DOCSLIB.ORG

GATA3 Is Downregulated in HCC and Accelerates HCC Aggressiveness by Transcriptionally Inhibiting Slug Expression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
GATA3 Is Downregulated in HCC and Accelerates HCC Aggressiveness by Transcriptionally Inhibiting Slug Expression ONCOLOGY LETTERS 21: 231, 2021 GATA3 is downregulated in HCC and accelerates HCC aggressiveness by transcriptionally inhibiting slug expression ZHUOLIANG ZHANG, XINGLIANG FANG, GUILIN XIE and JINLONG ZHU Department of General Surgery I, The Affiliated Hospital of Shaoxing University, Shaoxing, Zhejiang 312000, P.R. China Received August 21, 2019; Accepted June 30, 2020 DOI: 10.3892/ol.2021.12492 Abstract. Previous studies have reported that GATA3 is resection, the overall prognosis of patients with HCC remains downregulated in multiple types of tumours, including poor despite marked improvements in surgical techniques and gastric cancer and osteosarcoma. The aim of this study was perioperative management (2‑4). The overall 5‑year survival to explore whether GATA3 serves as a tumour suppressor to rate of HCC is still <20% (5); thus, an improved understanding inhibit hepatocellular carcinoma (HCC) development. Tumour of the molecular mechanisms underlying HCC metastasis will tissue specimens and adjacent normal tissue specimens help prevent HCC recurrence and metastasis. were obtained from 162 patients diagnosed with HCC in the Epithelial‑mesenchymal transition (EMT) is a crucial Affiliated Hospital of Shaoxing University from July 2000 event in tumour metastasis, where epithelial cell layers lose to May 2018. The result of the present study demonstrated polarity and cell‑cell contact, which results in dramatic that GATA3 was downregulated in HCC tumour tissues remodelling of the cytoskeleton (6). The main characteristic compared with that of adjacent normal tissues. The expression of EMT is loss of E‑cadherin expression, which is associated of GATA3 was also negatively associated with tumour size, with tumour invasiveness, metastasis and poor prognosis (7‑9). TNM stage and lymph node metastasis. Additionally, analysis The activation of various ligands, such as vascular endothelial of the follow‑up data revealed that low GATA3 expression growth factor (VEGF), epidermal growth factor (EGF) and was closely correlated with poor survival. Gain and loss of transforming growth factor‑β (TGF‑β) can induce the expres‑ function analyses revealed that overexpression of GATA3 sion of several EMT‑associated transcription factors, including decreased the ability of proliferation, migration and invasion zinc finger e‑box binding homeobox (ZEB) 1, snail, slug and in HCC cell lines, whereas inhibition of GATA3 promoted Twist (10). A previous study has demonstrated positive correla‑ the ability of proliferation, migration and invasion. In addi‑ tions between EMT‑associated transcription factors and poor tion, GATA3 suppressed EMT through the regulation of slug clinical outcomes in cancer, such as lung cancer, breast cancer, expression. Additionally, slug overexpression attenuated the melanoma and HCC (10). inhibitory effects of GATA3 overexpression on cancer cell GATA3, a member of the GATA family (11,12), serves a proliferation, migration and invasion. Thus, GATA3 is down‑ crucial role in T‑cell proliferation and differentiation (13). In regulated in HCC, and suppresses cell proliferation, migration addition, numerous studies have demonstrated that GATA3 and invasion. Moreover, GATA3 transcriptionally inhibits slug serves different roles in different cancers, for example, GATA3 expression, thereby suppressing EMT in HCC. serves as a tumour activator in soft tissue sarcomas, endo‑ metrial carcinomas and neuroblastomas (14‑16). In addition, Introduction GATA3 suppresses cell proliferation, migration and invasion in osteosarcoma (17). Furthermore, a recent study demon‑ Liver cancer has become one of the most malignant cancers strated that zinc finger protein 503 (ZNF503) accelerates