduction, the expression tended to decrease with (RSV) 59 bp leader containing a mutated RSV gag AUG time due either to the loss of proviral DNA or to the inacti- and a functional 5Ј splice site. The pHP construct was vation of promoter activity, which was found to be cell type- found to direct Gag-Pol synthesis as efficiently as wild-type dependent.
    [Show full text]
  • Structure of the Ty3/Gypsy Retrotransposon Capsid and the Evolution of Retroviruses
    Structure of the Ty3/Gypsy retrotransposon capsid and the evolution of retroviruses Svetlana O. Dodonovaa,b, Simone Prinza,1, Virginia Bilanchonec, Suzanne Sandmeyerc, and John A. G. Briggsa,d,2 aStructural and Computational Biology Unit, European Molecular Biology Laboratory, 69117 Heidelberg, Germany; bDepartment of Molecular Biology, Max Planck Institute for Biophysical Chemistry, 37077 Gottingen, Germany; cDepartment of Biological Chemistry, University of California, Irvine, CA 92697; and dStructural Studies Division, MRC Laboratory of Molecular Biology, Cambridge Biomedical Campus, CB2 0QH Cambridge, United Kingdom Edited by Wesley I. Sundquist, University of Utah Medical Center, Salt Lake City, UT, and approved March 29, 2019 (received for review January 21, 2019) Retroviruses evolved from long terminal repeat (LTR) retrotranspo- a bilobar capsid domain with structural similarity to retroviral CA sons by acquisition of envelope functions, and subsequently rein- proteins (11, 12). Arc was recently shown to form capsid-like vaded host genomes. Together, endogenous retroviruses and LTR structures, which are implicated in neuronal function and mem- retrotransposons represent major components of animal, plant, and ory (13, 14). fungal genomes. Sequences from these elements have been exapted The GAG gene in retroviruses and retrotransposons is initially to perform essential host functions, including placental development, expressed as Gag and Gag-Pol precursor polyproteins. Gag is synaptic communication, and transcriptional regulation. They encode greatly abundant over Gag-Pol and forms the structural basis of a Gag polypeptide, the capsid domains of which can oligomerize to immature particle assembly and genome packaging (15, 16). In form a virus-like particle. The structures of retroviral capsids have retroviruses, the conserved domains of Gag are MA (the matrix been extensively described.
    [Show full text]
  • Effect of Rous Sarcoma Virus Infection on Recovery of Nucleolar RNA, Ribonucleoprotein, and DNA Synthesis from Inhibition by Actinomycin D'
    [CANCER RESEARCH 29, 1598-1605, August 1969] Effect of Rous Sarcoma Virus Infection on Recovery of Nucleolar RNA, Ribonucleoprotein, and DNA Synthesis from Inhibition by Actinomycin D' R. Gerald Suskind, Thomas W. Pry, and Giancarlo F. Rabotti: Laboratory of Experimental Pathology, National Institute of Arthritis and Metabolic Disease, and Viral Biology Branch, National Cancer Institute, NIH, Bethesda, Maryland 20014 SUMMARY Rous sarcoma virus (RSV) remains poorly understood, and relatively little is known about the site and manner of viral The effect of Rous sarcoma virus (RSV) infection on the RNA synthesis (15, 16, 23-26, 32, 33, 38-40; S. W. C. Fiske recovery of nucleolar RNA and protein synthesis from selec- and F. Gaguenau, unpublished data). Studies with metabolic tive inhibition by actinomycin D was investigated using radio- inhibitors of RNA synthesis, such as actinomycin, and inhibi- autographic technics. A transient increase in the grain count tors of DNA and protein synthesis have shown a complex over nucleoli of actinomycin-treated cells, pulse-labeled with interdependence of infectivity and transformation with cellu- tritiated uridine, was observed in cells 10 to 18 hours after lar DNA and protein synthesis (2-4, 14, 20, 38, 39, 42, 43); infection with Bryan strain RSV. The proportion of the total however, the mechanism of inhibition is still incompletely RNA synthesized in the nucleolus at that time is greater than understood. Early administration of actinomycin results in in- in infected or uninfected cells not treated with actinomycin. hibition of cellular transformation (4, 38, 42) and will prevent In mock-infected cells, or in cells exposed to inactivated virus, RNA labeling of the purified virus particle (23).
    [Show full text]
  • HIV-1 Gag Binding Specificity for Psi: Implications for Virus Assembly
    HIV-1 Gag Binding Specificity for Psi: Implications for Virus Assembly THESIS Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University By Shuohui Liu Graduate Program in Chemistry The Ohio State University 2017 Master's Examination Committee: Dr. Karin Musier-Forsyth, Advisor Dr. Thomas Magliery Copyrighted by Shuohui Liu 2017 Abstract Human immunodeficiency virus type 1 (HIV-1) Gag is a polyprotein consisting of matrix (MA), capsid (CA), nucleocapsid (NC) and p6 domains, as well as two short spacer peptides, SP1 and SP2. During virus assembly, two copies of viral genomic RNA (gRNA) are selectively packaged into viral particles via specific interactions between Gag and gRNA packaging signal (Ψ), despite the vast abundance of cellular RNAs and spliced viral RNAs. However, the mechanism by which Gag specifically recognizes gRNA is not completely understood. In this study, several elements that are important for Gag’s binding specificity for Ψ were investigated using salt-titration binding assays. Salt- titration binding assays measure retroviral Gag’s ability to specifically recognize gRNA. Two parameters, Kd(1M) and Zeff, are obtained. Kd(1M) measures the non-electrostatic component of binding and Zeff measures the effective charge of the binding, reflecting the electrostatic component. In chapter 2, the role of MA domains from different retroviruses was tested. Even though MA does not directly interact with gRNA, it is still indispensable for maximum binding specificity in gRNA recognition. Chimeric proteins, wherein MA domains from HIV-1 and Rous sarcoma virus (RSV) were swapped, were made to test the specificity of MA.
    [Show full text]