US 201102.01090A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2011/0201090 A1 Buelter et al. (43) Pub. Date: Aug. 18, 2011

(54) YEAST MICROORGANISMS WITH filed on Feb. 26, 2010, provisional application No. REDUCED BY PRODUCT ACCUMULATION 61/282,641, filed on Mar. 10, 2010, provisional appli FOR IMPROVED PRODUCTION OF FUELS, cation No. 61/352,133, filed on Jun. 7, 2010, provi CHEMICALS, AND AMINO ACIDS sional application No. 61/411.885, filed on Nov. 9, 2010, provisional application No. 61/430,801, filed on (75) Inventors: Thomas Buelter, Denver, CO (US); Jan. 7, 2011. Andrew Hawkins, Parker, CO (US); Stephanie Porter-Scheinman, Conifer, CO Publication Classification (US); Peter Meinhold, Denver, CO (51) Int. Cl. (US); Catherine Asleson Dundon, CI2N I/00 (2006.01) Englewood, CO (US); Aristos Aristidou, Highlands Ranch, CO (52) U.S. Cl...... 435/243 (US); Jun Urano, Aurora, CO (US); Doug Lies, Parker, CO (US); Matthew Peters, Highlands Ranch, (57) ABSTRACT CO (US); Melissa Dey, Aurora, CO The present invention relates to recombinant microorganisms (US); Justas Jancauskas, comprising biosynthetic pathways and methods of using said Englewood, CO (US); Kent Evans, recombinant microorganisms to produce various beneficial Denver, CO (US); Julie Kelly, metabolites. In various aspects of the invention, the recombi Denver, CO (US); Ruth Berry, nant microorganisms may further comprise one or more Englewood, CO (US) modifications resulting in the reduction or elimination of 3 keto-acid (e.g., acetolactate and 2-aceto-2-hydroxybutyrate) (73) Assignee: GEVO, INC., Englewood, CO (US) and/or aldehyde-derived by-products. In various embodi (21) Appl. No.: 13/025,801 ments described herein, the recombinant microorganisms may be microorganisms of the Saccharomyces clade, Crab (22) Filed: Feb. 11, 2011 tree-negative yeast microorganisms, Crabtree-positive yeast microorganisms, post-WGD (whole genome duplication) Related U.S. Application Data yeast microorganisms, pre-WGD (whole genome duplica (60) Provisional application No. 61/304,069, filed on Feb. tion) yeast microorganisms, and non-fermenting yeast micro 12, 2010, provisional application No. 61/308,568, organisms. Patent Application Publication Aug. 18, 2011 Sheet 1 of 22 US 2011/02O1090 A1

Licose

Glycolysis ?-->2 pyruvate ::: co,-- Als

NAP * d KR NAD(P) to Hac. . . . 2, 3-dihydroxy Hac to wiso Yalerate

"SoH2-keto-isovalerate (0. -4 KIvo Hach isobutyraldehyde NADP- -

isobutanof

FGURE 1 Patent Application Publication Aug. 18, 2011 Sheet 2 of 22 US 2011/02O1090 A1

O O NAD(P)H NAD(P)

---OH 3-ketoacid reductase --> 2,3-dihydrox-2-methyl 2-acetolactate butanoate (DH2MB) (AL)

O O NAD(P)H NAD(P)" O HO OH — - - O 3-ketoacid reductase OH O 2-ethyl-2,3-dihydroxy-butyrate 2-aceto-2-hydroxy-butyrate

OH O O. O. NAD(P)H NAD(P)" -> — - - R R R OH R R 3-ketoacid reductase 3-hydroxyacid

3-ketoacid

FIGURE 2 Patent Application Publication Aug. 18, 2011 Sheet 3 of 22 US 2011/02O1090 A1

EC 1.1.1.30 HO 0 O NAD + N- or -- NADH + C + H o O (R)-3-hydroxybutanoate acetoacetate

EC 1.1.1.31 O O Hoyo + NAD -- NADH + o + Ht (S)-3-hydroxy-isobutyrate (S)-methylmalonate-semialdehyde EC 1.1.1.103 OH O O -Yo, + NAD" -- --so + NADH + 2 Ht NH3t NH2 L-threonine 2-amino-3-OXobutanoate

EC 1.1.1.217 Q OH NADPt cro's benzyl (2r,3s)-2-methyl-3-hydroxybutanoate

O NADPH Orar O s + Hit benzyl-2-methyl-3-oxobutanoate FIGURE 3 Patent Application Publication Aug. 18, 2011 Sheet 4 of 22 US 2011/02O1090 A1

EC 1.1.1.298 HO O O r + NADP + NADPH + H 3-hydroxypropionate malonate semialdehyde

FIGURE 3 (CONT.) Patent Application Publication Aug. 18, 2011 Sheet 5 of 22 US 2011/02O1090 A1

NAD(P)' NAD(P)H 1-propanal dehydrogenase (ALDH)

Chi NAD(P)' NAD(P)H isobutyraldehyde dehydrogenase (ALDH)

NAD(P)" NAD(P)H 1-butanal N-2 aldehyde dehydrogenase (ALDH)

NAD(P)" NAD(P)H 2-methyl-1-butanal NU aldehyde dehydrogenase (ALDH) 2-methyl 1-butyrate NAD(P)" NAD(P)H 3-methyl-1-butanal Nu' aldehyde dehydrogenase (ALDH) r 3-methyl 1-butyrate

FIGURE 4 Patent Application Publication Aug. 18, 2011 Sheet 6 of 22 US 2011/02O1090 A1

y Ewale acetolactate x A synthase (AES) AD(Py -atlacias -i i. --" -- AE. - x -x: x or * Y. Case - MEAEPH- 2,3-dihydrox-2-methyl kit-aid exist- r A isoerase (KARI) heate O-28B) NAD(P) : 2,3-dihydroxyisowalerate. CHIW - “.

dihydroxy-acid keysdatase (OHA) 2-keirisowalerate l is KIW) '"

A ketasovalerate o, - decarboxylase (KIVE)

NAD(P)H isoExityraldehyde a sk

PH- all e (AH) dehydrogenase (ADH) isobtstyrate NACP) - is stars l i-BiH) -" ^*

FGURE 5 Patent Application Publication Aug. 18, 2011 Sheet 7 of 22 US 2011/02O1090 A1

private x:

axeclaxiate E. 1syrittas Ai-S &-acetacitate A.E.) KAEF---, 23-3-hykir-2-retty isratasek&E-xx: recktie- &; bar:3t&ESSE& O-2338E. NADP

city oxy-acc cekycratasa is:

-kai:33 lease .

aretyl-C*. isoppy:Fialate synthase spropy:malise isotreras (x: * 3-sixtylrfalate xietyxixexase

3-rathyl-3-bias -- *: is *-*-** ae EBR- ceigs 8: re-dehydrogenaseE. (AH y-3-is:

FGURE 6

Patent Application Publication Aug. 18, 2011 Sheet 9 of 22 US 2011/0201,090 A1

5 s :

vvy' - eye KNC0S

08 NHC s 169 - ele190W-Z 098 - ele80W 109 ele,0e s O990 - SNCHO

s s s Aug. 18, 2011 Sheet 10 of 22 US 2011/02O1090 A1

?TOOB

l 1992, -92.1KncOS

(A ) 19, WHO Patent Application Publication Aug. 18, 2011 Sheet 11 of 22 US 2011/02O1090 A1

Patent Application Publication Aug. 18, 2011 Sheet 12 of 22 US 2011/02O1090 A1

Patent Application Publication Aug. 18, 2011 Sheet 13 of 22 US 2011/02O1090 A1

Patent Application Publication Aug. 18, 2011 Sheet 14 of 22 US 2011/02O1090 A1

O O O 2-5 s D 1. 2 O .9 E O ?t O x O- O en dS s > cy w 5 asE D 2 CD S2 S. O O O d : CD CD s S. 2 O E .9 Ey t O a5 5 o s s Patent Application Publication Aug. 18, 2011 Sheet 15 of 22 US 2011/02O1090 A1

(?Sið

Patent Application Publication Aug. 18, 2011 Sheet 16 of 22 US 2011/02O1090 A1

i

Patent Application Publication Aug. 18, 2011 Sheet 18 of 22 US 2011/02O1090 A1

Patent Application Publication Aug. 18, 2011 Sheet 19 of 22 US 2011/02O1090 A1

Patent Application Publication Aug. 18, 2011 Sheet 20 of 22 US 2011/02O1090 A1 Patent Application Publication Aug. 18, 2011 Sheet 21 of 22 US 2011/02O1090 A1

| , „s:(~~~~

:•! |- ~?~ Zoo Patent Application Publication Aug. 18, 2011 Sheet 22 of 22 US 2011/02O1090 A1

pyruvate st CH

-- NAD(P)HS NAD(P)" - acetyl-CoA illus r O S-s- \-N 1. C} CoA, CO2

H2O y CO2 - CO2 - M -Na1N N-Na' reduced electron acceptor -Na' oxidized electron acceptor NAD(P)HN NADPS(P) . NAD(P)" - NAD(P) c-1\-1N -n- N-N- NAD(P)H - 1-propanol -butano NAD(P)" - N CoA

N-Na'

NAD(P)H- NAD(P)" -

n 1a Oi Y-- Y -

1-butano

FIGURE 20 US 2011/020 1 090 A1 Aug. 18, 2011

YEAST MICROORGANISMIS WITH 0006. One of the primary reasons for the sub-optimal per REDUCED BY PRODUCT ACCUMULATION formance observed in many existing microorganisms is the FOR IMPROVED PRODUCTION OF FUELS, undesirable conversion of pathway intermediates to CHEMICALS, AND AMINO ACIDS unwanted by-products. The present inventors have identified various by-products, including 2,3-dihydroxy-2-methylbu CROSS REFERENCE TO RELATED tanoic acid (DH2MB) (CAS #14868-24-7), 2-ethyl-2,3-dihy APPLICATIONS droxybutyrate, 2,3-dihydroxy-2-methyl-butanonate, isobu tyrate, 3-methyl-1-butyrate, 2-methyl-1-butyrate, and 0001. This application claims priority to U.S. Provisional propionate, which are derived from various intermediates of Application Ser. No. 61/304,069, filed Feb. 12, 2010; U.S. biosynthetic pathways used to produce fuels, chemicals, and Provisional Application Ser. No. 61/308,568, filed Feb. 26, amino acids. The accumulation of these by-products nega 2010; U.S. Provisional Application Ser. No. 61/282,641, filed tively impacts the synthesis and yield of desirable metabolites Mar. 10, 2010; U.S. Provisional Application Ser. No. 61/352. in a variety of fermentation reactions. Until now, the enzy 133, filed Jun. 7, 2010; U.S. Provisional Application Ser. No. matic activities responsible for the production of these 61/411,885, filed Nov. 9, 2010; and U.S. Provisional Appli unwanted by-products had not been characterized. More par cation Ser. No. 61/430,801, filed Jan. 7, 2011, each of which ticularly, the present application shows that the activities of a is herein incorporated by reference in its entirety for all pur 3-ketoacid reductase (3-KAR) and an aldehyde dehydroge poses. nase (ALDH) allow for the formation of these by-products ACKNOWLEDGMENT OF GOVERNMENTAL from important biosynthetic pathway intermediates. SUPPORT 0007. The present invention results from the study of these enzymatic activities and shows that the Suppression of the 0002 This invention was made with government support 3-KAR and/or ALDH enzymes considerably reduces or under Contract No. 2009-10006-05919, awarded by the eliminates the formation of unwanted by-products, and con United States Department of Agriculture, and under Contract comitantly improves the yields and titers of beneficial No. W911 NF-09-2-0022, awarded by the United States metabolites. The present application shows moreover, that Army Research Laboratory. The government has certain enhancement of the 3-KAR and/or ALDH enzymatic activi rights in the invention. ties can be used to increase the production of various by products, such 2,3-dihydroxy-2-methylbutanoic acid TECHNICAL FIELD (DH2MB), 2-ethyl-2,3-dihydroxybutyrate, 2,3-dihydroxy-2- 0003 Recombinant microorganisms and methods of pro methyl-butanonate, isobutyrate, 3-methyl-1-butyrate, 2-me ducing Such organisms are provided. Also provided are meth thyl-1-butyrate, and propionate. ods of producing beneficial metabolites including fuels, chemicals, and amino acids by contacting a suitable Substrate SUMMARY OF THE INVENTION with recombinant microorganisms and enzymatic prepara tions therefrom. 0008. The present inventors have discovered that unwanted by-products can accumulate during various fer DESCRIPTION OF THE TEXT FILE SUBMITTED mentation processes, including fermentation of the biofuel ELECTRONICALLY candidate, isobutanol. The accumulation of these unwanted by-products results from the undesirable conversion of path 0004. The contents of the text file submitted electronically way intermediates including the 3-keto acids, acetolactate herewith are incorporated herein by reference in their and 2-aceto-2-hydroxybutyrate, and/or aldehydes, such as entirety: A computer readable format copy of the Sequence isobutyraldehyde, 1-butanal, 1-propanal, 2-methyl-1-buta Listing (filename: GEVO 045 03US SeqList ST25.txt, nal, and 3-methyl-1-butanal. The conversion of these inter date recorded: Feb. 9, 2011, file size: 306 kilobytes). mediates to unwanted by-products can hinder the optimal productivity and yield of a 3-keto acid- and/or aldehyde BACKGROUND derived products. Therefore, the present inventors have devel 0005. The ability of microorganisms to convert pyruvate oped methods for reducing the conversion of 3-keto acid to beneficial metabolites including fuels, chemicals, and and/or aldehyde intermediates to various fermentation by amino acids has been widely described in the literature in products during processes where a 3-keto acid and/or an recent years. See, e.g., Alper et al., 2009, Nature Microbiol. aldehyde acts as a pathway intermediate. Rev. 7: 715-723. Recombinant engineering techniques have 0009. In a first aspect, the present invention relates to a enabled the creation of microorganisms that express biosyn recombinant microorganism comprising a biosynthetic path thetic pathways capable of producing a number of useful way of which a 3-keto acid and/or an aldehyde is/are inter products, such as valine, isoleucine, leucine, and pan mediate(s), wherein said recombinant microorganism is (a) thothenic acid (vitamin B5). In addition, fuels such as isobu Substantially free of an enzyme catalyzing the conversion of a tanol have been produced recombinantly in microorganisms 3-keto acid to a 3-hydroxyacid; (b) substantially free of an expressing a heterologous metabolic pathway (See, e.g., enzyme catalyzing the conversion of an aldehyde to an acid WO/2007/050671 to Donaldson et al., and WO/2008/098227 by-product; (c) engineered to reduce or eliminate the expres to Liao, et al.). Although engineered microorganisms repre sion or activity of an enzyme catalyzing the conversion of a sent potentially useful tools for the renewable production of 3-keto acid to a 3-hydroxyacid; and/or (d) engineered to fuels, chemicals, and amino acids, many of these microorgan reduce or eliminate the expression or activity of an enzyme isms have fallen short of commercial relevance due to their catalyzing the conversion of an aldehyde to acid by-product. low performance characteristics, including low productivity, In one embodiment, the 3-keto acid is acetolactate. In another low titers, and low yields. embodiment, the 3-keto acid is 2-aceto-2-hydroxybutyrate. US 2011/020 1 090 A1 Aug. 18, 2011

0010. In one embodiment, the invention is directed to a or more endogenous proteins involved in catalyzing the con recombinant microorganism comprising a biosynthetic path version of a 3-keto acid intermediate to a 3-hydroxyacid way which uses the 3-keto acid, acetolactate, as an interme by-product is reduced by at least about 50%. In another diate, wherein said recombinant microorganism is engi embodiment, the activity or expression of one or more endog neered to reduce or eliminate the expression or activity of an enous proteins involved in catalyzing the conversion of a enzyme catalyzing the conversion of acetolactate to the cor 3-keto acid intermediate to a 3-hydroxyacid by-product is responding 3-hydroxyacid, DH2MB. In some embodiments, reduced by at least about 60%, by at least about 65%, by at the enzyme catalyzing the conversion of acetolactate to least about 70%, by at least about 75%, by at least about 80%, DH2MB is a 3-ketoacid reductase (3-KAR). by at least about 85%, by at least about 90%, by at least about 0011. In one embodiment, the invention is directed to a 95%, or by at least about 99% as compared to a recombinant recombinant microorganism comprising a biosynthetic path microorganism not comprising a reduction or deletion of the way which uses the 3-keto acid, 2-aceto-2-hydroxybutyrate, activity or expression of one or more endogenous proteins as an intermediate, wherein said recombinant microorganism involved in catalyzing the conversion of a 3-keto acid inter is engineered to reduce or eliminate the expression or activity mediate to a 3-hydroxyacid by-product. In one embodiment, of an enzyme catalyzing the conversion of acetolactate to the the 3-keto acid intermediate is acetolactate and the 3-hy corresponding 3-hydroxyacid, 2-ethyl-2,3-dihydroxybu droxyacid by-product is DH2MB. In another embodiment, tanoate. In some embodiments, the enzyme catalyzing the the 3-keto acid intermediate is 2-aceto-2-hydroxybutyrate conversion of 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3-di and the 3-hydroxyacid by-product is 2-ethyl-2,3-dihydrox hydroxybutanoate is a 3-ketoacid reductase (3-KAR). ybutanoate. 0012. In one embodiment, the invention is directed to a 0015. In various embodiments described herein, the pro recombinant microorganism comprising a biosynthetic path tein involved in catalyzing the conversion of a 3-keto acid way which uses an aldehyde as an intermediate, wherein said intermediate to a 3-hydroxyacid by-product is a ketoreduc recombinant microorganism is engineered to reduce or elimi tase. In an exemplary embodiment, the ketoreductase is a nate the expression or activity of an enzyme catalyzing the 3-ketoacid reductase (3-KAR). In another embodiment, the conversion of the aldehyde to an acid by-product. In some protein is a short chain alcoholdehydrogenase. In yet another embodiments, the enzyme catalyzing the conversion of the embodiment, the protein is a medium chain alcohol dehydro aldehyde to an acid by-product is an aldehyde dehydrogenase genase. In yet another embodiment, the protein is an aldose (ALDH). reductase. In yet another embodiment, the protein is a D-hy 0013. In one embodiment, the invention is directed to a droxyacid dehydrogenase. In yet another embodiment, the recombinant microorganism comprising a biosynthetic path protein is a lactate dehydrogenase. In yet another embodi way which uses both a 3-keto acid and an aldehyde as inter ment, the protein is selected from the group consisting of mediates, wherein said recombinant microorganism is (a) YAL060W, YJR159W, YGL157W, YBL114W, YOR120W, engineered to reduce or eliminate the expression or activity of YKL055C, YBR159W, YBR149W, YDL168W, YDR368W, an enzyme catalyzing the conversion of a 3-keto acid inter YLR426W, YCR107W, YIL124W, YML054C, YOL151W, mediate to a 3-hydroxyacid by-product; and (b) engineered to YMR318C, YMR226C, YBR046C, YHR104W, YIR036C, reduce or eliminate the expression or activity of an enzyme YDL174C, YDR541C, YBR 145W, YGL039W, YCR105W, catalyzing the conversion of an aldehyde intermediate to an YDL124W, YIR035C, YFLO56C, YNL274C, YLR255C, acid by-product. In one embodiment, the 3-keto acid is aceto YGL185C, YGL256W, YJR096W, YMR226C, YJR155W, lactate and the 3-hydroxyacid by-product is DH2MB. In YPL275W, YOR388C, YLR070C, YMR083W, YER081W, another embodiment, the 3-keto acid is 2-aceto-2-hydroxy YJR139C, YDL243C, YPL113C, YOL165C, YML086C, butyrate and the 3-hydroxyacid by-product is 2-ethyl-2,3- YMR303C, YDL246C, YLR070C, YHR063C, YNL331C, dihydroxybutanoate. In some embodiments, the enzyme cata YFLO57C, YIL155C, YOLO86C, YAL061W, YDR127W, lyzing the conversion of acetolactate to DH2MB is a YPR127W, YCI018W, YIL074C, YIL124W, and YEL071W 3-ketoacid reductase (3-KAR). In some other embodiments, genes of S. cerevisiae and homologs thereof. the enzyme catalyzing the conversion of 2-aceto-2-hydroxy 0016. In one embodiment, the endogenous protein is a butyrate to 2-ethyl-2,3-dihydroxybutanoate is a 3-ketoacid 3-ketoacid reductase (3-KAR). In an exemplary embodiment, reductase (3-KAR). In some other embodiments, the enzyme the 3-ketoacid reductase is the S. cerevisiae YMR226C (SEQ catalyzing the conversion of the aldehyde to an acid by ID NO: 1) protein, used interchangeably herein with product is an aldehyde dehydrogenase (ALDH). In yet some “TMA29. In some embodiments, the endogenous protein other embodiments, the enzyme catalyzing the conversion of may be the S. cerevisiae YMR226C (SEQID NO: 1) protein acetolactate to DH2MB is a 3-ketoacid reductase (3-KAR) or a homolog or variant thereof. In one embodiment, the and the enzyme catalyzing the conversion of the aldehyde to homolog may be selected from the group consisting of an acid by-product is an aldehyde dehydrogenase (ALDH). In Vanderwaltomzyma polyspora (SEQ ID NO: 2), Saccharo yet some other embodiments, the enzyme catalyzing the con myces castellii (SEQID NO:3), Candida glabrata (SEQID version of 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihy NO: 4), Saccharomyces bayanus (SEQID NO. 5), Zygosac droxybutanoate is a 3-ketoacid reductase (3-KAR) and the charomyces rouxii (SEQ ID NO: 6), Kluyveromyces lactis enzyme catalyzing the conversion of the aldehyde to an acid (SEQ ID NO: 7), Ashbya gossypii (SEQID NO: 8), Saccha by-product is an aldehyde dehydrogenase (ALDH). romyces kluyveri (SEQ ID NO: 9), Kluyveromyces thermo 0014. In various embodiments described herein, the tolerans (SEQ ID NO: 10), Kluyveromyces waltii (SEQ ID recombinant microorganisms of the invention may comprise NO: 11), Pichia stipitis (SEQ ID NO: 12), Debaromyces a reduction or deletion of the activity or expression of one or hansenii (SEQID NO: 13), Pichiapastoris (SEQID NO:14), more endogenous proteins involved in catalyzing the conver Candida dubliniensis (SEQ ID NO: 15), Candida albicans sion of a 3-keto acid intermediate to a 3-hydroxyacid by (SEQ ID NO: 16), Yarrowia lipolytica (SEQ ID NO: 17), product. In one embodiment, the activity or expression of one Issatchenkia Orientalis (SEQID NO: 18), Aspergillus nidu US 2011/020 1 090 A1 Aug. 18, 2011

lans (SEQID NO: 19), Aspergillus niger (SEQ ID NO: 20), the aldehyde dehydrogenase is the S. cerevisiae ALD6 (SEQ Neurospora crassa (SEQID NO: 21), Schizosaccharomyces ID NO: 25) protein. In some embodiments, the aldehyde pombe (SEQ ID NO: 22), and Kluyveromyces marxianus dehydrogenase is the S. cerevisiae ALD6 (SEQ ID NO: 25) (SEQ ID NO. 23). protein or a homolog or variant thereof. In one embodiment, 0017. In one embodiment, the recombinant microorgan the homolog is selected from the group consisting of Saccha ism includes a mutation in at least one gene encoding for a romyces castelli (SEQ ID NO: 26), Candida glabrata (SEQ 3-ketoacid reductase resulting in a reduction of 3-ketoacid ID NO: 27), Saccharomyces bayanus (SEQ ID NO: 28), reductase activity of a polypeptide encoded by said gene. In Kluyveromyces lactis (SEQID NO: 29), Kluyveromyces ther another embodiment, the recombinant microorganism motolerans (SEQID NO:30), Kluyveromyces waltii (SEQID includes a partial deletion of gene encoding for a 3-ketoacid NO:31), Saccharomyces cerevisiae YJ789 (SEQID NO:32), reductase resulting in a reduction of 3-ketoacid reductase Saccharomyces cerevisiae JAY291 (SEQ ID NO: 33), Sac activity of a polypeptide encoded by the gene. In another charomyces cerevisiae EC 1118 (SEQID NO:34), Saccharo embodiment, the recombinant microorganism comprises a myces cerevisiae DBY939 (SEQID NO:35), Saccharomyces complete deletion of a gene encoding for a 3-ketoacid reduc cerevisiae AWR11631 (SEQ ID NO:36), Saccharomyces tase resulting in a reduction of 3-ketoacid reductase activity cerevisiae RM11-1a (SEQID NO:37), Pichia pastoris (SEQ of a polypeptide encoded by the gene. In yet another embodi ID NO: 38), Kluyveromyces marxianus (SEQ ID NO:39), ment, the recombinant microorganism includes a modifica Schizosaccharomyces pombe (SEQ ID NO: 40), and tion of the regulatory region associated with the gene encod Schizosaccharomyces pombe (SEQID NO: 41). ing for a 3-ketoacid reductase resulting in a reduction of 0020. In one embodiment, the recombinant microorgan expression of a polypeptide encoded by said gene. In yet ism includes a mutation in at least one gene encoding for an another embodiment, the recombinant microorganism com aldehyde dehydrogenase resulting in a reduction of aldehyde prises a modification of the transcriptional regulator resulting dehydrogenase activity of a polypeptide encoded by said in a reduction of transcription of a gene encoding for a 3-ke gene. In another embodiment, the recombinant microorgan toacid reductase. In yet another embodiment, the recombi ism includes a partial deletion of gene encoding for an alde nant microorganism comprises mutations in all genes encod hyde dehydrogenase resulting in a reduction of aldehyde ing for a 3-ketoacid reductase resulting in a reduction of dehydrogenase activity of a polypeptide encoded by the gene. activity of a polypeptide encoded by the gene(s). In one In another embodiment, the recombinant microorganism embodiment, the 3-ketoacid reductase activity or expression comprises a complete deletion of a gene encoding for an is reduced by at least about 50%. In another embodiment, the aldehyde dehydrogenase resulting in a reduction of aldehyde 3-ketoacid reductase activity or expression is reduced by at dehydrogenase activity of a polypeptide encoded by the gene. least about 60%, by at least about 65%, by at least about 70%, In yet another embodiment, the recombinant microorganism by at least about 75%, by at least about 80%, by at least about includes a modification of the regulatory region associated 85%, by at least about 90%, by at least about 95%, or by at with the gene encoding for an aldehyde dehydrogenase least about 99% as compared to a recombinant microorgan resulting in a reduction of expression of a polypeptide ism not comprising a reduction of the 3-ketoacid reductase encoded by said gene. In yet another embodiment, the recom activity or expression. In one embodiment, said 3-ketoacid binant microorganism comprises a modification of the tran reductase is encoded by the S. cerevisiae TMA29 Scriptional regulator resulting in a reduction of transcription (YMR226C) gene or a homolog thereof. of a gene encoding for an aldehyde dehydrogenase. In yet 0.018. In various embodiments described herein, the another embodiment, the recombinant microorganism com recombinant microorganisms of the invention may comprise prises mutations in all genes encoding for an aldehyde dehy a reduction or deletion of the activity or expression of one or drogenase resulting in a reduction of activity of a polypeptide more endogenous proteins involved in catalyzing the conver encoded by the gene(s). In one embodiment, the aldehyde sion of an aldehyde to an acid by-product. In one embodi dehydrogenase activity or expression is reduced by at least ment, the activity or expression of one or more endogenous about 50%. In another embodiment, the aldehyde dehydro proteins involved in catalyzing the conversion of an aldehyde genase activity or expression is reduced by at least about 60%, to an acid by-product is reduced by at least about 50%. In by at least about 65%, by at least about 70%, by at least about another embodiment, the activity or expression of one or 75%, by at least about 80%, by at least about 85%, by at least more endogenous proteins involved in catalyzing the conver about 90%, by at least about 95%, or by at least about 99% as sion of an aldehyde to an acid by-product is reduced by at compared to a recombinant microorganism not comprising a least about 60%, by at least about 65%, by at least about 70%, reduction of the aldehyde dehydrogenase activity or expres by at least about 75%, by at least about 80%, by at least about Sion. In one embodiment, said aldehyde dehydrogenase is 85%, by at least about 90%, by at least about 95%, or by at encoded by the S. cerevisiae ALD6 gene or a homolog least about 99% as compared to a recombinant microorgan thereof. ism not comprising a reduction or deletion of the activity or 0021. In various embodiments described herein, the expression of one or more endogenous proteins involved in recombinant microorganism may comprise a biosynthetic catalyzing the conversion of an aldehyde to an acid by-prod pathway which uses a 3-keto acid as an intermediate. In one uct. embodiment, the3-keto acid intermediate is acetolactate. The 0019. In various embodiments described herein, the biosynthetic pathway which uses acetolactate as an interme endogenous protein involved in catalyzing the conversion of diate may be selected from a pathway for the biosynthesis of an aldehyde to an acid by-product is an aldehyde dehydroge isobutanol, 2-butanol, 1-butanol, 2-butanone, 2,3-butanediol. nase (ALDH). In one embodiment, the aldehyde dehydroge acetoin, diacetyl, Valine, leucine, pantothenic acid, isobuty nase is encoded by a gene selected from the group consisting lene, 3-methyl-1-butanol, 4-methyl-1-pentanol, and coen of ALD2, ALD3, ALD4, ALD5, ALD6, and HFD1, and Zyme A. In another embodiment, the 3-keto acid intermediate homologs and variants thereof. In an exemplary embodiment, is 2-aceto-2-hydroxybutyrate. The biosynthetic pathway US 2011/020 1 090 A1 Aug. 18, 2011

which uses 2-aceto-2-hydroxybutyrate as an intermediate specific embodiment, the 3-ketoacid reductase is encoded by may be selected from a pathway for the biosynthesis of 2-me the S. cerevisiae TMA29 (YMR226C) gene or a homolog thyl-1-butanol, isoleucine, 3-methyl-1-pentanol. 4-methyl-1- thereof. In some embodiments, the enzyme catalyzing the hexanol, and 5-methyl-1-heptanol. conversion of isobutyraldehyde to isobutyrate is an aldehyde 0022. In various embodiments described herein, the dehydrogenase. In a specific embodiment, the aldehyde dehy recombinant microorganism may comprise a biosynthetic drogenase is encoded by the S. cerevisiae ALD6 gene or a pathway which uses an aldehyde as an intermediate. The homolog thereof. biosynthetic pathway which uses an aldehyde as an interme 0027. In one embodiment, the isobutanol producing meta diate may be selected from a pathway for the biosynthesis of bolic pathway comprises at least one exogenous gene that isobutanol, 1-butanol, 2-methyl-1-butanol, 3-methyl-1-bu catalyzes a step in the conversion of pyruvate to isobutanol. In tanol. 1-propanol. 1-pentanol, 1-hexanol, 3-methyl-1-pen another embodiment, the isobutanol producing metabolic tanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, and 5-me pathway comprises at least two exogenous genes that catalyze thyl-1-heptanol. In various embodiments described herein, steps in the conversion of pyruvate to isobutanol. In yet the aldehyde intermediate may be selected from isobutyral another embodiment, the isobutanol producing metabolic dehyde, 1-butanal, 2-methyl-1-butanal, 3-methyl-1-butanal, pathway comprises at least three exogenous genes that cata 1-propanal, 1-pentanal, 1-hexanal, 3-methyl-1-pentanal, lyze steps in the conversion of pyruvate to isobutanol. In yet 4-methyl-1-pentanal, 4-methyl-1-hexanal, and 5-methyl-1- another embodiment, the isobutanol producing metabolic heptanal. pathway comprises at least four exogenous genes that cata 0023. In various embodiments described herein, the lyze steps in the conversion of pyruvate to isobutanol. In yet recombinant microorganism may comprise a biosynthetic another embodiment, the isobutanol producing metabolic pathway which uses a 3-keto acid and an aldehyde as inter pathway comprises at five exogenous genes that catalyze mediates. In one embodiment, the 3-keto acid intermediate is steps in the conversion of pyruvate to isobutanol. acetolactate. The biosynthetic pathway which uses acetolac 0028. In one embodiment, one or more of the isobutanol tate and an aldehyde as intermediates may be selected from a pathway genes encodes an enzyme that is localized to the pathway for the biosynthesis of isobutanol, 1-butanol, and cytosol. In one embodiment, the recombinant microorgan 3-methyl-1-butanol. In another embodiment, the 3-keto acid isms comprise an isobutanol producing metabolic pathway intermediate is 2-aceto-2-hydroxybutyrate. The biosynthetic with at least one isobutanol pathway enzyme localized in the pathway which uses 2-aceto-2-hydroxybutyrate and an alde cytosol. In another embodiment, the recombinant microor hyde as intermediates may be selected from a pathway for the ganisms comprise an isobutanol producing metabolic path biosynthesis of 2-methyl-1-butanol, 3-methyl-1-pentanol, way with at least two isobutanol pathway enzymes localized 4-methyl-1-hexanol, and 5-methyl-1-heptanol. in the cytosol. In yet another embodiment, the recombinant 0024. In one embodiment, the invention is directed to a microorganisms comprise an isobutanol producing metabolic recombinant microorganism for producing isobutanol, pathway with at least three isobutanol pathway enzymes wherein said recombinant microorganism comprises an localized in the cytosol. In yet another embodiment, the isobutanol producing metabolic pathway and wherein said recombinant microorganisms comprise an isobutanol pro microorganism is engineered to reduce or eliminate the ducing metabolic pathway with at least four isobutanol path expression or activity of an enzyme catalyzing the conversion way enzymes localized in the cytosol. In an exemplary of acetolactate to DH2MB. In some embodiments, the embodiment, the recombinant microorganisms comprise an enzyme catalyzing the conversion of acetolactate to DH2MB isobutanol producing metabolic pathway with five isobutanol is a 3-ketoacid reductase (3-KAR). In a specific embodiment, pathway enzymes localized in the cytosol. the 3-ketoacid reductase is encoded by the S. cerevisiae 0029 Invarious embodiments described herein, the isobu TMA29 (YMR226C) gene or a homolog thereof. tanol pathway genes encodes enzyme(s) selected from the 0025. In another embodiment, the invention is directed to group consisting of acetolactate synthase (ALS), ketol-acid a recombinant microorganism for producing isobutanol, reductoisomerase (KARI), dihydroxyacid dehydratase wherein said recombinant microorganism comprises an (DHAD), 2-keto-acid decarboxylase (KIVD), and alcohol isobutanol producing metabolic pathway and wherein said dehydrogenase (ADH). microorganism is engineered to reduce or eliminate the 0030. In another aspect, the recombinant microorganism expression or activity of an enzyme catalyzing the conversion may be engineered to reduce the conversion of isobutanol to of isobutyraldehyde to isobutyrate. In some embodiments, the isobutyraldehyde by reducing and/or eliminating the expres enzyme catalyzing the conversion of isobutyraldehyde to sion of one or more alcohol dehydrogenases. In a specific isobutyrate is an aldehyde dehydrogenase. In a specific embodiment, the alcoholdehydrogenase is encoded by a gene embodiment, the aldehyde dehydrogenase is encoded by the selected from the group consisting of ADH1, ADH2, ADH3. S. cerevisiae ALD6 gene or a homolog thereof. ADH4, ADH5, ADH6, and ADH7, and homologs and vari 0026. In yet another embodiment, the invention is directed ants thereof. to a recombinant microorganism for producing isobutanol, 0031. In another aspect, the present invention relates to wherein said recombinant microorganism comprises an modified alcoholdehydrogenase (ADH) enzymes that exhibit isobutanol producing metabolic pathway and wherein said an enhanced ability to convert isobutyraldehyde to isobu microorganism is (i) engineered to reduce or eliminate the tanol. In general, cells expressing these improved ADH expression or activity of an enzyme catalyzing the conversion enzymes will produce increased levels of isobutanol during of acetolactate to DH2MB and (ii) engineered to reduce or fermentation reactions. While the modified ADH enzymes of eliminate the expression or activity of an enzyme catalyzing the present invention have utility in isobutanol-producing the conversion of isobutyraldehyde to isobutyrate. In some fermentation reactions, it will be understood by those skilled embodiments, the enzyme catalyzing the conversion of aceto in the art equipped with this disclosure that the modified ADH lactate to DH2MB is a 3-ketoacid reductase (3-KAR). In a enzymes also have usefulness in fermentation reactions pro US 2011/020 1 090 A1 Aug. 18, 2011

ducing other alcohols such as 1-propanol, 2-propanol. 1-bu a valine residue. In one embodiment, the ADH enzyme con tanol, 2-butanol. 1-pentanol, 2-methyl-1-butanol, and 3-me tains two or more mutations at the amino acids corresponding thyl-1-butanol. to the positions described in these specific embodiments. In 0032. In certain aspects, the invention is directed to alco another embodiment, the ADH enzyme contains three or holdehydrogenases (ADHs), which have been modified to more mutations at the amino acids corresponding to the posi enhance the enzyme’s ability to convert isobutyraldehyde to tions described in these specific embodiments. In yet another isobutanol. Examples of such ADHS include enzymes having embodiment, the ADH enzyme contains four or more muta one or more mutations at positions corresponding to amino tions at the amino acids corresponding to the positions acids selected from: (a) tyrosine 50 of the L. lactis Adha described in these specific embodiments. In yet another (SEQ ID NO:185); (b) glutamine 77 of the L. lactis Adha embodiment, the ADH enzyme contains five or more muta (SEQID NO:185); (c) valine 108 of the L. lactis Adha (SEQ tions at the amino acids corresponding to the positions ID NO:185); (d) tyrosine 113 of the L. lactis Adha (SEQID described in these specific embodiments. In yet another NO:185); (e) isoleucine 212 of the L. lactis Adh A (SEQ ID embodiment, the ADH enzyme contains six mutations at the NO:185); and (f) leucine 264 of the L. lactis Adha (SEQID amino acids corresponding to the positions described in these NO: 185), wherein Adha (SEQ ID NO: 185) is encoded by specific embodiments. the L. lactis alcohol dehydrogenase (ADH) gene adhA (SEQ 0036. In certain exemplary embodiments, the ADH ID NO: 184) or a codon-optimized version thereof (SEQ ID enzyme comprises a sequence selected SEQ ID NO: 189, NO: 206). SEQID NO: 191, SEQID NO: 193, SEQID NO: 195, SEQ 0033. In one embodiment, the modified ADH enzyme IDNO: 197, SEQIDNO: 199, SEQID NO: 201, SEQID NO: contains a mutation at the amino acid corresponding to posi 203, SEQID NO: 205, SEQID NO. 208, SEQID NO: 210, tion 50 of the L. lactis Adh A (SEQ ID NO: 185). In another SEQID NO: 212, SEQID NO: 214, SEQID NO: 216, SEQ embodiment, the modified ADH enzyme contains a mutation IDNO: 218, SEQIDNO: 220, SEQID NO: 222, SEQID NO: at the amino acid corresponding to position 77 of the L. lactis 224, and homologs or variants thereof comprising corre Adh A (SEQ ID NO: 185). In yet another embodiment, the sponding mutations as compared to the wild-type or parental modified ADH enzyme contains a mutation at the amino acid enzyme. corresponding to position 108 of the L. lactis Adha (SEQID 0037. As alluded to in the preceding paragraph, further NO: 185). In yet another embodiment, the modified ADH included within the scope of the invention are ADH enzymes, enzyme contains a mutation at the amino acid corresponding other than the L. lactis Adh A (SEQ ID NO: 185), which to position 113 of the L. lactis Adha (SEQID NO:185). In contain alterations corresponding to those set out above. Such yet another embodiment, the modified ADH enzyme contains ADH enzymes may include, but are not limited to, the ADH a mutation at the amino acid corresponding to position 212 of enzymes listed in Table 97. the L. lactis AdhA (SEQID NO:185). In yet another embodi 0038. In some embodiments, the ADH enzymes to be ment, the modified ADH enzyme contains a mutation at the modified are NADH-dependent ADH enzymes. Examples of amino acid corresponding to position 264 of the L. lactis such NADH-dependent ADH enzymes are described in com Adha (SEQ ID NO:185). monly owned and co-pending U.S. Patent Publication No. 0034. In one embodiment, the ADH enzyme contains two 2010/0143997, which is herein incorporated by reference in or more mutations at the amino acids corresponding to the its entirety for all purposes. In some embodiments, genes positions described above. In another embodiment, the ADH originally encoding NADPH-utilizing ADH enzymes are enzyme contains three or more mutations at the amino acids modified to switch the co-factor preference of the enzyme to corresponding to the positions described above. In yet NADH. another embodiment, the ADH enzyme contains four or more 0039. As described herein, the modified ADHs will gen mutations at the amino acids corresponding to the positions erally exhibit an enhanced ability to convertisobutyraldehyde described above. In yet another embodiment, the ADH to isobutanol as compared to the wild-type or parental ADH. enzyme contains five or more mutations at the amino acids Preferably, the catalytic efficiency (k/K) of the modified corresponding to the positions described above. In yet ADH enzyme is enhanced by at least about 5% as compared another embodiment, the ADH enzyme contains six muta to the wild-type or parental ADH. More preferably, the cata tions at the amino acids corresponding to the positions lytic efficiency of the modified ADH enzyme is enhanced by described above. at least about 15% as compared to the wild-type or parental 0035. In one specific embodiment, the invention is ADH. More preferably, the catalytic efficiency of the modi directed to ADH enzymes wherein the tyrosine at position 50 fied ADH enzyme is enhanced by at least about 25% as is replaced with a phenylalanine or tryptophan residue. In compared to the wild-type or parental ADH. More preferably, another specific embodiment, the invention is directed to the catalytic efficiency of the modified ADH enzyme is ADH enzymes wherein the glutamine at position 77 is enhanced by at least about 50% as compared to the wild-type replaced with anarginine or serine residue. In another specific or parental ADH. More preferably, the catalytic efficiency of embodiment, the invention is directed to ADH enzymes the modified ADH enzyme is enhanced by at least about 75% wherein the valine at position 108 is replaced with a serine or as compared to the wild-type or parental ADH. More prefer alanine residue. In another specific embodiment, the inven ably, the catalytic efficiency of the modified ADH enzyme is tion is directed to ADH enzymes wherein the tyrosine at enhanced by at least about 100% as compared to the wild-type position 113 is replaced with a phenylalanine or glycine resi or parental ADH. More preferably, the catalytic efficiency of due. In another specific embodiment, the invention is directed the modified ADH enzyme is enhanced by at least about to ADH enzymes wherein the isoleucine at position 212 is 200% as compared to the wild-type or parental ADH. More replaced with a threonine or valine residue. In yet another preferably, the catalytic efficiency of the modified ADH specific embodiment, the invention is directed to ADH enzyme is enhanced by at least about 500% as compared to enzymes wherein the leucine at position 264 is replaced with the wild-type or parental ADH. More preferably, the catalytic US 2011/020 1 090 A1 Aug. 18, 2011 efficiency of the modified ADH enzyme is enhanced by at example kiv) from L. lactis, and an alcohol dehydrogenase least about 1000% as compared to the wild-type or parental (ADH) (e.g. a modified ADH described herein), encoded by, ADH. More preferably, the catalytic efficiency of the modi for example, adhA from L. lactis with one or more mutations fied ADH enzyme is enhanced by at least about 2000% as at positions Y50, Q77, V108, Y113, I212, and L264 as compared to the wild-type or parental ADH. More preferably, described herein. the catalytic efficiency of the modified ADH enzyme is 0044. In various embodiments described herein, the enhanced by at least about 3000% as compared to the wild recombinant microorganisms may be microorganisms of the type or parental ADH. Most preferably, the catalytic effi Saccharomyces clade, Saccharomyces sensu stricto microor ciency of the modified ADH enzyme is enhanced by at least ganisms, Crabtree-negative yeast microorganisms, Crabtree about 3500% as compared to the wild-type or parental ADH. positive yeast microorganisms, post-WGD (whole genome 0040. In additional aspects, the invention is directed to duplication) yeast microorganisms, pre-WGD (whole modified ADH enzymes that have been codon optimized for genome duplication) yeast microorganisms, and non-fer expression in certain desirable host organisms. Such as yeast menting yeast microorganisms. and E. coli. In other aspects, the present invention is directed 0045. In some embodiments, the recombinant microor to recombinant host cells comprising a modified ADH ganisms may be yeast recombinant microorganisms of the enzyme of the invention. According to this aspect, the present Saccharomyces clade. invention is also directed to methods of using the modified 0046. In some embodiments, the recombinant microor ADH enzymes in any fermentation process, where the con ganisms may be Saccharomyces sensu stricto microorgan version of isobutyraldehyde to isobutanol is desired. In one isms. In one embodiment, the Saccharomyces sensu stricto is embodiment according to this aspect, the modified ADH selected from the group consisting of S. cerevisiae, S. kudria enzymes may be suitable for enhancing a host cell's ability to vZevi, S. mikatae, S. bayanus, S. uvarum. S. carocanis and produce isobutanol. In another embodiment according to this hybrids thereof. aspect, the modified ADH enzymes may be suitable for 0047. In some embodiments, the recombinant microor enhancing a host cell's ability to produce 1-propanol. 2-pro ganisms may be Crabtree-negative recombinant yeast micro panol. 1-butanol, 2-butanol. 1-pentanol, 2-methyl-1-butanol, organisms. In one embodiment, the Crabtree-negative yeast and 3-methyl-1-butanol. microorganism is classified into a genera selected from the 0041. In various embodiments described herein, the group consisting of Saccharomyces, Kluyveromyces, Pichia, recombinant microorganisms comprising a modified ADH Issatchenkia, Hansenula, or Candida. In additional embodi may be further engineered to express an isobutanol producing ments, the Crabtree-negative yeast microorganism is selected metabolic pathway. In one embodiment, the recombinant from Saccharomyces kluyveri, Kluyveromyces lactis, microorganism may be engineered to express an isobutanol Kluyveromyces marxianus, Pichia anomala, Pichia stipitis, producing metabolic pathway comprising at least one exog Hansenula anomala, Candida utilis and Kluyveromyces enous gene. In one embodiment, the recombinant microor waltii. ganism may be engineered to express an isobutanol produc 0048. In some embodiments, the recombinant microor ing metabolic pathway comprising at least two exogenous ganisms may be Crabtree-positive recombinant yeast micro genes. In another embodiment, the recombinant microorgan organisms. In one embodiment, the Crabtree-positive yeast ism may be engineered to express an isobutanol producing microorganism is classified into a genera selected from the metabolic pathway comprising at least three exogenous group consisting of Saccharomyces, Kluyveromyces, genes. In another embodiment, the recombinant microorgan Zygosaccharomyces, Debaryomyces, Candida, Pichia and ism may be engineered to express an isobutanol producing Schizosaccharomyces. In additional embodiments, the Crab metabolic pathway comprising at least four exogenous genes. tree-positive yeast microorganism is selected from the group In another embodiment, the recombinant microorganism may consisting of Saccharomyces cerevisiae, Saccharomyces be engineered to express an isobutanol producing metabolic uvarum, Saccharomyces bayanus, Saccharomyces para pathway comprising five exogenous genes. Thus, the present doxus, Saccharomyces castelli, Kluyveromyces thermotoler invention further provides recombinant microorganisms that ans, Candida glabrata, Z. bailli, Z. rouxi, Debaryomyces comprise an isobutanol producing metabolic pathway and hansenii, Pichia pastorius, Schizosaccharomyces pombe, and methods of using said recombinant microorganisms to pro Saccharomyces uvarum. duce isobutanol. 0049. In some embodiments, the recombinant microor 0042. In various embodiments described herein, the isobu ganisms may be post-WGD (whole genome duplication) tanol pathway enzyme(s) is/are selected from acetolactate yeast recombinant microorganisms. In one embodiment, the synthase (ALS), ketol-acid reductoisomerase (KARI), dihy post-WGD yeast recombinant microorganism is classified droxyacid dehydratase (DHAD), 2-keto-acid decarboxylase into a genera selected from the group consisting of Saccha (KIVD), and alcohol dehydrogenase (ADH). romyces or Candida. In additional embodiments, the post 0.043 Invarious embodiments described herein, the isobu WGD yeast is selected from the group consisting of Saccha tanol pathway enzymes may be derived from a prokaryotic romyces cerevisiae, Saccharomyces uvarum, Saccharomyces organism. In alternative embodiments described herein, the bayanus, Saccharomyces paradoxus, Saccharomyces cas isobutanol pathway enzymes may be derived from a eukary telli, and Candida glabrata. otic organism. An exemplary metabolic pathway that con 0050. In some embodiments, the recombinant microor verts pyruvate to isobutanol may be comprised of a acetohy ganisms may be pre-WGD (whole genome duplication) yeast droxy acid synthase (ALS) enzyme encoded by, for example, recombinant microorganisms. In one embodiment, the pre alsS from B. subtilis, a ketol-acid reductoisomerase (KARI) WGD yeast recombinant microorganism is classified into a encoded by, for example ilvC from E. coli, a dihyroxy-acid genera selected from the group consisting of Saccharomyces, dehydratase (DHAD), encoded by, for example, ilvD from L. Kluyveromyces, Candida, Pichia, Issatchenkia, Debaryomy lactis, a 2-keto-acid decarboxylase (KIVD) encoded by, for ces, Hansenula, Pachysolen, Yarrowia and Schizosaccharo US 2011/020 1 090 A1 Aug. 18, 2011 myces. In additional embodiments, the pre-WGD yeast is 1-butanol, 3-methyl-1-pentanol, 4-methyl-1-hexanol, and selected from the group consisting of Saccharomyces 5-methyl-1-heptanol biosynthetic pathways. kluyveri, Kluyveromyces thermotolerans, Kluyveromyces 0053. In one embodiment, the recombinant microorgan marxianus, Kluyveromyces waltii, Kluyveromyces lactis, ism is grown under aerobic conditions. In another embodi Candida tropicalis, Pichia pastoris, Pichia anomala, Pichia ment, the recombinant microorganism is grown under stipitis, Issatchenkia Orientalis, Issatchenkia Occidentalis, microaerobic conditions. In yet another embodiment, the Debaryomyces hansenii, Hansenula anomala, Pachysolen recombinant microorganism is grown under anaerobic con tannophilis, Yarrowia lipolytica, and Schizosaccharomyces ditions. pombe. BRIEF DESCRIPTION OF DRAWINGS 0051. In some embodiments, the recombinant microor ganisms may be microorganisms that are non-fermenting 0054 Illustrative embodiments of the invention are illus yeast microorganisms, including, but not limited to those, trated in the drawings, in which: 0055 FIG. 1 illustrates an exemplary embodiment of an classified into a genera selected from the group consisting of isobutanol pathway. Tricosporon, Rhodotorula, Myxozyma, or Candida. In a spe 0056 FIG. 2 illustrates exemplary reactions capable of cific embodiment, the non-fermenting yeast is C. xestobii. being catalyzed by 3-ketoacid reductases. 0052. In another aspect, the present invention provides 0057 FIG. 3 illustrates a non-limiting list of exemplary methods of producing beneficial metabolites including fuels, 3-ketoacid reductases and their corresponding enzyme clas chemicals, and amino acids using a recombinant microorgan sification numbers. ism as described herein. In one embodiment, the method 0.058 FIG. 4 illustrates exemplary reactions capable of includes cultivating the recombinant microorganism in a cul being catalyzed by aldehyde dehydrogenases. ture medium containing a feedstock providing the carbon 0059 FIG. 5 illustrates a strategy for reducing the produc source until a recoverable quantity of the metabolite is pro tion of DH2MB and isobutyrate in isobutanol-producing duced and optionally, recovering the metabolite. In one recombinant microorganisms. embodiment, the microorganism produces the metabolite 0060 FIG. 6 illustrates a strategy for reducing the produc from a carbon source at a yield of at least about 5 percent tion of DH2MB and 3-methyl-1-butyrate in 3-methyl-1-bu theoretical. In another embodiment, the microorganism pro tanol-producing recombinant microorganisms. duces the metabolite at a yield of at least about 10 percent, at 0061 FIG. 7 illustrates a strategy for reducing the produc least about 15 percent, about least about 20 percent, at least tion of 2-ethyl-2,3-dihydroxybutyrate and 2-methyl-1-bu about 25 percent, at least about 30 percent, at least about 35 tyrate in 2-methyl-1-butanol producing recombinant micro percent, at least about 40 percent, at least about 45 percent, at organisms. least about 50 percent, at least about 55 percent, at least about 0062 FIG. 8 illustrates a stacked overlay of LC4 chro 60 percent, at least about 65 percent, at least about 70 percent, matograms showing a sample containing DH2MB and at least about 75 percent, at least about 80 percent, at least acetate (top) and a sample containing acetate and DHIV (bot about 85 percent, at least about 90 percent, at least about 95 tom). Elution order: DH2MB followed by acetate (top); lac percent, or at least about 97.5 percent theoretical. In one tate, acetate, DHIV, isobutyrate, pyruvate (bottom). embodiment, the metabolite may be derived from a biosyn 0063 FIG. 9 illustrates a chromatogram for sample frac thetic pathway which uses a 3-keto acid as an intermediate. In tion collected at retention time corresponding to DHIV col one embodiment, the 3-keto acid intermediate is acetolactate. lected on LC1 and analyzed by LC4 on an AS-11 Column Accordingly, the metabolite may be derived from a biosyn with Conductivity Detection. thetic pathway which uses acetolactate as an intermediate, 0064 FIG. 10 illustrates a 1H-COSY spectrum of the peak including, but not limited to, isobutanol, 2-butanol, 1-butanol, isolated from LC1. The spectrum indicates that DH2MB 2-butanone, 2,3-butanediol, acetoin, diacetyl, Valine, leucine, methyl protons (doublet) at 0.95 ppm are coupled to methine pantothenic acid, isobutylene, 3-methyl-1-butanol, 4-methyl proton (quartet) at 3.7 ppm. 1-pentanol, and coenzyme A. In another embodiment, the 0065 FIG. 11 illustrates a 1H-NMR spectrum of the peak 3-keto acid intermediate is 2-aceto-2-hydroxybutyrate. isolated from LC1. The spectrum indicates the presence of Accordingly, the metabolite may be derived from a biosyn DH2MB: a singlet of methyl protons (a) at 1.2 ppm with thetic pathway which uses 2-aceto-2-hydroxybutyrate as an integral value 3, a doublet of methyl protons (b) at 0.95 ppm intermediate, including, but not limited to, 2-methyl-1-bu with integral value 3 and a quartet of methine proton (c) at 3.7 tanol, isoleucine, 3-methyl-1-pentanol, 4-methyl-1-hexanol, ppm with integral value of 1.84. Integral value of methine and 5-methyl-1-heptanol. In another embodiment, the proton (c) is greater than 1 due to overlap with glucose reso metabolite may be derived from a biosynthetic pathway nance in the same region. which uses an aldehyde as an intermediate, including, but not 0.066 FIG. 12 illustrates a LC-MS analysis of the peak limited to, isobutanol, 1-butanol, 2-methyl-1-butanol, 3-me isolated from LC1. Several molecular ions were identified in thyl-1-butanol. 1-propanol. 1-pentanol, 1-hexanol, 3-methyl the sample as indicated at the top portion of the figure. Further 1-pentanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, and fragmentation (MS2) of 134 molecular ion indicated that 5-methyl-1-heptanol. In yet another embodiment, the isolated LC1 fraction contains hydroxyl carboxylic acid by metabolite may be derived from a biosynthetic pathway characteristic loss of CO (*) and H2O+CO (**). which uses acetolactate and an aldehyde as intermediates, 0067 FIG. 13 illustrates the diastereomeric and enantio including, but not limited to, isobutanol, 1-butanol, and 3-me meric structures of 2,3-dihydroxy-2-methylbutanoic acid thyl-1-butanol biosynthetic pathways. In yet another embodi (2R,3S)-1a, (2S,3R)-1b, (2R,3R)-2a, (2S,3S)-2b. ment, the metabolite may be derived from a biosynthetic 0068 FIG. 14 illustrates the 1H spectrum of crystallized pathway which uses 2-aceto-2-hydroxybutyrate and an alde DH2MB in D.O. 1H NMR (TSP) 1.1 (d. 6.5 Hz, 3H), 1.3 (s, hyde as intermediates, including, but not limited to, 2-methyl 3H), 3.9 (q, 6.5 Hz, 3H) US 2011/020 1 090 A1 Aug. 18, 2011