HCC worldwide (1), with hepatocellular carcinoma (HCC) cell aggressiveness by downregulating GATA3 expression accounting for ~80% cases of all cases (2). Due to the high via microRNA‑495, suggesting that GATA3 may serve as a rate of recurrence or intrahepatic metastasis after curative tumour suppressor in HCC (18). However, the detailed func‑ tion of GATA3 in HCC remains unclear. The aim of present study was to explore whether GATA3 serves as a tumour suppressor to inhibit HCC development and further investigate whether GATA3 may be a molecular Correspondence to: Dr Zhuoliang Zhang, Department of General Surgery I, The Affiliated Hospital of Shaoxing University, therapy target in HCC. 999 Zhongxingnan Road, Shaoxing, Zhejiang 312000, P.R. China E‑mail: [email protected] Materials and methods Key words: GATA3, proliferation, migration, invasion, Tumour samples. A total of 162 HCC tissues and adjacent epithelial‑mesenchymal transition non‑tumour tissues (resected 1‑2 cm from the malignant tumor) were obtained from the Affiliated Hospital of Shaoxing University from July 2000 to May 2018. These patients with 2 ZHANG et al: GATA3 SUPPRESSES HEPATOCELLULAR CARCINOMA CELL PROGRESSION gastric cancer included 92 males and 70 females aged between GCCCCAAAGATGAG‑3'; Snail forward, 5'‑GTTTACCTT 23‑78 years, with a mean age of 42.3 years. Tumour tissue CCAGCAGCCCT‑3', reverse, 5'‑TCCCAGATGAGCATTGG (TT) and adjacent non‑tumour tissue (ANT) were resected by CAG‑3'; ZEB1 forward, 5'‑GATGACCTGCCAACAGAC surgical excision. No prior treatments (including chemotherapy CA‑3', reverse: 5'‑CTGTGTCATCCTCCCAGCAG‑3'; and or radiotherapy) were conducted before liver resection surgery. GAPDH forward, 5'‑GAAAGCCTGCCGGTGACTAA‑3', Pathological staging was determined according to the seventh reverse, 5'‑AGGAAAAGCATCACCCGGAG‑3'. Each experi‑ edition of the tumour node metastasis (TNM) classification of ment was performed at least three times. the International Union Against Cancer (19). All tissue samples were confirmed using histopathological evaluation and stored Western blotting. Cell lysates were prepared using RIPA lysis at ‑80˚C until further use. The tissue samples were used in buffer (Pierce; Thermo Fisher Scientific, Inc.) with a protease accordance with the policies of the institutional review board inhibitor cocktail (Roche Applied Science) and protein at the Affiliated Hospital of Shaoxing University, China. The concentration was measured using a bicinchoninic acid kit study was approved the by the review board of the Affiliated (Beyotime Institute of Biotechnology) according to manufac‑ Hospital of Shaoxing University and written informed consent turer's protocol. Subsequently, 40 µg protein was separated on was obtained from all patients. 12% SDS‑PAGE and then transferred onto a PVDF membrane (EMD Millipore). After blocking with 5% non‑fat milk in Cell culture. HCC cell lines, including MHCC97‑H and TBST for 1 h at room temperature, membranes were incubated Hep3B were obtained from the Institute of Biochemistry with the indicated primary antibodies at 4˚C overnight. The and Cell Biology (Chinese Academy of Sciences). All cells primary antibodies used were as follows: GATA3 (1:1,000; cat. were cultured in DMEM medium (Thermo Fisher Scientific, no. ab199428; Abcam); E‑cadherin (1:1,000; cat. no. 14472; Inc.) supplemented with 100 U/ml penicillin‑streptomycin CST Biological Reagents Co., Ltd.); N‑cadherin (1:1,000; mixture (Beyotime Institute of Biotechnology) and 10% FBS cat. no. 13116; CST Biological Reagents Co. Ltd.); and Slug (Sigma‑Aldrich: Merck KGaA) at 37˚C with 5% CO2. (1:1,000; cat. no. ab51772; Abcam). The membranes were then washed with TBST three times and incubated with horse Cell transfection. Transfections were performed using radish peroxide‑conjugated goat anti‑rabbit IgG (1:2,000; cat. Lipofectamine® 2000 or Lipofectamine® RNAiMAX Reagent no. ab6721; Abcam) or goat anti‑mouse IgG (1:4,000; cat. (Invitrogen; Thermo Fisher Scientific, Inc.) according