Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations
1995 Molecular basis of resistance to soybean mosaic virus: reverse transcription (RT)-PCR and strain complementation analysis in soybeans Michael E. Omunyin Iowa State University
Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Molecular Biology Commons, and the Plant Pathology Commons
Recommended Citation Omunyin, Michael E., "Molecular basis of resistance to soybean mosaic virus: reverse transcription (RT)-PCR and strain complementation analysis in soybeans " (1995). Retrospective Theses and Dissertations. 11076. https://lib.dr.iastate.edu/rtd/11076
This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS
This mamiscnpt has been reproduced from ±e microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of conqiuter printer.
The qnaliQr of this reproduction is dependent upon the qoali^ of the coi^ submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and inqiroper alignment can adversely affect reproduction.
In the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and contimiing from left to right in equal secdons with small overly. Each original is also photographed in one exposure and is included in reduced form at the bade of the book.
Photographs inchided in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.
A Bell & Howell Information Company 300 North Zeeb Road. Ann Arbor. Ml 48106-1346 USA 313.'761-4700 800/521-0600
Molecular basis of resistance to soybean mosaic vims: Reverse transcription (RT)-PCR and strain complementation analysis in soybeans
by
Michael E. Omunyin
A Dissertati(Mi Submitted to the
Graduate Faculty in Partial Fulfillment of the
Requirements for the Degree of
DCXn-OR OF PHILOSOPHY
Department: Plant Pathology Major Plant Pathology
Signature was redacted for privacy.
Signature was redacted for privacy. For the Maji Signature was redacted for privacy. For the Graduate College
Iowa State University Ames, Iowa
1995 UHI Number: 9610977
DMI Microform 9610977 Copyright 1996, by DMI Company. All rights reserved.
This microform edition is protected against unauthorized copying under Title 17, United States Code.
UMI 300 North Zeeb Road Ann Arbor, MI 48103 ii
TABLE OF CONTENTS
page ACKNOWLEDGEMENTS iv
GENERAL INTRODUCnON 1
The inqxjrtance of soybeans 1
Potyvirus characteristics and gencxue organization 2
Hist(xy and econoniic importance of soybean mosaic virus 8
Taxonomy 8
Characteristics of SMV 10
Diagnostic techniques 11
SMV strains 15
Virus transmission 17
Host resistance to virus disease 17
Rsv gene resistance to SMV 21
Virus movement in plants and the phenomenon of complementation 23
Polymerase chain reaction and disease detection 29
Dissertaticm organization 31
Literature cited 32
CHAPTER L USE OF UNIQUE RNA SEQLfiiNCE-SPECinC OLIGONUCLEOTIDE PRIMERS FOR RT-PCR TO DETECT ,\ND DIFFERENTIATE SOYBEAN MOSAIC VIRUS STRAINS 53
Abstract 53
Introduction 53
Materials and methods 55
Plants and viruses 55 iii
EUSA 56
RT-PCR 57
Other analyses 58
Results 59
Discussion 61
Acknowledgements 63
References 63
CHAPTER n. MOLECULAR ANALYSIS OF SOYBEAN MOSAIC VIRUS (SMV) STRAINS TO CLARIFY THE NATURE OF STRAIN COMPLEMENTATION IN SOYBEANS 80
Abstract 80
Introduction 80
Materials and methods 83
Plants and viruses 83
Local lesion time course assay 84
Reverse transcription (RT)-PCR 85
Detection of SMV strains isolated firom single local lesions by RT-PCR 85
Results 86
Time course assay of SMV strain G7 86
Potential for complementation of SMV strains 86
Analysis of SMV strains isolated fi:t>m single local lesions by RT-PCR 87
Discussion 87
Acknowledgements 90
References 90
GENERAL CONCLUSION 107 iv
ACKNOWLEDGEMENTS
I express profound gradtude to my major professor, John H. Hill for his advice,
guidance and valuable encouragement throughout my course of study. I thank him for the
opportunity to work with him, and for tremendously enhancing my professional growth.
Additionally, I would like to thank my committee members W. Allen Miller, Richard Van
Deusen, Robert E. Andrews, Walter R. Fehr and C. A. Martinson for valuable suggestions,
review of this dissertation and encouragement It was a pleasure to work with them all. I especially thank W. Allen Miller fn: influencing my excitment about molecular plant science
and providing valuable advice during the study. I am grateful to him for the opportunity to operate, occasionally, in his laboratoty and interact with members of his research team, all of
whom I wish to thank for helpful suggestions. To Helen Benner and A. L. Eggenberger, I am
very grateful for their support, comments and technical advice during my research.
The keen interest and encouragement of Thomas Harrington, Chair, Plant Pathology
Department; and Thomas A. Fretz, fcmner Associate Dean and Director, Iowa Agriculture and
Home Economics Experiment Station, are greatly acknowledged. To all members of faculty
and staff, and fellow graduate students, I am grateful for their support and friendship.
It is a special pleasure to acknowledge offers of fellowships from the Kenya
Government; FAO, United Nations; USAID; and Plant Pathology Department, Iowa State
University.
I express my thanks and esteemed appreciation to my family and relatives, particularly
my parents fra- their support throughout my education. I
GENERAL INTRODUCTION
The importance of soybeans Soybean [Glycine max (L.) Merr.], is grown in most parts of the world as the primary source of vegetable oil and protein. It is cultivated in the United States, Latin America, China, countries of the European Economic Community, Eastern Europe. Asia and Africa. The four major producers of soybean are the United States, Brazil, China and Argentina that together account for 90 to 95% of the wwld production (Fehr, 1987; Wilcox, 1987). Soybean is the third most widely produced crop in the United States widi an annual production, in 1988, of 52 million tcms (Sinclair and Backman, 1989) representing over 50% of world output.
Soybean is grown mainly for its seed. The soybean seed is the primary source of: i) meal products, ii) vegetable oil and iii) whole bean products. Soybean meal is a major component in animal feed while soybean oil is used mainly in the making of edible products such as margarine and shortening. In 1987-88, soybean oil accounted for 30% of the estimated 50 million tons of vegetable oil produced in the world. Other oil seeds in descending order of importance are cotton seed (Gossypiim spp.), peanut {Arachis hypogea L,), sunflower {Heliantkus hypogea L.), palm kernel (Elaeis guineensis L.), rape seed {Brassica napus L.), flax seed (Linus usitatissimum L.) and Copra (Cocus nicifera L.) (Wilcox, 1987).
Soybean yields in 1982 averaged 2117 kg h*l and 1840 kg h"l in the US and
Zimbabwe, respectively (Wilcox, 1987; Singh et al., 1987). The constraints to the realization of higher soybean yields include agronomic and management limitations, pests, diseases and water stress. In the US, the problems of poorly adapted cultivars and poor management have been overcome largely by development of superior cultivars and better agronomic practices.
Diseases, pests and water stress are still tiie cause of concern to soybean growers. Aphids and thrips indirectiy affect the crop by transmitting soybean mosaic and tobacco ringspot viruses, 2 respectively. Approximately 35 of mcM-e than 100 diseases of soybeans are economically important worldwide (Sinclair and Backman, 1989). Losses to soybeans due to disease in the
US were estimated at $50 to 160 million in 1986 (Sinclair and Backman, 1989). In 1995, the value of yield reduction due to disease was $266.1 million in the South Central United States alone (Wrather et al. 1995). Of this, loss in dollar value due to viruses translated to about 1.4 million metric tons. Potyvirus characteristics and genome organization
Potyviruses are characterized by a flexuous rod morphology and repeating monomers of a single coat protein. The particle is approximately 11 nm in diameter and 650-900 nm long
(Hull et al., 1989), sediments at 150-160S, and has a density in CsCl of 1.31 g/cc. The capsid protein Mr is about 30-35 kDa, approximately 2(XX) subunits of which encapsidate the genomic
RNA in a helical arrangement. The potyviruses' genome consists of single stranded, positive sense RNA (Mr. 3.0-3.5x10) that accounts for 5% of the mass of the virion. The genome of die ^hid-, mite- and whitefly-tiiansmitted potyviruses have a single molecule of RNA while that of the fungus-transmitted potyviruses is distributed between two molecules of RNA
(Kashiwazaki et al., 1990).
The monopartite genome is approximately 10 kb in length (Hollings and Brunt, 1981) and has a viral protein (VPg) covalentiy attached to its 5' end (Shahabuddin et al., 1988;
Riechmann et al., 1992; Murphy et al., 1990) and a polyadenylate tract at the 3' terminus (Hari et al., 1979; Bamett, 1991). Subgenomic RNAs were once thought to be absent in infected tissues (Dougherty, 1983; Vance and Beachy, 1984), but have since been reported (Atabekov and Dorokhov, 1984) to be associated with virus-specific libonucleoprotein particles (vRNP) that also contain virus specific proteins.
Sequence data of mcmopartite genomes predict a single open reading frame (ORF)
(Allison, et al., 1986; Domier et al., 1986). The genomic RNA is translated as a large 3 polyprotein precursor of 3005 to 3344 amino acids (Dougherty and Carrington, 1988;
Riechmann et al., 1992). This precursor polyprotein is processed by virus encoded proteases to yield several mature proteins (Carrington and Dougherty, 1987; Carrington et al., 1989;
Ghabrial et al., 1990). These are arranged in the following order in the genome: PI protease,
HC-protease, P3,6Ki, CI, 6K2, NIa-VPg, NIa-protease, Nib (polymerase) and coat protein
(Verchot et al., 1991; Riechmann et al., 1992). Fig. 1 shows the position of proposed proteolytic processing events of these proteins. Potyvirus polyprotein processing involves seven to nine principal proteolytic reactions catalyzed by three virus-encoded proteinases: NIa,
HC-Pro, and PI. These proteinases may catalyse processing at different intrinsic rates and may be affected by cellular or viral factors (Dougherty and Paiks, 1989).
The genome of the fungus-transmitted potyvirus, barley yellow mosaic virus, has two
RNA species with total length of 11217 nucleotides. The large segment, RNA 1, contains
7632 nucleotides and codes for proteins analogous to P3,6K1, CI, 6K2, NIa (including VPg),
Nib and coat protein (Kashiwazaki et al., 1990; Peerenboom et al., 1992). The smaller segment, RNA 2, contains 3585 bases. It codes for a 98 kDa polyprotein whose N-terminus is homologous to the cysteine proteinase domain at the C-terminal end of the HC protein of aphid-transmitted potyviruses (Davidson et al., 1991).
The N-tenninus protein (PI) has been reported to range in size from 29 kDa for tobacco vein mottling virus (TVMV) (Domier et al., 1986; Mavankal and Rhoads, 1991) to 68 kDa for papaya ringspot virus (Yeh et al., 1992). It is a serine proteinase. PI is cleaved autocatalytically from the polyprotein at a Phe/Ser or Tyr/Ser dipeptide (Verchot et al., 1991;
Mavankal and Rhoads, 1991). The observation that PI cleaves efHciently in vivo and in wheat germ in vitro translation systems, but not in reticulocyte lysate, suggests that it requires a host cofactor (Verchot et al., 1991; Riechmann et al., 1992). 4
PI HC-PRO A B C D V E F t t tt tt t t t •-I I I TT I I I I I —poly(A) PI HC-Pro P3 6Ki Q 6K2 NIa Nib CP
h III II i~i—r ^ * ID 6K2 NIa i f\
PI HC-Pro P3 6K1 CI Nib CP •• VPg Pro
Fig. 1. Schematic representation of potyviral polyprotein processing. A cistron map of the potyviral genomic RNA is shown at the top of the Hgure. The location of the cleavage sites for NIa protease (named A to F and V) or for proteases PI and HC-Pro are shown on the cistronic map. Proteolytic processing events are depicted with arrows drawn from domains of the polyprotein to the sites processed. Co-translational and autocatalytic events may be involved. Derived from Riechman et al. (1992). 5
The helper con3p(Mient (HC) protein is a cysteine proteinase with several known activities. Its N-terminal region is required for aphid transmission, genome amplificadon and symptom expressicm (Thombury et al., 1985; Atreya et al., 1992). The central region is required for long distance movement in plants (Cronin et al., 1995). The C-teraiinal domain is a cysteine-type proteinase that autocatalytically cleaves a Gly-Gly bond between itself and the
P3 protein (Oh and Carrington, 1989; Carrington et al., 1989). Residues at the P4 (Tyr), P2
(Val), PI (Gly), and PI' (Gly) positions are conserved among potyviruses and are required for cleavage site recognition. Analysis of the requirement for HC-Pro processing during TEV genome recognition suggested that an active HC-Pro proteinase is required in cis for TEV genome amplification (Kasschau and Carrington, 1995).
The potyvirus P3 protein is poorly conserved among potyvirases. Like the cowpea mosaic comovirus (CPMV) 32 kDa protein, it is suggested to function in the regulation of the proteolytic processing of the viral polyprotein (Riechmann et al., 1992; Vos et al., 1988).
The cylindrical inclusion (CI) protein (70 kDa) is the largest of the potyviral proteins.
The N-terminal regicm of the CI protein bears a consensus sequence found in ATP-dependent helicases (Lain et al., 1991). It forms pinwheel-shaped inclusion bodies characteristic of potyviral mfections and has been found over plasmodesmata. Additionally, the CI protein is thought to be involved in cell-to-cell movement (Calder and Ingerfeld, 1990) and to be a non specific nucleotide binding protein (Langenberg and Purcifull, 1989).
The 6 kDa protein occurs at the C-terminus of tlie CI protein. It was once thought to be a VPg (Domier et al., 1987), but has since been determined to function in anchoring the VPg precursor to vesicular membranes (Giachetti and Semler, 1991).