0069 FIG. 15 illustrates the 13C spectrum of crystallized 0080. The term “species' is defined as a collection of DH2MB in D.O.The spectrum indicates five different carbon closely related organisms with greater than 97% 16S riboso resonances one of them being characteristic carboxylic acid mal RNA sequence homology and greater than 70% genomic resonance at 181 ppm. hybridization and sufficiently different from all other organ 0070 FIG. 16 illustrates the fermentation profile of isobu isms so as to be recognized as a distinct unit. tanol and by-products from a single fermentation with I0081. The terms “recombinant microorganism.” “modi GEVO3160. Production aeration was reduced from an OTR fied microorganism,” and “recombinant host cell are used of 0.8 mM/h to 0.3 mM/h at 93 h post inoculation. Open interchangeably herein and refer to microorganisms that have diamond-iBuOH, square-unknown quantified as DH2MB, been genetically modified to express or overexpress endog asterisk cell dry weight (cdw), and closed triangle-total enous polynucleotides, to express heterologous polynucle byproducts. otides, such as those included in a vector, in an integration 0071 FIG. 17 illustrates a structural alignment of the L. construct, or which have an alteration in expression of an lactis Adh A amino acid sequence with the structure of G. endogenous gene. By “alteration’ it is meant that the expres Stearothermophilus (Pymol). Active site mutations are shown sion of the gene, or level of a RNA molecule or equivalent (Y50F and L264V). Mutations in the co-factor binding RNA molecules encoding one or more polypeptides or domain are also shown (I212T and N219Y). polypeptide subunits, or activity of one or more polypeptides 0072 FIG. 18 illustrates biosynthetic pathways utilizing or polypeptide Subunits is up regulated or down regulated, acetolactate as an intermediate. Biosynthetic pathways for the Such that expression, level, or activity is greater than or less production of 1-butanol, isobutanol, 3-methyl-1-butanol, and than that observed in the absence of the alteration. For 4-methyl-1-pentanol use both acetolactate and an aldehyde as example, the term “alter can mean “inhibit, but the use of an intermediate. the word “alter is not limited to this definition. 0073 FIG. 19 illustrates biosynthetic pathways utilizing I0082. The term “expression' with respect to a gene 2-aceto-2-hydroxybutyrate as an intermediate. Biosynthetic sequence refers to transcription of the gene and, as appropri pathways for the production of 2-methyl-1-butanol, 3-me ate, translation of the resulting mRNA transcript to a protein. thyl-1-pentanol, 4-methyl-1-hexanol, and 5-methyl-1-hep Thus, as will be clear from the context, expression of a protein tanol use both 2-aceto-2-hydroxybutyrate and an aldehyde as results from transcription and translation of the open reading an intermediate. frame sequence. The level of expression of a desired product 0074 FIG. 20 illustrates additional biosynthetic pathways in a host cell may be determined on the basis of either the utilizing an aldehyde as an intermediate. amount of corresponding mRNA that is present in the cell, or the amount of the desired product encoded by the selected DETAILED DESCRIPTION sequence. For example, mRNA transcribed from a selected 0075. As used herein and in the appended claims, the sequence can be quantitated by qRT-PCR or by Northern singular forms “a” “an.” and “the include plural referents hybridization (see Sambrook et al., Molecular Cloning: A unless the context clearly dictates otherwise. Thus, for Laboratory Manual, Cold Spring Harbor Laboratory Press example, reference to “a polynucleotide' includes a plurality (1989)). Protein encoded by a selected sequence can be quan of Such polynucleotides and reference to “the microorgan titated by various methods, e.g., by ELISA, by assaying for ism’ includes reference to one or more microorganisms, and the biological activity of the protein, or by employing assays so forth. that are independent of Such activity. Such as western blotting 0.076 Unless defined otherwise, all technical and scien or radioimmunoassay, using antibodies that recognize and tific terms used herein have the same meaning as commonly bind the protein. See Sambrook et al., 1989, supra. The poly understood to one of ordinary skill in the art to which this nucleotide generally encodes a target enzyme involved in a disclosure belongs. Although methods and materials similar metabolic pathway for producing a desired metabolite. It is or equivalent to those described herein can be used in the understood that the terms "recombinant microorganism' and practice of the disclosed methods and compositions, the “recombinant host cell refer not only to the particular recom exemplary methods, devices and materials are described binant microorganism but to the progeny or potential progeny herein. of such a microorganism. Because certain modifications may 0077. Any publications discussed above and throughout occur in Succeeding generations due to either mutation or the text are provided solely for their disclosure prior to the environmental influences, such progeny may not, in fact, be filing date of the present application. Nothing herein is to be identical to the parent cell, but are still included within the construed as an admission that the inventors are not entitled to Scope of the term as used herein. antedate such disclosure by virtue of prior disclosure. I0083. The term “overexpression” refers to an elevated 0078. The term “microorganism’ includes prokaryotic level (e.g., aberrant level) of mRNAs encoding for a protein and eukaryotic microbial species from the Domains Archaea, (s) (e.g., an TMA29 protein or homolog thereof), and/or to Bacteria and Eucarya, the latter including yeast and filamen elevated levels of protein(s) (e.g., TMA29) in cells as com tous fungi, protozoa, algae, or higher Protista. The terms pared to similar corresponding unmodified cells expressing “microbial cells' and “microbes’ are used interchangeably basal levels of mRNAs (e.g., those encoding Aft proteins) or with the term microorganism. having basal levels of proteins. In particular embodiments, 007.9 The term “genus is defined as a taxonomic group of TMA29, or homologs thereof, may be overexpressed by at related species according to the Taxonomic Outline of Bac least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, teria and Archaea (Garrity, G. M., Lilburn, T.G., Cole, J. R. 12-fold, 15-fold or more in microorganisms engineered to Harrison, S. H., Euzeby, J., and Tindall, B. J. (2007) The exhibit increased TMA29 mRNA, protein, and/or activity. Taxonomic Outline of Bacteria and Archaea. TOBA Release I0084 As used herein and as would be understood by one 7.7, March 2007. Michigan State University Board of Trust of ordinary skill in the art, “reduced activity and/or expres ees. http://www.taxonomicoutline.org/). sion of a protein Such as an enzyme can mean either a US 2011/020 1 090 A1 Aug. 18, 2011

reduced specific catalytic activity of the protein (e.g. reduced 0090. As used herein, the term "isobutanol producing activity) and/or decreased concentrations of the protein in the metabolic pathway refers to an enzyme pathway which pro cell (e.g. reduced expression), while “deleted activity and/or duces isobutanol from pyruvate. expression” or "eliminated activity and/or expression of a 0091. The term "heterologous' as used herein with refer protein Such as an enzyme can mean either no or negligible ence to molecules and in particular enzymes and polynucle specific catalytic activity of the enzyme (e.g. deleted activity) otides, indicates molecules that are expressed in an organism and/or no or negligible concentrations of the enzyme in the other than the organism from which they originated or are cell (e.g. deleted expression). found in nature, independently of the level of expression that 0085. The term “wild-type microorganism’ describes a can be lower, equal or higher than the level of expression of cell that occurs in nature, i.e. a cell that has not been geneti the molecule in the native microorganism. cally modified. A wild-type microorganism can be geneti 0092. On the other hand, the term “native” or “endog cally modified to express or overexpress a first target enzyme. enous” as used herein with reference to molecules, and in This microorganism can act as a parental microorganism in particular enzymes and polynucleotides, indicates molecules the generation of a microorganism modified to express or that are expressed in the organism in which they originated or overexpress a second target enzyme. In turn, the microorgan are found in nature, independently of the level of expression ism modified to express or overexpress a first and a second that can be lower equal or higher than the level of expression target enzyme can be modified to express or overexpress a of the molecule in the native microorganism. It is understood third target enzyme. that expression of native enzymes or polynucleotides may be I0086 Accordingly, a “parental microorganism' functions modified in recombinant microorganisms. as a reference cell for Successive genetic modification events. 0093. The term “feedstock is defined as a raw material or Each modification event can be accomplished by introducing mixture of raw materials Supplied to a microorganism or a nucleic acid molecule into the reference cell. The introduc fermentation process from which other products can be made. tion facilitates the expression or overexpression of a target For example, a carbon Source, Such as biomass or the carbon enzyme. It is understood that the term “facilitates' encom compounds derived from biomass area feedstock for a micro passes the activation of endogenous polynucleotides encod organism that produces a biofuel in a fermentation process. ing a target enzyme through genetic modification of e.g., a However, a feedstock may contain nutrients other than a promoter sequence in a parental microorganism. It is further carbon Source. understood that the term “facilitates' encompasses the intro 0094. The term “substrate' or “suitable substrate” refers to duction of heterologous polynucleotides encoding a target any substance or compound that is converted or meant to be enzyme in to a parental microorganism converted into another compound by the action of an enzyme. 0087. The term “engineer refers to any manipulation of a The term includes not only a single compound, but also com microorganism that results in a detectable change in the binations of compounds, such as Solutions, mixtures and microorganism, wherein the manipulation includes but is not other materials which contain at least one substrate, orderiva limited to inserting a polynucleotide and/or polypeptide het tives thereof. Further, the term “substrate' encompasses not erologous to the microorganism and mutating a polynucle only compounds that provide a carbon Source Suitable for use otide and/or polypeptide native to the microorganism. as a starting material. Such as any biomass derived Sugar, but 0088. The term “mutation” as used herein indicates any also intermediate and end product metabolites used in a path modification of a nucleic acid and/or polypeptide which way associated with a recombinant microorganism as results in an altered nucleic acid or polypeptide. Mutations described herein. include, for example, point mutations, deletions, or insertions 0.095 The term "C2-compound as used as a carbon of single or multiple residues in a polynucleotide, which Source for engineered yeast microorganisms with mutations includes alterations arising within a protein-encoding region in all pyruvate decarboxylase (PDC) genes resulting in a of a gene as well as alterations in regions outside of a protein reduction of pyruvate decarboxylase activity of said genes encoding sequence. Such as, but not limited to, regulatory or refers to organic compounds comprised of two carbonatoms, promoter sequences. A genetic alteration may be a mutation including but not limited to ethanol and acetate. of any type. For instance, the mutation may constitute a point (0096. The term “fermentation” or “fermentation process” mutation, a frame-shift mutation, a nonsense mutation, an is defined as a process in which a microorganism is cultivated insertion, or a deletion of part or all of a gene. In addition, in in a culture medium containing raw materials, such as feed Some embodiments of the modified microorganism, a portion stock and nutrients, wherein the microorganism converts raw of the microorganism genome has been replaced with a het materials. Such as a feedstock, into products. erologous polynucleotide. In some embodiments, the muta (0097. The term “volumetric productivity” or “production tions are naturally-occurring. In other embodiments, the rate' is defined as the amount of product formed per volume mutations are identified and/or enriched through artificial of medium per unit of time. Volumetric productivity is selection pressure. In still other embodiments, the mutations reported in gram per liter per hour (g/L/h). in the microorganism genome are the result of genetic engi (0098. The term “specific productivity” or “specific pro neering. duction rate' is defined as the amount of product formed per I0089. The term “biosynthetic pathway', also referred to as Volume of medium per unit of time per amount of cells. “metabolic pathway', refers to a set of anabolic or catabolic Specific productivity is reported ingram or milligram per liter biochemical reactions for converting one chemical species per hour per OD (g/L/h/OD). into another. Gene products belong to the same “metabolic (0099. The term "yield” is defined as the amount of product pathway’ if they, in parallel or in series, act on the same obtained per unit weight of raw material and may be Substrate, produce the same product, or act on or produce a expressed as g product per g substrate (g/g). Yield may be metabolic intermediate (i.e., metabolite) between the same expressed as a percentage of the theoretical yield. “Theoreti substrate and metabolite end product. cal yield' is defined as the maximum amount of product that US 2011/020 1 090 A1 Aug. 18, 2011

can be generated per a given amount of Substrate as dictated compete with the desired metabolic pathway (e.g., an isobu by the stoichiometry of the metabolic pathway used to make tanol-producing metabolic pathway) means the level of the the product. For example, the theoretical yield for one typical enzyme is Substantially less than that of the same enzyme in conversion of glucose to isobutanol is 0.41 g/g. As such, a the wild-type host, wherein less than about 50% of the wild yield of isobutanol from glucose of 0.39 g/g would be type level is preferred and less than about 30% is more pre expressed as 95% of theoretical or 95% theoretical yield. ferred. The activity may be less than about 20%, less than 0100. The term “titer is defined as the strength of a solu about 10%, less than about 5%, or less than about 1% of tion or the concentration of a Substance in Solution. For wild-type activity. Microorganisms which are “substantially example, the titer of a biofuel in a fermentation broth is free” of a particular enzymatic activity (3-KAR, ALDH, described as g of biofuel in solution per liter of fermentation PDC, GPD, etc.) may be created through recombinant means broth (g/L). or identified in nature. 0101 “Aerobic conditions” are defined as conditions 0108. The term “non-fermenting yeast’ is a yeast species under which the oxygen concentration in the fermentation that fails to demonstrate an anaerobic metabolism in which medium is sufficiently high for an aerobic or facultative the electrons from NADH are utilized to generate a reduced anaerobic microorganism to use as a terminal electron accep product via a fermentative pathway Such as the production of tOr. ethanol and CO from glucose. Non-fermentative yeast can 0102. In contrast, “anaerobic conditions” are defined as be identified by the “Durham Tube Test” (J. A. Barnett, R. W. conditions under which the oxygen concentration in the fer Payne, and D. Yarrow. 2000. Yeasts Characteristics and Iden mentation medium is too low for the microorganism to use as tification. 3" edition. p. 28-29. Cambridge University Press, a terminal electron acceptor. Anaerobic conditions may be Cambridge, UK) or by monitoring the production of fermen achieved by sparging a fermentation medium with an inert gas tation productions such as ethanol and CO. Such as nitrogen until oxygen is no longer available to the 0109. The term “polynucleotide' is used herein inter microorganism as a terminal electron acceptor. Alternatively, changeably with the term “nucleic acid and refers to an anaerobic conditions may be achieved by the microorganism organic polymer composed of two or more monomers includ consuming the available oxygen of the fermentation until ing nucleotides, nucleosides or analogs thereof, including but oxygen is unavailable to the microorganism as a terminal not limited to single stranded or double stranded, sense or electron acceptor. Methods for the production of isobutanol antisense deoxyribonucleic acid (DNA) of any length and, under anaerobic conditions are described in commonly where appropriate, single stranded or double stranded, sense owned and co-pending publication, US 2010/0143997, the or antisense ribonucleic acid (RNA) of any length, including disclosures of which are herein incorporated by reference in siRNA. The term “nucleotide' refers to any of several com its entirety for all purposes. pounds that consist of a ribose or deoxyribose Sugar joined to 0103 Aerobic metabolism” refers to a biochemical pro a purine or a pyrimidine base and to a phosphate group, and cess in which oxygen is used as a terminal electron acceptor that are the basic structural units of nucleic acids. The term to make energy, typically in the form of ATP from carbohy “nucleoside' refers to a compound (as guanosine or adenos drates. Aerobic metabolism occurs e.g. via glycolysis and the ine) that consists of a purine or pyrimidine base combined TCA cycle, wherein a single glucose molecule is metabolized with deoxyribose or ribose and is found especially in nucleic completely into carbon dioxide in the presence of oxygen. acids. The term “nucleotide analog or “nucleoside analog 0104. In contrast, “anaerobic metabolism” refers to a bio refers, respectively, to a nucleotide or nucleoside in which chemical process in which oxygen is not the final acceptor of one or more individual atoms have been replaced with a electrons contained in NADH. Anaerobic metabolism can be different atom or with a different functional group. Accord divided into anaerobic respiration, in which compounds other ingly, the term polynucleotide includes nucleic acids of any than oxygen serve as the terminal electron acceptor, and length, DNA, RNA, analogs and fragments thereof. A poly substrate level phosphorylation, in which the electrons from nucleotide of three or more nucleotides is also called nucleo NADH are utilized to generate a reduced product via a “fer tidic oligomer or oligonucleotide. mentative pathway.” 0110. It is understood that the polynucleotides described 0105. In “fermentative pathways”, NAD(P)H donates its herein include “genes” and that the nucleic acid molecules electrons to a molecule produced by the same metabolic described herein include “vectors’ or “plasmids.” Accord pathway that produced the electrons carried in NAD(P)H. For ingly, the term “gene’’, also called a “structural gene' refers to example, in one of the fermentative pathways of certain yeast a polynucleotide that codes for aparticular sequence of amino strains, NAD(P)H generated through glycolysis transfers its acids, which comprise all or part of one or more proteins or electrons to pyruvate, yielding ethanol. Fermentative path enzymes, and may include regulatory (non-transcribed) DNA ways are usually active under anaerobic conditions but may sequences. Such as promoter sequences, which determine for also occur under aerobic conditions, under conditions where example the conditions under which the gene is expressed. NADH is not fully oxidized via the respiratory chain. For The transcribed region of the gene may include untranslated example, above certain glucose concentrations, Crabtree regions, including introns, 5'-untranslated region (UTR), and positive yeasts produce large amounts of ethanol under aero 3'-UTR, as well as the coding sequence. bic conditions. 0111. The term “operon” refers to two or more genes 0106 The term “byproduct” or “by-product” means an which are transcribed as a single transcriptional unit from a undesired product related to the production of an amino acid, common promoter. In some embodiments, the genes com amino acid precursor, chemical, chemical precursor, biofuel, prising the operon are contiguous genes. It is understood that or biofuel precursor. transcription of an entire operon can be modified (i.e., 0107 The term “substantially free” when used in refer increased, decreased, or eliminated) by modifying the com ence to the presence or absence of enzymatic activities mon promoter. Alternatively, any gene or combination of (3-KAR, ALDH, PDC, GPD, etc.) in carbon pathways that genes in an operon can be modified to alter the function or US 2011/020 1 090 A1 Aug. 18, 2011

activity of the encoded polypeptide. The modification can has a similar amino acid sequence to that of the second gene. result in an increase in the activity of the encoded polypep Alternatively, a protein has homology to a second protein if tide. Further, the modification can impart new activities on the the two proteins have “similar amino acid sequences. (Thus, encoded polypeptide. Exemplary new activities include the the term “homologous proteins’ is defined to mean that the use of alternative substrates and/or the ability to function in two proteins have similar amino acid sequences). alternative environmental conditions. 0118. The term “analog or “analogous' refers to nucleic 0112 A“vector is any means by which a nucleic acid can acid or protein sequences or protein structures that are related be propagated and/or transferred between organisms, cells, or to one another in function only and are not from common cellular components. Vectors include viruses, bacteriophage, descent or do not share a common ancestral sequence. Ana pro-viruses, plasmids, phagemids, transposons, and artificial logs may differ in sequence but may share a similar structure, chromosomes such as YACs (yeast artificial chromosomes), due to convergent evolution. For example, two enzymes are BACs (bacterial artificial chromosomes), and PLACs (plant analogs or analogous if the enzymes catalyze the same reac artificial chromosomes), and the like, that are “episomes.” tion of conversion of a Substrate to a product, are unrelated in that is, that replicate autonomously or can integrate into a sequence, and irrespective of whether the two enzymes are chromosome of a host cell. A vector can also be a naked RNA related in structure. polynucleotide, a naked DNA polynucleotide, a polynucle otide composed of both DNA and RNA within the same Recombinant Microorganisms with Reduced By-Product Strand, a poly-lysine -conjugated DNA or RNA, a peptide Accumulation conjugated DNA or RNA, a liposome-conjugated DNA, or 0119 Yeast cells convert sugars to produce pyruvate, the like, that are not episomal in nature, or it can be an which is then utilized in a number of pathways of cellular organism which comprises one or more of the above poly metabolism. In recent years, yeast cells have been engineered nucleotide constructs such as an agrobacterium or a bacte to produce a number of desirable products via pyruvate 1. driven biosynthetic pathways. In many of these biosynthetic 0113. “Transformation” refers to the process by which a pathways, the initial pathway step is the conversion of endog vector is introduced into a host cell. Transformation (or trans enous pyruvate to a 3-keto acid. duction, or transfection), can be achieved by any one of a 0.120. As used herein, a “3-keto acid refers to an organic number of means including chemical transformation (e.g. compound which contains a carboxylic acid moiety on the C1 lithium acetate transformation), electroporation, microinjec carbon and a ketone moiety on the C3 carbon. For example, tion, biolistics (or particle bombardment-mediated delivery), acetolactate and 2-hydroxy-2-methyl-3-oxobutanoic acid are or agrobacterium mediated transformation. 3-keto acids with a ketone group at the C3 carbon (See, e.g., 0114. The term “enzyme” as used herein refers to any FIG. 2). Substance that catalyzes or promotes one or more chemical or I0121. An example of a 3-keto acid which is common to biochemical reactions, which usually includes enzymes many biosynthetic pathways is acetolactate, which is formed totally or partially composed of a polypeptide, but can include from pyruvate by the action of the enzyme acetolactate Syn enzymes composed of a different molecule including poly thase (also known as acetohydroxy acid synthase). Amongst nucleotides. the biosynthetic pathways using acetolactate as intermediate 0115 The term “protein.” “peptide,” or “polypeptide' as include pathways for the production of isobutanol, 2-butanol, used herein indicates an organic polymer composed of two or 1-butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, more amino acidic monomers and/or analogs thereof. As used Valine, leucine, pantothenic acid, isobutylene, 3-methyl-1- herein, the term "amino acid' or "amino acidic monomer butanol, 4-methyl-1-pentanol, and coenzyme A. Engineered refers to any natural and/or synthetic amino acids including biosynthetic pathways for the synthesis of these beneficial glycine and both D or L optical isomers. The term “amino acetolactate-derived metabolites are found in Table 1 and acid analog refers to an amino acid in which one or more FIG. 18. individual atoms have been replaced, either with a different atom, or with a different functional group. Accordingly, the TABLE 1 term polypeptide includes amino acidic polymer of any length including full length proteins, and peptides as well as Biosynthetic Pathways Utilizing Acetolactate as an Intermediate analogs and fragments thereof. A polypeptide of three or Biosynthetic Pathway Reference more amino acids is also called a protein oligomer or oli gopeptide Isobutanol US 2009/0226991 (Feldman et al.), US 2011/0020889 (Feldman et al.), and 0116. The term “homolog. used with respect to an origi US 2010/0143997 (Buelter et al.) nal enzyme or gene of a first family or species, refers to 1-Butanol WO/2010/017230 (Lynch), distinct enzymes or genes of a second family or species which WO/2010/031772 (Wu et al.), and KR2011 002130 (Lee et al.) are determined by functional, structural or genomic analyses 2-Butanol WO/2007/130518 (Donaldson et al.), to be an enzyme or gene of the second family or species which WO 2007. 130521 corresponds to the original enzyme or gene of the first family (Donaldson et al.), and WO/2009/134276 (Donaldson et al.) or species. Most often, homologs will have functional, struc 2-Butanone WO/2007/130518 (Donaldson et al.), tural or genomic similarities. Techniques are known by which WO 2007. 130521 homologs of an enzyme or gene can readily be cloned using (Donaldson et al.), and genetic probes and PCR. Identity of cloned sequences as WO/2009/134276 (Donaldson et al.) 2-3-Butanediol WO/2007/130518 (Donaldson et al.), homolog can be confirmed using functional assays and/or by WO 2007. 130521 genomic mapping of the genes. (Donaldson et al.), and 0117. A protein has “homology' or is “homologous' to a WO/2009/134276 (Donaldson et al.) second protein if the amino acid sequence encoded by a gene US 2011/020 1 090 A1 Aug. 18, 2011

5-methyl-1-heptanol. Engineered biosynthetic pathways for TABLE 1-continued the synthesis of these beneficial 2-aceto-2-hydroxybutyrate derived metabolites are found in Table 2 and FIG. 19. Biosynthetic Pathways Utilizing Acetolactate as an Intermediate Biosynthetic Pathway Reference TABLE 2 Acetoin WO/2007/130518 (Donaldson et al.), Biosynthetic Pathways Utilizing 2-Aceto-2-Hydroxybutyrate as an WO/2007/130521 (Donaldson et al.), and Intermediate WO/2009/134276 (Donaldson et al.) Diacetyl Gonzalez et al., 2000, J. Bioi. Chem Biosynthetic Pathway Reference' 275:35876-85 and Ehsani et al., 2009, App. Environ. Micro. 75:3196-205 2-Methyl-1-Butanol WO/2008/098227 (Liao et al.), Valine WO/2001/021772 (Yocum et al.) and WO/2009/076480 (Picataggio et al.), McCourt et al., 2006, Amino Acids 31: 173-210 and Atsumi et al., 2008, Nature 451: 86-89 Leucine WO/2001/021772 (Yocum et al.) and Isoleucine McCourt et al., 2006, Amino Acids 31: 173-210 McCourt et al., 2006, Amino Acids 31: 173-210 3-Methyl-1-Pentanol WO/2010/045629 (Liao et al.), Zhang et al., Pantothenic Acid WO/2001/021772 (Yocum et al.) 2008, Proc Nati AcadSci USA 105: 20653-20658 3-Methyl-1-Butanol WO/2008/098227 (Liao et al.), Atsumi et al., 4-Methyl-1-Hexanol W WO/2010/045629 (Liao et al.), Zhang et al., 2008, Nature 451:86-89, and Connor et al., 2008, Proc Nati AcadSci USA 105: 20653-20658 2008, Appi. Environ. Microbiol. 74:5769-5775 5-Methyl-1-Heptanol WO/2010/045629 (Liao et al.), Zhang et al., 4-Methyl-1-Pentanol WO/2010/045629 (Liao et al.), Zhang et al., 2008, Proc Nati AcadSci USA 105: 20653-20658 2008, Proc Nati AcadSci USA 105: 20653-20658 Coenzyme A The contents of each of the references in this table are herein incorporated by reference in WO/2001/021772 (Yocum et al.) their entireties for all purposes. The contents of each of the references in this table are herein incorporated by reference in their entireties for all purposes. 0.124. Each of the biosynthetic pathways listed in Table 2 0122 Each of the biosynthetic pathways listed in Table 1 shares the common 3-keto acid intermediate, 2-aceto-2-hy shares the common 3-keto acid intermediate, acetolactate. droxybutyrate. Therefore, the product yield from these bio Therefore, the product yield from these biosynthetic path synthetic pathways will in part depend upon the amount of ways will in part depend upon the amount of acetolactate that acetolactate that is available to downstream enzymes of said is available to downstream enzymes of said biosynthetic path biosynthetic pathways. ways. 0.125. Likewise, yeast cells can be engineered to produce a (0123. Another example of a 3-keto acid which is common number of desirable products via biosynthetic pathways that to many biosynthetic pathways is 2-aceto-2-hydroxybutyrate, utilize an aldehyde as a pathway intermediate. Engineered which is formed from pyruvate and 2-ketobutyrate by the biosynthetic pathways comprising an aldehyde intermediate action of the enzyme acetolactate synthase (also known as include biosynthetic pathways for the production of isobu acetohydroxy acid synthase). Amongst the biosynthetic path tanol, 1-butanol, 2-methyl-1-butanol, 3-methyl-1-butanol, ways using 2-aceto-2-hydroxybutyrate as intermediate 1-propanol. 1-pentanol, 1-hexanol, 3-methyl-1-pentanol, include pathways for the production of 2-methyl-1-butanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, and 5-methyl-1- isoleucine, 3-methyl-1-pentanol, 4-methyl-1-hexanol, and heptanol (See Table 3 and FIGS. 18, 19, and 20).

TABLE 3 Biosynthetic Pathways Utilizing an Aldehyde as an Intermediate Biosynthetic Aldehyde Pathway Intermediate Reference Isobutanol Isobutyraldehyde US 2009/0226991 (Feldman et al.), US 2011/0020889 (Feldman et al.), and US 2010/0143997 (Buelter et al.) 1-Butanol 1-Butanal WO/2010/017230 (Lynch), WO/2010/031772 (Wu et al.), WO/2010/045629 (Liao et al.), WO/2007/041269 (Donaldson et al.), WO 2008/052991 (Raamsdonket al.), WO/2008/143704 (Buelter et al.), and WO/2008/08O124 (Gunawardena et al.) 2-Methyl-1- 2-Methyl-1- WO/2008/098227 (Liao et al.), WO/2009/076480 (Picataggio Butanol Butanal et al.), and Atsumi et al., 2008, Nature 451: 86-89 3-Methyl-1- 3-Methyl-1- WO/2008/098227 (Liao et al.), Atsumi et al., 2008, Nature Butanol Butanal 451:86-89, and Connor et al., 2008, Appl. Environ. Microbiol. 74: 5769-5775 -Propano -Propanal WO/2008/098227 (Liao et al.) -Pentano -Pentanal WO/2010/045629 (Liao et al.), Zhang et al., 2008, Proc. Nail AcadSci USA 105: 20653-20658 -Hexanol -Hexanal WO/2010/045629 (Liao et al.), Zhang et al., 2008, Proc. Nail AcadSci USA 105: 20653-20658 WO/2010/045629 (Liao et al.), Zhang et al., 2008, Proc. Nail AcadSci USA 105: 20653-20658 WO/2010/045629 (Liao et al.), Zhang et al., 2008, Proc. Nail AcadSci USA 105: 20653-20658 WO/2010/045629 (Liao et al.), Zhang et al., 2008, Proc. Nail AcadSci USA 105: 20653-20658 US 2011/020 1 090 A1 Aug. 18, 2011

TABLE 3-continued Biosynthetic Pathways Utilizing an Aldehyde as an Intermediate Biosynthetic Aldehyde Pathway Intermediate Reference 5-Methyl-1- 5-Methyl-1- WO/2010/045629 (Liao et al.), Zhang et al., 2008, Heptanol Heptanal Proc. Nail AcadSci USA 105: 20653-20658 The contents of each of the references in this table are herein incorporated by reference in their entireties for all purposes,

0126 Each of the biosynthetic pathways listed in Table 3 lactate. The accumulation of this by-product was found to have an aldehyde intermediate. For example, the aldehyde hinder optimal productivity and yield of the biosynthetic intermediate in the isobutanol producing metabolic pathway pathway's target metabolite. The present inventors found that is isobutyraldehyde (See FIG. 1), while pathways for the the production of DH2MB is caused by the reduction of production of 1-butanol, 2-methyl-1-butanol, 3-methyl-1-bu acetolactate. To reduce or eliminate the activity responsible tanol. 1-propanol. 1-pentanol, 1-hexanol, 3-methyl-1-pen for the production of DH2MB, the corresponding enzymatic tanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, and 5-me activity catalyzing this reaction had to be identified and thyl-1-heptanol utilize 1-butanal, 2-methyl-1-butanal, 3-methyl-1-butanal, 1-propanal, 1-pentanal, 1-hexanal, reduced or eliminated. The inventors have found in S. cerevi 3-methyl-1-pentanal, 4-methyl-1-pentanal, 4-methyl-1- siae that one Such enzyme catalyzing the conversion of aceto hexanal, and 5-methyl-1-heptanol as aldehyde intermediates, lactate to DH2MB is YMR226C (also known as TMA29). respectively. Therefore, the product yield in biosynthetic This the first report of a protein in yeast that converts aceto pathways that utilize these aldehyde intermediates will in part lactate to DH2MB. depend upon the amount of the aldehyde intermediate that is I0131 The present inventors have also discovered that the available to downstream enzymes of said biosynthetic path 3-hydroxyacid by-product, 2-ethyl-2,3-dihydroxybutanoate, ways. accumulates during fermentation reactions with microorgan 0127. As described herein, the present inventors have dis isms comprising biosynthetic pathways involving the 3-keto covered the enzymatic activities responsible for the accumu acid intermediate, 2-aceto-2-hydroxybutyrate. The accumu lation of unwanted by-products derived from 3-keto acid lation of this by-product was found to hinder optimal produc and/or aldehyde intermediates. Specifically, they have deter tivity and yield of the biosynthetic pathway's target metabo mined that a 3-ketoacid reductase and an aldehyde dehydro lite. The present inventors found that the production of genase are responsible for the conversion of 3-keto acids and 2-ethyl-2,3-dihydroxybutanoate is caused by the reduction of aldehydes, respectively, to unwanted by-products. The activi 2-aceto-2-hydroxybutyrate. To reduce or eliminate the activ ties of these enzymes are shown to hinder the optimal pro ity responsible for the production of 2-ethyl-2,3-dihydrox ductivity and yield of 3-keto acid- and/or aldehyde-derived ybutanoate, the corresponding enzymatic activity catalyzing products, including, but not limited to, those listed in Tables this reaction had to be identified and reduced or eliminated. 1-3. The present inventors have found that Suppressing these The inventors have found in S. cerevisiae, the enzyme newly-characterized enzymatic activities considerably YMR226C (also known as TMA29) which catalyzes the con reduces or eliminates the formation of unwanted by-products, version of acetolactate to DH2MB also catalyzes the conver and concomitantly improves the yields and titers of beneficial sion of 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydrox metabolites. ybutanoate. This the first report of a protein in yeast that Reduced Accumulation of 3-Hydroxyacids from 3-Keto converts 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydrox Acids ybutanoate. 0128. As described herein, the present inventors have dis 0.132. The present inventors describe herein multiple strat covered that unwanted by-products, 3-hydroxyacids, can egies for reducing the conversion of the 3-keto acid interme accumulate during fermentation reactions with microorgan diate to the corresponding 3-hydroxyacid by-product, a pro isms comprising a pathway involving a 3-keto acid interme cess which is accompanied by an increase in the yield of diate. desirable metabolites. In one embodiment, the 3-keto acid 0129. As used herein, a “3-hydroxyacid' is an organic intermediate is acetolactate and the corresponding 3-hy compound which contains a carboxylic acid moiety on the C1 droxyacid is DH2MB. As described herein, reducing the con carbon and an alcohol moiety on the C3 carbon. 3-hydroxy version of acetolactate to DH2MB enables the increased pro acids can be obtained from 3-keto acids by chemical reduc duction of beneficial metabolites such as isobutanol, tion of the 3-keto acid ketone moiety to an alcohol moiety. For 2-butanol, 1-butanol. 2-butanone, 2,3-butanediol, acetoin, example, reduction of the ketone moiety in acetolactate or diacetyl, Valine, leucine, pantothenic acid, isobutylene, 3-me 2-hydroxy-2-methyl-3-oxobutanoic acid results in the forma thyl-1-butanol, 4-methyl-1-pentanol, and coenzyme A which tion of 3-hydroxyacid 2,3-dihydroxy-2-methylbutanoic acid are derived from biosynthetic pathways which use acetolac (DH2MB) (See, e.g., FIG. 2). tate as an intermediate. In another embodiment, the 3-keto 0130. The present inventors have discovered that the 3-hy acid intermediate is 2-aceto-2-hydroxybutyrate and the cor droxyacid by-product, 2,3-dihydroxy-2-methylbutanoic acid responding 3-hydroxyacid is 2-ethyl-2,3-dihydroxybu (CAS # 14868-24-7) (DH2MB), accumulates during fermen tanoate. As described herein, reducing the conversion of 2-ac tation reactions with microorganisms comprising biosyn eto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutanoate thetic pathways involving the 3-keto acid intermediate, aceto enables the increased production of beneficial metabolites US 2011/020 1 090 A1 Aug. 18, 2011

Such as 2-methyl-1-butanol, isoleucine, 3-methyl-1-pen said gene. In another embodiment, the recombinant microor tanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol. ganism includes a partial deletion of a gene encoding for a 0.133 Accordingly, one aspect of the invention is directed 3-ketoacid reductase gene resulting in a reduction of 3-ke to a recombinant microorganism comprising a biosynthetic toacid reductase activity of a polypeptide encoded by the pathway which uses a 3-keto acid as an intermediate, wherein gene. In another embodiment, the recombinant microorgan said recombinant microorganism is Substantially free of an ism comprises a complete deletion of a gene encoding for a enzyme that catalyzes the conversion of the 3-keto acid inter 3-ketoacid reductase resulting in a reduction of 3-ketoacid mediate to a 3-hydroxyacid by-product. In one embodiment, reductase activity of a polypeptide encoded by the gene. In yet the 3-keto acid intermediate is acetolactate and the 3-hy another embodiment, the recombinant microorganism droxyacid by-product is DH2MB. In another embodiment, includes a modification of the regulatory region associated the 3-keto acid intermediate is 2-aceto-2-hydroxybutyrate with the gene encoding for a 3-ketoacid reductase resulting in and the 3-hydroxyacid by-product is 2-ethyl-2,3-dihydrox a reduction of expression of a polypeptide encoded by said ybutanoate. gene. In yet another embodiment, the recombinant microor 0134. In another aspect, the invention is directed to a ganism comprises a modification of the transcriptional regu recombinant microorganism comprising a biosynthetic path lator resulting in a reduction of transcription of gene encoding way which uses a 3-keto acid as an intermediate, wherein said for a 3-ketoacid reductase. In yet another embodiment, the recombinant microorganism is engineered to reduce or elimi recombinant microorganism comprises mutations in all genes nate the expression or activity of an enzyme catalyzing the encoding for a 3-ketoacid reductase resulting in a reduction of conversion of the 3-keto acid intermediate to a 3-hydroxyacid activity of a polypeptide encoded by the gene(s). In one by-product. In one embodiment, the 3-keto acid intermediate embodiment, said 3-ketoacid reductase gene is the S. cerevi is acetolactate and the 3-hydroxyacid by-product is DH2MB. siae TMA29 (YMR226C) gene or a homolog thereof. As In another embodiment, the 3-keto acid intermediate is 2-ac would be understood in the art, naturally occurring homologs eto-2-hydroxybutyrate and the 3-hydroxyacid by-product is of TMA29 in yeast other than S. cerevisiae can similarly be 2-ethyl-2,3-dihydroxybutanoate. inactivated using the methods of the present invention. 0135) In various embodiments described herein, the pro TMA29 homologs and methods of identifying such TMA29 tein involved in catalyzing the conversion of the 3-keto acid homologs are described herein. intermediate to the 3-hydroxyacid by-product is a ketoreduc 0.138. As is understood by those skilled in the art, there are tase. In an exemplary embodiment, the ketoreductase is a several additional mechanisms available for reducing or dis 3-ketoacid reductase (3-KAR). As used herein, the term rupting the activity of a protein such as 3-ketoacid reductase, “3-ketoacid reductase' refers to a ketoreductase (i.e. ketone including, but not limited to, the use of a regulated promoter, reductase) active towards the 3-oxo group of a 3-keto acid. An use of a weak constitutive promoter, disruption of one of the illustration of exemplary reactions capable of being catalyzed two copies of the gene in a diploid yeast, disruption of both by 3-ketoacid reductases is shown in FIG. 2. Suitable 3-ke copies of the gene in a diploid yeast, expression of an anti toacid reductases are generally found in the enzyme classifi sense nucleic acid, expression of an siRNA, over expression cation subgroup 1.1.1.X., the final digit X being dependent of a negative regulator of the endogenous promoter, alteration upon the Substrate. A non-limiting list of exemplary 3-ke of the activity of an endogenous or heterologous gene, use of toacid reductases and their corresponding enzyme classifica a heterologous gene with lower specific activity, the like or tion number is shown in FIG. 3. combinations thereof. 0136. In an exemplary embodiment, the 3-ketoacid reduc 0.139. As described herein, the recombinant microorgan tase is the S. cerevisiae YMR226C (SEQID NO: 1) protein, isms of the present invention are engineered to produce less of used interchangeably herein with “TMA29. In some the 3-hydroxyacid by-product than an unmodified parental embodiments, the 3-ketoacid reductase is the S. cerevisiae microorganism. In one embodiment, the recombinant micro YMR226C (SEQID NO: 1) protein or a homolog or variant organism produces the 3-hydroxyacid by-product from a car thereof. In one embodiment, the homolog may be selected bon source at a carbon yield of less than about 20 percent. In from the group consisting of Vanderwaltonzyma polyspora another embodiment, the microorganism is produces the (SEQ ID NO: 2), Saccharomyces castellii (SEQID NO:3), 3-hydroxyacid by-product from a carbon Source at a carbon Candida glabrata (SEQID NO: 4), Saccharomyces bayanus yield of less than about 10, less than about 5, less than about (SEQIDNO:5), Zgosaccharomyces rouxii (SEQID NO:6), 2, less than about 1, less than about 0.5, less than about 0.1, or K. lactis (SEQID NO: 7), Ashbya gossypii (SEQ ID NO: 8), less than about 0.01 percent. In one embodiment, the 3-hy Saccharomyces kluyveri (SEQ ID NO: 9), Kluyveromyces droxyacid by-product is DH2MB, derived from the 3-keto thermotolerans (SEQ ID NO: 10), Kluyveromyces waltii acid, acetolactate. In another embodiment, the 3-hydroxyacid (SEQ ID NO: 11), Pichia stipitis (SEQID NO: 12), Debaro by-product is 2-ethyl-2,3-dihydroxybutanoate, derived from myces hansenii (SEQ ID NO: 13), Pichia pastoris (SEQ ID the 3-keto acid, 2-aceto-2-hydroxybutyrate. NO: 14), Candida dubliniensis (SEQ ID NO: 15), Candida 0140. In one embodiment, the 3-hydroxyacid by-product albicans (SEQID NO:16), Yarrowia lipolytica (SEQID NO: carbonyield derived from the3-ketoacid is reduced by at least 17), Issatchenkia Orientalis (SEQ ID NO: 18), Aspergillus about 50% in a recombinant microorganism as compared to a nidulans (SEQID NO: 19), Aspergillus niger (SEQ ID NO: parental microorganism that does not comprise a reduction or 20), Neurospora crassa (SEQ ID NO: 21), Schizosaccharo deletion of the activity or expression of one or more endog myces pombe (SEQID NO: 22), and Kluyveromyces marx enous proteins involved in catalyzing the conversion of the ianus (SEQID NO. 23). 3-ketoacid intermediate to the 3-hydroxyacid by-product. In 0.137 In one embodiment, the recombinant microorgan another embodiment, the 3-hydroxyacid by-product derived ism of the invention includes a mutation in at least one gene from the 3-ketoacid is reduced by at least about 60%, by at encoding for a 3-ketoacid reductase resulting in a reduction of least about 65%, by at least about 70%, by at least about 75%, 3-ketoacid reductase activity of a polypeptide encoded by by at least about 80%, by at least about 85%, by at least about US 2011/020 1 090 A1 Aug. 18, 2011

90%, by at least about 95%, by at least about 99%, by at least droxyacid by-product are outlined as follows: endogenous about 99.9%, or by at least about 100% as compared to a yeast genes coding for ketoreductases, short chain alcohol parental microorganism that does not comprise a reduction or dehydrogenases, medium chain alcohol dehydrogenases, deletion of the activity or expression of one or more endog members of the aldose reductase family, members of the enous proteins involved in catalyzing the conversion of the D-hydroxyacid dehydrogenase family, alcohol dehydrogena 3-ketoacid to the 3-hydroxyacid by-product. In one embodi ses, and lactate dehydrogenases are deleted from the genome ment, the 3-hydroxyacid by-product is DH2MB, derived of a yeast strain comprising a biosynthetic pathway in which from the 3-keto acid, acetolactate. In another embodiment, a 3-ketoacid (e.g., acetolactate or 2-aceto-2-hydroxybu the 3-hydroxyacid by-product is 2-ethyl-2,3-dihydroxybu tyrate) is an intermediate. These deletion strains are com tanoate, derived from the 3-keto acid, 2-aceto-2-hydroxybu pared to the parent strain by fermentation and analysis of the tyrate. fermentation broth for the presence and concentration of the 0141. In an additional embodiment, the yield of a desirable corresponding 3-hydroxyacid by-product (e.g., DH2MB or fermentation product is increased in the recombinant micro 2-ethyl-2,3-dihydroxybutanoate, derived from acetolactate organisms comprising a reduction or elimination of the activ and 2-aceto-2-hydroxybutyrate, respectively). In S. cerevi ity or expression of one or more endogenous proteins siae, deletions that reduce the production of the 3-hydroxy involved in catalyzing the conversion of the 3-ketoacid inter acid by-product are combined by construction of strains car mediate to the 3-hydroxyacid by-product. In one embodi rying multiple deletions. Candidate genes can include, but are ment, the yield of a desirable fermentation product is not limited to,YAL060W.YJR 159W, YGL157W, YBL114W, increased by at least about 1% as compared to a parental YOR120W, YKL055C, YBR159W, YBR149W, YDL168W, microorganism that does not comprise a reduction or elimi YDR368W, YLR426W, YCR107W, YILL24W, YML054C, nation of the activity or expression of one or more endog YOL151W, YMR318C, YBR046C, YHR104W, YIR036C, enous proteins involved in catalyzing the conversion of the YDL174C, YDR541C, YBR 145W, YGL039W, YCR105W, 3-ketoacid intermediate to the 3-hydroxyacid by-product. In YDL124W, YIR035C, YFLO56C, YNL274C, YLR255C, another embodiment, the yield of a desirable fermentation YGL185C, YGL256W, YJR096W, YJR155W, YPL275W, product is increased by at least about 5%, by at least about YOR388C, YLR070C, YMR083W, YER081W, YJR139C, 10%, by at least about 25%, or by at least about 50% as YDL243C, YPL113C, YOL165C, YML086C, YMR303C, compared to a parental microorganism that does not comprise YDL246C, YLR070C, YHR063C, YNL331C, YFLO57C, a reduction or elimination of the activity or expression of one YIL155C, YOLO86C, YAL061W, YDR127W, YPR127W, or more endogenous proteins involved in catalyzing the con YCL018W, YIL074C, YIL124W, and YEL071 W. Many of version of the 3-ketoacid intermediate to the 3-hydroxyacid these deletion strains are available commercially (for by-product. In one embodiment, the 3-hydroxyacid by-prod example Open Biosystems YSC1054). These deletion strains uct is DH2MB, derived from the 3-keto acid, acetolactate. are transformed with a plasmid pGV2435 from which the Accordingly, in one embodiment, the desirable fermentation ALS gene (e.g., the B. subtilis alss) is expressed under the product is derived from any biosynthetic pathway in which control of the CUP1 promoter. The transformants are culti acetolactate acts as an intermediate, including, but not limited vated in YPD medium containing 150 g/L glucose in shake to, isobutanol, 2-butanol. 1-butanol, 2-butanone, 2,3-butane flasks at 30°C., 75 rpm in a shaking incubator for 48 hours. diol, acetoin, diacetyl, Valine, leucine, pantothenic acid, After 48 h samples from the shake flasks are analyzed by isobutylene, 3-methyl-1-butanol, 4-methyl-1-pentanol, and HPLC for the concentration of the 3-hydroxyacid by-product coenzyme A. In another embodiment, the 3-hydroxyacid by (e.g., DH2MB and 2-ethyl-2,3-dihydroxybutanoate, derived product is 2-ethyl-2,3-dihydroxybutanoate, derived from the from acetolactate and 2-aceto-2-hydroxybutyrate, respec 3-keto acid, 2-aceto-2-hydroxybutyrate. Accordingly, in tively). As would be understood in the art, naturally occurring another embodiment, the desirable fermentation product is homologs of 3-ketoacid reductase genes (e.g., TMA29) in derived from any biosynthetic pathway in which 2-aceto-2- yeast other than S. cerevisiae can similarly be inactivated. hydroxybutyrate acts as an intermediate, including, but not 3-ketoacid reductase gene (e.g., TMA29) homologs and limited to, 2-methyl-1-butanol, isoleucine, 3-methyl-1-pen methods of identifying such 3-ketoacid reductase gene tanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol. homologs are described herein. 0142. In further embodiments, additional enzymes poten 0144. Another way to screen the deletion library is to tially catalyzing the conversion of a 3-ketoacid intermediate incubate yeast cells with the 3-ketoacid intermediate (e.g., to a 3-hydroxyacid by-product are deleted from the genome acetolactate or 2-aceto-2-hydroxybutyrate) and analyze the of a recombinant microorganism comprising a biosynthetic broth for the production of the corresponding 3-hydroxyacid pathway which uses a 3-ketoacid as an intermediate. Endog by-product (e.g., DH2MB or 2-ethyl-2,3-dihydroxybu enous yeast genes with the potential to convert of a 3-ketoacid tanoate, derived from acetolactate and 2-aceto-2-hydroxybu intermediate to a 3-hydroxyacid by-product include ketore tyrate, respectively). ductases, short chain alcohol dehydrogenases, medium chain 0145 Some of the listed genes are the result of tandem alcohol dehydrogenases, members of the aldose reductase duplication or whole genome duplication events and are family, members of the D-hydroxyacid dehydrogenase fam expected to have similar substrate specificities. Examples are ily, alcohol dehydrogenases, and lactate dehydrogenases. In YAL061W (BDH1), and YAL060W (BDH2), YDR368W one embodiment, the 3-hydroxyacid by-product is DH2MB, (YPR1) and YOR120W (GCY1). Deletion of just one of the derived from the3-keto acid, acetolactate. In another embodi duplicated genes is likely not to result in a phenotype. These ment, the 3-hydroxyacid by-product is 2-ethyl-2,3-dihydrox gene pairs have to be analyzed in strains carrying deletions in ybutanoate, derived from the 3-keto acid, 2-aceto-2-hydroxy both genes. butyrate. 014.6 An alternative approach to find additional endog 0143 Methods for identifying additional enzymes cata enous activity responsible for the production of the 3-hy lyzing the conversion of a 3-ketoacid intermediate to a 3-hy droxyacid by-product (e.g., DH2MB or 2-ethyl-2,3-dihy US 2011/020 1 090 A1 Aug. 18, 2011

droxybutanoate, derived from acetolactate and 2-aceto-2- ucts (e.g., isobutyrate in the case of isobutanol), can accumu hydroxybutyrate, respectively) is to analyze yeast strains that late duringfermentation reactions with microorganisms com overexpress the genes Suspected of encoding the enzyme prising a pathway involving an aldehyde intermediate (e.g., responsible for production of the 3-hydroxyacid by-product. isobutyraldehyde in the case of isobutanol). Such strains are commercially available for many of the can didate genes listed above (for example Open Biosystems 0151. As used herein, an “acid by-product” refers to an YSC3870). The ORF overexpressing strains are processed in organic compound which contains a carboxylic acid moiety. the same way as the deletion strains. They are transformed An acid by-product can be obtained by the oxidation of an with a plasmid for ALS expression and screened for 3-hy aldehyde. For example, the oxidation of isobutyraldehyde droxyacid by-product (e.g., DH2MB or 2-ethyl-2,3-dihy results in the formation of isobutyric acid (See, e.g., FIG. 4). droxybutanoate) production levels. To narrow the list of pos 0152 The present inventors have found that accumulation sible genes causing the production of the 3-hydroxyacid of these acid by-products hinders the optimal productivity by-product (e.g., DH2MB or 2-ethyl-2,3-dihydroxybu and yield of the biosynthetic pathway which utilize aldehyde tanoate), their expression can be analyzed in fermentation intermediates. The present inventors found that the produc samples. Genes that are not expressed during a fermentation tion of these acid by-products is caused by dehydrogenation that produced the 3-hydroxyacid by-product (e.g., DH2MB of the corresponding aldehyde. To reduce or eliminate the or 2-ethyl-2,3-dihydroxybutanoate) can be excluded from the activity responsible for the production of the acid by-product, list of possible targets. This analysis can be done by extraction the corresponding enzymatic activity catalyzing this reaction of RNA from fermenter samples and submitting these had to be identified and reduced or eliminated. The inventors samples to whole genome expression analysis, for example, have found in S. cerevisiae that one such enzyme catalyzing by Roche NimbleGen. the conversion of aldehydes to acid by-products is aldehyde 0147 As described herein, strains that naturally produce dehydrogenase. low levels of one or more 3-hydroxyacid by-products can also have applicability for producing increased levels of desirable 0153. The present inventors describe herein multiple strat fermentation products that are derived from biosynthetic egies for reducing acid by-product formation, a process pathways comprising a 3-ketoacid intermediate. As would be which is accompanied by an increase in the yield of desirable understood by one skilled in the art equipped with the instant metabolites such as isobutanol, 1-butanol, 2-methyl-1-bu disclosure, Strains that naturally produce low levels of one or tanol, 3-methyl-1-butanol. 1-propanol, 1-pentanol, 1-hex more 3-hydroxyacid by-products may inherently exhibit low anol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, 4-methyl or undetectable levels of endogenous enzyme activity, result 1-hexanol, and 5-methyl-1-heptanol. ing in the reduced conversion of 3-ketoacids to 3-hydroxyac 0154 Accordingly, one aspect of the invention is directed ids, a trait favorable for the production of a desirable fermen to a recombinant microorganism comprising a biosynthetic tation product such as isobutanol. Described herein are pathway which uses an aldehyde as an intermediate, wherein several approaches for identifying a native host microorgan said recombinant microorganism is Substantially free of an ism which is substantially free of 3-ketoacid reductase activ enzyme that catalyzes the conversion of an aldehyde to an ity. For example, one approach to finding a host microorgan acid by-product. ism which exhibits inherently low or undetectable 0.155. In another aspect, the invention is directed to a endogenous enzyme activity responsible for the production recombinant microorganism comprising a biosynthetic path of the 3-hydroxyacid by-product (e.g., DH2MB or 2-ethyl-2, way which uses an aldehyde as an intermediate, wherein said 3-dihydroxybutanoate) is to analyze yeast strains by incubat recombinant microorganism is engineered to reduce or elimi ing the yeast cells with a 3-keto acid (e.g., acetolactate or nate the expression or activity of one or more enzymes cata 2-aceto-2-hydroxybutyrate) and analyze the broth for the pro lyzing the conversion of the aldehyde to an acid by-product. duction of the corresponding 3-hydroxyacid by-product (e.g., 0156. In one embodiment, the aldehyde intermediate is DH2MB or 2-ethyl-2,3-dihydroxybutanoate, derived from isobutyraldehyde and the acid by-product is isobutyrate. In acetolactate and 2-aceto-2-hydroxybutyrate, respectively). another embodiment, the aldehyde intermediate is 1-butanal 0148. The recombinant microorganisms described herein and the acid by-product is butyrate. In yet another embodi which produce a beneficial metabolite derived from a biosyn ment, the aldehyde intermediate is 2-methyl-1-butanal and thetic pathway which uses a 3-keto acid as an intermediate the acid by-product is 2-methyl-1-butyrate. In yet another may be further engineered to reduce or eliminate enzymatic embodiment, the aldehyde intermediate is 3-methyl-1-buta activity for the conversion of pyruvate to products other than nal and the acid by-product is 3-methyl-1-butyrate. In yet the 3-keto acid (e.g., acetolactate and/or 2-aceto-2-hydroxy another embodiment, the aldehyde intermediate is 1-propanal butyrate). In one embodiment, the enzymatic activity of pyru and the acid by-product is propionate. In yet another embodi vate decarboxylase (PDC), lactate dehydrogenase (LDH), ment, the aldehyde intermediate is 1-pentanal and the acid pyruvate oxidase, pyruvate dehydrogenase, and/or glycerol by-product is pentanoate. In yet another embodiment, the 3-phosphate dehydrogenase (GPD) is reduced or eliminated. aldehyde intermediate is 1-hexanal and the acid by-product is 0149. In a specific embodiment, the beneficial metabolite hexanoate. In yet another embodiment, the aldehyde interme is produced in a recombinant PDC-minus GPD-minus yeast diate is 3-methyl-1-pentanal and the acid by-product is 3-me microorganism that overexpresses an acetolactate synthase thyl-1-pentanoate. In yet another embodiment, the aldehyde (ALS) gene. In another specific embodiment, the ALS is intermediate is 4-methyl-1-pentanal and the acid by-product encoded by the B. subtilis alsS. is 4-methyl-1-pentanoate. In yet another embodiment, the Reduced Accumulation of Acid By-Products from Aldehyde aldehyde intermediate is 4-methyl-1-hexanal and the acid Intermediates by-product is 4-methyl-1-hexanoate. In yet another embodi 0150. As described further in the Examples, the present ment, the aldehyde intermediate is 5-methyl-1-heptanal and inventors have also discovered that unwanted acid by-prod the acid by-product is 5-methyl-1-heptanoate. US 2011/020 1 090 A1 Aug. 18, 2011