to the no. ab6789; Abcam) secondary antibodies for 1 h at room manufacturer's instructions. FLAG‑GATA3 (pcDNA3.1) and temperature. The specific bands were visualized using the FLAG‑slug (pcDNA3.1) plasmids were obtained from Vigene enhanced chemiluminescence (ECL; Merck KGaA) according Bioscience Inc. The sequences of small interfering (si)RNAs to manufacturer's protocol. β‑actin (1:5,000; cat. no. ab8226; were as follows: Scramble siRNA (SCR): 5'‑UUCUCCGA Abcam) was used as the internal control. Each experiment was ACGUGUCACGU‑3'; siGATA3#1: 5'‑AAACUAGGUCU performed at least three times. Western blotting densitometry GAUAUUCAUU‑3'; siGATA3#2: 5'‑CUUUAUUGCAUCUG was analysed using Image J software (v1.48; National Institutes GGUAGUU‑3'. For overexpression of GATA3 or/and slug, of Health). cells were transfected with 2.5 µg FLAG‑GATA3 and/or 2.5 µg FLAG‑slug using Lipofectamine® 2000. For inhibition Cell Counting Kit‑8 (CCK‑8) assay. CCK‑8 (Dojindo of GATA3, cells were transfected with 40 nM siRNAs using Molecular Technologies, Inc.) was utilized to determine the Lipofectamine® RNAiMAX Reagent. After transfection for effect of GATA3 on cell proliferation according to the manu‑ 48 h, cells were collected. facturer's instructions. Briefly, Hep3B and MHCC97‑H cells were transfected with FLAG‑GATA3 or GATA3 siRNA. After RNA extraction and quantitative reverse transcription quanti‑ transfection for 48 h, ~2x103 cells were seeded in 96‑well plates tative (RT‑q)PCR. Total RNA was extracted from tissue with 200 µl DMEM at 37˚C with 5% CO2. After 24 and 48 h of samples or cells using TRIzol® reagent (Invitrogen; Thermo incubation, 20 µl CCK‑8 reagent was added to each well and Fisher Scientific, Inc.) according to the manufacturer's instruc‑ cultured for 2 h. Finally, the absorbance at 450 nm measured tions. A total of 2 µg RNA was
Load more

Recommended publications
  • GATA3 As an Adjunct Prognostic Factor in Breast Cancer Patients with Less Aggressive Disease: a Study with a Review of the Literature
    diagnostics Article GATA3 as an Adjunct Prognostic Factor in Breast Cancer Patients with Less Aggressive Disease: A Study with a Review of the Literature Patrizia Querzoli 1, Massimo Pedriali 1 , Rosa Rinaldi 2 , Paola Secchiero 3, Paolo Giorgi Rossi 4 and Elisabetta Kuhn 5,6,* 1 Section of Anatomic Pathology, Department of Morphology, Surgery and Experimental Medicine, University of Ferrara, 44124 Ferrara, Italy; [email protected] (P.Q.); [email protected] (M.P.) 2 Section of Anatomic Pathology, ASST Mantova, Ospedale Carlo Poma, 46100 Mantova, Italy; [email protected] 3 Surgery and Experimental Medicine and Interdepartmental Center of Technology of Advanced Therapies (LTTA), Department of Morphology, University of Ferrara, 44121 Ferrara, Italy; [email protected] 4 Epidemiology Unit, Azienda Unità Sanitaria Locale-IRCCS di Reggio Emilia, 42122 Reggio Emilia, Italy; [email protected] 5 Division of Pathology, Fondazione IRCCS Ca’ Granda, Ospedale Maggiore Policlinico, 20122 Milano, Italy 6 Department of Biomedical, Surgical, and Dental Sciences, University of Milan, 20122 Milano, Italy * Correspondence: [email protected]; Tel.: +39-02-5032-0564; Fax: +39-02-5503-2860 Abstract: Background: GATA binding protein 3 (GATA3) expression is positively correlated with Citation: Querzoli, P.; Pedriali, M.; estrogen receptor (ER) expression, but its prognostic value as an independent factor remains unclear. Rinaldi, R.; Secchiero, P.; Rossi, P.G.; Thus, we undertook the current study to evaluate the expression of GATA3 and its prognostic value Kuhn, E. GATA3 as an Adjunct in a large series of breast carcinomas (BCs) with long-term follow-up. Methods: A total of 702 Prognostic Factor in Breast Cancer consecutive primary invasive BCs resected between 1989 and 1993 in our institution were arranged Patients with Less Aggressive in tissue microarrays, immunostained for ER, progesterone receptor (PR), ki-67, HER2, p53, and Disease: A Study with a Review of GATA3, and scored.