The Nuclear Inclusicm protein a (NIa) follows the 6K protein in the potyvirus polyprotein and functions as a cysteine proteinase. The NIa protein is responsible for most of the cleavage reactions of the potyviral polyprotein (Dougherty and Carrington, 1988) that include cis autocatalytic cleavages and trans cleavage reactions (Carrington and 6
Dougherty,1987; Himmler et al., 1990; Riechmann et al., 1992) (Fig. 1). The TEV NIa proteinase functions efficiently both in cis and trans recognizing a penta- or heptapeptide sequence (Dougherty and Parks, 1989). NIa autocatalytically releases from the polyprotein by cleaving the CI-NIa and NIa-NIb junctions and catalyses the production of CI, Nib, and coat protein by cleaving the P3-CI, and NIb-CP junctions. Additional cleavages to release VPg and the 6K1 and 6K2 products also occur (Garcia et al., 1992). The NIa proteinase is also involved in self processing to release the genome-linked protein VPg. The NIa proteinase is a bifiinctional protein. It has a proteinase d 1991). The domains are separated from each odier by a suboptimal NIa cleavage site. The VPg is covalentiy linked to the 5' end of the genomic RNA (Shahabuddin et al., 1988; Murphy et al., 1990). The Nuclear Inclusion protein b (Nib) is thought to be an RNA-dependent RNA polymerase (RDRP) because of the sequences that are conserved in the RDRPs of other viruses (Dougherty and Carrington, 1988). It shares sequence similarities with the RDRP of conaoviruses and picomaviruses and contains the GDD consensus sequence motif. Nib is the most conserved of the potyvirus gene products. The coat protein is at the C-terminus of the polyprotein. Its nucleic acid or protein sequences have been determined for strains of several viruses (Ward and Shukla, 1991). It ranges in size from 28-40 kDa and q)proximately 20(X) subunits encapsidate the genomic RNA. The coat protein consists of three domains. These are the hydrophilic N-terminal region of variable sequence, a conserved core region making up about two-thirds of the coat protein, and a small hydrophilic C-terminus. It has been shown that the N- and C-termini are exposed at the virion surface and can be removed with a limited trypsin digest without affecting virion morphology or infectivity (Shukla et al., 1988b). The N-terminal is variable in length and sequence, and has an abundance of charged and polar residues (hence very hydrophilic). 7 Consequently, antibodies raised against it tend to be virus-specific, while those raif^ed against the consm'ed core tend to recognize a wide range of potyviruses. The observation that removal of the termini of the coat protein renders the virus non- transmissible by aphids supports involvement of the N-terminal region in aphid transmission of the virus (Shukla et al., 1988a). Aphid transmissibility of the virus has been precisely mapped to a DAG (aspartic acid-alanine-glycine) tripeptide in the N-terminal region (Harrison and Robinson, 1988; Atreya et al., 1990; Jayaram et al., 1991). A search for the DAG sequences in the amino-terminal domains of the coat proteins of aphid-transmitted (AT) and non-aphid- transmitted (NAT) viruses revealed that all known NAT strains of different potyviruses have substitutions in either the second, third or both second and third positions of the DAG triplet (Shukla et al., 1994). Exceptions are PVY-18 (Shukla et al. 1988c) and ZYMV-C (Gmmet and Fang, 1990) which have DAG triplets, but are not-aphid transmissible. The loss of aphid transmissicm in PVY-18 and ZYMV-C could be due to mutations in the sequences encoding their HC proteins a* to the presence of an acidic residue D, next to the G. It has been shown that loss of aphid transmissibility is associated with mutations affecting either the coat protein or HC (Thombury et al., 1990) and the presence of the sequence DAGE in TVMV (Atreya et al., 1992). An additional function of the CP is encapsidation of the viral RNA and long distance movement (Dolja et al., 1995). Taken together, the long-distance movement functions of the HC-Pro and the coat protein may suggest that the HC-Pro interacts with the coat protein. The conserved core of the coat protein often begins at amino acid position number 93. This region is required for particle assembly. Because polyclonal antibodies tend to be directed to the conserved core regions of the coat protein, they are relatively insensitive for differentiating viruses or virus strains (Shukla et al., 1988b). 8 History and economic importance of soybean mosaic virus Soybean mosaic virus (SMV), a typical potyvirus, was first observed in soybean in Connecticut in the United States by Clinton (1915) and described as soybean mosaic by Gardner and Kendrick (1921). It is believed to have been introduced with the first soybeans brought from Asia. The vims induces a variety of cuMvar dependent symptoms in soybean such as mild mosaic, nK>ttling, malfcmnation, leaf curling, systemic necrosis, male sterility, fiower abnormalities, reduced pubescence, seed coat mottling and stunting. Most soybean cultivars develop transient systemic vein clearing, followed by a rolling and distortion mosaic in younger leaves v^th dark green areas along the main veins and chlorosis between the dark coloured areas. Systemic necrosis is induced by certain strains; e.g., strain G7 in genotypes carrying the Rsv gene. Infected plants produce fewer pods that may sometimes be malformed, glabrous and seedless. SMV naturally infects also Lupinus albus and Viciafaba that show leaf chlorosis (Bos, 1972; Brunt et al., 1990). The virus has been reported to infect 47 species of 27 genera in five families (Edwardson and Christie, 1991). SMV causes a common and widespread disease of soybeans. It is regarded as an important disease in some areas of the world. Yields may be reduced by 100%. Oil content of seeds (Demski and Jellum, 1975), seed size (Ross, 1969), and nodulation and nitrogen fixing activity of plants (Tu et al., 1970, Tu, 1989) are also reduced significantly. Susceptible cultivars produce smaller plants with delayed maturity and reduced seed yields of 48-99% depending on the virus strain, cultivar and time of infection. Depending on these conditions, the percentage of mottled seeds in susceptible cultivars ranged from 42 to 1(X)%. These findings show that SMV can be a major limiting factor in soybean production. Taxonomy SMV belongs to the family Potyviridae (Bamett, 1991). This family contains over 180 distinct viruses and is the largest family of plant viruses (Shukla et al., 1994). Viruses have been assigned into the Potyviridae family by using a number of criteria. These criteria include: 9 particle morphology, cytopathology, genome structure and organization (viral genome RNA or DNA, nucleotide sequence, replication module, processing of a polyprotein, a S' VPg, and a 3' poly [A]), coat protein sequence, serology and mode of vector transmission (Niblet et al., 1991; Bamett, 1992). The genotype and the coat protein appear to be the most valuable group specific criteria (Ward et al., 1992; Shukla et al., 1994). The coat protein is reported to have an amino acid composidmi that is characteristic of potyviruses (Fauquet et al., 1986; Domier et al., 1987; Rybicki and Shukla, 1992). Use of serology and sequence data from the conserved C-terminal regicm of the CP, for exaiiq)le, has enabled the mite-transmitted (Niblet et al., 1991) fungal transmitted (Foulds et al., 1993) and whitefly-transmitted (Mibie, 1988) viruses to be assigned to separate genera of the family Potyviridae. The Potyviridae now consist of three genera and one possible genus (a Hfth genus is also possible that might include maclura potyvirus and narcissus latent carlavirus [Shukla et al., 1994]). The four genera are the Potyvirus (PVY-like aphid transmitted viruses, e.g., potato virus Y), the Rymovirus (mite-transmitted viruses, e.g., wheat streak mosaic virus), the Bymovirus (fungus-transmitted viruses, e.g., barley yellow mosaic virus) and Ipomovirus (whitefly-transmitted viruses, e.g., sweet potato mild mottle virus) (Bamett, 1992). All viruses in these genera have flexuous filamentous particles that contain a positive sense ssRNA genome and pinwheel inclusions accumulate in the cytoplasm of infected plants. Their genomes consist of a poly(A) tract at the 3' end, a genome-linked protein covalentiy attached to the S' terminus of the genome, and functional proteins are generated by processing polyprotein precursors. The iynK)viruses, as exemplified by wheat streak mosaic virus, have particles which are similar to potyviruses but are shorter (7(X) nm) and contain a monopartite ssRNA genome of 8.5 kb and a larger coat protein (Mr = 42 K) (Bamett, 1991). The genome has a 3'-terminal poly(A) tract and a translation strategy based on processing of a polyprotein. A protein of 332 amino acids occurs at the S' end and bears 34% homolgy to potyvirus cylindrical inclusion 10 protein. Additionally, a protein of 185 amino acids occurs in the 3' direction and bears 54% homology to the potyvirus Nib putative polymerase. The coat protein gene maps to the 3' end and has 10% homology to the four potyviruses. The bymoviruses have a bipartite genome. They have poly(A) tracts on the 3' ends of both genomic RNA species and a replication gene module on RNA 1 similar to that of the potyviruses (Kashiwazaki et al.,1990; Peerenboom et al., 1992). However, the RNA 2 shows differences in organization when compared with the S'-terminal region of the potyvirus genome (Davidson et al., 1991). At the moment, no data are available for the sweet potato mild mottle virus, the type member of the genus Ipomovirus (Shukla et al., 1994). All viruses which form inclusions fit into one of the four genera of the family Potyviridae except maclura mosaic and narcissus latent viruses. The particle lengths of these two are shorter than those of members in the four genera and the coat protein molecular weight is larger (Bamett, 1992). The genus Potyvirus has been shown to contain groups of virus species that are closely related and have many properties in common. Therefore, members of the genus have been placed into subgroups and serogroups based on antigenic relationships and sequence homologies above the species level (Bamett, 1992). Subgroups are a collection of closely related species. In the genus Potyvirus, like all other genera, variation of the species is recognized by placement of strains, isolates or variants. Characteristics of SMV SMV is a member of the genus Potyvirus. The particles of SMV are 650-760 nm long and are strongly immunogenic (Brunt et al., 1990; Edwardson and Christie, 1991). Antisera with precipitin titres of 1/2048 have been produced (Bos, 1972). Monoclonal antibodies that differentiate strains of SMV have also been produced (Hill et al., 1984,1989). The virus has been detected in seeds using different serological procedures (Lister, 1978; Bryant et al., 1982, 1983; Chen et al., 1982; Diaco et al., 1985) and is seed-transmitted in many soybean cuWvars. 11 SMV is closely related serologically to watermelon mosaic virus (WMV2) and distantly to bean common mosaic virus (BCMV), bean yellow mosaic virus (BYMV) and clitoria yellow vein tymovirus (CIYW) (Purcifiill and Hiebert, 1979; Ward and Shukla, 1991). A polyclonal antiserum directed to the coat protein core of the monocot-infectimg johnsongrass mosaic virus (JGMV) was found to react strongly with SMV-N (Shukla et al., 1989). The coat protein gene and the 3' non-coding sequences of SMV-N (Eggenberger et al, 1989) and the complete genome sequences of strains G2 and G7 (Jayaram et al., 1991,1992) have been determined. Additionally, the NIa proteinase encoding gene has been analyzed (Ghabrial et al., 1990). The SMV genome is 9588 nucleotides long and has a genome organization that is similar to those of other members of the genus Potyvirus. The SMV coat protein consists of 265 amino acid residues corresponding to a molecular weight of 29.5 kDa. The 3' noncoding region is 259 nucleotides in length. The SMV strains N, G2 and G7 show sequence identities of 98.9-99.6% between their coat proteins and 93-100% between their 3' non-coding regions (Eggenberger et al., 1989; Jayaram et al., 1991). The G2 and G7 strains show nucleotide sequence identity of 94% and amino acid sequence identity of 97% between their genomes and polyproteins, respectively (Jayaram et al., 1992). Diagnostic techniques Potyviruses, including SMV, can be detected and identified by a number of techniques that are based on biological, cytological, antigenic and structural properties. Among the biological techniques, host range and symptomatology are commonly used for virus detection and identification. However, both have problems related to reliability. The use of vector transmissi(m is limited to assigning a new potyvirus isolate to a genus (Berger, 1992). Potyviruses induce various types of inclusion bodies in infected tissue and these have been shown to be useful in diagnosis (Edwardson, 1992). The major inclusion types are cytoplasmic cylindrical inclusion, nuclear inclusions and amorphous inclusions; each is encoded by a different gene of the potyvirus genome (Dougherty and Carrington, 1988). Of 12 these inclusions, the presence of CIs has been accepted as a major family-specific criterion for the Potyviridae. A wide variety of serological techniques have been developed for virus diagnosis. These techniques are based on the antigenicity of virus coat protein and are most widley used due to their efficiency. Precipitin tests are amenable to large scale screening of samples, but are not as sensitive as other techniques. Agglutination tests, sodium dodecyl sulfate (SDS)- immunodiffiision tests (Purcifull and Hiebert, 1979), double andbody sandwich enzyme-linked immunosorbent assay (DAS-EUSA) (Koenig, 1978), radioimmunosorbent assay (RIA), inmiunosorbent electron microscopy (ISEM) and decoration immunoelectron microscopy (lEM) (rewiewed in Shukla et aL, 1994) are among the most useful serological techniques for detection of potyviruses and some other plant viruses. These techniques have been shown to be highly sensitive with the exception of SDS-double diffusion tests. Agglutination tests permit virus detection at concentrations as low as 5 to 20 ng virus per ml, and have been applied to many potyviruses including peanut mottie virus. The high sensitivity of DAS- ELISA (Koenig, 1978) is thought to be due to reduced denaturation that occurs during capture by antibodies. RIA, based on the principle of DAS-ELISA, should be as sensitive as the latter except for the disadvantage of using ^^Sj.iabeHed antibody as a substitute for the antibody-enzyme conjugate (Ghabrial and Shepherd, 1980). Bryant et al. (1982,1983), developed a variation of RIA named solid -phase radioimmunoassay (SPRIA) for the detection of SMV in soybean seeds. This procedure involves coating the virus-specific antibody to polystyrene beads instead of microtitre plate wells. The virus antigens are bound to the immobilized antibodies on the solid-phase bead surface and are detected using virus-specific antibodies labelled with By using this procedure, purified preparations of SMV were detected at concentrations ranging ftom 25 to 50 ng ml'^. 13 like precipitin tests, indirect ELISA and Western blotting, because of their broad specificity, are appropriate for studying distant relationships among distinct viruses. Broad specificity in indirect ELISA is due to scmie denaturation of virus particles that occurs when they are adsorbed direcdy to microtitre plates. Denaturation exposes the internal coat protein epitopes which are generally conserved among plant viruses. Western blotting has been reported to be highly sensitive for detection and characterization of plant viruses as well as their gene products (Towbin et al., 1979). The method exhibits more broad speciHcity than other techniques provided non-fat dry milk powder and antibodies to the conserved core region of the coat protein are used. Dot-blot immunoassay, a variant of Western blotting, can detect potyvinises at amounts as low as O.S pg. This is a highly sensitive method that is suited for large scale screening of san^les (Berger et al., 1985). A method that has proved extremely reliable for accurate identification and classification of potyvinises is the high performance liquid chromatography (HPLC) peptide profiling of virus coat protein. It is based on the sequence relationship between virus coat proteins. The lysine and arginine residues cleaved by trypsin are fairly well distributed across coat proteins resulting in profiles containing greater than 20 peaks. Variation in peptide profiles of the coat proteins are suggested to reflect sequence identities of species (40 -75%) as well as strains of potyvinises (Ward and Shukla, 1991). Using this technique, non-clear cut profile comparisons are supplemented by amino acid comparisons and sequence of peptides. Nucleic acid hytddization, using probes based on defined gene sequences of the potyvirus genome, is a highly sensitive technique that can detect potyvinises at pg levels. Q>at protein amino acid sequences data has been used to identify and differentiate distinct potyvirus members from their strains; sequence identity between distinct members ranges from 38 to 71% while that between strains of one virus range from 90 to 99% (Shukla and Ward, 1988). Coat protein sequences also have shown a close relationship between the 14 viruses, WMV2 and a strain of SMV, that had only partial identity as shown by SDS-double diffusion tests (Purciful and Hiebert, 1979; Ward and Shukla, 1991). The accumulation of genomic sequence data has led to development of polymerase chain reaction (PGR) fw detection of viruses. PGR of gene segments using degenerate primers based on conserved gencMne sequences is believed to be a very powerful technique for the detection and identification of those potyviruses which are most difficult to diagnose by other known procedures (Shukla et al., 1994). PGR uses a thermostable Taq DNA polymerase to synthesize DNA from oligonucleotide primers and template DNA. The template may be genomic or first strand cDNA or cloned sequences. The PGR technique has the capacity to selectively enrich a DNA sequence by a factor of lO^-lO^ and enables detection of single or few copies of DNA. Table 1 summarizes the sensitivity of serological and molecular techniques fw the detection of plant viruses. Table 1. Sensitivity of serological and molecular techniques for the detection of plant viruses. Techniques Detection range^ Liquid precipitin tests 1-10 |ig virus ml'l SDS -double diffusion tests 2-20 )ig virus ml"1 Agglutination tests 5-20 ng virus ml" ^ Immunoelectron microscopy 1-10 ng virus ml'^ Western blotting 500 pg Dot-blot 0.5 pg virus ELISA 1-10 |ig virus ml"l Radioimmunosorbent assay 1-lOp.g virus ml~^ Nucleic add hylxidization 1-5 pg virus ^ Sources; Shukla et al. (1994). 