0157. In various embodiments described herein, the pro encoded by the gene(s). In one embodiment, said aldehyde tein involved in catalyzing the conversion of an aldehyde to dehydrogenase is encoded by a gene selected from the group acid by-product is an aldehyde dehydrogenase (ALDH). consisting of ALD2, ALD3, ALD4, ALD5, ALD6, and 0158. As used herein, the term “aldehyde dehydrogenase' HFD1, and homologs and variants thereof. As would be refers to an enzyme catalyzing the reaction: understood in the art, naturally occurring homologs of alde an aldehyde--oxidized cofactor+H2O=an acid-reduced hyde dehydrogenase in yeast other than S. cerevisiae can cofactor-i-H similarly be inactivated using the methods of the present invention. Aldehyde dehydrogenase homologs and methods 0159. An illustration of exemplary reactions capable of being catalyzed by aldehyde dehydrogenases is shown in of identifying Such aldehyde dehydrogenase homologs are FIG. 4. Suitable aldehyde dehydrogenases are generally described herein. found in the enzyme classification Subgroup EC 1.2.1.X. 0162. As is understood by those skilled in the art, there are wherein the final digit X is dependent upon the substrate or several additional mechanisms available for reducing or dis the cofactor. For example, EC 1.2.1.3 catalyzes the following rupting the activity of a protein such as aldehyde dehydroge reaction: an aldehyde--NAD+HO-an acid--NADH-H): nase, including, but not limited to, the use of a regulated EC 1.2.1.4 catalyzes the following reaction: an aldehyde-- promoter, use of a weak constitutive promoter, disruption of NADP+HO—an acid-i-NADPH+H"); and EC1.2.1.5 cata one of the two copies of the gene in a diploid yeast, disruption lyzes the following reaction: an aldehyde--NAD(P)+ of both copies of the gene in a diploid yeast, expression of an HO—an acid-i-NAD(P)H-i-H". anti-sense nucleic acid, expression of an siRNA, over expres 0160. As described herein, the protein involved in cata sion of a negative regulator of the endogenous promoter, lyzing the conversion of an aldehyde to an acid by-product is alteration of the activity of an endogenous or heterologous an aldehyde dehydrogenase (ALDH). In one embodiment, gene, use of a heterologous gene with lower specific activity, the aldehyde dehydrogenase is encoded by a gene selected the like or combinations thereof. from the group consisting of ALD2, ALD3, ALD4, ALD5, 0163 As would be understood by one skilled in the art, the ALD6, and HFD1, and homologs and variants thereof. In an activity or expression of more than one aldehyde dehydroge exemplary embodiment, the aldehyde dehydrogenase is the S. nase can be reduced or eliminated. In one specific embodi cerevisiae aldehyde dehydrogenase ALD6 (SEQID NO:25) ment, the activity or expression of ALD4 and ALD6 or or a homolog or variant thereof. In one embodiment, the homologs or variants thereof is reduced or eliminated. In homolog may be selected from the group consisting of Sac another specific embodiment, the activity or expression of charomyces castelli (SEQ ID NO: 26), Candida glabrata ALD5 and ALD6 or homologs or variants thereof is reduced (SEQ ID NO: 27), Saccharomyces bayanus (SEQ ID NO: or eliminated. In yet another specific embodiment, the activ 28), Kluyveromyces lactis (SEQID NO: 29), Kluyveromyces ity or expression of ALD4, ALD5, and ALD6 or homologs or thermotolerans (SEQ ID NO: 30), Kluyveromyces waltii variants thereof is reduced or eliminated. In yet another spe (SEQID NO:31), Saccharomyces cerevisiae YJ789 (SEQID cific embodiment, the activity or expression of the cytosoli NO:32), Saccharomyces cerevisiae JAY291 (SEQ ID NO: cally localized aldehyde dehydrogenases ALD2, ALD3, and 33), Saccharomyces cerevisiae EC1118 (SEQ ID NO:34), ALD6 or homologs or variants thereof is reduced or elimi Saccharomyces cerevisiae DBY939 (SEQID NO:35), Sac nated. In yet another specific embodiment, the activity or charomyces cerevisiae AWR11631 (SEQ ID NO:36), Sac expression of the mitochondrially localized aldehyde dehy charomyces cerevisiae RM11-1a (SEQ ID NO: 37), Pichia drogenases, ALD4 and ALD5 or homologs or variants pastoris (SEQID NO: 38), Kluyveromyces marxianus (SEQ thereof, is reduced or eliminated. ID NO:39), Schizosaccharomyces pombe (SEQID NO: 40), 0164. As described herein, the recombinant microorgan and Schizosaccharomyces pombe (SEQID NO: 41). isms of the present invention are engineered to produce less of 0161 In one embodiment, the recombinant microorgan the acid by-product than an unmodified parental microorgan ism includes a mutation in at least one gene encoding for an ism. In one embodiment, the recombinant microorganism aldehyde dehydrogenase resulting in a reduction of aldehyde produces the acid by-product from a carbon source at a carbon dehydrogenase activity of a polypeptide encoded by said yield of less than about 50 percent as compared to a parental gene. In another embodiment, the recombinant microorgan microorganism. In another embodiment, the microorganism ism includes a partial deletion of gene encoding for an alde is produces the acid by-product from a carbon Source from a hyde dehydrogenase resulting in a reduction of aldehyde carbon source at a carbonyield of less than about 25, less than dehydrogenase activity of a polypeptide encoded by the gene. about 10, less than about 5, less than about 1, less than about In another embodiment, the recombinant microorganism 0.5, less than about 0.1, or less than about 0.01 percent as comprises a complete deletion of a gene encoding for an compared to a parental microorganism. In one embodiment, aldehyde dehydrogenase resulting in a reduction of aldehyde the acid by-product is isobutyrate, derived from isobutyral dehydrogenase activity of a polypeptide encoded by the gene. dehyde, an intermediate of the isobutanol biosynthetic path In yet another embodiment, the recombinant microorganism way. In another embodiment, the acid by-product is butyrate, includes a modification of the regulatory region associated derived from 1-butanal, an intermediate of the 1-butanol bio with the gene encoding for an aldehyde dehydrogenase synthetic pathway. In yet another embodiment, the acid by resulting in a reduction of expression of a polypeptide product is 2-methyl-1-butyrate, derived from 2-methyl-1-bu encoded by said gene. In yet another embodiment, the recom tanal, an intermediate of the 2-methyl-1-butanol biosynthetic binant microorganism comprises a modification of the tran pathway. In yet another embodiment, the acid by-product is Scriptional regulator resulting in a reduction of transcription 3-methyl-1-butyrate, derived from 3-methyl-1-butanal, an of a gene encoding for an aldehyde dehydrogenase. In yet intermediate of the 3-methyl-1-butanol biosynthetic path another embodiment, the recombinant microorganism com way. In yet another embodiment, the acid by-product is pro prises mutations in all genes encoding for an aldehyde dehy pionate, derived from 1-propanal, an intermediate of the drogenase resulting in a reduction of activity of a polypeptide 1-propanol biosynthetic pathway. In yet another embodi US 2011/020 1 090 A1 Aug. 18, 2011

ment, the acid by-product is pentanoate, derived from 1-pen 0166 In an additional embodiment, the yield of a desirable tanal, an intermediate of the 1-pentanol biosynthetic pathway. fermentation product is increased in the recombinant micro In yet another embodiment, the acid by-product is hexanoate, organisms comprising a reduction or elimination of the activ derived from 1-hexanal, an intermediate of the 1-hexanol ity or expression of one or more proteins involved in cata biosynthetic pathway. In yet another embodiment, the acid lyzing the conversion of an aldehyde to acid by-product. In by-product is 3-methyl-1-pentanoate, derived from 3-methyl one embodiment, the yield of a desirable fermentation prod 1-pentanal, an intermediate of the 3-methyl-1-pentanol bio uct is increased by at least about 1% as compared to a parental synthetic pathway. In yet another embodiment, the acid by microorganism that does not comprise a reduction or elimi product is 4-methyl-1-pentanoate, derived from 4-methyl-1- nation of the activity or expression of one or more endog enous proteins involved in catalyzing the conversion of an pentanal, an intermediate of the 4-methyl-1-pentanol aldehyde to acid by-product. In another embodiment, the biosynthetic pathway. In yet another embodiment, the acid yield of a desirable fermentation product is increased by at by-product is 4-methyl-1-hexanoate, derived from 4-methyl least about 5%, by at least about 10%, by at least about 25%, 1-hexanal, an intermediate of the 4-methyl-1-hexanol biosyn or by at least about 50% as compared to a parental microor thetic pathway. In yet another embodiment, the acid by-prod ganism that does not comprise a reduction or elimination of uct is 5-methyl-1-heptanoate, derived from 5-methyl-1- the activity or expression of one or more endogenous proteins heptanal, an intermediate of the 5-methyl-1-heptanol involved in catalyzing the conversion of an aldehyde to acid biosynthetic pathway. by-product. As described herein, the desirable fermentation 0.165. In one embodiment, the acid by-product carbon product may be derived from any biosynthetic pathway in yield from the corresponding aldehyde is reduced by at least which an aldehyde acts as an intermediate, including, but not about 50% in a recombinant microorganism as compared to a limited to, isobutanol, 1-butanol, 2-methyl-1-butanol, 3-me parental microorganism that does not comprise a reduction or thyl-1-butanol. 1-propanol. 1-pentanol, 1-hexanol, 3-methyl deletion of the activity or expression of one or more proteins 1-pentanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, and involved in catalyzing the conversion of an aldehyde to an 5-methyl-1-heptanol biosynthetic pathways. acid by-product. In another embodiment, the acid by-product 0.167 Methods for identifying additional enzymes cata carbon yield from acetolactate is reduced by at least about lyzing the conversion of an aldehyde to acid by-product are 60%, by at least about 65%, by at least about 70%, by at least outlined as follows: endogenous yeast genes coding for puta about 75%, by at least about 80%, by at least about 85%, by tive aldehyde and alcohol dehydrogenases are deleted from at least about 90%, by at least about 95%, by at least about the genome of a yeast strain. These deletion strains are com 99%, by at least about 99.9%, or by at least about 100% as pared to the parent strain by enzymatic assay. Many of these compared to a parental microorganism that does not comprise deletion strains are available commercially (for example a reduction or deletion of the activity or expression of one or Open Biosystems YSC1054). more proteins involved in catalyzing the conversion of an 0168 Another way to screen the deletion library is to aldehyde to an acid by-product. In one embodiment, the acid incubate yeast cells with an aldehyde (e.g., isobutyraldehyde by-product is isobutyrate, derived from isobutyraldehyde, an or 1-butanal) and analyze the broth for the production of the intermediate of the isobutanol biosynthetic pathway. In corresponding acid by-product (e.g., isobutyrate or butyrate, another embodiment, the acid by-product is butyrate, derived derived from isobutyraldehyde or 1-butanal, respectively). from 1-butanal, an intermediate of the 1-butanol biosynthetic 0169. An alternative approach to find additional endog pathway. In yet another embodiment, the acid by-product is enous activity responsible for the production of the acid by 2-methyl-1-butyrate, derived from 2-methyl-1-butanal, an product (e.g., isobutyrate or butyrate, derived from isobu intermediate of the 2-methyl-1-butanol biosynthetic path tyraldehyde or 1-butanal, respectively) is to analyze yeast way. In yet another embodiment, the acid by-product is 3-me strains that overexpress the genes Suspected of encoding the thyl-1-butyrate, derived from 3-methyl-1-butanal, an inter enzyme responsible for production of the acid by-product. mediate of the 3-methyl-1-butanol biosynthetic pathway. In Such strains are commercially available for many of the can yet another embodiment, the acid by-product is propionate, didate genes listed above (for example Open Biosystems derived from 1-propanal, an intermediate of the 1-propanol YSC3870). The ORF overexpressing strains are screened for biosynthetic pathway. In yet another embodiment, the acid increased acid by-product production levels. Alternatively, by-product is pentanoate, derived from 1-pentanal, an inter the cell lysates of the ORF overexpressing strains are assayed mediate of the 1-pentanol biosynthetic pathway. In yet for increased aldehyde oxidation activity. To narrow the list of another embodiment, the acid by-product is hexanoate, possible genes causing the production of acid by-products, derived from 1-hexanal, an intermediate of the 1-hexanol their expression can be analyzed in fermentation samples. biosynthetic pathway. In yet another embodiment, the acid Genes that are not expressed during a fermentation that pro by-product is 3-methyl-1-pentanoate, derived from 3-methyl duces an acid by-product can be excluded from the list of 1-pentanal, an intermediate of the 3-methyl-1-pentanol bio possible targets. This analysis can be done by extraction of synthetic pathway. In yet another embodiment, the acid by RNA from fermenter samples and submitting these samples product is 4-methyl-1-pentanoate, derived from 4-methyl-1- to whole genome expression analysis, for example, by Roche pentanal, an intermediate of the 4-methyl-1-pentanol NimbleGen. biosynthetic pathway. In yet another embodiment, the acid 0170 As described herein, strains that naturally produce by-product is 4-methyl-1-hexanoate, derived from 4-methyl low levels of one or more acid by-products can also have 1-hexanal, an intermediate of the 4-methyl-1-hexanol biosyn applicability for producing increased levels of desirable fer thetic pathway. In yet another embodiment, the acid by-prod mentation products that are derived from biosynthetic path uct is 5-methyl-1-heptanoate, derived from 5-methyl-1- ways comprising an aldehyde intermediate. As would be heptanal, an intermediate of the 5-methyl-1-heptanol understood by one skilled in the art equipped with the instant biosynthetic pathway. disclosure, Strains that naturally produce low levels of one or US 2011/020 1 090 A1 Aug. 18, 2011 more acid by-products may inherently exhibit low or unde or exchange, as well as gene disruption by the insertion of tectable levels of endogenous enzyme activity, resulting in the another gene or marker cassette. reduced conversion of aldehydes to acid by-products, a trait 0176 Another strategy described herein for reducing the favorable for the production of a desirable fermentation prod production of the by-product isobutyrate is to increase the uct such as isobutanol. Described herein are several activity and/or expression of an alcohol dehydrogenase approaches for identifying a native host microorganism (ADH) responsible for the conversion of isobutyraldehyde to which is substantially free of aldehyde dehydrogenase activ isobutanol. This strategy prevents competition by endog ity. For example, one approach to finding a host microorgan enous enzymes for the isobutanol pathway intermediate, ism which exhibits inherently low or undetectable endog isobutyraldehyde. An increase in the activity and/or expres enous enzyme activity responsible for the production of the sion of the alcohol dehydrogenase may be achieved by vari acid by-product (e.g., isobutyrate or butyrate) is to analyze ous means. For example, alcoholdehydrogenase activity can yeast strains by incubating the yeast cells with an aldehyde be increased by utilizing a promoter with increased promoter (e.g., isobutyraldehyde or 1-butanal) and analyze the broth strength, by increasing the copy number of the alcohol dehy for the production of the corresponding acid by-product (e.g., drogenase gene, or by utilizing an alternative or modified isobutyrate or butyrate, derived from isobutyraldehyde or alcohol dehydrogenase with increased specific activity. 1-butanal, respectively). 0177. An alternative strategy described herein for reduc 0171 As described above, one strategy reducing the pro ing the production of the by-product isobutyrate is to utilize duction of the acid by-product, isobutyrate, is to reduce or an alcohol dehydrogenase (ADH) in the isobutanol pathway eliminate the activity or expression of one or more endog responsible for the conversion of isobutyraldehyde to isobu enous aldehyde dehydrogenase proteins present in yeast that tanol which exhibits a decrease in Michaelis-Menten constant may be converting isobutyraldehyde to isobutyrate. (K). This strategy also prevents competition by endogenous 0172 Another strategy for reducing the production of enzymes for the isobutanol pathway intermediate, isobutyral isobutyrate is the reduction or elimination of activity or dehyde. expression of one more endogenous yeast alcohol dehydro 0.178 Another strategy described herein for reducing the genases. Reducing the expression of or deleting one or more production of the by-product isobutyrate is to utilize an alco alcohol dehydrogenases including, but not limited to, S. Cer holdehydrogenase (ADH) in the isobutanol pathway respon evisiae ADH1, ADH2, ADH3, ADH4, ADH5, ADH6, ADH7, sible for the conversion of isobutyraldehyde to isobutanol and SFA1, and homologs or variants thereof, will generally which exhibits increased activity and a decrease in Michaelis lead to a reduced production of isobutyrate and a concomitant Menten constant (K). This strategy also prevents competi increase in isobutanol yield. The reduction and/or deletion of tion by endogenous enzymes for the isobutanol pathway additional dehydrogenases are envisioned herein and are con intermediate, isobutyraldehyde. sidered within the scope of the present invention. These dehy (0179. Further, by utilizing a modified ADH enzyme, the drogenases include additional alcohol dehydrogenases Such present inventors may establish a situation in which the for as S. cerevisiae BDH1, BDH2, SOR1, SOR2, and XYL1, and ward reaction (i.e. the isobutyraldehyde conversion to isobu homologs or variants thereof, as well as aryl alcohol dehy tanol) is the favored reaction over the reverse reaction (i.e. the drogenases such as AAD3, AAD4, AAD6, AAD10, AAD14, conversion of isobutanol to isobutyraldehyde). AAD15, AAD16, and YPL088W, and homologs or variants 0180. The strategies described above generally lead to a thereof. decrease in isobutyrate yield, which is accompanied by an 0173. In another embodiment, the invention provides increase in isobutanol yield. Hence, the above strategies are recombinant microorganisms engineered to reduce and/or useful for decreasing the isobutyrate yield and/or titer and for deletion one or more additional genes encoding carbonyl/ increasing the ratio of isobutanol yield over isobutyrate yield. aldehyde reductases. These carbonyl/aldehyde reductases 0181. In one embodiment, the isobutyrate yield (mol include S. cerevisiae ARI1, YPR1, TMA29, YGL039W, and isobutyrate per mol glucose) is less than about 5%. In another UGA2, and homologs or variants thereof. embodiment, the isobutyrate yield (mol isobutyrate per mol 0.174. An additional strategy described herein for reducing glucose) is less than about 1%. In yet another embodiment, the production of the by-product isobutyrate is to reduce or the isobutyrate yield (mol isobutyrate per mol glucose) is less eliminate the activity or expression of endogenous proteins than about 0.5%, less than about 0.1%, less than about 0.05%, present in yeast that may be producing isobutyrate from the or less than about 0.01%. isobutanol pathway intermediate 2-ketoisovalerate. Such 0182. In one embodiment, the isobutanol to isobutyrate enzymes are generally referred to as ketoacid dehydrogena yield ratio is at least about 2. In another embodiment, the ses (KDH). Elimination or reduction of the activity or expres isobutanol to isobutyrate yield is at least about 5. In yet sion of these endogenous proteins can reduce or eliminate the another embodiment, the isobutanol to isobutyrate yield ratio production of the unwanted byproduct, isobutyrate. KDH at least about 20, at least about 100, at least about 500, or at enzyme activity has been identified in S. cerevisiae (Dickin least about 1000. son, J. R., and I. W. Dawes, 1992, The catabolism of 0183 The recombinant microorganisms described herein branched-chain amino acids occurs via a 2-oxoacid dehydro which produce a beneficial metabolite derived from a biosyn genase in S. cerevisiae. J. Gen. Microbiol. 138: 2029-2033). thetic pathway which uses an aldehyde as an intermediate Reducing the expression of or deleting one or more ketoacid may be further engineered to reduce or eliminate enzymatic dehydrogenases and homologs or variants thereof, will gen activity for the conversion of pyruvate to products other than erally lead to a reduced production of isobutyrate and a con a 3-keto acid (e.g., acetolactate and/or 2-aceto-2-hydroxybu comitant increase in isobutanol yield. tyrate). In one embodiment, the enzymatic activity of pyru 0.175. The reduction in expression of or deletion of genes vate decarboxylase (PDC), lactate dehydrogenase (LDH), in S. cerevisiae and other yeast can be achieved by methods pyruvate oxidase, pyruvate dehydrogenase, and/or glycerol known to those of skill in the art, such as allelic replacement 3-phosphate dehydrogenase (GPD) is reduced or eliminated. US 2011/020 1 090 A1 Aug. 18, 2011 20

0184. In a specific embodiment, the beneficial metabolite (SEQ ID NO: 2), Saccharomyces castellii (SEQ ID NO:3), is produced in a recombinant PDC-minus GPD-minus yeast Candida glabrata (SEQID NO: 4), Saccharomyces bayanus microorganism that overexpresses an acetolactate synthase (SEQIDNO:5), Zgosaccharomyces rouxii (SEQID NO:6), (ALS) gene. In another specific embodiment, the ALS is K. lactis (SEQID NO: 7), Ashbya gossypii (SEQID NO: 8), encoded by the B. subtilis alsS. Saccharomyces kluyveri (SEQ ID NO: 9), Kluyveromyces Reduced Accumulation of 3-Hydroxyacid By-Products and thermotolerans (SEQ ID NO: 10), Kluyveromyces waltii Acid by-Products (SEQID NO: 11), Pichia stipitis (SEQID NO: 12), Debaro 0185. The present inventors describe herein multiple strat myces hansenii (SEQ ID NO: 13), Pichia pastoris (SEQ ID egies for reducing the conversion of a 3-keto acid intermedi NO: 14), Candida dubliniensis (SEQ ID NO: 15), Candida ate to a corresponding 3-hydroxyacid by-product, a process albicans (SEQID NO:16), Yarrowia lipolytica (SEQID NO: which is accompanied by an increase in the yield of desirable 17), Issatchenkia Orientalis (SEQ ID NO: 18), Aspergillus metabolites. The present inventors also describe herein mul nidulans (SEQID NO: 19), Aspergillus niger (SEQID NO: tiple strategies for reducing the conversion of an aldehyde 20), Neurospora crassa (SEQ ID NO: 21), Schizosaccharo intermediate to a corresponding acid by-product, a process myces pombe (SEQID NO: 22), and Kluyveromyces marx which is accompanied by a further increase in the yield of ianus (SEQID NO:23). desirable metabolites. 0189 In various embodiments described herein, the pro 0186. Accordingly, in one aspect, the invention is directed tein involved in catalyzing the conversion of an aldehyde to an to a recombinant microorganism comprising a biosynthetic acid by-product is an aldehyde dehydrogenase (ALDH). In pathway which uses a 3-keto acid as an intermediate and an one embodiment, the aldehyde dehydrogenase is encoded by aldehyde as an intermediate, wherein said recombinant a gene selected from the group consisting of ALD2, ALD3. microorganism is (i) Substantially free of an enzyme that ALD4, ALD5, ALD6, and HFD1, and homologs and variants catalyzes the conversion of the 3-keto acid intermediate to a thereof. In an exemplary embodiment, the aldehyde dehydro 3-hydroxyacid by-product and (ii) substantially free of an genase is the S. cerevisiae aldehyde dehydrogenase ALD6 enzyme that catalyzes the conversion of an aldehyde to an (SEQ ID NO: 25) or homolog or variant thereof. In one acid by-product. In one embodiment, the 3-keto acid inter embodiment, the homolog may be selected from the group mediate is acetolactate. The biosynthetic pathway which uses consisting of Saccharomyces castelli (SEQID NO: 26), Can acetolactate and an aldehyde as intermediates may be dida glabrata (SEQ ID NO: 27), Saccharomyces bayanus selected from a pathway for the biosynthesis of isobutanol, (SEQ ID NO: 28), Kluyveromyces lactis (SEQ ID NO: 29), 1-butanol, and 3-methyl-1-butanol. In another embodiment, Kluyveromyces thermotolerans (SEQID NO:30), Kluyvero the 3-keto acid intermediate is 2-aceto-2-hydroxybutyrate. myces waltii (SEQ ID NO: 31), Saccharomyces cerevisiae The biosynthetic pathway which uses 2-aceto-2-hydroxybu YJ789 (SEQID NO:32), Saccharomyces cerevisiae JAY291 tyrate and an aldehyde as intermediates may be selected from (SEQ ID NO: 33), Saccharomyces cerevisiae EC1118 (SEQ a pathway for the biosynthesis of 2-methyl-1-butanol, 3-me ID NO. 34), Saccharomyces cerevisiae DBY939 (SEQ ID thyl-1-pentanol, 4-methyl-1-hexanol, and 5-methyl-1-hep NO: 35), Saccharomyces cerevisiae AWR11631 (SEQ ID tanol. NO:36), Saccharomyces cerevisiae RM11-1a (SEQID NO: 0187. In another aspect, the invention is directed to a 37), Pichia pastoris (SEQID NO:38), Kluyveromyces marx recombinant microorganism comprising a biosynthetic path ianus (SEQID NO:39), Schizosaccharomyces pombe (SEQ way which uses a 3-keto acid as an intermediate and an ID NO: 40), and Schizosaccharomyces pombe (SEQID NO: aldehyde as an intermediate, wherein said recombinant 41). microorganism is (i) engineered to reduce or eliminate the 0190. The recombinant microorganisms described herein expression or activity of an enzyme catalyzing the conversion which produce a beneficial metabolite derived from a biosyn of the 3-keto acid intermediate to a 3-hydroxyacid by-product thetic pathway which uses a 3-keto acid and an aldehyde as an and (ii) engineered to reduce or eliminate the expression or intermediate may be further engineered to reduce or eliminate activity of one or more enzymes catalyzing the conversion of enzymatic activity for the conversion of pyruvate to products the aldehyde to an acid by-product. In one embodiment, the other than a 3-keto acid (e.g., acetolactate and/or 2-aceto-2- 3-keto acid intermediate is acetolactate. The biosynthetic hydroxybutyrate). In one embodiment, the enzymatic activity pathway which uses acetolactate and an aldehyde as interme of pyruvate decarboxylase (PDC), lactate dehydrogenase diates may be selected from a pathway for the biosynthesis of (LDH), pyruvate oxidase, pyruvate dehydrogenase, and/or isobutanol, 1-butanol, and 3-methyl-1-butanol. In another glycerol-3-phosphate dehydrogenase (GPD) is reduced or embodiment, the 3-keto acid intermediate is 2-aceto-2-hy eliminated. droxybutyrate. The biosynthetic pathway which uses 2-aceto 0191 In a specific embodiment, the beneficial metabolite 2-hydroxybutyrate and an aldehyde as intermediates may be is produced in a recombinant PDC-minus GPD-minus yeast selected from a pathway for the biosynthesis of 2-methyl-1- microorganism that overexpresses an acetolactate synthase butanol, 3-methyl-1-pentanol, 4-methyl-1-hexanol, and (ALS) gene. In another specific embodiment, the ALS is 5-methyl-1-heptanol. encoded by the B. subtilis alsS. 0188 In various embodiments described herein, the pro Illustrative Embodiments of Strategies for Reducing Accu tein involved in catalyzing the conversion of the 3-keto acid mulation of 3-Hydroxyacid By-Products and/or Acid By intermediate to the 3-hydroxyacid by-product is a ketoreduc Products tase. In an exemplary embodiment, the ketoreductase is a 0.192 In a specific illustrative embodiment, the recombi 3-ketoacid reductase (3-KAR). In a further exemplary nant microorganism comprises an isobutanol producing embodiment, the 3-ketoacid reductase is the S. cerevisiae metabolic pathway of which acetolactate and isobutyralde YMR226C (SEQID NO: 1) protein or a homolog or variant hyde are intermediates, wherein said recombinant microor thereof. In one embodiment, the homolog may be selected ganism is Substantially free of enzymes catalyzing the con from the group consisting of Vanderwaltonzyma polyspora version of the acetolactate intermediate to DH2MB and of the US 2011/020 1 090 A1 Aug. 18, 2011 isobutyraldehyde intermediate to isobutyrate. In another spe (ALDH). A non-limiting example of such a pathway in which cific embodiment, the recombinant microorganism com a 3-ketoacid reductase (3-KAR) and an aldehyde dehydroge prises an isobutanol producing metabolic pathway of which nase (ALDH) are eliminated is depicted in FIG. 7. acetolactate and isobutyraldehyde are intermediates, wherein Overexpression of Enzymes Converting DH2MB into Isobu said recombinant microorganism is (i) engineered to reduce tanol Pathway Intermediates or eliminate the expression or activity of one or more 0.195 A different approach to reduce or eliminate the pro enzymes catalyzing the conversion of acetolactate to duction of 2,3-dihydroxy-2-methylbutanoic acid (CASH DH2MB and (ii) engineered to reduce or eliminate the 14868-24-7) in isobutanol producing yeast is to overexpress expression or activity of one or more enzymes catalyzing the an enzyme that converts DH2MB into an isobutanol pathway conversion of isobutyraldehyde to isobutyrate. In one intermediate. One way to accomplish this is through the use embodiment, the enzyme catalyzing the conversion of aceto of an enzyme that catalyzes the interconversion of DH2MB lactate to DH2MB is a 3-ketoacid reductase (3-KAR). In and acetolactate, but favors the oxidation of DH2MB. There another embodiment, the enzyme catalyzing the conversion fore, in one embodiment, the present invention provides a of isobutyraldehyde to isobutyrate is an aldehyde dehydroge recombinant microorganism for producing isobutanol, nase (ALDH). A non-limiting example of Such a pathway in wherein said recombinant microorganism overexpresses an which a 3-ketoacid reductase (3-KAR) and an aldehyde dehy endogenous or heterologous protein capable of converting drogenase (ALDH) are eliminated is depicted in FIG. 5. DH2MB into acetolactate. 0193 In a further specific illustrative embodiment, the 0196. In one embodiment, the endogenous or heterolo recombinant microorganism comprises a 3-methyl-1-butanol gous protein kinetically favors the oxidative reaction. In producing metabolic pathway of which acetolactate and another embodiment, the endogenous or heterologous protein 3-methyl-1-butanal are intermediates, wherein said recombi has a low K for DH2MB and a high K for acetolactate. In nant microorganism is substantially free of enzymes cata yet another embodiment, the endogenous or heterologous lyzing the conversion of the acetolactate intermediate to protein has a low K for the oxidized form of its cofactor and DH2MB and of the 3-methyl-1-butanal intermediate to 3-me a high K for the corresponding reduced form of its cofactor. thyl-1-butyrate. In another specific embodiment, the recom In yet another embodiment, the endogenous or heterologous binant microorganism comprises a 3-methyl-1-butanol pro protein has a higherk for the oxidative reaction than for the ducing metabolic pathway of which acetolactate and reductive direction. This endogenous or heterologous protein 3-methyl-1-butanal are intermediates, wherein said recombi should preferably have the ability to use aredox cofactor with nant microorganism is (i) engineered to reduce or eliminate a high concentration of its oxidized form versus its reduced the expression or activity of one or more enzymes catalyzing form. the conversion of acetolactate to DH2MB and (ii) engineered 0.197 In one embodiment, the endogenous or heterolo to reduce or eliminate the expression or activity of one or gous protein is encoded by a gene selected from the group more enzymes catalyzing the conversion of 3-methyl-1-buta consisting of YAL060W, YJR 159W, YGL157W, YBL114W, nal to 3-methyl-1-butyrate. In one embodiment, the enzyme YOR120W, YKL055C, YBR159W, YBR149W, YDL168W, catalyzing the conversion of acetolactate to DH2MB is a YDR368W, YLR426W, YCR107W, YILL24W, YML054C, 3-ketoacid reductase (3-KAR). In another embodiment, the YOL151W, YMR318C, YBR046C, YHR104W, YIR036C, enzyme catalyzing the conversion of 3-methyl-1-butanal to YDL174C, YDR541C, YBR 145W, YGL039W, YCR105W, 3-methyl-1-butyrate is an aldehyde dehydrogenase (ALDH). YDL124W, YIR035C, YFLO56C, YNL274C, YLR255C, A non-limiting example of Such a pathway in which a 3-ke YGL185C, YGL256W, YJR096W, YJR155W, YPL275W, toacid reductase (3-KAR) and an aldehyde dehydrogenase YOR388C, YLR070C, YMR083W, YER081W, YJR139C, (ALDH) are eliminated is depicted in FIG. 6. YDL243C, YPL113C, YOL165C, YML086C, YMR303C, 0194 In a further specific illustrative embodiment, the YDL246C, YLR070C, YHR063C, YNL331C, YFLO57C, recombinant microorganism comprises a 2-methyl-1-butanol YIL155C, YOLO86C, YAL061W, YDR127W, YPR127W, producing metabolic pathway of which acetolactate and YCLO18W,YIL074C,YIL124W, and YELO71 W. In addition, 2-methyl-1-butanal are intermediates, wherein said recombi heterologous genes can be overexpressed in isobutanol pro nant microorganism is substantially free of enzymes cata ducing yeast. For examples beta-hydroxy acid dehydrogena lyzing the conversion of the 2-aceto-2-hydroxybutyrate inter ses (EC 1.1.1.45 and EC 1.1.1.60) would be candidates for mediate to 2-ethyl-2,3-dihydroxybutyrate and of the overexpression. 2-methyl-1-butanal intermediate to 2-methyl-1-butyrate. In 0.198. In another embodiment, the endogenous or heter another specific embodiment, the recombinant microorgan ologous protein kinetically that favors the reductive reaction ism comprises a 2-methyl-1-butanol producing metabolic is engineered to favor the oxidative reaction. In another pathway of which 2-aceto-2-hydroxybutyrate and 2-methyl embodiment, the protein is engineered to have a low K for 1-butanal are intermediates, wherein said recombinant DH2MB and a high K for acetolactate. In yet another microorganism is (i) engineered to reduce or eliminate the embodiment, the protein is engineered to have a low K for expression or activity of one or more enzymes catalyzing the the oxidized form of its cofactor and a high K for the cor conversion of 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3-di responding reduced form of its cofactor. In yet another hydroxybutyrate and (ii) engineered to reduce or eliminate embodiment, the protein is engineered to have a higher k, the expression or activity of one or more enzymes catalyzing for the oxidative reaction than for the reductive direction. This the conversion of 2-methyl-1-butanal to 2-methyl-1-butyrate. engineered protein should preferably have the ability to use a In one embodiment, the enzyme catalyzing the conversion of redox cofactor with a high concentration of its oxidized form 2-aceto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutyrate versus its reduced form. is a 3-ketoacid reductase (3-KAR). In another embodiment, 0199 Alternatively, an enzyme could be overexpressed the enzyme catalyzing the conversion of 2-methyl-1-butanal that isomerizes DH2MB into DHIV. This approach represents to 2-methyl-1-butyrate is an aldehyde dehydrogenase a novel pathway for the production of isobutanol from pyru US 2011/020 1 090 A1 Aug. 18, 2011 22

Vate. Thus, in one embodiment, the present invention pro present invention provides a recombinant microorganism for vides a recombinant microorganism for producing isobu producing a product selected from 2-methyl-1-butanol, iso tanol, wherein said recombinant microorganism leucine, 3-methyl-1-pentanol, 4-methyl-1-hexanol, and overexpresses an endogenous or heterologous protein 5-methyl-1-heptanol, wherein said recombinant microorgan capable of converting DH2MB into 2,3-dihydroxyisovaler ism overexpresses an endogenous or heterologous protein ate. capable of converting 2-ethyl-2,3-dihydroxybutanoate into Overexpression of Enzymes Converting 2-Ethyl-2,3-Dihy C.B-dihydroxy-3-methylvalerate. droxybutanoate into Biosynthetic Pathway Intermediates Use of Overexpressed Ketol-Acid Reductoisomerase (KARI) 0200. A different approach to reduce or eliminate the pro and/or Modified Ketol-Acid Reductoisomerase (KARI) to duction of 2-ethyl-2,3-dihydroxybutanoate in yeast is to over Reduce the Production of DH2MB express an enzyme that converts 2-ethyl-2,3-dihydroxybu 0204 As described herein, the conversion of acetolactate tanoate into a biosynthetic pathway intermediate. This to DH2MB competes with the isobutanol pathway for the approach is useful for any biosynthetic pathway which uses intermediate acetolactate. In the current yeast isobutanol pro 2-aceto-2-hydroxybutyrate as an intermediate, including, but duction Strains, ketol-acid reductoisomerase (KARI) cata not limited to, 2-methyl-1-butanol, isoleucine, 3-methyl-1- lyzes the conversion of acetolactate to DHIV. pentanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol. 0205. In one embodiment, the present invention provides One way to accomplish this is through the use of an enzyme recombinant microorganisms having an overexpressed ketol that catalyzes the interconversion of 2-ethyl-2,3-dihydrox acid reductoisomerase (KARI), which catalyzes the conver ybutanoate and 2-aceto-2-hydroxybutyrate, but favors the sion of acetolactate to 2,3-dihydroxyisovalerate (DHIV). The oxidation of 2-ethyl-2,3-dihydroxybutanoate. Therefore, in overexpression of KARI has the effect of reducing DH2MB one embodiment, the present invention provides a recombi production. In one embodiment, the KARI has at least 0.01 nant microorganism for producing a product selected from U/mg of activity in the lysate. In another embodiment, the 2-methyl-1-butanol, isoleucine, 3-methyl-1-pentanol, 4-me KARI has at least 0.03 U/mg of activity in the lysate. In yet thyl-1-hexanol, and 5-methyl-1-heptanol wherein said another embodiment, the KARI has at least 0.05, 0.1, 0.5, 1, recombinant microorganism overexpresses an endogenous or 2, 5, or 10 U/mg of activity in the lysate. heterologous protein capable of converting 2-ethyl-2,3-dihy 0206. In a preferred embodiment, the overexpressed droxybutanoate into 2-aceto-2-hydroxybutyrate. KARI is engineered to exhibit a reduced K for acetolactate 0201 In one embodiment, the endogenous or heterolo as compared to a wild-type or parental KARI. The use of the gous protein kinetically favors the oxidative reaction. In modified KARI with lower K for acetolactate is expected to another embodiment, the endogenous or heterologous protein reduce the production of the by-product DH2MB. A KARI has a low K for 2-ethyl-2,3-dihydroxybutanoate and a high with lower Substrate K is identified by Screening homologs. K for 2-aceto-2-hydroxybutyrate. In yet another embodi In the alternative, the KARI can be engineered to exhibit ment, the endogenous or heterologous protein has a low K. reduced K by directed evolution using techniques known in for the oxidized form of its cofactor and a high K for the the art. corresponding reduced form of its cofactor. In yet another 0207. In each of these embodiments, the KARI may be a embodiment, the endogenous or heterologous protein has a variant enzyme that utilizes NADH (rather than NADPH) as higher k, for the oxidative reaction than for the reductive a co-factor. Such enzymes are described in the commonly direction. This endogenous or heterologous protein should owned and co-pending publication, US 2010/0143997, which preferably have the ability to use a redox cofactor with a high is herein incorporated by reference in its entirety for all pur concentration of its oxidized form versus its reduced form. poses. 0202 In one embodiment, the endogenous or heterolo gous protein is encoded by a gene selected from the group Use of Overexpressed Dihydroxy Acid Dehydratase (DHAD) consisting of YAL060W. YJR 159W, YGL157W, YBL114W, to Reduce the Production of DH2MB YOR120W, YKL055C, YBR159W, YBR149W, YDL168W, 0208. As described herein, the present inventors have YDR368W, YLR426W, YCR107W, YILL24W, YML054C, found that overexpression of the isobutanol pathway enzyme, YOL151W, YMR318C, YBR046C, YHR104W, YIR036C, dihydroxyacid dehydratase (DHAD), reduces the production YDL174C, YDR541C, YBR 145W, YGL039W, YCR105W, of the by-product, DH2MB. YDL124W, YIR035C, YFLO56C, YNL274C, YLR255C, YGL185C, YGL256W, YJR096W, YJR155W, YPL275W, 0209. Accordingly, in one embodiment, the present inven YOR388C, YLR070C, YMR083W, YER081W, YJR139C, tion provides recombinant microorganisms having an dihy YDL243C, YPL113C, YOL165C, YML086C, YMR303C, droxyacid dehydratase (DHAD), which catalyzes the conver YDL246C, YLR070C, YHR063C, YNL331C, YFLO57C, sion of 2,3-dihydroxyisovalerate (DHIV) tO YIL155C, YOLO86C, YAL061W, YDR127W, YPR127W, 2-ketoisovalerate (KIV). The overexpression of DHAD has YCLO18W,YIL074C,YIL124W, and YELO71 W. In addition, the effect of reducing DH2MB production. In one embodi heterologous genes can be overexpressed in isoleucine pro ment, the DHAD has at least 0.01 U/mg of activity in the ducing yeast. For examples beta-hydroxy acid dehydrogena lysate. In another embodiment, the DHAD has at least 0.03 ses (EC 1.1.1.45 and EC 1.1.1.60) would be candidates for U/mg of activity in the lysate. In yet another embodiment, the overexpression. DHAD has at least 0.05, 0.1, 0.5, 1, 2, 5, or 10 U/mg of 0203 Alternatively an enzyme could be overexpressed activity in the lysate. that isomerizes 2-ethyl-2,3-dihydroxybutanoate into 2,3-di Recombinant Microorganisms for the Production of 3-Hy hydroxy-3-methylvalerate. This approach represents a novel droxyacids pathway for the production of 2-methyl-1-butanol, isoleu cine, 3-methyl-1-pentanol. 4-methyl-1-hexanol, and 5-me 0210. The present invention provides in additional aspects thyl-1-heptanol from pyruvate. Thus, in one embodiment, the recombinant microorganisms for the production of 3-hy US 2011/020 1 090 A1 Aug. 18, 2011

droxyacids as a product or a metabolic intermediate. In one ucts derived from aldehydes. In one embodiment, these acid embodiment, these 3-hydroxyacid-producing recombinant product producing recombinant microorganisms express an microorganisms express acetolactate synthase (ALS) and a aldehyde dehydrogenase catalyzing the conversion of an 3-ketoacid reductase catalyzing the reduction of 2-acetolac aldehyde to a corresponding acid product. These acid product tate to DH2MB. In another embodiment, these 3-hydroxy producing recombinant microorganisms may be further engi acid-producing recombinant microorganisms express aceto neered to reduce or eliminate competing enzymatic activity lactate synthase (ALS) and a 3-ketoacid reductase catalyzing for the undesirable conversion of metabolites upstream of the the reduction of 2-aceto-2-hydroxybutyrate into 2-ethyl-2,3- desired acid product. dihydroxybutyrate. 0217. In a specific embodiment, the acid product is pro 0211. These 3-hydroxyacid-producing recombinant duced in a recombinant yeast microorganism that overex microorganisms may be further engineered to reduce or presses an aldehyde dehydrogenase. In one embodiment, the eliminate enzymatic activity for the conversion of pyruvate to aldehyde dehydrogenase is natively expressed. In another products other than acetolactate. In one embodiment, the embodiment, the aldehyde dehydrogenase is heterologously enzymatic activity of pyruvate decarboxylase (PDC), lactate expressed. In yet another embodiment, the aldehyde dehy dehydrogenase (LDH), pyruvate oxidase, pyruvate dehydro drogenase is overexpressed. In a specific embodiment, the genase, and/or glycerol-3-phosphate dehydrogenase (GPD) aldehyde dehydrogenase is encoded by the S. cerevisiae is reduced or eliminated. ALD6 gene or a homolog thereof. 0212. In a specific embodiment, DH2MB is produced in a 0218. In accordance with this additional aspect, the recombinant PDC-minus GPD-minus yeast microorganism present invention also provides a method of producing an acid that overexpresses an ALS gene and expresses a 3-ketoacid product, comprising: (a) providing an acid product-produc reductase. In one embodiment, the 3-ketoacid reductase is ing recombinant microorganism that expresses an aldehyde natively expressed. In another embodiment, the 3-ketoacid dehydrogenase catalyzing the conversion of an aldehyde to reductase is heterologously expressed. In yet another embodi acid product, and (b) cultivating said recombinant microor ment, the 3-ketoacid reductase is overexpressed. In a specific ganism in a culture medium containing a feedstock providing embodiment, the 3-ketoacid reductase is encoded by the S. the carbon source, until a recoverable quantity of the desired cerevisiae TMA29 gene or a homolog thereof. In another acid product is produced. specific embodiment, the ALS is encoded by the B. subtilis AlsS. The Microorganism in General 0213. In another specific embodiment, 2-ethyl-2,3-dihy droxybutyrate is produced in a recombinant PDC-minus 0219. The recombinant microorganisms provided herein GPD-minus yeast microorganism that overexpresses an ALS can express a plurality of heterologous and/or native enzymes gene and expresses a 3-ketoacid reductase. In one embodi involved in pathways for the production of beneficial metabo ment, the 3-ketoacid reductase is natively expressed. In lites such as isobutanol, 2-butanol, 1-butanol, 2-butanone, another embodiment, the 3-ketoacid reductase is heterolo 2,3-butanediol, acetoin, diacetyl, Valine, leucine, pantothenic gously expressed. In yet another embodiment, the 3-ketoacid acid, isobutylene, 3-methyl-1-butanol, coenzyme A, 2-me reductase is overexpressed. In a specific embodiment, the thyl-1-butanol, isoleucine, 1-pentanol, 1-hexanol, 3-methyl 3-ketoacid reductase is encoded by the S. cerevisiae TMA29 1-pentanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, 5-me gene or a homolog thereof. In another specific embodiment, thyl-1-heptanol, and 1-propanol from a Suitable carbon the ALS is encoded by the B. subtilis AlsS. Source. A non-limiting list of beneficial metabolites produced 0214. In accordance with these additional aspects, the in engineered biosynthetic pathways is found herein at Tables present invention also provides a method of producing 2.3- 1-3. dihydroxy-2-methylbutanoic acid (DH2MB), comprising: 0220. As described herein, “engineered” or “modified” (a) providing a DH2MB-producing recombinant microorgan microorganisms are produced via the introduction of genetic ism that expresses acetolactate synthase (ALS) and a 3-ke material into a host or parental microorganism of choice toacid reductase catalyzing the reduction of 2-acetolactate to and/or by modification of the expression of native genes, DH2MB, and (b) cultivating said recombinant microorgan thereby modifying or altering the cellular physiology and ism in a culture medium containing a feedstock providing the biochemistry of the microorganism. Through the introduction carbon source, until a recoverable quantity of DH2MB is of genetic material and/or the modification of the expression produced. of native genes the parental microorganism acquires new 0215. In accordance with these additional aspects, the properties, e.g., the ability to produce a new, or greater quan present invention also provides a method of producing tities of an intracellular and/or extracellular metabolite. As 2-ethyl-2,3-dihydroxybutyrate, comprising: (a) providing a described herein, the introduction of genetic material into 2-ethyl-2,3-dihydroxybutyrate-producing recombinant and/or the modification of the expression of native genes in a microorganism that expresses acetolactate synthase (ALS) parental microorganism results in a new or modified ability to and a 3-ketoacid reductase catalyzing the reduction of 2-ac produce beneficial metabolites such as isobutanol, 2-butanol, eto-2-hydroxybutyrate to 2-ethyl-2,3-dihydroxybutyrate, and 1-butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, (b) cultivating said recombinant microorganism in a culture Valine, leucine, pantothenic acid, isobutylene, 3-methyl-1- medium containing a feedstock providing the carbon Source, butanol, coenzyme A, 2-methyl-1-butanol, isoleucine, 1-pen until a recoverable quantity of 2-ethyl-2,3-dihydroxybutyrate tanol, 1-hexanol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, is produced. 4-methyl-1-hexanol, 5-methyl-1-heptanol, and 1-propanol from a suitable carbon Source. The genetic material intro Recombinant Microorganisms for the Production of Acid duced into and/or the genes modified for expression in the Products parental microorganism contains gene(s), or parts of genes, 0216. The present invention provides in additional aspects coding for one or more of the enzymes involved in a biosyn recombinant microorganisms for the production of acid prod thetic pathway for the production of one or more metabolites US 2011/020 1 090 A1 Aug. 18, 2011 24 selected from isobutanol, 2-butanol, 1-butanol, 2-butanone, codons can also be modified to reflect host preference. For 2,3-butanediol, acetoin, diacetyl, Valine, leucine, pantothenic example, typical stop codons for S. cerevisiae and mammals acid, isobutylene, 3-methyl-1-butanol, coenzyme A, 2-me are UAA and UGA, respectively. The typical stop codon for thyl-1-butanol, isoleucine, 1-pentanol, 1-hexanol, 3-methyl monocotyledonous plants is UGA, whereas insects and E. 1-pentanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, 5-me coli commonly use UAA as the stop codon (Dalphin et al., thyl-1-heptanol, and 1-propanol and may also include 1996, NuclAcids Res. 24:216-8). Methodology for optimiz additional elements for the expression and/or regulation of ing a nucleotide sequence for expression in a plant is pro expression of these genes, e.g., promoter sequences. vided, for example, in U.S. Pat. No. 6,015,891, and the ref 0221. In addition to the introduction of a genetic material erences cited therein. into a host or parental microorganism, an engineered or modi 0227 Those of skill in the art will recognize that, due to fied microorganism can also include alteration, disruption, the degenerate nature of the genetic code, a variety of DNA deletion or knocking-out of a gene or polynucleotide to alter compounds differing in their nucleotide sequences can be the cellular physiology and biochemistry of the microorgan used to encode a given enzyme of the disclosure. The native ism. Through the alteration, disruption, deletion or knocking DNA sequence encoding the biosynthetic enzymes described out of a gene or polynucleotide the microorganism acquires above are referenced herein merely to illustrate an embodi new or improved properties (e.g., the ability to produce a new ment of the disclosure, and the disclosure includes DNA metabolite or greater quantities of an intracellular metabolite, compounds of any sequence that encode the amino acid to improve the flux of a metabolite down a desired pathway, sequences of the polypeptides and proteins of the enzymes and/or to reduce the production of by-products). utilized in the methods of the disclosure. In similar fashion, a 0222 Recombinant microorganisms provided herein may polypeptide can typically tolerate one or more amino acid also produce metabolites in quantities not available in the Substitutions, deletions, and insertions in its amino acid parental microorganism. A "metabolite' refers to any Sub sequence without loss or significant loss of a desired activity. stance produced by metabolism or a Substance necessary for The disclosure includes such polypeptides with different or taking part in a particular metabolic process. A metabolite amino acid sequences than the specific proteins described can be an organic compound that is a starting material (e.g., herein so long as the modified or variant polypeptides have glucose or pyruvate), an intermediate (e.g., 2-ketoisovaler the enzymatic anabolic or catabolic activity of the reference ate), or an end product (e.g., isobutanol) of metabolism. polypeptide. Furthermore, the amino acid sequences encoded Metabolites can be used to construct more complex mol by the DNA sequences shown herein merely illustrate ecules, or they can be broken down into simpler ones. Inter embodiments of the disclosure. mediate metabolites may be synthesized from other metabo 0228. In addition, homologs of enzymes useful for gener lites, perhaps used to make more complex substances, or ating metabolites are encompassed by the microorganisms broken down into simpler compounds, often with the release and methods provided herein. of chemical energy. 0229. As used herein, two proteins (or a region of the 0223) The disclosure identifies specific genes useful in the proteins) are Substantially homologous when the amino acid methods, compositions and organisms of the disclosure; how sequences have at least about 30%, 40%, 50% 60%. 65%, ever it will be recognized that absolute identity to such genes 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, is not necessary. For example, changes in a particular gene or 96%, 97%, 98%, or 99% identity. To determine the percent polynucleotide comprising a sequence encoding a polypep identity of two amino acid sequences, or of two nucleic acid tide or enzyme can be performed and screened for activity. sequences, the sequences are aligned for optimal comparison Typically such changes comprise conservative mutations and purposes (e.g., gaps can be introduced in one or both of a first silent mutations. Such modified or mutated polynucleotides and a second amino acid or nucleic acid sequence for optimal and polypeptides can be screened for expression of a func alignment and non-homologous sequences can be disre tional enzyme using methods known in the art. garded for comparison purposes). In one embodiment, the 0224. Due to the inherent degeneracy of the genetic code, length of a reference sequence aligned for comparison pur other polynucleotides which encode substantially the same or poses is at least 30%, typically at least 40%, more typically at functionally equivalent polypeptides can also be used to clone least 50%, even more typically at least 60%, and even more and express the polynucleotides encoding Such enzymes. typically at least 70%, 80%, 90%, 100% of the length of the 0225. As will be understood by those of skill in the art, it reference sequence. The amino acid residues or nucleotides at can be advantageous to modify a coding sequence to enhance corresponding amino acid positions or nucleotide positions its expression in a particular host. The genetic code is redun are then compared. When a position in the first sequence is dant with 64 possible codons, but most organisms typically occupied by the same amino acid residue or nucleotide as the use a subset of these codons. The codons that are utilized most corresponding position in the second sequence, then the mol often in a species are called optimal codons, and those not ecules are identical at that position (as used hereinamino acid utilized very often are classified as rare or low-usage codons. or nucleic acid “identity” is equivalent to amino acid or Codons can be substituted to reflect the preferred codon usage nucleic acid “homology’). The percent identity between the of the host, in a process sometimes called "codon optimiza two sequences is a function of the number of identical posi tion” or “controlling for species codon bias.” tions shared by the sequences, taking into account the number 0226 Optimized coding sequences containing codons of gaps, and the length of each gap, which need to be intro preferred by a particular prokaryotic or eukaryotic host (Mur duced for optimal alignment of the two sequences. ray et al., 1989, NuclAcids Res. 17:477-508) can be prepared, 0230. When “homologous' is used in reference to proteins for example, to increase the rate of translation or to produce or peptides, it is recognized that residue positions that are not recombinant RNA transcripts having desirable properties, identical often differ by conservative amino acid substitu Such as a longer half-life, as compared with transcripts pro tions. A "conservative amino acid substitution' is one in duced from a non-optimized sequence. Translation stop which an amino acid residue is substituted by another amino US 2011/020 1 090 A1 Aug. 18, 2011 acid residuehaving a side chain (Rgroup) with similar chemi 4-methyl-1-hexanol, 5-methyl-1-heptanol, and 1-propanol cal properties (e.g., charge or hydrophobicity). In general, a from five-carbon (pentose) Sugars including Xylose. Most conservative amino acid substitution will not substantially yeast species metabolize Xylose via a complex route, in which change the functional properties of a protein. In cases where xylose is first reduced to xylitol via a xylose reductase (XR) two or more amino acid sequences differ from each other by enzyme. The xylitol is then oxidized to xylulose via axylitol conservative substitutions, the percent sequence identity or dehydrogenase (XDH) enzyme. The xylulose is then phos degree of homology may be adjusted upwards to correct for phorylated via a xylulokinase (XK) enzyme. This pathway the conservative nature of the substitution. Means for making operates inefficiently in yeast species because it introduces a this adjustment are well known to those of skill in the art (See, redox imbalance in the cell. The xylose-to-xylitol step uses e.g., Pearson W. R., 1994, Methods in Mol Biol 25: 365-89). NADH as a cofactor, whereas the xylitol-to-xylulose step 0231. The following six groups each contain amino acids uses NADPH as a cofactor. Other processes must operate to that are conservative substitutions for one another: 1) Serine restore the redox imbalance within the cell. This often means (S), Threonine (T); 2) Aspartic Acid (D), Glutamic Acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine that the organism cannot grow anaerobically on Xylose or (K); 5) Isoleucine (I), Leucine (L), Alanine (A), Valine (V), other pentose Sugars. Accordingly, a yeast species that can and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W). efficiently ferment Xylose and other pentose Sugars into a 0232 Sequence homology for polypeptides, which is also desired fermentation product is therefore very desirable. referred to as percent sequence identity, is typically measured 0236. Thus, in one aspect, the recombinant microorgan using sequence analysis software. See commonly owned and ism is engineered to express a functional exogenous Xylose co-pending application US 2009/0226991. A typical algo isomerase. Exogenous Xylose isomerases functional in yeast rithm used comparing a molecule sequence to a database are known in the art. See, e.g., Rajgarhia et al., US2006/ containing a large number of sequences from different organ 0234364, which is herein incorporated by reference in its isms is the computer program BLAST. When searching a entirety. In an embodiment according to this aspect, the exog database containing sequences from a large number of differ enous Xylose isomerase gene is operatively linked to pro ent organisms, it is typical to compare amino acid sequences. moter and terminator sequences that are functional in the Database searching using amino acid sequences can be mea yeast cell. In a preferred embodiment, the recombinant Sured by algorithms described in commonly owned and co microorganism further has a deletion or disruption of a native pending application US 2009/0226991. gene that encodes for an enzyme (e.g., XRand/or XDH) that 0233. It is understood that a range of microorganisms can catalyzes the conversion of xylose to xylitol. In a further be modified to include a recombinant metabolic pathway preferred embodiment, the recombinant microorganism also suitable for the production of beneficial metabolites from contains a functional, exogenous Xylulokinase (XK) gene acetolactate- and/or aldehyde intermediate-requiring biosyn thetic pathways. In various embodiments, microorganisms operatively linked to promoter and terminator sequences that may be selected from yeast microorganisms. Yeast microor are functional in the yeast cell. In one embodiment, the Xylu ganisms for the production of a metabolite such as isobutanol, lokinase (XK) gene is overexpressed. 2-butanol, 1-butanol. 2-butanone, 2,3-butanediol, acetoin, 0237. In one embodiment, the microorganism has reduced diacetyl, Valine, leucine, pantothenic acid, isobutylene, 3-me or no pyruvate decarboxylase (PDC) activity. PDC catalyzes thyl-1-butanol, coenzyme A, 2-methyl-1-butanol, isoleucine, the decarboxylation of pyruvate to acetaldehyde, which is 1-pentanol, 1-hexanol, 3-methyl-1-pentanol, 4-methyl-1- then reduced to ethanol by ADH via an oxidation of NADH to pentanol, 4-methyl-1-hexanol, 5-methyl-1-heptanol, and NAD+. Ethanol production is the main pathway to oxidize the 1-propanol may be selected based on certain characteristics: NADH from glycolysis. Deletion of this pathway increases 0234 One characteristic may include the property that the the pyruvate and the reducing equivalents (NADH) available microorganism is selected to convert various carbon sources for the biosynthetic pathway. Accordingly, deletion of PDC into beneficial metabolites such as isobutanol, 2-butanol, genes can further increase the yield of desired metabolites. 1-butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, 0238. In another embodiment, the microorganism has Valine, leucine, pantothenic acid, isobutylene, 3-methyl-1- reduced or no glycerol-3-phosphate dehydrogenase (GPD) butanol, coenzyme A, 2-methyl-1-butanol, isoleucine, 1-pen activity. GPD catalyzes the reduction of dihydroxyacetone tanol, 1-hexanol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, 4-methyl-1-hexanol, 5-methyl-1-heptanol, and 1-propanol. phosphate (DHAP) to glycerol-3-phosphate (G3P) via the The term "carbon source’ generally refers to a substance oxidation of NADH to NAD+. Glycerol is then produced suitable to be used as a source of carbon for prokaryotic or from G3P by Glycerol-3-phosphatase (GPP). Glycerol pro eukaryotic cell growth. Examples of suitable carbon Sources duction is a secondary pathway to oxidize excess NADH are described in commonly owned and co-pending applica from glycolysis. Reduction or elimination of this pathway tion US 2009/0226991. Accordingly, in one embodiment, the would increase the pyruvate and reducing equivalents recombinant microorganism herein disclosed can convert a (NADH) available for the biosynthetic pathway. Thus, dele variety of carbon Sources to products, including but not lim tion of GPD genes can further increase the yield of desired ited to glucose, galactose, mannose, Xylose, arabinose, lac metabolites. tose, Sucrose, and mixtures thereof. 0239. In yet another embodiment, the microorganism has 0235. The recombinant microorganism may thus further reduced or no PDC activity and reduced or no GPD activity. include a pathway for the production of isobutanol, 2-butanol, PDC-minus/GPD-minus yeast production strains are 1-butanol, 2-butanone, 2,3-butanediol, acetoin, diacetyl, described in commonly owned and co-pending publications, Valine, leucine, pantothenic acid, isobutylene, 3-methyl-1- US 2009/0226991 and US 2011/0020889, both of which are butanol, coenzyme A, 2-methyl-1-butanol, isoleucine, 1-pen herein incorporated by reference in their entireties for all tanol, 1-hexanol, 3-methyl-1-pentanol, 4-methyl-1-pentanol, purposes. US 2011/020 1 090 A1 Aug. 18, 2011 26