    [Show full text]
  • A Core Transcriptional Network Composed of Pax2/8, Gata3 and Lim1 Regulates Key Players of Pro/Mesonephros Morphogenesis
    Developmental Biology 382 (2013) 555–566 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/locate/developmentalbiology Genomes and Developmental Control A core transcriptional network composed of Pax2/8, Gata3 and Lim1 regulates key players of pro/mesonephros morphogenesis Sami Kamel Boualia a, Yaned Gaitan a, Mathieu Tremblay a, Richa Sharma a, Julie Cardin b, Artur Kania b, Maxime Bouchard a,n a Goodman Cancer Research Centre and Department of Biochemistry, McGill University, 1160 Pine Ave. W., Montreal, Quebec, Canada H3A 1A3 b Institut de Recherches Cliniques de Montréal, Montréal, Québec, Canada H2W 1R7, Department of Anatomy and Cell Biology, Division of Experimental Medicine, McGill University, Montréal, Quebec, Canada, H3A 2B2 and Faculté de médecine, Université de Montréal, Montréal, Quebec, Canada, H3C 3J7. article info abstract Article history: Translating the developmental program encoded in the genome into cellular and morphogenetic Received 23 January 2013 functions requires the deployment of elaborate gene regulatory networks (GRNs). GRNs are especially Received in revised form crucial at the onset of organ development where a few regulatory signals establish the different 27 July 2013 programs required for tissue organization. In the renal system primordium (the pro/mesonephros), Accepted 30 July 2013 important regulators have been identified but their hierarchical and regulatory organization is still Available online 3 August 2013 elusive. Here, we have performed a detailed analysis of the GRN underlying mouse pro/mesonephros Keywords: development. We find that a core regulatory subcircuit composed of Pax2/8, Gata3 and Lim1 turns on a Kidney development deeper layer of transcriptional regulators while activating effector genes responsible for cell signaling Transcription and tissue organization.
    [Show full text]
  • GATA3 Acts Upstream of FOXA1 in Mediating ESR1 Binding by Shaping Enhancer Accessibility
    Downloaded from genome.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Research GATA3 acts upstream of FOXA1 in mediating ESR1 binding by shaping enhancer accessibility Vasiliki Theodorou,1 Rory Stark,2 Suraj Menon,2 and Jason S. Carroll1,3,4 1Nuclear Receptor Transcription Lab, 2Bioinformatics Core, Cancer Research UK, Cambridge Research Institute, Li Ka Shing Centre, Cambridge CB2 0RE, United Kingdom; 3Department of Oncology, University of Cambridge, Cambridge CB2 OXZ, United Kingdom Estrogen receptor (ESR1) drives growth in the majority of human breast cancers by binding to regulatory elements and inducing transcription events that promote tumor growth. Differences in enhancer occupancy by ESR1 contribute to the diverse expression profiles and clinical outcome observed in breast cancer patients. GATA3 is an ESR1-cooperating transcription factor mutated in breast tumors; however, its genomic properties are not fully defined. In order to investigate the composition of enhancers involved in estrogen-induced transcription and the potential role of GATA3, we performed extensive ChIP-sequencing in unstimulated breast cancer cells and following estrogen treatment. We find that GATA3 is pivotal in mediating enhancer accessibility at regulatory regions involved in ESR1-mediated transcription. GATA3 silencing resulted in a global redistribution of cofactors and active histone marks prior to estrogen stimulation. These global genomic changes altered the ESR1-binding profile that subsequently occurred following estrogen, with events exhibiting both loss and gain in binding affinity, implying a GATA3-mediated redistribution of ESR1 binding. The GATA3-mediated redistributed ESR1 profile correlated with changes in gene expression, suggestive of its functionality. Chromatin loops at the TFF locus involving ESR1-bound enhancers occurred independently of ESR1 when GATA3 was silenced, indicating that GATA3, when present on the chromatin, may serve as a licensing factor for estrogen–ESR1-mediated interactions between cis-regulatory elements.