15 SMV strains Accoiding to The International Committee on Taxonomy of Viruses (ICTV), a plant virus species has been defmed as "a polythetic class of viruses that constitute a replicating lineage and occupies a particular ecological niche" (van Regenmortel, 1992). A virus isolate refers to a single isolation from an infected plant (Bamett, 1992). Isolates of a species are similar because of the replicating lineage, but isolates of die species from different times and places will vary within limits imposed by selection pressure. Plant viruses readily develop strains due to natural variation. A strain has been defined as a collection of naturally occurring isolates of a virus species that all have the same recognizable property or properties not present in other isolates of the virus (Bamett, 1992). Strains may differ in properties such as host response and virulence, antigenicity, vector transmission and rates of seed transmission. Pathotypes and serotypes are specific types of strains based on host reactions or antigenic properties, respectively. Viral strains have been identified by criteria that have been applicable also for distinguishing viruses. In the past, these criteria were host range, symptomatology, cross protection, cytopathology and serology. These have played a significant role both in the identification and differentiation of virus strains, e.g., ELISA (Diaco et al., 1985) and immunosorbent electron microsccopy (ISEM), but have been largely imperfect due to biological and antigenic variation of potyviruses (Shukla et al., 1994). Now, coat protein amino acid sequence data (Shukla et al., 1988c), HPLC peptide profiling of coat protein (Ward and Shukla, 1991; Jain et al., 1992), and nucleic acid hybridization and PGR (Frenkel, 1992; Wetzel et al., 1991; Rizos et al., 1992) are additional methods used for identification of botii potyviruses and their strains. Using coat protein sequences, the chlorotic spot strain of BYMV and strain 30, previously regarded as one virus have been shown to be distinct viruses; these are, BYMV (Takahashi et al., 1990) and clover yellow mosaic vein mosaic virus (CYNMV) (Uyeda et al., 1991), respectively. 16 Numerous SMV strains (G1 through 07, G7a, C14 and SMV-0) have been identified that vary in syn^tom induction, vector transmission and antigenic properties (Chen et al., 1988; Cho and Goodman, 1979; Lucas and Hill, 1980). Cho and Goodman (1979), in a virulence study, identified seven distinct strains (G1 to G7) fi'om 98 isolates in the USDA soybean gennplasm collections. Based on serology and symptomatology in cowpea, bean and pea and on the reactions of soybean differential cultivars, Hunst and Tolin (1982) identified two strains, SMV-VA and SMV-OCM, as belonging to the G1 and G3 strain groups, respectively, of Cho and Goodman (1979). Lucas and Hill (1980) distinguished three other SMV strains, 75-16-1,12-18 and 0, on the basis of host reactions and aphid transmissibility. Strain 75-16-1 is a G2 (Hill, personal communication) while the relations of the other two to the strains G1 to G7 were not determined. Buzzell and Tu (1984) characterized strain G7a and Lim (1985) identified strain C14. Studies on antigenic properties have shown that SMV strains can also be divided into three serological groups based on one-dimensional trypic peptide maps immunoblotted with 12 monoclonal antibodies (Hill et al., 1989). Comparison of coat protein tryptic digests from 14 potyvirus isolates from soybean confirmed them to be SMV strains (Jain et al., 1992). SMV isolates and strains have been shown to induce cytoplasmic cylindrical inclusions characteristic of subdivisions m and IV. According to Edwandson and Christie (1991), most SMV isolates induce type-3 cylindrical inclusions and are regarded as members of subdivision in while isolates that induce type-4 inclusions, are members of subdivision IV. However, both serology (Hill et al., 1989; Hill et al., 1994) and cytoplasmic inclusions (Edwardson, 1992) can present problems for identification of strains in mixed infections. For example, mixed infections with viruses of subgroups I and n give inclusions appearing as viruses from subgroup m and difficulty has been experienced in discriminating between the subgroups I and m(Shuklaet al., 1994). 17 Virus transmission In addition to seed transmission, SMV is transmitted by £^hid species and mechanically by inoculation of plant sap. Seed transmission has been reported ranging finm 0 to 75% (Edwaidson and Christie, 1991; Tu, 1989), depending on the SMV strain and cultivar. Transmission by aphids occurs in the non-persistent manner and requires a virus encoded transmission factor (Mr 53-58 x 10^) (Hull et al., 1989). SMV is transmitted in nature by several aphid species belonging to 14 different genera. Some of the most important species include Acayrhosiphon pisum, Aphis fabae, Myzus persicae and Rhopalosiphum maids (Edwardson and Giristie, 1991). Through the various means of transmission, SMV has been reported to infect 47 species of 27 genera in five families of plants (Edwardson and Christie, 1991). Host resistance to virus disease Plant resistance is the ability of the host plant to hinder the growth and /or development of the pathogen (Parlevliet, 1979). A resistant plant has been defined most commonly as one that restricts virus multiplication whereas a susceptible plant allows multiplication and spread of virus (Cooper and Jones, 1983) resulting in disease development Zaitiin and Hull (1987) have identified several levels at which natural resistance could be maintained. These levels are: true immunity (non-host), where no virus multiplication takes place at all; subliminal infection, when virus replication is restricted to the initially infected cell(s); the hypersensitive response, where virus is restricted to cells around each primary site of infection, usually with necrosis; and tolerance in which virus replication occurs witii a mild or symptomless systemic virus infecticm. Historically, resistance of plants to virus disease has been divided into host and non- host resistance. Non-host resistance is observed when all members of a plant species are immune to infection. Host resistance occurs when some members of a species are resistant while others may be susceptible; it is typically controlled by either a single gene or a small 18 number of genes. This type of resistance has been exploited because of the ease of selection and Ixeeding for resistance. Genetics of resistance studies involve the crossing of resistant and susceptible parents followed by analysis of the F1 and F2 plants and backcross progenies. In classical genetic analysis of resistance, segregati(Mi ratios have often identified Mendelian control by a single dominant allele. Fraser (1985) proposed the positive and the negative models to explain the action of resistance genes. The positive model proposes direct interference with viral replication and viral pathogenesis. According to the negative action model, the resistance gene is a mutant allele of a wild type gene that confers susceptibility to viral replication and pathogenesis. In the positive action model, host resistance can occur by interruption of the virus life cycle at one ra* more stages. These steps in the virus life cycle upon which resistance could act are: i) entry into the cell, ii) uncoating of the nucleic acid, iii) translation of viral proteins, iv) replication of the viral nucleic acid, v) assembly of progeny virions, and vi) movement of the virus, both to new cells and to new hosts (Siegel, 1979). The functional effect of each one of these steps OT combination of steps may constitute a mechanism of resistance. Host resistance can be induced or constitutive (Lamb et al., 1989). Induced resistance is not normally expressed in the plant and is stimulated by the invasion of the virus. It allows some viral multiplication to occur. The following strategies to protect plants against viruses (Mansky and Hill, 1993; Wilson, 1993) have been reported: a) genetically engineered resistance (Gadani et al., 1990; Wilson 1993), b) the hypersensitive response (Fritig et al., 1987) and the associated antiviral factor (Sela et al., 1987), c) systemic acquired resistance (White, 1979), d) pathogenesis related (PR) proteins (Gordon-Weeks et al., 1991; Stintzi et al., 1991) and e) the phenomenon of cross-protection (Matthews, 1991). Plants have been genetically engineered to express part of a viral genome by using coat protein, replicase, movement proteins, or other putative binding proteins, e.g., potato leaf roll virus 17 kDa 19 protein. Other single dominant, pathogen-derived resistance genes or pathogen targeted transgenic resistance strategies involve defective interfering (DI) viral sequences, symptom attenuating satellite RNAs (Sat-RNAs), defective viral (auto) protease(s), antiviral ribozymes, antisense RNA, antibodies, or dormant antisense phytotoxin (suicide) genes such as ricin, pokeweed antiviral protein, or diphtheria toxin connected to negative-strand virus replication signals (e.g., CP subgenomic RNA promoter) (Wilson, 1993). Constitutive resistance is expressed in the plant even in the absence of virus. Several models addressing constitutive resistance have been reported (Mansky and Hill, 1993). They include: tomato (genes Tm-1, Tm-2, and Tm-2^) resistance to tobacco mosaic virus (TMV) (Pelham, 1972); cowpea (cultivar Arlington) resistance to cowpea mosaic virus (CPMV) (Beier et al., 1977); resistance in potato to potato virus X (PVX) (Jones, 1985); cowpea resistance to cowpea chlorotic mottle virus (CCMV) (Wyatt and Kuhn, 1979); barley (cultivar Shanon, Yd2 gene) resistance to barley yellow dwarf virus (BYDV) (Larkin et al., 1991); resistance in cucumber cultivar China (Kyoto) to cucumber mosaic virus (CMV) (Matthews, 1991); resistance of tobacco (cultivar TN 86 and Ky 14) to tobacco vein mottle virus (TVMV) (Gibb et al., 1989); resistance of potato to potato virus Y (PVY) (Barker and Harrison, 1984); and resistance in maize to maize dwarf mosaic virus (MDMV) (Scott, 1989). For TMV, Tm 1 confers a syn^tomless reaction while Tm-2 and Tm-2^ confer a hypersensitive response. Wanatabe et al. (1987) showed that resistance conditioned by Tm-1 is maintained in protoplasts. Sequence conq)arisons between the Tm-1 resistance-breaking Lta strain and the L strain (parent) of TMV revealed two base changes resulting in amino acid changes in tiie 130 and 180 kDa proteins (Meshi et al., 1988). Based on infectivity of mutants, when the base changes were introduced into infectious transcripts of the L strain (Meshi et al., 1988), it has been suggested that Tm-1 interferes with viral replication. In vitro studies with CPMV indicate that leaves of the cowpea cultivar Arlington contain a protease inhibitor that inhibits CPMV RNA2 translation. The examples of studies with TMV and CPMV show that resistance is due 20 to the interruption in the virus life cycle either at the level of nucleic acid replication (when protoplasts are resistant), cell to cell movement (when protoplasts are susceptible) or polyprotein processing (when protoplasts are resistant, but some virus accumulation occurs). Since 1992, resistance (R) genes firom several plant species that enable them to resist pathogens have been cloned (Lamb, 1994; Staskawicz et al., 1995). These genes confer resistance to fungal (the maize Hml gene; the tomato Cf-9 gene; the flax gene), bacterial (the potato PTO gene; the Arabdiopsis RPS2 gene), and viral (the tobacco N gene) pathogens (Dong, 1995; Staskawicz et al., 1995). In the case of TMV, the viral-encoded coat protein appeared to function as a specific intracellular elicitor that activates a hypersensitive response (HR) in Nicotiana sylvestris cultivars that carry the R gene N* (Culver and Dawson, 1991). DNA sequence analysis of the RPS2, N, Cf-9, and genes revealed that they encode- proteins that contain leucine-rich repeats found in many plant and animal proteins and are usually involved in protein-protein interactions (Staskawicz et al., 1995). These findings implicate the R genes in signal transduction mechanisms for the expression of plant resistance. The proteins of RPS2, N, mdiP share signiHcant sequence homology; in addition to leucine- rich repeats, all have a conserved nucleotide binding site, but N is more closely related to than it is to RPS2. The NH2-terminus of the N gene shares homology with the Toll protein of Drosophila and the mammalian interleukin-1 receptor (IL-IR) (Staskawicz et al., 1995). The presence of this domain and lack of the leader peptide by the N proteins are reasons for the suggestion that N protein might be cytoplasmic and may function in recognition of intercellular ligands. Protoplasts have been used for analysis of virus disease resistance to identify potential resistance mechanisms. Two types of resistance mechanisms have been observed (Mansky and Hill, 1993). In the less common type of resistance, protoplasts from resistant plants do not support virus multiplication. Examples if this type of resistance include the Tm-1 gene of tomato (Wanatabe et al., 1987), and the Ry genes of potato (Barker and Harrison, 1984). In 21 these instances, resistance is more likely the result of inhibition of virus multiplication within the individual cell than of cell-to-cell movement or systemic spread. In the more common observation, protoplasts firom plants resistant to systemic viral infection support viral multiplication, suggesting that resistance is confened by inhibition of cell-to-cell movement and subsequent systemic spread of vims. Examples include barley cuMvars containing the Yd2 gene that are resistant to BYDV (Larkin et al., 1991), and tobacco resistant to TVMV (Gibb et al., 1989). These observations suggest resistance operating at the level of cell-to-cell movement or systemic spread is more prevalent in nature than that operating at the level of protoplasts. Additionally, studies of subliminal viral infection of plants (Zaitlin and Hull, 1987) and infection of isolated protoplasts, e.g., TMV in cowpea and cotton (SuLrinski and Zaitlin, 1982), support resistance acting at the level of cell-to-cell movement Rsv gene resistance to SMV SMV is one of the most common virus diseases of soybeans. Use of host resistance and SMV-free seed are the best approaches currently available to minimize the losses by vims as some soybean cultivars do not support seed transmission of SMV. Goodman et al. (1979) found 19 soybean lines through which seed transmission of SMV did not occur. Additionally, a number of soybean cultivars, breeding lines and hybrids have been reported to be moderately or highly resistant to the virus in the US and Korea (Edwardson and Christie, 1991; Cho and Goodman, 1982). Genes for resistance to SMV in soybean have been identified at three loci in various cultivars and introductions (Prowidenti and Hampton, 1992; Yu et al., 1994). These resistance genes are dominant. Kiihl and Hartwig (1979) found that SMV resistance in PI 96983 and Ogden was controlled by alleles at a single locus designated Rsv and r5v^ respectively. Studies with cultivars York, Marshal, and Kwanggyo have shown that each contains a different allele of Rsv (Chen et al., 1991). Other lines for which single-gene inheritance has been reported include Raiden (Buzzell and Tu, 1984), Suweon 97 (Lim, 1985), 22 Columbia (Buzzell and Tu, 1989), AGS 129 (Choi et al., 1989), Buffalo and HLS (Bowers et al., 1992). SMV resistance in PI 486355 is controlled by two independent dominant genes, one of which seems to be at the Rsv locus (Chen et al., 1993). The resistance genes in Raiden and Columbia are at different loci and are designated as Rsv2 and Rsv3, respectively. The resistance gene in Suweon is not at the Rsv locus, but allelism with other loci has not been tested. It has been reported that the SMV resistance is linked to genes conditioning resistance to peanut mottle virus (Roane et al., 1983) and peanut stripe virus (Choi et al., 1989). Yu et al. (1994) reported identification of the chromosomal location of Rsv gene using the G1 strain, and restriction fragment length polymorphisms and microsatellites or simple sequence repeats as genetic markers. The SSR marker, SM176 (a soybean heat shock protein gene), and two RFLP markers, pA186 and pK644a, were closely linked to Rsv, with distances of 0.5,1.5, and 2.1 centiMorgans, respectively. The marker analysis also indicated that the SMV resistance gene in Buffalo might be at the Rsv locus. The single dominant allele Rsv in the line PI 96983 confers resistance to all virulence groups, except 07 and G7a (Chen et al., 1988). L78-379, a near-isoline homozygous for Rsvl (originated as a plant selection fircMn Williams BC5 x PI 96983 [Bemard et al., 1991]), is also resistant to all virulence groups except G7 and G7a (Chen et al., 1988). The cultivar Davis is susceptible to SMV strains G4 - G7 as are the cultivars York, Dorman, and Ware (Roane et al., 1986a, b; Chen et al., 1988). At least one strain of SMV can overcome the resistance genes but no known strain can overcome all three genes. SMV-soybean interaction has been suggested to be a gene-for-gene relationship (Roane et al., 1986a; Thompson and Burdon, 1992). Often, gene-for-gene interactions are inferred from tiie specificity of the host-parasite reactions. The genetic basis of interactions in the SMV-soybean system involves studies of host parasite strains (pathogen genotypes) and as such might provide little inframation on how the gene-for-gene interaction is influenced by 23 population (Thompson and Buidon, 1992). The resistance to some SMV strains seems sensitive to low temperature (Mansky et al., 1991). Protein extracts firom the resistant cultivar Davis had no specific effect on the cell-free translation profile of an avirulent strain of SMV (G2) that oKrelated with resistance in Davis (Mansky et al., 1992), as has been observed with the CPMV polyprotein processing inhibitor in Arlington cowpea (Ponz et al., 1987). Use of SMV-free seed and soybean host resistance are the best approaches currendy available to control viral infection. S(Mne soybean lines have been reported that do not support seed transmission of SMV (Goodman et al., 1979), and genes for resistance have been identified (Prowidenti and Hampton, 1992). Genetically engineered resistance using coat protein or other non-structural viral genes may provide additional means to control SMV infecticm. Transgenic tobacco plants expressing the coat protein gene of the N strain of SMV were found to confer a high level of resistance to virus when challenge-inoculated widi TEV and PVY (Staik and Beachy, 1989). These findings suggested that the coat protein gene of SMV could be used successfully to generate transgenic soybean cultivars resistant to SMV infection. Virus movement in plants and the phenomenon of complementation The importance of virus movement in plants and its role in disease resistance, host range and host specificity have been reviewed (Hull, 1989; Maule, 1991; Deom et al., 1992; Malyshensko et al., 1989; Mansky and Hill, 1993). Plant viruses spread from sites of initial infection to distal sites through a multistep process. First, a plant virus must cross the cell wall and the initially infected cell must support viral replication to supply infectious material for subsequent movement Second, the virus must move from cell-to-cell through intercellular connections called plasmodesmata within the initially infected leaf. Next, the virus must enter the phloem sieve elements where it infects die host systemically (passive movement) within the same leaf and between organs. Finally, the virus must exist sieve elements and reestablish replication and cell-to-cell movement in distal tissues. 