Inhibition of Wnt-1 Signaling Induces Apoptosis in ß-Catenin-Deficient

[CANCER RESEARCH 64, 3474–3478, May 15, 2004] Inhibition of Wnt-1 Signaling Induces Apoptosis in ␤-Catenin-Deficient Mesothelioma Cells

Liang You, Biao He, Kazutsugu Uematsu, Zhidong Xu, Julien Mazieres, Amie Lee, Frank McCormick, and David M. Jablons Thoracic Oncology Laboratory, Department of Surgery, Comprehensive Cancer Center, University of California, San Francisco, California

ABSTRACT Moreover, we have found that Wnt-1 is expressed in many human cancer cell lines and tissues, and we have also demonstrated that ␤ It is known that Wnt-1 signaling inhibits apoptosis by activating -cate- blockade of Wnt-1 signaling [by Wnt-1 small interfering (si)RNA or nin/tcf-mediated transcription. Here, we show that blocking Wnt-1 sig- ␤ a Wnt-1-targeted monoclonal antibody] induces apoptosis in some naling in -catenin-deficient mesothelioma cell lines H28 and MS-1 in- ␤ duces apoptotic cell death. Both Wnt-1 small interfering RNA (siRNA) human cancer cells (17). This apoptotic induction should be -cate- and Dishevelled siRNA induced significant apoptosis in these cell lines. A nin/Tcf-dependent based on the antiapoptosis mechanism proposed small molecule inhibitor of c-Jun NH2-terminal kinase inhibited the ap- for Wnt-1 signaling (10, 12). On the basis of our recent findings, optotic cell killing induced by either Wnt-1 siRNA or Dishevelled siRNA however, we hypothesized that Wnt noncanonical pathway(s) (e.g., in these cells. Our data suggest that ␤-catenin-independent noncanonical Wnt/JNK pathway) may play a role in the apoptosis inhibition caused pathway(s), i.e., Wnt/JNK pathway, may play a role in the apoptotic by Wnt-1 signaling. inhibition caused by Wnt-1 signaling.