    [Show full text]
  • A Combination of GATA3 and SOX10 Is Useful for the Diagnosis of Metastatic Triple-Negative Breast Cancer☆ Gary H
    Human Pathology (2019) 85,221–227 www.elsevier.com/locate/humpath Original contribution A combination of GATA3 and SOX10 is useful for the diagnosis of metastatic triple-negative breast cancer☆ Gary H. Tozbikian MD⁎, Debra L. Zynger MD Department of Pathology, The Ohio State University Wexner Medical Center, Columbus, OH 43210, USA Received 9 July 2018; revised 2 November 2018; accepted 7 November 2018 Keywords: Summary In metastatic breast cancer (MBC), it can be difficult to establish the origin if the primary tumor is Triple negative; triple negative or if there is a loss of biomarker expression. SOX10 expression has been reported in primary Breast cancer; triple-negative breast cancer but is poorly studied in metastatic lesions. In this study, the diagnostic utility of SOX10; a panel of SOX10, GATA3, and androgen receptor (AR) in MBC negative for estrogen receptor, progester- GATA3; one receptor, and human epidermal growth factor receptor 2 was evaluated and compared with the expres- Metastatic; sion of these markers in the matched primary breast cancer. In a series of 57 triple-negative MBCs, 82% Primary were positive for GATA3, 58% for SOX10, and 25% for AR. Nearly all MBCs (95%) were positive for ei- ther GATA3 or SOX10, with 46% dual positive and 5% of cases negative for both markers. Most GATA3- negative MBC cases were SOX10 positive (70%). AR expression was only seen in GATA3-positive MBC (25%) and was significantly more frequent in SOX10-negative MBC (48%) versus SOX10-positive MBC (9%; P = .001). Concordance for GATA3, SOX10, and AR between the primary and metastasis was 89%, 88%, and 80%, respectively.
    [Show full text]
  • The Nuclear Receptor REV-Erbα Modulates Th17 Cell-Mediated Autoimmune Disease
    The nuclear receptor REV-ERBα modulates Th17 cell-mediated autoimmune disease Christina Changa,b, Chin-San Looa,b, Xuan Zhaoc, Laura A. Soltd, Yuqiong Lianga, Sagar P. Bapata,c,e, Han Choc, Theodore M. Kameneckad, Mathias Leblanca, Annette R. Atkinsc, Ruth T. Yuc, Michael Downesc, Thomas P. Burrisf, Ronald M. Evansc,g,1, and Ye Zhenga,1 aNOMIS Center for Immunobiology and Microbial Pathogenesis, The Salk Institute for Biological Studies, La Jolla, CA 92037; bDivision of Biological Sciences, University of California San Diego, La Jolla, CA 92093; cGene Expression Laboratory, The Salk Institute for Biological Studies, La Jolla, CA 92037; dDepartment of Molecular Therapeutics, The Scripps Research Institute, Jupiter, FL 33458; eMedical Scientist Training Program, University of California San Diego, La Jolla, CA 92093; fCenter for Clinical Pharmacology, Washington University School of Medicine and St. Louis College of Pharmacy, St. Louis, MO 63104; and gHoward Hughes Medical Institute, The Salk Institute for Biological Studies, La Jolla, CA 92037 Contributed by Ronald M. Evans, July 29, 2019 (sent for review May 9, 2019; reviewed by Ming O. Li and David D. Moore) T helper 17 (Th17) cells produce interleukin-17 (IL-17) cytokines In this study, we show that REV-ERBα is also a key feedback and drive inflammatory responses in autoimmune diseases such as regulator of RORγt in Th17 cells. REV-ERBα is specifically up- multiple sclerosis. The differentiation of Th17 cells is dependent on regulated during Th17 differentiation and plays a dual role in the retinoic acid receptor-related orphan nuclear receptor RORγt. Th17 cells. When expressed at a low level, REV-ERBα promotes Here, we identify REV-ERBα (encoded by Nr1d1), a member of the RORγt expression via the suppression of negative regulator nuclear hormone receptor family, as a transcriptional repressor NFIL3 as reported previously (15, 16).