24 Viruses move in plants by encoding movement proteins (MP) (non structural) that are not essential fcH* viral replication oc encapsidation but are required for systemic infection of the host (Atebekov and Dorokhov, 1984; Maule, 1991; Deom et al., 1992). The current understanding of MP function is based on studies of the single MP protein encoded by TMV, red clover necrotic mosaic dianthovirus (RCNMV) and alfalfa mosaic virus (AIMV) (Citovsky et al., 1990,1992; Osman et al., 1992; Waigmann et al., 1994; Schoumacher et al., 1992). Each has been shown to be a sequence-nonspecific nucleic acid binding protein that binds RNA and facilitates passage through plasnxxlesmata. The TMV 30 kDa MP accumulates initially in the cytoplasm and then near plasmodesmata (Meshi et al., 1992) and increases size exclusion limit (SEL) of plasmodesmata about 10-fold. When microinjected into mesophyll cells, bacterially expressed fusions of MP of TMV or RCNMV increased measured SELs of plasmodesmata (Osman et al., 1992; Waigmann et al., 1994). In addition, each of these MP fusions rapidly moved from cell-to-cell and functioned to move single-stranded RNA. It has been suggested that the amino terminus of both TMV and AIMV MPs is critical for activity and that a 19 amino acid sequence near that carboxy terminus is essential for localization of the protein to the cell wall fracticxi of plant cells (Emy et al., 1992; Bema et al., 1991). These studies have formed the basis fcv the proposal that MPs are molecular cheparones (nucleic acid- binding proteins for rapid assembly and translocation) that bind the viral RNA genome and target it to the plasnxxlesmata where the MP protein functions to increase the SEL and facilitate cell-to-cell movement of the viral genome. Several other viruses encode single gene transport proteins and the triple-gene block proteins of potex-, aria-, fiiro-, and hordei-virus groups have been reported and may constitute a new class of products that potentiate virus movement (Beck et al., 1991; Mansky and Hill, 1993). A second model proposed for the action of MPs has come from electron microscopic studies of cauliflower mosaic virus (CaMV), CPMV, tomato ringspot virus, and tomato spotted wilt virus (TSWV) infections. According to this model, virus translocation results 25 from specific interaction between the virus and the plant The MP is associated with mbular structures that contain viius-like particles and appear to extend from cell walls at or near plasmodesmata into adjacent uninfected cells (van Lent et al., 1990; Perbal et al., 1993; Wieczorek and Sanfacon, 1993; Kormelink et al., 1994). It has been suggested that a virus particle or subviral nucleoprotein form may move in association with these tubular structures. Transient expression assays in protoplasts have shown that the single viral-encoded MP is sufficient to induce formation of the tubular structures (van Lent et al., 1991; Perbal et al., 1993). The bipartite geminiviruses move between cells through the coordinated activities of two MPs, BRl and BLl, that act direcdy to promote viral movement and define viral host range and pathogenic properties (Ingham et al., 1995). BRl shutties viral ssDNA from its site of viral replication in the nucleus to the cytoplasm and BLl facilitates transit of BRl-ssDNA complexes via plasmodesmata (Noueiry et al., 1994; Pascal., 1994). In the case of squash curl leaf curl geminivirus, it was shown, using transient expression assays in insect cells and Nicotiana tabacum cultivar Xanthi protoplasts, that BRl and BLl proteins interact specifically with each other. Sanderfoot and Lazarowitz (1995), showed tiiat when individually expressed, BRl is localized to the nuclei and BLl to the periphery (plasma membrane and cell wall) in both insect and plant cells. When coexpressed in either cell type, BLl specifically relocalized BRl (not the coat protein) from the nucleus to the periphery. The results demonstrated that the BLl protein interacts with BRl to facilitate movement and is responsible for providing directionality to noovement of the viral genome. In potyviruses such as tobacco etch virus (TEV), proteins witii dedicated movement functions have not been identified. The PI protein has been proposed to function as the potyviral MP, but deletions and modifications of the PI coding sequence have shown littie direct effect on movement (Verchot and Cairington, 1995 a, b). In addition, it has been proposed, based on mutational analyses, that the coat protein performs cell-to-cell functions 26 G^olja et al., 1995). Long-distance transport of TEV is suggested to involve viral functions distinct from those necessary for cell-to-cell movement Dolja et al., (1995) showed that different domains within the capsid protein (263 amino acid residues) play specific roles in cell- to-cell and long distance transport The core domain, which is required for assembly of the flexuous rod-shaped virions, is absolutely required for cell-to-cell movement On the contrary, the N-terminal (29 residues) and C-terminal (18 residues) regions, which comprise surface oriented domains not required for assembly, are dispensable for cell-to-cell transport but necessary for long-distance movement Mutants that lacked either terminal domain moved fitom cell-to-cell in initial infection courts but were incapable of systemic movement The data were interpreted to suggest that the TEV coat protein interacts with unique cellular factors or viral factors, or both, during cell-to-cell and long-distance movement. Recendy, through genetic anlysis of TEV, Cronin et al. (1995) showed that the potyvirus helper component proteinase (HC-Pro) that functioned in aphid-mediated transmission and polyprotein processing facilitated long-distance movement This activity was shown to reside within the central region of the HC-Pro. The proteinase factor appeared to possess only minor roles in genome amplification and cell-to-cell nnovement functions. In situ histochemical analysis revealed that the mutant defective in the central region of the HC-Pro was capable of infecting mesophyll, bundle sheath, and phloem cells within inoculated leaves. This observation was interpreted to suggest that the long distance movement function of HC-Pro was associated with viral entry or exit from sieve elements. The long distance effect was shown to be specifically complemented by HC-Pro supplied in trans by a transgenic host Taken together, the data were regarded to indicate that HC-Pro functions in one or more steps in the process of long distance transport. Understanding of virus movement has for the most part been done through molecular analysis studies. These studies have involved subliminal viral infection of plants, infection of isolated protoplasts, and con:q>lementation experiments in which infection of a plant with the 27 helper virus allowed systemic infection of a second virus. Complementation has been defined as the process by which one genome provides functions which another genome lacks (Hull et al., 1989). The most common type of complementation, interallelic, occurs when two mutants defective in diffo'ent functions assist each other in the virus replication cycle by complementing the defective fimction. One of the earliest exaiiq)les was complementation of cell-to-cell transport of the Ni2519 TMV mutant by a helper TMV strain under temperature sensitive conditions (Taliansky et al., 1982a). The Ni2519 mutant was temperature sensitive both in transpcxt and in virus assembly, making interpretation of results difficult. Intraallelic complementation, which occurs less frequentiy, takes place when the gene product of both viruses is a multimeric protein and each virus is defective in different domains of the functional viral protein (Fincham RS, 1966). Complementation in the virus transport function has been implied from mixed infection experiments between related and unrelated viruses; e.g., bean golden mosaic virus helped by TMV to spread in t(Mnato and bean (Carr and Kim, 1983), TMV helped by PVX to spread in plants containing the Tm-2 gene (Taliansky et al., 1982b), and TMV helped by barley stripe mosaic virus to spread in potato (Barker, 1987). These studies have been interpreted to suggest that the noovement protein (Deom et al., 1987) of the helper virus affects cellular physiology to allow cell-to-cell-movemenL However, other studies suggest involvement of additional factors; e.g., movement of red clover mottie comovirus (RCMV) was complemented by the Lsl isolate of TMV but transgenic tobacco plants expressing the 30 kDa movement protein did not potentiate the systemic spread of RCMV (Taliansky et al., 1992). In addition, a recombinant genome of afiican cassava mosaic geminivirus containing tomato golden mosaic virus movement protein genes could not spread systemically in Nicotiana benthandana. However, systemic movement of the recombinant cowpea chlorotic mottie bromovirus containing the 30 kDa protein of sunhemp mosaic virus suggested, that in this virus, the 28 movement protein acts independently of specific features of viral coat protein or interactions independent of RNA sequence. Complementation of defective challenge virus in transgenic plants has also been observed in other systems, including AIMV (van Dun et al., 1988), tomato golden mosaic geminivirus (Hanley-Bowdoin et al., 1990), and the potyvinis TVMV (Klein and Shaw, 1993; Cronin et al., 1995). Mutant viruses generated by introducing frame shift mutations in either the movement gene or the CP gene were found to be fiilly complemented in transgenic plants that expressed the appropriate wild type gene (Holt and Beachy, 1991). Recently, a genetic complementation system was developed in which tobacco etch potyvinis (TEV) polymerase (NIb)-expressing transgenic plants or protoplasts were inoculated with Nib-defective TEV mutants (Li and Carrington, 1995). The four mutant viruses used were VNN (mutation affected the GDD polymerase motif), EDE (mutation affected a nuclear localization signal sequence), aD/b (mutation weakened the Nib N-terminal cleavage site) and Ab Cocked the entire Nib sequence). It was shown that each mutant was unable to amplify in non- transformed tobacco plants. In contrast, the VNN, EDE, and Ab mutants were complemented to various degrees in Nib-expressing cells, whereas the aD/b mutant was not complemented. These data were interpreted to suggest that Nib supplied entirely in trans could provide all Nib functions essential for RNA replication. The observation that EDE was the mutant complemented least efficiently suggested that the resulting mutant protein was transinhibitory. A pannel of monoclonal antibodies that distinguish epitopic differences among the coat proteins of SMV strains have been used to test con:q)lementation of pathogenic strains in mixed infection (Mansky et al., 1995). It was found that G2 could spread systemically in immune as well as susceptible plants preinfected with either G7 or G7a. 29 Polymerase chain reaction and disease detection Polymerase chain reaction (PGR) is a highly sensitive method for the amplification of genomes. The PCR is now routinely used for gene cloning, genome analysis, disease diagnosis and has great potential fra* the study of plant-pathogen interaction (Innis et al., 1990). PCR is a conqilex series of chemical reactions involving three distinct steps used to amplify a region of DNA. These steps are i) denaturation of the double stranded DNA sample at high temperature ii) annealing of tiie oligonucleotide primers to the DNA template at temperatures between 37 C and 70 C and iii) extension of the primers using Taq DNA polymerase at temperatures between 70 and 74 C (Innis et al., 1990). The steps are perfomied repeatedly in cycles in a thermocycler. In the first cycle, each template strand gives rise to a newly synthesized ccHnplement; the number of the target region is doubled in the first and in subsequent cycles. The template DNA may be genomic or first strand cDNA, or cloned sequences. In viruses that consist of genomic RNA molecules, first strand synthesis by reverse transcription is an initial step in PCR (RT-PCR) (Langeveld et al., 1991). Primers are designed to anneal to complementary strands to initiate DNA synthesis at each primer resulting in replication of the region of the template between the primers. The success of PCR depends on its abUity to yield a specific amplified product in good yield. It has been reported that specificity depends on various factors including optimization of concentrations of primers, magnesium, deoxynucleoside triphosphates and template DNA; standardizing the annealing temperature; and the use of 'hot start' PCR (Ruano et al., 1991). PCR has become widely used as a diagnostic technique for infections of mycoplasma like organisms (MLOs) (Schaff et al., 1992), bacteria (Minsavage at al., 1994), viroids (Rezaian, et al., 1992) and plant viruses belonging to several different groups, e.g., the geminivinis, the luteovirus and the potyvirus groups (Henson and French, 1993; Langeveld et al., 1991; Robertson et al., 1991; Rojas, et al., 1993). Langeveld et al. (1991) applied PCR to positively identify nine different potyviruses infecting bulbous crops by using degenerate 30 oligonuclodde primers based on conserved sequences in the Nib and coat protein coding regions of the potyvirus genomes. The two sets of primers used were shown to be potyvinis specific as they amplified the expected gene fragments, but did not support amplification of carlavirus and potexyvirus gene segments. Based on the assay, BYMV, iris mild mosaic virus (IMMV), iris severe mosaic virus (ISMV) and tulip breaking virus (TBV) only, were shown to be definitive members of the family Potyviridae. Additionally, PCR assay has been applied to detect other potyviruses such as plum pox virus (Wetzel et al., 1991), sugarcane mosaic virus (Smith and Velde, 1994), and two sweet potato viruses (Colinet et al., 1994). With these viruses, the primers were designed to amplify a variable region of the potyvirus genome to distinguish between different viruses within the group rather than strains of the same virus. Differentiation of the same virus strains using reverse transcription PCR (RT-PCR)-based assay has also been reported with cucumber mosaic virus (Rizos et al., 1992), citrus tristeza virus (Gillings et al., 1993) and vertebrate viruses such as equine herpesvirus (EHV) (Welch et al., 1992). These viruses were first detected by using primers derived from variable or conserved regions of the viral genome and then differentiated by further analysis of the amplified products by restriction endonuclease analyses or hybridization with type specific oligonucleotide probes (Sharma et al., 1992). Variations of PCR have been developed in attempts to simplify disease detection, e.g., PCR-microplate hytnidization fw detection of PVY (Hataya et al., 1994) and abutting primer PCR for isolation of full length infectious clones of geminiviruses (Briddon et al., 1993). To circumvent nucleic acid extractions, Wetzel et al. (1991) and Boija and Ponz (1992) published procedures for performing RT-PCR directly in dilute crude plant extracts. Immunocapture RT- PCR involving a step of viral thermal disruption prior to reverse transcription has been reported for hepatitis A virus and plum pox virus (Jansen et al., 1990; Wetzel et al., 1992). Additionally, an elegant immunocapture RT-PCR involving use of immobilized antibodies in ELISA without previous viral disruption has been reported (Nolasco et al., 1993). In this case 31 the amplified product was deteaed by fluorescence of a non-intercalating dye; the method was applied for detection of eight viruses, the satellite of cucumber mosaic virus, and potato spindle tuber viroid. However, all these variations of PGR either were applied to different viruses rather tiian strains or required further analysis of amplified products. An approach to PGR known as nested PGR has allowed detection and differentiation of EHV-1 and EHV-4 without the need for further analytical techniques (Borchers and Slater, 1993). Dissertation organization Soybean [Glycine max (L.) Merr.] is an important crop worldwide whose production is affected by SMV. Soybean lines exist that contain genes for resistance to some, but not all strains of SMV. The observation that at least one strain of SMV can overcome each of the known resistance