ONCOLOGY LETTERS 21: 231, 2021 GATA3 is downregulated in HCC and accelerates HCC aggressiveness by transcriptionally inhibiting slug expression ZHUOLIANG ZHANG, XINGLIANG FANG, GUILIN XIE and JINLONG ZHU Department of General Surgery I, The Affiliated Hospital of Shaoxing University, Shaoxing, Zhejiang 312000, P.R. China Received August 21, 2019; Accepted June 30, 2020 DOI: 10.3892/ol.2021.12492 Abstract. Previous studies have reported that GATA3 is resection, the overall prognosis of patients with HCC remains downregulated in multiple types of tumours, including poor despite marked improvements in surgical techniques and gastric cancer and osteosarcoma. The aim of this study was perioperative management (2‑4). The overall 5‑year survival to explore whether GATA3 serves as a tumour suppressor to rate of HCC is still <20% (5); thus, an improved understanding inhibit hepatocellular carcinoma (HCC) development. Tumour of the molecular mechanisms underlying HCC metastasis will tissue specimens and adjacent normal tissue specimens help prevent HCC recurrence and metastasis. were obtained from 162 patients diagnosed with HCC in the Epithelial‑mesenchymal transition (EMT) is a crucial Affiliated Hospital of Shaoxing University from July 2000 event in tumour metastasis, where epithelial cell layers lose to May 2018. The result of the present study demonstrated polarity and cell‑cell contact, which results in dramatic that GATA3 was downregulated in HCC tumour tissues remodelling of the cytoskeleton (6). The main characteristic compared with that of adjacent normal tissues. The expression of EMT is loss of E‑cadherin expression, which is associated of GATA3 was also negatively associated with tumour size, with tumour invasiveness, metastasis and poor prognosis (7‑9). TNM stage and lymph node metastasis. Additionally, analysis The activation of various ligands, such as vascular endothelial of the follow‑up data revealed that low GATA3 expression growth factor (VEGF), epidermal growth factor (EGF) and was closely correlated with poor survival. Gain and loss of transforming growth factor‑β (TGF‑β) can induce the expres‑ function analyses revealed that overexpression of GATA3 sion of several EMT‑associated transcription factors, including decreased the ability of proliferation, migration and invasion zinc finger e‑box binding homeobox (ZEB) 1, snail, slug and in HCC cell lines, whereas inhibition of GATA3 promoted Twist (10). A previous study has demonstrated positive correla‑ the ability of proliferation, migration and invasion. In addi‑ tions between EMT‑associated transcription factors and poor tion, GATA3 suppressed EMT through the regulation of slug clinical outcomes in cancer, such as lung cancer, breast cancer, expression. Additionally, slug overexpression attenuated the melanoma and HCC (10). inhibitory effects of GATA3 overexpression on cancer cell GATA3, a member of the GATA family (11,12), serves a proliferation, migration and invasion. Thus, GATA3 is down‑ crucial role in T‑cell proliferation and differentiation (13). In regulated in HCC, and suppresses cell proliferation, migration addition, numerous studies have demonstrated that GATA3 and invasion. Moreover, GATA3 transcriptionally inhibits slug serves different roles in different cancers, for example, GATA3 expression, thereby suppressing EMT in HCC. serves as a tumour activator in soft tissue sarcomas, endo‑ metrial carcinomas and neuroblastomas (14‑16). In addition, Introduction GATA3 suppresses cell proliferation, migration and invasion in osteosarcoma (17). Furthermore, a recent study demon‑ Liver cancer has become one of the most malignant cancers strated that zinc finger protein 503 (ZNF503) accelerates HCC worldwide (1), with hepatocellular carcinoma (HCC) cell aggressiveness by downregulating GATA3 expression accounting for ~80% cases of all cases (2). Due to the high via microRNA‑495, suggesting that GATA3 may serve as a rate of recurrence or intrahepatic metastasis after curative tumour suppressor in HCC (18). However, the detailed func‑ tion of GATA3 in HCC remains unclear. The aim of present study was to explore whether GATA3 serves as a tumour suppressor to inhibit HCC development and further investigate whether GATA3 may be a molecular Correspondence to: Dr Zhuoliang Zhang, Department of General Surgery I, The Affiliated Hospital of Shaoxing University, therapy target in HCC. 999 Zhongxingnan Road, Shaoxing, Zhejiang 312000, P.R. China E‑mail: [email protected] Materials and methods Key words: GATA3, proliferation, migration, invasion, Tumour samples. A total of 162 HCC tissues and adjacent epithelial‑mesenchymal transition non‑tumour tissues (resected 1‑2 cm from the malignant tumor) were obtained from the Affiliated Hospital of Shaoxing University