INTRODUCTION MATERIALS AND METHODS

Wnt ligand binds directly to its receptor Frizzled (Fz), and this Cell Lines and Tissue Samples. Human non-small cell lung cancer cell binding activates canonical and noncanonical pathways (1, 2). The line NCI-H1703 and human mesothelioma cancer cell line H28 were from activation of the canonical pathway leads to signal transduction American Type Culture Collections (Manassas, VA). Human mesothelioma through Dishevelled (Dvl) and results in ␤-catenin stabilization and cancer cell line MS-1 was from NIH. These cells were cultured in RPMI 1640 accumulation in the cytoplasm. ␤-Catenin translocates into the nu- supplemented with 10% fetal bovine serum, penicillin (100 IU/ml), and strep- cleus and binds to Tcf/Lef transcription factors to make a het- tomycin (100 ␮g/ml). All cells were cultured at 37°C in a humid incubator with erodimeric complex that activates the transcription of Wnt target 5% CO2. genes, e.g., c-myc and cyclin D1 (3–6). ␤-Catenin is a key mediator RNA Interference. Cells were plated into a 6-well plate with fresh media of the Wnt signal. Noncanonical pathways, referred as Wnt signaling without antibiotics 24 h before testing. The ion-exchange high-performance pathways that signal independently of ␤-catenin, may signal through liquid chromatography-purified siRNAs (Wnt-1 siRNA, Dvl siRNA, and nonsilencing siRNA control, Ͼ97% pure) were purchased from Qiagen-Xeragon calcium flux, c-Jun NH -terminal kinase (JNK), and G proteins (7). 2 (Germantown, MD). The siRNA-targeted both human Wnt-1 are derived from Wnt-1 was originally described as a proto-oncogene in mouse a mRNA sequence (GGTTCCATCGAATCCTGCA) of human Wnt-1. The mammary tumor induced by mouse mammary tumor virus (8). Re- siRNA-targeted both human Dvl-1 and Dvl-3 are derived from an mRNA ␤ cently, it has been shown that Wnt-1/ -catenin signaling promotes sequence (AACAAGATCACCTTCTCCGAG) of human Dvl-3, which is iden- cell survival in various cell types (9–11). For instance, Chen et al. tical in that of human Dvl-1, and the one targeted human Dvl-2 is derived from (10) have recently shown that Wnt-1 signaling inhibits apoptosis a mRNA sequence (AACTTTGAGAACATGAGCAAC) of human Dvl-2 (18). through ␤-catenin and that cells expressing Wnt-1 resist apoptosis The siRNA-targeted human JNK1 are derived from a mRNA sequence CGT- induction by chemotherapy. In addition, c-Myc was identified as one GGATTTATGGTCTGTG of human JNK1, and the siRNA-targeted human of the transcriptional targets of ␤-catenin/Tcf in colorectal cancer cells JNK2 was purchased from Upstate-Dharmacon (Charlottesville, VA). The (5), suggesting that Wnt signaling functions in oncogenesis, in part, is control (nonsilencing) siRNA was purchased from Qiagen-Xeragon, and it through the growth promoting activity of c-Myc (12). At least two does not target any known mammalian gene (the targeted sequence is AAT- classes of Wnt antagonists have been reported and both classes of TCTCCGAACGTGTCACGT). The lyophilized siRNAs were dissolved in annealing buffer and reheated to 95°C for 1 min followed by1hat37°C molecules prevent ligand-receptor