    [Show full text]
  • Mapping Origins of Variation in Neural Trajectories of Human Pluripotent Stem Cells
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.17.435870; this version posted March 17, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Mapping origins of variation in neural trajectories of human pluripotent stem cells Suel-Kee Kim1,11,13, Seungmae Seo1,13, Genevieve Stein-O’Brien1,7,13, Amritha Jaishankar1,13, Kazuya Ogawa1, Nicola Micali1,11, Yanhong Wang1, Thomas M. Hyde1,3,5, Joel E. Kleinman1,3, Ty Voss9, Elana J. Fertig4, Joo-Heon Shin1, Roland Bürli10, Alan J. Cross10, Nicholas J. Brandon10, Daniel R. Weinberger1,3,5,6,7, Joshua G. Chenoweth1, Daniel J. Hoeppner1, Nenad Sestan11,12, Carlo Colantuoni1,3,6,8,*, Ronald D. McKay1,2,* 1Lieber Institute for Brain Development, 855 North Wolfe Street, Baltimore, MD 21205 2Department of Cell Biology, 3Department of Neurology, 4Departments of Oncology, Biomedical Engineering, and Applied Mathematics and Statistics, 5Department of Psychiatry, 6Department of Neuroscience, 7McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins School of Medicine, Baltimore, MD 21205 8Institute for Genome Sciences, University of Maryland School of Medicine, Baltimore, MD 21201 9Division of Preclinical Innovation, Nation Center for Advancing Translational Science / NIH, Bethesda, MD 20892 10Astra-Zeneca Neuroscience iMED., 141 Portland Street, Cambridge, MA 01239 11Department of Neuroscience, 12Departments of Genetics, of Psychiatry and of Comparative Medicine, Kavli Institute for Neuroscience, Program in Cellular Neuroscience, Neurodegeneration and Repair, Child Study Center, Yale School of Medicine, New Haven, CT 06510, USA. 13Co-first author *Corresponding authors: [email protected] (C.C.), [email protected] (R.D.M.) Lead contact: R.
    [Show full text]
  • FOXC1 Is Involved in ERΑ Silencing by Counteracting GATA3
    Oncogene (2016) 35, 5400–5411 © 2016 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 0950-9232/16 www.nature.com/onc ORIGINAL ARTICLE FOXC1 is involved in ERα silencing by counteracting GATA3 binding and is implicated in endocrine resistance Y Yu-Rice1, Y Jin1, B Han1,YQu1, J Johnson1, T Watanabe1, L Cheng2, N Deng3, H Tanaka1, B Gao1, Z Liu3, Z Sun2, S Bose4, AE Giuliano1 and X Cui1 Estrogen receptor-α (ERα) mediates the essential biological function of estrogen in breast development and tumorigenesis. Multiple mechanisms, including pioneer factors, coregulators and epigenetic modifications have been identified as regulators of ERα signaling in breast cancer. However, previous studies of ERα regulation have focused on luminal and HER2-positive subtypes rather than basal-like breast cancer (BLBC), in which ERα is underexpressed. In addition, mechanisms that account for the decrease or loss of ER expression in recurrent tumors after endocrine therapy remain elusive. Here, we demonstrate a novel FOXC1-driven mechanism that suppresses ERα expression in breast cancer. We find that FOXC1 competes with GATA-binding protein 3 (GATA3) for the same binding regions in the cis-regulatory elements upstream of the ERα gene and thereby downregulates ERα expression and consequently its transcriptional activity. The forkhead domain of FOXC1 is essential for the competition with GATA3 for DNA binding. Counteracting the action of GATA3 at the ERα promoter region, overexpression of FOXC1 hinders recruitment of RNA polymerase II and increases histone H3K9 trimethylation at ERα promoters. Importantly, ectopic FOXC1 expression in luminal breast cancer cells reduces sensitivity to estrogen and tamoxifen.