genes, urgues for better understanding of plant resistance in order to insure the stability of soybean varieties against virus disease. Therefore, soybean and SMV were used as a model to learn more about plant resistance to vims disease. The study involved first, development of an accurate reverse transcription-polymerase chain reaction-based assay for differentiation of SMV strains. Next, this technique was applied to study the nature of conc^lementaticMi between SMV strains in mixed infection of soybeans. The hypotheses set forth for the study were two-fold: (a) a biochentucal assay (e.g., the polymerase chain reaction) and the differences in biological properties (e.g., differential hosts) can be used to separate closely related strains of SMV; (b) the possibility that co-inoculation of soybean plants with virulent and avirulent strains of SMV may lead to systemic movement of the avirulent virus in the resistant lines can be determined by searching for the presence of viral RNAs of both the virulent and avirulent strains. Initially, the goal was to assign SMV strains of all combinations of virulence into functional complementation groups involved in overcoming /?sv-mediated resistance. This study has concentrated on strains G2, G7 and G7a. This dissertation is written in an alternate format. It starts widi a general introduction followed by literature cited. This is followed by two chapters, each of which is a complete 32 manuscript Each chapter contains an abstract, introduction, materials and methods, results, discussion, and literature cited. The dissertation ends with a general conclusion. Literature cited Allison R, Johnston RE, Dougherty WG (1986) The nucleotide sequence of the coding region of tobacco etch virus genomic RNA: evidence for the synthesis of a single polyprotein. Virology 154:9-20 Atabekov JG, Dorokhov YL (1984) Plant virus-specific transport function and resistance of plants to viruses. Adv Virus Res 29:313-364 Atreya CD, Raccah B, Pirone TP (1990) A point mutation in the coat protein abolishes aphid transmissibility of a potyvirus. Virology 178:161-165 Atreya CD, Atreya PL, Thwnbury DW, Pirone TP (1992) Site-directed mutations in the potyvirus HC-pro gene affect helper component activity, vims accumulation, and symptom expression in infected tobacco plants. Virology 191:106-111 Barker H (1987) Invasion of non-phloem tissue in Nicotiana clevelandii by potato leafioll luteovirus is enhanced in plants also infected with potato virus Y potyvirus. J Gen Virol 68:1223-1227 Barker H, Harrison BD (1984) Expression of genes for resistance to potato virus Y in potato plants and protoplasts. Ann Appl Biol 105:539-545 Bamett OW (1991) Potyviridae, a proposed family of plant viruses. Arch Virol 118:139-141 Bamett OW (1992) A summary of potyvirus taxonomy and definitions. In: Bamett OW (ed.), Potyviras taxonomy. Springer-Verlag, Wien and New York (Archives of Virology [Supplement] 5), pp 435-444 Beck DL, Guilford PJ, Voot DM, Andersen MT, Forster RSL (1991) Triple gene block proteins of white clover mosaic potexvirus are required for transport Virology 183: 695-702 33 Beier H, Siler DJ, Russel ML, Bruening G (1977) Survey of susceptibility to cowpea mosaic virus among protoplasts and intact plants from Vigm sinensis lines. Phytopathology 67:917-921 Berger PH (1992) The usefulness of £^hid transmission as a taxonomic criterion for potyviruses. In: Bamett OW (ed.), Potyvirus Taxonomy. Springer-Verlag, Wien and New York (Archives of Virology [Supplement] 5), pp 251-255 Berger PH, Thombury DW, Pirone TP (1985) Detection of picogram quantities of potyviruses using a dot blot immunobinding assay. J Virol Methods 12: 31-39 Bema A, Gafhy R, Wolf S, Lucas WJ, Holt CA, Beachy RN (1991) The TMV movement protein: role of the C-terminal 73 amino acids in subcellular localization and function. Virology 182:682-689 Bernard RL, Nelson RL, Cremeens CR (1991) USDA soybean genetic collection: isoline collection. Soybean Genetic Newsl 18:27-57 Borchers K, Slater J (1993) A nested rcR for the detection and differentiation of EHV-1 and EHV-4. J Virol Methods 45: 331-336 Boija MJ, Ponz F (1992) An ^praisal of different methods for the detection of the walnut strain of cherry leafroll virus. J Virol Methods 36:73-83 Bos L (1972) Soybean mosaic virus. CMI/AAB Description of plant viruses. No. 93. G)nunonwealth Agricultural Bureaux and the Association of Appied Biologists, Kew and Warwick, UK Bowers GR, Jr, Paschal EH II, Bernard RL, Goodman RM (1992) Inheritance of resistance to soybean nrasaic virus in 'Buffalo' and HLS soybean. Crop Sci 32: 67-72 Briddon RW, Prescott AG, Lunness P, Chamberlin LCL, Markham PC (1993) Rapid production of full-length, infectious geminivirus clones by abutting primer PGR (AbP- PCR). J Virol Methods 43: 7-20 34 Buzzell RI, Tu JC (1984) Inheritance of soybean resistance to soybean mosaic vims J Hered 75: 82 Buzzell RI, Tu JC (1989) Inheritance of a soybean stem-tip necrosis reaction to soybean mosaic virus. J Hered 80:400-401 Brunt AA, Crabtree K, Gibbs AJ (1990) Viruses of tropical plants. CAB International, Wallingfoid, UK, 707pp Bryant GR, Hill JH, Bailey TB, Tachibana H, Durand DP, Benner HI (1982) Detection of soybean mosaic virus in seed by solid-phase radio immunoassay. Plant Dis 66: 693- 695 Bryant GR, Durand DP, Hill JH (1983) Development of a solid phase radioimmunoassay for detection of soybean QU)saic virus. Phytopathology 73:623-629 Calder VL, Ingerfeld M (1990) The roles of cylindrical inclusion protein of a potyvirus in the induction of vesicles and in cell-to-cell spread. J Structural Biol 105: 62-66 Carr RJ, Kim KS (1983) Evidence that bean golden mosaic virus invades non-phloem tissue in double infections with tobacco mosaic virus. J Gen Virol 64:2489-2492 Carrington JC, Dougherty WG (1987) Processing of the tobacco etch vims 49K protease requites autoproteolysis. Virology 160: 355-362 Carrington JC, Freed DD, Sanders TC (1989) Autocatalytic processing of the potyvims helper component proteinase in Escherichia coli and in vitro. J Virol 63:4459-4463 Chen L-C, Durand DP, Hill JH (1982) Detection of pathogenic strains of soybean mosaic virus by enzyme-linked immunosorbent assay with polystyrene plates and beads as solid phase. Phytopathology 72:1177-1181 Chen P, Buss GR, Tolin SA (1988) Inheritance of reaction to strains G5 and G6 of soybean mosaic vims (SMV) in differential soybean cultivars. Soybean Gen Newsl 15: 130- 134 35 Chen P, Buss GR, Tolin SA (1993) Resistance to soybean mosaic virus conferred by two independent dominant genes in PI 486355. J Hered 84:25-28 Chen P, Buss GR, Roane CW, Tolin SA (1991) Allelism among genes for resistance to soybean mosaic virus in strain-differential soybean cultivars. Crop Sci 31: 305-308 Cho E, Goodman RM (1979) Strains of soybean mosaic virus: classification based on virulence in resistant soybean cultivars. Phytopadiology 69:467-470 Cho EK, Goodman RM (1982) Evaluation of resistance in soybeans to soybean mosaic virus strains. Crop Sci 22:1133-1136 Choi SH, Green SK, Lee DR (1989) Linkage relationship between two genes conferring resistance to peanut stripe virus and soybean mosaic. Euphytica 44:163-169 Citovsky V, Knorr D, Schuster G, Zambryski P (1990) The P 30 movement protein of tobacco mosaic virus is a single-stranded nucleic acid binding protein. Cell 60: 637- 647 Citovsky V, Wong, ML, Shaw AL, Prasad BW, Zambryski P (1992) Visualization and characterization of tobacco mosaic virus movement protein binding to single-stranded nucleic acids. The Plant cell 4: 397-411 Clinton GP (1915) Notes on plant diseases of Connecticut Report of the Connecticut Agricultural Experiment Station for 1915, pp 421-451 Colinet D, Kummert J, Lepoivre P, Semal J (1994) Identification of distinct potyviruses in mixedly-infected sweet potato by polymerase chain reaction with degenerate primers. Phytopathology 84:65-69 Cooper JI, Jones AT (1983) Responses of plants to viruses: proposals for the use of terms. Phytopathology 73:127-128 Cronin S, Verchot J, Haldeman-Cahill R, Schaad MC, Carrington JC (1995) Long-distance movement factor a transport function of the potyvirus helper component proteinase. The Plant CeU 7:549-559 36 Culver JN, Dawson WO (1991) Tobacco mosaic virus elicitor coat protein genes produce a hypersensitive phenotype in transgenic Nicotiana sylvestris plants. Mol Plant-Microbe Interact 4:458-463 Davidson AD, Prols M, Schell J, Steinbbiss H.-H (1991) The nucleotide sequence of RNA 2 of barley yellow mosaic virus. J Gen Virol 72:989-993 Demski JW, Jellum MD (1975) Single and double virus infection of soybeans: plant characteristics and chemical composition. Phytopathology 65:1154-1156 Deem CM, Lapidot M, Beachy RN (1992) Plant virus movement proteins. Cell 69:221-224 De virus potentiates virus movement. Science 237:389-394 Diaco R, Hill JH, Hill EK, Tachibana H, Durand DP (1985) Monoclonal andbody-based biotin-avidin ELISA for detection of soybean mosaic virus in soybean seeds. J Gen Virol 66:2089-2094 Dolja W, Haldeman-Cahill R, Montgomery AE, VandenBosch KA, Carrington JC (1995) Q^sid protein determinants involved in cell-to-cell and long distance movement of tobacco etch potyvirus. Virology 206:1007-1016 Domier LL, Franklin KM, Shahabuddin M, Hellman GM, Overmeyer JH, Hiremath ST, Siaw MEE, Lomonossoff GP, Shaw JG, Rhoads E (1986) The nucleotide sequence of tobacco vein mottling virus. Nucleic Acids Res 14:5417-5430 Domier LL, Shaw JG, Rhoads RE (1987) Potyviral proteins share amino acid sequence hcMnology with picoma-, conK>-, and caulimoviral proteins. Virology 158: 20-27 Dong X (1995) Finding the missing pieces in the puzzle of plant disease resistance. Proc Natl Acad Sci USA 92:7137-7139 Dougherty WG (1983) Analysis of viral RNA isolated from tobacco leaf tissue infected with tobacco etch virus. Virology 131:473-481 37 Dougherty WG, Carrington JC (1988) Expression and function of potyviral gene products. Annu Rev Phytopathol 26:123-143 Dougherty GW, Parks TD (1989) Molecular genetic and biochemical evidence for the involvement of the heptapeptide cleavage sequence in determining the reaction profile at two tobacco etch virus cleavage sites in cell-£ree assays. Virology 172:145-155 Dougherty WG, Parks TD (1991) Post-translational processing of the tobacco etch virus 49-kDa small nuclear inclusion polyprotein: identification of an internal cleavage site and delimination of VPg and proteinase domains. Virology 183:449-456 Edwardson JR, Christie RG (1991) The potyvirus group. Volumes I-FV, Florida Agricultural Experiment Station Monograph 16 Edwardson JR (1992) Inclusion bodies. In: Bamett, OW (ed.), Potyvirus taxonomy. Springer-Verlag, Wien and New York (Achiv Virol [Suppl] 5), pp 259-267 Eggenberger AL, Staik DM, Beachy RN (1989) The nucleotide sequence of a soybean mosaic virus coat protein-coding region and its expression in Escherichia coli, Agrobacterium uunefaciens and tobacco callus. J Gen Virol 70:1853-1860 Emy C, Schoumacher F, Jung C, Gagey M-J, Godefroy-Colbum T, Stussi-Garard C, Bema A (1992) An N-proximal sequence of the alfalfa mosaic virus movement protein is necessary for association witii cell walls in transgenic plants. J Gen Virol 73:2115- 2119 Fauquet C, Dejardin J, Thouvenel JC (1986) Evidence that the amino acid composition of the particle proteins of plant viruses is characteristic of tiie virus group. 2. Discriminant analysis according to structural, biological and classification properties of plant vimses. Intervirology 25:190-200 Fehr WR, (1987) Soybean. In: Fehr WR (ed.). Principles of cultivar development, vol 2, Crop species. Macmillan Publishing Co, New York Fincham RS (1966) Genetic complementation. W. A. Benjamin, New York 38 Foulds U, Lea VJ, Sidebottom C, James CM, Boulton RE, Bears T, Slabas AR, Jack PL, StratfcHd R (1993) Qoning and sequence analysis of the coat protein gene of barley mild mosaic virus. Virus Res 27:79-89 Eraser RSS (198S) Mechanisms of resistance to plant diseases. Marmus Nijhoff/Dr W. Junk Publishers, Dordrecht, Netherlands Frenkel MJ, Jilka JM, Shukla DD, Ward CW (1992) Differentiation of potyviruses and their strains by hybridization with the 3' non-coding region of the viral genome. J Virol Methods 36:51-62 Fritig B, Kauffimann S, Dumans B, Geoffrey P, Kopp M, Legrand L (1987) Mechanisms of the hypersensitivity reaction of plants. In: Evered D, Harnett S (eds), Plant resistance to viruses, Wiley, Chichester, pp 92-103 Garcia JA, Martin MT, Cerver MA, Riechman JL (1992) Proteolytic processing of the plum pox potyvirus polyprotein by the NIa protease at a novel cleavage site. Virology 188:697-703 Gadani F, Mansky LM, Medici R, Miller WA, Hill JH (1990) Genetic engineering of plants for virus resistance. Arch Virol 115:1-21 Gardner MW, Kendrick JB (1921) Soybean mosaic virus. J Agric Res 22:111-114 Ghabrial SA, Shepherd RJ (1980) A sensitive radioimmunosorbent assay for the detection of plant viruses. J Gen Virol 48: 311-317 Ghabrial SA, Smith HA, Paries TD, Dougherty WG (1990) Molecular genetic analyses of the soybean mosaic virus NIa proteinase. J Gen Virol 71:1921-1927 Giachetti C, Semler BL (1991) Role of a viral membrane polypeptide in strand-specific initiation of poliovirus RNA synthesis. J Virol 65: 2647-2654 Gibb KS, Hellmann GM, Pirone TP (1989) Nature of resistance of a tobacco cultivar to tobacco vein mottling virus. Mol Plant Microbe Interact 2:332-339 39 Gillings M, Broadbent P, Indsto J, Lee R (1993) Characterisation of isolates and strains of citrus tristeza closterovirus using restriction analysis of the coat protein gene amplified by the polymerase chain reaction. J Virol Methods 44:305-317 Goodman RM, Bowers GM, Paschal EH (1979) Identification of soybean germplasm lines and cultivars witii low incidence of soybean mosaic virus transmission through seed. Crop Sci 19:264-267 Gordon-Weeks R, White RF, Pierpoint WS (1991) Evidence for the presence of endogenous inducers of the accumulaticm of pathogenesis related (PR-1) proteins in leaves of virus- infected tobacco plants of an interspecific Nicotiana hybrid. Physiol Mol Plant Pathol 38: 375-392 Gmmet R, Fang G (1990) cDNA cloning and sequence analysis of the 3'-terminal region of zucchini yellow mosaic virus RNA. J Gen Virol 71:1619-1622 Hanley-Bowdoin L, Elmer JS, Rogers SG (1990) Expression of functional replication protein from tomato golden mosaic virus in transgenic tobacco plants. Proc Natl Acad Sci USA 87:1446-1450 Haii V, Siegel A, Rozek C, Timberlake WE (1979) The RNA of tobacco etch virus contains poly(A). Virology 92: 568-571 Harrison BD, Robinson DJ (1988) Molecular variations in vector-bome plant viruses: epidemiological significance. Phil Trans Royal Soc London, Series B 321:447-462 Hataya T, Inoue AK, Shikata E (1994) A PCR-microplate hybridization method for plant virus detection. J Virol Methods 46:223-236 Henson JM, French R (1993) The polymerase chain reaction and plant disease diagnosis. Annu Rev Phytpathol 31: 81-109 Hill EK, Hill JH, Durand DP (1984) Production of monoclonal antibodies to viruses in the potyvirus group. J Gen Virol 65:525-532 40 Hill JH, Be'nner HI, Permar TA, Bailey TB, Andrews RE, Jr, Durand DP, Van Deusen RA (1989) Differentiation of soybean mosaic virus isolates by one-dimensional trypsin peptide maps immunoblotted with monoclonal antibodies. Phytopathology 79:1261- 1265 Hill JH, Benner HI, Van Deusen RA (1994) Rapid differentiation of soybean mosaic virus isolates by antigenic signature analysis. J Phytopathol 142:152-162 Himmler G, Frank S, Steinkellner H, Ruker F, Mattanovich D, Katinger HWD (1990) Detection of the trans activity of the plum pox virus NIa-Iike protease in infected plants. J Gen Virol 71:1623-1625 Holt CA, Beachy RN (1991) In vivo complementation of infectious transcripts from mutant tobacco virus cDNAs in transgenic plants. Virology 181:109-117 HoUingsM, Brunt AA (1981) Potyvirus group. CMI/AAB Description of plant viruses. No. 245 Hull R (1989) The movement of viruses in plants. Annu Rev Phytopathol 27:213-240 Hull R, Brown F, Payne C (1989) Virology: directory and dictionary of animal and plant viruses. Stockton Press, New York Hunst PL, Tolin SA (1982) Isolation and comparison of two strains of soybean mosaic virus. Phytopathology 72:710-713 Ingham DJ, Pascal E, and Lazarowitz SG (1995) Both geminivirus movement proteins define viral host range, but only BLl determines viral pathogenicicity. Virology 207:191-204 Innis MA, Gelfand DH, Sninsky JJ, White TJ (1990) PGR protocols: A guide to methods and applications. Academic Press, New Yoik, 1990 Jain RK, McKem NM, Tolin SA, Hill JH, Bamett OW, Tosic M, Ford RE, Beachy RN, Yu MH, Ward CW, Shukla DD (1992) Confirmation that fourteen potyvims isolates from soybean are strains of one virus by comparing coat protein peptide profiles. Phytopathology 82:294-299 41 Jansen RW, Siegl G, Lemon SM (1990) Molecular epidemiology of human hepatitis A virus defined by an antigen-capture polymerase chain reaction metiiod. Pro. Natl. Acad. Sci. USA 87:2867-2871 Jayaram Ch., Hill JH, Miller WA (1991) Nucleotide sequences of the coat protein genes of two aphid-transmissible strains of soybean mosaic virus. J Gen Virol 72; 1001-1003 Jayaram (Th, Hill JH, Miller WA (1992) Q)mplete nucleotide sequences of two soybean mosaic virus strains differentiated by response of soybean containing the Rsv resistance gene. J Gen Virol 73: 2067-2077 Jones RAC (1985) Further studies on resistance-breaking strains of potato virus X. Plant Pathol 34:182-189 Kashiwazaki S, Minobe Y, Omura T, Hibino H (1990) Nucleotide sequence of barley yellow mosaic virus RNA 1: a close evolutionary relationship with potyviruses. J Gen Virol 71:2781-2790 Kasschau KD, Carrington JC (1995) Requirement for HC-Pro processing during genome anq)lification of tobacco etch potyvirus. Virology 209:268-273 Kiihl RAS, Hartwig EE (1979) Inheritance of reaction to soybean mosaic virus in soybeans. Crop Sci 19:372-375 Klein PG, Shaw JG (1993) Complementation studies on transgenic plants of a lethal mutant of tobacco vein mottling potyvirus. In: IX International Congress of Virology. Abstarct P60-11 Koenig R (1978) BUS A in the study of homologous and heterologous reactions of plant viruses. J Gen Virol 40:309-318 Konnelink R, Storms M, van Lent J, Goldbach R (1994) Expression and subcelluar localization of the SNm protein of tomato spotted wilt virus (TSWV), a putative