interactions. The first class, includ- incubation. siRNA transfection was performed according to the manufacturer’s ing secreted Frizzled-related proteins family and Wnt inhibitory protocol. After siRNA transfection, incubate plates for 3–5 days at 37°C before factor-1, binds directly to Wnt ligand. The second class, including additional analysis. Dickkopf family, binds to a low-density lipoprotein-receptor-related Antibody Incubation with Cells. The anti-Wnt-1 mouse monoclonal an- protein 6, a subunit of Wnt receptor complex (13). Down-regulation tibody (IgG1) was custom-made (17) at Rockland, Inc. (Gilbertsville, PA). of ␤-catenin levels by secreted Frizzled-related proteins and Dick- Cells were plated in 6-well plates or 10-cm dishes 1 day before experiments. kopf-1 sensitize cells to proapoptotic stimuli (14). Then normal media were replaced by media containing antibodies various To date, ␤-catenin-independent mechanism(s) have not been linked concentrations, and the cells were incubated at 37°C in a humid incubator with with the apoptotic inhibition caused by Wnt-1 signaling. We have 5% CO2. At various time points, the cells were collected using standard recently shown evidence of Wnt pathway activation through Dvl protocols for additional analysis. overexpression in both human lung cancer and mesothelioma (15, 16). Western Blotting. Standard protocol was used. Anti-Dvl3 and anti- survivin antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-caspase3 antibody was from Oncogene (Cambridge, MA). Anti-␤-actin Received 1/13/04; revised 2/21/04; accepted 3/17/04. antibody was obtained from Cell Signaling Technology, Inc. (Beverly, MA). Grant support: The Larry Hall Memorial Trust and the Kazan, McClain, Edises, ␤ Abrams, Fernandez, Lyons & Farrise Foundation. Anti- -catenin antibody was purchased from Transduction Laboratories (Lex- The costs of publication of this article were defrayed in part by the payment of page ington, KY). Anti-Active-JNK antibody was from Promega (Madison, WI). charges. This article must therefore be hereby marked advertisement in accordance with Anti-JNK antibody was from purchased from Upstate-Dharmacon. Anti-cyto- 18 U.S.C. Section 1734 solely to indicate this fact. chrome c antibody was from BD Biosciences (San Diego, CA). For detecting Requests for reprints: David M. Jablons, Department of Surgery, Cancer Center, ␤ 1600 Divisadero Street, C322C, Box 1674, San Francisco, CA 94115. Phone: (415) 353- alteration of -catenin, cytosolic extracts were prepared and examined as 7502; Fax: (415) 502-3179; E-mail: [email protected]. described previously (16). 3474

necrotic or late apoptotic stages were labeled with both Annexin V-FITC and propidium iodide. TOPFLASH Assay. Cells were plated in 6-well plates. The TOPFLASH or FOPFLASH reporter plasmid was transfected transiently into cells as described previously (16). Tcf-mediated gene transcription was determined by the ratio of pTOPFLASH:pFOPFLASH luciferase activity, and each was normalized to luciferase activities of the pRL-TK reporter (cotransfected internal control). All experiments were performed in triplicate.