    [Show full text]
  • Pyrrothiogatain Acts As an Inhibitor of GATA Family Proteins and Inhibits
    www.nature.com/scientificreports OPEN Pyrrothiogatain acts as an inhibitor of GATA family proteins and inhibits Th2 cell diferentiation in vitro Shunsuke Nomura1, Hirotaka Takahashi1, Junpei Suzuki2, Makoto Kuwahara2, Masakatsu Yamashita2 & Tatsuya Sawasaki 1* The transcription factor GATA3 is a master regulator that modulates T helper 2 (Th2) cell diferentiation and induces expression of Th2 cytokines, such as IL-4, IL-5, and IL-13. Th2 cytokines are involved in the protective immune response against foreign pathogens, such as parasites. However, excessive production of Th2 cytokines results in type-2 allergic infammation. Therefore, the application of a GATA3 inhibitor provides a new therapeutic strategy to regulate Th2 cytokine production. Here, we established a novel high-throughput screening system for an inhibitor of a DNA-binding protein, such as a transcription factor, and identifed pyrrothiogatain as a novel inhibitor of GATA3 DNA-binding activity. Pyrrothiogatain inhibited the DNA-binding activity of GATA3 and other members of the GATA family. Pyrrothiogatain also inhibited the interaction between GATA3 and SOX4, suggesting that it interacts with the DNA-binding region of GATA3. Furthermore, pyrrothiogatain signifcantly suppressed Th2 cell diferentiation, without impairing Th1 cell diferentiation, and inhibited the expression and production of Th2 cytokines. Our results suggest that pyrrothiogatain regulates the diferentiation and function of Th2 cells via inhibition of GATA3 DNA binding activity, which demonstrates the efciency of our drug screening system for the development of novel small compounds that inhibit the DNA-binding activity of transcription factors. Transcription factors are key molecules that regulate gene expression and cell fate in response to cell signalling stimuli from extracellular environments1,2.
    [Show full text]
  • Head and Neck Pathology Traditional Prognostic Factors
    314A ANNUAL MEETING ABSTRACTS Design: 421 archived cases of EC(1995-2007) were reviewed and TMAs prepared Conclusions: Positive GATA3 staining is seen in all vulvar PDs. GATA3 staining is as per established procedures. ERCC1 and RRM1 Immunofl uorescence stains were generally retained in the invasive component associated with vulvar PDs. GATA3 is combined with Automated Quantitative Analysis to assess their expression. The average more sensitive than GCDFP15 for vulvar PDs. Vulvar PDs only rarely express ER and of triplicate core expression was used to determine high and low score cutoff points PR. Vulvar PD should be added to the GATA3+/GCDFP15+ tumor list. using log-rank test on overall survival(OS). Association between expression profi les and clinicopathological parameters was tested using Fisher’s exact test. The independent prognostic value of ERCC1 and RRM1 was tested using Cox model adjusted for Head and Neck Pathology traditional prognostic factors. Results: 304(72%) type-I EC cases and 117(38%) type-II EC cases were identifi ed. Caucasian women had higher proportion of type-I tumors(p<0.001) while elderly women 1297 Subclassification of Perineural Invasion in Oral Squamous Cell were more likely to have type-II tumors (p<0.001). ERCC1 and RRM1 expression was Carcinoma: Prognostic Implications observed in 80% of tumors (336 cases 335 cases,respectively). Kaplan Meier curves K Aivazian, H Low, K Gao, JR Clark, R Gupta. Royal Prince Alfred Hospital, Sydney, showed statistically signifi cant difference in OS between low and high expression of New South Wales, Australia; Royal Prince Alfred Hospital, Sydney, Australia; Sydney ERCC1 and RRM1.
    [Show full text]
  • Bhlhe40 Controls Cytokine Production by T Cells and Is Essential for Pathogenicity in Autoimmune Neuroinflammation
    ARTICLE Received 31 Jul 2013 | Accepted 4 Mar 2014 | Published 3 Apr 2014 DOI: 10.1038/ncomms4551 Bhlhe40 controls cytokine production by Tcells and is essential for pathogenicity in autoimmune neuroinflammation Chih-Chung Lin1, Tara R. Bradstreet1, Elizabeth A. Schwarzkopf1, Julia Sim2, Javier A. Carrero1, Chun Chou1, Lindsey E. Cook1, Takeshi Egawa1, Reshma Taneja3, Theresa L. Murphy1, John H. Russell2 & Brian T. Edelson1 TH1 and TH17 cells mediate neuroinflammation in experimental autoimmune encephalo- myelitis (EAE), a mouse model of multiple sclerosis. Pathogenic TH cells in EAE must produce the pro-inflammatory cytokine granulocyte-macrophage colony stimulating factor (GM-CSF). TH cell pathogenicity in EAE is also regulated by cell-intrinsic production of the immuno- suppressive cytokine interleukin 10 (IL-10). Here we demonstrate that mice deficient for the basic helix–loop–helix (bHLH) transcription factor Bhlhe40 (Bhlhe40 À / À ) are resistant to the induction of EAE. Bhlhe40 is required in vivo in a T cell-intrinsic manner, where it posi- tively regulates the production of GM-CSF and negatively regulates the production of IL-10. À / À In vitro, GM-CSF secretion is selectively abrogated in polarized Bhlhe40 TH1 and TH17 cells, and these cells show increased production of IL-10. Blockade of IL-10 receptor in Bhlhe40 À / À mice renders them susceptible to EAE. These findings identify Bhlhe40 as a critical regulator of autoreactive T-cell pathogenicity. 1 Department of Pathology and Immunology, Washington University School of Medicine, St Louis, Missouri 63110, USA. 2 Department of Developmental Biology, Washington University School of Medicine, St Louis, Missouri 63110, USA.