viral movement protein. Virology 200: 56-65 42 Lain S, Martin MT, Riechnoann JL, Garcia JA (1991) Novel catalytic activity associated with positive-strand RNA vims infection: Nucleic acid-stimulated ATPase activity of the plum pox potyvirus helicaselike protein. J Virology 63:1-6 Lamb O, Lawton MA, Dron M, Dixon DA (1989) Signals and transduction mechanisms for activation of plant defenses against microbial attack. Cell 56:215-224 Lamb CJ (1994) Plant disease resistance genes in signal perception and transduction. Cell 76: 419-422 Langenberg WG, Purcifiill DE (1989) Interactions between pepper ringspot virus and cylindrical inclusions of potyviruses. J Ultrastruct Mol Struct Res 102: 53-58 Langeveld SA, Dore JM, Memelink J, Derks AFLM, Van der Vlugt CIM, Asjes CJ, Bol JF (1991) Identification of potyviruses using polymerase chain reaction with degenerate primers. J Gen Virol 72:1531-1541 Larkin PJ, Young MJ, Gerlach WL, Waterfiouse PM (1991) The Yd2 resistance to barley yellow dwarf virus is effective in barley plants but not in their infected protoplasts. Ann Appl Biol 118:115-125 Li XH, Carrington JC (1995) Complementation of tobacco etch potyvirus mutants by active RNA polymerase expressed in transgenic cells. Proc Natl Acad Sci 92:457-461 Lim SM, (1985) Resistance of soybean mosaic vims in soybeans. Phytopathology 75:199- 201 Lucas BS, Hill JH (1980) Characteristics of the transmission of three soybean mosaic vims isolates by Myzus persicae and Rhopalosiphum maidis. Phytopath Z 99:47-53. Lister RM (1978) Application of the enzyme linked immunosorbent assay for detecting vimses in soybean plants. Phytopathology 68:1393-1400 Malyshenko SI, Kondakova OA, Taliansky ME, Atabekov JG (1989) Plant vims transport function: complementation by helper vimses is non-specific. J Gen Virol 70: 2751- 2757 43 Mansky LM, Durand DP, Hill JH (1991) Effect of temperature on the maintenance of resistance in soybean to soybean mosaic virus in soybean. Phytopathology 81: 535- 538 Mansky LM, Durand DP, Hill JH (1992) Cell free translation of potyviral RNA including extracts from disease resistant soybean. J Phytopathol 136:211-220 Mansky LM, Hill JH (1993) Molecular basis for virus resistance in plants. Arch Virol 131:1- 6 Mansky LM, Hill JH (1995) Evidence for complementation of plant potyvirus pathogenic strains in mixed infection. J Phytopathol 143:247-250 Matthews REF (1991) Plant virology (3rd ed.). Academic Press, New York Maule AJ (1991) Virus movement in infected plants. Crit Rev Plant Sci 9:457-473 Mavankal G, Rhoads RE (1991) In vitro cleavage at or near the N-terminus of the helper OMnponent protein in the tobacco vein mottling virus polyprotein. Virology 185:721- 731 Meshi T, Hosokawa D, Kawagishi M, Watanabe Y, Okada Y (1992) Reinvestigation of intracellular localization of the 30 K protein in tobacco protoplasts infected with tobacco mosaic virus RNA. Virology 187: 809-813 Meshi T, Motoyoshi F, Adachi A, Watanabe Y, Takamatsu N, Okada Y (1988) Two ccHicomitant base substitutions in the putative repUcase genes of tobacco mosaic virus confer the ability to overcome the effects of a tomato resistance gene, Tm-1. EMBO J. 7:1575-1581 Milne RG (1888) Taxonomy of the rod-shaped filamentous viruses. In: Milne RG (ed.) The plant viruses. No. 4, The filamentous plant viruses. Plenum Press, New York, pp 3-50 Minsavage GV, Thoirq)son CM, Hopkins DL, Leite RMVBC, Stall RE (1994) Deveolopment of a polymerase chain reaction protocol for detection of Xylella fastidiosa in plant tissue. Phytopathology 84:456-461 44 Murphy JF, Rhoads RE, Hunt AG, Shaw JG (1990) The VPg of tobacco etch virus RNA is the 49-kDa proteinase w the N-tenninal 24-kDa part of the proteinase. Virology 178:285-288 Niblett CL, Zagula KR, Calvert LA, Kendall TL, Stark DM, Smith GE, Beachy RN, Lommel SA (1991) cDNA cloning and nucleotide sequence of the wheat streak mosaic virus capsid protein gene. J Gen Virol 72:499-504 Nolasco G, de Bias C, Torres V, Ponz F (1993) A method combining immunocapture and PCR amplification in a microtiter plate for the detection of plant viruses and subviral pathogens. J Virol Methods 45:201-218 Noueiry AO, Lucas WJ, Gilbertson RL (1994) Two proteins of a plant DNA virus coordinate nuclear and plasmodesnfiatal transport Cell 76:925-932 Oh C-S, Canington JC (1989) Identification of essential residues in potyvirus proteinase HC- Pro by site-directed mutagenesis. Virology 173:692-699 Osman TAM, Hayes RJ, Buck KW (1992) Cooperative binding of the red clover necrotic mosaic virus movement protein to single-stranded nucleic acids. J Gen Virol 73:223- 227 Perbal M -C, Thomas CL, Maule AJ (1993) Cauliflower mosaic virus gene I product (PI) forms tubular structures which extend fi'om the surface of infection protoplasts. Virology 195:281-285 Parlevliet JE (1979) Components of resistance that reduce the rate of epidemic development Annu. Rev. Phytopathol. 17: 203-222 Pascal E, Sanderfoot AA, Ward BM, Medville R, Turgeon R, Lazarowitz SG (1994) The geminivirus BRl movement protein binds single-stranded DNA and localizes to the cell nucleus. Plant Cell 6:995-l(X)6 45 Peerenboom E, Prols M, Schell J, Steinbiss HH, Davidson AD (1992) The complete nucleotide sequence of RNA 1 of a German isolate of barley yellow mosaic virus and its comparison with a Japanese isolate. J Gen Virol 73:1303-1308 Pelham J (1972) Strain-genotype interactions of tobacco mosaic virus and tomato. Ann Appl Biol 71:219-228 Ponz F, Glascock CB, Bruening G (1987) An inhibitor of polyprotein processing with the characteristics of a natural virus resistance factor. Mol Plant Microbe Interact 1; 25-31 Prowidenti R, Hampton RO (1992) Sources of resistance to viruses in the Potyviridae. In: Bamett OW (ed.), Potyvinis taxonomy. Springer-Verlag, Wien and New York (Archives of Virology [Suppl. ] 5), pp 189-211 Purcifiill DE, Hiebert E (1979) Serological distinction of watermelon mosaic virus isolates. Phytopathology 69:112-116 Riechmann JL, Lain S, Garcia JA (1992) Highlights and prospects of potyvinis molecular biology. J Gen Virol 73:1-16 RizosH,GunnLV, Pares RD,Gillings MR (1992) Differentiation of cucumber mosaic virus isolates using polymerase chain reaction. J Gen Virol 73:2099-2103 Rezaian MA, Krake LR, Golino DA (1992) Common identity of grapevine viroids from USA and Australia revealed by PGR analysis. Intervirology 34:38-43 Roane CW, Tolin SA, Buss GR (1986a) Application of the gene-for-gene hypothesis to soybean-soybean mosaic virus interactions. Soybean Genet Newsl 13:136-139 Roane CW, Tolin SA, Buss GR (1986b) Genetics of reaction to soybean mosaic virus (SMV) in the cultivars Kwanggyo, Marshall, and PI 96983. Soybean Genet Newsl 13:134- 135 Roane CW, Tolin SA, Buss GR (1983) Inheritance of reaction to two viruses in the cross 'York' X 'Lee 68'. J Hered 74: 289-291 46 Robertson ML, French R, Gray SM (1991) Use of group specific primers and the polymerase chain reaction for the detection and identification of luteoviruses. J Gen Virol 72: 1473-1477 Rojas MR, Gilbertson RL, Russell DR, Maxwell DP (1993) Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant Dis 77:340-347 Ross JP (1969) Effect of time and sequence of inoculation of soybeans with soybean mosaic and bean pod mottle viruses on yields and seed characters. Phytopathology 59:1404- 1408 Ruano G, Brash DE, Kidd KK (1991) PGR: The first few cycles, amplifications. A forum for users. Issue No 7, Perkin Elmer, Cetus RybickiEP, ShuklaDD (1992) Coat protein phylogeny and systematics of potyviruses. In: Bamett OW (ed.), Potyvirus taxonomy. Springer-Verlag, Wien and New York Arch Virol [Suppl. ] 5), pp 139-170 Sanderfoot AA, Lazarowitz SG (1995) Cooperation in viral movement: the geminivirus BLl movement protein interacts with BRl and redirects it from the nucleus to the cell periphery. The Plant Cell 7:1185-1194 Schaff D, Lee I-M, Davis RE (1992) Sensitive detection and identification of mycoplasma-like organisms in plants by polymerase chain reactions. Biochem Biophys Res Commun 186:1503-1509 Schoumacher F, Emy C, Bema A, Godefroy-Colbum T, Stussi-Garaud C (1992) Nucleic acid-binding properties of the alfalfa mosaic virus movement protein produced in yeast. Virology 188:896-899 Scott GE (1989) Linkage between maize dwarf mosaic virus resistance and endosperm color in maize. Crop Sci 29:1478-1480 47 Sela I, GraH G, Sher N, Edelbaum O, Yagev H, Gerassi E (1987) Resistance systems related to N gene and their conq)arison with interferon. In: Evered D, Harnett S (eds) Plant resistance to viruses. Willey, Chichester, pp 109-119 Siegel A (1979) Recognition and specificity in plant virus infection. In: Daly JM, Uritani I (eds) Recognidon and specificity in plant host-parasite interactions. Japan Scientific Society Press, Tokyo, pp 253-272 Sinclair JB, Backman PA (eds) (1989) Compedium of soybean diseases (Srd ed.). American Phytopathological Society, St Paul, MN Singh SR, Rachie KO, Dashiell KE (1987) Soybeans for the tropics: research, pnxiuction and utilization. John Willey and Sons, Chichester, UK Shahabuddin M, Shaw JG, Rhoads RE (1988) Mapping of the tobacco vein mottling virus VPg cistron. Virology 163:635-637 Sharma PG, Cullinane AA, Onions DE, Nicolson L (1992) Diagnosis of equine herpesvirus -1 and -4 by polymerase chain reaction. Equine Vet J 24:20-25 Shukla DD, Ford RE, Tosic M, JUka J, Ward CW (1989) Possible members of the potyvirus group transmitted by mites or whiteflies share epitopes with aphid-transmitted definitive members of the group. Arch Virol 105:143-151 Shukla DD, McKem NM, Gough KH, Tracy SL, Letho SG (1988a) Differentiation of potyviruses and their strains by high performance liquid chromatographic profiling of coat proteins. J Gen Virol 69:493-502 Shukla DD, Strike PM, Tracy SL, Gough KH, Ward CW (1988b) The N and C termini of the coat proteins of potyviruses ate surface-located and the N terminus contains the major virus specific epitopes. J Gen Virol 69:1497-1508 Shukla DD, Thomas JE, McKem NM, Tracy SL, Ward CW (1988c) Coat protein of potyviruses. 4 Comparison of biological properties, serological relationships, and coat 48 protein amino acid sequences of four strains of potato virus Y. Arch Virol 102:207- 219 Shukla DD, Ward CW (1988) Amino acid sequence homology of coat proteins as a basis for identification and classification of the potyvirus group J Gen Virol 69:2703-2710 Shukla DD, Ward CW, Brunt AA (eds) (1994) The Potyviridae. CAB International, Wallingford, UK Smith GR, Van de Velde R (1994) Detection of sugarcane mosaic virus and Hji disease virus in diseased sugarcane using the polymerase chain reaction. Plant Dis 78:557-561 Staik DM, Beachy RN (1989) Protection against potyvirus infection in transgenic plants: evidence for broad spectrum resistance. Bio/Technology 7:1257-1262 Staskawicz BJ, Ausubel FM, Baker BJ, Ellis JG, Jones JDG (1995) Molecular genetics of plant disease resistance. Science 268:661-667 Stintzi A, Heitz T, Kauf&nann S, Legrand M, Fritig B (1991) Identification of a basic pathogenesis-related, thaumantin-like protein of virus-infected tobacco as osmotin. Physiol Mol Plant Pathol 38:135-146 Sulzinski MA, Zaitlin M (1982) Tobacco mosaic virus replication in resistant and susceptible plants: In some resistant species virus is confined to a small number of initially infected cells. Virology 121:12-19 Taliansky ME, Atabekova TI, Kaplan IB, Morozov SY, Malyshenko SI, Atabekov JG (1982a) A study of TMV ts-mutant Ni2519 1. Complementation experiments. Virology 118:301-308 Taliansky ME, Malyshenko SI, Pshennikova ES, Kaplan IB, Ulanova EF, Atabekov JG 1982b) Plant virus-specific transport function 1. Virus genetic control required for systemic spread. Virology 122: 318-326 Taliansky ME, Malyshenko SI, Pshennikova ES, Atabekov JG (1982c) Plant virus-specific transport function. E. A factor controlling host range. Virology 122: 327-332 49 Taliansky ME, Malyshenko SI, Kaplan IB, Kondakova OA, Atabekov JG (1992) Production of the tobacco mosaic virus (TMV) transport protein in transgenic plants is essential but not sufficient for cfxnplementing fcneign virus transport a need for full-length TMV genome or some other TMV-encoded product J Gen Virol 73:471-474 Takahashi T, Uyeda I, Shikata E (1990) Nucleotide sequence of the capsid protein gene of bean yellow mosaic virus chlorotic spot strain. J Fac Agric, Hokaido Univ, Saparo Japan 64; 152-163 Thompson JN, Burdon JJ (1992) Gene-for-gene coevolution between plants and parasites Nature 360:121-125 Thombury DW, Hellmann GM, Rhoads RE, Pirone TP (1985) Purification and characterization of potyvirus helper component Virology 144:260-267 Thombury DW, Patterson CA, Dessens JT, Rhoads RE, Pirone TP (1990) Comparative sequence of the helper component (HC) region of potato virus Y and a HC-defective strain, potato virus C. Virology 178:573-578 Towbin H, Staehelin T, Gordon J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. Procedure and some applications. Proc Natl Acad Sci USA 76:4350-4354 Tu JC, (1989) Effect of different strains of soybean mosaic virus on growth, maturity, yield, seed mottling and seed transmission in several soybean cultivars. J Phytopathol 126: 231-236 Tu JC, Ford RE, Quiniones SS (1970) Effects of soybean mosaic virus and /or bean pod mottle viras infection on soybean nodulation. Phytopathology 60:518-523 Uyeda I, Takahashi T, Shikata E (1991) Relatedness of the nucleotide sequence of the 3'- terminal region of clover yellow vein potyviras RNA to bean yellow mosaic RNA. Intervirology 32:234-245 50 van Dun CMP, van Volten-Doting L, Bol JF (1988) Expression of alfalfa mosaic virus cDNA 1 and 2 in transgenic tobacco plants. Virology 163:572-578 van Lent J, Wellink J, Goldbach R (1990) Evidence for the involvement of the 58K and 48K proteins in the intercellular movement of cowpea mosaic virus. JGen Virol71: 219- 223 van Lent J, Storms M, van der Meer F, Wellink J, Goldbach R (1991) Tubular structures involved in movement of cowpea mosaic virus are also formed in infected cowpea protoplasts. J Gen Virol 72: 2615-2623 van Regenmortel, MHV (1992) What is a virus? In: Bamett, OW (ed.), Potyvirus taxonomy. Springer-Verlag, Wien and New York (Arch of Virol [Suppl. ] 5), pp 47-53 Vance VB, Beachy RN (1984) Detection of genomic-length soybean mosaic virus RNA on polyribosomes of infected soybean leaves. Virology 138:26-36 Verchot J, Koonin EV, Clarrington JC (1991) The 35-kDa protein from the N-terminus of the potyviral polyprotein functions as a third virus-encoded proteinase. Virology 185: 527- 535 Verchot J, Carrington JC (1995a) Debilitation of plant potyvirus infectivity for PI proteinase- inactivating mutations and restoration by second-site modifications. J Viiol 69:1582- 1590 Verchot J, Clarrington JC (1995b) Evidence that the potyvirus PI proteinase functions in trans as an accessory factor fOT genome amplification. J Virol 69:3668-3674 Vos P, Verver J, Jaegle M, Wellink J, Van Kamenn A, Goldbach R (1988) Two viral proteins involved in the proteolytic processing of the cowpea mosaic virus polyproteins. Nucleic Acids Res 16:1967-1985. Waigmann E, Lucas WJ, Citovsky V, 2^ambryski P (1994) Direct functional assay for tobacco mosaic virus ceU-to-cell movement protein and identification of a domain involved in increasing plasmodesmata permeability. Proc Natl Acad Sci USA 91:1433-1437 51 Wanatabe Y, Kishibayashi N, Motoyoshi F, Okada Y (1987) Characterization of Tm-1 gene action on replicaticm of conunon isolates and a resistance breaking isolate of TMV. Virology 161:527-532 Ward CW, Shukla DD (1991) Taxonomy of potyviruses: cuinent problems and some solutions. Intervirology 32:269-296 Ward CW, McKem NM, Frenkel MJ, Shukla DD (1992) Sequence data as the major criterion for potyvirus classification. In: Bamett OW (ed.), Potyvirus Taxonomy. Springer- Verlag, Wien and New Yoric (Arch Virol [Suppl. ] 5), pp 283-297 Welch HM, Bridges CG, Lyon AM, Griffiths L, Edington N (1992) Latent equid herpesviruses 1 and 4: detection and distinction using the polymerase chain reaction and co-cultivation frcsn lymphoid tissues. J Gen Virol 73: 261-268 Wetzel T, Candresse T, Macquaire G, Ravelonandio M, Dunez J (1992) A highly sensitive immunocapture polymerase chain reaction method for plum pox potyvirus detection. J Virol Methods 39:27-37 Wetzel T, Candresse T, Ravelonadro M, Dunez J (1991) A polymerase chain reaction assay adapted fcH* plum pox potyvirus detection. J Virol Methods 33:355-365 White RF (1979) Acetylsalicyclic acid (aspirin) induces resistance to tobacco mosaic virus in tobacco. Virology 99:410-412 Wieczorek A, and Sanfacon H (1993) Characterization and subcellular localization of tomato ringspot nepovirus putative movement protein. Virology 194:734-742 Wilcox JR (ed.) (1987) Soybeans: Improvement, production and uses (2nd ed.). American Society of Agronomy, Madison, WI Wilson TMA, (1993) Strategies to protect crop plants against viruses: pathogen-derived resistance blossoms. Proc Nati Acad Sci USA 90: 3134-3141 Wrather JA, Chambers AY, Fox JA, Moore WF, Sciumbato GL (1995) Soybean disease loss estimates for the Southern United States, 1974 to 1994. Plant Dis 79:1076-1079 52 Wyatt SD, Kuhn CW (1979) Replication and properties of cowpea chlorotic mottle virus in resistant cowpeas. Phytopathology 69:125-129 Yeh S-D, Jan F-J, Chiang C-H, Doong T-J, Chen M-C, Chung P-H and Bau, H-J (1992) Ccnnplete nucleotide sequence and genetic organization of pe^aya ringspot virus RNA. J Gen Virol 73:2531-2541 Yu YG, Saghai Maroof MA, Buss GR, Maughan PJ, Tolin SA (1994) RFLP and microsatellite mapping of a gene fc^ soybean mosaic virus resistance. Phytopathology 84: 60-64 Zaitlin M, Hull R (1987) Plant virus-host interactions. Ann Rev Plant Physiol 38: 291-315 53 CHAPTER 1. USE OF UNIQUE RNA SEQUENCE-SPECIFIC OLIGONUCLEOTIDE PRIMERS FOR RT-PCR TO DETECT AND DIFFERENTIATE SOYBEAN MOSAIC VIRUS STRAINS A p^)er submitted for publication to Plant Disease M. E. Omunyin, J. H. Hill, and W. A. Miller Department of Plant Pathology, Iowa State University, Ames, Iowa 50011. Abstract A reverse transcription polymerase chain reaction (RT-PCR) assay was developed to detect and discriminate between RNAs of individual SMV strains G2 and G7. This assay utilized oligonucleotides con^lementary to unique regions in the cylindrical inclusion protein cistron. When G2- and G7-specific primers were used, amplification firom total RNAs fitom trifoliate soybean