Fig. 1. Human mesothelioma cell lines H28 and MS-1 have no cytosolic ␤-catenin and RESULTS AND DISCUSSION Tcf-mediated transcription activity. A, Western analysis of Dishevelled (Dvl)-3 and ␤-catenin expression in malignant plural mesothelioma cell lines H28 and MS-1 and a To test our hypothesis that ␤-catenin is not essential for Wnt-1- non-small cell lung cancer cell line H1703. ␤-Actin was used as loading control. Cytosolic proteins were prepared and used in these Western blots. B, TOPFLASH assay of Tcf- induced apoptosis inhibition, the mesothelioma cell line H28, con- dependent transcriptional activity in mesothelioma cell lines H28 and MS-1 and non-small taining a homozygous deletion of the ␤-catenin gene, was chosen for cell lung cancer cell line H1703. The results are means Ϯ SD (error bars). Experiments were performed in triplicate. this study (19). A non-small cell lung cancer cell line H1703 (16) and another mesothelioma cell line MS-1 (20) were also used for control experiments. All these cell lines were found to express Wnt-1 protein by Western blot analysis. The homozygous deletion of ␤-catenin in Apoptosis Analysis. Cells were harvested by trypsinization and stained using an Annexin V FITC Apoptosis Detection kit (Oncogene, Cambridge, H28 cell line was confirmed by Southern blot analysis, and lack of ␤ MA), according to the manufacture’s protocol. Then stained cells were imme- -catenin expression was validated using Northern and Western blot diately analyzed by flow cytometry (FACScan; Becton Dickinson, Franklin analysis. We checked their protein expression of cytosolic ␤-catenin Lake, NJ). Early apoptotic cells with exposed phosphatidylserine but intact cell and Dvl-3, and we found no cytosolic ␤-catenin protein in both H28 membranes bound to Annexin V-FITC but excluded propidium iodide. Cells in and MS-1 cells (Fig. 1A). In a TOP/FOP analysis, lower Tcf/lef

Fig. 2. Inhibition of Wnt-1 signaling induces apoptosis in H28 and MS-1 cells. A, 0.5% Crystal Violet staining of mesothelioma cell lines H28 and MS-1 and non-small cell lung cancer cell line H1703 after transfection of nonsilencing control siRNA or Wnt-1 siRNA (17) (ϳ5–6 days after Oligo- fectamine transfection). Concentration of both control and Wnt-1 siRNA used is 100 nM. B, examples of Annexin V analysis of apoptosis induced by Wnt-1 siRNA in mesothelioma cell lines H28 and MS-1. The cells were transfected with 100 nM nonsilencing control siRNA or 100 nM Wnt-1 siRNA, respectively. Flow cytometry analysis was performed 4–5 days after transfection. FL1-H (x axis) represents Annexin V-FITC staining, and FL3-H (y axis) represents propidium iodide staining. C, Western analysis after Wnt-1 siRNA transfection in cell lines H28, MS-1, and H1703 (100 nM for 4–5 days). Nonsi- lencing siRNA was used as control (ctrl). ␤-Actin served as loading control. Cytosolic proteins were prepared and used in these Western blots, except that whole cell extract was used for probing Wnt-1 protein. D, 0.5% Crystal Violet staining of cell lines H28, MS-1, and H1703 after an anti-Wnt-1 monoclonal antibody treatment (17) (ϳ4–5 days after treatment). Concen- tration of both control and anti-Wnt-1 monoclonal antibodies used is 10 ␮g/ml. E, apoptosis analysis by flow cytometry (Annexin V staining) after anti-Wnt-1 monoclonal antibody treatment (10 ␮g/ml for 3–4 days) in cell lines H28, MS-1, and H1703. The results (percentage of apoptotic cells) are the means Ϯ SD (error bars). Experiments were performed in triplicate, and a total of 20,000 cells was analyzed in each individual experiment. F, Western analysis after the anti- Wnt-1 monoclonal antibody treatment (10 ␮g/ml for 3–4 days) in cell lines H28, MS-1, and H1703. ␤-Actin served as loading control. Cytosolic proteins were prepared and used in these Western blots. G, Western analysis of survivin expression in C57Wnt1 and C57 MG cells. ␤-Actin served as loading control.