0240. In one embodiment, the yeast microorganisms may main pathway to oxidize the NADH from glycolysis is be selected from the “Saccharomyces Yeast Clade', as through the production of ethanol. Ethanol is produced by described in commonly owned and co-pending application alcohol dehydrogenase (ADH) via the reduction of acetalde US 2009/0226991. hyde, which is generated from pyruvate by pyruvate decar 0241 The term "Saccharomyces sensu stricto' taxonomy boxylase (PDC). In one embodiment, a fermentative yeast group is a cluster of yeast species that are highly related to S. can be engineered to be non-fermentative by the reduction or cerevisiae (Rainieri et al., 2003, J. Biosci Bioengin 96: 1-9). elimination of the native PDC activity. Thus, most of the Saccharomyces sensu stricto yeast species include but are not pyruvate produced by glycolysis is not consumed by PDC and limited to S. cerevisiae, S. kudriavZevi, S. mikatae, S. baya is available for the isobutanol pathway. Deletion of this path nus, S. uvarum, S. Carocanis and hybrids derived from these way increases the pyruvate and the reducing equivalents species (Masneufetal., 1998, Yeast 7:61-72). available for the biosynthetic pathway. Fermentative path 0242 Anancient whole genome duplication (WGD) event ways contribute to low yield and low productivity of desired occurred during the evolution of the hemiascomycete yeast metabolites such as isobutanol. Accordingly, deletion of PDC and was discovered using comparative genomic tools (Kellis genes may increase yield and productivity of desired metabo et al., 2004, Nature 428: 617-24; Dujon et al., 2004, Nature lites Such as isobutanol. 430:35-44; Langkjaeret al., 2003, Nature 428: 848-52; Wolfe 0247. In some embodiments, the recombinant microor et al., 1997, Nature 387: 708-13). Using this major evolution ganisms may be microorganisms that are non-fermenting ary event, yeast can be divided into species that diverged from yeast microorganisms, including, but not limited to those, a common ancestor following the WGD event (termed “post classified into a genera selected from the group consisting of WGD yeast herein) and species that diverged from the yeast Tricosporon, Rhodotorula, Myxozyma, or Candida. In a spe lineage prior to the WGD event (termed “pre-WGD yeast” cific embodiment, the non-fermenting yeast is C. xestobii. herein). 0243 Accordingly, in one embodiment, the yeast micro Isobutanol-Producing Yeast Microorganisms organism may be selected from a post-WGD yeast genus, 0248. As described herein, in one embodiment, a yeast including but not limited to Saccharomyces and Candida. The microorganism is engineered to converta carbon Source, Such favored post-WGD yeast species include: S. cerevisiae, S. as glucose, to pyruvate by glycolysis and the pyruvate is uvarum, S. bayanus, S. paradoxus, S. castelli, and C. gla converted to isobutanol via an isobutanol producing meta brata. bolic pathway (See, e.g., WO/2007/050671, WO/2008/ 0244. In another embodiment, the yeast microorganism 098227, and Atsumiet al., 2008, Nature 45: 86-9). Alternative may be selected from a pre-whole genome duplication (pre pathways for the production of isobutanol have been WGD) yeast genus including but not limited to Saccharomy described in WO/2007/050671 and in Dickinson et al., 1998, ces, Kluyveromyces, Candida, Pichia, Issatchenkia, J Biol Chen 273:25751-6. Debaryomyces, Hansenula, Yarrowia and, Schizosaccharo 0249 Accordingly, in one embodiment, the isobutanol myces. Representative pre-WGD yeast species include: S. producing metabolic pathway to convert pyruvate to isobu kluyveri, K. thermotolerans, K. marxianus, K. Waltii, K. lac tanol can be comprised of the following reactions: tis, C. tropicalis, P. pastoris, P anomala, P Stipitis, I. Orien (0250) 1.2 pyruvate->acetolactate+CO, talis, I. Occidentalis, I. Scutulata, D. hansenii, H. anomala, Y. (0251 2. acetolactate--NAD(P)H->2,3-dihydroxyisoval lipolytica, and S. pombe. erate+NAD(P)" 0245. A yeast microorganism may be either Crabtree 0252) 3. 2,3-dihydroxyisovalerate->alpha-ketoisovaler negative or Crabtree-positive as described in described in ate commonly owned and co-pending application US 2009/ 0253 4. alpha-ketoisovalerate->isobutyraldehyde--CO, 0226991. In one embodiment the yeast microorganism may (0254 5. isobutyraldehyde--NAD(P)H->isobutanol--NAD be selected from yeast with a Crabtree-negative phenotype (P)" including but not limited to the following genera: Saccharo 0255. These reactions are carried out by the enzymes 1) myces, Kluyveromyces, Pichia, Issatchenkia, Hansenula, and Acetolactate Synthase (ALS), 2) Ketol-acid Reducto Candida. Crabtree-negative species include but are not lim Isomerase (KARI), 3) Dihydroxy-acid dehydratase (DHAD), ited to: S. kluyveri, K. lactis, K. marxianus, P anomala, P 4) Keto-isovalerate decarboxylase (KIVD), and 5) an Alcohol stipitis, I. Orientalis, I. Occidentalis, I. Scutulata, H. anomala, dehydrogenase (ADH) (FIG. 1). In another embodiment, the and C. utilis. In another embodiment, the yeast microorgan yeast microorganism is engineered to overexpress these ism may be selected from yeast with a Crabtree-positive enzymes. For example, these enzymes can be encoded by phenotype, including but not limited to Saccharomyces, native genes. Alternatively, these enzymes can be encoded by Kluyveromyces, Zygosaccharomyces, Debaryomyces, Pichia heterologous genes. For example, ALS can be encoded by the and Schizosaccharomyces. Crabtree-positive yeast species alsS gene of B. subtilis, alsS of L. lactis, or the ilvK gene of K. include but are not limited to: S. cerevisiae, S. uvarum, S. pneumonia. For example, KARI can be encoded by the ilvC bayanus, S. paradoxus, S. castelli, K. thermotolerans, C. genes of E. coli, C. glutamicum, M. maripaludis, or Piromy glabrata, Z. bailli, Z. rouxii, D. hansenii, P. pastorius, and S. ces sp E2. For example, DHAD can be encoded by the ilvD pombe. genes of E. coli, C. glutamicum, or L. lactis. For example, 0246. Another characteristic may include the property that KIVD can be encoded by the kiv D gene of L. lactis. ADH can the microorganism is that it is non-fermenting. In other be encoded by ADH2, ADH6, or ADH7 of S. cerevisiae or words, it cannot metabolize a carbon source anaerobically adh A of L. lactis. while the yeast is able to metabolize a carbon source in the 0256 In one embodiment, pathway steps 2 and 5 may be presence of oxygen. Nonfermenting yeast refers to both natu carried out by KARI and ADH enzymes that utilize NADH rally occurring yeasts as well as genetically modified yeast. (rather than NADPH) as a co-factor. Such enzymes are During anaerobic fermentation with fermentative yeast, the described in the commonly owned and co-pending publica US 2011/020 1 090 A1 Aug. 18, 2011 27 tion, US 2010/0143997, which is herein incorporated by ref enzyme catalyzing the conversion of acetolactate to DH2MB erence in its entirety for all purposes. The present inventors is a 3-ketoacid reductase (3-KAR). In a specific embodiment, have found that utilization of NADH-dependent KARI and the 3-ketoacid reductase is encoded by the S. cerevisiae ADH enzymes to catalyze pathway steps 2 and 5, respec TMA29 (YMR226C) gene or a homolog thereof. In one tively, Surprisingly enables production of isobutanol under embodiment, the homolog may be selected from the group anaerobic conditions. Thus, in one embodiment, the recom consisting of Vanderwaltomzyma polyspora (SEQID NO: 2), binant microorganisms of the present invention may use an Saccharomyces castellii (SEQID NO:3), Candida glabrata NADH-dependent KARI to catalyze the conversion of aceto (SEQ ID NO: 4), Saccharomyces bayanus (SEQ ID NO. 5), lactate (+NADH) to produce 2,3-dihydroxyisovalerate. In Zygosaccharomyces rouxii (SEQID NO: 6), Kluyveromyces another embodiment, the recombinant microorganisms of the lactis (SEQ ID NO: 7), Ashbya gossypii (SEQ ID NO: 8), present invention may use an NADH-dependent ADH to cata Saccharomyces kluyveri (SEQ ID NO: 9), Kluyveromyces lyze the conversion of isobutyraldehyde (+NADH) to pro thermotolerans (SEQ ID NO: 10), Kluyveromyces waltii duce isobutanol. In yet another embodiment, the recombinant (SEQID NO: 11), Pichia stipitis (SEQID NO: 12), Debaro microorganisms of the present invention may use both an myces hansenii (SEQ ID NO: 13), Pichia pastoris (SEQ ID NADH-dependent KARI to catalyze the conversion of aceto NO: 14), Candida dubliniensis (SEQ ID NO: 15), Candida lactate (+NADH) to produce 2,3-dihydroxyisovalerate, and albicans (SEQID NO:16), Yarrowia lipolytica (SEQID NO: an NADH-dependent ADH to catalyze the conversion of 17), Issatchenkia Orientalis (SEQ ID NO: 18), Aspergillus isobutyraldehyde (+NADH) to produce isobutanol. nidulans (SEQID NO: 19), Aspergillus niger (SEQID NO: 0257. In another embodiment, the yeast microorganism 20), Neurospora crassa (SEQ ID NO: 21), Schizosaccharo may be engineered to have increased ability to convert pyru myces pombe (SEQID NO: 22), and Kluyveromyces marx vate to isobutanol. In one embodiment, the yeast microorgan ianus (SEQID NO:23). ism may be engineered to have increased ability to convert 0261. In another embodiment, the invention is directed to pyruvate to isobutyraldehyde. In another embodiment, the a recombinant microorganism for producing isobutanol, yeast microorganism may be engineered to have increased wherein said recombinant microorganism comprises an ability to convert pyruvate to keto-isovalerate. In another isobutanol producing metabolic pathway and wherein said embodiment, the yeast microorganism may be engineered to microorganism is engineered to reduce or eliminate the have increased ability to convert pyruvate to 2,3-dihydroxy expression or activity of an enzyme catalyzing the conversion isovalerate. In another embodiment, the yeast microorganism of isobutyraldehyde to isobutyrate. In some embodiments, the may be engineered to have increased ability to convert pyru enzyme catalyzing the conversion of isobutyraldehyde to vate to acetolactate. isobutyrate is an aldehyde dehydrogenase. In an exemplary 0258. Furthermore, any of the genes encoding the forego embodiment, the aldehyde dehydrogenase is the S. cerevisiae ing enzymes (or any others mentioned herein (or any of the aldehyde dehydrogenase ALD6 (SEQ ID NO: 25) or a regulatory elements that control or modulate expression homolog or variant thereof. In one embodiment, the homolog thereof)) may be optimized by genetic/protein engineering is selected from the group consisting of Saccharomyces cas techniques, such as directed evolution or rational mutagen telli (SEQID NO: 26), Candida glabrata (SEQID NO: 27), esis, which are known to those of ordinary skill in the art. Saccharomyces bayanus (SEQ ID NO: 28), Kluyveromyces Such action allows those of ordinary skill in the art to opti lactis (SEQ ID NO: 29), Kluyveromyces thermotolerans mize the enzymes for expression and activity in yeast. (SEQ ID NO: 30), Kluyveromyces waltii (SEQ ID NO: 31), 0259. In addition, genes encoding these enzymes can be Saccharomyces cerevisiae YJ789 (SEQID NO:32), Saccha identified from other fungal and bacterial species and can be romyces cerevisiae JAY291 (SEQ ID NO:33), Saccharomy expressed for the modulation of this pathway. A variety of ces cerevisiae EC 1118 (SEQ ID NO. 34), Saccharomyces organisms could serve as Sources for these enzymes, includ cerevisiae DBY939 (SEQ ID NO:35), Saccharomyces cer ing, but not limited to, Saccharomyces spp., including S. evisiae AWR11631 (SEQ ID NO:36), Saccharomyces cer cerevisiae and S. uvarum, Kluyveromyces spp., including K. evisiae RM11-1a (SEQID NO:37), Pichia pastoris (SEQID thermotolerans, K. lactis, and K. marxianus, Pichia spp., NO: 38), Kluyveromyces marxianus (SEQ ID NO: 39), Hansenula spp., including H. polymorpha, Candida spp., Schizosaccharomyces pombe (SEQ ID NO: 40), and TrichospOron spp., Yamadazyma spp., including Y. spp. Stipi Schizosaccharomyces pombe (SEQID NO: 41). tis, Torulaspora pretoriensis, Issatchenkia Orientalis, 0262. In yet another embodiment, the invention is directed Schizosaccharomyces spp., including S. pombe, Cryptococ to a recombinant microorganism for producing isobutanol, cus spp., Aspergillus spp., Neurospora spp., or Ustilago spp. wherein said recombinant microorganism comprises an Sources of genes from anaerobic fungi include, but not lim isobutanol producing metabolic pathway and wherein said ited to, Piromyces spp., Orpinomyces spp., or Neocallinastix microorganism is (i) engineered to reduce or eliminate the spp. Sources of prokaryotic enzymes that are useful include, expression or activity of an enzyme catalyzing the conversion but not limited to, Escherichia. coli, Zymomonas mobilis, of acetolactate to DH2MB and (ii) engineered to reduce or Staphylococcus aureus, Bacillus spp., Clostridium spp., eliminate the expression or activity of an enzyme catalyzing Corynebacterium spp., Pseudomonas spp., Lactococcus spp., the conversion of isobutyraldehyde to isobutyrate. In some Enterobacter spp., and Salmonella spp. embodiments, the enzyme catalyzing the conversion of aceto 0260. In one embodiment, the invention is directed to a lactate to DH2MB is a 3-ketoacid reductase (3-KAR). In a recombinant microorganism for producing isobutanol, specific embodiment, the 3-ketoacid reductase is encoded by wherein said recombinant microorganism comprises an the S. cerevisiae TMA29 (YMR226C) gene or a homolog or isobutanol producing metabolic pathway and wherein said variant thereof. In one embodiment, the homolog is selected microorganism is engineered to reduce or eliminate the from the group consisting of Vanderwaltonzyma polyspora expression or activity of an enzyme catalyzing the conversion (SEQ ID NO: 2), Saccharomyces castellii (SEQ ID NO:3), of acetolactate to DH2MB. In some embodiments, the Candida glabrata (SEQID NO: 4), Saccharomyces bayanus US 2011/020 1 090 A1 Aug. 18, 2011 28

(SEQIDNO:5), Zgosaccharomyces rouxii (SEQID NO:6), pathway enzymes localized in the cytosol. Isobutanol produc Kluyveromyces lactis (SEQID NO:7), Ashbya gossypii (SEQ ing metabolic pathways in which one or more genes are ID NO: 8), Saccharomyces kluyveri (SEQ ID NO: 9), localized to the cytosol are described in commonly owned Kluyveromyces thermotolerans (SEQID NO: 10), Kluyvero and co-pending U.S. application Ser. No. 12/855,276, which myces waltii (SEQID NO: 11), Pichia stipitis (SEQID NO: is herein incorporated by reference in its entirety for all pur 12), Debaromyces hansenii (SEQ ID NO: 13), Pichia pas poses. toris (SEQID NO: 14), Candida dubliniensis (SEQ ID NO: 15), Candida albicans (SEQID NO: 16), Yarrowia lipolytica Expression of Modified Alcohol Dehydrogenases in the Pro (SEQ ID NO: 17), Issatchenkia orientalis (SEQID NO: 18), duction of Isobutanol Aspergillus nidulans (SEQ ID NO: 19), Aspergillus niger 0265 Another strategy described herein for reducing the (SEQ ID NO: 20), Neurospora crassa (SEQ ID NO: 21), production of the by-product isobutyrate is to increase the Schizosaccharomyces pombe (SEQ ID NO: 22), and activity and/or expression of an alcohol dehydrogenase Kluyveromyces marxianus (SEQ ID NO. 23). In some (ADH) responsible for the conversion of isobutyraldehyde to embodiments, the enzyme catalyzing the conversion of isobu isobutanol. This strategy prevents competition by endog tyraldehyde to isobutyrate is an aldehyde dehydrogenase. In a enous enzymes for the isobutanol pathway intermediate, specific embodiment, the aldehyde dehydrogenase is the S. isobutyraldehyde. An increase in the activity and/or expres cerevisiae aldehyde dehydrogenase ALD6 (SEQID NO:25) sion of ADH may be achieved by various means. For or a homolog or variant thereof. In one embodiment, the example, ADH activity can be increased by utilizing a pro homolog is selected from the group consisting of Saccharo moter with increased promoter strength or by increasing the myces castelli (SEQID NO: 26), Candida glabrata (SEQID copy number of the alcohol dehydrogenase gene. NO: 27), Saccharomyces bayanus (SEQ ID NO: 28), 0266. In alternative embodiments, the production of the Kluyveromyces lactis (SEQID NO: 29), Kluyveromyces ther by-product isobutyrate may be reduced by utilizing an ADH motolerans (SEQID NO:30), Kluyveromyces waltii (SEQID with increased specific activity for isobutyraldehyde. Such NO:31), Saccharomyces cerevisiae YJ789 (SEQID NO:32), ADH enzymes with increased specific activity for isobutyral Saccharomyces cerevisiae JAY291 (SEQ ID NO: 33), Sac dehyde may be identified in nature, or may result from modi charomyces cerevisiae EC 1118 (SEQID NO:34), Saccharo fications to the ADH enzyme, such as the modifications myces cerevisiae DBY939 (SEQID NO:35), Saccharomyces described herein. In some embodiments, these modifications cerevisiae AWR11631 (SEQ ID NO:36), Saccharomyces will produce a decrease in the Michaelis-Menten constant cerevisiae RM11-1a (SEQID NO:37), Pichia pastoris (SEQ (K) for isobutyraldehyde. Through the use of such modified ID NO: 38), Kluyveromyces marxianus (SEQ ID NO:39), ADH enzymes, competition by endogenous enzymes for Schizosaccharomyces pombe (SEQ ID NO: 40), and isobutyraldehyde is further limited. In one embodiment, the Schizosaccharomyces pombe (SEQID NO: 41). isobutyrate yield (mol isobutyrate per mol glucose) in a 0263. In one embodiment, the isobutanol producing meta recombinant microorganism comprising a modified ADH as bolic pathway comprises at least one exogenous gene that described herein is less than about 5%. In another embodi catalyzes a step in the conversion of pyruvate to isobutanol. In ment, the isobutyrate yield (mol isobutyrate per mol glucose) another embodiment, the isobutanol producing metabolic in a recombinant microorganism comprising a modified ADH pathway comprises at least two exogenous genes that catalyze as described herein is less than about 1%. In yet another steps in the conversion of pyruvate to isobutanol. In yet embodiment, the isobutyrate yield (mol isobutyrate per mol another embodiment, the isobutanol producing metabolic glucose) in a recombinant microorganism comprising a pathway comprises at least three exogenous genes that cata modified ADH as described herein is less than about 0.5%, lyze steps in the conversion of pyruvate to isobutanol. In yet less than about 0.1%, less than about 0.05%, or less thanabout another embodiment, the isobutanol producing metabolic O.O1%. pathway comprises at least four exogenous genes that cata 0267 Further, by utilizing a modified ADH enzyme, the lyze steps in the conversion of pyruvate to isobutanol. In yet present inventors may establish a situation in which the for another embodiment, the isobutanol producing metabolic ward reaction (i.e. the isobutyraldehyde conversion to isobu pathway comprises at five exogenous genes that catalyze tanol) is the favored reaction over the reverse reaction (i.e. the steps in the conversion of pyruvate to isobutanol. conversion of isobutanol to isobutyraldehyde). 0264. In one embodiment, one or more of the isobutanol 0268. The strategies described above generally lead to a pathway genes encodes an enzyme that is localized to the decrease in isobutyrate yield, which is accompanied by an cytosol. In one embodiment, the recombinant microorgan increase in isobutanol yield. Hence, the above strategies are isms comprise an isobutanol producing metabolic pathway useful for decreasing the isobutyrate yield and/or titer and for with at least one isobutanol pathway enzyme localized in the increasing the ratio of isobutanol yield over isobutyrate yield. cytosol. In another embodiment, the recombinant microor 0269. Accordingly, in one aspect, the present application ganisms comprise an isobutanol producing metabolic path describes the generation of modified ADHs with enhanced way with at least two isobutanol pathway enzymes localized activity that can facilitate improved isobutanol production in the cytosol. In yet another embodiment, the recombinant when co-expressed with the remaining four isobutanol path microorganisms comprise an isobutanol producing metabolic way enzymes. In one embodiment according to this aspect, pathway with at least three isobutanol pathway enzymes the present application is directed to recombinant microor localized in the cytosol. In yet another embodiment, the ganisms comprising one or more modified ADHS. In one recombinant microorganisms comprise an isobutanol pro embodiment, the recombinant microorganism is further engi ducing metabolic pathway with at least four isobutanol path neered to reduce or eliminate the expression or activity of an way enzymes localized in the cytosol. In an exemplary enzyme catalyzing the conversion of acetolactate to DH2MB embodiment, the recombinant microorganisms comprise an as described herein. In another embodiment, the recombinant isobutanol producing metabolic pathway with five isobutanol microorganism is further engineered to reduce or eliminate US 2011/020 1 090 A1 Aug. 18, 2011 29 the expression or activity of an enzyme catalyzing the con tide can thus be produced. The above-described version of isobutyraldehyde to isobutyrate as described oligonucleotide directed mutagenesis can, for example, be herein. carried out via PCR. 0270. In addition to the isobutanol biosynthetic pathway, 0274 Enzymes for use in the compositions and methods other biosynthetic pathways utilize ADH enzymes for the of the invention include any enzyme having the ability to conversion of an aldehyde to an alcohol. For example, ADH convert isobutyraldehyde to isobutanol. Such enzymes enzymes convert various aldehydes to alcohols as part of include, but are not limited to, the L. lactis Adha, the S. biosynthetic pathways for the production of 1-propanol, pneumoniae Adh A, the S. aureus Adha, and the Bacillus 2-propanol, 1-butanol, 2-butanol. 1-pentanol, 2-methyl-1-bu cereus Adha, amongst others. Additional ADH enzymes modifiable by the methods of the present invention include, tanol, 3- and methyl-1-butanol. but are not limited to those, disclosed in commonly owned (0271. As used herein, the terms “ADH or “ADHenzyme” and co-pending U.S. Patent Publication No. 2010/0143997. A or “alcohol dehydrogenase' are used interchangeably herein representative list of ADH enzymes modifiable by the meth to refer to an enzyme that catalyzes the conversion of isobu ods described herein can be found in Table 16. As will be tyraldehyde to isobutanol. ADH sequences are available from understood by one of ordinary skill in the art, modified ADH a vast array of microorganisms, including, but not limited to, enzymes may be obtained by recombinant or genetic engi L. lactis (SEQID NO: 175), Streptococcus pneumoniae, Sta neering techniques that are routine and well-known in the art. phylococcus aureus, and Bacillus cereus. ADH enzymes Modified ADH enzymes can, for example, be obtained by modifiable by the methods of the present invention include, mutating the gene or genes encoding the ADH enzyme of but are not limited to those, disclosed in commonly owned interest by site-directed or random mutagenesis. Such muta and co-pending U.S. Patent Publication No. 2010/0143997. A tions may include point mutations, deletion mutations, and representative list of ADH enzymes modifiable by the meth insertional mutations. For example, one or more point muta ods described herein can be found in Table 97. tions (e.g., Substitution of one or more amino acids with one or more different amino acids) may be used to construct Modified ADH Enzymes modified ADH enzymes of the invention. 0275. The invention further includes homologous ADH 0272. In accordance with the invention, any number of enzymes which are 5%, 10%, 20%, 30%, 40%, 50%, 60%, mutations can be made to the ADH enzymes, and in one 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% embodiment, multiple mutations can be made to result in an identical at the amino acid level to a wild-type ADH enzyme increased ability to convert isobutyraldehyde to isobutanol. (e.g., L. lactis Adha or E. coli Adh A) and exhibit an increased Such mutations include point mutations, frame shift muta ability to convert isobutyraldehyde to isobutanol. Also tions, deletions, and insertions, with one or more (e.g., one, included within the invention are ADH enzymes, which are two, three, four, five, or six, etc.) point mutations preferred. In 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, an exemplary embodiment, the modified ADH enzyme com 98%, or 99% identical at the amino acid level to an ADH prises one or more mutations at positions corresponding to enzyme comprising the amino acid sequence set out in SEQ amino acids selected from: (a) tyrosine 50 of the L. lactis ID NO: 185 and exhibit an increased ability to convert isobu Adh A (SEQ ID NO: 185); (b) glutamine 77 of the L. lactis tyraldehyde to isobutanol as compared to the unmodified Adh A (SEQID NO:185); (c) valine 108 of the L. lactis AdhA wild-type enzyme. The invention also includes nucleic acid (SEQ ID NO: 185); (d) tyrosine 113 of the L. lactis Adha molecules, which encode the above-described ADH (SEQ ID NO: 185); (e) isoleucine 212 of the L. lactis Adha enzymes. (SEQID NO:185); and (f) leucine 264 of the L. lactis Adha 0276. The invention also includes fragments of ADH (SEQ ID NO: 185), wherein Adh A (SEQ ID NO: 185) is enzymes which comprise at least 50, 100, 150,200,250,300, encoded by the L. lactis alcohol dehydrogenase (ADH) gene 350, 400, 450, 500, 550, or 600 amino acid residues and retain adhA (SEQ ID NO: 184) or a codon-optimized version one or more activities associated with ADH enzymes. Such thereof (SEQID NO: 206). fragments may be obtained by deletion mutation, by recom (0273 Mutations may be introduced into the ADH binant techniques that are routine and well-known in the art, enzymes of the present invention using any methodology or by enzymatic digestion of the ADH enzyme(s) of interest known to those skilled in the art. Mutations may be intro using any of a number of well-known proteolytic enzymes. duced randomly by, for example, conducting a PCR reaction The invention further includes nucleic acid molecules, which in the presence of manganese as a divalent metalion cofactor. encode the above described modified ADH enzymes and Alternatively, oligonucleotide directed mutagenesis may be ADH enzyme fragments. used to create the modified ADH enzymes which allows for 0277. By a protein or protein fragment having an amino all possible classes of base pair changes at any determined site acid sequence at least, for example, 50% “identical to a along the encoding DNA molecule. In general, this technique reference amino acid sequence, it is intended that the amino involves annealing an oligonucleotide complementary (ex acid sequence of the protein is identical to the reference cept for one or more mismatches) to a single Stranded nucle sequence except that the protein sequence may include up to otide sequence coding for the ADH enzyme of interest. The 50 amino acid alterations per each 100 amino acids of the mismatched oligonucleotide is then extended by DNA poly amino acid sequence of the reference protein. In other words, merase, generating a double-stranded DNA molecule which to obtain a protein having an amino acid sequence at least contains the desired change in sequence in one strand. The 50% identical to a reference amino acid sequence, up to 50% changes in sequence can, for example, result in the deletion, of the amino acid residues in the reference sequence may be substitution, or insertion of an amino acid. The double deleted or substituted with anotheramino acid, or a number of Stranded polynucleotide can then be inserted into an appro amino acids up to 50% of the total amino acid residues in the priate expression vector, and a mutant or modified polypep reference sequence may be inserted into the reference US 2011/020 1 090 A1 Aug. 18, 2011 30 sequence. These alterations of the reference sequence may (1982), 307 329. Suitable Streptomyces plasmids include occur at the amino (N-) and/or carboxy (C-) terminal posi pIJ101 (Kendall et al., J. Bacteriol. 169:41.774183 (1987)). tions of the reference amino acid sequence and/or anywhere Pseudomonas plasmids are reviewed by John et al., (Rad. between those terminal positions, interspersed either indi Insec. Dis. 8:693 704 (1986)), and Igaki, (Jpn. J. Bacteriol. vidually among residues in the reference sequence and/or in 33:729 742 (1978)). Broad-host range plasmids or cosmids, one or more contiguous groups within the reference such as pCP13 (Darzins and Chakrabarty, J. Bacteriol. 159:9 sequence. As a practical matter, whether a given amino acid 18 (1984)) can also be used for the present invention. sequence is, for example, at least 50% identical to the amino 0282 Suitable hosts for cloning the ADH nucleic acid acid sequence of a reference protein can be determined con molecules of interest are prokaryotic hosts. One example of a ventionally using known computer programs such as those prokaryotic host is E. coli. However, the desired ADH nucleic described above for nucleic acid sequence identity determi acid molecules of the present invention may be cloned in nations, or using the CLUSTALW program (Thompson, J. other prokaryotic hosts including, but not limited to, hosts in D., et al., Nucleic Acids Res. 22:4673 4680 (1994)). the genera Escherichia, Bacillus, Streptomyces, Pseudomo 0278. In one aspect, amino acid substitutions are made at nas, Salmonella, Serratia, and Proteus. one or more of the above identified positions (i.e., amino acid 0283 Eukaryotic hosts for cloning and expression of the positions equivalent or corresponding to Y50, Q77, V108, ADH enzyme of interest include yeast and fungal cells. A Y113, I212, or L264 of L. lactis Adha (SEQ ID NO: 185)). particularly preferred eukaryotic host is yeast. Expression of Thus, the amino acids at these positions may be substituted the desired ADH enzyme in such eukaryotic cells may require with any other amino acid including Ala, ASn, Arg, Asp, Cys, the use of eukaryotic regulatory regions which include Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser. Thr, Trp, eukaryotic promoters. Cloning and expressing the ADH Tyr, and Val. A specific example of a ADH enzyme which nucleic acid molecule in eukaryotic cells may be accom exhibits an increased ability to convert isobutyraldehyde to plished by well known techniques using well known eukary isobutanol is an ADH in which (1) the tyrosine at position 50 otic vector systems. has been replaced with a phenylalanine or tryptophan residue, 0284. In accordance with the invention, one or more muta (2) the glutamine at position 77 has been replaced with an tions may be made in any ADH enzyme of interest in order to arginine or serine residue, (3) the valine at position 108 has increase the ability of the enzyme to convertisobutyraldehyde been replaced with a serine oralanine residue, (4) the tyrosine to isobutanol, or confer other properties described herein at position 113 has been replaced with a phenylalanine or upon the enzyme, in accordance with the invention. Such glycine residue, (5), the isoleucine at position 212 has been mutations include point mutations, frame shift mutations, replaced with a threonine or valine residue, and/or (6) the deletions, and insertions. Preferably, one or more point muta leucine at position 264 is replaced with a valine residue. tions, resulting in one or more amino acid substitutions, are 0279 Polypeptides having the ability to convert isobu used to produce ADH enzymes having an enhanced ability to tyraldehyde to isobutanol for use in the invention may be convert isobutyraldehyde to isobutanol. In a preferred aspect isolated from their natural prokaryotic or eukaryotic sources of the invention, one or more mutations at positions equiva according to standard procedures for isolating and purifying lent or corresponding to position Y50 (e.g., Y50W or Y50F), natural proteins that are well-known to one of ordinary skill in Q77 (e.g., Q77S or Q77R), V108 (e.g. V108S or V108A), the art (see, e.g., Houts, G. E., et al., J. Virol. 29:517 (1979)). Y113 (e.g., Y113F or Y113G), I212 (e.g., I212T or I212V), In addition, polypeptides having the ability to convert isobu and/or L264 (e.g. L264V) of the L. lactis Adha (SEQID NO: tyraldehyde to isobutanol may be prepared by recombinant 185) enzyme may be made to produce the desired result in DNA techniques that are familiar to one of ordinary skill in other ADH enzymes of interest. the art (see, e.g., Kotewicz, M. L., et al., Nucl. Acids Res. 0285. The corresponding positions of the ADH enzymes 16:265 (1988); Soltis, D. A., and Skalka, A. M., Proc. Natl. identified herein (e.g. the L. lactis Adh A of SEQIDNO:185) Acad. Sci. USA 85:33723376 (1988)). may be readily identified for other ADH enzymes by one of 0280. In one aspect of the invention, modified ADH skill in the art. Thus, given the defined region and the assays enzymes are made by recombinant techniques. To clone a described in the present application, one with skill in the art gene or other nucleic acid molecule encoding an ADH can make one or a number of modifications, which would enzyme which will be modified in accordance with the inven result in an increased ability to convert isobutyraldehyde to tion, isolated DNA which contains the ADH enzyme gene or isobutanol in any ADH enzyme of interest. open reading frame may be used to construct a recombinant 0286. In a preferred embodiment, the modified ADH DNA library. Any vector, well known in the art, can be used to enzymes have from 1 to 6 amino acid substitutions selected clone the ADH enzyme of interest. However, the vector used from positions corresponding to Y50, Q77, V108,Y113, I212, must be compatible with the host in which the recombinant or L264 as compared to the wild-type ADHenzymes. In other vector will be transformed. embodiments, the modified ADH enzymes have additional 0281 Prokaryotic vectors for constructing the plasmid amino acid Substitutions at other positions as compared to the library include plasmids Such as those capable of replication respective wild-type ADH enzymes. Thus, modified ADH in E. coli such as, for example, pFBR322, ColE1, pSC101, enzymes may have at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, pUC-vectors (pUC18, puC19, etc.: In: Molecular Cloning. A 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, Laboratory Manual, Cold Spring Harbor Laboratory Press, 29, 30, 31, 32,33, 34,35, 36, 37,38, 39, 40 different residues Cold Spring Harbor, N.Y. (1982); and Sambrook et al., In: in other positions as compared to the respective wild-type Molecular Cloning A Laboratory Manual (2d ed.) Cold ADH enzymes. As will be appreciated by those of skill in the Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. art, the number of additional positions that may have amino (1989)). Bacillus plasmids include pC194, puB110, pE194, acid substitutions will depend on the wild-type ADH enzyme pC221 pC217, etc. Such plasmids are disclosed by Glyczan, used to generate the variants. Thus, in some instances, up to T. In: The Molecular Biology Bacilli, Academic Press, York 50 different positions may have amino acid substitutions. US 2011/020 1 090 A1 Aug. 18, 2011

0287. It is understood that various microorganisms can act with databases such as BRENDA, KEGG, or MetaCYC. The as “sources' for genetic material encoding ADH enzymes candidate gene or enzyme may be identified within the above Suitable for use in a recombinant microorganism provided mentioned databases in accordance with the teachings herein. herein. For example. In addition, genes encoding these Furthermore, enzymatic activity can be determined pheno enzymes can be identified from other fungal and bacterial typically. species and can be expressed for the modulation of this path Methods of Making ADH Enzymes with Enhanced Catalytic way. A variety of organisms could serve as sources for these Efficiency enzymes, including, but not limited to, Lactococcus sp., 0290 The present invention further provides methods of including L. lactis, Lactobacillus sp., including L. brevis, L. engineering ADH enzymes to enhance their catalytic effi buchneri, L. hilgardii, L. fermentum, L. reuteri, L. vaginalis, ciency. L. antri, L. Oris, and L. Coleohominis, Pediococcus sp., includ 0291. One approach to increasing the catalytic efficiency ing P acidilactici, Bacillus sp., including B. cereus, B. thur of ADH enzymes is by saturation mutagenesis with NNK ingiensis, B. coagulans, B. anthracis, B. Weihenstephanensis, libraries. These libraries may be screened for increases in B. mycoides, and B. amyloliquefaciens, Leptotrichia sp., catalytic efficiency in order to identify, which single muta including L. goodfellowii, L. buccalis, and L. hofstadii, Acti tions contribute to an increased ability to convert isobutyral nobacillus sp., including A. pleuropneumoniae, Streptococ dehyde to isobutanol. Combinations of mutations at afore cus sp., including S. Sanguinis, S. parasanguinis, S. gordonii, mentioned residues may be investigated by any method. For S. pneumoniae, and S. mitis, Streptobacillus sp., including S. example, a combinatorial library of mutants may be designed moniliformis, Staphylococcus sp., including S. aureus, based on the results of the Saturation mutagenesis studies. Eikenella sp., including E. corrodens, Weissella sp., including 0292 Another approach is to use random oligonucleotide W. paramesenteroides, Kingella sp., including K. Oralis, and mutagenesis to generate diversity by incorporating random Rothia sp., including R. dentocariosa, and Exiguobacterium mutations, encoded on a synthetic oligonucleotide, into the Sp. enzyme. The number of mutations in individual enzymes 0288 The nucleotide sequences for several ADH enzymes within the population may be controlled by varying the length are known. For instance, the sequences of ADH enzymes are of the target sequence and the degree of randomization during available from a vast array of microorganisms, including, but synthesis of the oligonucleotides. The advantages of this not limited to, L. lactis (SEQID NO:185), S. pneumoniae, S. more defined approach are that all possible amino acid muta aureus, and Bacillus cereus. ADH enzymes modifiable by the tions and also coupled mutations can be found. methods of the present invention include, but are not limited 0293 If the best variants from the experiments described to those, disclosed in commonly owned and co-pending U.S. above do not display sufficient activity, directed evolution via Patent Publication No. 2010/0143997. A representative list of error-prone PCR may be used to obtain further improve ADH enzymes modifiable by the methods described herein ments. Error-prone PCR mutagenesis of the ADH enzyme can be found in Table 97. may be performed followed by screening for ADH activity. 0289. In addition, any method can be used to identify genes that encode for ADH enzymes with a specific activity. Enhanced ADH Catalytic Efficiency Generally, homologous or analogous genes with similar 0294. In one aspect, the catalytic efficiency of the modi activity can be identified by functional, structural, and/or fied ADH enzyme is enhanced. As used herein, the phrase genetic analysis. In most cases, homologous or analogous “catalytic efficiency” refers to the property of the ADH genes with similar activity will have functional, structural, or enzyme that allows it to convert isobutyraldehyde to isobu genetic similarities. Techniques known to those skilled in the tanol. art may be suitable to identify homologous genes and 0295. In one embodiment, the catalytic efficiency of the homologous enzymes. Generally, analogous genes and/or modified ADH is enhanced as compared to the wild-type or analogous enzymes can be identified by functional analysis parental ADH. Preferably, the catalytic efficiency of the and will have functional similarities. Techniques known to modified ADH enzyme is enhanced by at least about 5% as those skilled in the art may be suitable to identify analogous compared to the wild-type or parental ADH. More preferably, genes and analogous enzymes. For example, to identify the catalytic efficiency of the modified ADH enzyme is homologous or analogous genes, proteins, or enzymes, tech enhanced by at least about 15% as compared to the wild-type niques may include, but not limited to, cloning a gene by PCR or parental ADH. More preferably, the catalytic efficiency of using primers based on a published sequence of a gene/en the modified ADH enzyme is enhanced by at least about 25% Zyme or by degenerate PCR using degenerate primers as compared to the wild-type or parental ADH. More prefer designed to amplify a conserved region among a gene. Fur ably, the catalytic efficiency of the modified ADH enzyme is ther, one skilled in the art can use techniques to identify enhanced by at least about 50% as compared to the wild-type homologous or analogous genes, proteins, or enzymes with or parental ADH. More preferably, the catalytic efficiency of functional homology or similarity. Techniques include exam the modified ADH enzyme is enhanced by at least about 75% ining a cell or cell culture for the catalytic efficiency or the as compared to the wild-type or parental ADH. More prefer specific activity of an enzyme through in vitro enzyme assays ably, the catalytic efficiency of the modified ADH enzyme is for said activity, then isolating the enzyme with said activity enhanced by at least about 100% as compared to the wild-type through purification, determining the protein sequence of the or parental ADH. More preferably, the catalytic efficiency of enzyme through techniques such as Edman degradation, the modified ADH enzyme is enhanced by at least about design of PCR primers to the likely nucleic acid sequence, 200% as compared to the wild-type or parental ADH. More amplification of said DNA sequence through PCR, and clon preferably, the catalytic efficiency of the modified ADH ing of said nucleic acid sequence. To identify homologous or enzyme is enhanced by at least about 500% as compared to analogous genes with similar activity, techniques also include the wild-type or parental ADH. More preferably, the catalytic comparison of data concerning a candidate gene or enzyme efficiency of the modified ADH enzyme is enhanced by at US 2011/020 1 090 A1 Aug. 18, 2011 32 least about 1000% as compared to the wild-type or parental ably linked to a promoter and optionally termination ADH. More preferably, the catalytic efficiency of the modi sequences that operate to effect expression of the coding fied ADH enzyme is enhanced by at least about 2000% as sequence in compatible host cells. The host cells are modified compared to the wild-type or parental ADH. More preferably, by transformation with the recombinant DNA expression the catalytic efficiency of the modified ADH enzyme is vectors of the disclosure to contain the expression system enhanced by at least about 3000% as compared to the wild sequences either as extrachromosomal elements or integrated type or parental ADH. Most preferably, the catalytic effi into the chromosome. ciency of the modified ADH enzyme is enhanced by at least 0299 Moreover, methods for expressing a polypeptide about 3500% as compared to the wild-type or parental ADH. from a nucleic acid molecule that are specific to a particular microorganism (i.e. a yeast microorganism) are well known. Gene Expression of Modified ADH Enzymes For example, nucleic acid constructs that are used for the 0296 Provided herein are methods for the expression of expression of heterologous polypeptides within Kluyveromy one or more of the modified ADH enzyme genes involved the ces and Saccharomyces are well known (see, e.g., U.S. Pat. production of beneficial metabolites and recombinant DNA Nos. 4,859,596 and 4,943,529, each of which is incorporated expression vectors useful in the method. Thus, included by reference herein in its entirety for Kluyveromyces and, e.g., within the scope of the disclosure are recombinant expression Gellissen et al., Gene 190(1):87–97 (1997) for Saccharomy vectors that include Such nucleic acids. The term expression ces. Yeast plasmids have a selectable marker and an origin of vector refers to a nucleic acid that can be introduced into a replication, also known as Autonomously Replicating host microorganism or cell-free transcription and translation Sequences (ARS). In addition certain plasmids may also con system. An expression vector can be maintained permanently tain a centromeric sequence. These centromeric plasmids are or transiently in a microorganism, whether as part of the generally a single or low copy plasmid. Plasmids without a chromosomal or other DNA in the microorganism or in any centromeric sequence and utilizing either a 2 micron (S. cer cellular compartment, such as a replicating vector in the cyto evisiae) or 1.6 micron (K. lactis) replication origin are high plasm. An expression vector also comprises a promoter that copy plasmids. The selectable marker can be either pro drives expression of an RNA, which typically is translated totrophic, such as HIS3, TRP1, LEU2, URA3 or ADE2, or into a polypeptide in the microorganism or cell extract. For antibiotic resistance. Such as, bar, ble, hph, or kan. efficient translation of RNA into protein, the expression vec 0300. A nucleic acid of the disclosure can be amplified tor also typically contains a ribosome-binding site sequence using cDNA, mRNA synthetic DNA, or alternatively, positioned upstream of the start codon of the coding sequence genomic DNA, as a template and appropriate oligonucleotide of the gene to be expressed. Other elements, such as enhanc primers according to standard PCR amplification techniques ers, secretion signal sequences, transcription termination and those procedures described in the Examples section sequences, and one or more marker genes by which host below. The nucleic acid so amplified can be cloned into an microorganisms containing the vector can be identified and/ appropriate vector and characterized by DNA sequence or selected, may also be present in an expression vector. analysis. Furthermore, oligonucleotides corresponding to Selectable markers, i.e., genes that confer antibiotic resis nucleotide sequences can be prepared by standard synthetic tance or sensitivity, are used and confer a selectable pheno techniques, e.g., using an automated DNA synthesizer. type on transformed cells when the cells are grown in an 0301. It is also understood that an isolated nucleic acid appropriate selective medium. molecule encoding a polypeptide homologous to the enzymes 0297. The various components of an expression vector can described herein can be created by introducing one or more vary widely, depending on the intended use of the vector and nucleotide Substitutions, additions ordeletions into the nucle the host cell(s) in which the vector is intended to replicate or otide sequence encoding the particular polypeptide, such that drive expression. Expression vector components suitable for one or more amino acid Substitutions, additions or deletions the expression of genes and maintenance of vectors in E. coli, are introduced into the encoded protein. Mutations can be yeast, Streptomyces, and other commonly used cells are introduced into the polynucleotide by Standard techniques, widely known and commercially available. For example, Suit Such as site-directed mutagenesis and PCR-mediated able promoters for inclusion in the expression vectors of the mutagenesis. In contrast to those positions where it may be disclosure include those that function in eukaryotic or desirable to make a non-conservative amino acid substitu prokaryotic host microorganisms. Promoters can comprise tions (see above), in some positions it is preferable to make regulatory sequences that allow for regulation of expression conservative amino acid substitutions. A "conservative amino relative to the growth of the host microorganism or that cause acid substitution' is one in which the amino acid residue is the expression of a gene to be turned on or offin response to replaced with an amino acid residue having a similar side a chemical or physical stimulus. For E. coli and certain other chain. Families of amino acid residues having similar side bacterial host cells, promoters derived from genes for biosyn chains have been defined in the art. These families include thetic enzymes, antibiotic-resistance conferring enzymes, amino acids with basic side chains (e.g., lysine, arginine, and phage proteins can be used and include, for example, the histidine), acidic side chains (e.g., aspartic acid, glutamic galactose, lactose (lac), maltose, tryptophan (trp), beta-lacta acid), uncharged polar side chains (e.g., glycine, asparagine, mase (bla), bacteriophage lambda PL, and T5 promoters. In glutamine, serine, threonine, tyrosine, cysteine), nonpolar addition, synthetic promoters. Such as the tac promoter (U.S. side chains (e.g., alanine, Valine, leucine, isoleucine, proline, Pat. No. 4.551,433), can also be used. For E. coli expression phenylalanine, methionine, tryptophan), beta-branched side vectors, it is useful to include an E. coli origin of replication, chains (e.g., threonine, Valine, isoleucine) and aromatic side such as from puC, p1 P. p1, and pBR. chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). 0298 Thus, recombinant expression vectors contain at 0302 Although the effect of an amino acid change varies least one expression system, which, in turn, is composed of at depending upon factors such as phosphorylation, glycosyla least a portion of a biosynthetic gene coding sequences oper tion, intra-chain linkages, tertiary structure, and the role of the US 2011/020 1 090 A1 Aug. 18, 2011

amino acid in the active site or a possible allosteric site, it is generally preferred that the substituted amino acid is from the TABLE 4 same group as the amino acid being replaced. To some extent the following groups contain amino acids, which are inter YMR226C and honologs thereof. changeable: the basic amino acids lysine, arginine, and histi Species Gene Name SEQ ID NO: dine; the acidic amino acids aspartic and glutamic acids; the S. cerevisiae YMR226C 1 neutral polar amino acids serine, threonine, cysteine, K. polyspora Kpol 1043p53 2 S. casteli Scas 594.12d 3 glutamine, asparagine and, to a lesser extent, methionine; the C. glabrata CAGLOM11242g 4 nonpolar aliphatic amino acids glycine, alanine, Valine, iso S. bayantis Sbay 651.2 5 leucine, and leucine (however, because of size, glycine and Z. rotaxi ZYROOA05742p 6 K. iactis KLLAOBO8371g 7 alanine are more closely related and valine, isoleucine and A. goSSpi AFR561Wp 8 leucine are more closely related); and the aromatic amino S. kluyveri SAKLOHO4730g 9 acids phenylalanine, tryptophan, and tyrosine. In addition, K. thermotoierans KLTHOD13002p 10 although classified in different categories, alanine, glycine, K. waiti Kwal 26.9160 11 and serine seem to be interchangeable to Some extent, and cysteine additionally fits into this group, or may be classified 0307. In addition to synteny, fungal homologs to the S. with the polar neutral amino acids. cerevisiae TMA29 gene may be identified by one skilled in the artthrough tools such as BLAST and sequence alignment. Methods in General These other homologs may be deleted in a similar manner from the respective yeast species to eliminate the accumula Identification of 3-Ketoacid Reductase Homologs tion of the 3-hydroxyacid by-product. Examples of homolo gous proteins can be found in Vanderwaltonzyma polyspora 0303 Any method can be used to identify genes that (SEQ ID NO: 2), Saccharomyces castellii (SEQ ID NO:3), encode for enzymes with 3-ketoacid reductase activity, Candida glabrata (SEQID NO: 4), Saccharomyces bayanus including, but not limited to S. cerevisiae TMA29. Generally, (SEQIDNO:5), Zgosaccharomyces rouxii (SEQID NO:6), genes that are homologous or similar to 3-ketoacid reductases K. lactis (SEQID NO: 7), Ashbya gossypii (SEQID NO: 8), Saccharomyces kluyveri (SEQ ID NO: 9), Kluyveromyces such as TMA29 can be identified by functional, structural, thermotolerans (SEQ ID NO: 10), Kluyveromyces waltii and/or genetic analysis. In most cases, homologous or similar (SEQID NO: 11), Pichia stipitis (SEQID NO: 12), Debaro genes and/or homologous or similar enzymes will have func myces hansenii (SEQ ID NO: 13), Pichia pastoris (SEQ ID tional, structural, or genetic similarities. NO: 14), Candida dubliniensis (SEQ ID NO: 15), Candida 0304. The S. cerevisiae gene TMA29 is also known as albicans (SEQID NO:16), Yarrowia lipolytica (SEQID NO: YMR226C. The open reading frame (ORF) YMR226C is 17), Issatchenkia Orientalis (SEQ ID NO: 18), Aspergillus found on the S. cerevisiae Chromosome XIII at positions nidulans (SEQID NO: 19), Aspergillus niger (SEQID NO: 722395. . . 721592. The chromosomal location of YMR226C 20), Neurospora crassa (SEQ ID NO: 21), Schizosaccharo is a region that is highly syntenic to chromosomes in many myces pombe (SEQID NO: 22), and Kluyveromyces marx related yeast Byrne, K. P. and K. H. Wolfe (2005) “The Yeast ianus (SEQID NO:23). 0308 Techniques known to those skilled in the art may be Gene Order Browser: combining curated homology and Syn Suitable to identify additional homologous genes and tenic context reveals gene fate in polyploid species. Genome homologous enzymes. Generally, analogous genes and/or Res. 15(10): 1456-61. Scannell, D. R. K. P. Byrne, J. L. analogous enzymes can be identified by functional analysis Gordon, S. Wong, and K. H. Wolfe (2006) “Multiple rounds and will have functional similarities. Techniques known to of speciation associated with reciprocal gene loss in polyp those skilled in the art may be suitable to identify analogous loidy yeasts.” Nature 440: 341-5. Scannell, D. R. A. C. Frank, genes and analogous enzymes. For example, to identify G. C. Conant, K. P. Byrne, M. Woolfit, and K. H. Wolfe (2007) homologous or analogous genes, proteins, or enzymes, tech “Independent sorting-out of thousands of duplicated gene niques may include, but not limited to, cloning a dehydratase pairs in two yeast species descended from a whole-genome gene by PCR using primers based on a published sequence of duplication.” Proc Natl AcadSci USA 104: 8397-402. a gene/enzyme or by degenerate PCR using degenerate prim 0305 For example, locations of the syntenic versions of ers designed to amplify a conserved region among dehy YMR226C from other yeast species can be found on Chro dratase genes. Further, one skilled in the art can use tech mosome 13 in Candida glabrata, Chromosome 1 in Zygosac niques to identify homologous or analogous genes, proteins, charomyces rouxi, Chromosome 2 in K. lactis, Chromosome or enzymes with functional homology or similarity. Tech 6 in Ashbya gossypii, Chromosome 8 in S. kluyveri, Chromo niques include examining a cellor cell culture for the catalytic some 4 in K. thermotolerance and Chromosome 8 from the activity of an enzyme through in vitro enzyme assays for said activity (e.g. as described herein or in Kiritani, K. Branched inferred ancestral yeast species Gordon, J. L. K. P. Byrne, Chain Amino Acids Methods Enzymology, 1970), then iso and K. H. Wolfe (2009) Additions, losses, and rearrange lating the enzyme with said activity through purification, ments on the evolutionary route from a reconstructed ancestor determining the protein sequence of the enzyme through to the modern Saccharomyces cerevisiae genome. PLOS techniques such as Edman degradation, design of PCR prim Genet. 5: e1000485. ers to the likely nucleic acid sequence, amplification of said 0306. Using this syntenic relationship, species-specific DNA sequence through PCR, and cloning of said nucleic acid versions of this gene are readily identified and examples can sequence. To identify homologous or similar genes and/or be found in Table 4. homologous or similar enzymes, analogous genes and/or US 2011/020 1 090 A1 Aug. 18, 2011 34 analogous enzymes or proteins, techniques also include com NO: 26), Candida glabrata (SEQID NO: 27), Saccharomy parison of data concerning a candidate gene or enzyme with ces bayanus (SEQ ID NO: 28), Kluyveromyces lactis (SEQ databases such as BRENDA, KEGG, or MetaCYC. The can ID NO: 29), Kluyveromyces thermotolerans (SEQ ID NO: didate gene or enzyme may be identified within the above 30), Kluyveromyces waltii (SEQID NO:31), Saccharomyces mentioned databases in accordance with the teachings herein. cerevisiae YJ789 (SEQ ID NO:32), Saccharomyces cerevi siae JAY291 (SEQ ID NO: 33), Saccharomyces cerevisiae Identification of Aldehyde Dehydrogenase Homologs EC1118 (SEQ ID NO. 34), Saccharomyces cerevisiae 0309 Any method can be used to identify genes that DBY939 (SEQ ID NO: 35), Saccharomyces cerevisiae encode for enzymes with aldehyde dehydrogenase activity, AWR11631 (SEQ ID NO:36), Saccharomyces cerevisiae including, but not limited, to the S. cerevisiae ALD6. Gener RM11-1a (SEQ ID NO: 37), Pichia pastoris (SEQ ID NO: ally, genes that are homologous or similar to aldehyde dehy 38), Kluyveromyces marxianus (SEQID NO:39), Schizosac drogenases such as ALD6 can be identified by functional, charomyces pombe (SEQ ID NO: 40), and Schizosaccharo structural, and/or genetic analysis. In most cases, homolo myces pombe (SEQID NO: 41). gous or similar genes and/or homologous or similar enzymes will have functional, structural, or genetic similarities. Identification of an ADH or KDH in a Microorganism 0310. The S. cerevisiae gene ALD6 is also known by its 0314 Any method can be used to identify genes that systematic name YPL061W. The open reading frame (ORF) encode for enzymes with alcohol dehydrogenase (ADH) or YPLO61 W is found on the S. cerevisiae Chromosome XVI at ketoacid dehydrogenase (KDH) activity. Alcoholdehydroge positions 432585 . . . 434087. The chromosomal location of nase (ADH) can catalyze the reversible conversion of isobu YPL061W is a region that is highly syntenic to chromosomes tanol to isobutyraldehyde. Ketoacid dehydrogenases (KDH) in many related yeast Byrne, K. P. and K. H. Wolfe (2005) can catalyze the conversion of 2-ketoisovalerate to isobu “The Yeast Gene Order Browser: combining curated homol tyryl-CoA, which can be converted further to isobutyrate by ogy and Syntenic context reveals gene fate in polyploid spe the action of transacetylase and carboxylic acid kinase cies. Genome Res. 15: 1456-61. Scannell, D. R. K. P. Byrne, enzymes. Generally, genes that are homologous or similar to J. L. Gordon, S. Wong, and K. H. Wolfe (2006) “Multiple known alcoholdehydrogenases and ketoacid dehydrogenases rounds of speciation associated with reciprocal gene loss in can be identified by functional, structural, and/or genetic polyploidy yeasts.” Nature 440: 341-5. Scannell, D. R. A. C. analysis. In most cases, homologous or similar alcohol dehy Frank, G. C. Conant, K. P. Byrne, M. Woolfit, and K. H. drogenase genes and/or homologous or similar alcohol dehy Wolfe (2007)“Independent sorting-out of thousands of dupli drogenase enzymes will have functional, structural, or cated gene pairs in two yeast species descended from a whole genetic similarities. Likewise, homologous or similar genome duplication.” Proc Natl Acad Sci USA 104: 8397 ketoacid dehydrogenase genes and/or homologous or similar 402. ketoacid dehydrogenase enzymes will have functional, struc 0311 For example, locations of the syntenic versions of tural, or genetic similarities. YPL061W from other yeast species can be found on Chro mosome 8 in Candida glabrata, Chromosome 5 in K. lactis, Identification of PDC and GPD in a Yeast Microorganism Chromosome 5 in K. thermotolerans and Chromosome 8 from the inferred ancestral yeast species Gordon, J. L., K. P. 0315. Any method can be used to identify genes that Byrne, and K. H. Wolfe (2009) Additions, losses, and rear encode for enzymes with pyruvate decarboxylase (PDC) rangements on the evolutionary route from a reconstructed activity or glycerol-3-phosphate dehydrogenase (GPD) activ ancestor to the modern Saccharomyces cerevisiae genome.” ity. Suitable methods for the identification of PDC and GPD PLoS Genet. 5: e1000485.). are described in commonly owned and co-pending publica 0312. Using this syntenic relationship, species-specific tions, US 2009/0226991 and US 2011/0020889, both of versions of this gene are readily identified and examples can which are herein incorporated by reference in their entireties be found in Table 5. for all purposes. Genetic Insertions and Deletions TABLE 5 0316. Any method can be used to introduce a nucleic acid ALD6 and honologs thereof. molecule into yeast and many Such methods are well known. For example, transformation and electroporation are common Species Gene Name SEQID NO: methods for introducing nucleic acid into yeast cells. See, S. cerevisiae YPLO61W 25 e.g., Gietz et al., 1992, Nuc Acids Res. 27: 69-74; Ito et al., S. castelii Scas 664.24 26 C. glabrata CAGLOHO5137g 27 1983, J. Bacteriol. 153: 163-8; and Becker et al., 1991, Meth S. bayant is Sbay 623.4 28 ods in Enzymology 194: 182-7. K. iactis KLLAOE23057 29 0317. In an embodiment, the integration of a gene of inter K. thermotoierans KLTHOE12210g 30 est into a DNA fragment or target gene of a yeast microor K. waiti Kwal 27.119760 31 ganism occurs according to the principle of homologous recombination. According to this embodiment, an integration 0313. In addition to synteny, fungal homologs to the S. cassette containing a module comprising at least one yeast cerevisiae ALD6 gene may be identified by one skilled in the marker gene and/or the gene to be integrated (internal mod art through tools such as BLAST and sequence alignment. ule) is flanked on either side by DNA fragments homologous These other homologs may be deleted in a similar manner to those of the ends of the targeted integration site (recombi from the respective yeast species to eliminate the accumula nogenic sequences). After transforming the yeast with the tion of the aldehyde by-product. Examples of homologous cassette by appropriate methods, a homologous recombina proteins can be found in Saccharomyces castelli (SEQ ID tion between the recombinogenic sequences may result in the US 2011/020 1 090 A1 Aug. 18, 2011