leaves infected with either strain or a mixture of strains yielded specific fragments. The specificity of primers was validated fiuther by amplification of only the expected 277-bp fragment characteristic of the G7 strain from infected soybean differential cultivars used to discriminate the strains. Thus, this assay allowed discrimination of strains in a mixed infection of a single soybean host plant This represents a metiiod capable of discriminating between two very closely related pathogens that were previously distinguishable only by laborious bioassays. Additional key words: potyvirus, detection. Introduction Soybean mosaic virus (SMV) belongs to the large and economically important family Potyviridae [1]. Several strains of SMV (G1 through G7, G7a, and C14) have been identified on the basis of their pathogenicity to differential soybean lines [3,24] and transmission by aphid species [17]. SMV strains have also been divided into three serological groups by using 54 one-dimensional trypsin peptide maps immunoblotted with 12 monoclonal antibodies [10]. Comparison of coat protein tryptic digests frcMii 14 potyvirus isolates from soybean confirmed them to be SMV strains [12]. The complete nucleotide sequences of strains G2 and G7 have been determined [13]. The genomes of G2 and G7 are 9588 nucleotides (nts) long, excluding the poly(A) tail, and encode a polyprotein of 3066 amino acids. Nucleotide sequence identity between G2 and G7 strains is 94%. Most variation is in the 5' end of the genome (35K [PI], helper component-protease [HC-Pro], 42K [P3], and cylindrical inclusion protein [CI]). Such variation, an important consideration when identifying strains, may be related to pathogenicity of different strains. SMV strains G2 and G7, although distinguished by pathogenicity on differential lines [21], have been difficult to differentiate serologically [9,10]. In nature, SMV is spread by aphids [17] and may result in infection of soybeans by mixed strains of the virus. Therefore, the limited sensitivity of serological assays could have practical implications for virus detection of G2 and G7 in doubly infected soybeans. Polymerase chain reaction (PCR), a highly sensitive method for the amplification of genomes, has become widely used as a diagnostic technique for infections by mycoplasma-like organisms (MLOs) [28], bacteria [21], viroids [22], and plant viruses belonging to several different groups (e.g., the geminivirus, luteovirus, and potyvirus groups [8,16,25,26]). The assay has been applied to enhance detection sensitivity of potyviruses such as plum pox virus [34], sugarcane mosaic virus [30], lettuce mosaic virus [36], zucchini yellow mosaic virus [31], and two sweet potato potyviruses [4]. Witii these viruses, the PCR procedure utilized primers designed to amplify a variable region of the potyvirus genome to distinguish between different viruses within the group rather than between strains of the same virus. Differentiation of strains of the same virus by using a reverse-transcription PCR (RT-PCR)-based assay has been reported for cucumber mosaic virus [23], citrus tristeza virus [7], and vertebrate viruses such as equine herpesvirus (EHV) [33]. These viruses were first detected by using primers derived from variable (cucumber 55 mosaic and cimis tristeza viruses) or conserved (EHV-1 and EHV-4 strains) regions of the viral gen(xne and then differentiated by further analysis of the amplified products by restriction- endonuclease analyses and restriction fragment length polymorphism [7,23,33] or hybridizadon with type specific oligonucleotide probes [29]. However, a different approach to PGR, known as nested PGR, allowed detection and differentiation of EHV-1 and EHV-4 without the need fa: further analytical techniques [2], More recently, nucleotide-specific PGR was shown to discriminate between two variants of influenza virus C [20]. Primers have been shown to discriminate between the PI and P4 isolates of pea seedbome mosaic virus [14,15]. However, they have not been used in reciprocal tests to detect and discriminate between the two isolates inoculated to the same plant. The objective of this study was to develop a simple and accurate RT-PGR-based method for detection of and discrimination between two SMV strains that does not require furtiier analysis of amplified products. Here, we describe a reverse transcription PGR (RT- PGR) assay using unique RNA sequences in the GI cistron of SMV to detect and differentiate strains G2 and 07. The method greatiy increases the speed and ease of detecting two very closely related plant vims strains. Materials and methods Plants and viruses SMV strains 02 (ATGG PV-723) and 07 (ATGG PV-722) have been previously described [18]. Soybean cultivars Williams 82 (susceptible to all SMV strains) and PI 96983 and L78-379 (susceptible to 07, immune to G2 [24,35]) were used for all experimental tests; the cultivar Williams 82 was used also as the maintenance host for the vimses. Primary leaves of 12-day-old soybean seedlings of these cultivars were mechanically inoculated separately with strain 02 or 07. Test plants were maintained in growth chambers operating at a constant temperature of 20 G with a 16-h day photoperiod and an irradiance of 50 w/m^. 56 Approximately 3 weeks after inoculation, infected trifoliate leaf tissue from plants inoculated with either strain was canbined (1:1 w/w) to obtain 300 mg of leaf sample for total RNA extraction and cDNA synthesis. Alternatively, total RNA was extracted from plants infected separately with either G2 or G7, cDNA synthesized by reverse transcription from the first PGR primer, and the resulting cDNAs combined (1:1 vA') before PGR amplification. In a separate experiment, 12-day-old seedlings of the cultivar Williams 82 were inoculated with both strains 02 and G7 by using one strain per leaf or half leaf. The first treatment consisted of inoculating plants with both strains at the same time. In the second treatment, plants were inoculated with the G2 strain 24 h after plants had been inoculated with G7. Gonfinnation of infection was done first by enzyme linked immunosorbent assay (ELISA) and then by RT-PGR amplification of cDNA synthesized from total RNA from plants of PI 96983 and L78-379 inoculated with the two strains. As controls for all experiments, uninoculated plants maintained in the same growth chamber as the inoculated plants were used for parallel assays. ELISA Non-specific-strain monoclonal antibody-based biotin-avidin ELISA (MAb ELISA) was performed as described previously [5,11} with some modifications. All steps involving incubation of reactants were performed at 26 G, followed by rinsing of wells three times for 3 min with PBS-Tween (0.02 M sodium phosphate, pH 7.2,0.15 M NaGl, containing 0.05% Tween-20). Wells in polystyrene flat-bottomed ELISA plates (Dynatech Laboratories, Ghantilly, VA) were coated fw 2 h with MAb S7 (100 fil/well, 5.0 |i.g/ml [10]) diluted in 0.05 M sodium carbonate, pH 9.6, containing 0.02% sodium azide (carbonate coating buffer). Usually, peripheral wells were filled with distilled water. After plates were rinsed, 300 ^il of BLOTTO (50 g nonfat dry milk per liter PBS-Tween) was added, and plates were incubated overnight Virus antigens were prepared by grinding, in PBS-Tween (I g/ml), trifoliolate leaves of cultivar Williams 82 plants inoculated with both strains G2 and G7, followed by 57 squeezing through a single layer of cheesecloth. The filtrate (100 ^U) was added to wells, which were incubated fn* 2 h and rinsed before addition of biotinylated MAb S2-G12 (100 ^1/well, 2.5 ^g/ml). After 2 h of incubation, ExtrAvidin-alkaline phosphatase (1:20,(XK); Sigma, St. Louis, MO) and then p-nitrophenylphosphate (1 mg/ml in 10% diethanolamine, pH 9.6, Sigma) were added to wells (100 |jl/well) containing test treatments, and absorbance measurements (405 nm) were made after 60 min. RT-PCR Four 20 nucleotide SMV strain-specific primers, designated G2-5'CI (cylindrical inclusion protein), G2-3'CI, G7-5'CI, and G7-3'CI were synthesized using an Applied Biosystems DNA Synthesizer 394 (Perkin Elmer, Norwalk, (2T) by the Iowa State University Nucleic Acids facility. The oligonucleotides were designed using the PRIMER DESIGNER program version 2.0 (Scientific & Educational Software, State Line, PA) based on sequence divergence between SMV strains G2 and G7 [13] at positions 4937-4956 in the CI region (Fig 1). The downstream primers G2-3'CI f5'-GCAGTCTTGTGTCAATCAM.3'^ and G7-3'CI f5'-GCAATCTGTGGATC1Ci'GGG-3'^ were complementary to nucleotides 4937-4956 of SMV strains G2 and 07 (ccHnmon nucleotides of G7 and G2 are underlined). The upstream primers G2-5'CI (5'-CCACACTTCATAGTCGCAAC-3') and G7-5'CI (5'- C11GGCAGAGTTGGTCXjTrG -3') were homologous to RNA nucleotides 4518-4537 of SMV G2 and 4680-4699 of SMV G7, respectively. An additional upstream primer G2-5'CI-0 (5'-C11 GGCAGAGTTGGTCX jTTG-3') homologous to RNA nucleotides 4680-4699 was also tested. Total RNA was extracted from trifoliate leaves by the method of Wadsworth et al. [32]. Single-stranded cDNA was synthesized from approximately 80 ng of total RNA by using a 3' RACE (rapid amplification of cDNA ends) system for first strand cDNA synthesis (GIBCO BRL, Gaithersburg, MD), according to manufacturer's instructions except that we utilized the downstream primers G2-3'CI and G7-3'CI (Fig. 1) instead of those primers supplied by the 58 manufacturer. Ten pmol of the specific primer was used in a final volume of 21 ^1. Other components of the reaction consisted of lOX synthesis buffer [200 mM Tri-HCl (8.4), 500 mM KCl, 25 mM MgC12,1 mg/ BSA], 10 tnM each dNTP and 100 mM DTT. Reverse transcription was catalysed by Moloney murine leukaemia virus RNase H~ reverse transcriptase (Superscript RNase H" RT, 200 unitis (U)/nl, GIBCO). The enzyme has been engineered to eliminate the RNase H activity found in other reverse transcriptases that degrade RNA during the first strand reaction. After incubation in a 42 C water bath for 30 min, RNase H (2 U/|il) was added to the reaction and incubated for 10 min. Optimization of PGR buffer conditions for amplification of SMV strains employed a PGR Optimizer kit (Invitrogen, San Diego, GA). Briefly, reactions were performed in volumes of 50 ^1 that contained buffers (300 mM Tris-HGl, 75 mM (NH4)2S04) ranging from pH 8.5 to 9.5 and with Mga2 concentrations from 1.5 to 3.5 mM; 2.5 mM of each dNTP; 30-40 pmol each of downstream and upstream primers; 1-2 nl cDNA (100-3(X) ng) and 1 unit of AmpliTaq DNA polymerase (Peridn Ehner Getus, Norwalk, GT). The thermocycler (Ericomp TwinBlock System, San Diego, GA) was programmed for template denaturation at 94 G for 1 min (2 min first cycle), primer annealing at 55 G for 2 min, and DNA synthesis at 72 G for 3 min. A final 7 min extension step at 72 G was performed at the end of 25 cycles. In subsequent amplifications of the first strand cDNA, samples were held at 80 G, prior to amplification according to the Invitrogen's Optimizer kit instructions. Other analyses Nucleic acids were separated on 6.5 cm by 9.0 cm, 2% (w/v) agarose gels in THE buffer (0.09 M-Tris-borate, 0.09 M-boric acid, 0.02 M-EDTA, pH 8.0) at 80 V for 30-40 min. Gels were stained with ethidium bromide and photographed with a UVP CDS 5(XX) Imaging System (San Gabriel, GA). Hae m restriction digests were performed as recommended by the manufacturer (Promega, Madison, WI) and purified by using standard methods [27]. Direct sequencing of 59 PGR products was performed with the Applied Biosystems DNA Synthesizer 373 (Perkin Elmer Cetus, Norwalk, CT) by the Iowa State University Nucleic Acid facility using either downstream or upstream primers. The DNA was prepared for sequencing using centricom 30 (Amicon, Beverly, MA) and or gel purification in low-melting Nusieve GTG agarose (FMC BioProducts, Rockland, ME). Results Primers G2-3'CI, G2-5'CI, G2-5'CI-0, G7-3'CI, and G7-5'CI for PGR amplification of SMV G2 and G7 cDNA were designed to anneal to the region of die SMV genome that showed the highest level of local divergence between the strains (Fig. 1 [13]). The RT-PCR amplification of SMV-specific RNA from total nucleic acid extracts yielded prcxlucts that migrated at about 380 bp and 280 bp for strains G2 and G7, respectively (Fig. 2). The G2 product migrated faster than the expected size of 439 bp, whereas the G7 product migrated exactiy as expected (277 bp) from the position of the known SMV sequence (Fig. 1). The G2 product indicated anomaly, probably due to secondary structure, but it still allowed specific detection. To find conditi(Mis for optimal sensitivity and specificity, the conditions were optimized Successful amplification worked over a range of magnesium concentrations and pH levels. Optimal buffer conditions consisted of 3.5 mM MgCl2 and pH 8.5 for Uie G2 strain and 2.0 mM MgGl2 and pH 9.0 to 10.0 for the G7 strain (Fig. 2). Buffer containing 2.0 or 3.5 mM Mga2 and pH 9.0 or 9.5, gave the highest yields of amplified products and therefore was used for subsequent amplifications. Primer annealing at 55^ for two min and amplification for 25 cycles worked well for both strains. The G2-3'CI and G2-5'CI-0 pair inconsistentiy amplified a 277-bp fragment for G2 and also amplified the characteristic G7 fragment under all conditions (data not shown). Thus, we did not pursue use of G2-5'GI-0 further. 60 We next tested whether the assay could specifically detect G2 and 07 in a mixture of the two. Total RNA was extracted fitom a mixture of trifoliate leaves from a soybean plant infected with the 02 strain and leaves fiom a 07-infected plant RT- PGR amplification with the primer pairs G2-3'CI and G2-5'CI or 07-3'CI and 07-5'CI of this mixture yielded products of 380 bp and 277 bp, respectively (Fig. 3). 02 RNA gave stronger signals when amplified alone than in the presence of 07 RNA. In the latter case, the G2-specific primers gave unusual primer-dimers. No fragments were amplified fiom RNA extracted fiom uninoculated soybean plants. Strains were further differentiated by amplification of the expected products on mixed samples of cDNAs prepared from total RNAs of separately inoculated plants and showed distinguishable signals for both 02 and 07 (Fig. 3). The occasional formation of some nonspecific bands with the 07~3'CI and G7-5'CI primer pair is not due to loss of discrimination ability because the 380-bp fragment primed by the 02-3'CI and G2-S'CI pair is absent The nonspecific bands could be eliminated by taking care to insure thorough mixing of the extracted tissue with phenol-chloroform during isolation of the RNA or by hot start PGR (either dNTPS or Taq DNA polymerase was omitted during assembly on ice and added afier the reaction mixture was heated to 80 G) (compare Fig. 3, lanes 6 and 7). We used ELIS A to ensure that plants inoculated with both strains 02 and 07 were infected, but this assay does not distinguish between strains (Fig. 4). The specificity of PGR was validated by detecting RNA of each strain from the individual plants infected with both strains. Positive signals in PGR correlated with ELISA readings. The primer pair 07-3'GI and 07-5'CI amplified CMily the 277-bp fragment of strain 07; no such band occurred with the 02-3'GI and 02-5'GI pair that primed amplification of the 380-bp fragment of 02 (Fig. 5). As observed with the mixed RNAs from separately infected plants, the 02-3'GI and 02-5'GI pair amplified the target less well when used to anqilify 02 RNA fiom mixed infection by strains 02 and 07 than from plants inoculated with 02 alone (Fig. 5). 61 To provide further confirmation of primer specificity, PGR amplifications were performed on total RNA extracted from the differential soybean lines PI 96983 or L78-379, each separately inoculated with strain G7 or G2. These soybean lines are immune to 02 but not 07 and thus, were used to cmelate the differential host reactions with presence of specific viral RNA. The expected fragments (277 bp) were obtained with RNAs extracted from 07 infected plants by using the primer pair 07-3'CI and 07-5'CI, whereas no fragments resulted from 02 infected PI 96983 or L78-379 (Fig.6 A). The primer pair 02-3'CI and 02-5'CI yielded negative results (data not shown). Digestion of the amplified SMV 07 CI product with in (Fig. 1) produced the expected restriction fragments of 155 and 122 bp (Fig. 6 B), and the nucleotide sequence of this DNA product was as predicted (data not shown). Discussion Results of this study demonstrated the differentiation of SMV strains 02 and 07 by RT-PCR based on unique RNA-specific oligonucleotide fragments. This differs from previous approaches employed with other viruses that required further analyses of amplified products [7,23,29,33] or use of nucleic acid hybridizations based on radiolabelled PCR-amplified 3' noncoding sequences as probes [6]. Although the objective of this study was not to differentiate all SMV strains, the assay would also differentiate other strains such as 01 (ATCC PV-716), 03 (ATCC PV-718), 04 (ATCC PV-719), 05 (ATCC PV-720), and 07a (ATCC PV-724) from 02 (data not shown). Strain 01 could be differentiated from strains 03,04,05, and 07a by further digestion of the 07-3'CI-07-5'CI amplified product with HaeSL. Restriction fragments of 155 and 122 bp were produced for all these strains except 01 (data not shown). For this study, primers were selected from the CI region because it showed one of the highest levels of variation when sequences of the 02 and 07 genomes were compared [13]. Within this CI region, design of primers complementary to strains 02 and 07 allowed 62 mismatch of twelve bases, and the homologous (upstream) primers mapped to different positions to ensure a size difference of 162 bases between amplification products. Initially, we had designed upstream primers that mapped to the same position for both G2 and G7. This approach presented some difficulties in finding primers and conditions absolutely specific for 02 and 07. Consequentiy, we employed the alternative and more accurate approach that involved using primers that gave different sizes of products. Under optimized conditions, amplification of total RNA extracted from soybean plants separately infected with strain 02 and 07 yielded 380-bp and 277-bp fragments, respectively, indicating that RT-PCR can be used to detect and differentiate between SMV strains. Amplification