from July 2000 to May 2018. These patients with 2 ZHANG et al: GATA3 SUPPRESSES HEPATOCELLULAR CARCINOMA CELL PROGRESSION gastric cancer included 92 males and 70 females aged between GCCCCAAAGATGAG‑3'; Snail forward, 5'‑GTTTACCTT 23‑78 years, with a mean age of 42.3 years. Tumour tissue CCAGCAGCCCT‑3', reverse, 5'‑TCCCAGATGAGCATTGG (TT) and adjacent non‑tumour tissue (ANT) were resected by CAG‑3'; ZEB1 forward, 5'‑GATGACCTGCCAACAGAC surgical excision. No prior treatments (including chemotherapy CA‑3', reverse: 5'‑CTGTGTCATCCTCCCAGCAG‑3'; and or radiotherapy) were conducted before liver resection surgery. GAPDH forward, 5'‑GAAAGCCTGCCGGTGACTAA‑3', Pathological staging was determined according to the seventh reverse, 5'‑AGGAAAAGCATCACCCGGAG‑3'. Each experi‑ edition of the tumour node metastasis (TNM) classification of ment was performed at least three times. the International Union Against Cancer (19). All tissue samples were confirmed using histopathological evaluation and stored Western blotting. Cell lysates were prepared using RIPA lysis at ‑80˚C until further use. The tissue samples were used in buffer (Pierce; Thermo Fisher Scientific, Inc.) with a protease accordance with the policies of the institutional review board inhibitor cocktail (Roche Applied Science) and protein at the Affiliated Hospital of Shaoxing University, China. The concentration was measured using a bicinchoninic acid kit study was approved the by the review board of the Affiliated (Beyotime Institute of Biotechnology) according to manufac‑ Hospital of Shaoxing University and written informed consent turer's protocol. Subsequently, 40 µg protein was separated on was obtained from all patients. 12% SDS‑PAGE and then transferred onto a PVDF membrane (EMD Millipore). After blocking with 5% non‑fat milk in Cell culture. HCC cell lines, including MHCC97‑H and TBST for 1 h at room temperature, membranes were incubated Hep3B were obtained from the Institute of Biochemistry with the indicated primary antibodies at 4˚C overnight. The and Cell Biology (Chinese Academy of Sciences). All cells primary antibodies used were as follows: GATA3 (1:1,000; cat. were cultured in DMEM medium (Thermo Fisher Scientific, no. ab199428; Abcam); E‑cadherin (1:1,000; cat. no. 14472; Inc.) supplemented with 100 U/ml penicillin‑streptomycin CST Biological Reagents Co., Ltd.); N‑cadherin (1:1,000; mixture (Beyotime Institute of Biotechnology) and 10% FBS cat. no. 13116; CST Biological Reagents Co. Ltd.); and Slug (Sigma‑Aldrich: Merck KGaA) at 37˚C with 5% CO2. (1:1,000; cat. no. ab51772; Abcam). The membranes were then washed with TBST three times and incubated with horse Cell transfection. Transfections were performed using radish peroxide‑conjugated goat anti‑rabbit IgG (1:2,000; cat. Lipofectamine® 2000 or Lipofectamine® RNAiMAX Reagent no. ab6721; Abcam) or goat anti‑mouse IgG (1:4,000; cat. (Invitrogen; Thermo Fisher Scientific, Inc.) according to the no. ab6789; Abcam) secondary antibodies for 1 h at room manufacturer's instructions. FLAG‑GATA3 (pcDNA3.1) and temperature. The specific bands were visualized using the FLAG‑slug (pcDNA3.1) plasmids were obtained from Vigene enhanced chemiluminescence (ECL; Merck KGaA) according Bioscience Inc. The sequences of small interfering (si)RNAs to manufacturer's protocol. β‑actin (1:5,000; cat. no. ab8226; were as follows: Scramble siRNA (SCR): 5'‑UUCUCCGA Abcam) was used as the internal control. Each experiment was ACGUGUCACGU‑3'; siGATA3#1: 5'‑AAACUAGGUCU performed at least three times. Western blotting densitometry GAUAUUCAUU‑3'; siGATA3#2: 5'‑CUUUAUUGCAUCUG was analysed using Image J software (v1.48; National Institutes GGUAGUU‑3'. For overexpression of GATA3 or/and slug, of Health). cells were transfected with 2.5 µg FLAG‑GATA3 and/or 2.5 µg FLAG‑slug using Lipofectamine® 2000. For inhibition Cell Counting Kit‑8 (CCK‑8) assay. CCK‑8 (Dojindo of GATA3, cells were transfected with 40 nM siRNAs using Molecular Technologies, Inc.) was utilized to determine the Lipofectamine® RNAiMAX Reagent. After transfection for effect of GATA3 on cell proliferation according to the manu‑ 48 h, cells were collected. facturer's instructions. Briefly, Hep3B and MHCC97‑H cells were transfected with FLAG‑GATA3 or GATA3 siRNA. After RNA extraction and quantitative reverse transcription quanti‑ transfection for 48 h, ~2x103 cells were seeded in 96‑well plates tative (RT‑q)PCR. Total RNA was extracted from tissue with 200 µl DMEM at 37˚C with 5% CO2. After 24 and 48 h of samples or cells using TRIzol® reagent (Invitrogen; Thermo incubation, 20 µl CCK‑8 reagent was added to each well and Fisher Scientific, Inc.) according to the manufacturer's instruc‑ cultured for 2 h. Finally, the absorbance at 450 nm measured tions. A total of 2 µg RNA was