3475

Fig. 3. Dishevelled (Dvl) siRNA induces apoptosis in H28 and MS-1 cells. A, 0.5% Crystal Violet staining of cell lines H28, MS-1, and H1703 after transfection of nonsilencing control siRNA or Dvl siRNA (16)(ϳ5–6 days after transfection). Concentration of both control and Dvl siRNA used is 100 nM. B, apoptosis analysis by flow cytometry (Annexin V staining) after Dvl siRNA transfection in cell lines H28, MS-1, and H1703 (100 nM for 4–5 days). The results (percentage of apoptotic cells) are the means Ϯ SD (error bars). Experiments were performed in triplicate, and a total of 20,000 cells was analyzed in each individual experiment. C, Western analysis after Dvl siRNA transfection in cell lines H28, MS-1, and H1703 (100 nM for 4–5 days). Nonsilencing siRNA was used as control. ␤-Actin served as loading control. Cytosolic proteins were prepared and used in these Western blots. transcription activity level was detected in both H28 and MS-1 cells when compared with H1703 cells. As expected, reexpression of ␤-catenin in H28 cell line was able to restore the Tcf/lef transcription activity (Fig. 1B). To assess the role of Wnt-1 in the H28 cells lacking ␤-catenin, Wnt-1 siRNA and anti-Wnt-1 monoclonal antibody were used to treat the cells. Interestingly, Wnt-1 siRNA was able to kill ␤-catenin- deficient H28 cells (Fig. 2A), and this cell killing was largely because of apoptosis induction (Fig. 2B). The blockade of Wnt-1 signaling was confirmed by checking the expression of Wnt-1 signaling mediators (Fig. 2C). Wnt-1 is down-regulated by Wnt-1 siRNA, and a Wnt intracellular signaling molecule, Dvl-3, is down-regulated in the H28 cells treated with Wnt-1 siRNA. An inhibitor of apoptosis, survivin, was down-regulated and cytochrome c was up-regulated after the Fig. 4. The small molecule c-Jun NH2-terminal kinase (JNK) inhibitor (SP600125) blockade of Wnt-1 signaling. MS-1 cell line lacking cytosolic ␤-cate- inhibits apoptosis induced by Wnt-1 siRNA, anti-Wnt-1 monoclonal antibody, or Dishev- elled (Dvl) siRNA in H28 and MS-1 cells. A, 0.5% Crystal Violet staining of mesothe- nin showed similar apoptotic and downstream effect after treatment lioma cell line H28 and NSCLC cell line H460 (expressing ␤-catenin) after transfection with Wnt-1 siRNA. Moreover, similar results were seen when we of nonsilencing control siRNA, Dvl siRNA, or Wnt-1 siRNA (ϳ5–6 days after transfec- treated both H28 and MS-1 cells with an anti-Wnt-1 monoclonal tion) in the presence (bottom wells) and absence (top wells) of the JNK inhibitor SP600125 (10 nM). Concentration of all siRNA used is 100 nM. B–E, morphologies of H28 antibody (Fig. 2D–F; Ref. 17). We have found that C57Wnt-1 cells cells after the treatment with control monoclonal antibody alone, anti-Wnt-1 monoclonal expresses higher level of surviving when compared with the control antibody alone, control monoclonal antibody plus the JNK inhibitor SP600125, and C57mv7 cells (Fig. 2, G), suggesting that Wnt-1 signaling may induce anti-Wnt-1 monoclonal antibody plus SP600125, respectively. Antibody concentration used is 10 ␮g/ml, and SP600125 concentration used is 10 nM. F, apoptosis analysis by survivin expression in C57MG cells. A non-small cell lung cancer cell flow cytometry (Annexin V staining) in the presence and absence of the JNK inhibitor line H1703, which is known to have ␤-catenin/tcf-mediated transcrip- SP600125 (10 nM) after siRNA transfection (100 nM for 4–5 days) or monoclonal antibody treatment (10 ␮g/ml for 3–4 days) in cell lines H28 and MS-1. The results tion activity, was used as a control. Both Wnt-1 siRNA and the (percentage of apoptotic cells) are the means Ϯ SD (error bars). Experiments were anti-Wnt-1 monoclonal antibody induced apoptotic cell killing in performed in triplicate, and a total of 20,000 cells was analyzed in each individual H1703 cells. Furthermore, we have demonstrated recently that Wnt-1 experiment. G, Western analysis in the presence and absence of the JNK inhibitor SP600125 (10 nM) after siRNA transfection (100 nM for 4–5 days) or monoclonal siRNA induces apoptosis in a breast cancer cell line MCF-7 that also antibody treatment (10 ␮g/ml for 3–4 days) in cell lines H28 and MS-1. ␤-Actin served contains wild-type ␤-catenin (17). These data suggest that a ␤-cate- as loading control. Cytosolic proteins were prepared and used in these Western blots. H, nin-independent mechanism(s) is responsible for the apoptosis in- 0.5% Crystal Violet staining of mesothelioma cell line H28 cells after the treatment with control monoclonal antibody alone, anti-Wnt-1 monoclonal antibody alone, control mono- duced by blocking Wnt-1 signaling. To our knowledge, this is the first clonal antibody plus JNK siRNA, and anti-Wnt-1 monoclonal antibody plus JNK siRNA, proof that ␤-catenin is not essential for Wnt-1-induced apoptotic respectively. Antibody concentration used is 10 ␮g/ml, and JNK siRNA used is 100 nM. ␤ I, Western analysis of JNK protein expression in H28 cells after the treatment with control inhibition. It was demonstrated that Wnt-1/ -catenin/Tcf signaling monoclonal antibody alone or anti-Wnt-1 monoclonal antibody. ␤-Actin served as loading inhibited apoptosis by preventing cytochrome c release and subse- control. 3476