    [Show full text]
  • Direct Reprogramming to Multipotent Trophoblast Stemlogo Cells, & STYLE and GUIDE Is Pluripotency Needed for Regenerative Medicine Either?31 December 2012
    Commentary Page 1 of 4 Direct reprogramming to multipotent trophoblast stemLOGO cells, & STYLE and GUIDE is pluripotency needed for regenerative medicine either?31 December 2012 Yu Yang1,2, Graham C. Parker3, Elizabeth E. Puscheck1, Daniel A. Rappolee1,2,3,4,5 1CS Mott Center for Human Growth and Development, Department of Ob/Gyn, Reproductive Endocrinology and Infertility, 2Department of Physiology, 3Department of Pediatrics and Children’s Hospital of Michigan, 4Institutes for Environmental Health Science, Wayne State University 1 School of Medicine, Detroit, MI 48201, USA; 5Department of Biology, University of Windsor, Windsor, ON N9B 3P4, Canada Correspondence to: Daniel A. Rappolee. CS Mott Center for Human Growth and Development, Wayne State University School of Medicine, 275 East Hancock, Detroit, MI 48201, USA. Email: [email protected]. Received: 23 April 2016; Accepted: 10 June 2016; Published: 21 June 2016. doi: 10.21037/sci.2016.06.05 View this article at: http://dx.doi.org/10.21037/sci.2016.06.05 For the clinical applications of regenerative medicine, iTSC in vitro and in vivo, as well as the transcriptome and induced pluripotent stem cells (iPSCs) (all acronyms epigenetic modification of iTSC compared with blastocyst- are defined in the Glossary at the end of the text) derived TSC (bdTSC). have advantages over embryonic stem cells (ESCs) in Of the TFs tested, three were identified in both histocompatibility and the lack of reliance on embryo reports as necessary for successful TSC induction, which derivation. Induction of pluripotency can be achieved were GATA Binding Protein 3 (Gata3), Eomesodermin by transiently expressing a minimal set of transcription (Eomes), and Transcription factor AP-2 gamma (Tfap2c).
    [Show full text]
  • A Dual Role for REV-ERB Alpha in Th17 Cell Mediated Immune Response
    UNIVERSITY OF CALIFORNIA, SAN DIEGO A Dual Role for REV-ERB alpha in Th17 Cell Mediated Immune Response A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biology by Fang-Chen Chang Committee in charge: Professor Ye Zheng, Chair Professor Jack Bui Professor Christopher K. Glass Professor Lifan Lu Professor Clodagh O’Shea Professor Elina Zuniga 2016 Copyright Fang-Chen Chang, 2016 All rights reserved The dissertation of Fang-Chen Chang is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Chair University of California, San Diego 2016 iii DEDICATION To my parents, for the opportunities they afforded me, and their unwavering support. And to Edmond, who spent many beautiful weekend afternoons waiting in the Salk parking lot. iv EPIGRAPH First, there is a mountain, then there is no mountain, then there is. —Traditional Buddhist saying, via Donovan (1967) v TABLE OF CONTENTS SIGNATURE PAGE .............................................................................................. iii DEDICATION ........................................................................................................ iv EPIGRAPH ............................................................................................................ v TABLE OF CONTENTS ........................................................................................ vi LIST OF FIGURES .............................................................................................
    [Show full text]