internal module replacing the chromosomal region in e.g., Methods in Yeast Genetics (1997 edition), Adams, between the two sites of the genome corresponding to the Gottschling, Kaiser, and Stems, Cold Spring Harbor Press recombinogenic sequences of the integration cassette. (Orr (1998). In addition, certain point-mutation(s) can be intro Weaver et al., 1981, PNAS USA 78: 6354-58). duced which results in an enzyme with reduced activity. Also 0318. In an embodiment, the integration cassette for inte included within the scope of this invention are yeast strains gration of a gene of interest into a yeast microorganism which when found in nature, are substantially free of one or includes the heterologous gene under the control of an appro more activities selected from 3-ketoacid reductase, PDC, priate promoter and terminator together with the selectable ALDH, or glycerol-3-phosphate dehydrogenase (GPD) marker flanked by recombinogenic sequences for integration activity. of a heterologous gene into the yeast chromosome. In an 0323 Alternatively, antisense technology can be used to embodiment, the heterologous gene includes an appropriate reduce enzymatic activity. For example, yeast can be engi native gene desired to increase the copy number of a native neered to contain a cDNA that encodes an antisense molecule gene(s). The selectable marker gene can be any marker gene that prevents an enzyme from being made. The term “anti used in yeast, including but not limited to, HIS3, TRP1, sense molecule' as used herein encompasses any nucleic acid LEU2, URA3, bar, ble, hph, and kan. The recombinogenic molecule that contains sequences that correspond to the cod sequences can be chosen at will, depending on the desired ing strand of an endogenous polypeptide. An antisense mol integration site Suitable for the desired application. ecule also can have flanking sequences (e.g., regulatory 0319. In another embodiment, integration of a gene into sequences). Thus antisense molecules can be ribozymes or the chromosome of the yeast microorganism may occur via antisense oligonucleotides. A ribozyme can have any general random integration (Kooistra et al., 2004, Yeast 21: 781-792). structure including, without limitation, hairpin, hammerhead, 0320 Additionally, in an embodiment, certain introduced or axhead structures, provided the molecule cleaves RNA. marker genes are removed from the genome using techniques 0324 Yeast having a reduced enzymatic activity can be well known to those skilled in the art. For example, URA3 identified using many methods. For example, yeast having marker loss can be obtained by plating URA3 containing cells reduced 3-ketoacid reductase, PDC, ALDH, or glycerol-3- in FOA (5-fluoro-orotic acid) containing medium and select phosphate dehydrogenase (GPD) activity can be easily iden ing for FOA resistant colonies (Boeke et al., 1984, Mol. Gen. tified using common methods, which may include, for Genet. 197: 345-47). example, measuring glycerol formation via liquid chroma 0321. The exogenous nucleic acid molecule contained tography. within a yeast cell of the disclosure can be maintained within that cell in any form. For example, exogenous nucleic acid Overexpression of Heterologous Genes molecules can be integrated into the genome of the cell or 0325 Methods for overexpressing a polypeptide from a maintained in an episomal state that can stably be passed on native or heterologous nucleic acid molecule are well known. (“inherited') to daughter cells. Such extra-chromosomal Such methods include, without limitation, constructing a genetic elements (such as plasmids, mitochondrial genome, nucleic acid sequence Such that a regulatory element pro etc.) can additionally contain selection markers that ensure motes the expression of a nucleic acid sequence that encodes the presence of Such genetic elements in daughter cells. the desired polypeptide. Typically, regulatory elements are Moreover, the yeast cells can be stably or transiently trans DNA sequences that regulate the expression of other DNA formed. In addition, the yeast cells described herein can con sequences at the level of transcription. Thus, regulatory ele tain a single copy, or multiple copies of a particular exog ments include, without limitation, promoters, enhancers, and enous nucleic acid molecule as described above. the like. For example, the exogenous genes can be under the control of an inducible promoter or a constitutive promoter. Reduction of Enzymatic Activity Moreover, methods for expressing a polypeptide from an 0322 Yeast microorganisms within the scope of the inven exogenous nucleic acid molecule in yeast are well known. For tion may have reduced enzymatic activity Such as reduced example, nucleic acid constructs that are used for the expres 3-ketoacid reductase, PDC, ALDH, or glycerol-3-phosphate sion of exogenous polypeptides within Kluyveromyces and dehydrogenase (GPD) activity. The term “reduced as used Saccharomyces are well known (see, e.g., U.S. Pat. Nos. herein with respect to a particular enzymatic activity refers to 4,859.596 and 4,943,529, for Kluyveromyces and, e.g., Gel a lower level of enzymatic activity than that measured in a lissen et al., Gene 190(1):87–97 (1997) for Saccharomyces). comparable yeast cell of the same species. The term reduced Yeast plasmids have a selectable marker and an origin of also refers to the elimination of enzymatic activity as com replication. In addition certain plasmids may also contain a pared to a comparable yeast cell of the same species. Thus, centromeric sequence. These centromeric plasmids are gen yeast cells lacking 3-ketoacid reductase, PDC, ALDH or erally a single or low copy plasmid. Plasmids without a cen glycerol-3-phosphate dehydrogenase (GPD) activity are con tromeric sequence and utilizing either a 2 micron (S. cerevi sidered to have reduced 3-ketoacid reductase, PDC, ALDH or siae) or 1.6 micron (K. lactis) replication originare high copy glycerol-3-phosphate dehydrogenase (GPD) activity since plasmids. The selectable marker can be either prototrophic, most, if not all, comparable yeast strains have at least some such as HIS3, TRP1, LEU2, URA3 or ADE2, or antibiotic 3-ketoacid reductase, PDC, ALDH, or glycerol-3-phosphate resistance. Such as, bar, ble, hph, or kan. dehydrogenase (GPD) activity. Such reduced enzymatic 0326 In another embodiment, heterologous control ele activities can be the result of lower enzyme concentration, ments can be used to activate or repress expression of endog lower specific activity of an enzyme, or a combination enous genes. Additionally, when expression is to be repressed thereof. Many different methods can be used to make yeast or eliminated, the gene for the relevant enzyme, protein or having reduced enzymatic activity. For example, a yeast cell RNA can be eliminated by known deletion techniques. can be engineered to have a disrupted enzyme-encoding locus 0327. As described herein, any yeast within the scope of using common mutagenesis or knock-out technology. See, the disclosure can be identified by selection techniques spe US 2011/020 1 090 A1 Aug. 18, 2011 36 cific to the particular enzyme being expressed, over-ex 0331. In one aspect, the present invention provides a pressed or repressed. Methods of identifying the strains with method of producing a beneficial metabolite derived from a the desired phenotype are well known to those skilled in the recombinant microorganism comprising a biosynthetic path art. Such methods include, without limitation, PCR, RT-PCR, way. and nucleic acid hybridization techniques such as Northern 0332. In one embodiment, the method includes cultivating and Southern analysis, altered growth capabilities on a par a recombinant microorganism comprising a biosynthetic ticular substrate or in the presence of a particular Substrate, a pathway which uses a 3-ketoacid as an intermediate in a chemical compound, a selection agent and the like. In some culture medium containing a feedstock providing the carbon cases, immunohistochemistry and biochemical techniques source until a recoverable quantity of the beneficial metabo can be used to determine if a cell contains a particular nucleic lite is produced and optionally, recovering the metabolite. In acid by detecting the expression of the encoded polypeptide. one embodiment, the 3-ketoacid intermediate is acetolactate. For example, an antibody having specificity for an encoded In an exemplary embodiment, said recombinant microorgan ism is engineered to reduce or eliminate the expression or enzyme can be used to determine whether or not a particular activity of an enzyme catalyzing the conversion of acetolac yeast cell contains that encoded enzyme. Further, biochemi tate to DH2MB. The beneficial metabolite may be derived cal techniques can be used to determine if a cell contains a from any biosynthetic pathway which uses acetolactate as particular nucleic acid molecule encoding an enzymatic intermediate, including, but not limited to, biosynthetic path polypeptide by detecting a product produced as a result of the ways for the production of isobutanol, 2-butanol, 1-butanol, expression of the enzymatic polypeptide. For example, trans 2-butanone, 2,3-butanediol, acetoin, diacetyl, Valine, leucine, forming a cell with a vector encoding acetolactate synthase pantothenic acid, isobutylene, 3-methyl-1-butanol, 4-methyl and detecting increased acetolactate concentrations com 1-pentanol, and coenzyme A. In a specific embodiment, the pared to a cell without the vector indicates that the vector is beneficial metabolite is isobutanol. In another embodiment, both present and that the gene product is active. Methods for the 3-ketoacid intermediate is 2-aceto-2-hydroxybutyrate. In detecting specific enzymatic activities or the presence of par an exemplary embodiment, said recombinant microorganism ticular products are well known to those skilled in the art. For is engineered to reduce or eliminate the expression or activity example, the presence of acetolactate can be determined as of an enzyme catalyzing the conversion of 2-aceto-2-hy described by Hugenholtz and Starrenburg, 1992, Appl. Micro. droxybutyrate to 2-ethyl-2,3-dihydroxybutyrate. The benefi Biot. 38:17-22. cial metabolite may be derived from any biosynthetic path way which uses 2-aceto-2-hydroxybutyrate as intermediate, Increase of Enzymatic Activity including, but not limited to, biosynthetic pathways for the 0328. Yeast microorganisms of the invention may be fur production of 2-methyl-1-butanol, isoleucine, 3-methyl-1- ther engineered to have increased activity of enzymes (e.g., pentanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol. increased activity of enzymes involved in an isobutanol pro 0333. In another embodiment, the method includes culti ducing metabolic pathway). The term “increased as used Vating a recombinant microorganism comprising a biosyn herein with respect to a particular enzymatic activity refers to thetic pathway which uses an aldehyde as an intermediate in a higher level of enzymatic activity than that measured in a a culture medium containing a feedstock providing the car comparable yeast cell of the same species. For example, bon source until a recoverable quantity of the beneficial overexpression of a specific enzyme can lead to an increased metabolite is produced and optionally, recovering the level of activity in the cells for that enzyme. Increased activi metabolite. In an exemplary embodiment, said recombinant ties for enzymes involved in glycolysis or the isobutanol microorganism is engineered to reduce or eliminate the pathway would result in increased productivity and yield of expression or activity of an enzyme catalyzing the conversion isobutanol. of an aldehyde to acid by-product. The beneficial metabolite 0329 Methods to increase enzymatic activity are known may be derived from any biosynthetic pathway which uses an to those skilled in the art. Such techniques may include aldehyde as intermediate, including, but not limited to, bio increasing the expression of the enzyme by increased copy synthetic pathways for the production of isobutanol, 1-bu number and/or use of a strong promoter, introduction of muta tanol, 2-methyl-1-butanol, 3-methyl-1-butanol. 1-propanol, tions to relieve negative regulation of the enzyme, introduc 1-pentanol, 1-hexanol, 3-methyl-1-pentanol, 4-methyl-1- tion of specific mutations to increase specific activity and/or pentanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol. In a decrease the Km for the substrate, or by directed evolution. specific embodiment, the beneficial metabolite is isobutanol. See, e.g., Methods in Molecular Biology (vol. 231), ed. 0334. In another embodiment, the method includes culti Arnold and Georgiou, Humana Press (2003). Vating a recombinant microorganism comprising a biosyn thetic pathway which uses acetolactate and an aldehyde as Methods of Using Recombinant Microorganisms for High intermediates in a culture medium containing a feedstock Yield Fermentations providing the carbon source until a recoverable quantity of the beneficial metabolite is produced and optionally, recov 0330 For a biocatalyst to produce a beneficial metabolite ering the metabolite. In an exemplary embodiment, said most economically, it is desirable to produce said metabolite recombinant microorganism is engineered to (i) reduce or at a high yield. Preferably, the only product produced is the eliminate the expression or activity of an enzyme catalyzing desired metabolite, as extra products (i.e. by-products) lead to the conversion of acetolactate to DH2MB and (ii) reduce or a reduction in the yield of the desired metabolite and an eliminate the expression or activity of an enzyme catalyzing increase in capital and operating costs, particularly if the extra the conversion of an aldehyde to acid by-product. The ben products have little or no value. These extra products also eficial metabolite may be derived from any biosynthetic path require additional capital and operating costs to separate way which uses acetolactate and an aldehyde as intermediate, these products from the desired metabolite. including, but not limited to, biosynthetic pathways for the US 2011/020 1 090 A1 Aug. 18, 2011 37 production of isobutanol, 1-butanol, and 3-methyl-1-butanol. embodiment, the microorganism may produce the beneficial In a specific embodiment, the beneficial metabolite is isobu metabolite from a carbon source at a yield of at least about 10 tanol. percent, at least about 15 percent, about least about 20 per 0335. In another embodiment, the method includes culti Vating a recombinant microorganism comprising a biosyn cent, at least about 25 percent, at least about 30 percent, at thetic pathway which uses 2-aceto-2-hydroxybutyrate and an least about 35 percent, at least about 40 percent, at least about aldehyde as intermediates in a culture medium containing a 45 percent, at least about 50 percent, at least about 55 percent, feedstock providing the carbon source until a recoverable at least about 60 percent, at least about 65 percent, at least quantity of the beneficial metabolite is produced and option about 70 percent, at least about 75 percent, at least about 80 ally, recovering the metabolite. In an exemplary embodiment, percent, at least about 85 percent, at least about 90 percent, at said recombinant microorganism is engineered to (i) reduce least about 95 percent, or at least about 97.5% theoretical. In or eliminate the expression or activity of an enzyme cata a specific embodiment, the beneficial metabolite is isobu lyzing the conversion of 2-aceto-2-hydroxybutyrate to tanol. 2-ethyl-2,3-dihydroxybutyrate and (ii) reduce or eliminate 0339. This invention is further illustrated by the following the expression or activity of an enzyme catalyzing the con examples that should not be construed as limiting. The con version of an aldehyde to acid by-product. The beneficial tents of all references, patents, and published patent applica metabolite may be derived from any biosynthetic pathway tions cited throughout this application, as well as the Figures which uses 2-aceto-2-hydroxybutyrate and an aldehyde as and the Sequence Listing, are incorporated herein by refer intermediate, including, but not limited to, biosynthetic path ways for the production of 2-methyl-1-butanol, 3-methyl-1- ence for all purposes. pentanol, 4-methyl-1-hexanol, and 5-methyl-1-heptanol. 0336. In another embodiment, the present invention pro EXAMPLES vides a method of producing a beneficial metabolite derived from an alcohol dehydrogenase (ADH)-requiring biosyn General Methods for Examples 1-26 thetic pathway. In one embodiment, the method includes cultivating a recombinant microorganism comprising a modi 0340 Sequences: Amino acid and nucleotide sequences fied ADH described herein in a culture medium containing a disclosed herein are shown in Table 6.

TABLE 6 Amino Acid and Nucleotide Sequences of Enzymes and Genes Disclosed in Various Examples. Corresponding Protein Enz. Source Gene (SEQID NO) (SEQID NO) ALS B. subtiis Bs alsS1 coSc (SEQ ID NO: 42) Bs. AlsS1 (SEQID NO:43) KARI E. coi Ec ilvC coSce''' (SEQID NO:44) Ec IIvce (SEQID NO: 45) E. coi Ec ilvC coSc2'-' (SEQID NO:46) Ec ilvC coSc2'-' (SEQID NO:47) KIVD L. lactis Ll kiv D2 coEc (SEQID NO: 48) Ll Kivd2 (SEQID NO:49) DHAD L. lactis Ll ilvD coSc (SEQID NO: 50) Ll Ilv) (SEQID NO: 51) S. cerevisiae Sc ILV3AN (SEQID NO:52) Sc Ilv3AN (SEQID NO:53) ADH D. melanogaster Dm ADH (SEQID NO:54) Dm Adh (SEQID NO: 55) L. lactis Ll adh A (SEQID NO: 56) Ll Adh A (SEQID NO: 57) L. lactis Ll adhA coScis (SEQID NO:58) Ll Adhais (SEQID NO:59) L. lactis Ll adhA coSc' (SEQID NO: 60) Ll AdhAF-lis (SEQID NO: 61) feedstock providing the carbon source until a recoverable 0341 Media: Medium used was standard yeast medium quantity of the beneficial metabolite is produced and option (see, for example Sambrook, J., Russel, D. W. Molecular ally, recovering the metabolite. The beneficial metabolite Cloning, A Laboratory Manual. 3rd ed. 2001, Cold Spring may be derived from any ADH-requiring biosynthetic path Harbor, N.Y.: Cold Spring Harbor Laboratory Press and way, including, but not limited to, biosynthetic pathways for Guthrie, C. and Fink, G. R. eds. Methods in Enzymology Part the production of 1-propanol. 2-propanol, 1-butanol. 2-bu B: Guide to Yeast Genetics and Molecular and Cell Biology tanol. 1-pentanol, 2-methyl-1-butanol, and 3-methyl-1-bu 350:3-623 (2002)). YP medium contains 1% (w/v) yeast extract, 2% (w/v) peptone.YPD is YP containing 2% glucose tanol. In a specific embodiment, the beneficial metabolite is unless specified otherwise. YPE is YP containing 25 mL/L isobutanol. ethanol. SC medium is 6.7 g/L Difco TMYeast Nitrogen Base, 0337. In a method to produce a beneficial metabolite from 14 g/L SigmaTM Synthetic Dropout Media supplement (in a carbon Source, the yeast microorganism is cultured in an cludes amino acids and nutrients excluding histidine, tryp appropriate culture medium containing a carbon Source. In tophan, uracil, and leucine), 0.076 g/L histidine, 0.076 g/L certain embodiments, the method further includes isolating tryptophan, 0.380 g/L leucine, and 0.076 g/L uracil. SCD is the beneficial metabolite from the culture medium. For containing 2% (w/v) glucose unless otherwise noted. Drop example, isobutanol may be isolated from the culture medium out versions of SC and SCD media are made by omitting one by any method known to those skilled in the art, Such as or more of histidine (-H), tryptophan (-W), leucine (-L), or distillation, pervaporation, or liquid-liquid extraction. uracil (-U). Solid versions of the above described media con 0338. In one embodiment, the recombinant microorgan tain 2% (w/v) agar. ism may produce the beneficial metabolite from a carbon 0342 Cloning techniques: Standard molecular biology source at a yield of at least 5 percent theoretical. In another methods for cloning and plasmid construction were generally US 2011/020 1 090 A1 Aug. 18, 2011

used, unless otherwise noted (Sambrook, J., Russel, D. W. and the transformation Suspension was Vortexed for 5 short Molecular Cloning, A Laboratory Manual. 3 ed. 2001, Cold pulses. The transformation was incubated for 30 min at 30° Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press). C., followed by incubation for 22 min at 42°C. The cells were Cloning techniques included digestion with restriction collected by centrifugation (18,000xg, 10 seconds, 25°C.). enzymes, PCR to generate DNA fragments (KOD Hot Start The cells were resuspended in 350 LLYPD and after an Polymerase, Cati 71086, Merck, Darmstadt, Germany), liga overnight recovery shaking at 30° C. and 250 rpm, the cells tions of two DNA fragments using the DNA Ligation Kit were spread over YPD plates containing 0.2 g/L G418 selec (Mighty Mix Catil TAK 6023, Clontech Laboratories, Madi tive plates. Transformants were then single colony purified son, Wis.), and bacterial transformations into competent E. onto G418 selective plates. coli Cells (Xtreme Efficiency DH5a Competent Cells, Cath 0347 K. marxianus transformations: K. marxianus strains ABP-CE-CC02096P. Allele Biotechnology, San Diego, were grown in 3 mL of an appropriate culture medium at 250 Calif.). Plasmid DNA was purified from E. coli Cells using rpm and 30° C. overnight. The following day, cultures were the Qiagen QIAprep Spin Miniprep Kit (Catil 27106, Qiagen, diluted in 50 mL of the same medium and grown to an ODoo Valencia, Calif.). DNA was purified from agarose gels using of between 1 and 4. The cells were collected in a sterile 50 mL the Zymoclean Gel DNA Recovery Kit (Zymo Research, conical tube by centrifugation (1600xg, 5 min at room tem Orange, Calif.; Catalog #D4002) according to manufacturer's perature). The cells were resuspended in 10 mL of electropo protocols. ration buffer (10 mM Tris-C1, 270 mM sucrose, 1 mM (0343 Colony PCR: Yeast colony PCR used the FailSafetM MgCl, pH 7.5), and collected at 1600xg for 5 min at room PCR System (EPICENTRER Biotechnologies, Madison, temperature. The cells were resuspended in 10 mLIB (YPE, Wis.; Catalog #FS99250) according to manufacturer's proto 25 mM DTT, 20 mM HEPES, pH 8.0: prepared fresh by cols. A PCR cocktail containing 15 uL of Master Mix E diluting 100 uL of 2.5M DTT and 200 uL of 1 MHEPES, pH buffer, 10.5 LL water, 2 LL of each primer at 10 uM concen 8.0 into 10 mL ofYPD). The cells were incubated for 30 min, tration, 0.5 LL polymerase enzyme mix from the kit was 250 rpm, 30° C. (tube standing vertical). The cells were added to a 0.2 mL PCR tube for each sample (30 uL each). For collected at 1600xg for 5 min at room temperature and resus each candidate a small amount of cells was added to the pended in 10 mL of chilled electroporation buffer. The cells reaction tube using a sterile pipette tip. Presence of the posi were pelleted at 1600xg for 5 min at 4°C. The cells were tive PCR product was assessed using agarose gel electro resuspended in 1 mL of chilled electroporation buffer and phoresis. transferred to a microfuge tube. The cells were collected by 0344 SOE PCR: The PCR reactions were incubated in a centrifugation at >10,000xg for 20 sec at 4°C. The cells were thermocycler using the following PCR conditions: 1 Cycle of resuspended in appropriate amount of chilled electroporation 94° C.x2 min, 35 Cycles of 94° C.x30s, 53° C.x30s, 72° buffer for a final biomass concentration of 30-38 OD/mL. C.x2 min and 1 Cycle of 72°C.x10 min. A master mix was 400 uL of cells was added to a chilled electroporation cuvette made Such that each reaction contained the following: 3 ul. (0.4 cm gap), 50 uL of SOE PCR product (or water control) MgSO (25 mM), 5uL 10xKOD buffer, 5uL 50% DMSO, 5 was added and mixed by pipetting up and down, and the uL dNTP mix (2 mM each), 1 uL KOD, 28 uL dHO, 1.5 LL cuvette was incubated on ice for 30 min. The samples were forward primer (10 uM), 1.5 LL reverse primer (10 uM), 0.5 electroporated at 1.8 kV, 1000 Ohm, 25uF. The samples were uL template (plasmid or genomic DNA). then transferred to a 50 mL tube with 1 mL of an appropriate (0345 Genomic DNA Isolation: The Zymo Research ZR culture medium, and the samples were incubated for over Fungal/Bacterial DNA Kit (Zymo Research Orange, Calif.; night at 250 rpm at 30° C. After incubation the cells were Catalog #D6005) was used for genomic DNA isolation plated onto appropriate agar plates. according to manufacturer's protocols with the following 0348 K. lactis transformations: K. lactis strains were modifications. Following resuspension of pellets, 200LL was grown in 3 mL YPD at 250 rpm and 30° C. overnight. The transferred to 2 separate ZR Bashing BeadTM Lysis Tubes (to following day, cultures were diluted in 50 mL YPD and maximize yield). Following lysis by bead beating, 400 uL of allowed to grow until they reached an ODoo of -0.8. Cells supernatant from each of the ZR Bashing BeadTMLysis Tubes from 50 mL YPD cultures were collected by centrifugation was transferred to 2 separate Zymo-SpinTM IV Spin Filters (2700 rcf. 2 min, 25°C.). The cells were washed with 50 mL and centrifuged at 7,000 rpm for 1 min. Following the spin, sterile water and collected by centrifugation at 2700 rcf for 2 1.2 mL of Fungal/Bacterial DNA Binding Buffer was added min at RT. The cells were washed again with 25 mL sterile to each filtrate. In 800 ul aliquots, filtrate from both filters was water and collected by centrifugation at 2700 rcf for 2 min at transferred to a single Zymo-SpinTM IIC Column in a collec RT. The cells were resuspended in 1 mL 100 mM lithium tion tube and centrifuged at 10,000xg for 1 min. For the acetate and transferred to a 1.5 mL Eppendorf tube. The cells elution step, instead of eluting in 100LL of EB (elution buffer, were collected by centrifugation for 10 sec at 18,000 rcfat RT. Qiagen), 50 uL of EB was added, incubated 1 min then the The cells were resuspended in a volume of 100 mM lithium columns were centrifuged for 1 min. This elution step was acetate that was approximately 4x the volume of the cell repeated for a final elution volume of 100 uL. pellet. A volume of 10-15 uL of DNA, 72 uL 50% PEG 0346 S. cerevisiae Transformations. S. cerevisiae strains (3350), 10 uIl 1 M lithium acetate, 3 ul. denatured salmon were grown in YPD containing 1% ethanol. Transformation sperm DNA, and sterile water were combined to a final vol competent cells were prepared by resuspension of S. cerevi ume of 100 uL for each transformation. In a 1.5 mL tube, 15 siae cells in 100 mM lithium acetate. Once the cells were uL of the cell suspension was added to the DNA mixture and prepared, a mixture of DNA (final volume of 15 uL with the transformation suspension was vortexed with 5 short sterile water), 72 uL 50% PEG, 10uL 1M lithium acetate, and pulses. The transformation was incubated for 30 min at 30° 3 uL of denatured salmon sperm DNA (10 mg/mL) was C., followed by incubation for 22 min at 42°C. The cells were prepared for each transformation. In a 1.5 mL tube, 15 uL of collected by centrifugation for 10 sec at 18,000 rcfat RT. The the cell suspension was added to the DNA mixture (100 uL), cells were resuspended in 400 uL of an appropriate medium US 2011/020 1 090 A1 Aug. 18, 2011 39 and spread over agar plates containing an appropriate sized according to Cioffi et al. (Ciofi, E. et al. Anal Biochem medium to select for transformed cells. 1980, 104, pp. 485). DH2MB was synthesized as described in Example 8 and quantified based on the assumption that DHIV Analytical Chemistry: and DH2MB exhibit the same response factor. Racemic 0349 Gas Chromatography (method GC1). Analysis of acetolactate was made by hydrolysis of Ethyl-2-acetoxy-2- Volatile organic compounds, including ethanol and isobu methylacetoacetate (EAMMA) with NaOH (Krampitz, L.O. tanol was performed on a Agilent 5890/6890/7890 gas chro Methods in Enzymology 1957, 3, 277-283.). In this method, matograph fitted with an Agilent 7673 Autosampler, a ZB DHIV and DH2MB are separated (FIG. 8). FFAP column(J&W:30 m length, 0.32 mm ID, 0.25uM film thickness) or equivalent connected to a flame ionization Enzyme Assays detector (FID). The temperature program was as follows: 0352 Determination of protein concentration: Protein 200° C. for the injector,300° C. for the detector, 100° C. oven concentration (of yeast lysate or of purified protein) was for 1 minute, 70° C./minute gradient to 230°C., and then hold determined using the BioRad Bradford Protein Assay for 2.5 min. Analysis was performed using authentic stan Reagent Kit (Catil 500-0006, BioRad Laboratories, Hercules, dards (>99%, obtained from Sigma-Aldrich, and a 5-point Calif.) and using BSA for the standard curve. A standard calibration curve with 1-pentanol as the internal standard. curve for the assay was made using a dilution series of a 0350 High Performance Liquid Chromatography standard protein stock of 500 ug/mL BSA. An appropriate (method LC1): Analysis of organic acid metabolites includ dilution of cell lysate was made in water to obtain ODsos ing 2,3-dihydroxyisovalerate (DHIV), 2,3-dihydroxy-2-me measurements of each lysate that fell within linear range of thylbutanoic acid (DH2MB), isobutyrate and glucose was the BioRad protein standard curve. TenuL of the lysate dilu performed on an Agilent 1200 or equivalent High Perfor tion was added to 500 uL of diluted BioRad protein assay dye, mance Liquid Chromatography system equipped with a Bio samples were mixed by Vortexing, and incubated at room Rad Micro-guard Cation H Cartridge and two Phenomenex temperature for 6 min. Samples were transferred to cuvettes Rezex RFQ-Fast Fruit H+ (8%), 100x7.8-mm columns in series, or equivalent. Organic acid metabolites were detected and read at 595 nm in a spectrophotometer. The linear regres using an Agilent 1100 or equivalent UV detector (210 nm) sion of the standards was used to calculate the protein con and a refractive index detector. The column temperature was centration of each sample. 60° C. This method was isocratic with 0.0180 NHSO in 0353 Alcohol Dehydrogenase (ADH) Assay. Cells were Milli-Q water as mobile phase. Flow was set to 1.1 mL/min. thawed on ice and resuspended in lysis buffer (100 mM Tris Injection Volume was 20 Jul and run time was 16 min. Quan HCl pH 7.5). 1000 uL of glass beads (0.5 mm diameter) were titation of organic acid metabolites was performed using a added to a 1.5 mL Eppendorf tube and 875 uL of cell suspen 5-point calibration curve with authentic standards (>99% or sion was added. Yeast cells were lysed using a Retsch MM301 highest purity available), with the exception of DHIV (2,3- mixer mill (Retsch Inc. Newtown, Pa.), mixing 6x1 min each dihydroxy-3-methyl-butanoate, CAS 1756-18-9), which was at full speed with 1 min incubations on ice between each synthesized according to Cioffi et al. (Cioffi, E. et al. Anal bead-beating step. The tubes were centrifuged for 10 min at Biochem 1980, 104, pp. 485) and DH2MB which quantified 23,500xg at 4°C. and the supernatant was removed for use. based on the assumption that DHIV and DH2MB exhibit the These lysates were held on ice until assayed. Yeast lysate same response factor. In this method, DHIV and DH2MB protein concentrations were determined as described. co-elute, hence their concentrations are reported as the Sum of 0354) Dilutions of the samples were made such that an the two concentrations. activity reading could be obtained. Generally the samples 0351 High Performance Liquid Chromatography from strains expected to have low ADH activity were diluted (method LC4): Analysis of oxo acids, including 2,3-dihy 1:5 in lysis buffer (100 mM Tris-HCl pH 7.5) and the samples droxyisovalerate (DHIV, CAS 1756-18-9), 2,3-dihydroxy-2- from strains with expected high ADH activity such as strains methylbutyrate acid (DH2MB), lactate, acetate, acetolactate, where the ADH gene is expressed from a high copy number isobutyrate, and pyruvate) was performed on a Agilent-1 100 plasmid were diluted 1:40 to 1:100. Reactions were per High Performance Liquid Chromatography system equipped formed in triplicate using 10 uL of appropriately diluted cell with an IonPac AS11-HC Analytical column (Dionex: 9 um, extract with 90 uL of reaction buffer (100 mM Tris-HCl, pH 4.6x250 mm) coupled with an IonPac AG11-HC guard col 7.5; 150 uM NADH: 11 mM isobutyraldehyde) in a 96-well umn (Dionex: 13 lum, 4.6x50 mm) and an IonPac ATC-3 plate in a SpectraMax(R340PC multi-plate reader (Molecular Anion Trap column (Dionex: 9x24mm). Acetolactate was Devices, Sunnyvale, Calif.). The reaction was followed at 340 detected using a UV detector at 225 nm, while all other nm for 5 minutes, with absorbance readings every 10 seconds. analytes were detected using a conductivity detector (ED50 The reactions were performed at 30° C. The reactions were suppressed conductivity with ASRS 4 mm in AutoSuppres performed in complete buffer and also in buffer with no sion recycle mode, 200 mA Suppressor current). The column substrate. temperature was 35°C. Injection size was 10 uL. This method 0355 Isobutyraldehyde Oxidation Assay (ALD6 assay): used the following elution profile:0.25 mMNaOH for 3 min, Cell pellets were thawed on ice and resuspended in lysis followed by a linear gradient from 0.25 to 5 mM NaOH in 22 buffer (10 mM sodium phosphate pH7.0, 1 mM dithiothreitol, min and a second linear gradient from 5 mM to 38.25 mM in 5% w/v glycerol). One mL of glass beads (0.5 mm diameter) 0.1 min, followed by 38.25 mM NaOH for 4.9 minanda final was added to a 1.5 mL Eppendorf tube for each sample and linear gradient from 38.25 mM to 0.25 mM for 0.1 min before 850 uL of cell suspension were added. Yeast cells were lysed re-equilibrating at 0.25 mM NaOH for 7 min. Flow was set at using a Retsch MM301 mixer mill (Retsch Inc. Newtown, 2 mL/min. Analysis was performed using a 4-point calibra Pa.), mixing 6x1 min each at full speed with 1 minincubation tion curve with authentic standards (>99%, or highest purity on ice between. The tubes were centrifuged for 10 min at available), with the following exceptions: DHIV was synthe 21,500xg at 4° C. and the supernatant was transferred to a US 2011/020 1 090 A1 Aug. 18, 2011 40 fresh tube. Extracts were held on ice until assayed. Yeast and incubated for 15 min at 30° C. A no substrate control lysate protein concentrations were determined as described. (buffer without pyruvate) and a no lysate control (lysis buffer 0356. The method used to measure enzyme activity of instead of lysate) were also included. After incubation each enzymes catalyzing the oxidation of isobutyraldehyde to reaction was mixed with 21.5uL of 35% HSO, incubated at isobutyrate in cell lysates was modified from Meaden et al. 37° C. for 1 h and centrifuged for 5 min at 5,000xg to remove 1997, Yeast 13: 1319-1327 and Postma et al. 1988, Appl. any insoluble precipitants. Environ. Microbiol. 55; 468-477. Briefly, for each sample, 10 0359 All assay samples were analyzed for the assay sub uL of undiluted cell lysate was added to 6 wells of a UV strate (pyruvate) and product (acetoin) via high performance microtiter plate. Three wells received 90 uL assay buffer liquid chromatography an HP-1200 High Performance Liq containing 50 mM HEPES-NaOH at pH 7.5,0.4 mMNADP", uid Chromatography system equipped with two Restek RFQ 3.75 mM MgCl, and 0.1 mM, 1 mM, or 10 mM isobutyral 150x4.6 mm columns in series. Organic acid metabolites dehyde. The other 3 wells received 90 uL of no substrate were detected using an HP-1100 UV detector (210 nm) and buffer (same as assay buffer but without isobutyraldehyde). refractive index. The column temperature was 60° C. This The buffers were mixed with the lysate in the wells by pipet method was isocratic with 0.0180 NHSO (in Milli-Q water) ting up and down. The reactions were then monitored at 340 as mobile phase. Flow was set to 1.1 mL/min. Injection vol nm for 5 minutes, with absorbance readings taken every 10 ume was 20 L and run time was 8 min. Analysis was per seconds in a SpectraMax(R 340PC plate reader (Molecular formed using authentic standards (>99%, obtained from Devices, Sunnyvale, Calif.). The reactions were performed at Sigma-Aldrich) and a 5-point calibration curve. 30°C. The V for each sample was determined by subtract 0360 TMA29 enzyme assay: Cell pellets were thawed on ing the background reading of the no Substrate control. A no ice and resuspended in lysis buffer (10 mM sodium phosphate lysate control was also performed in triplicate for each sub pH7.0, 1 mM dithiothreitol, 5% w/v glycerol). One mL of strate concentration. glass beads (0.5 mm diameter) was added to a 1.5 mL Eppen 0357 ALS Assay: For ALS assays described in Examples dorf tube for each sample and 850 uL of cell suspension were 1-18, cells were thawed on ice and resuspended in lysis buffer added. Yeast cells were lysed using a Retsch MM301 mixer (50 mM potassium phosphate buffer pH 6.0 and 1 mM mill (Retsch Inc. Newtown, Pa.), mixing 6x1 min each at full MgSO4). 1000 uL of glass beads (0.5 mm diameter) were speed with 1 min incubation on ice between. The tubes were added to a 1.5 mL Eppendorf tube and 875 uL of cell suspen centrifuged for 10 min at 21.500xg at 4°C. and the superna sion was added. Yeast cells were lysed using a Retsch MM301 tant was transferred to a fresh tube. Extracts were held on ice mixer mill (Retsch Inc. Newtown, Pa.), mixing 6x1 min each until assayed. Yeast lysate protein concentration was deter at full speed with 1 min incubations on ice between each mined using the BioRad Bradford Protein Assay Reagent Kit bead-beating step. The tubes were centrifuged for 10 min at (Cath 500-0006, BioRad Laboratories, Hercules, Calif.) and 23,500xg at 4°C. and the supernatant was removed for use. using BSA for the standard curve as described. These lysates were held on ice until assayed. Protein content 0361 Enzymatic synthesis of (S)-2-acetolactate ((S)-AL) of the lysates was measured as described. All ALS assays was performed in an anaerobic flask. The reaction was carried were performed in triplicate for each lysate, both with and out in a total volume of 55 mL containing 20 mM potassium without Substrate. To assay each lysate, 15 uL of lysate was phosphate pH 7.0, 1 mM MgCl, 0.05 mM thiamine pyro mixed with 135 uL of buffer (50 mM potassium phosphate phosphate (TPP), and 200 mM sodium pyruvate. The synthe buffer pH 6.0, 1 mM MgSO 1 mMthiamin-pyrophosphate, sis was initiated by the addition of 65 units of purified B. 110 mM pyruvate), and incubated for 15 minutes at 30° C. subtilis AlsS, and the reaction was incubated at 30° C. in a Buffers were prepared at room temperature. A no substrate static incubator for 7.5h. control (buffer without pyruvate) and a no lysate control (lysis 0362 Chemical synthesis of racemic 2-acetolactate ((R/ buffer instead of lysate) were also included. After incubation S)-2-AL) was performed by mixing 50 uL of ethyl-2-ac 21.5uL of 35% HSO was added to each reaction and incu etoxy-2-methylacetoacetate (EAMMA) with 990 uL of bated at 37° C. for 1 h. water. 260 uL of 2 N NaOH was then added in 10 uL incre 0358 For ALS assays described in Examples 19-25, cells ments with 15 seconds of vortexing after each addition. The were thawed on ice and resuspended in lysis buffer (100 mM solution was then mixed on an orbital shaker for 20 minutes. NaPO pH 7.0, 5 mM MgCl, and 1 mM DTT). One mL of 0363 Chemical synthesis of racemic AHB ((R/S)-AHB) glass beads (0.5 mm diameter) were added to a 1.5 mL Eppen was performed by mixing 50 uL of ethyl-2-acetoxy-2-ethyl dorf tube and 800 uL of the cell suspension was added to the 3-oxobutanoate with 990 uL of water. 2 N. NaOH was then tube containing glass beads. Yeast cells were lysed using a added in 10 uI, increments with 15 seconds of vortexing after Retsch MM301 mixer mill (Retsch Inc. Newtown, Pa.) and a each addition. The NaOH was added until the pH of the cooling block by mixing six times for 1 min each at 30 solution was 12 (~180 uL of 2 N NaOH). The solution was cycles/second with 1 min icing in between mixing. The tubes then mixed on an orbital shaker for 20 minutes. were centrifuged for 10 min at 21,500xg at 4° C. and the 0364 For determination of (S)-AL, (R/S)-AL or (R/S)- Supernatant was removed. Extracts were held on ice until AHB reduction activity, 10 uL of undiluted cell lysate was assayed. Yeast lysate protein concentration was determined added to 6 wells of a UV microtiter plate. Three wells using the BioRad Bradford Protein Assay Reagent Kit (Catil received 90 uL assay buffer containing 100 mMKPO at pH 500-0006, BioRad Laboratories, Hercules, Calif.) and using 7.0, 150 uM NADPH, and 5 mM (S)-AL or 10 mM (R/S)-AL BSA for the standard curve as described. All ALS assays were or 10 mM (R/S)-AHB as substrate. The other 3 wells received performed in triplicate for each lysate. All buffers, lysates and 90 uL of assay buffer but without substrate. The buffers were reaction tubes were pre-cooled on ice. To assay each lysate, mixed with the lysate in the wells by pipetting up and down. 15 uL of lysate (diluted with lysis buffer as needed) was The reactions were then monitored at 340 nm, with absor mixed with 135uL of assay buffer (50mMKPi, pH 7.0, 1 mM bance readings taken every 10 seconds in a SpectraMax(R) MgSO 1 mM thiamin-pyrophosphate, 110 mM pyruvate), 340PC plate reader (Molecular Devices, Sunnyvale, Calif.). US 2011/020 1 090 A1 Aug. 18, 2011

The reactions were performed at 30°C. The (S)-AL, (R/S)- AL or (R/S)-AHB reduction activity for each sample was TABLE 7-continued determined by Subtracting the background reading of the no Substrate control. A no lysate control was also performed in Genotype of Strains Disclosed in Example 1. triplicate. GEVO Number Genotype 0365 DHAD Enzyme Assay: Cell pellets were thawed on ice and resuspended in lysis buffer (50 mM Tris pH 8.0, 5 mM EC ilvC coSc99. pdc6A::URA3:bla: P: Ll kiv D2: Ps: MgSO, and G Biosciences Yeast/Fungal ProteaseArrestTM Dm ADH (St. Louis, Mo., USA, Catalog #788–333)). One mL of glass {evolved for C2 Supplement-independence, glucose beads (0.5 mm diameter) was added to a 1.5 mL Eppendorf tolerance and faster growth tube for each sample and 850 uL of cell suspension were added. Yeast cells were lysed using a Retsch MM301 mixer mill (Retsch Inc. Newtown, Pa.), mixing 6x1 min each at full speed with 1 min incubation on ice between. The tubes were TABLE 8 centrifuged for 10 min at 21.500xg at 4°C. and the superna tant was transferred to a fresh tube. Extracts were held on ice Plasmids Disclosed in Example 1. until assayed. Yeast lysate protein concentration was deter Plasmid Name Relevant Genes/Usage Genotype mined as described. Protein from each sample was diluted in DHAD assay buffer (50 mM Tris pH8, 5 mM MgSO) to a pGV2011 21 plasmid expressing Priors:Ec ilvC coSc', KARI, and DHAD PTEF1:Ll ilvD coSc, final concentration of 0.5g/LL. Three samples of each lysate 2 ori, bla, G418R were assayed, along with no lysate controls. 10 uIl of each pGV2485 21 plasmid expressing P:Ec ilvC coSce''', sample (or DHAD assay buffer) was added to 0.2 mL PCR KARI, DHAD, and ADH P:Ll ilvD coSc, tubes. Using a multi-channel pipette, 90 uL of the substrate PENo2:Ll adhA, was added to each tube (substrate mix was prepared by adding 2 ori, bla, G418R 4 mL DHAD assay buffer to 0.5 mL 100 mM DHIV). Samples were put in a thermocycler (Eppendorf Mastercy cler) at 35°C. for 30 min followed by a 5 min incubation at 0368 S. cerevisiae strain GEVO2843, which expresses a 95°C. Samples were cooled to 4°C. on the thermocycler, then single alcohol dehydrogenase (D. melanogaster ADH, centrifuged at 3000xg for 5 minutes. Finally, 75uI of super Dm ADH) from its chromosomal DNA was transformed natant was transferred to new PCR tubes and analyzed by with 2L plasmids pGV2011 carrying only the KARI and HPLC as follows 100 uL DNPH reagent (12 mM 2,4-Dini DHAD (Ec ilvC Q11OV and Ll ilvD coSc, respectively) or trophenyl Hydrazine 10 mM Citric Acid pH 3.0 80% Aceto pGV2485 carrying the KARI, DHAD and ADH (Ec ilvC nitrile 20% MilliOHO) was added to 100 uL of each sample. Q11OV. Ll ilvD coSc, and L1 adhA, respectively) as Samples were incubated for 30 min at 70° C. in a thermo cycler (Eppendorf, Mastercycler). Analysis of keto-isovaler described. ate and isobutyraldehyde was performed on an HP-1200 High 0369 To start fermentation cultures, small overnight cul Performance Liquid Chromatography system equipped with tures of the transformed strains were started in YPD medium an Eclipse XDB C-18 reverse phase column (Agilent) and a containing 1% ethanol and 0.2 g/L G418 and incubated over C-18 reverse phase column guard (Phenomenex). Ketoisov night at 30° C. and 250 rpm. Three biological replicates of alerate and isobutyraldehyde were detected using an each strain were tested. The next morning, the ODoo of these HP-1100 UV detector (210 nm). The column temperature cultures was determined and an appropriate amount used to was 50°C. This method was isocratic with 70% acetonitrile to inoculate 50 mL of the same medium in a 50 mL baffled flask water as mobile phase with 2.5% dilute phosphoric acid (4%). to an ODoo of approximately 0.1. These precultures were Flow was set to 3 mL/min. Injection size was 10 uL and run incubated at 30° C. and 250 rpm overnight. When the cultures time is 2 min. had reached an ODoo of approximately 5-6 they were cen trifuged at 2700 rpm for 5 min at 25° C. in 50 mL Falcon Example 1 tubes. The cells from one 50 mL culture (one clone) were Increased Isobutanol/Isobutyrate Ratio by Increasing resuspended in YPD containing 8% glucose, 0.2 g/L G418, ADH Activity in S. cerevisiae 1% (v/v) ethanol (containing 3 g/L ergosterol and 132 g/L Tween-80), and buffered at pH 6.5 with 200 mM MES. The 0366. The purpose of this example is to demonstrate that cultures were then transferred into 250 mL unbaffled flasks increased alcohol dehydrogenase activity results in an and incubated at 30° C. and 75 rpm. increased isobutanol yield, a decreased isobutyrate yield, and 0370. At the 72 h timepoint, samples from each fermenta an increase in the ratio of isobutanol yield to isobutyrate yield. tion flask were taken for determining ODoo, ADH activity, 0367 Strains and plasmids disclosed in this example are and for analysis by GC1 and LC1. To prepare samples for shown in Tables 7 and 8, respectively. GC1 and LC1 analysis, an appropriate volume of cell culture was spun in a microcentrifuge for 10 minutes at maximum TABLE 7 speed and the supernatant was removed for GC1 and LC1 analysis. Cell pellets were prepared for ADH assays by cen Genotype of Strains Disclosed in Example 1. trifuging 14 mL of culture medium at 3000xg for 5 minutes at GEVO Number Genotype 4°C. The supernatant was removed and the cells washed in 3 mL cold, sterile water. The tubes were then centrifuged as per GEVO2843 S. cerevisiae, MATaura3 leu2 his3 trp1 pdc1A::PCP1:BS alsS1 coSc:Tcyc1: PPok1: above for 2 minutes, the Supernatant removed, and the tubes Ll kiv D2: Pro2: Sp HIS5 reweighed to determine total cell weight. The Falcon tubes were stored at -80° C. ADH assays were performed as described. US 2011/020 1 090 A1 Aug. 18, 2011 42

0371 Table 9 shows the ODoo for each strain during the course of the fermentation. During the 72 h of this fermenta TABLE 11 tion, the ODoo of the strains were similar: they started at an ODoo of around 7 and ended at an ODoo of around 9. The in Genotype of Strains Disclosed in Example 2. vitro ADH enzymatic activity of lysates from GEVO2843 GEVO transformed with the two plasmids was measured for the 72h Number Genotype timepoint. Table 9 shows the ADH activity in the lysates as GEVO2843 S. cerevisiae, MATaura3 leu2 his3 trp1 measured in vitro. The strain carrying the plasmid with no pdc1A::PCP:BS alss1 coSc:Toyo: Peak: Ll kiv 2: ADH (pGV2011) showed an activity of about 0.04U/mg. The Pyo: Sp HIS5 strain carrying the plasmid with the L1 adhA gene, pdc5A::LEU2: bla: P: ILV3AN: Pos: (pGV2485), had approximately 7-fold more ADH activity. Ec ilvC coSc99. pdc6A::URA3:bla: P: Ll kiv D2: P: Dim ADH TABLE 9 {evolved for C2 Supplement-independence, glucose ODoo and Alcohol Dehydrogenase Activity of Strain GEVO2843 tolerance and faster growth Transformed with Plasmids pGV2011 or pGV2485 After 72 h of Fermentation. ADH activity TABLE 12 GEVO2843 transformed with OD6oo Umg Plasmids Disclosed in Example 2. pGV2011 8.5 O.04 Plasmid Name Relevant Genes/Usage Genotype pGV2485 9.1 O.29 pGV2543 21 plasmid expressing P:Ec ilvC coSco11or. KARI, DHAD, KIVD, P:Ll ilvD coSc, and ADH PPok1:Ll kiv D coEc, 0372 Isobutanol and isobutyrate titers after 72 h offer (Ll AdhAis) PEvo: Ll Adha', mentation are shown in Table 10. The isobutanol titer in the 2 ori, bla, G418R pGV2545 21 plasmid expressing Ports:Ec ilvC coSC''', strain with low ADH activity of 0.04U/mg was significantly KARI, DHAD, KIVD, P:Ll ilvD coSc, lower compared to the strain with high ADH activity of 0.29 and ADH Peck:Ll kiv) coEc, U/mg. The isobutyrate titer in the strain with low ADH activ (Ll AdhAREl-his6) P: Ll AdhA.'', ity of 0.04 U/mg was significantly higher compared to the 2 ori, bla, G418R strain with high ADH activity of 0.29 U/mg. Table 6 also shows the yield for isobutyrate and isobutanol after 72 h of 0374. S. cerevisiae strain GEVO2843, which expresses a fermentation. The isobutanol yield in the strain with low ADH single alcohol dehydrogenase (D. melanogaster ADH, activity of 0.04U/mg was significantly lower compared to the Dm ADH) from its chromosomal DNA was transformed strain with high ADH activity of 0.29 U/mg. The isobutyrate with 2L plasmids pGV2543 carrying KARI, DHAD, KIVD yield in the strain with low ADH activity of 0.04 U/mg was and his-tagged, codon-optimized wild-type ADH (Ec significantly higher compared to the strain with high ADH ilvC''', Ll ilvD coSc, and L1 adhA coSc', respec activity of 0.29 U/mg. tively) or pGV2545 carrying KARI, DHAD, KIVD and his

TABLE 10

Titers and Yields for Isobutanol and Isobutyrate in Strain GEVO2843 Transformed with Plasmids pGV2011 or pGV2485 After 72 h of Fermentation.

Isobutanol Isobutyrate titer titer isobutanol yield Isobutryate yield Yield ratio g/L) g/L) mol/mol glucose mol/mol glucose (isobutanol isobutyrate) pGV2011 3.2 3.8 O.22 O.22 1.O pGV2485 4.7 1.9 O.33 O.11 3.0

Example 2 tagged, codon-optimized mutant ADH (Ec ilvC''', Further Increased Isobutanol/Isobutyrate Ratio by Ll ilvD coSc, and L1 adhA''' coSc', respectively). Use of Variant ADH Ll AdhA''' in S. cerevisiae These strains were cultured and evaluated for ADH enzyme 0373 The purpose of this example is to demonstrate that activity and the production of extracellular metabolites by expression of an alcohol dehydrogenase with increased k, GC1 and LC1 as described. and decreased K results in a further increase in isobutanol 0375. The kinetic parameters of the gene products of yield, decrease in isobutyrate yield, and increase in the ratio L1 adhA coSc' L1 adhA' coSc" (L1 adh A" and of isobutanol yield to isobutyrate yield. L1 adhA'''', respectively) are shown in Table 13. US 2011/020 1 090 A1 Aug. 18, 2011 43

ity of about 0.38 U/mg. The strain carrying the plasmid with TABLE 13 the L1 adhA''' coSc' gene, (pCV2545), had approxi mately 7-fold more ADH activity. Comparison of Kinetic Parameters of Wild-Type Ll adhA" with Modified Ll adhA. Measured for Isobutyraldehyde with NADH as Cofactor. TABLE 1.4 KM kcar kcal/KM ODoo, and Alcohol Dehydrogenase Activity of Strain GEVO2843 Variant mM isobutyraldehyde s M-1 *s- Transformed with Plasmids pCV2543 or pGV2545. After 72 h of Fermentation. Ll adhA.is 11.7 51 4400 Ll adhAREl-hise 1.6 84 497OO ADH activity GEVO2843 transformed with OD6oo Umg 0376 Table 14 shows the ODoo for each strain during the E. 2. course of the fermentation. During the 72 h of this fermenta- p tion, the ODoo of the strains were similar: they started at an ODoo of around 6 and ended at an ODoo of around 9. The in 0377 Isobutanol and isobutyrate titers and yield after 72h vitro ADH enzymatic activity of lysates from GEVO2843 of fermentation are shown in Table 15. The isobutanol titer transformed with the two plasmids was measured for the 72h and yield in the strain carrying pGV2543 was lower com timepoint. Table 14 shows the ADH activity in the lysates as pared to the strain carrying pGV2545. The isobutyrate titer measured in vitro as described above. The strain carrying the and yield in the strain carrying pGV2543 was significantly plasmid with L1 adhA coSc' (pGV2543) showedan activ higher compared to the strain carrying pCV2545.

TABLE 1.5 Titers and Yields for Isobutanol and Isobutyrate in Strain GEVO2843 Transformed with Plasmids pGV2453 or pGV2485 After 72 h of Fermentation.

GEVO2843 transformed Isobutanol Isobutyrate isobutanol yield Isobutryate yield Yield ratio with g/L) g/L) mol/mol glucose mol/mol glucose (Isobutanol isobutyrate) pGV2543 4.6 1.3 O.28 O.O6 4 pGV2545 4.9 O.3 O.29 O.O1 2O

Example 3 Further Increased Isobutanol/Isobutyrate Ratio in S. cerevisiae by Expression of RE1 0378. The purpose of this example is to demonstrate that expression of an alcohol dehydrogenase with increased k, and decreased K results in an increase in isobutanol yield and a decrease in isobutyrate yield in fermentations per formed in fermenter vessels. 0379 A fermentation was performed to compare perfor mance of S. cerevisiae Strains GEVO3519 and GEVO3523. Isobutanol and isobutyrate titers and yields were measured during the fermentation. GEVO3519 carries a 2L plasmid pGV2524 that contains genes encoding the following enzymes: KARI, DHAD, KIVD and his-tagged, codon-opti mized wild-type Lactococcus lactis ADH. GEVO3523 car ries a 2L plasmid pGV2524 that contains genes encoding the following enzymes: KARI, DHAD, KIVD and an improved variant of the his-tagged, codon-optimized Lactococcus lac tis ADH having decreased K and increased k. These strains were evaluated for isobutanol, isobutyraldehyde, glu cose consumption by LC1 and GC1, as well as for ODoo during a fermentation in DasGipfermenter vessels.