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2004 American Association for Cancer Research. Wnt-1 SIGNALING BLOCKADE AND APOPTOSIS quent caspase activation; however, ␤-catenin/Tcf transcription is re- vation of JNK was not noticed in most of the cancer cells naturally quired for this Wnt-1-mediated cell survival (10, 12). expressing both Wnt-1 and Dvl-3. JNK activation was only seen in The cytoplasmic Dvl family proteins are membrane-proximal sig- these cells after treatment with siRNA for either Wnt-1 or Dvl-3. nal intermediates in the Wnt signal pathway. Dvl interacts with Fz To further examine the possible involvement of JNK in Wnt-1- receptor and mediates Wnt-1 signaling in both canonical and nonca- induced apoptosis inhibition, a selective JNK-1, JNK-2, JNK-3 inhib- nonical pathways. Dvl proteins consist of DIX, PDZ, and DEP do- itor, SP600125 (30), was used to treat the H28 cells combined with mains. The COOH-terminal DEP domain has been connected with Wnt-1 siRNA, anti-Wnt-1 monoclonal antibody, or Dvl siRNA. Re- JNK pathway (21). More recently, the PDZ domain, which is involved cently, the JNK inhibitor has been shown to inhibit chemotherapy- in both canonical and noncanonical pathways, was found to bind induced apoptosis, at least in part, through the inhibition of caspase-3 directly to the COOH-terminal region of Fz (22). activity (31). In this study, this small molecule inhibitor of JNK To determine whether this ␤-catenin-independent apoptosis inhibi- inhibits significantly the apoptotic cell killing induced by Wnt-1 tion involves the Wnt signaling molecule Dvl, Dvl siRNA was used to siRNA, anti-Wnt-1 monoclonal antibody, or Dvl siRNA (Fig. 4). In treat H28 cell line (16). Dvl siRNA induced dramatic apoptosis in the the ␤-catenin-deficient H28 and MS-1 cells, the JNK inhibitor showed ␤-catenin-deficient H28 cells (Fig. 3, A and B). Similar apoptotic limited toxicity in cultured cells and reduced dramatically the apo- effect was also seen in MS-1 cells that lack cytoplasmic ␤-catenin ptotic cell death induced by either Wnt-1 siRNA or Dvl siRNA (Fig. (Fig. 3, A and B). After Dvl siRNA treatment, Dvl-3 was confirmed to 4, A–F). In a non-small cell lung cancer cell line H460 with intact be down-regulated in all three cell lines by Western blot analysis. An ␤-catenin, the JNK inhibitor failed to inhibit apoptotic cell death inhibitor of apoptosis, survivin, was down-regulated in both H28 and induced by Wnt-1 siRNA (Fig. 4A). These data suggest that the MS-1 cells treated with Dvl siRNA (Fig. 3C). Our earlier data indi- apoptosis induction in the H28 and MS-1 cells lacking ␤-catenin may cates that Dvl-specific siRNA treatment in H1703 decreased Dvl and require activated JNK pathway, and the results also suggest that both ␤-catenin expression, resulting in reduction of Tcf-dependent tran- canonical and noncanonical pathways may be involved in the apopto- scriptional activity and growth inhibition (16). The physiological sis induced by blockade of Wnt-1 signaling in H460 cells. The significance of down-regulation of Dvl-3 induced by Wnt-1 siRNA is inhibition of activated JNK-1 was confirmed by checking the acti- the inhibition of both canonical and noncanonical Wnt pathways, vated form of JNK-1 (Fig. 4G). By Western blot analysis, it was found therefore the downstream effects. that the cleaved form of caspase-3 was reduced and survivin was In a recent study, we have shown that Dvl-3 overexpression is up-regulated when treatment with the JNK inhibitor was combined consistent with higher expression of Wnt-1 in lung cancers, implicat- with Wnt-1 siRNA, anti-Wnt-1 antibody, or Dvl siRNA in both H28 ing that Wnt-1 may up-regulate Dvl-3 in these tumors (16). Dvl and MS-1 cells (Fig. 4G). These data suggest that caspase-3 and siRNA does not appear to affect expression levels of Dvl-1 and Dvl-2 survivin may be involved in the induction of apoptosis occurs as a because the expression levels for both Dvl-1 and Dvl-2 are minimally result of blocking Wnt-1 signaling. Furthermore, JNK siRNA was expressed in the samples tested (16). Interestingly, JNK was found to used to test if it can show similar effect as SP600125. Our results be up-regulated in these cells after blocking Wnt-1 signaling (Fig. 