TABLE 16 Genotype of Strains Disclosed in Example 3. GEVO Number Genotype GEVO3128 S. cerevisiae, MATaura3 leu2 his3 trp1 US 2011/020 1 090 A1 Aug. 18, 2011 44

TABLE 16-continued Genotype of Strains Disclosed in Example 3. GEVO Number Genotype

pdc6A::Pter:Ll ilvD:Priors:Ec ilvC coSc''':Pevo2:Ll adhA:Pe:Sc TRP1 {evolved for C2 Supplement-independence, glucose tolerance and faster growth GEVO3519 GEVO3128 transformed with plasmid pCV2524 GEVO3523 GEVO3128 transformed with plasmid pCV2546

TABLE 17 TABLE 1.8 Plasmids Disclosed in Example 3. Isobutanol and Isobutyrate Titers and Yields. Plasmid Relevant Isobutanol Name Genes/Usage Genotype Isobutanol yield Isobutyrate Isobutyrate yield Strain titer g/L (96 theor. tilter g/L) % C-yield pGV2524 21 plasmid P:Ec ilvC coSc'P'', PTEF1:Ll ilvD coSc, GEVO3519 3.9 O.4 50.5 - 21 O.82 0.04 4.O.O.O PPok1:Ll kiv D2 coEc GEVO3523 S.O.O.3 59.5 21 O.40 OO1 2.O. O.O Peo2:Ll adhA coSc", 2 ori, bla, G418R pGV2546 21 plasmid P:Ec ilvC coSc'P'', PTEF1:Ll ilvD coSc, Example 4 Peck:Ll kiv D2 coEc Decreased Isobutyrate and Acetate Production in P:Ll adhA coSc'''. Fermentations with Deletion of ALD6 Gene in S. 2 ori, bla, G418R cerevisiae 0382. The following example illustrates that deletion of 0380 S. cerevisiae strain GEVO3128 was transformed the ALD6 gene leads to a decrease in isobutyrate and acetate with either 2 plasmid pGV2524 or pGV2546, to generate production in fermentations. 0383 Construction of ALD6 Deletion Strains: PCR was strains GEVO3519 and GEVO3523, respectively as used to generate a DNA fragment that contained a deletion described. Inoculum cultures of GEVO3519 and GEVO3523 allele of ALD6 for deletion of ALD6 from S. cerevisiae. One were started by inoculating 500 mL baffled flasks containing PCR reaction amplified a DNA fragment (A) comprising the 80 mL of YPD medium 0.2 g/L G418 antibiotic, 1% v/v upstream flanking region of ALD6 and a region of overlap at ethanol, and 0.019 g/L tryptophan. The cultures were incu the 3' end of the DNA fragment with the 5' end of the Ps bated for approximately 34 h. The orbital shaker was set at cc promoter region from pCV1954, using primers oGV2834 and oGV2835. Another PCR reaction amplified a 250 rpm and 30°C. in both experiments. Similar cell mass DNA fragment (D) comprising the downstream flanking was achieved for GEVO3519 and GEVO3523 Strains. The region of ALD6 and a region of overlap at the 5' end of the cell density achieved after incubation was 8.0 ODoo. Batch DNA fragment with the 3' end of the hph hygromycin resis fermentations were conducted inYPD medium containing 80 tance ORF from pGV2074, using primers oGV2836 and g/L glucose, 0.2 g/L G418, 1% V/v ethanol, and 0.019 g/L oGV2837. Another PCR reaction amplified a DNA fragment tryptophan using 2 L top drive motor DasGip Vessels with a (B) comprising the Ps. promoter region from pGV1954 with a region of overlap at the 5' end of the DNA working volume of 0.9 L per vessel. Vessels were sterilized, fragment with the 3' end of the upstream flanking region of along with the appropriate dissolved oxygen and pH probes, ALD6 (fragment A) and a region at the 3' end of the DNA for 60 minutes at 121° C. Dissolved oxygen probes were fragment with the 5' end of the hph hygromycin resistance calibrated post sterilization in order to allow for polarization, ORF from pGV2074, using primers oGV2631 and oGV2632. however, pH probes were calibrated prior to sterilization. The Another PCR reaction amplified a DNA fragment (C) com pH was controlled at pH 6.0 using 6N KOH and 2N HSO. prising the hph hygromycin resistance ORF from pGV2074 During the growth phase of the culture the oxygen transfer with a region of overlap at the 5' end of the DNA fragment rate (OTR) was 10 mM/h and during the production phase of with the 3' end of the Ps, a promoter region from the culture the OTR was 0.2 mM/h. pGV 1954 (fragment B) and a region of overlap at the 3' end of the DNA fragment with the 5' end of the downstream flanking 0381 Table 18 shows the isobutanol titer and yield (as % region of ALD6 (fragment D), using primers oGV2633 and theoretical) as calculated for the production phase of the oGV2634. DNA fragments A and B were combined by PCR culture. Both isobutanol titer and yield are increased in strain using primers oGV2834 and oGV2632 to generate DNA frag GEVO3523 carrying the alcohol dehydrogenase with ment AB and DNA fragments C and D were combined by decreased K and increased k. Table 18 also shows the PCR using primers oGV2633 and oGV2837 to generate DNA isobutyrate titer, reported as maximum titer reached, and fragment CD. DNA fragments AB and CD were combined by yield as carbon yield in 96. Both isobutyrate titer and yield are PCR using primers oGV2834 and oGV2837 to generate the decreased in strain GEVO3523 carrying the alcoholdehydro final DNA fragment ABCD that contained the deletion allele genase with decreased K and increased k. of ALD6.

US 2011/020 1 090 A1 Aug. 18, 2011 46

TABLE 1.9- continued Primer Sequences Disclosed in Example 4. dGW No. Sequence oGW2.831 TGCGGCTAACCCATATTGAG (SEO ID NO: 98) oGW2832 TACGCTGAGCGTAGTACAAC (SEO ID NO: 99) dGW2833 TAAAGCGCTGGGTGGACAACCG (SEQ ID NO: 1.OO) oGW2.834 GCACCGAGACGTCATTGTTG (SEQ ID NO: 101) oGW2835 CTTCATTACGGCATAACGTATTGTAAACACGCCAGGCTTGACC (SEQ ID NO: 102) oGW2836 CGTCCGAGGGCAAAGGAATAATCCATTCGGTGGTGTTAAGC (SEQ ID NO: 103) oGW2837 ATGGCGAAATGGCAGTACTC (SEQ ID NO: 104) dGW2838 ACCAACGACCCAAGAATC (SEQ ID NO: 105) oGW2839 CTTTGCGACAGTGACAAC (SEQ ID NO: 106) oGW2.84 O CCTCACGTAAGGGCATGATAG (SEO ID NO : 107) oGW2841 GCATTGCAGCGGTATTGTCAGG (SEQ ID NO: 108) oGW2842 CAGCAGCCACATAGTATACC (SEQ ID NO: 109) oGV2843. CTTCATTACGGCATAACGTATTGAGCCGTCGTTTGACATGTTG (SEQ ID NO: 110) dGW2844 CGTCCGAGGGCAAAGGAATAACGCTCCATTTGGAGGGATCG (SEQ ID NO: 111) oGW2845 GAATGCGCTTGCTGCTAGGG (SEQ ID NO: 112) oGW2846. CAGCTCTTGCTGCAGGTAACAC (SEQ ID NO: 113) oGW2847 GGCACAATCTTGGAGCCGTTAG (SEQ ID NO: 114) oGW2848 ACCAAGCCATCAAGGTTGTC (SEQ ID NO: 115) oGW2849 TGGGTGATGGTTTGGCGAATGC (SEQ ID NO: 116) dGW2896 GAAATGATGACATGTGGAAATATAACAG (SEO ID NO : 117)

0384 Strains to demonstrate decreased isobutyrate and transformation of GEVO3198 with plasmid pGV2247. acetate production by deletion of ALD6 were constructed by Transformants were selected for resistance to 0.2 g/L G418 transformation of GEVO3198with the ABCD DNA fragment and purified by re-streaking onto media containing 0.2 g/L that contained the deletion allele of ALD6. Transformants G418. were selected for resistance to 0.1 g/L hygromycin and trans 0386 Construction of ald2A, ald3A, ald4A, ald5A and formant colonies were screened by colony PCR for the cor hfd1 A Deletion Strains: PCR was used to generate separate rect integration of the ABCD DNA fragment using primer DNA fragments that contained individual deletion alleles of pairs oGV284.0/oGV2680, oGV968/oGV2841, and ALD2, ALD3, ALD4, ALD5 and HFD1 for deletion of oGV283.8/oGV2839. Strains GEVO3711, GEVO3712 and ALD2, ALD3, ALD4, ALD5 and HFD1 individually from S. GEVO3713 were identified by this colony PCR as having cerevisiae in separate strains. Additionally, PCR was used to ALD6 deleted by correct integration of the ABCD DNA generate a DNA fragment that contained a deletion allele fragment. covering both ALD2 and ALD3, which are adjacent genes in 0385 Strains containing an isobutanol production path the S. cerevisiae genome, for deletion of ALD2 and ALD3 way to demonstrate decreased isobutyrate and acetate pro together (ald2A ald3A) from S. cerevisiae in an individual duction by deletion of ALD6 were constructed by transfor strain. Four-component fragments containing the upstream mation of GEVO3711, GEVO3712 and GEVO3713 with a 2. flanking region, the Ps. 12 promoter region from origin of replication plasmid, pGV2247, carrying genes pGV 1954, the hph hygromycin resistance ORF from expressing KARI, DHAD, KIVD and ADH (Ec ilvC pGV2074 and the downstream flanking region for each indi coSc''''', Ll ilvD coSc, Ll kivD2 coEc, and L1 adhA, vidual gene were generated by PCR as for the generation of respectively). Transformants were selected for resistance to the ABCD fragment for deletion of ALD6 except using the 0.2 g/L G418 and 0.1 g/L hygromycin and purified by re primer pairs listed in Table 20. The four-component fragment streaking onto media containing 0.1 g/L hygromycin and 0.2 for deletion of ALD2 and ALD3 together contained the g/L G418, generating strains GEVO3714, GEVO3715 and upstream flanking region from ALD2 and the downstream GEVO3716. An ALD6 control strain containing an isobu flanking region from ALD3 and was similarly constructed by tanol production pathway, GEVO3466, was generated by PCR using the primer pairs listed in Table 20. The Ps. US 2011/020 1 090 A1 Aug. 18, 2011 47 promoter region from pCV 1954 was always amplified with this colony PCR as having ALD5 correctly deleted; and primer pair oGV2631/oGV2632 and the hph hygromycin strains GEVO3720, GEVO3721 and GEVO3722 were iden resistance ORF from pCV2074 was always amplified with tified by this colony PCR as having HFD1 correctly deleted. primer pair oGV2633/oGV2634. 0388 Strains containing an isobutanol production path way and with deletion of ALD2, ALD3 and ALD5 individu TABL E ally or with deletion of ALD2 and ALD3 together were con Primers Used to Amplify Upstream and Downstream structed by transformation of strains GEVO3567, Regions for Gene Deletions. GEVO3568, GEVO3569, GEVO3705, GEVO3706 and GEVO3707 with plasmid pGV2247. Transformants were Primer Pairs for Primer Pairs for selected for resistance to 0.2 g/L G418 and 0.1 g/L hygromy Gene Deletion Upstream Region Downstream Region cin and purified by re-streaking onto media containing 0.1 g/L ald2A oGV2796/ocgv2797, oGV28OO/oGV28O1 hygromycin and 0.2 g/L G418, generating strains oGV2796/ocgv2798 GEVO3586, GEVO3587, GEVO3588, GEVO3590, ald3A oGV2806/og V28O8 oGV281 OAoGV2811 GEVO3591, GEVO3592, GEVO3593, GEVO3594, GEVO3595, GEVO3708, GEVO3709 and GEVO3710. ald2A ald3A oGV2796/ocgv2798 oGV281 O/oGV2811 Strains GEVO3579, GEVO3720, GEVO3721 and GEVO3722 were generated from GEVO3466 and therefore ald4A oGV281.6/og V2.818 oGV282O/oGV2821 contained plasmid pGV2247. ald5A oGV2826/og V2827 oGV2828/oGV2829 TABL E 21 ald6A oGV2834/oGV2835 oGV283 6/ogW2837 Primers Used to Screen Colonies for Werification hifc1A oGV2842/oGV2843 oGV284.4/oGV2845 of Gene Deletions. (0387 Strains with deletion of ALD2, ALD3, ALD4, Gene Deletion Primer Pairs ALD5 and HFD1 individually and with deletion of ALD2 and ALD3 together were constructed by transformation of GEVO3198 or GEVO3466 with the individual four-compo ald3A oGV281.2/oGV2632, oGV968/oGV2813, nent DNA fragment that contained the individual deletion oGV281.4/oGV2815 allele of ALD2, ALD3, ALD4, ALD5 or HFD1 or with the four-component DNA fragment that contained the deletion ald2A ald3A oGV28O2/oGV2632, oGV968/oGV2813, allele of ALD2 and ALD3 together. Transformants were oGV2804AoGV28 O5, oGV281.4/oGV2815 selected for resistance to 0.1 g/L hygromycin and transfor ald4A oGV2 822/oGV2632, oGV968/oGV2896, mant colonies were screened by colony PCR for the correct oGV2824/oGV2825 integration of the four-component DNA fragment using the primer pairs listed in Table 21. Strain GEVO3567 was iden ald5A oGV2832/oGV268O. oGV1.965/ocgv2833, tified by this colony PCR as having ALD2 correctly deleted; oGV283 OAoGV2831 strain GEVO3568 was identified by this colony PCR as hav ald6A oGV284 OAoGV268O. oGV968/oGV2841, ing ALD3 correctly deleted; strain GEVO3569 was identified oGV283.8/oGV2839 by this colony PCR as having ALD2 and ALD3 together hifc1A oGV2848/oGV268O. oGV968/oGV2849, correctly deleted; strain GEVO3579 was identified by this oGV2846/ogW2847 colony PCR as having ALD4 correctly deleted; strains GEVO3705, GEVO3706 and GEVO3707 were identified by

TABLE 22 Genotype of Strains Disclosed in Example 4. GEVO No. Genotype GEVO31.98 MATaura3 leu2 his3 trp1 gpd1A:T K UR43. gpd2 A:T K UR43 shor:PFB.41:KI URA3:TK1 UR-43) pdc5A::LEU2:bla:Per:Sc ILV3AN:Pris-Ec ilvC coSce'' pdc6A::Pter:Ll ilvD coSc:Priors:Ec ilvC coSc''':Pexo:Ll adhA:Pe:Sc TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth GEVO3466 MATaura3 leu2 his3 trp1 gpd1A:T K UR43. gpd2 A:T K UR43 shor:PFB.41:KI URA3:TK1 UR-43) pdc5A::LEU2:bla:Per:Sc ILV3AN:Pris-Ec ilvC coSce'' pdc6A::Pter:Ll ilvD coSc:Priors:Ec ilvC coSc''':Pexo:Ll adhA:Pe:Sc TRP1 {evolved for C2 supplement-independence, glucose tolerance and faster growth: transformed with pCV2247 GEVO3567 MATaura3 leu2 his3 tripl gpd1A::Te R43 gpd2 A:Te R43 Pre-1:Kll URA3:Te Ras pdc5A::LEU2:bla:Per:Sc ILV3AN:Pris-Ec ilvC coSce''

US 2011/020 1 090 A1 Aug. 18, 2011 49

TABLE 23 TABLE 24 Plasmids Disclosed in Example 4. Shake Flask Fermentation Results Demonstrating Decreased Isobutyrate Plasmid Name Genotype and Acetate Production by Deletion of ALD6 pGV2247 Pter:Ll ilvD coSc PItts:EC ilvC coSc''' Peck:Ll kiv D2 coEc PENo2: Isobutanol Isobutanol Isobutyrate Acetate Ll adhA 2-ori, plJC-ori, bla, G418.R. Titer Yield Produced Produced Strain g/L) % theoretical g/L g/L) 0389 Shake Flask Fermentations: Fermentations were performed to compare the performance of GEVO3466 to GEVO3466 2.60.1 44 + 2 O48 OO6 O.59 O.04 strains containing the ald2A, ald3A, ald2A ald3A, ald4A, (ALD6) ald5A, hfd1A and ald6A deletion mutations. Yeast strains GEVO3714, 3.20.2 42 - 2 O.14 OO6 O.O8 OO1 were inoculated from cell patches or from purified single GEVO3715 colonies from YPD agar plates containing 0.2 g/L G418 into 3 mL of YPD containing 0.2 g/L G418 and 1% V/v ethanol and medium in 14 mL round-bottom Snap-cap tubes. The cultures GEVO3716 were incubated overnight up to 24h shaking at an angle at 250 (ald6A) rpm at 30° C. Separately for each strain, these overnight cultures were used to inoculate 50 mL of YPD containing 0.2 0391 The 72 h shake flask fermentation results for g/L G418 and 1% V/v ethanol medium in a 250 mL baffled GEVO3466 and the ald2A, ald3A, ald2A, ald3A, ald4A, ald5A flask with a sleeve closure to an ODoo of 0.1. These flask and hfd1A strains are summarized in Table 25 and Table 26. cultures were incubated overnight up to 24h shaking at 250 Strains with deletions in ALD3, ALD2 and ALD3 together or rpm at 30° C. The cells from these flask cultures were har ALD4 had no decrease in isobutyrate production compared vested separately for each strain by centrifugation at 3000xg with the wild-type ALDH strain GEVO3466. Strains with for 5 minutes and each cell pellet resuspended separately in 5 deletions in ALD2, ALD5 or HFD1 had no appreciable mL of YPD containing 80 g/L glucose, 1% V/v stock solution decrease in isobutyrate production compared with the wild of 3 g/L ergosterol and 132 g/L Tween 80 dissolved in etha type ALDH strain GEVO3466. Strains with deletions of both nol, 200 mMMES buffer, pH 6.5, and 0.2 g/L G418 medium. ALD2 and ALD3 together produced 19% less acetate than the Each cell suspension was used to inoculate 50 mL of YPD wild-type ALDH strain GEVO3466 but strains with indi containing 80 g/L glucose, 1% V/v Stock solution of 3 g/L vidual deletions of ALD2, ALD3, ALD4, ALD5 or HFD1 had ergosterol and 132 g/L Tween 80 dissolved in ethanol, 200 no appreciable decrease in acetate production compared with mMMES buffer, pH 6.5, and 0.2 g/L G418 medium in a 250 mL non-baffled flask with a vented Screw-cap to an ODoo of the wild-type ALD strain GEVO3466. approximately 5. These fermentations were incubated shak TABLE 25 ing at 250 rpm at 30° C. Periodically, samples from each Shake Flask Fermentation Results Demonstrating No Decrease in shake flask fermentation were removed to measure ODoo Isobutyrate and Acetate production by Deletion of ALD2, ALD3, ALD4 and to prepare for gas chromatography (GC1) analysis, for or ALD2 and ALD3 Together. isobutanol and other metabolites, and for high performance Isobutanol Isobutanol Isobutyrate Acetate liquid chromatography (LC1) analysis for organic acids and Titer Yield Produced Produced glucose. Samples of 2 mL were removed into a microcentri Strain g/L) % theoretical g/L g/L) fuge tube and centrifuged in a microcentrifuge for 10 min at GEVO3466 5.1 - 0.1 42 - 2 124 O15 O.95 O.O7 maximum rpm. One mL of the Supernatant was analysis of (wild-type) extracellular metabolites by GC1 and LC1 as described. GEVO3590, 5.2 0.2 45 - 2 1.21 OO6 O.85 O.O7 GEVO3591 0390 Deletion of ALD6 decreased isobutyrate and acetate and production in shake flask fermentations: The 52 h shake flask GEVO3592 fermentation results for GEVO3466 and the ald6A strains (ald2A) GEVO3714, GEVO3715 and GEVO3716 are summarized in GEVO3593, 5.5 - 0.6 45 --- 6 1.34 - 0.16 O.91 O.O7 GEVO3594 Table 24. The ald6A strains GEVO3714, GEVO3715 and and GEVO3716 produced 71% less isobutyrate than the ALD6 GEVO3595 strain GEVO3466. The ald6A strains GEVO3714, (ald3A) GEVO3596, 6.8 O.1 51 --- 1 GEVO3715 and GEVO3716 also produced 86% less acetate GEVO3597 than the ALD6 strain GEVO3466. Isobutanol yield in the and ald6A strains GEVO3714, GEVO3715 and GEVO3716 was GEVO3598 not appreciably different than the ALD6 strain GEVO3466. (ald2A ald3A) GEVO3579 5.6 0.7 46 -- 6 1.34 - 0.13 O.89. O.15 Isobutanol titer in the ald6A strains GEVO3714, GEVO3715 (aldAA) and GEVO3716 was 23% higher than the ALD6 strain GEVO3466. US 2011/020 1 090 A1 Aug. 18, 2011 50

TABLE 26 TABLE 27 Shake Flask Fermentation Results Demonstrating No Decrease in Benchtop Fermenter Fermentation Results Demonstrating Decreased Isobutyrate and Acetate Production by Deletion of ALDS or HFDl. Isobutyrate and Acetate Production and Increased Isobutanol Yield by Deletion of ALD6. Isobutanol Isobutyrate Acetate Titer Isobutanol Yield Produced Produced Isobutanol Isobutyrate Acetate Strain g/L) % theoretical g/L) g/L) Titer Isobutanol Yield Produced Produced Strain g/L) % theoretical g/L g/L) GEVO3466 4.0 + 0.4 447 O47 (0.04 O.75 O.05 (wild-type) GEVO3466 8.20.1 32 - 1 2.10.1 2.303 GEVO3708, 3.8 + 0.8 46 - 15 O41 - 0.04 O.64 O.08 (ALD6) GEVO3709 GEVO3714 11.10.1 40 - O 1.3 O.1 O.90.1 and and GEVO3710 GEVO3715 (ald5A) (ald6A) GEVO3720, 4.4 + 1.0 54 - 14 O4O O.O7 O.S60.18 GEVO3721 and GEVO3722 Example 5 (hfd1A) Determination of ALD6 Activity in S. cerevisiae 0392. Fermentations in benchtop fermenters: Fermenta 0394 The following example illustrates that the isobu tions in benchtop fermenters were performed to compare the tyraldehyde oxidation activity is significantly decreased in an performance of GEVO3466 (ALD6) to GEVO3714 and ald6A strain. GEVO3715 (ald6A). Glucose consumption, isobutanol pro duction, isobutyrate production, and ODoo were measured TABLE 28 during the fermentation. For these fermentations, purified strains from streak plates were transferred to 500 mL baffled Genotype of Strains Disclosed in Example 5. flasks containing 80 mL of YPD medium containing 1% V/v GEVO fi Genotype Source ethanol, 100 uM CuSO4.5H20 and 0.2 g/L G418 and incu GEVO3527 MATC his3A-1 leu2A ATCC# 201389 (BY4742) bated for 32 hat 30° C. in an orbital shaker at 250 rpm. The lys2A ura3A flask cultures were transferred to individual 2 L top drive GEVO3940 MATC. his3A-1 OpenBiosystems cath YSC1054 motor fermenter vessels with a working volume of 0.9 L of leu2Alys2A ura3A (Yeast MATalpha collection) YPD medium containing 80 g/L glucose, 1% v/v ethanol, 100 ald6A:kan uM CuSO4.5H20 and 0.2 g/L G418 per vessel for a starting ODoo of 0.5. Fermenters were operated at 30° C. and pH 6.0 0395 Yeast strains GEVO3940 from which the ALD6 controlled with 6N KOH and 2N HSO in a 2-phase aerobic (YPL061W) gene was deleted and its parent GEVO3527 condition based on oxygen transfer rate (OTR). Initially, fer were each cultured in triplicate by inoculating 3 mL of YPD menters were operated at a growth phase OTR of 10 mM/h by medium in a 14 mL culture tube in triplicate for each strain. fixed agitation of 700 rpm and an air overlay of 5 sL/h. Cultures were started from patches on YPD agar plate for Cultures were grown for 24 h to approximately 9-10 ODoo GEVO3527 and onYPD agar plates containing 0.2 g/L G418 then immediately switched to a production aeration OTR=2.0 plates for GEVO3940. The cultures were incubated overnight mM/h by reducing agitation from 700 rpm to 450 rpm for the at 30° C. and 250 rpm. The next day, the ODoo of the over period of 24 h to 86.5 h. Periodically, samples from each night cultures were measured and the Volume of each culture fermenter were removed to measure ODoo and to prepare for to inoculate a 50 mL culture to an ODoo of 0.1 was calcu gas chromatography (GC1) analysis, for isobutanol and other lated. The calculated volume of each culture was used to metabolites, and for high performance liquid chromatogra inoculate 50 mL of YPD in a 250 mL baffled flask and the cultures were incubated at 30°C. and 250 rpm. The cells were phy (LC1) analysis for organic acids and glucose. Samples of harvested during mid-log phase at ODs of 1.6-2.1 after 7 h of 2 mL were removed into a microcentrifuge tube and centri growth. The cultures were transferred to pre-weighed 50 mL fuged in a microcentrifuge for 10 min at maximum rpm. One Falcon tubes and cells were collected by centrifugation for 5 mL of the supernatant was submitted for GC1 and LC1 analy minutes at 3000xg. After removal of the medium, cells were sis as described. washed with 10 mL MilliOH-0. After removal of the water, 0393 Deletion of ALD6 decreased isobutyrate and acetate the cells were centrifuged again at 3000xg for 5 minutes and production and increased isobutanol yield in benchtop fer the remaining water was carefully removed using a 1 mL menter fermentations: The 86.5 h benchtop fermenter fer pipette tip. The cell pellets were weighed and then stored at mentation results are summarized in Table 27. The ald6A -80° C. until they were lysed and assayed for isobutyralde strains GEVO3714 and GEVO3715 produced 38% less hyde oxidation activity as described. isobutyrate than the ALD6 strain GEVO3466. The ald6A 0396. As shown in Table 29, the specific activity of S. strains GEVO3714 and GEVO3715 also produced 61% less cerevisiae ALD6 in GEVO3527 lysates for the oxidation of acetate than the ALD6 strain GEVO3466. Isobutanol yield in 10 mM isobutyraldehyde was 13.9 mu/mg. The same strain the ald6A Strains GEVO3714 and GEVO3715 was 25% with an ALD6 deletion had a specific activity of 0.6 mU/mg higher than the ALD6 strain GEVO3466. Isobutanol titer in which is 22-fold less. The specific activity of S. cerevisiae the ald6A Strains GEVO3714 and GEVO3715 was also 35% ALD6 in GEVO3527 lysates for the oxidation of 1.0 mM higher than the ALD6 strain GEVO3466. isobutyraldehyde was 17.6 mU/mg. The same strain with an US 2011/020 1 090 A1 Aug. 18, 2011 5 1.

ALD6 deletion had a specific activity of 2.1 mU/mg which is improved kinetic properties leads to a further decrease in 8-fold less. The specific activity of S. cerevisiae ALD6 in isobutyrate production and to a further increase in isobutanol GEVO3527 lysates for the oxidation of 0.1 mM isobutyral production. dehyde was 6.7 mU/mg. The same strain with an ALD6 deletion had a specific activity of 1.3 mU/mg which is 5-fold 0398 Isobutyrate is a byproduct of isobutyraldehyde less. These data demonstrate that the endogenous ALD6 metabolism in yeast and can comprise a significant fraction of enzyme is responsible for the isobutyrate byproduct of the the carbon yield. The following yeast strains were con isobutanol pathway in S. cerevisiae structed: GEVO3466 was constructed by transforming strain GEVO3 198 with a 2L plasmid, pGV2247, carrying genes TABLE 29 encoding the following enzymes: KARI, DHAD, KIVD and Specific Isobutyraldehyde Oxidation Activities of Strains GEVO3527 wild-type ADH (Ec ilvC coSc''''', Ll ilvD coSc, and GEVO3940 Using Various Isobutyraldehyde Concentrations. Specific Activities were Measured in Lysates From 3 Parallel Ll kiv D2 coEc, and L1 adhA, respectively). GEVO3 198 Cultures of GEVO3527 and GEVO3940. Shown are the Averages expresses a single copy of alcohol dehydrogenase (L. lactis and Standard Deviations of the Activities Measured in the Biological ADH, L1 adhA) from its chromosomal DNA. The second Replicate Cultures. strain, of which biological replicates are termed GEVO3714 Activity mC/mg total protein measured and GEVO3715, was constructed by transforming two inde with isobutyraldehyde pendent strains, GEVO3711 and GEVO3712, with a 2 plas O.1 mM 1.0 mM 10 mM mid pGV2247 carrying genes encoding the following Strain Isobutyraldehyde Isobutyraldehyde Isobutyraldehyde enzymes: KARI, DHAD, KIVD and wild-type ADH (Ec GEVO3527 6.7 0.4 17.6 1.2 13.9 O.4 ilvC coSc'''', Ll ilvD coSc, Ll kivD2 coEc, and GEVO3940 1.3 O2 2.1 - 0.2 O.6 0.1 L1 adhA, respectively). GEVO3711 and 3712 express a single alcohol dehydrogenase (L. lactis ADH, Ll adhA) and have the ALD6 gene deleted from the chromosomal DNA. A Example 6 third strain, of which biological replicates are termed Further Decreased Isobutyrate Production with Dele GEVO3855 and GEVO3856, was constructed by transform tion of ALD6 Gene and Overexpression of an ing a strain, GEVO3711, with 2L plasmid pGV2602 carrying Improved Alcohol Dehydrogenase in S. cerevisiae genes encoding the following enzymes: KARI, DHAD, 0397. The following example illustrates that the combina KIVD and a mutant ADH (Ec ilvC coSc'''''", Ll il tion of an ALD6 deletion and overexpression of an ADH with vD coSc, Ll kivD2 coEc, and L1 adhA''', respectively).

TABLE 30 Genotype of Strains Disclosed in Example 6. GEVO No. Genotype GEVO31.98 MATaura eu2 his3 trp1 TKE UR43 short:PFBA 1:KI URA3:Tkl UR-43) PCP1:BS alsS coSc:Toyo 1:PPok1:Ll kiv DkivD:PENo2:Sp HIS5 :bla:Per:ILV3AN:Ports:Ec ilvC coSce'' ilvD:Priors:Ec ilvC coSc''':Peop:Ll adhA:Pe:Sc TRP1 Supplement-independence, glucose tolerance and faster growth GEVO3466 his3 trp1 gpd1A:Tk UR-43 UR43 shor:PFBA 1:KI URA3:TK URA3) :BS alss coSc:T:Pe:Ll kiv DkivD:Pyo:Sp HIS5 :bla:Per:ILV3AN:Ports:Ec ilvC coSce'' ilvD:Priors:Ec ilvC coSc''':Peop:Ll adhA:Pe:Sc TRP1 ith pCV2247 evolved for C2 supplement-independence, glucose er growth GEVO3711, his3 trp1 gpd1A:Te R43 GEVO3712 UR43 short:PFBA 1:KI URA3:Tkl UR-43) :BS alss coSc:Tl :bla:P:ILV3AN:P13:Ec ilvC coSc ilvD:Priors:Ec ilvC coSc''':Pevo2:Ll adhA:Pe:Sc TRP1 : hph evolved for C2 supplement-independence, glucose tolerance h GEVO3714, his3 trp1 gpd1A:Tk UR-43 GEVO3715 UR43 sher, PFBA 1:Kl URA3:TK UR43)

::P:hph Transformed with pCV2247 evolved for C2 supplement independence, glucose tolerance an faster growth GEVO3855, MATaura GEVO3856 gpd2A:: pdc1A:: pdc5A:: LE US 2011/020 1 090 A1 Aug. 18, 2011 52

TABLE 30-continued Genotype of Strains Disclosed in Example 6. GEVO No. Genotype pdc6A::Pter:Ll ilvD:Ports:Ec ilvC coSc''':Pevo2:Ll adh A:Pe:Sc TRP1 ald6A::Pr: hph Transformed with pCV2602 evolved for C2 supplement independence, glucose tolerance and faster growth

2.5-3.0 mM/h was sustained by reducing agitation from 700 TABLE 31 rpm to 425 rpm while in the second experiment, an OTR of 2.0-2.5 mM/h was sustained by reducing agitation from 700 Plasmids Disclosed in Example 6. rpm to 400 rpm. Periodically, samples from each fermenter Plasmid were removed to measure ODoo and to prepare for gas chro Name Genotype matography (GC1) and liquid chromatography (LC1) analy pGV2247 Pter:Ll ilvD coSc, Priors:Ec ilvC coSc''', sis. For GC1 and LC1, 2 mL sample was removed into an PPok1:Ll kiv D2 coEc, Eppendorf tube and centrifuged in a microcentrifuge for 10 P2: Ll adhA. 21-ori, puC-ori, bla, G418.R. minat maximum. One mL of the Supernatant was analyzed by pGV2602 PTEF1:Ll ilvD coSc, GC1 (isobutanol, other metabolites) and one mL analyzed by Priors:Ec ilvC coSc'''. Peck:Ll kiv D2 coEc, high performance liquid chromatography (LC1) for organic Peo: Ll adhA. 2-ori, pUC-ori, bla, G418.R. acids and glucose. 0400. The 72.5 h data from two separate fermentation sets 0399. Two different sets offermentations were performed. A and B are summarized in Tables 32 and 33. Fermentation Fermentation set A was performed to compare the perfor set A compared GEVO3466 (WT ADH) to GEVO3714 and mance of GEVO3466 (L1 adhA) to GEVO3714-GEVO3715 3715 (WTADH, ald6A) while the fermentation set B com (L1-adha, ald6A). Fermentation set B was performed to com pared GEVO3714 (WT ADH, ald6A) to GEVO3855 and pare the performance of GEVO3714 (L1 adhA, ald6A) to 3856 (L1 adhA', ald6A) GEVO3855-GEVO3856 (L1 adhA', ald6A) respectively. 04.01 The data referring to fermentation set A (Table 32) Glucose consumption, isobutanol production, isobutyrate show that isobutanol titer and theoretical yield in the strain production, and ODoo were measured during the fermenta carrying Ll adhA with the ALD6 gene deletion was 1.4- and tion. For these fermentations, single isolate cell colonies 1.3-fold higher, respectively, compared to the strain carrying grown on YPD agar plates were transferred to 500 mL baffled L1 adhA without the ALD6 gene deletion. The strain carrying flasks containing 80 mL of YPD medium containing 1% V/v L1 adhA without ALD6 gene deletion (GEVO3466) had an Ethanol, 100 uM CuSO4.5H20, and 0.2 g/L G418 and incu isobutyrate yield (gram isobutyrate produced/gram glucose bated for 32 hat 30° C. in an orbital shaker at 250 rpm. The consumed) of 0.040 g/g while the strains carrying Ll adhA flask cultures were transferred to individual 2 L top drive with the ALD6 gene deletion (GEVO3714, GEVO3715) had motor fermenter vessels with a working volume of 0.9 L of a lower isobutyrate yield of 0.017 g/g. The strain carrying the YPD medium containing 80 g/L glucose, 1% v/v Ethanol, L. lactis adhA without the ALD6 gene deletion produced 2.3 100 uM CuSO4.5H20, and 0.2 g/L G418 per vessel for a g/L acetate while the strain carrying the L. lactis adhA with starting ODoo of 0.5. Fermenters were operated at 30°C. and the ALD6 gene deletion produced 0.6 g/L acetate.

TABLE 32

Data from Fermentation Set A. Isobutanol Isobutyrate Isobutanol Isobutyrate Acetate produced produced yield .9% yield produced Strain ODsoo g/L) g/L) theoretical gig g/L GEVO3466 9.7 O.1 7.4 O.6 17 O.O 48.12.6 O.0400.004 23 O.1 (WTADH) GEVO3714, 10.0 + 0.7 10.4 + 0.1 O.801 553 - 0.6 O.O17 O.OO3 O.6O1 GEVO3715 (WTADH, ALD6A) pH 6.0 controlled with 6N KOH in a 2-phase aerobic condi- 0402. The data referring to fermentation set B (Table 33) tion based on oxygen transfer rate (OTR). Initially, ferment show that isobutanol titer and theoretical yield in the strain ers were operated at a growth phase OTR of 10 mM/h by fixed carrying L. lactis adhA''' with the ALD6 gene deletion was agitation of 700 rpm and an air overlay of 5 sL/h in both 1.2 and 1.1-fold higher, respectively, compared to the strain experiments. Cultures were grown for 24 h to approximately carrying L. lactis adhA with the ALD6 gene deletion. The 9-10 ODoo then immediately switched to production aera strains carrying L. lactis adhA''' with the ALD6 gene dele tion conditions for 48.5 h. In the first experiment, an OTR of tion (GEVO3855, GEVO3856) had the lowest isobutyrate US 2011/020 1 090 A1 Aug. 18, 2011

yield (gram isobutyrate produced/gram glucose consumed), lent-1 100 UV detector (360 nm). The column temperature 0.005 g/g, and produced 0.0 g/L acetate compared to the was 50° C. This method was isocratic with 60% acetonitrile strain carrying L. lactis adhA with ALD6 gene deletion 2.5% phosphoric acid (0.4%), 37.5% water as mobile phase. (GEVO3714) which had a higher isobutyrate yield of 0.014 Flow was set to 2 mL/min. Injection size was 10 L and run g/g and a similar acetate titer of 0.0 g/L (Table 33). time is 10 min.

TABLE 33

Data from Fermentation Set B. Isobutanol Isobutyrate Isobutanol Isobutyrate Acetate produced produced yield (9% yield produced Strain OD6oo g/L g/L theoretical gig g/L) GEVO3714, 9.7 0.2 10.3 0.1 O.8 O.O 46.5 - 1.6 O.O14 O.OOO O.O.O.O (WTADH, ALD6A) GEVO3855, 9.90.3 12.O. O.O O3 + O.O 515 O.8 O.OOSOOOO O.O.O.O GEVO3856 (L1 adhAF, ALD6A)

Example 7 04.07 High Performance Liquid Chromatography LC4: Analysis of oxoacids was performed on a Agilent-1 100 High Identification of DH2MB as a By-Product of Isobu Performance Liquid Chromatography system equipped with tanol Fermentation an IonPac AS11-HC Analytical, IonPac AG 11-HC guard col umn (3-4 mm for IonPac ATC column, Dionex) or equivalent 0403. During fermentation of isobutanol-producing yeast and an IonPac ATC-1 Anion Trap column or equivalent. Oxo strains, it was found that an unknown peak, co-eluting with acids were detected using a conductivity detector (ED50 2,3-dihydroxyisovalerate (DHIV) on method LC1, and quan Suppressed conductivity, Suppressor type: ASRS 4 mm in titated on this basis, was acting as a sink for a substantial AutoSuppression recycle mode, Suppressor current: 300 portion of the carbon being utilized. mA). The column temperature was 35°C. This method used 0404 Initially, it was believed this peak was solely 2,3- the following elution profile: Hold at 0.25 mM for 3 min: dihydroxyisovalerate (DHIV), but subsequent studies indi linear gradient to 5 mM at 25 min; linear gradient to 38.5 mM cated that KARI product inhibition would have occurred at at 25.1 min, hold at 38.5 mM for 4.9 min; linear gradient to these levels of DHIV, making Such concentrations impos 0.25 mMat 30.1 min; hold for 7 minto equilibrate. Flow was sible. Additional experiments showed that this recovered set at 2 mL/min. Injection size is 5 uL and run time is 37.1 peak was not reactive with DHAD in enzyme assays, thus 1. eliminating the possibility that significant amounts of DHIV (0408 GC-MS: Varian 3800CPGC system equipped with were present. a single quad 320MS; DB-5ms column; 1079 injection port 04.05 High Performance Liquid Chromatography LC1: at 250° C.; constant flow 1.0 mL/min at 100 split ration; oven Analysis of organic acid metabolites was performed on an profile: initial temperature, 40°C., hold for 5 min, ramp of 20° Agilent- 1200 High Performance Liquid Chromatography C./min up to 235° C. and hold for 2 minutes; combiPAL system equipped with two Rezex RFQ-Fast Fruit H+ (8%) autosampler delivering 0.5 LL of sample; collected masses of 150x4.6 mm columns (Phenomenex) in series. Organic acid 35 to 100. BSTFA Derivation: (1) Evaporate sample to dry metabolites were detected using an Agilent-1 100 UV detector ness under nitrogen in a GC vial; (2) add 0.5 mL of Acetoni (210 nm) and refractive index (RI) detector. The column trile and 0.5 mL of BSTFA reagent; (3) Incubate at 50° C. for temperature was 60° C. This method was isocratic with 30 minutes; (4) Inject onto GC-MS. 0.0128 NHSO (25% 0.0512 NHSO in Milli-Q water) as (0409 LC-MS. For the LC-MS analysis of the LC1 peak mobile phase. Flow was set to 1.1 mL/min. Injection volume fraction the sample was injected into an Agilent 1100 Series was 20 uI and run time was 16 min. high-performance liquid chromatographic (HPLC) system 0406 High Performance Liquid Chromatography LC3: that was equipped with a multiple wavelength detector and an For samples containing a maximum of 10 mM aldehydes, LC/MSD Trap mass spectrometer (ion trap). The separations ketones and ketoacid intermediates (combined), DNPH were monitored by mass spectrometry to provide identifica reagent was added to each sample in a 1:1 ratio. 100 uL tion for the component in the sample. The mass spectrometer DNPH reagent (12 mM 2,4-Dinitrophenyl Hydrazine 20 mM was operated in the atmospheric pressure chemical ionization Citric Acid pH 3.0 80% Acetonitrile 20% MilliQ HO) was (APCI) mode for sample injection. The analyses were con added to 100 uL of each sample. Samples were incubated for ducted using the positive and negative APCI modes. Detec 30 min at 70° C. in a thermo-cycler (Eppendorf, Mastercy tion of the “unknown was only observed in the negative cler). Analysis of acetoin, diacetyl, ketoisovalerate and isobu ionization mode. The analysis was conducted using MSn to tyraldehyde was performed on an Agilent-1200 High Perfor obtain fragmentation data on the sample analyte. Separations mance Liquid Chromatography system equipped with an were achieved using a 4.6x150 mm Agilent Zorbax SB C-18 Eclipse XDB C-18 150x4 mm; 5 um particle size reverse column with 5 um particles. The sample was run using an phase column (Agilent) and a C-18 reverse phase guard col isocratic method which used an eluent of 90% HPLC water umn (Phenomenex). All analytes were detected using an Agi and 10% methanol. A 10 uL injection was used for the analy US 2011/020 1 090 A1 Aug. 18, 2011 54 sis of the sample solution. The sample was also analyzed 0421. As described herein, DH2MB is derived from (2S)- bypassing the chromatographic column. 2-hydroxy-2-methyl-3-oxobutyrate (acetolactate). The prod 0410 DHIV and its isomer, DH2MB, elute at the same uct of this reaction would be either (2S,3R)-2,3-Dihydroxy retention time on LC1. The peak related to these compounds 2-methylbutanoic acid, (2S,3S)-2,3-Dihydroxy-2- is separated from other compounds in the fermentation methylbutanoic acid or a mixture of the two diastereomers samples. The peak was collected from the HPLC and used for depending on the stereoselectivity of the endogenous enzyme further analysis. (s) catalyzing this conversion. 0411. The signal ratio of the RI detector signal to UV detector signal seen in LC1 for DHIV (and DH2MB) is char acteristic of common organic acids (e.g. lactate, acetate, etc.); Example 8 conjugated acids (e.g., pyruvate) have very different RI/UV signal ratios. The recovered “peak DHIV had the character Production and Purification of DH2MB istics of a non-conjugated acid: 0412. Ratio (RI/UV): Recovered DHIV/DH2MB peak 0422 The purpose of this example is to illustrate how (130); DHIV Std (150); Pyruvate (14). DH2MB was produced and purified. 0413. The lack of a carbonyl moiety in the “mystery peak” 0423. An engineered S. cerevisiae CEN.PK2 strain com was confirmed by the complete lack of reaction between the prising ALS activity (GEVO3160, S. cerevisiae CEN.PK2: recovered peak fraction from LC1 and DNPH: no adduct MATaura3 leu2 his3 trp 1 gpd1A::P2: Hph gpd2A:T peaks were evident in the LC3 chromatographic system. trus hor?: Pro41: Kl URA3: Tx R-43 pdc1A::PCUp: 0414. The recovered peak fraction from LC1 was then Bs alsS coSc: Toyo: Peck: Ll kiv D: Pevo2 s, HIS5 analyzed by method LC4, which runs under alkaline condi pdc5A::LEU2: bla: Pr: ILV3AN: Ps: ilvC coSc tions, and is capable of separating DHIV and acetolactate. Q110V pac6A::P: Ll ilvD P: Ec ilvC coSc That result is shown in FIG. 9, together with an overlay of P2D1-A1: Ply: Ll adhA: P: Sc TRP1 evolved for standard mixtures. This clearly shows the separation between C2 Supplement-independence, glucose tolerance and faster DH2MB (as it was subsequently identified), and DHIV. Some growth expressing plasmid pGV2247 (2-micron, G418 pyruvate was also brought along in the collection of the DH2MB peak. resistant plasmid for the expression of Ec ilvC P2D1-A1, 0415 NMR Analysis: The sample peak recovered from Ll ilvD, Ll kiv)2, and L1 adhA) was used to produce method LC1 was neutralized and lyophilized and sent for approximately 10 g/L DH2MB in a batch fermentation using NMR analysis. The 2-D connectivity analysis by 1H-COSY a 2 L top drive motor DasGip vessels filled with 1 L culture NMR (FIG. 10) and the proton NMR spectrum (FIG. 11) medium medium (10g/L yeast extract, 20g/L peptone, 80 g/L yielded good results. glucose, 1% V/v Ethanol, 100 uM CuSO 5H.0, 0.2 g/L 0416 2-D analysis of “mystery peak' eluting with DHIV G418) at 30° C., pH6.0, and an OTR of approximately 10 (FIG.10): One methyl group, shifted downfield, is not split by mmol/h. any adjacent protons, where the methyl group at 0.95 ppm is 0424 The cell-free fermentation broth was acidified to pH split into a doublet by one proton adjacent to a hydroxyl. That 2 using concentrated HSO4. Acidified broth was concen proton, in turn, is split into a quartet by the adjacent methyl trated to 350 mL under reduced pressure (0-100 mbar) using group. Complex patterns between 3.1 and 3.7 ppm indicate Büchi Rotovapor R-215. The flask containing broth was the different anomers of glucose carried along during the peak heated in the water bath to 20-30°C. during evaporation. A 70 collection of “DHIV. mL volume of MeOH was added to concentrated broth and 0417. The assignments of the NMR peaks are shown in the mixture was transferred to a 500 mL liquid-liquid extractor spectrum below (FIG. 11), clearly indicating that the identity (Sigma-Aldrich cat. # Z562432), which was set up according of the “mystery peak' is 2,3-dihydroxy-2-butyrate to manufacturer's specifications for continuous extraction (DH2MB). with ethyl acetate (EtOAc). Continuous extraction was car 0418. The 1H NMR and COSY spectra support the pres ried out for 3 days replacing the EtOAc extract daily with ence of 2,3-dihydroxy-2-methylbutanoic acid, a structural fresh EtOAc. isomer of dihydroxyisovaleric acid. Other signals in these spectra Support the presence of anomeric proteins and, there 0425 Following extraction, the first two batches of fore, a Sugar component. Furthermore, complex grouping of DH2MB extract in EtOAC were combined and dried with signals between 3.1-3.8 ppm are often observed with oli anhydrous MgSO followed by filtration. Dry extract was gosaccharides. The 13C NMR spectrum is very weak and concentrated under vacuum to 500 mL and was treated with 3 appears to be an attached proton test (APT) experiment based g of activated charcoal (Fluka catfi 05105) for 30 min by on the signal at 45 ppm that falls below the base line. stirring at room temperature. The decolorized solution was 0419 LC-MS was also carried out on the LC1 peak frac filtered and concentrated to approximately 50 mL under tion. The LC-MS was sufficient to demonstrate that the com vacuum (0-100 mbar using Büchi Rotovapor R-215). The pound had a mass of 134 (both DHIV and DH2MB) (FIG. Solution was incubated at 4°C. for two days. Obtained crys 12). tals were filtered and washed with ice-cold diethylether and 0420. This analysis conclusively identified the unknown acetone. Crystals were dried using lyophilizer under reduced by-product as 2,3-dihydroxy-2-methylbutanoic acid (CAS if pressure (0.05 mbar) for one day. 14868-24-7). This compound exists in 4 different stereoiso 0426 Isolated DH2MB was analyzed by 1H (FIG. 14) and meric forms. 2,3-dihydroxy-2-methylbutanoic acid exists as 13C (FIG. 15) NMR. 1H NMR (TSP) 1.1 (d. 6.5 Hz,3H), 1.3 a set of cis and trans diastereomers, each of which exists as a (s, 3H), 3.9 (q, 6.5 Hz, 3H). A 13C spectrum indicated five set of enantiomers. The four compounds are shown in FIG. different carbon atoms present in the sample. Resonance at 13. 181 ppm indicated carboxylic acid carbon present in the US 2011/020 1 090 A1 Aug. 18, 2011

sample. In conclusion, based on NMR spectra one could fuged in a microcentrifuge for 10 min at maximum. One mL estimate a 99% purity of isolated DH2MB. of the Supernatant was analyzed by GC1 (isobutanol, other metabolites) and one mL analyzed by high performance liq Example 9 uid chromatography (LC1) for organic acids and glucose. 0430 FIG. 16 depicts the product and by-product profiles Impact of DH2MB Production on Isobutanol Yield in of S. cerevisiae GEVO3160 transformed with pGV2247. Fermentation These profiles are representative for isobutanol producing 0427. The purpose of this example is to demonstrate that Pdc-minus, Gpd-minus yeast strains. Pdc-minus/Gpd-minus DH2MB accumulates to substantial levels in yeast strains yeast production Strains are described in commonly owned comprising ALS and TMA29 activity. and co-pending publications, US 2009/0226991 and US 0428 Strains and plasmids disclosed in this example are 2011/0020889, both of which are herein incorporated by shown in Tables 34 and 35, respectively. reference in their entireties for all purposes. FIG. 16 shows that isobutanol (13.9 g/L) and the unknown compound quan tified as “DHIV” and now identified as DH2MB (8.4 g/L) are TABLE 34 the primary products produced during microaerobic produc Genotype of S. cerevisiae Strain GEVO3160. tion OTR. Assuming that the quantitation using the response factor of DHIV leads to an accurate quantitation of DH2MB, Strain Genotype approximately 12-13% of the carbon consumed is diverted GEVO3160 MATaura3 leu2 his3 trp 1 gpd1A::Pt 12: into production of DH2MB. If the acetolactate that is con verted into DH2MB would instead be converted into isobu BS alsS coSc: Tcycl: PPok1: Ll kiv D: PENo2: tanol then the isobutanol yield over the entire time of the Sp HIS5pdc5A::LEU2: bla: P-ILV3AN: Ps: fermentation shown in FIG.16 would be significantly higher. Ec ilvC coSce''' pdc6A::Pr: Ll ilvD Prs: Ec ilvC coSc''': Example 10 Pro2: Ll adh A: Pe: Sc TRP1){evolved for C2 Supplement-independence, glucose tolerance and faster ALS Expression is Necessary for DH2MB Produc growth pCV2247 tion 0431. The purpose of this example is to demonstrate that TABLE 35 exogenously expressed ALS activity is required for DH2MB accumulation in S. cerevisiae. Genotype of Plasmid pCV2247. 0432. This experiment was performed to determine whether ALS is required for the production of DH2MB. The Plasmid Genotype strains used in this experiment were GEVO 1187 (S. cerevi pGV2247 Ps, ref: Ll ilvD coSc, Ps, tors: Ec ilvC coSc', siae CEN.PK2: MATaura3-52 leu2-3 112 his3A1 trp 1-289 Pse TPfi: G418R, Pse PGK1: ADE2) and GEVO2280 (S. cerevisiae CEN.PK2: MATaura3 Ll kivD coEc, Ps. No.2: Ll adhA, 21, AP, PMB1 leu2 his3 trp 1 ADE2 pdc1A::Pe:Bs alsS2:TRP1). Prior to fermentations, both strains were transformed with the 2 0429 S. cerevisiae strain GEVO3160 was transformed micron plasmid pGV2082 (Prs:Ec ilvC coSc'''. with pGV2247 as described. A fermentation was performed Pre:Ll ilvD coSc, Peck:Ll kiv) coEc, and Pevo: to characterize the transformed Strain. A single isolate cell Dm ADH, 2L ori, bla, G418R) as described. colony grown on a YPD agar plate containing 0.2 g/L G418 0433) To measure ALS activity, yeast cell extracts from were transferred 5 mL of YPD medium containing 80 g/L GEVO1187 and GEVO2280 were prepared. Cells were glucose, 1% V/v ethanol, 100 uM CuSO4.5H20, and 0.2 g/L grown to an ODoo of about 1, induced with 1 mM CuSO for G418 and incubated for 24 h at 30° C., 250 rpm. Next, this 2 hours and then harvested. To prepare cells for assays, 50 ml culture was transferred to 500 mL baffled flasks containing 80 of cells was collected by centrifugation at 2700xg. After mL of the same medium and incubated for 24hat 30°C. in an removal of the media, cells were resuspended insteriledHO, orbital shaker at 250 rpm. The flask culture was transferred to centrifuged at 2700xg and the remaining media was carefully a 2 L top drive motor fermenter vessel with a working volume removed with a 1 ml pipette tip. The cell pellets were weighed of 0.9L of the same medium for a starting ODoo of 0.5. The (empty tubes were preweighed) and then frozen at -80° C. fermenter was operated at 30° C. and pH 6.0 controlled with until use. Cell lysates were made using the following SOP as 6N KOH in a 2-phase aerobic condition based on oxygen described below. Cells were thawed on ice and resuspended in transfer rate (OTR). Initially, the fermenter was operated at a lysis buffer (250 mMKPO pH 7.5, 10 mMMgCl, and 1 mM growth phase OTR of 10 mM/h by fixed agitation of 700 rpm DTT) such that the result was a 20% cell suspension by mass. and an air overlay of 5 sI/h in both experiments. The cultures A volume of 1000 ul of glass beads (0.5 mm diameter) were was grown for about 20h to an ODoo of approximately 8, and added to a 1.5 ml Eppendorf tube and 875 ul of cell suspen then immediately switched to production aeration. An OTR sion was added. Yeast cells were lysed using a Retsch MM301 of 1 mM/h was sustained by reducing agitation from 700 rpm mixer mill (Retsch Inc. Newtown, Pa.) by mixing 6x1 min to 350 rpm. After 93 h post inoculation, one replicate vessel each at full speed with 1 min icing steps between. The tubes from each strain was further reduced to an OTR=0.3 mM/h by were centrifuged for 10 min at 23,500xg at 4° C. and the decreasing the agitation from 350 rpm to 180 rpm. Periodi Supernatant was removed. Extracts were held on ice until cally, samples from each fermenter were removed to measure assayed. The lysate protein concentration was determined ODoo and to prepare for gas chromatography (GC1) and using the BioRad Bradford Protein Assay Reagent Kit (Cath liquid chromatography (LC1) analysis. For GC1 and LC1, 2 500-0006, BioRad Laboratories, Hercules, Calif.) and using mL sample was removed into an Eppendorf tube and centri BSA for the standard curve as described. Briefly, all ALS US 2011/020 1 090 A1 Aug. 18, 2011 56 assays were performed in triplicate for each lysate, both with 0438 Shake flask cultures of GEVO2618 transformed and without substrate. To assay each lysate, 100 uL of lysate with pGV2020 and GEVO2618 transformed with pGV2227 diluted 1:2 with lysis buffer was mixed with 900 uL of buffer were started inYPD (15% glucose) containing 200 mMMES (50 mM potassium phosphate buffer pH 6.0, 1 mMMgSO 1 pH6.5, and 0.4 g/L G418 at an OD600-0.1, and were run at mM thiamin-pyrophosphate, 110 mM pyruvate), and incu 30° C. and 75 rpm in a shaking incubator. Samples were taken bated for 15 minutes at 30°C. Buffers were prepared at room at 24 hand 48 hand the samples were analyzed for metabolite temperature. A no substrate control (buffer without pyruvate) levels by HPLC (LC1) and GC (GC1). After 48 hours, all and a no lysate control (lysis buffer instead of lysate) were glucose was consumed from the media by both Strains. The also included. After incubation 175 uL from each reaction strain containing the empty vector (GEVO2618+pGV2020) was mixed with 25uL35% HSO and incubated at 37° C. for produced 4.6 g/L of DHIV+DH2MB representing 3.8% 30 min. Samples were submitted to analytics for analysis by yield. The strain containing the vector expressing additional LC1. Using this method, it was determined that the wild-type four pathway genes (GEVO2618+pGV2227), produced a strain GEVO1187 had no detectable ALS activity while the similar titer of 5.6 g/L DHIV+DH2MB representing 3.1% ALS-expressing strain GEVO2280 had 0.65 units/mg lysate yield. ALS activity. 0434. The performance of the two strains (with or without Example 12 the heterologous ALS integrated expression construct) was Effect of Increased KARI Activity on DH2MB Pro compared using the following shake flask fermentation con duction ditions. Strains were patched onto YPD plates containing 0.2 mg/mL G418. After overnight growth, cells were removed 0439. The purpose of this example is to demonstrate that from the plate with a sterile toothpick and resuspended in 4 increased KARI activity results in decreased in DH2MB pro mL of YPD with 0.2 g/L G418. The ODoo was determined for duction in yeast comprising ALS activity. each culture. Cells were added to 50 mL YP with 50 g/L 0440 Strains and plasmids disclosed in this example are dextrose and 0.2 mg/mL G418 such that a final ODoo of 0.1 shown in Tables 36 and 37, respectively. was obtained. To induce the CUP1 promoter driving ALS expression, 1 mM copper sulfate was added at the 24 hour TABLE 36 time point. Unused media was stored at 4°C. to act as medium blank for GC and LC, and to act as the t-0 sample for the Genotype of Strains Disclosed in Example 12. fermentation. At t=24, 48 and 72 hours samples were pre Strain Genotype pared for analysis by GC1 and at 72 hours samples were GEVO2843 S. cerevisiae, MATaura3 leu2 his3 trp1 additionally analyzed by LC1. At 24 and 48 hours a 1:10 pdc1A::PCP1:BS alss1 coSc:Tcycl: PPok1: Ll kiv 2: dilution of the supernatant of each culture was analyzed by Pyo: Sp HIS5 YSI. If needed 50% glucose containing 0.2 g/L G418 was pdc5A::LEU2: bla: PIE: ILV3AN: P is: added to a final concentration of 100 g/L glucose. Fermenta Ec ilvC coSc99. pdc6A::URA3:bla: P: Ll kiv D2: P3: Dm ADH tions were performed at 30° C. shaking at 250 RPM. {evolved for C2 Supplement-independence, glucose 0435 The DH2MB titer reached at 72 hours of a shake tolerance and faster growth flask fermentation was determined using LC1 method for both the WT strain (BUD1187) without ALS and the strain expressing the P:Bs alsS2 at PDC1 (BUD2280). Each strain was transformed with the 4-component plasmid TABLE 37 pGV2082. The fermentation was performed as described. Without exogenous ALS expression, the strain produced no Plasmids Disclosed in Example 12. DH2MB, whereas the strain with ALS expression produced Plasmid Genotype up to 1.4 g/L DH2MB plus DHIV. pGV2196 CEN, ARS, hph, bla, plJC-ori. pGV2377 PTEF1: Ll ilvD coSc, PsPok1: Ll kiv) coEc, Psy: Ll adhA, 21 ori, plJC ori, bla, G418R Example 11 pGV2466 Pter: Ll ilvD coSc, Pscripts: Ec ilvC coSc". Pspok: Ll kiv) coEc, Psevo2: Ll adhA, 21. Only ALS Expression is Necessary for DH2MB Pro ori, plJC ori, bla, G418R duction pGV2398 Pter: Ll ilvD coSc, Pscripts: Ec ilvC coSc'". PsPok1: Ll kiv) coEc, PSENo2:Ll adhA, 2 ori, plJC ori, bla, G418R 0436 The purpose of this example is to demonstrate that pGV2400 Pter: Ll ilvD coSc, Pscripts: Ec ilvC coSc''''', ALS activity alone is responsible for DH2MB accumulation PsPGK1: Ll kiv) coEc, Ps-ENO2: in S. cerevisiae. Ll adhA, 2 ori, plJC ori, bla, G418R 0437. This experiment was performed to determine pGV2406 Ps EC ilvC coSce'''', CEN, ARS, hph, bla, whether ALS alone or in combination with a KARI, DHAD, pUC ori. KIVD, ADH expressing plasmid is responsible for the pro duction of DH2MB. The strain used in this experiment was 0441 S. cerevisiae strain GEVO2843 was transformed GEVO2618 (MATa ura3 leu2 his3 trp 1 pdc1A::Pe: with 2L plasmids pGV2377, pGV2466, pGV2398, and Bs alsS1 coSc: TRP1). The plasmids tested in this experi pGV2400 as described to determine if expression of wild ment were pGV2227 which contains the remaining four path type or engineered KARIS led to a greater accumulation of way genes (-P:Ll ilvD coSc: P:Ec ilvC DH2MB. coSc':Ps te: G418: Pe: Ll kivD2 coEc:PDC1-3' 0442. Precultures of GEVO2843 transformed with the 2u. region: P: Ll adhA2u bla, pUC-ori), and pGV2020, the plasmids (pGV2377,2466, 2398, 2400) were started in YPD empty vector control (Ps. 1, Ps 71, G418R, APr; 2L). containing 1% ethanol and 0.2 g/L G418 and incubated over US 2011/020 1 090 A1 Aug. 18, 2011 57 night at 30° C. and 250 rpm. These precultures were used to was sequentially added, with Vortex mixing between addi inoculate 50 mL of the same medium in a baffled flask and tions for 15 sec, until 260 ul of NaOH was added. The aceto incubated at 30° C. and 250 rpm until reaching an ODoo of lactate was agitated at room temperature for 20 min and held -5. They were pelleted in 50 mL Falcon tubes at 2700 rcffor on ice. NADPH was prepared in 0.01 N. NaOH to a concen 5 minutes at 25° C. Next, the cells from each 50 mL culture tration of 50 mM. The concentration was determined by read were resuspended in 50 mLYPD containing 8% glucose, 1% ing the OD of a diluted sample at 340 nm in a spectropho (v/v) ethanol, ergosterol, Tween-80, 0.2 g/L G418, and 200 tometer and using the molar extinction coefficient of 6.22 mM MES, pH6.5. The cultures were added to 250 mL Mcm to calculate the precise concentration. Three buffers unbaffled flasks and placed in an incubator at 30° C. and 75 rpm. Samples were taken after 72 h to determine ODoo and to were prepared and held on ice. Reaction buffer contained 250 analyze the fermentation broth for extracellular metabolites mM KPO pH 7.5, 10 mM MgCl, 1 mM DTT, 10 mM via GC1 and LC1 analysis. acetolactate, and 0.2 mM NADPH. No Substrate buffer was 0443 Table 38 shows that the strain transformed with missing the acetolactate. No NADPH buffer was missing the pGV2377 (Not overexpressing any KARI gene from plas NADPH. Reactions were performed in triplicate using 10 ul mid) produced the highest carbon yield of 15% for combined of cell extract with 90 ul of reaction buffer in a 96-well plate DH2MB+DHIV, while the strains with pGV2466 (containing in a SpectraMax 340PC multi-plate reader (Molecular Ec ilvC coSc"), p.GV2398 (containing Ec ilvC Devices, Sunnyvale, Calif.). The reaction was followed at 340 coSc'''), and pGV2400 (containing Ec ilvC nm by measuring a kinetic curve for 5 minutes, with OD coSc'''''') had similar combined DH2MB+DHIV car readings every 10 seconds at 30° C. The Vmax for each bon yields of 8-10%. Likewise, the strain transformed with extract was determined after Subtracting the background pGV2377 produced isobutanol at the lowest carbon yield of reading of the no Substrate control from the reading in com 6%. The remaining strains comprising KARI genes on a plete buffer. plasmid produced isobutanol at higher carbon yields. The 0447 Table 39 shows data for KARI activity, as well as observation that decreased DH2MB production correlates carbon yield in % for isobutanol and combined DH2MB+ with increased isobutanol production is consistent with the DHIV. As KARI activity increased the isobutanol carbon finding that DH2MB is produced from acetolactate via a yield increased and the combined DH2MB+DHIV carbon reaction that does not involve KARI. yield decreased.