4). indicate that JNK siRNA was also able to inhibit the apoptosis We have also examined the links between Dvl and JNK. In one induced by an anti-Wnt-1 antibody in H28 cells (Fig. 4H). In addition, experiment, we transfected Dvl into two cell lines LARK1A and we have found that Wnt-2 siRNA also induces apoptosis in H28 cells H513, and the induced Dvl overexpression induced Tcf-dependent (data not shown), suggesting that this effect may be specific for more transcription activity and then did Western blot analysis using an than one Wnt-1 class proteins (e.g., Wnt-1, Wnt-2). Lastly, we have antiactive JNK antibody. Indeed, we noticed JNK inactivation in both shown that the inhibition of Wnt-1 signaling by an anti-Wnt-1 anti- cell lines after expressing exogenous Dvl when compared with the body does not affect protein level of JNK in H28 cells (Fig. 4I). same cell lines transfected with empty vector. In another test, the level Activation of JNK is essential for apoptosis induced by multiple of active JNK was reduced in the C57MG and H28 cells after a 24-h stress inducers, including tumor growth factor ␣ (32, 33). To date, treatment with Wnt-1 conditioned medium. Taken together, these little is known about the connection of Dvl and apoptosis in a findings suggest that Dvl may be required for the apoptotic inhibition JNK-dependent manner. This study suggests that Dvl inactivates the induced by Wnt-1 signaling and JNK may be up-regulated by block- JNK-dependent apoptotic pathway in some cancer cell lines. Blockade ing Dvl. of Wnt-1 signaling induces programmed cell death, at least in part, To date, the role of JNK pathway in Wnt signaling is still unclear through Dvl/JNK-dependent pathway. (7). It has been shown that Dvl induces JNK activity through DEP domain in planar cell polarity pathway in vertebrate cells (21). How- REFERENCES ever, several recent studies indicated that Wnt-5a, a JNK activator 1. Dann CE, Hsieh JC, Rattner A, Sharma D, Nathans J, Leahy DJ. Insights into Wnt involved in planar cell polarity pathway, serves as an antagonist of binding and signalling from the structures of two Frizzled cysteine-rich domains. Wnt canonical pathway mediated by Wnt-1 class signals (23, 24); Nature (Lond.) 2001;412:86–90. therefore, Wnt-5a may function as a tumor suppressor. Given the 2. Hsieh JC, Rattner A, Smallwood PM, Nathans J. Biochemical characterization of Wnt-frizzled interactions using a soluble, biologically active vertebrate Wnt protein. complexity of Wnt canonical and noncanonical pathways, it is con- Proc Natl Acad Sci USA 1999;96:3546–51. ceivable that Wnt-1 class and Wnt5a class may recruit different set of 3. Wodarz A, Nusse R. Mechanisms of Wnt signaling in development. Annu Rev Cell Dev Biol 1998;14:59–88. positive/negative regulators, including Dvl-binding proteins. Several 4. Uthoff SM, Eichenberger MR, McAuliffe TL, Hamilton CJ, Galandiuk S. Wingless- Dvl-binding proteins may directly or indirectly induce effects that type frizzled protein receptor signaling and its putative role in human colon cancer. consistent with our current findings. Firstly, a Wnt signaling-negative Mol Carcinog 2001;31:56–62. ␤ 5. He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of the APC regulator Axin can induce JNK activity and -catenin down-regula- pathway. Science (Wash. DC) 1998;281:1509–12. tion (25, 26). Secondly, an antagonist of Wnt signaling, Naked, was 6. Tetsu O, McCormick F. ␤-Catenin regulates expression of cyclin D1 in colon shown to interact with Dvl and negatively regulate ␤-catenin but carcinoma cells. Nature (Lond.) 1999;398:422–6. 7. Veeman MT, Axelrod JD, Moon RT. A second canon. Functions and mechanisms of positively regulate JNK-mediated planar cell polarity pathway (27, ␤-catenin-independent Wnt signaling. Dev Cell 2003;5:367–77. 28). Thirdly, a Dvl-associated kinase and positive regulator of Wnt 8. Nusse R, Varmus HE. Wnt genes. Cell 1992;69:1073–87. 9. Satoh S, Daigo Y, Furukawa Y, et al. AXIN1 mutations in hepatocellular carcinomas, signaling, Par-1, activates the canonical pathway but inhibits the and growth suppression in cancer cells by virus-mediated transfer of AXIN1. Nat JNK-mediated planar cell polarity pathway (29). In this study, acti- Genet 2000;24:245–50. 3477

10. Chen S, Guttridge DC, You Z, et al. Wnt-1 signaling inhibits apoptosis by activating 22. Wong HC, Bourdelas A, Krauss A, et al. Direct binding of the PDZ domain of ␤-catenin/T-cell factor-mediated transcription. J Cell Biol 2001;152:87–96. Dishevelled to a conserved internal sequence in the C-terminal region of Frizzled. 11. Ioannidis V, Beermann F, Clevers H, Held W. The ␤-catenin–TCF-1 pathway ensures Mol Cell 2003;12:1251–60. CD4(ϩ)CD8(ϩ) thymocyte survival. Nat Immunol 2001;2:691–7. 23. Topol L, Jiang X, Choi H, Garrett-Beal L, Carolan PJ, Yang Y. Wnt-5a inhibits the 12. You Z, Saims D, Chen S, et al. Wnt signaling promotes oncogenic transformation by canonical Wnt pathway by promoting GSK-3-independent ␤-catenin degradation. inhibiting c-Myc-induced apoptosis. J Cell Biol 2002;157:429–40. J Cell Biol 2003;162:899–908. 13. Nusse R. Developmental biology. Making head or tail of Dickkopf. Nature (Lond.) 24. Westfall TA, Brimeyer R, Twedt J, et al. Wnt-5/pipetail functions in vertebrate axis 2001;411:255–6. formation as a negative regulator of Wnt/␤-catenin activity. J Cell Biol 2003;162: 14. Shou J, Ali-Osman F, Multani AS, Pathak S, Fedi P, Srivenugopal KS. Human Dkk-1, 889–98. a gene encoding a Wnt antagonist, responds to DNA damage and its overexpression 25. Zhang Y, Neo SY, Wang X, Han J, Lin SC. Axin forms a complex with MEKK1 and sensitizes brain tumor cells to apoptosis following alkylation damage of DNA. activates c-Jun NH(2)-terminal kinase/stress-activated protein kinase through do- Oncogene 2002;21:878–89. mains distinct from Wnt signaling. J Biol Chem 1999;274:35247–54. 15. Uematsu K, Kanazawa S, You L, et al. Wnt pathway activation in mesothelioma: 26. Neo SY, Zhang Y, Yaw LP, Li P, Lin SC. Axin-induced apoptosis depends on the evidence of Dishevelled overexpression and transcriptional activity of ␤-catenin. extent of its JNK activation and its ability to down-regulate ␤-catenin levels. Biochem Cancer Res 2003;63:4547–51. Biophys Res Commun 2000;272:144–50. 16. Uematsu K, He B, You L, Xu Z, McCormick F, Jablons DM. Activation of the Wnt 27. Zeng W, Wharton KA Jr, Mack JA, et al. Naked cuticle encodes an inducible pathway in non-small cell lung cancer: evidence of dishevelled overexpression. antagonist of Wnt signalling. Nature (Lond.) 2000;403:789–95. Oncogene 2003;22:7218–21. 17. He B, You L, Uematsu K, et al. A monoclonal antibody against Wnt-1 induces 28. Yan D, Wallingford JB, Sun TQ, et al. Cell autonomous regulation of multiple apoptosis in human cancer cells. Neoplasia 2004;6:7–14. Dishevelled-dependent pathways by mammalian Nkd. Proc Natl Acad Sci USA 18. Li L, Mao J, Sun L, Liu W, Wu D. Second cysteine-rich domain of Dickkopf-2 2001;98:3802–7. activates canonical Wnt signaling pathway via LRP-6 independently of dishevelled. 29. Sun TQ, Lu B, Feng JJ, et al. PAR-1 is a Dishevelled-associated kinase and a positive J Biol Chem 2002;277:5977–81. regulator of Wnt signalling. Nat Cell Biol 2001;3:628–36. 19. Shigemitsu K, Sekido Y, Usami N, et al. Genetic alteration of the ␤-catenin gene 30. Bennett BL, Sasaki DT, Murray BW, et al. SP600125, an anthrapyrazolone inhibitor (CTNNB1) in human lung cancer and malignant mesothelioma and identification of of Jun N-terminal kinase. Proc Natl Acad Sci USA 2001;98:13681–6. a new 3p21.3 homozygous deletion. Oncogene 2001;20:4249–57. 31. Krilleke D, Ucur E, Pulte D, Schulze-Osthoff K, Debatin KM, Herr I. Inhibition of 20. Hsu SM, Hsu PL, Zhao X, Kao-Shan CS, Whang-Peng J. Establishment of human JNK signaling diminishes early but not late cellular stress-induced apoptosis. Int J mesothelioma cell lines (MS-1, -2) and production of a monoclonal antibody (anti- Cancer 2003;107:520–7. MS) with diagnostic and therapeutic potential. Cancer Res 1988;48:5228–36. 32. Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell 2000;103: 21. Boutros M, Paricio N, Strutt DI, Mlodzik M. Dishevelled activates JNK and discrim- 239–52. inates between JNK pathways in planar polarity and wingless signaling. Cell 1998; 33. Deng Y, Ren X, Yang L, Lin Y, Wu X. A JNK-dependent pathway is required for 94:109–18. TNF-␣-induced apoptosis. Cell 2003;115:61–70.

3478

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2004 American Association for Cancer Research. Inhibition of Wnt-1 Signaling Induces Apoptosis in β -Catenin-Deficient Mesothelioma Cells

Liang You, Biao He, Kazutsugu Uematsu, et al.

Cancer Res 2004;64:3474-3478.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/64/10/3474

Cited articles This article cites 33 articles, 12 of which you can access for free at: http://cancerres.aacrjournals.org/content/64/10/3474.full#ref-list-1

Citing articles This article has been cited by 8 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/64/10/3474.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/64/10/3474. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.