TABLE 38

Isobutanol and Combined DH2MB + DHIV Carbon Yields

Isobutanol carbon DH2MB + DHIV Strain Plasmid KARI yield (9%) carbon yield 9%

GEVO2843 p6V2377 n/a 6 15 GEVO2843 p6V2466 Ec ilvC coSc' 18 8 GEVO2843 p6V2398 Ec ilvC coSc90'- 15 8 GEVO2843 p6V2400 Ec ilvC coSc?--is 18 10

0444. A second experiment was performed in which strains expressed either no KARI from a plasmid, a low level TABLE 39 of KARI, or a high level of KARI. In this experiment the KARI Activity, Isobutanol and Combined DH2MB + DHIV KARI activity of cell lysates was measured. Carbon Yields. 0445 S. cerevisiae strain GEVO2843 was transformed as Isobutanol DH2MB - described with combinations of plasmids as described in KARI activity carbon DHIV carbon Table 37: the no KARI strain contained pGV2377+pGV2196 Strain Plasmid Imol/min.img yield 96 yield .9% and had no plasmid-borne KARI, the low KARI strain con GEVO2843 p6V2377+ O.O11.002 5 19 tained pGV2377+pGV2406 and expressed KARI from a low pGV2196 copy plasmid, and the high KARI Strain contained GEVO2843 p6V2377+ 0.0303 11: 16* pGV2398+pGV2 196 and expressed KARI from a high copy pGV2406 plasmid. Fermentations and sampling were performed as GEVO2843 p6V2398 + O.151.005 19 11 described. GC1 and LC1 methods were performed as pGV2196 described. Cells for KARI assays were lysed as described This data comprises only one sample except that lysis buffer was 250 mM. KPO, pH 7.5, 10 mM MgCl, and 1 mM DTT. The protein concentration of lysates Example 13 was determined as described. Effect of Increased DHAD Activity 0446. To measure in vitro KARI activity, acetolactate sub 0448. The purpose of this example is to demonstrate that strate was made by mixing 50 ul of ethyl-2 acetoxy-2-methyl increased DHAD activity results in decreased in DH2MB acetoacetate with 990 ul of water. Next 10 ul of 2 N NaOH production in yeast comprising ALS activity. US 2011/020 1 090 A1 Aug. 18, 2011 58

0449 Strains and plasmids disclosed in this example are 0451 Table 42 shows the DHAD activity, isobutanol yield shown in Tables 40 and 41, respectively. and the combined DHIV+DH2MB yield. The strain trans 04.50 GEVO2843 was transformed with different pairs of formed with pGV2284+pGV2.196 (no DHAD expressed plasmids. Strain A contains pGV2227 plus pGV2196. Strain from a plasmid) produced the highest carbon yield of 19% for B contains pGV2284 plus pCV2196. Strain C contains combined DH2MB+DHIV and the lowest carbon yield of pGV2284 plus pGV2336. Single transformants of BUD2843 isobutanol at 9%. The strain transformed with pGV2227+ with one of the three 2-plasmid combinations were single colony purified on YPD plates containing hygromycin, and pGV2196 (highest DHAD expression from a plasmid) had the patched cells were used to inoculate 3 mLYPD containing the lowest carbonyield of 9% for combined DH2MB+DHIV 1% ethanol (v/v), 0.2 g/L G418, and 0.1 g/L hygromycin. The and the highest carbonyield for isobutanol at 18%. The strain cultures were incubated at 30°C., 250 rpm overnight prior to transformed with pGV2284+pGV2336 (low copy DHAD their use to inoculate 3 mLYPD containing 1% ethanol (v/v), expression from a plasmid) had an intermediate carbon yield 0.2 g/L G418, and 0.1 g/L hygromycin. These cultures were of 16% for combined DH2MB+DHIV and of 12% for isobu incubated at 30° C., 250 rpm overnight. The following day, tanol. the cultures were used to inoculate 50 ml YPD containing 8% TABLE 42 glucose, 200 mMMES pH6.5, Ergosterol, and Tween80 to an ODoo of approximately 0.1. These cultures were incubated at DHAD Activities, Isobutanol and Combined DH2MB + DHIV 30° C., 250 rpm overnight. The following day the cultures Carbon Yields at 92 hrs Fermentation. were diluted in 50 mL of the same medium to an ODoo of Isobutanol ~0.1. The cultures were incubated at 30°C., 250 rpm, and 1.5 carbon DH2MB - DHIV mL samples were removed after 0, 24, 47, 70, and 92 hours of Strain Plasmids DHAD activity yield 9% carbon yield 96 incubation. The samples were prepared for GC and LC analy A. pGV2227+ O.29 O.OS 18 9 sis as described. After 92 hours, the remainder of all samples pGV2196 was centrifuged and the pellets were weighed and stored at B pGV2284 + O.OS OOO 9 19 -80°C. DHAD assays were performed with lysates prepared pGV2196 from the frozen pellets as described. LC1 and GC1 analysis C pGV2284 + O.O8 OO1 12 16 was performed as described. pGV2336 TABLE 40 Genotype of Strains Disclosed in Example 13. 0452. In a second experiment, GEVO2843 was trans formed with different pairs of plasmid (Table 43) and Strain Genotype assessed in a shake flask fermentation as above. Strain D GEVO2843 MATaura3 leu2 his3 trp1 contains pGV2196 plus pCV2589. Strain E contains pdc1A::PCP1:BS alss coSc:Tcyc1:PPok1:Ll kiv): pGV2529 plus pGV2589. Strain F contains pGV2.196 plus Po2:Sp HIS5pdc5 pGV2485. The strain transformed with pGV2196+pGV2589 A:LEU2:bla:PI:Sc ILV3AN:Pts: (no plasmid-borne DHAD) produced 1.25 g/L isobutanol and Ec ilvC coSc99. pdc6A::URA3:bla:P:Ll kiv D:P:DmADH 5.67 g/L DH2MB+DHIV. The strain with DHAD expressed {evolved for C2 supplement-independence, from a high-copy plasmid (pGV2196+pGV2485) produced glucose tolerance and faster growth 2.74 g/L isobutanol and 3.71 g/L DH2MB+DHIV, indicating that an increase in DHAD expression led to a decrease in DH2MB+DHIV accumulation. The Strain with DHAD TABLE 41 expressed from a low-copy plasmid (pGV2529+pGV2485) produced an intermediate level of both metabolites, consis Plasmids Disclosed in Example 13. tent with an intermediate level of DHAD activity. Plasmids Genotype TABLE 43 pGV2227 Ps. Ter: Ll ilvD coSc, Pse tors: Ec ilvC coSc'. Ps TP11: G418, Pse PGK1: Additional Plasmids Disclosed in Example 13. Ll kiv D coEc, Ps. No.2: Ll adh A, 21, AP, PMB1 pGV2284 Ps ter. Ps tors: Ec ilvC coSC''', Plasmid Genotype Ps (Pri: G418, Pse Pok1: Ll kiv D coEc, Pse ENo2: Ll adhA, 21, AP, PMB1 21.96 Ps poki, Ps. TEF1, PS (PrihPh, CEN, AP, plJCORI pGV2196. Ps, Pak Ps. 11, Ps, P1: hph, CEN, AP, plJCORI 2529 Ps poki, Pse terLl ilvD coSc4, Ps. (Prihph, CEN, AP, pGV2336 Pse ENO, TSPDC6 Pse PGK, pUC ORI Ps TEF1: Ll ilvD coSc Pse TDH3, Pse TP11: hph, 2589 Ps (DHEc ilvC coSc Q110V, PS (PriC418R, CEN, AP, puC ORI Ps vo2Ll adhA, 21, AP, PMB1

TABLE 44 DHAD activities, Isobutanol Titer and Yield, and Combined DH2MB + DHIV Titers at 72 hrs Fermentation.

Plasmid-borne Isobutanol Isobutanol DH2MB + DHIV Strain Plasmid(s) DHAD Titer (g/L). Yield (%) (g/L) D pGV2196+ pCV2589 None 1.25 + 0.27 16.1 S-67 0.29 E pGV2529 + pCV2589 Low-copy 2.15 0.05 24.8 S.OO 0.2O F pGV2196+ pCV2485 High-copy 2.74 - 0.22 31.0 3.71 - 0.11 US 2011/020 1 090 A1 Aug. 18, 2011 59

Example 14 Deletion of TMA29 in S. cerevisiae by Targeted TABLE 47 - continued Deletion Oligonucleotide Sequences Disclosed in Example 14.

0453 The following example illustrates that deletion of oGW the TMA29 gene from the S. cerevisiae genome eliminates Sequence the production of DH2MB when acetolactate synthase is overexpressed. 0454. Several reductase enzyme candidates that may cata 2870 TTTCGCCGGTATATTCCGTAG lyze the production of DH2MB were identified in the S. (SEQ ID NO: 1.24) cerevisiae genome, including the TMA29 gene product. The 2891 GTTCTATTAAGTTTCCTGTATAACGGCATTGTTCACCAGAATGTC genes encoding these reductases were deleted in the S. Cer (SEQ ID NO: 125) evisiae strain GEVO2618, a strain known to produce g/L quantities of DH2MB, using integration of a URA3 marker. 29 O2 TCCCGACGGCTGCTAGAATG Fermentations were performed with these strains to deter (SEQ ID NO: 126) mine if deleting any of the candidate genes, including 29 O4 CGCTCCCCATTAATTATACA TMA29, reduced or eliminated the production of DH2MB. (SEO ID NO : 127) 0455 Strains, plasmids, and primer sequences are listed in Tables 45, 46, and 47, respectively.

TABLE 45 Genotype of Strains Disclosed in Example 14. GEVO No. Genotype GEVO1187 S. cerevisiae CEN.PK2 MATaura3-52 leu2-3 112 his3A1 trp1-289 ADE2 GEVO2618 S. cerevisiae, MATaura3 leu2 his3 trp 1 podc1A::Pe: Bs alss 1 coSc: TRP1. GEVO3638 S. cerevisiae, MATaura3 leu2 his3 trp 1 podc1A::Pe: Bs alss 1 coSc: TRP1 tma29A:T K UR-43 shor: PFBA 1: Kl URA3: TK UR43. GEVO3639 S. cerevisiae, MATaura3 leu2 his3 trp 1 pac1A::Pe: Bs alsS1 coSc: TRP1 tma29A:T K UR-43 shor:PFBA 1: Kl URA3: TK1 UR-43) GEVO3640 S. cerevisiae, MATaura3 leu2 his3 trp 1 podc1A::Pe: Bs alss 1 coSc: TRP1 tma29A:T K UR-43 shor: PFBA 1: Kl URA3:TK1 UR43.

TABLE 46 TABLE 47 - continued Plasmids Disclosed in Example 14. Oligonucleotide Sequences Disclosed in Example 14.

Plasmid Name Genotype oGW Sequence pGV1299 Kl URA3, bla, plJC-ori. pGV2129 Kl URA3-5", bla. 291.3 GAAAGGCTCTTGGCAGTGAC (SEQ ID NO: 128)

291.4 GCCCTGGTGCAATTAGAATG TABL E 47 (SEQ ID NO: 129) Oligonucleotide Sequences Disclosed in Example 14. 291.5 TGCAGAGGGTGATGAGTAAG (SEQ ID NO: 13 O) dGW Sequence 2916 GGCCAAAGGTAAGGAGAACG (SEQ ID NO: 131) 893. GGATGTGAAGTCGTTGACACAG (SEQ ID NO: 118) 0456 Strain Construction: S. cerevisiae strains 22.31 TTGAAACGTTGGGTCCATAC GEVO3638, GEVO3639, and GEVO3640 were constructed (SEQ ID NO: 119) by transforming GEVO2618 with bipartite integration SOE 2232 TTCACCGTGTGCTAGAGAAC PCR products to replace TMA29 with a URA3 marker. Prim (SEQ ID NO: 12O) ers to amplify 5' and 3' targeting sequences for reductase 2862 TTATACAGGAAACTTAATAGAACAAATC genes were designed with a 20 bp sequence homologous to a (SEQ ID NO: 121) URA3 fragment. This was done so that SOE PCR could be used to create fragments containing the URA3 marker and 2867 TGAAACAGCATGGCGCATAG homologous regions flanking the reductase gene of interest. (SEQ ID NO: 122) PCR was performed on an Eppendorf Mastercycler(R) (Catil 2869 CTGTGTCAACGACTTCACATCCGAGGTAACGAGGAACAAGCC 71086, Novagen, Madison Wis.). The following PCR pro (SEQ ID NO: 123) gram was followed for primer sets used to generate SOE PCR fragments: 94° C. for 2 min then 30 Cycles of (94° C. 30 sec, US 2011/020 1 090 A1 Aug. 18, 2011 60

53° C. 30 sec, 72° C. 1.5 min) then 72° C. for 10 min. The pipette tip. The cell pellets were weighed (empty tubes were following primer pairs and template were used for the first preweighed) and then frozen at -80°C. until thawed for ALS step of the SOE reactions. assays as described. 0457. To generate the 5' URA3 fragment, oGV2232 and 0463. The production of DH2MB is dependent on heter oGV2862 were used to amplify the 5' URA3 fragment using ologous ALS expression, for instance the Bs alss1 coSc pGV2129 as template. The 1364 bp fragment was purified by gene. The ALS activity of cell lysates was measured as gel electrophoresis. To generate the 3' URA3 fragment, described to demonstrate that the TMA29 deletion had no oGV2231 and oGV893 were used to amplify the 3' URA3 impact on ALS expression and/or activity. The ALS activity fragment using pCV1299 as template. The 1115bp fragment of extracts from the strains carrying the TMA29 deletion is was purified by gel electrophoresis. not less than, and is slightly more than the activity of extracts 0458. To generate the 5'TMA29 fragment, oGV2867 and from the parent strain. The results at 24 h (48 h for ALS oGV2891 were used to amplify the 5'TMA29 fragment using activity) are summarized in Table 48 and clearly demonstrate S. cerevisiae S288c genomic DNA as template. The S. cer the lack of DH2MB production in the strain with the TMA29 evisiae S288c strain was purchased from ATCC (ATCC#204508). The 412 bp fragment was purified by gel deletion. LC4 analysis confirmed that GEVO3527 did not electrophoresis. To generate the 3' TMA29 fragment, produce DHIV. oGV2869 and oGV2870 were used to amplify the 3'TMA29 fragment using S. cerevisiae S288c genomic DNA as tem TABLE 48 plate. The 305bp fragment was purified by gel electrophore Production of DH2MB in Strain with TMA29 Deletion. S1S. 0459. The following primer pairs and templates were used Glucose to generate the SOE PCR products. To generate the 5'TMA29 consumed by DH2MB by ALS activity SOE PCR product, oGV2232 and oGV2867 were used. The Strain OD6oo LC1 g/L LC1 g/L Umg 5' URA3 fragment and the 5'TMA29 fragment were used as template. To generate the 3' TMA29 SOE PCR product, GEVO2618 9.2 O.9 6156 - 12.O 151- 0.1 O44 - 0.06 oGV2231 and oGV2870 were used. The 3' URA3 fragment GEVO3638, 12.5 SO 68.44 - 12.5 OOO, O.O O57 0.04 and the 3' TMA29 fragment were used as template. GEVO3639, 0460 Transformation of S. cerevisiae strain GEVO2618 GEVO3640 with the bipartite integration SOE PCR products was per (tma29A) formed as described. Following transformation, the cells were collected by centrifugation (18,000xg, 10 seconds, 25° C.) and resuspended in 400 uL SCD-HLWU media. Integra Example 15 tive transformants were selected by plating the transformed cells on SCD-Ura agar medium. Once the transformants were Deletion of TMA29 in S. cerevisiae by Deletion single colony purified they were maintained on SCD-Ura plates. Library 0461 Colony PCR was used to verify correct integration. 0464. The following example illustrates that deletion of To screen for the correct 5'-end, the URA3: TMA295' junc tion primers oGV2915 and oGV2902 were used to give an the TMA29 gene from the S. cerevisiae genome eliminates expected band at 991 bp. To screen for the correct3'-end, the the production of DH2MB when acetolactate synthase is URA3: TMA293'junction primers oGV2904 and oGV2916 overexpressed. were used to give an expected band at 933 bp. To screen 0465 Strains, ORF deletions, and plasmids are listed in deletion of the TMA29 gene primers oGV2913 and oGV2914 Tables 49, 50, and 51. were used, expecting a lack of a 288 bp if the CDS was deleted. TABLE 49 0462. Fermentations: Fermentations were conducted with tma29A strains GEVO3638, GEVO3639, and GEVO3640 Genotype of Strains Disclosed in Example 15. and the parent TMA29 strain GEVO2618. Cultures were GEVO fi Genotype/Source started in YPD shaking at 30° C. and 250 rpm. After four GEVO3527 S. cerevisiae BY4742: MATa his3A1 leu2AO lys2AO doublings, the ODoo was determined for each culture. Cells ura3AO/ATCC #201389, purchased from ATCC 10801 were added to 50 mLYPD with 15% glucose such that a final University Boulevard Manassas, VA 20110-2209 ODoo of 0.05 was obtained. At t=24h, 2 mL of media was removed and 25 uL used at a 1:40 dilution to determine ODoo. The remaining culture was centrifuged in a microcen trifuge at maximum speed for 10 min and 1 mL of Supernatant TABLE 50 was removed and submitted for LC1 and LC4 analysis. At ORF Deletion Disclosed in Example 15. t=48 h, 2 mL of media was removed and 25uL used at a 1:40 dilution to determine ODoo. 1 mL of Supernatant was sub ORF deletion Gene name Source mitted for LC1 analysis. In addition, 14 mL was collected by YMR226C TMA29 Deletion library was obtained from Open centrifugation at 2700xg. After removal of the media, cells Biosystems, cat #YSC 1054 were resuspended in sterile dH20, centrifuged at 2700xg and the remaining medium was carefully removed with a 1 mL US 2011/020 1 090 A1 Aug. 18, 2011

not produce detectable levels of DH2MB. The specific TABLE 51 DH2MB titer for GEVO3527 was 0.2 g/L/OD; the YMR226C deletion strain (tma29A) did not produce detectable levels of Plasmid Disclosed in Example 15. DH2MB. LC4 analysis confirmed that GEVO3527 did not Plasmid Relevant Genes produce DHIV. pGV2435 Pscrip: BS alss.1 CoSc:PS1P1.hph:Tscyc1, CENARS, bla, plJC-ori TABLE 52

0466. A commercial library of S. cerevisiae strains which Cell Growth, Glucose Consumed, and DH2MB Production at 72 h. has one gene/ORF deleted per strain was used to screen for a deletion that might catalyze the production of DH2MB. The DH2MB Specific candidate strain containing the deletion of the TMA29 (i.e., Glucose consumed tilter by DH2MB titer YMR226C) ORF was selected. Since exogenous ALS expression is required for production of DH2MB, a CEN Strain OD6oo by LC1 g/L LC1 g/L g/L/OD plasmid (pGV2435) containing the Bs alsS1 coSc gene driven by the CUP1 promoter was transformed into the strains GEVO3527 13.70.3 223.30.6 28 0.1 O2 OO1 as described. Transformations were recovered overnight at TMA29A 15.7 S.S 223.90.2 O.O.O.O O.O.O.O 30°C.,250 rpm before plating onto YPD plates containing 0.2 g/L hygromycin. Transformants were then patched onto YPD plates containing 0.2 g/L hygromycin and incubated at 30°C. 0467 Fermentations were performed with these strains to Example 16 determine if deleting TMA29 (YMR226C) reduced or elimi nated the production of DH2MB. Three independent trans Improved Isobutanol Rate, Yield, and Titer with formants of each Strain were used to inoculate fermentation precultures which were grown overnight to saturation inYPD Deletion of TMA29 Gene in S. cerevisiae containing 0.2 g/L hygromycin at 30° C. and 250 rpm. The next day, the ODoo of the precultures was measured and the 0469. The following example illustrates that deletion of volume of overnight culture needed to inoculate a 50 mL the TMA29 gene from the S. cerevisiae genome leads to an culture to an ODoo of 0.1 was calculated for each culture. 50 increase in productivity, yield, and titer of the desired product, mL of YPD containing 150 g/L glucose, 200 mM MES, pH isobutanol. In addition, it leads to a decrease in DH2MB 6.5, and 0.2 g/L hygromycin in a 250 mL non-baffled flask productivity, yield and titer. were inoculated with the calculated amount of overnight cul ture. Cells were incubated at 30° C. and 75 rpm in an orbital 0470 DH2MB is a byproduct of acetolactate metabolism shaker. At 24 h, all cultures were fed an additional 75 g/L of in yeast. In isobutanol fermentations, DH2MB can comprise glucose by addition of 8.8 mL of a 50% glucose solution to 10% or greater of the carbon yield. Strains with wild-type each flask and then returned to incubation at 30° C. and 75 TMA29 produce DH2MB in the presence of expressed aceto rpm. At 72 h, 1.5 mL was sampled from each flask (750 uL lactate synthase (ALS), encoded by Bs alsS1 coSc (SEQID divided between two Eppendorf tubes). The ODoo was mea NO:23). Strains deleted for TMA29 do not produce DH2MB sured for each culture (1:40 dilution in HO). The cells were in the presence of expressed BS alss1 coSc. A yeast strain removed from samples by centrifugation at 214000xg for 10 minutes in a microcentrifuge. The Supernatants from the deleted for all PDC and GPD genes that expresses ALS (Bs samples were collected and stored at 4°C. until analysis by alsS1 coSc) from the chromosome was deleted for TMA29 LC1, and the cell pellets were stored at -80° C. until thawed and transformed with a high copy four-component isobutanol for ALS assays as described. pathway plasmid, pGV2550 with genes for DHAD (Ll ilvD 0468. There was some variation in the growth between the coSc), KARI (Ec ilvC coSc?''''), KIVD(Ll kivD2 two strains, with ODoo values of 13.7 for GEVO3527 and coEc) and ADH (L1 adhA coSc'"). Isobutanol titer, 15.7 for the TMA29 deletion strain at 72 h (Table 52). The yield and productivity of this strain were compared to that of strains consumed the same amount of glucose of around 223 the parent strain that was not deleted for the TMA29 gene, in g/L by 72 h (Table 52). GEVO3527 produced 2.8 g/L of both a shake flask fermentation and infermenters. Strains and DH2MB by 72h. The YMR226C deletion strain (tma29A) did plasmids are listed in Tables 53 and 54, respectively.

TABLE 53 Genotype of Strains Disclosed in Example 16. GEVO No. Genotype GEVO 1187 S. cerevisiae CEN.PK2 MATaura3 leu2 his3 trp1 ADE2 GEVO3351 MATaura3 leu2 his3 trp1 gpd1A::TKI URA3 gpd2 A:TKI URA3 pdc1 A::Pe:BS alss1 coSc:Toyo:Peck:Ll kiv D-PNo:Sp HIS5 pdc5 A::LEU2; bla; Pter:ILV3AN: Priors; ilvC coSc' pdc6 A::Pter-Ll ilvD:Priors:Ec ilvC coSc''':Pevo2:Ll adhA:Pe:Sc TRP1 {evolved for C2 Supplement-independence, glucose tolerance and faster growth GEVO3663 MATaura3 leu2 his3 tripl gpdl:Te R43 gpd1A:Te Rasgpd2 A:Te R43 US 2011/020 1 090 A1 Aug. 18, 2011 62

TABLE 53-continued Genotype of Strains Disclosed in Example 16. GEVO No. Genotype pdc6 A::Pter-Ll ilvD:Priors:Ec ilvC coSc''':Pevo2:Ll adh A:Pe:Sc TRP1 tma29A:Te R43 : PER41:Kl URA3: Tx, UR-43]{evolved for C2 Supplement independence, glucose tolerance and faster growth GEVO3690, MATaura3 leu2 his3 trp1 gpd1A::TK 43 gpd2 A::TK 3. GEVO 3692 pdc5 A::LEU2: bla; Per:ILV3AN: Ports: ilvC coSce'' pdc6 A::Pter-Ll ilvD:Priors:Ec ilvC coSc''':Pexo:Ll adhA:Pe:Sc TRP1 Transformed with pCV2550 evolved for C2 supplement-independence, glucose tolerance and faster growth GEVO3694, MATaura3 leu2 his3 trp1 gpd1A::TK 43 gpd2 A::TK 3. GEVO3696 pdc5 A::LEU2; bla; Pref:ILV3AN: Ports: ilvC coSc' GEVO3697 tma29A:T& R 43 : PER11:Kl URA3: Tx R-43Transformed with pCV2550 {evolved for C2 Supplement-independence, glucose tolerance and faster growth

0.2 g/L G418 plates. Once the transformants were single TABLE 54 colony purified they were maintained on YPD plates contain ing 0.2 g/L G418. Plasmids Disclosed in Example 16. 0473. Fermentations: A shake flask fermentation was per Plasmid formed comparing performance of GEVO3690-GEVO3692 Name Genotype (TMA29) to GEVO3694-GEVO3695 and GEVO3697 pGV1299 Kl URA3, bla, plJC-ori. (tma29A). Cultures (3 mL) were started in YPD containing pGV2129 Kl URA3-5", bla, plJC ori 1% ethanol and 0.2 g/L G418 and incubated overnight at 30° pGV2550 Ps:Ll ilvD coS, C. and 250 rpm. The ODoo of these cultures was measured Pstors:Ec ilvC coSc'''':PsPok:Ll kiv D2 coEc: after about 20 h. An appropriate amount of each culture was Pse:Ll adhA coSc'''', 2-ori, puC-ori, bla, G418R. used to inoculate 50 mL of YPD containing 1% ethanol and 0.2 g/L G418 in a 250 mL baffled flask to an ODoo of 0471 Yeast strain construction: GEVO3663 was con approximately 0.1. These precultures were incubated at 30° structed by transforming GEVO3351 with the bipartite inte C. and 250 rpm overnight. When the cultures had reached an gration SOE PCR products described in Example 14 to ODoo of approximately 5 they were centrifuged at 2700 rcf replace TMA29 with a URA3 marker as described, except for 5 minat 25°C. in 50 mL Falcon tubes. The cells from each after transformation the cells were resuspended in 350 LL 50 mL culture were resuspended in 50 mL of fermentation SCD-Ura media before being spread to SCD-Ura plates. media as described. The cultures were then transferred to 250 0472. S. cerevisiae strains GEVO3690, GEVO3691, and mL unbaffled screw-cap flasks with small vents and incu GEVO3692 were constructed by transforming GEVO3351 bated at 30° C. and 75 rpm. At 24 and 48 h, samples from each with plasmid pGV2550. S. cerevisiae strains GEVO3694, flask were removed to measure ODoo and to prepare for GC1 GEVO3695, and GEVO3697 were constructed by transform analysis. For GC1, 2 mL sample was removed into an Eppen ing GEVO3663 with plasmid pGV2250 Briefly, competent dorf tube and centrifuged in a microcentrifuge for 10 min at cells were prepared by removing cells from a fresh plate into maximum. One mL of the Supernatant was analyzed by GC1. 100 uL 100 mM lithium acetate. The cell suspension was At 72 h the same procedures were used to collect cells for incubated at room temperature for 30 min. Plasmid DNA was ODoo and GC analysis and in addition the samples were transformed as described. After transformation, the cells were analyzed by high performance liquid chromatography (LC1) resuspended in 400 uLYPD containing 1% ethanol and incu for organic acids, including DH2MB and DHIV, and glucose. bated at 30° C. for 6hshaking at 250 rpm. The cells were then 0474. The results at 72 h are summarized in Table 55. spread onto YPD plates containing 0.2 g/L G418. Transfor Isobutanol titer, yield and rate increase with deletion of the mants were single colony purified onto YPD plates containing TMA29 gene, while DH2MB production decreases.

TABLE 55

Isobutanol Titer, Yield, and Rate Increase at 72 h.

Glucose Isobutanol Isobutanol Isobutanol DH2MB consumed produced yield .9% rate produced Strain OD6oo g/L) g/L) theoretical g/L/h g/L

GEVO3690, 8.3 O.3 29.8 13 5.5 O.4 45.14 O.08 3.1 GEVO3691, GEVO3692 US 2011/020 1 090 A1 Aug. 18, 2011

TABLE 55-continued

Isobutanol Titer. Yield, and Rate Increase at 72 h.

Glucose Isobutanol Isobutanol Isobutanol DH2MB consumed produced yield .9% rate produced Strain OD6oo g/L) g/L) theoretical g/L/h g/L GEVO3694, 8.3 O.7 33.4 1.O 76 O.2 55:12 O.11 O.O3 GEVO3695, GEVO3697 (TMA29A)

0475. In addition, the performance of GEVO3690- Example 17 GEVO3691 (TMA29) to GEVO3694-GEVO3696 (tma29A) was also compared in fermentations performed in fermenter Determination of TMA29 Activity in S. cerevisiae vessels. Plated cultures were transferred to 500 mL baffled 0477 The following example illustrates that the (S)-2- flasks containing 80 mL of YP medium with 20 g/L glucose, acetolactate reduction activity is significantly decreased in a 1% v/v Ethanol, 100 uMCuSO4.5H20, and 0.2 g/L G418 and tima29A strain. incubated for 34.5 h at 30°C. in an orbital shaker at 250 rpm. The flask cultures were transferred to individual 2 L top drive motor fermenter vessels with a working volume of 1.2 L of 80 TABLE 57 mL of YP medium with 20 g/L glucose, 1% V/v Ethanol, 100 Genotype of Strains Disclosed in Example 17. uM CuSO4.5H20, and 0.2 g/L G418 for a starting ODoo of 0.2. Fermenters were operated at 30° C. and pH 6, controlled GEVO fi Genotype Source with 6N KOH in a two-phase aerobic fermentation. Initially, GEVO3527 MATC. his3A-1 leu2A ATCC# 201389 (BY4742) fermenters were operated at a growth phase oxygen transfer lys2A ura3A rate (OTR) of 10 mM/h by fixed agitation of 850 rpm and an GEVO3939 MATC. his3A-1 leu2A OpenBiosystems cath YSC1054 air overlay of 5 sL/h. Cultures were grown for 31 hto approxi lys2A ura3A (Yeast MATalpha collection) mately 6-7 ODoo then immediately switched to a production tma29:kan aeration OTR of 0.5 mM/h by reducing agitation from 850 rpm to 300 rpm for the remainder of the fermentation of 111 0478 Yeast strains GEVO3939 from which the TMA29 h. Periodically, samples from each fermenter were removed (YMR226C) gene was deleted and its parent GEVO3527 to measure ODoo and to prepare for gas chromatography were each cultured in triplicate by inoculating 3 mL of YPD (GC1) analysis. For GC, 2 mL sample was removed into an in a 14 mL culture tube in triplicate for each strain. Cultures Eppendorf tube and centrifuged in a microcentrifuge for 10 were started from patches on YPD agar plate for GEVO3527 minat maximum. One mL of the Supernatant was analyzed by and on YPD plates containing 0.2 g/L G418 for GEVO3939 GC1 (isobutanol, other metabolites). At 72 h the same proce and GEVO3940. The cultures were incubated overnight at dures were used to collect cells for ODoo and GC analysis 30° C. and 250 rpm. The next day, the ODoo of the overnight and in addition the samples were analyzed by high perfor cultures were measured and the volume of each culture to mance liquid chromatography (LC1) for organic acids and inoculate a 50 mL culture to an ODoo of 0.1 was calculated. glucose. The calculated volume of each culture was used to inoculate 0476. The results at 111 h are summarized in Table 56. 50 mL of YPD in a 250 mL baffled flask and the cultures were Isobutanol titer, yield, and rate increased with deletion of the incubated at 30° C. and 250 rpm. TMA29 gene. DH2MB production decreased to undetectable 0479. The cells were harvested during mid-log phase at levels. ODs of 1.6-2.1 after 7 h of growth. The cultures were trans

TABLE 56 Isobutanol Titer, Yield, and Rate Increase at 111 h.

Glucose Isobutanol DH2MB Isobutanol Isobutanol consumed produced produced yield rate Strain OD6oo g/L) g/L) g/L) % theor. gLh GEVO3690, 7.2 + 0.7 29.7 + 1.1 8.6 + 0.1 2.9 62.43 O.09 GEVO3691 (TMA29+) GEVO3694, 7.4 + 1.3 35.7 + 3.9 12.3 + 1.2 O 7S.O. O.O1 O.14 GEVO3695, GEVO3696 (TMA29A)

Glucose, isobutanol, and DH2MB tilters are the final tilters, i.e. at 111 h offermentation, Isobutanol yield and rate are calculated based on the production phase only, i.e. from 31 to 111 h of fermentation. US 2011/020 1 090 A1 Aug. 18, 2011 64 ferred to pre-weighed 50 mL Falcon tubes and cells were collected by centrifugation for 5 minutes at 3000xg. After TABLE 59 - continued removal of the medium, cells were washed with 10 mL MilliO H0. After removal of the water, the cells were centrifuged Oligonucleotide Sequences Disclosed in Example 18. again at 3000xg for 5 minutes and the remaining water was oGV # Sequence carefully removed using a 1 mL pipette tip. The cell pellets were weighed and then stored at -80°C. until further use. 306.7 TCAAATTTTTCTTTTTTTTCTGTACAGTTACCCAAGCTGTTTT 0480 Cell pellets were thawed on ice and resuspended in GCCTATTTTCAAAGC lysis buffer (10 mM sodium phosphate pH7.0, 1 mM dithio (SEQ ID NO: 136) threitol, 5% w/v glycerol) such that the result was a 20% cell 3 O 68 GCTTTGAAAATAGGCAAAACAGCTTGGGTAACTGTACAGAAAA Suspension by mass. One mL of glass beads (0.5 mm diam AAAAGAAAAATTTG eter) was added to a 1.5 mL Eppendorf tube for each sample (SEO ID NO : 137) and 850 uL of cell suspension were added. Yeast cells were 3 O 69 AGTTCAAATCAGTTCGAGGATAATTTAAG lysed using a Retsch MM301 mixer mill (Retsch Inc. New (SEQ ID NO: 138) town, Pa.), mixing 6x1 min each at full speed with 1 min incubation on ice between. The tubes were centrifuged for 10 3 O 70 TTAATAAATGCTCAAAAGAAAAAAGGCTGGCG min at 21,500xg at 4°C. and the supernatant was transferred (SEQ ID NO: 139) to a fresh tube. Extracts were held on ice until they were 31 O3 ACCGGTGCTTCTGCAGGTATTG assayed using the TMA29 assay as described. (SEQ ID NO: 14 O) 0481. The specific activity of S. cerevisiae TMA29 in 31 O6 ATGCTTGGTTGGAAGCAAATAC GEVO3527 lysates, a wild-type MATa S. cerevisiae strain, (SEQ ID NO: 141) for the reduction of (S)-2-acetolactate was 6.9+0.2 mU/mg. The tima29A strain GEVO3939 had a specific activity of 0.7+0.3 mU/mg. The wild-type GEVO3527 strain had about 0483. The K. lactis strain GEVO4458 was constructed a 10-fold higher specific TMA29 activity than the deletion from GEVO1742 as follows. DNA constructs were made to delete the TMA29 locus of K. lactis using SOE PCR. The 5' strain. targeting sequence was amplified by PCR using GEVO1287 Example 18 genomic DNA as template with primers oGV3103 and oGV3065. The 376 bp fragment was purified by gel electro Determination of TMA29 Activity in Kluyveromyces phoresis. The 3' targeting sequence was amplified by PCR lactis using GEVO1287 genomic DNA as template with primers oGV3106 and oGV3067. The 405 bp fragment was gel puri 0482. The following example illustrates that the (S)-2- fied. The Hph marker was amplified by PCR using pCV2701 acetolactate reduction activity is significantly decreased in a (P-Hph, CEN/ARS. pUC-ori, bla) as template with prim tima29A strain. ers oGV3066 and oGV3068. The 1,165 bp fragment was gel purified. Next the 5' targeting sequence and the hph marker TABLE 58 were joined together using PCR products described as tem Genotype of Strains Disclosed in Example 18. plate. The reaction was amplified using primers oGV3068 and oGV3103. The 1984 bp fragment was gel purified. Next GEVO fi Genotype the 5' targeting sequence plus Hph marker PCR fragment was GEVO1287 Kluyveromyces lactis, MATC. uraA1 trp 1 leu2 lysA1 ade1 joined with the 3' targeting sequence using PCR with primers lac4-8 pKD1 oGV3103 and oGV3106. The 2.331 bp was gel purified and GEVO1742 Kluyveromyces lactis, MATalpha uraA1 trp 1 leu2 lysA1 used for transformation. Yeast DNA was isolated using the ade1 lac4-8 pKD1 pdc1A::kan Zymo Research ZR Fungal/Bacterial DNA Kit (Zymo GEVO4458 Kluyveromyces lactis, MATalpha uraA1 trp 1 leu2 lysA1 Research Orange, Calif.; Catalog #D6005). GEVO1287 was grown to saturation in 12.5 mL of YPD in baffled 125 mL flasks. The entire culture was collected in 15 mL Falcon tubes and cells collected at 2700 rcf for 5 min. Genomic DNA was TABL E 59 isolated according to the manufacturer's instructions. The DNA concentration was measured and all genomic DNA Oligonucleotide Sequences Disclosed in Example 18. preps were diluted to a final concentration of 25 ng/uL. oGV # Sequence 0484 GEVO1742 was transformed as follows. 50 mL YPD medium in 250 mL baffled flasks were inoculated with 821 CGGGTAATTAACGACACCCTAGAGG GEVO1742 cells from a fresh plate. The cultures were incu (SEQ ID NO: 132) bated overnight at 30° C. and 250 rpm. The next morning the 232O GGCTGTGTAGAAGTACTCGCCGATAG culture was diluted 1:50 inYPD medium and allowed to grow (SEQ ID NO: 133) for 6 h. Cells were collected by centrifugation at 2700 rcffor 3 O65 AAAAAGGAGTAGAAACATTTTGAAGCTATGCGTTGATAAGGGC 2 minat30°C. Cells were washed by fully resuspending cells AACAACGTTAGTATC with 50 mL sterile MilliO water. Cells were collected by (SEQ ID NO: 134) centrifugation at 2700 rcf for 2 min at 30° C. Cells were washed by resuspending with 25 mL sterile MilliO water. 3 O66 ATACTAACGTTGTTGCCCTTATCAACGCATAGCTTCAAAATGT TTC TACTCCTTTTTTAC Cells were collected by centrifugation at 2700 rcf for 2 minat (SEQ ID NO: 135) 30° C. Cells were resuspended in 1 mL 100 mM lithium acetate, transferred to an Eppendorf tube and collected by centrifuging at 14,000 rcf for 10 seconds. The supernatant US 2011/020 1 090 A1 Aug. 18, 2011

was removed and the cells were resuspended with 4x the H0. After removal of the water, the cells were centrifuged pellet volume in 100 mM LiOAc. A mixture of DNA (15 L again at 3000xg for 5 min and the remaining water was of PCR product), 72 uL 50% PEG, 10u L 1 M lithium acetate, carefully removed with a 1 mL pipette tip. The cell pellets and 3 uI of denatured salmon sperm DNA (10 mg/mL) was were weighed and then stored at -80° C. prepared for each transformation. In a 1.5 mL tube, 15 uL of 0487 Cell pellets were thawed on ice and resuspended in the cell suspension was added to the DNA mixture (170 uL), lysis buffer (10 mM sodium phosphate pH7.0, 1 mM dithio and the transformation Suspension was Vortexed for 5 short threitol, 5% w/v glycerol) such that the result was a 20% cell pulses. The transformation was incubated for 30 min at 30° Suspension by mass. One mL of glass beads (0.5 mm diam C., followed by incubation for 22 min at 42°C. The cells were eter) was added to a 1.5 mL Eppendorf tube for each sample collected by centrifugation (18,000xg, 10 sec. 25°C.). The and 850 uL of cell suspension were added. Yeast cells were cells were resuspended in 400 uLYPD medium and allowed lysed using a Retsch MM301 mixer mill (Retsch Inc. New to recover overnight at 30° C. and 250 rpm. The following town, Pa.), mixing 6x1 min each at full speed with 1 min morning, the cells were spread onto YPE plates 1% (w/v) incubation on ice between. The tubes were centrifuged for 10 yeast extract, 2% (w/v) peptone, 25 mL/L ethanol) supple min at 21,500xg at 4°C. and the supernatant was transferred mented with 0.1 g/L Hygromycin. Transformants were single to a fresh tube. Extracts were held on ice until they were colony purified onto YPE plates supplemented with 0.1 g/L assayed using the TMA29 assay as described. Hygromycin. 0488. The specific activity of Gevo 1742 with the TMA29 0485 The single colony isolates were patched onto YPE gene for the reduction of (S)-2-acetolactate was 0.0043+0. Supplemented with 0.1 g/L Hygromycin plates and the 0005umol/min/mg lysate. The specific activity of Gevo4459 patches were screened for the correct integration by colony deleted for the TMA29 gene was 0.0019+0.0003 umol/min/ PCR. Presence of the correct PCR product was confirmed mg lysate. using agarose gel electrophoresis. To Screen for the internal TMA29 coding region, primers oGV3103 and oGV3106 Example 19 were used. To Screen the 5' integration junction, primers Increased Isobutanol Yield in Strains Comprising an oGV3069 and oGV821 wereused. To screen the 3' integration ALD6 Deletion, a TMA29 Deletion and an Alcohol junction, primers oGV2320 and oGV3070 were used. Dehydrogenase with Increased k, and Decreased 0486 Yeast cells were cultured by inoculating 3 mL of K in S. cerevisiae YPD medium (1% (w/v) yeast extract, 2% (w/v) peptone, 2% 0489. The following example illustrates that the combina (w/v) glucose) in a 14 mL culture tube in triplicate for each tion of an ALD6 deletion, TMA29 deletion and overexpres strain. Cultures were started from patches on aYPD plate 1% sion of a gene encoding an ADH with improved kinetic prop (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glucose, 2% erties leads to increased isobutanol production and theoretical agar). The cultures were incubated overnight at 30° C. and yield. 250 rpm. The next day, the ODoo of the overnight cultures 0490 A.S. cerevisiae CEN.PK2 strain, GEVO3991, was were measured and the Volume of each culture to inoculate a constructed by transforming a S. cerevisiae CEN.PK2 strain, 50 mL culture to an ODoo of 0.1 was calculated. The calcu GEVO3956, which expresses an improved alcohol dehydro lated volume of each culture was used to inoculate 50 mL of genase (L. lactis ADH, L1 ADH) and a decarboxylase (L. YPD in a 250 mL baffled flask and the cultures were incu lactis KIVD, Ll kiv D2) from its chromosomal DNA with a bated at 30° C. and 250 rpm overnight. Cells were harvested 2u plasmid, pGV2603 (P:Ec ilvC coSc''''', during mid-log phase at ODs of 1.8-2.2. The cultures were Pre:Ll ilvD coSc, P:Ll adhA'', 2-ori. pUC-ori, transferred to pre-weighed 50 mL Falcon tubes and cells were bla, G418R), expressing genes encoding enzymes: KARI, collected by centrifugation for 5 min at 3000xg. After DHAD, and the improved ADH (Ec ilvC coSc'''''', removal of the medium, cells were washed with 10 mL MilliO Ll ilvD coSc, and Ll adhA''', respectively).

TABLE 60 Genotype of Strains Disclosed in Example 19. GEVO No. Genotype GEVO3991 MATaura3 leu2 his3 trp1

pdcóA::Priders:Sc AFT1:PeNo2:Ll adhA':T-ky UR43 a?: P:KI URA3:T Kevolved for C2 Supplement-independence, glucose tolerance and faster growth, pGV2603) GEVO3956 MATaura3 leu2 his3 trp1 ald6A::Peo:Ll adhA':Pe:Sc TRP1

pdc1A::Pepci:Ll kiv D2 coSciS:Pre-1:LEU2:Tier2:Papti:BS alsS1 coSc:Tcyc1:Peok:Ll kiv D2 coEc: US 2011/020 1 090 A1 Aug. 18, 2011 66

TABLE 60-continued Genotype of Strains Disclosed in Example 19. GEVO No. Genotype pdc6A::Pridia:Sc AFT1:Peno2:Ll adhA:T K UR43 a?: Pe:KI URA3:TK, as evolved for C2 Supplement-independence, glucose tolerance and faster growth

0491. A fermentation was performed to determine the per microaerobic fermentation. Samples for liquid chromatogra formance of GEVO3991 (L1 adhA, ALD6A, TMA29A) phy (LC), gas chromatography (GC) analysis and ODoo in four replicate fermenters. Glucose consumption, isobu were taken at roughly 24 h intervals. The samples (2 mL) tanol production, isobutyrate production, acetate production were centrifuged at 18,000xg for 10 min and 1.5 mL of the and ODoo were measured during the fermentation. For these clarified supernatant was used for analysis by GC1 and LC1. fermentations, single isolate cell colonies grown onYPDagar plates were transferred to 500 mL baffled flasks containing 80 0494. Fermentations started at an ODoo of about 4. The mL of YPD containing 80 g/L glucose, 5 g/L ethanol, 0.5 g/L cells grew to an ODoo of about 8 by 72 h of microaerobic MgSO and 0.2 g/L G418 and incubated for 30 hat 30°C. in fermentation. After 72 h, the isobutanol titer was 12.3 g/L and an orbital shaker at 250 rpm. The flask cultures were trans the isobutanol yield was 67.2% of theoretical. Isobutyrate ferred to four individual 2 L top drive motor fermenter vessels titer and yield were low: 0.6 g/L isobutyrate was produced at with a working volume of 0.9 L of YPD containing 80 g/L a yield of 0.013 g/g, glucose. The production of DH2MB was glucose, 5 g/L ethanol, 0.5 g/L MgSO4, and 0.2 g/L G418 per not detected. vessel for a starting ODoo of 0.3. Fermenters were operated at 30° C. and pH 6.0 controlled with 6N KOH in a 2-phase Example 20 aerobic condition based on oxygen transfer rate (OTR). Ini tially, fermenters were operated at a growth phase OTR of 10 mM/h by fixed agitation of 700 rpm and an air overlay of 5 Effect of TMA29 Deletion in K. marxianus sL/h. Cultures were grown for 22.5 h to approximately 10-11 ODoo then immediately switched to production aeration 0495. The purpose of this example is to demonstrate that conditions for 40.7 h. Cell density during production phase the deletion of TMA29 in a Kluyveromyces marxianus strain approached 13-14 ODoo. The production phase was operated comprising ALS activity results in reduced DH2MB produc at an OTR of 0.5 mM/h by fixed agitation of 300 rpm. Peri tion. odically, samples from each fermenter were removed to mea 0496 Strains, plasmids, and oligonucleotide sequences Sure ODoo and to prepare for gas chromatography (GC) and liquid chromatography (LC) analysis. For GC and LC, 2 mL disclosed in this example are listed in Tables 61, 62, and 63, sample was removed into an Eppendorf tube and centrifuged respectively. in a microcentrifuge for 10 min at maximum. One mL of the supernatant was analyzed by GC1 (isobutanol, other metabo TABLE 61 lites) and one mL analyzed by high performance liquid chro matography (LC1) for organic acids and glucose as Genotype of Strains Disclosed in Example 20. described. 0492 GEVO3991 achieved a cell density of 13.8 during GEVO No. Genotype the 22.5 h growth phase. The isobutanol produced during the 1947 ura,3-delta2, derived from strain NRRL-Y-7571 entire duration of the experiment (63.2 h) was 18.6+0.9 g/L Kluyveromyces marxianus (E. C. Hansen) van der Walt with 0.84+0.10 g/L isobutyrate and 0.15+0.02 g/L acetate (1971) produced. The theoretical isobutanol yield achieved during 2348 ura,3-delta2 pdc1A::G418R, the production phase of the experiment (22.5-63.5 h) was Ps PC:31COX4 MTS:Bs alss:Ps 1:URA3 80.3+1.1% while the isobutyrate yield was only 0.013+0.001 ura-delta2 g/g glucose. The production of DH2MB was not detected. 6403, 64.04 ura,3-delta2 pdc1A::G418R, 0493. In addition, three independent transformants of Ps PC:31COX4 MTS:alsS: Ps. 1:URA3 ura3 GEVO3991 were also characterized in shake flasks. The delta2 tma29A::Ps 11-hph strain was grown overnight in 3 mL of YPD containing 1% ethanol and 0.2 g/L G418 at 30°C. at 250 rpm. These cultures were diluted to an ODoo of 0.1 in 50 mL of the same medium in a baffled 250 mL flask and grown overnight. The ODoo TABLE 62 was measured and a Volume of cells approximately equal to 250 ODoo was collected for each culture by centrifugation at Plasmid Disclosed in Example 20. 2700 rcf for 2 minutes and the cells were resuspended in 50 Plasmid mL of fermentation medium (YPD containing 80 g/L glu Name Relevant Genes/Usage Genotype cose, 0.03 g/L ergosterol, 1.32 g/L Tween80, 1% V/v ethanol, pGV2701 For SOE PCR to give the hph P:hph, CEN, plJC ori, 200 mMMES, pH6.5), and transferred to an unbaffled vented fragment bla screw cap 250 mL flask. The ODoo was checked and the cultures were placed at 30° C. at 75 rpm to initiate the US 2011/020 1 090 A1 Aug. 18, 2011 67

TABL E 63 Oligonucleotide Sequences Disclosed in Example 20. Primer Sequence 3498 ATGTCTCAAGGTAGAAGAGCTG (SEQ ID NO: 142) 3137 GGAGTAGAAACATTTTGAAGCTATGTATATCTTCTGAATCAATTGCACCGAC (SEQ ID NO: 143)

314 O CAAATTTTTCTTTTTTTTCTGTACAGAGAGGTATGATTAATACCAATGTCTTGGG (SEQ ID NO: 144)

34.99 TCATTCACCACGGTAAATGTGG (SEQ ID NO: 145) 31.38 GTCGGTGCAATTGATTCAGAAGATATACATAGCTTCAAAATGTTTCTACTCC (SEQ ID NO: 146)

3139 GTATTAATCATACCTCTCTGTACAGAAAAAAAAGAAAAATTTGAAATATAAATAACG (SEO ID NO : 147)

35O1 GAAGGAAATTCCAGTCTCCTAGTTCCTTTGAACAC (SEQ ID NO: 148)

232O GGCTGTGTAGAAGTACTCGCCGATAG (SEQ ID NO: 149)

3500 CAGAACAATCAATCAACGAACGAACGACCCACCC (SEQ ID NO: 15O)

821 CGGGTAATTAACGACACCCTAGAGG (SEQ ID NO: 151)

3141 AAGGAGATGCTTGGTTTGTAGCAAACACC (SEQ ID NO: 152)

0497 Strain Construction: The K. marxianus TMA29 0500 Fermentation: Shake flask fermentations was per gene homolog encoding the K. marxianus TMA29 protein formed in triplicate for each of the strains GEVO2348 (SEQ ID NO. 23) was deleted from parent K. marxianus (TMA29), GEVO6403 (tma29A), and GEVO6404 (tma29A) strain GEVO2348 as follows, resulting in strains GEVO6403 as described to determine if deletion of TMA29 in strains and GEVO6404. expressing BS alsS would result in diminished production of 0498 Genomic DNA was isolated from GEVO 1947 as DH2MB. Single colony isolated transformants of tima29A described. Constructs were made to integrate the E. coli hph strains were patched to YPE plates containing 0.1 g/L hygro (hygromycin resistance) cassette into the TMA29 locus of mycin, while parent strains were patched to YPE plates. Cells GEVO2348 by SOE PCR as described. PCR step #1 consisted from the patches were used to inoculate 3 mL cultures of YPE. of three reactions resulting in the 5' TMA29 targeting Cultures were incubated overnight at 30° C. and 250 rpm. sequence, the 3' TMA29 targeting sequence, and the hph After overnight incubation, the ODoo of these cultures was marker. The 5' targeting sequence was amplified from pre determined by diluting 1:40 in water. The appropriate amount pared GEVO1947 genomic DNA with primers oGV3498 and oGV3137. The 385bp fragment was purified by gel electro of culture was added to 50 mL of YPE to obtain an ODoo of phoresis. The 3' targeting sequence was amplified from pre 0.1 in 250 mL baffled flasks and incubated at 30° C. and 250 pared GEVO1947 genomic DNA with primers oGV3140 and rpm. After a 24h incubation, the ODoo of these cultures was oGV3499. The 473 bp fragment was gel purified. The Pr: determined by diluting 1:40 in water. The appropriate amount hph:To cassette was amplified from pCV2701 with of culture was added to 50 mL of YPD containing 8% glucose primers oGV3138 and oGV3139. The 1,651 bp fragment was and 200 mM MES, pH 6.5 to obtain an ODoo of 5. Fermen gel purified. The final SOE PCR step joined the 3 products tation cultures were incubated at 30° C. and 75 rpm in from step #1 (5' targeting sequence/hph marker/3' targeting unbaffled 250 mL flasks. One 15 mL aliquot of medium was sequence). The reaction was amplified using primers also collected to use as a blank for LC4 analysis and was kept oGV3498 and oGV3499. The 2,414 bp fragment was gel at 4°C. until sample submission. After 72 h, 1.5 mL of culture purified as described and used for transformation of was removed and samples were prepared as above for ODoo GEVO2348 as described. Medium used to grow the cells for and LC4 analysis. In addition, samples for enzyme assays the transformation was YPE. Following the transformation, were harvested at 72 h by transferring 80 OD's of the appro 150 uL of the transformation culture was spread onto YPE priate sample to two 15 mL Falcon tubes centrifuged at plates containing 0.1 g/L hygromycin. The plates were incu 3000xg for 5 min at 4°C. Pellets were resuspended in 3 mL bated at 30° C. and transformed colonies were single colony cold, sterile water and were centrifuged at 5000xg for 2 min isolated and then patched for colony PCR on YPE plates at 4°C. in a Swinging bucket rotor in the tabletop centrifuge. containing 0.1 g/L hygromycin. The water was removed by vacuum aspirator. The conical 0499 Yeast Colony PCR was used to screen for the appro tubes were stored at -80° C. priate 3' integration junction, 5' integration junction, as well 0501. The in vitro ALS enzymatic activities of the lysates as lack of the TMA29 coding region as described. The proper were measured as described. Table 64 shows the average in 3' integration junction was confirmed using primers vitro ALS enzymatic activity of lysates from the strains after oGV3501 and 2320. The proper 5' integration junction was 72 h. ALS activity is measurable in GEVO2348 (average of confirmed using primers oGV3500 and oGVO821 were used. 3.14 Units/mg lysate) as well as in both tima29A strains Finally, to screen for deletion of the TMA29 internal coding GEVO6403 and GEVO6404 (averages of 1.63 and 1.58 region, primers oGV3500 and oGV3141 were used. Units/mg lysate respectively). US 2011/020 1 090 A1 Aug. 18, 2011 68

0502 Table 64 also shows the DH2MB and DHIV titers by LC4 for these strains. GEVO2348 (TMA29) strains produced TABLE 66 average DH2MB titers of 0.89 g/L while DHIV was not detected. The DH2MB titers were significantly decreased in Plasmids Disclosed in Example 21. the tima29A Strains GEVO6403 and GEVO6404 which mea Plasmid Name Relevant Genes/Usage Genotype sured at 0.16 and 0.15g/L respectively. While the ALS activ ity is decreased in the tima29A Strains, this does not account pGV1429 High copy 1.6L empty 1.6-ori, PMB1 ori, bla, for the D-80% decrease in DH2MB titers in the deletion vector containin g TRP1 TRP1 pGV1645 High copy 1.6L vector 1.6-ori, PMB1 ori, bla, strains. For example, one technical replicate of GEVO2348 containing TRP1 and Bs alsS TRP1, Bs alss exhibited an ALS activity of 2.5 Units/mg lysate and pro pGV1726 Vector containing TRP1 and PMB1 ori, bla, TRP1, duced 0.83 g/L DH2MB while one of the technical replicates (linearized with Bs alsS Bs alss of the tima29A strain GEVO6404 has similar activity of 1.9 Ahdl) Units/mg lysate and produced only 0.16 g/L DH2MB.

TABLE 64 TABL E 67 ALS Activity, DH2MB and DHIV titers, and Percent DH2MB Decrease in tma29A Strains After 72 h Fermentation. Oligonucleotide Sequences Disclosed in Example 21.

ALS Primer Sequence Activity DH2MB DH2MB AAAAAGGAGTAGAAACATTTTGAAGCTATGCGTTGATAAGG (U/ by LC4 DHIV by decrease GCAACAACGTTAGTATC Strain TMA29 mg lysate) (gL) LC4 (gL) (%) (SEQ ID NO: 53) GEVO2348 -- 3.10.5 0.89 O.O7 n.d. GEVO6403 A 16 O2 (0.16 O.O2 n.d. 82% ATACTAACGTTG TGCCCTTATCAACGCATAGCTTCAAAAT GEVO6404 A 1.6 O.3 0.15 OO1 n.d. 83% GTTTC TACTCCT. TTTTAC (SEQ ID NO: 54) n.d. = not detected TCAAATTTTTCT TTTTTTCTGTACAGTTACCCAAGCTGTT TTGCCTATTTTCAAAGC Example 21 (SEQ ID NO: 55) GCTTTGAAAATAGGCAAAACAGCTTGGGTAACTGTACAGAA Effect of TMA29 Deletion in Kluyveromyces lactis AAAAAAGAAAAA TTG (SEQ ID NO: 56)

0503. The purpose of this example is to demonstrate that oGW3 1.03 ACCGGTGCTTCTGCAGGTATTG the deletion of TMA29 in a Kluyveromyces lactis strain com (SEQ ID NO: 57) prising ALS activity results in reduced DH2MB production. oGW3 1.06 ATGCTTGGTTGGAAGCAAATAC 0504 Strains, plasmids, and oligonucleotide primers dis (SEQ ID NO: 58) closed in this example are listed in Tables 65, 66, and 67. respectively.

TABLE 65

Genotype of Strains Disclosed in Example 21.

GEVO Number Genotype

1742 MATalpha uraA1 trp 1 leu2 lysA1 ade1 lac4-8 pKD1 pcic ::kan, derived from K. lactis strain ATCC 200826 (Kluyveromyces lactis (Dom browski) van der Walt, teleomorph) 4458 MATalpha uraA1 trp 1 leu2 lysA1 ade1 lac4-8 pKD1 pcic ::kantma29::hph 6310, 6311, 6312 MATalpha uraA1 trp 1 leu2 lysA1 ade1 lac4-8 pKD1 pdc ::kan pCV1429 6313, 6314, 6315 MATalpha uraA1 trp 1 leu2 lysA1 ade1 lac4-8 pKD1 pdc ::kan pCV1645 6316,6317 MATalpha uraA1 trp 1 leu2 lysA1 ade1 lac4-8 pKD1 pcic ::kan + random integration of Bs alss:TRP1 6318, 6319, 6320 MATalpha uraA1 trp 1 leu2 lysA1 ade1 lac4-8 pKD1 pdc ::kantma29::hph pGV1429) 6321, 6322, 6323 MATalpha uraA1 trp 1 leu2 lysA1 ade1 lac4-8 pKD1 pdc ::kantma29::hph pGV1645) 6324, 6325 MATalpha uraA1 trp 1 leu2 lysA1 ade1 lac4-8 pKD1 pcic ::kantma29::hph + random integration of Bs alss:TRP1 US 2011/020 1 090 A1 Aug. 18, 2011 69

was determined by diluting 1:40 in water. The appropriate TABLE 67 - continued amount of culture was added to 50 mL of YPD containing 8% glucose, 200 mM MES pH 6.5 or SCD-W containing 8% Oligonucleotide Sequences Disclosed in Example 21. glucose to obtain an ODoo of 5. When 250 OD's were not available to start the fermentation, the entire 50 mL culture Primer Sequence was used. Fermentation cultures were incubated at 30°C. and dGW1321 AATCATATCGAACACGATGC 75 rpm in unbaffled 250 mL flasks. A 15 mL conical tube was (SEO ID NO: 159) also collected for media blanks for LC1 and LC4 analysis as oGW1324 AGCTGGTCTGGTGATTCTAC described and kept at 4°C. until sample submission. At the 72 (SEQ ID NO: 16O) h timepoint, 1.5 mL of culture was collected. ODoo values were determined and samples were prepared for LC1 and LC4 analysis by centrifuging for 10 min at 14,000 rpm and 0505 Strain Construction: The K. lactis TMA29 gene removing 1 mL of the Supernatant to be analyzed. In addition homolog encoding the K. lactis TMA29 protein (SEQID NO: samples for enzyme assays were harvested at the 72 h time 7) was deleted from parent K. lactis strain GEVO1742 as point. 60 OD's of the appropriate sample were transferred follows, resulting in strain GEVO4458 as described in into a 15 mL Falcon tube and centrifuged at 3000xg for 5 min Example 18. at 4°C. Pellets were resuspended in 3 mL cold, sterile water 0506 K. lactis strains GEVO1742 (parent, TMA29) and and transferred to 3, 1.5 mL Eppendorf tubes (1 mL each) to GEVO4458 (tma29A) were transformed with plasmid make 3x20 OD replicates. The tubes were centrifuged at pGV1429 (empty control vector), pGV1645 (expressing 5000xg for 2 min at 4°C. in a swinging bucket rotor in the Bs alsS) or with Ahd I linearized plasmid pGV 1726 (result tabletop centrifuge. The water was removed by vacuum aspi ing in random integration of Bs alss) as described, resus rator. The Eppendorf tubes were stored at -80° C. pended in 400 uL of 1.25xSC-HWLU and spread over 0508. The in vitro ALS enzymatic activities of the lysates SCD-W plates to select for transformed cells. Random inte were measured as described. Table 68 shows the average in gration of Ahd I linearized pGV1726 in both GEVO1742 and vitro ALS enzymatic activity of lysates from the strains after tma29A strain GEVO4458 was confirmed by colony PCR 72 h. ALS activity was measurable only in strains with with primers oGV 1321 and oGV 1324 that are specific to the Bs alsS randomly integrated (GEVO6316, GEVO6317, internal BS alsS coding region as described. Strains GEVO6324, 6325) or expressed from plasmid (GEVO6313 GEVO6316, GEVO6317, GEVO6324, and GEVO6325 were 6315, GEVO6321-6323). ALS activity in strains with positive for the gene integration. Bs alss integrated is lower than in strains expressing Bs alsS 0507 Fermentation: A shake flask fermentation was per from plasmid. However, the activity of 0.25 Units/mg lysate formed on the various GEVO strains (Table 65) as described in the TMA29 strains with integrated Bs alsS (GEVO6316, to determine if deletion of TMA29 in strains expressing GEVO6317) was still enough to produce a titer 1.06 g/L of Bs alsS would result in diminished production of DH2MB. combined DHIV+DH2MB. Single colony isolated transformants were patched to SCD-W 0509 Table 68 shows the combined DHIV+DH2MB titers plates, non transformed parents were patched onto YPD. for the various strains after 72h offermentation based on LC1 Cells from the patches were used to inoculate 3 mL cultures in analysis. Strain GEVO1742 (parent, TMA29) strains pro either YPD (parent strains and integrated strains) or 3 mL duced measurable combined DHIV+DH2MB titers only SCD-W. Cultures were incubated overnight at 30° C. and 250 when Bs alsS was randomly integrated (1.06 g/L) or rpm. After overnight incubation, the ODoo of these cultures expressed from plasmid pGV1645 (0.45 g/L). These DHIV+ was determined by diluting 1:40 in water. The appropriate DH2MB titers were abolished in the tima29A strain amount of culture was added to 50 mL of YPD containing 5% GEVO4458 when expressing Bs alsS via random integration glucose or SCD-W containing 5% glucose to obtain an ODoo (GEVO6324, GEVO6325) or plasmid (GEVO6321-6323). of 0.1 in 250 mL baffled flasks and incubated at 30° C. and LC4 analysis indicated that the majority of the combined 250 rpm. After 24 h incubation, the ODoo of these cultures DHIV+DH2MB titer was in fact DH2MB.

TABLE 68 ALS Activity, Combined DHIV + DH2MB Titer, and Percentage of DH2MB of Combined DHIV + DH2MBTiter.

Plasmid DHIV- %DH2MB in Integrated (I), DH2MB DH2MB - Parent plasmid (P), ALS Activity by LC1 DHIV Strain Strain or control (C) TMA29 ALS (Umg lysate) (gL) by LC4

GEVO1742 Ole -- OOOOOO OOOOOO na GEVO6316,6317 GEVO1742 pGV1726 (I) -- -- O.25 OO6 1.06 O.23 80.0 - 3.7 GEVO4458 GEVO1742 none A OOOOOO OOOOOO na GEVO6324, 6325 GEVO4458 pGV1726 (I) A -- O.86 O.28 OOOOOO na GEVO6310-6312 GEVO1742 pGV1429 (C) + OOOOOO OOOOOO na GEVO6313-6315 GEVO1742 pGV1645 (P) + -- 6.12 1.09 O45 O.O2 87.22.3 GEVO6318-6320 GEVO4458 pGV1429 (C) A OOOOOO OOOOOO na GEVO6321-6323 GEVO4458 pGV1645 (P) A -- 1.23 O.45 OOOOOO na

nia = not applicable, samples had no detectable peak by LC1 so were not analyzed by LC4 US 2011/020 1 090 A1 Aug. 18, 2011 70

Example 22 in 250 mL baffled flasks to an ODoo of 0.01 and the cultures were grown at 30° C. and 250 rpm until they reached an Effect of TMA29 Deletion in I. Orientalis ODoo of approximately 4-8. This culture was used to inocu 0510. The following example illustrates that deletion of late 50 mL ofYPD containing 8% glucose, 200 mMMES pH the I. Orientalis TMA29 gene results in decreased TMA29 6.5 to a final ODoo of 4-5 by centrifuging an appropriate activity and also results in decrease in DH2MB production in amount of culture at 2,700xg for 3 minin a 50 mL Falcon tube strains comprising ALS activity. and then resuspending the cell pellet in 50 mL of the stated

TABLE 69 Genotype of Strains Disclosed in Example 22. GEVO fi Relevant Genotype GEVO4450 ura Afura A pdc1-1A::Ll kiv D: Ts: loXP: Pay: BS alss. pdc1-2A::Ll kiv D: Tscyc1: loXP: PENo.1: BS alss TMA29,TMA29 GEVO12425 ura Afura A pdc1-1A:: Ll kiv D: Ts: loXP: Pay: BS alss polc1-2A:: Ll kiv): loXP TMA29,TMA29 GEVO6155 ura Aura A pdc1-1A::Ll kiv D: Tscyc1: loXP: PENo.1: BS alss pdc1-2A::Ll kiv D: loxP TMA29, ma29A::Pe:Ll adhA: Prs: Ec ilvC''': loxP: URA3: loxP: Po: Ll ilvD GEVO6158 ura Afura A pdc1-1A:: Ll kiv D: Tscycl: loXP: PENo.1: BS alsS pdc1-2A:: Ll kiv D: loxP ma29A: Pe: Ll adhA': Ps: Ec ilvC'-' coCB: lox P: URA3: loxP: Po: Ll ilv) ma29A: Perc: Ll adhA': Ports:Ec ilvC''': loxP: URA3: loxP: Pevo: Ll ilvD GEVO12473 ura Afura A pdc1-1A: Ll kiv D: Tsco: loXP: Pryo: BS alsS pdc1-2A:: Ll kiv D: loxP ma29A:: OxP:URA3: OxP. ma29A::OxP:MEL5: OxP GEVO12474 ura Afura A pdc1-1A:: Ll kiv D: Tscycl: loXP: PENo.1: BS alsS pdc1-2A:: Ll kiv D: loxP ma29A:: OxP:URA3: OxP. ma29A:: OxP:MEL5: OxP

0511 Strain Construction: Issatchenkia Orientalis strains medium. Cells were incubated in 250 mL non-baffled flasks derived from PTA-6658 were constructed that were wild-type at 30° C. and 75 rpm for 48 h (fermentation phase). Eighty OD for the TMA29 gene (GEVO4450, GEVO12425), heterozy cell pellets were harvested as described. Cells were resus gous for deletion of one copy of the TMA29 gene pended, lysed and assayed for TMA29 activity as described. (GEVO6155), or completely deleted for the TMA29 gene 0513 Table 70 shows the specific TMA29 activity of (GEVO6158, GEVO12473, GEVO12474) using standard lysates of I. orientalis strains GEVO4450, 6155, and 6158 in yeast genetics and molecular biology methods. These strains U/mg of total protein. Specific TMA29 activity is reduced in also carry a copy of the Bacillus subtilis alss gene. GEVO6155 (tma29/TMA29) and GEVO6158 (complete 0512 TMA29 Enzyme Assay: For the TMA29 in vitro tma29 deletion) as compared to GEVO4450 (TMA29/ assay, I. orientalis strains GEVO4450 (TMA29/TMA29), TMA29). GEVO6155 (tma29A/TMA29), and GEVO6158 (complete tma29A/tma29A) were grown by inoculating 25 mLYPD in TABLE 70 125 mL baffled flasks with cells from a fresh YPD plate. Cultures were grown overnight at 30° C. and 250 rpm. These TMA29 Activity in I. Orientalis Strains. cultures were used to inoculate 50 mL of YPD in 250 mL. TMA29 activity TMA29 activity baffled flasks to an ODoo of 0.05. The cultures were grown at Late log phase 48 h fermentation phase 30° C. and 250 rpm until they had reached an ODoo of STRAIN Umg total protein Umg total protein approximately 5-8 (late log phase). Cells were harvested by GEVO44SO O.OO48 OO1O OO27 OOO3 collecting 80 ODs of cells in a 50 mL Falcon tube and cen GEVO6155 O.OO25 OOO8 OO1OOOO1 trifuging at 2,700xg for 3 min. After removal of supernatant, GEVO6158 O.OO23 OOO3 OO1OOOO3 cells were placed on ice and washed with 5 mL cold water. Cells were centrifuged at 2,700xg for 3 minand the water was 0514 Fermentation: For the fermentation, I. Orientalis removed. The cell pellets were stored at -80° C. until use. strains GEVO12425 (TMA29/TMA29), GEVO12473 Additionally, the same strains were grown by inoculating 3 (tma29/tma29), and GEVO12474 (tma29/tma29) were mL of YPD from fresh plates and growing for 8h at 30°C. and grown by inoculating 12 mLYPD in 125 mL baffled flasks 250rpm. These cultures were used to inoculate 50 mL ofYPD with cells from a fresh YPD plate. Cultures were grown US 2011/020 1 090 A1 Aug. 18, 2011

overnight at 30° C. and 250 rpm. The ODoo of the 12 mL day, the cultures were diluted in YPD with 5% glucose to an overnight cultures were determined and the appropriate ODoo of approximately 0.15 and incubated overnight at 250 amount was used to inoculate 50 mL YPD containing 5% rpm and 30° C. The cells were harvested upon reaching an glucose in 250 mL baffled flasks to an ODoo of 0.1. The flasks ODoo of between 4 and 6. To harvest pellets for enzyme were incubated at 30° C. and 250 rpm overnight. The ODoo assays 80 ODs of the appropriate sample were transferred of the 50 mL cultures was determined. The appropriate into two 15 mL Falcon tube (for duplicate samples) and amount of culture was centrifuged at 2700 rcf for 5 min at 25° centrifuged at 3000xg for 5 min at 4°C. Pellets were resus C. in 50 mL Falcon tubes and the supernatant removed. The pended in 3 mL cold, sterile water and were centrifuged at cells from each 50 mL culture were resuspended in 50 mL 5000xg for 2 min at 4°C. in a swinging bucket rotor in the YPD containing 8% glucose, 200 mM MES, pH 6.5. The tabletop centrifuge. The water was removed by vacuum aspi cultures were then transferred to 250 mL unbaffled screw-cap rator. The pellets were stored at -80° C. Lysates were pre flasks and incubated at 30° C. and 75 rpm. At 72 h samples pared and TMA29 enzyme assays were performed as from each flask were removed, the ODoo was measured and described. samples prepared for LC4 analysis by transferring 1 mL 0518. The specific activity of S. pombe GEVO6444 sample to an Eppendorf tube and centrifuging at 18,000xg, 10 lysates for the reduction of (S)-2-acetolactate was 0.018+0. seconds, 25°C. After centrifugation, 0.75 mL of supernatant 002 U/mg total protein. Lysates of the tima29A strain was transferred to a microtiter plate and analyzed by LC4. GEVO6445 had a specific activity of 0.001+0.002 U/mg total Also at 72 h cells for enzyme assays were collected by trans protein. ferring 80 ODs to 15 mL Falcon tubes as described. Cells for ALS assays were resuspended, lysed, and assayed as Example 24 described. 0515 Table 71 shows the DH2MB production and ALS Effect of ALD6 Deletion in K. marxianus activities for GEVO 12425, 12473, and 12474 at 72 h. The 0519. The purpose of this example is to demonstrate that DH2MB titer was determined by LC4. The ALS activity was the deletion of ALD6 in a Kluyveromyces marxianus Strain similar in all strains. results in reduced isobutyraldehyde oxidation activity and isobutyrate production. TABLE 71 0520 Strains, plasmids, and oligonucleotide primers dis DH2MB Production and ALS Activity in I. orientalis Strains at 72h closed in this example are listed in Tables 73, 74, and 75, Fermentation. respectively

DH2MB by LC4 ALS activity TABLE 73 STRAIN g/L) Umg

GEVO1242S 1870.60 4..6+ 1.1 Genotype of K. marxianus Strains Disclosed in Example 24. GEVO12473 O.O8 O.O1 4.O. O.1 GEVO12474 O.07 - O.OO 3.11.1 GEVO Number Genotype GEVO1947 ura-delta2 GEVO6264, ura,3-delta2 ald6A::P1-hph GEVO626S Example 23 GEVO2O87 ura,3-delta2, PDC1, Psi Pic:31COX4 MTS:alsS:Ps 13:kivD co HMI1 Effect of TMA29 Deletion in S. pombe MTS:Ps apti:ADH7:Ps FB41:URA3 0516. The following example illustrates that the (S)-2- GEVO6270 ura3-delta2, PDC1, Ps. 1:31COX4 acetolactate reduction activity is significantly decreased in an GEVO6271 MTS:alsS:Ps 13:kivD co HMI1 S. pombe tima29A strain compared to an S. pombe TMA29 strain. TABLE 74 TABLE 72 Plasmids Disclosed in Example 24. Genotype of Strains disclosed in Example 23. Plasmid Name Relevant Genes/Usage Genotype GEVO fi Genotype Source pGV2701 For SOE PCR to give the P:hph, CEN, plJC ori, bla GEVO6444 hade6-M216, ura4-D18, leu1-32 Bioneer strain hph fragment BG OOOOH8 GEVO6445 h+ SPAC521.03A::kanMX4, ade6- Bioneer strain M216, ura4-D18, leu1-32 BG 1772H TMA29 homolog (SEQ ID NO: 22) deleted TABL E 75 Oligonucleotide Sequences Disclosed in Example 24. 0517 Yeast strains GEVO6444 which has an intact TMA29 gene (SEQ ID NO: 161) and GEVO6445 which has Primer Sequence the TMA29 gene deleted, were grown overnight in 12 mL oGW.349 O GTCAAGATTGTTGAACAAAAGCC YPD in 125 mL baffled flasks at 250 rpm and 30° C. The next (SEQ ID NO: 162) day, ODoo values were determined and technical triplicate oGW.3492 GAGTAAAAAAGGAGTAGAAACATTTTGAAGCTATGGTTTAG cultures were started in 50 mL YPD with 5% glucose at an TGGGGTTGGGGAAGCTGGC ODoo of approximately 0.3. Cultures were allowed to grow (SEQ ID NO: 163) at 250 rpm and 30°C. throughout the day. At the end of the US 2011/020 1 090 A1 Aug. 18, 2011 72

initial colony PCR screening, then single colony isolated and TABLE 75- continued repatched on YPD plates supplemented with 0.2 g/L hygro mycin. Oligonucleotide Sequences Disclosed in Example 24. 0523 Yeast Colony PCR was used to screen for the appro Primer Sequence priate 3' integration junction, 5' integration junction, as well as lack of the ALD6 coding region as described. The proper3 oGV3493 CAAATTTTTCTTTTTTTTCTGTACAGGCCAACATCAAGAAG integration junction was confirmed using primers oGV3497 ACTATTCCAAACTTGGTC (SEQ ID NO: 164) and oGV2320. The proper 5' integration junction was con firmed using primers oGV3496 and OGVO821. Finally, dele oGV349s TGTATGATTCGAAAGCTTCTTCACC tion of the ALD6 internal coding region was confirmed using (SEQ ID NO: 165) primers oGV3495 and oGV0706. oGW.3491 GCCAGCTTCCCCAACCCCACTAAACCATAGCTTCAAAATGT TTCTACTCCTTTTTTACTC 0524 Fermentation: A shake flask fermentation with 2 g/L (SEQ ID NO: 166) isobutyraldehyde was performed as described using technical triplicates of the ald6A strains GEVO6264/GEVO6265 and oGW.3494 GACCAAGTTTGGAATAGTCTTCTTGATGTTGGCCTGTACAG AAAAAAAAGAAAAATTTG GEVO6270/GEVO6271 and their corresponding ALD6 par (SEO ID NO: 167) ent Strains GEVO1947 and GEVO2087. oGV3 497 TTACTCGAGCTTGATTCTGAC 0525 Single colony isolated transformants of confirmed (SEQ ID NO: 168) ald6A strains were patched to YPD plates supplemented with 0.2 g/L hygromycin plates and parents were patched to YPD oGW232O GGCTGTGTAGAAGTACTCGCCGATAG plates. Cells from the patches were used to inoculate technical (SEQ ID NO: 169) triplicate 3 mL cultures of YPD. Cultures were incubated oGW.3496 ATGTCTTCATCACTAGCAGAG overnight at 30° C. and 250 rpm. After overnight incubation, (SEO ID NO: 17O) the ODoo of these cultures was determined by diluting 1:40 dGWO821 CGGGTAATTAACGACACCCTAGAGG in water. The appropriate amount of culture was added to 50 (SEO ID NO: 171) mL of YPD with 5% glucose to obtain an ODoo of 0.1 in 250 mL baffled flasks and cultures were incubated at 30° C. and oGWOf O6 GGTTGGTATTCCAGCTGGTGTCG (SEO ID NO: 172) 250 rpm. After 24h incubation, the ODoo of these cultures was determined by diluting 1:40 in water. The appropriate amount of culture was added to 50 mL of YPD containing 8% 0521 Strain Construction: The K. marxianus ALD6 gene glucose, 200 mMMES pH 6.5, and 2 g/L isobutyraldehyde to homolog encoding the K. marxianus ALD6 protein (SEQID obtainan ODoo of5. Fermentation cultures were incubated at NO: 39) was deleted from parent K. marxianus strains 30° C. and 75 rpm in unbaffled 250 mL flasks. Unused media GEVO1947 and GEVO2087 as follows, resulting in strains was collected as a media blank for LC analysis and kept at 4° GEVO6264/GEVO6265, and GEVO6270/GEVO6271 C. until sample submission. At 48 h, samples from each of the respectively. flasks were taken as follows. 1.5 mL of culture was removed 0522 Genomic DNA was isolated from GEVO 1947 as into 1.5 mL Eppendorf tubes. ODoo values were determined described. Constructs were made to integrate the E. coli hph and samples were prepared for LC1 analysis. Each tube was centrifuged for 10 min at 14,000 rpm and the supernatant was (hygromycin resistance) cassette into the ALD6 locus of analyzed by LC1. In addition samples for enzyme assays GEVO 1947 and GEVO2087 by SOE PCR as described. PCR were harvested after 48 h. 80 ODs of the appropriate sample step #1 consisted of three reactions: the 5' ALD6 targeting were transferred into two 15 mL Falcon tube (for duplicate sequence, the 3' ALD6 targeting sequence, and the hph samples) and centrifuged at 3000xg for 5 min at 4°C. Pellets marker. The 5' targeting sequence was amplified from pre were resuspended in 3 mL cold, sterile water and were cen pared GEVO1947 genomic DNA with primers oGV3490 and trifuged at 5000xg for 2 min at 4°C. in a swinging bucket oGV3492. The 635 bp fragment was purified by gel electro rotor. The water was removed by vacuum aspirator. The coni phoresis. The 3' targeting sequence was amplified from pre cal tubes were stored at -80° C. pared GEVO1947 genomic DNA with primers oGV3493 and 0526 Table 76 shows the isobutyrate titer after 48 h of oGV3495. The 645bp fragment was gel purified. The Pe: fermentation. The ALD6 parent strain GEVO1947 produced hph:Tcl cassette was amplified from pCV2701 with average total and specific isobutyrate titers of 0.19 g/L and primers oGV3491 and oGV3494. The 1,665 bp fragment was 0.013 g/L/OD, respectively. These total and specific isobu gel purified. The final SOE PCR step joined the 3 products tyrate titers were significantly decreased in the ald6A strain from step #1 (5' ALD6 targeting sequence/hph/marker/3' GEVO6264 (0.06 g/L and 0.004 g/L/OD respectively), and ALD6 targeting sequence). The reaction was amplified using also in the ald6A strain GEVO6265 (0.05 g/L and 0.003 primers oGV3490 and oGV3495. The 2,826 bp fragment was g/L/OD respectively). The ALD6 parent strain GEVO2087 gel purified and used for transformations of GEVO1947 and produced total and specific isobutyrate titers of 0.15 g/L and GEVO2087 as described. Medium used to grow cells for the 0.008 g/L/OD, respectively. The total and specific isobutyrate transformation was YPD. Following the transformation, 150 titers were significantly decreased in the ald6A strain uL of each transformation culture was spread onto YPD plates GEVO6270 (0.05 g/L and 0.003 g/L/OD), and also in the Supplemented with 0.2 g/L hygromycin. The plates were ald6A strain GEVO6271 (0.08 g/L and 0.005 g/L/OD, respec incubated at 30°C. Transformed colonies were patched for tively). US 2011/020 1 090 A1 Aug. 18, 2011 73

TABLE 76 TABL E 79 Oligonucleotide Sequences Disclosed in Example 25. Isobutyrate Production of ALD6 Parent Strains and ald6A Strains Derived From Said ALD6 Parent Strains. Primer Sequence

oGW35O2 GAAACACAGTGGATTAGTGCTGTC Isobutyraldehyde Feed (SEO ID NO: 173) Fermentation (48 hr) oGW3504 GAAGAGTAAAAAAGGAGTAGAAACATTTTGAAGCTATGCTC TTTGTAATTGTTGTTGGTG Isobutyrate (SEO ID NO: 174) Parent Titer Isobutyrate Strain Strain ALD6 (g/L) Decrease (%) oGV3s Os CAAATTTTTCTTTTTTTTCTGTACAAACAGAGTCCATCCGT TTGAAACTGATTGCATGTC (SEO ID NO: 175 GEVO1947 -- O.19 O.OS GEVO6264 GEVO1947 O.O60.02 68% oGV3s Of TCAAATTCTATTATCGCGCGGG GEVO626S GEVO1947 O.OS O.O2 74% (SEO ID NO: 176) GEVO2O87 oGW3503 CACCAACAACAATTACAAAGAGCATAGCTTCAAAATGTTTC GEVO6270 TACTCCTTTTTTACTC TTC (SEO ID NO: 177 GEVO6271 oGW.3506 GACATGCAATCAGTTTCAAACGGATGGACTCTGTTTGTACA GAAAAAAAAGAAAAATTTG (SEO ID NO: 178

Example 25 oGV3s O9 CTCCTCCGTTGCAGAACAAGGCTTTG (SEO ID NO: 179 Effect of ALD6 Deletion in K. lactis oGW232O GGCTGTGTAGAAGTACTCGCCGATAG (SEQ ID NO: 18O 0527 The purpose of this example is to demonstrate that the deletion of ALD6 in a Kluyveromyces lactis strain results oGW.3508 CGGTGTTAAGTGCCAGAAATTGGTTG in reduced isobutyraldehyde oxidation activity and isobu (SEQ ID NO: 181 tyrate production. oGWO821 CGGGTAATTAACGACACCCTAGAGG 0528 Strains, plasmids, and oligonucleotide primers dis (SEQ ID NO: 182) closed in this example are listed in Tables 77, 78, and 79, oGW351 O CGGCGTACTCGACGTCTTGAGAAGTAG respectively. (SEQ ID NO: 183)

TABLE 77 0529 Strain Construction: The K. lactis ALD6 gene Genotype of K. lactis Strains Disclosed in Example 25. homolog encoding the K. lactis ALD6 protein (SEQID NO: 29) was deleted from parent K. lactis strains GEVO1287 and GEVO Number Genotype GEVO1830 as follows, resulting in strains GEVO6242 and GEVO1287 MATC. uraA1 trp1 GEVO6244/GEVO6245, respectively. Kluyveromyces lactis (Dombrowski) van der Walt, 0530 Genomic DNA was isolated from GEVO1287 as teleomorph, ATCC 20O826 described. Constructs were made to integrate the E. coli hph GEVO6242 MATC. uraA1 trp1 eu2 lysA1 ade1 lac4-8 pKD1 ald6A::P1-hph (hygromycin resistance) cassette into the ALD6 locus of GEVO1830 MATC. uraA1 trp1 eu2 lysA1 ade1 lac4-8 pKD1 GEVO1287 and GEVO1830 by SOE PCR as described. PCR pdc1::kan:Ec ilvC AN:Ec ilvdAN cokl::Sc LEU2 step #1 consisted of three reactions: the 5' ALD6 targeting integrated sequence, the 3' ALD6 targeting sequence, and the hph {Ll kiv.D, Sc Ad h7:Km URA3 randomly integrated}{Ps ce:Bs alsS:TRP1 marker. The 5' targeting sequence was amplified from pre random integrated pared GEVO1287 genomic DNA with primers oGV3502 and GEVO6244, MATC. uraA1 trp1 eu2 lysA1 ade1 lac4-8 pKD1 oGV3504. The 639 bp fragment was purified by gel electro GEVO6245 pdc1::kan:Ec ilvC AN:Ec ilvdAN cokl::Sc LEU2 integrated phoresis. The 3' targeting sequence was amplified from pre {Ll kiv.D, Sc Ad h7:Km URA3 integrated pared GEVO1287 genomic DNA with primers oGV3505 and {Ps. cup-1:Bs a SS:TRP1 random oGV3507. The 628 bp fragment was gel purified. The Pe: integrated ald6A:: PTEF1-hph hph:Tcl cassette was amplified from pGV2701 with primers oGV3503 and oGV3506. The 1,663 bp fragment was gel purified. The final SOE PCR step joined the 3 products from step #1 (5' targeting sequence/hph marker/3' targeting TABLE 78 sequence). The reaction was amplified using primers Plasmid Disclosed in Example 25. oGV3502 and oGV3507. The 2,810 bp fragment was gel purified and used for transformations of GEVO1287 and Plasmid Name Genotype GEVO1830 as described. Colonies were selected for hygro pGV2701 P:hph, CEN, puC ori, bla mycin resistance on YPD plates supplemented with 0.1 g/L hygromycin. Yeast Colony PCR was used to screen for the appropriate 3' integration junction, 5' integration junction, as US 2011/020 1 090 A1 Aug. 18, 2011 74 well as lack of the ALD6 coding region as described. The proper 3' integration junction was confirmed using primers TABLE 81 oGV3509 and oGV2320. The proper 5' integration junction was confirmed using primers oGV3508 and oGV 0821. Genotype of Strains Disclosed in Example 26. Finally, deletion of the ALD6 internal coding region was confirmed using primers oGV3508 and oGV3510. GEVO fi Genotype Source 0531. Fermentation: A first shake flask fermentation with GEVO3527 MATC his3A-1 leu2A ATCC# 201389 (BY4742) 2 g/L isobutyraldehyde in the medium was performed using lys2A ura3A GEVO3939 MATC. his3A-1 leu2A OpenBiosystems cathi YSC1054 technical triplicates of the ald6A strain GEVO6242 and the lys2A ura3A (Yeast MATalpha collection) ALD6 wild-type parent strain GEVO1287. Single colony tma29:kan isolated transformants of confirmed ald6A deletion strains were patched to YPD plates supplemented with 0.1 g/L hygromycin plates, parent Strains were patched onto YPD. 0534 Yeast strains GEVO3939 from which the TMA29 Cells from the patches were used to inoculate technical trip (YMR226C) gene was deleted and its parent GEVO3527 licate 3 mL cultures of YPD. Cultures were incubated over were each cultured in triplicate by inoculating 3 mL of YPD night at 30° C. and 250 rpm. After overnight incubation, the in a 14 mL culture tube in triplicate for each strain. Cultures ODoo of these cultures was determined by diluting 1:40 in were started from patches on YPD agar plate for GEVO3527 water. The appropriate amount of culture was added to 50 mL and on YPD plates containing 0.2 g/L G418 for GEVO3939. of YPD with 5% glucose to obtain an ODoo of 0.1 in 250 mL The cultures were incubated overnight at 30° C. and 250 rpm. baffled flasks and cultures were incubated at 30° C. and 250 The next day, the ODoo of the overnight cultures were mea rpm. After 24h incubation, the ODoo of these cultures was sured and the volume of each culture to inoculate a 50 mL determined by diluting 1:40 in water. The appropriate amount culture to an ODoo of 0.1 was calculated. The calculated of culture was added to 50 mL of YPD containing 8% glucose, Volume of each culture was used to inoculate 50 mL of YPD 200 mMMES pH 6.5, and 2 g/L isobutyraldehyde to obtain in a 250 mL baffled flask and the cultures were incubated at an ODoo of 5. Fermentation cultures were incubated at 30°C. 30° C. and 250 rpm. and 75 rpm in unbaffled 250 mL flasks. Unused media was 0535 The cells were harvested during mid-log phase at collected as a media blank for LC1 analysis and kept at 4°C. ODs of 2.2-2.7 after 8 h of growth. The cultures were trans until sample Submission. At 24 h, samples from each of the ferred to pre-weighed 50 mL Falcon tubes and cells were flasks were taken as follows. 1.5 mL of culture was removed collected by centrifugation for 5 minutes at 3000xg. After into 1.5 mL Eppendorf tubes. ODoo values were determined removal of the medium, cells were washed with 10 mL MilliO and samples were prepared for LC1 analysis as described. H0. After removal of the water, the cells were centrifuged Each tube was centrifuged for 10 min at 14,000 rpm and the again at 3000xg for 5 minutes and the remaining water was supernatant was collected for analysis by LC1 as described. carefully removed using a 1 mL pipette tip. The cell pellets 0532. A second shake flask fermentation with 2 g/L isobu were weighed and then stored at -80° C. until further use. tyraldehyde was performed as described using the ald6A 0536 Cell pellets were thawed on ice and resuspended in deletion Strains GEVO6244/GEVO6245 and their corre lysis buffer (10 mM sodium phosphate pH7.0, 1 mM dithio sponding ALD6 parent strain GEVO1830. This fermentation threitol, 5% w/v glycerol) such that the result was a 20% cell was sampled at 24 and 48 has described. Table 80 shows the Suspension by mass. One mL of glass beads (0.5 mm diam isobutyrate titer for both of these fermentations. Isobutyrate eter) was added to a 1.5 mL Eppendorf tube for each sample titers are significantly decreased in the ald6A strains com and 850 uL of cell suspension were added. Yeast cells were pared to the ALD6 parent strains. lysed using a Retsch MM301 mixer mill (Retsch Inc. New town, Pa.), mixing 6x1 min each at full speed with 1 min TABLE 8O incubation on ice between. The tubes were centrifuged for 10 Isobutyrate Production of ALD6 Parent Strains and ald6A Strains Derived min at 21,500xg at 4°C. and the supernatant was transferred From Said ALD6 Parent Strains. to a fresh tube. Extracts were held on ice until they were Isobutyraldehyde Feed assayed using the TMA29 assay as described to determine Isobutyraldehyde Feed Fermentation (48 hr TMA29 activity towards (R/S)-AHB and (R/S)-AL. 0537. The specific activity of S. cerevisiae TMA29 in Fermentation (24 hr Isobutyrate GEVO3527 lysates, a wild-type MATa S. cerevisiae strain, for the reduction of (R/S)-AHB was 10.5+0.6 mU/mg. The Isobutyrate Isobutyrate Isobutyrate Decrease tma29A strain GEVO3939 had a specific activity of 4.8+0.1 Strain Titer (g/L) Decrease (%) Titer (g/L) (%) mu/mg. The wild-type GEVO3527 strain had about a 2-fold GEVO1287 O.19 O.O3 n.d. n.d. higher specific TMA29 activity than the deletion strain. GEVO6242 O.12 O.O2 36.8% n.d. n.d. GEVO1830 O.16 OOO O.12 O.O1 0538. The specific activity of S. cerevisiae TMA29 in GEVO6244 O.O6 O.O2 62.5% O.04 O.O1 66.7 GEVO3527 lysates, a wild-type MATa S. cerevisiae strain, GEVO6245 O.O7 OOO 56.3% OOOOOO as 79.2* for the reduction of (R/S)-AL was 12.3+0.2 mU/mg. The n.d. = not determined in this experiment tma29A strain GEVO3939 had a specific activity of 2.9-0.3 *based on LOO for isobutyrate of 0.025 g/L mu/mg. The wild-type GEVO3527 strain had about a 4-fold higher specific TMA29 activity than the deletion strain. Example 26 TMA29 Activity Towards 2-aceto-2-hydroxybutyrate General Methods for Examples 27-30 0533. The following example illustrates that the S. cerevi 0539 Strains, plasmids, gene/amino acid sequences, and siae TMA29 protein is active towards (S)-2-acetolactate (S)- primer sequences described in Examples 27-30 are listed in AL) and 2-aceto-2-hydroxybutyrate (AHB). Tables 82.83, 84, and 85, respectively.

US 2011/020 1 090 A1 Aug. 18, 2011 76

TABLE 85 - continued TABLE 85 - continued

Primer Sequences (shown from 5' to 3') Disclosed Primer Sequences (shown from 5' to 3') Disclosed in Examples 27-30. in Examples 27- 3 O. Primer Name Sequence'k Primer Name Sequence'k

RecombADHY5 Orew CCTGCCTTGTTGCCGWAATCTCCGGCAGCA Recomb2S77 Gens TGATGTAAGCTCGCTTTCTGTTGGTGATCG (SEQ D NO: 234) for 7 (SEO ID NO: 257)

RecombADHL.264 for ATGGTAGCCGTTGCTKTACCAAACACAGAA Recomb2S77 Gens CGATCACCAACAGAAAGCGAGCTTACATCA (SEQ D NO: 235) rew8 (SEO ID NO: 258)

RecombADHL.264 rew TTCTGTGTTTGGTAMAGCAACGGCTACCAT Recomb2Y113 Gens TTAAAAATGCAGGATATTCAGTTGATGGCG (SEQ D NO: 236) for 9 (SEO ID NO: 259)

RecombADHI212 Y219 GCTGATGTCAYAATTAACTCTGGTGACGTT Recomb2Y113 Gens CGCCATCAACTGAATATCCTGCATTTTTAA for WACCCTGTAG rew1 O (SEQ ID NO: 26O) (SEQ D NO: 237) Recomb2F113 Gen5 TTAAAAATGCAGGATTTTCAGTTGATGGCG RecombADHI212 Y219 CTACAGGGTWAACGTCACCAGAGTTAATTR for 11 (SEQ ID NO: 261) rew TGACATCAGC (SEQ D NO: 238) Recomb2F113 Gens CGCCATCAACTGAAAATCCTGCATTTTTAA rew12 (SEQ ID NO: 262) NINKA D F50 for TGCTGCCGGAGATNNKGGCAACAAG (SEQ D NO: 239) Recomb2G113 Gens TTAAAAATGCAGGAGGGTCAGTTGATGGCG for 13 (SEQ ID NO: 263) NINKAD F50 rev GCCTTGTTGCCMNNATCTCCGGCAG (SEQ D NO: 24 O) Recomb2G113 Gens CGCCATCAACTGACCCTCCTGCATTTTTAA rew14 (SEQ ID NO: 264) NINKAD R77 for GTTAGTTCTCTCNNKGTAGGTGATAG (SEQ D NO: 241) Recomb2T212 Mini GAGCTGATGTGRYAATCAATTCTGGTGATG for 15 (SEQ ID NO: 265) NINKAD R77 rev CACTCTATCACCTACMNNGAGAGAAC (SEQ D NO: 242) Recomb2T212 Mini CATCACCAGAATTGATTRYCACATCAGCTC rew16 (SEQ ID NO: 266) NINKAD A1 O8 for ACATTTTGCCGAGAANNKAAAAACGC (SEQ D NO: 243) Recomb2W264 Mini TGGTTGCTGTGGCAKTACCCAATACTGAGA for 17 (SEO ID NO: 267) NINKA A1 O8 rew ACCAGCGTTTTTMNNTTCTCGGCAAA (SEQ D NO: 244) Recomb2W264 Mini TCTCAGTATTGGGTAMTGCCACAGCAACCA rew18 (SEQ ID NO: 268) NINKAD F113 for GTCAAAAACGCTGGTNNKAGCGTTGA (SEQ D NO: 245) *A (Adenine), G (Guanline), C (Cytosine), T (Thymine), U (Uracil), R (Purine-A or G), Y (Pyrimidine - C or T), N (Any nucleotide), W (Weak-A or T), S (Strong-G or C), M (Amino-A or NINKA D F113 rew ACCATCAACGCTMNNACCAGCGTTTT C) K (Keto-G or T). B (Not A-G or C or T), H (Not G-A or C or (SEQ D NO: 246) T) D (Not C-A or G or T), and V (Not T-A or G or C)

NINKAD T212 for AGATAGGTGCTGATGTCNNKATTAAC (SEO ID NO: 247) Media and Buffers: NINKA D T212 rew CAGAGTTAATMNNGACATCAGCACCT (0540 SC-URA: 6.7 g/L DifcoTMYeast Nitrogen Base, 14 (SEQ ID NO: 248) g/L SigmaTM Synthetic Dropout Media supplement (includes NINKAD W264 for GGTAGCCGTTGCTNNKCCAAACACAG amino acids and nutrients excluding histidine, tryptophan, (SEQ ID NO: 24.9) and leucine), 10 g/L casamino acids, 20 g/L glucose, 0.018 NINKA D W264 rew ATTTCTGTGTTTGGMNNAGCAACGGC g/L adenine hemisulfate, and 0.076 g/L tryptophan. (SEQ ID NO: 25O) (0541 SD-URA: Commercially available at MP Biomedi Recomb2F5OMinilib GTTGCAGCAGGTGATTDKGGCAACAAAGCA cals (Irvine, Calif.). Composition: 1.7 g/L yeast nitrogen base for (SEQ D NO: 251) (YNB), 5 g/L ammonium sulfate, 20 g/L glucose, with casamino acids without uracil CSM-URA. Recomb2F5OMinilib TGC TT GTTGCCMHAATCACCTGCTGCAAC rew (SEQ D NO: 252) 0542 YPD (yeast peptone dextrose) media: 10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose. Recomb2O77Gen5 TGATG AAGCTCGCTTCAAGTTGGTGATCG (0543. Tris-DTT: 0.39 g 1,4-dithiothreitol per 1 mL of 1 M for 3 (SEQ D NO: 253) TrishC1, pH 8.0, filter sterilized. Recomb2O77 Gen.5 CGATCACCAACTTGAAGCGAGCTTACATCA 0544 Buffer A: 20 mM Tris, 20 mM imidazol, 100 mM rew 4 (SEQ D NO: 254) NaCl, 10 mM MgCl, adjusted to pH 7.4, filter sterilized. Recomb2Rf7Gen5 TGATG AAGCTCGCTTCGAGTTGGTGATCG (0545 Buffer B: 20 mM Tris, 300 mMimidazol, 100 mM for 5 (SEQ D NO: 255) NaCl, 10 mM MgCl, adjusted to pH 7.4, filter sterilized. Recomb2Rf7Gen5 CGATCACCAACTCGAAGCGAGCTTACATCA 0546 Buffer E: 1.2 g Tris base, 92.4 g glucose, and 0.2g rew8 (SEQ D NO: 256) MgCl, per 1 L of deionized water, adjusted to pH 7.5, filter sterilized. US 2011/020 1 090 A1 Aug. 18, 2011 77

(0547 Construction of pET1947: The L. lactis adhA (Ll h at 250 rpm and 37° C. Protein expression was induced at adhA) gene was cloned out of pGV 1947 using primers His ODoo of about 1 with the addition of IPTG to a final concen Not1 1947 fivd and Sal1 rev and ligated into pET22b(+), tration of 0.5 mM. Protein expression was allowed to con yielding plasmid pET1947. tinue for 24h at 225 rpm and 25°C. Cells were harvested at (0548 Construction of pGV2476: Plasmid pGV2274 5300xg and 4°C. for 10 min, and then cell pellets were frozen served as template for PCR using forward primer adhAcoSc at -20°C. until further use. Sallin for and reverse primer adhAcoSC Notlin his rev. 0552. Heterologous Expression in S. cerevisiae CEN. The PCR product was purified, restriction digested with NotI PK2: Flasks (1000 mL Erlenmeyer) filled with 100 mL of and SalI, and ligated into pGV1662, which had been cut with SC-URA were inoculated with 1 mL overnight culture (5 mL NotI and SalI and purified. SC-URA inoculated with a single CEN.PK2 colony, grown at 0549. Transformation of S. cerevisiae: In the evening 30° C. and 250 rpm). The expression cultures were grown at before a planned transformation, a YPD culture was inocu 30° C. and 250 rpm for 24 hours. The cells were pelleted at lated with a single S. cerevisiae CEN.PK2 colony and incu 5300xg for 5 min. The supernatant was discarded and the bated at 30°C. and 250 rpm over night. On the next morning, pellets were spun again. The residual Supernatant was then a 20 mL YPD culture was started in a 250 mL Erlenmeyer taken off with a pipette. The pellets were frozen at -20°C. flask without baffles with the overnight culture at an ODoo of until further use. 0.1. This culture was incubated at 30° C. and 250 rpm until it 0553 Heterologous Expression in CEN.PK2 in 96-Well reached an ODoo of 1.3-1.5. When the culture had reached Plates for High Throughput Assays Shallow 96-well plates, 1 the desired ODoo 200 uL of Tris-DTT were added, and the mL capacity per well, filled with 300 uL of SC-URA were culture was allowed to incubate at 30° C. and 250 rpm for inoculated with single CEN.PK2 colonies carrying plasmids another 15 min. The cells were then pelleted at 4° C. and coding for L1 adhA' or variants thereof. Deep 96-well 2,500xg for 3 min. After removing the supernatant, the pellet plates, 2 mL capacity per well, filled with 600 uL of SC-URA was resuspended in 10 mL of ice-cold buffer E and spun down per well were inoculated with 50 L of these overnight cul again as described above. Then, the cell pellet was resus tures. The plates were grown at 30°C. and 250 rpm for 24 h. pended in 1 mL of ice-cold buffer E and spun down one more and were then harvested at 5300xg for 5 min and 4°C. and time as before. After removal of the supernatant with a stored at -20°C. pipette, 200LL of ice-cold buffer Ewere added, and the pellet 0554 Preparation of ADH-Containing Extracts from E. was gently resuspended. The 6LL of insert/backbone mixture coli: E. coli cell pellets containing expressed ADH were was split in half and added to 50LL of the cell suspension. The thawed and resuspended (0.25 g wet weight/mL buffer) in DNA/cell mixtures were transferred into 0.2 cm electropora buffer A. The resuspended cells were lysed by sonication for tion cuvettes (BIORAD) and electroporated without a pulse 1 min with a 50% duty cycle and pelleted at 11000xg and 4 controller at 0.54 kV and 25 uF. Immediately, 1 mL of pre C. for 10 min. Extracts were stored at 4°C. warmed YPD was added, and the transformed cells were 0555 Preparation of ADH-Containing Extracts from S. allowed to regenerate at 30° C. and 250 rpm in 15 mL round cerevisiae CEN.PK2: S. cerevisiae CEN.PK2cell pellets con bottom culture tubes (Falcon). After 1 hour, the cells were taining expressed ADH were thawed and weighed to obtain spun down at 4°C. and 2,500xg for 3 min, and the pellets the wet weight of the pellets. Cells were then resuspended in were resuspended in 1 mL pre-warmed SD-URA media. Dif buffer A such that the result was a 20% cell suspension by ferent amounts of transformed cells were plated on SD-URA mass. Glass beads of 0.5 mm diameter were added to the 1000 plates and incubated at 30°C. for 1.5 days or until the colonies uL-mark of (0.5 mm diameter) of a 1.5 mL Eppendorf tube, were large enough to be picked with sterile toothpicks. before 875 uL of cell suspension were added. Yeast cells were 0550 Plasmid Mini-Preparation of Yeast Cells: The lysed by bead beating using a Retsch MM301 mixer mill ZymoprepTM II Yeast Plasmid Miniprep kit (Zymo (Retsch Inc. Newtown, Pa.), mixing 6x1 min each at full Research, Orange, Calif.) was used to prepare plasmid DNA speed with 1-min icing steps between. The tubes were cen from S. cerevisiae cells according to the manufacturer's pro trifuged for 10 min at 23,500xg and 4°C., and the supernatant tocol for liquid cultures, which was slightly altered. An ali was removed. Extracts were stored at 4°C. quot of 200 uL of yeast cells was spun down at 600xg for 2 0556 Purification of ADH: The ADH was purified by min. After decanting the supernatant, 200 uL of Solution 1 IMAC (Immobilized metal affinity chromatography) over a 1 were added to resuspend the pellets. To the samples, 3 ul of mL Histrap High Performance (histrap HP) column pre ZymolyaseTM were added and the cell/enzyme suspensions charged with Nickel (GE Healthcare) using an Aktapurifier were gently mixed by flicking with a finger. After incubating FPLC system (GE Healthcare). The column was equilibrated the samples for 1 hour at 37°C., Solutions 2 and 3 were added with four column volumes (cv) of buffer A. After injecting the and mixed well after each addition. The samples were then crude extracts onto the column, the column was washed with spun down at maximum speed and 4° C. for 10 min. The buffer A for 2 cvs, followed by a linear gradient to 100% following clean-up over Zymo columns was performed elution buffer B for 15 cvs and collected in 96-well plates. The according to the manufacturer's instructions. The plasmid fractions containing the protein were pooled and at Stored at DNA was eluted with 10 uL of PCR grade water. Half of this 40 C. Volume was used to transform E. coli DH5a. 0557 ADH Cuvette Assay: ADH activity was assayed 0551 Heterologous ADH expression in E. coli: Flasks kinetically by monitoring the decrease in NADH concentra (500 mL Erlenmeyer) containing 50 mL of Luria-Bertani tion by measuring the absorbance at 340 nm. A reaction buffer (LB) medium (10g, tryptone, 10 g NaCl, 5 g yeast extract per was prepared containing 100 mM Tris/HCl pH 7.0, 1 mM liter) with ampicillin (final concentration 0.1 mg/mL) were DTT, 11 mM isobutyraldehyde, and 200 uM NADH. The inoculated to an initial ODoo of 0.1 using 0.5 mL overnight reaction was initiated by addition of 100 uL of crude extract LB,anip culture of a single colony carrying plasmid pET1947. or purified protein in an appropriate dilution to 900 uL of the The 50 mLLB expression culture was allowed to grow for 3-4 reaction buffer.