on total RNA isolated fix^m plants doubly infected with both strains 02 and 07 confirmed and validated the specificity of the oligonucleotide-primer pairs. The procedure allows the use of primers that ensure differences in size of amplified products and provides unqualified discrimination between strains. Signals were readily reproducible. The apparent reduced amplification of 02 in the presence of 07 suggests that 02 may replicate more slowly, relative to 07, in Williams 82 infected with both strains. This observation would not have been possible by using primers that give the same size products fiom 02 and 07. Such information may be valuable for future studies of mixed infection. Further validation of the reliability and specificity of the RT-PCR assay was established by using soybean differential lines that contain the Rsv resistance gene [35] and used to group SMV strains [3]. Although the 07 strain is able to induce disease in plants containing the Rsv gene, the plants remain immune to 02. The combined infectivity and RT-PCR assays demonstrated that only strain 07 and not the 02 strain could be identified in virus-inoculated plants containing the Rsv gene. Virus strain differentiation becomes important for viruses such as SMV, which exists as a complex of several very closely related strains that can occur as a mixture in infected soybean host plants. Highly sensitive and rapid techniques for detection and differentiation of 63 SMV strains are insportant for identification of resistance genes in breeding lines, establishment of naturally occurring variation within strain groups, noonitoring spatial and temporal spread of strains, and molecular studies to discem the potential for complementation among SMV strains in mixed infection (19). This RT-PCR assay has shown that unique RNA sequence-specific primers can be employed to detect and discriminate between RNAs of very similar strains. Acknowledgements The auth United Nations/Kenya Agricultural Research Institute project No. KEN/86-029. References 1. Bamett, OW (1991) Potato virus Y group. In: Classification and Nomenclature of Viruses. RIB Francki, CM Fauquet, DL Knudson, F Brown (eds) Arch Virol Suppl 2: 351-356 2. Borchers K, Slater J (1993) A nested PCR for the detection and differentiation of EHV-1 and EHV-4. J Viiol Metiiods 45: 331-336 3. Cho E, and Goodman, RM (1979) Strains of soybean mosaic virus: classification based on virulence in resistant soybean cultivars. Phytopatiiology 69:467-470 4. Colinet D, Kummert J, Lepoivre P, and Semal J (1994) Identification of distinct potyviruses in mixedly-infected sweet potato by polymerase chain reaction with degenerate primers. Phytopathology 84:65-69 5. Diaco R, Hill JH, Hill EK, Tachibana H, Durand DP (1985) Monoclonal antibody-based biotin-avidin ELISA for detection of soybean mosaic virus in soybean seeds. J Gen Virol 66: 2089-2094 64 6. Frenkel MJ, Jilka JM, Shukla DD, Ward CW (1992) Differentiation of potyviruses and their strains by hybridization with the 3' non-coding region of the viral genome. J Virol Methods 36:51-62 7. Gillings M, Broadbent P, Indsto J, Lee R (1993) Characterisation of isolates and strains of citrus tristeza closterovirus using restriction analysis of the coat protein gene amplified by the polymerase chain reaction. J Virol Methods 44:305-317 8. Henson JM, French R (1993) The polymerase chain reaction and plant disease diagnosis. Anna Rev Phytopathol 31:81-109 9. Hill JH, Benner HI, Van Deusen RA (1994) Rapid differentiation of soybean mosaic virus isolates by antigenic signature analysis. J Phytopathol 142:152-162 10. Hill JH, Benner HI, Permar TA, Bailey TB, Andrews RE, Jr, Durand DP, Van Deusen RA (1989) Differentiation of soybean mosaic virus isolates by one-dimensional trypsin peptide maps immunoblotted witii monoclonal antibodies. Phytopathology 79:1261- 1265 11. Hill JH, Bryant OR, Durand DP (1981) Detection of plant viruses by using IgG in ELISA. J Virol Metiiods 3: 27-35 12. Jain RK, McKem NM, Tolin SA, Hill JH, Bamett OW, Tosic M, Ford RE, Beachy RN, Yu MH, Ward CW, Shukla DD (1992) Confirmation that fourteen potyvirus isolates from soybean are strains of one virus by comparing coat protein peptide profiles. Phytopathology 82:294-299 13. Jayaram Ch., Hill JH, Miller WA (1992) Complete nucleotide sequences of two soybean mosaic virus strains differentiated by response of soybean containing the Jtsv resistance gene. J Gen Virol 73:2067-2077 14. Kohnen PD, Dougherty WG, Hampton RO (1992) Detection of pea seedbome mosaic potyvirus by sequence specific enzymatic amplification. J Virol Methods 37:253-258 65 15. Kohnen PD, Johansen IE, Haiiq)ton RO (1995) Characterization and molecular detection of the P4 pathotype of pea seedbome potyvirus. Phytopathology 85:789-793 16. Langeveld SA, Dotc JM, Memelink J, Deiks AFLM, Van der Vlugt CIM, Asjes CJ, Bol JF (1991) Identification of potyviruses using polymerase chain reaction with degenerate primers. J Gen Virol 72:1531- 1541 17. Lucas BS, Hill JH (1980) Giaracteristics of the transmission of three soybean mosaic virus isolates by Myzus persicae and Rhopalosiphwn maidis. Phytopathol Z 99:47-53 18. Mansky LM, Durand DP, Hill JH (1991) Effects of temperature on the maintenance of resistance to soybean mosaic virus in soybean. Phytopathology 81: 535-538 19. Mansky LM, Durand DP, Hill JH (1995) Evidence for complementation of plant potyvirus pathogenic strains in mixed infection. J Phytopathol 143:247-250 20. Marshall M, Schuler A, Boswald C, Helten A, Hechtfischer A, Lapatschek M, Meierewert H (1995) Nucleotide-specific PGR for molecular virus typing. J Virol Methods 52: 169-174 21. Minsavage GV, Thompson CM, Hopkins DL, Leite RMVBC, Stall RE (1994) Development of a polymerase chain reaction protocol for detection of Xylella fastidiosa in plant tissue. Phytopathology 84:456-461 22. Rezaian MA, Krake LR, Golino DA (1992) Common identity of grapevine viroids from USA and Australia revealed by PCR analysis. Intervirology 34: 38-43 23. Rizos H, Gunn LV, Pares RD, Gillings MR (1992) Differentiation of cucumber mosaic virus isolates using polymerase chain reaction. J Gen Virol 73; 2099-2103 24. Roane CW, Tolin SA, Buss GR (1986) Application of the gene-for-gene hypothesis to soybean-soybean oaosaic virus interactions. Soybean Genet Newsl 13:136-139 25. Robertson NL, French R, Gray SM (1991) Use of group-specific primers and the polymerase chain reaction for the detection and identification of luteoviruses. J Gen Viiol72; 1473-1477 66 26. Rojas MR, Gilbertson RL, Russell DR, Maxwell DP (1993) Use of degenerate primers in the polymerase chain reaction to detect whitefly transmitted-geminiviruses. Plant Dis 77: 340-347 27. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual (2nd ed.). Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y 28. Schaff D, Lee I-M, Davis RE (1992) Sensitive detection and identification of mycoplasma- like OTganisms in plants by polymerase chain reactions. Biochem Biophys Res dlommun 186:1503-1509 29. Sharma PG, CuUinane AA, Onions DE, Nicolson L (1992) Diagnosis of equine herpesvirus -1 and -4 by polymerase chain reaction. Equine Vet J 24: 20-25 30. Smith OR, Van de Velde R (1994) Detection of sugarcane mosaic virus and fiji disease virus in diseased sugarcane using the polymerase chain reaction. Plant Dis 78: 557-561 31. Thompson KG, Dietzgen RG, Gibbs AJ, Tang YC, Liesack W, Teakle DS, and Stackebrandt E (1995) Identification of zucchini yellow mosaic potyvirus by RT-PCR and analysis of sequence variability. J Virol Methods 55: 83-96 32. Wadsworth GJ, Redinbaugh MG, Scandalios JG (1988) A procedure for the small-scale isolation of plant RNA suitable for RNA lot analysis. Anal Biochem 172:279-283 33. Welch HM, Bridges CG, Lyon AM, Griffiths L, Edington N (1992) Latent equid heipesviruses 1 and 4: detection and distinction using the polymerase chain reaction and co-cultivation firom lymphoid tissues. J Gen Virol 73: 261-268 34. Wetzel T, Candresse T, Ravelonandro M, Dunez J (1991) A polymerase chain reaction assay adapted for plum pox potyvirus detection. J Virol Methods 33: 355-365 35. Yu YG, Saghai Maroof MA, Buss GR, Maughan PJ, Tolin SA (1994) RFLP and microsatellite mapping of a gene for soybean mosaic virus resistance. Phytopathology 84: 60-64 67 36. Zerbini FM, Koike ST, Gilbertson RL (1995) Biological and molecular characterization of lettuce mosaic potyvirus isolates from the Salinas Valley of California. Phytopathology 85:746-752 Fig. 1 A, Location of nucleotide sequence divergence between soybean mosaic virus (SMV) strains G2 and 07 fiom positions 4937 to 4956 within the cylindrical inclusion (CI) coding region. Bases of the G7 sequence are shown below the G2 sequence where they differ from the 02. The proposed organization of SMV coding regions is shown. Ablxeviations: PI, first protein (35K); HC-Pro, helper conq>onent-protease; P3, third protein (42K); Q, cylindrical inclusion protein; 6K putative peptide; NIa, nuclear inclusion 'a' protein (21K & 27K peptides, VPg and protease, respectively); Nib (POL), putative RNA polymerase; and CP, coat protein. B, RNA sequence positions of primers used for RT-PCR amplificaticHi of SMV 02 and 07 RNAs are shown together with expected ccHTesponding amplification products. The location of the Hae m site is shown where it cuts 07 DNA. 69 A h- CGTGATTGACACAAGACTGC -\ [- - CCAGAGAT- CAC - - - T 1 4937 4956 vPgH P1 HC PRO P3 CI 6K NIa Nlb(POL) CP B G2 4518 -• 439 bp ^ 4956 Wae III (4801) G7 4680 277 bp ^ 4956 Fig. 2. The effect of buffer pH and Mg++ concentrations on PGR amplification of cDNA derived from soybean mosaic virus RNA. A, 02 strain-specific cDNA amplified with 02 primers. Lane 1, DNA markers, 100-2072 bp (100 ng total DNA [OIBCO BRL, Oaithersburg, MD]); lanes 2,3,4, S, buffer Mg'*'*' concentrations of 1.5,2.0,2.5, and 3.5 mM, respectively (pH 8.5); lanes 6,7, 8, pH 9.0,9.5,10.0, respectively (Mg++ 2.0 mM); lane 9, PGR control, (Mg*^ 2.5 mM, pH 9.0, manufacturer's control template T600, [Invitrogen, San Diego, CA]); lane 10 PGR control, (Mg ++ 3.5 mM, pH 9.0, manufacturer's contrd ten^late T2000). Note that the expected strain 02-439 bp product migrated at at distance equivalent to 380 bp. B, 07 strain specific cDNA amplified with 07 primers. All lanes contain the same treatments as in A, except lanes 9 and 10 are omitted. B 1234567 8 9 10 1 2 3 4 5 67 8 pH 8.5 9.0 9.5 10 9.0 8.5 9.0 9.5 10 Mg(mM) 1.5 2.0 2.5 3.5 2.0 2.0 2.0 2.5 3.5 1.5 2.0 2.5 3.5 2.0 2.0 2.0 bI 1i 380 Fig. 3. Ethidium bromide-stained agarose gel of sauries anq>lified from cultivar Williams 82 plants separately infected with soybean mosaic virus strains G2 or G7. Lane 1, DNA markers, 100-2072 bp (100 ng total DNA[GIBCO BRL, Gaithersburg, MD]); Lanes 2,3, sanq>les amplified frcm a mixture of RNA from G2 and G7 infected plants. Lane 2: primers G2-3'CI and G2-5'CI, lane 3: primers G7-3'CI and G7-5'a; Lanes 4 and 5, G2 primer pair. Lane 4 no RNA. Lane 5: RNA amplified from G2 infected plants. Lanes 6 and 7, G7 samples amplified from G7-infected plants by using the G7 primer pair. Lane 7: hot start PGR. Lanes 8 and 9, uninoculated controls amplified by using G2 and G7 primer pairs, respectively. Samples in lanes 10 and 11 resulted from amplification of a mixture of cDNAs that were mixed after synthesis from RNAs of strains G2 and G7 by using the G2 and G7 primer pairs, respectively. The band in lane 11 was faint and did not reproduce clearly in the image. 2345678910 11 -380 -277 Fig. 4. Monoclonal antibody-based biotin-avidin ELJSA of soybean cultivar Williams 82 infected with strains G2 and G7 of soybean mosaic virus. Opposite leaves were inoculated with strains G7 and G2 (7x2[0]) simultaneously; G2 24 hr after G7 (7X2[1]); G7 or G2. MAbs S7 and S2-G12 were used as capture and biotinylated antibodies, respectively. Readings given were the average of data from three separate plants or determinations. 75 • Diseased M Healthy • Buffer 7x2(0) 7x2(1) G7 Soybean samples Fig. 5. RT-PCR of soybean mosaic virus (SMV) RNA firom plants inoculated with SMV strains G2 and G7. Analysis of PGR products an^lified with RNA sequence-specific primer pairs, from soybean culdvar Williams 82. All samples were from trifoliate leaves after inoculation of primary leaves. Lanes 2 and 3 - c^posite leaves inoculated with SMV strains G2 and G7 simultaneously, lanes 4 and 5 opposite leaves inoculated with G2,24 hr after G7, lanes 6 and 7 - uninoculated controls, and lanes 8 and 9 - leaves inoculated with G2 or G7, re^)ectively. Primers used fw PGR anqplification were G2-3'GI and G2-S'CI (lanes 2,4,6 and 8), and G7-3'GI & G7-5'CI Oanes 3,5,7 and 9). Lane 1 - DNA markers, 100-2072 bp (100 ng total DNA [GIBCO BRL, Gaithersburg, MD). 123456789 -380 Fig. 6. Electrophoretic analysis of RT-PCR amplified products of soybean mosaic virus RNAs and Hae m restriction enzyme digests. A, Products of amplification, by using the primer pair G7-3'CI and G7-S'CI, oi RNA extracts from differential soybean lines inoculated with strains G2 and G7. Lane 1, DNA marker, 100-2072 (100-bp ladder [GIBCO BRL, Gaithersburg, MD]); lanes 2 and 3, products fiom L78-379 inoculated with G7 and G2, respectively; lanes 4 and 5, products from PI 96983 inoculated with G7 and G2, respectively. B, Hae m restriction enzyme digests of G7 amplification products. Lane 1, DNA maricer 100-2072 bp (100-bp ladder[BRL]); lanes 2 and 3, Hae m digests; lanes 4 and 5, undigested controls. Cultivar L78-379 PI 96983 Strain G7 G2 G7 G2 1 2 3 4 5 Strain G7 Enzyme ^a^III Control 1 2 3 4 5 B ' SjI 277 — 155 V. 122 80 CHAPTER II. MOLECULAR ANALYSIS OF SOYBEAN MOSAIC VIRUS (SMV) STRAINS TO CLARIFY THE NATURE OF STRAIN COMPLEMENTATION IN SOYBEANS A paper prepared for submission to Archives of Virology M. E. Omunyin, J. H. Hill, and W. A. Miller Department of Plant Pathology, Iowa State University, Ames, Iowa 50011 Abstract An RT-PCR assay allowing detection of soybean mosaic virus (SMV) strains in mixed infection, was used to test the potential for complementation of SMV strains. The model system was used to detect SMV strain G2 in plants systemically preinfected with the related SMV strain G7 or G7a. The soybean lines PI 96983, L78-379, and Davis (immune to G2, susceptible to G7 and G7a) were used. Presence of virus in host plants was assayed 20 to 25 days after inoculation. In the soybean lines PI 96983, L78-379, and Davis strain G2 was not complemented by either G7 (x G7a. Introduction Soybean mosaic virus (SMV), a member of the virus family Potyviridae (Bamett, 1991), is characterized by flexuous rod morphology and a coat protein consisting of a single repeating subunit (Dougherty and Carrington, 1988). The virus is similar to members of the genus Potyvirus whose members have a genome consisting of a single positive-sense RNA molecule of approximately lOOCX) nucleotides (nts) with a covalendy attached protein (VPg) at the 5' terminus (Dougherty and Carrington, 1988) and a poly(A) tail at the 3' temiinus (Eggenberger et al., 1989). SMV genomic RNA encodes a large precursor polyprotein (Ghabrial et al., 1990). The complete nucleotide sequences of SMV strains G7 and G2 have 81 been determined (Jayaram et aL, 1992); their genome is 9588 nts and encodes a polyprotein of 3066 amino acids with a predicted Mr of either 349 542 (strain G2) or 349 741 (strain G7). The polyprotein encoded by the SMV genome predicts nine mature proteins that share 94 to 100% amino acid identity in the strains G2 and 07 (Jayaram et al., 1992). SMV consists of several strains (01 through 07,07a C14 and SMV-0) that have been identified on the basis of transmission by aphids species (Lucas and Hill, 1980), pathogenicity to differential soybean lines (Cho et al., 1979), and serological reactions (Hill et al., 1989; 1994). The cultivars chosen by Cho and Ooodman (1979,1982) to differentiate the SMV strains included Suweon 97, Buffalo, Kwanggyo, Ogden, Marshall, and Davis. These lines possess genes for resistance to some SMV strains. It has been reported that resistance to mosaic-inducing strains is conditioned by single dominant genes (Bowers et al., 1992) while the non-necrotic reaction to a necrosis-inducing strain is controlled by a single recessive gene (Kwon and Oh, 1980). Additionally, Buzzell and Tu (1989) showed that stem-tip necrosis on soybean was a hypersensitive and temperature-dependent reaction, and was conferred by a single dominant gene. At least three genes, Rsvl, Rsv2 and Rsv3, confer resistance to SMV (Buzzell and Tu, 1984). The lines PI 96983 and L78-379 contain the single allele /?^vl, that confers resistance to all virulence groups except 07 and G7a (Chen et al., 1988). The cultivars Davis, York, Donnan, and Ware are susceptible to strains 04 - 07 (Roane et al., 1986b; Chen et al., 1988). They possess a single dominant resistance gene that is allelic to ^jvl from PI 96983 (Roane et al., 1986a), Ogden was shown to carry a gene designated Rsvl-t (Chen et al., 1991) while the line OX670 contained the gene Rsv2. The dominant gene Rsv3 derived from the Columbia cultivar was found to be responsible for stem-tip necrosis (Buzzell and Tu, 1989). The observation that the resistance conferred by each gene can be overcome by different SMV strains (Lim 1985) provides an opportunity to use these strains to study virus interactions in mixed infections, which may assist in understanding of mechanisms of resistance. 82 Complementation is one of the interactions that may occur in mixed infection. It has been deHned as the process by which one genome provides functions that another genome lacks (Hull et al., 1989). Complementadon has been demonstrated by interactions between virus defective in different functions or by the interaction of a chimeric gene with helper virus in transgenic plant(s). Examples include a temperature sensitive mutant Lsl of tobacco mosaic virus (TMV) complemented by both a related temperature resistant TMV strain and an unrelated potato virus X (PVX) (Taliansky et al., 1982a; b; Deom et al., 1987). Complementation of defective challenge virus in transgenic plants has also been observed in other systems, including alfalfa mosaic virus (van Dun et al., 1988), tomato golden mosaic geminivirus (Hanley-Bowdoin et al., 1990), tobacco vein mottling potyvirus (TVMV) (Klein and Shaw, 1993), and TMV (Holt and Beachy, 1991). Biological assay as well as a panel of monoclonal antibodies that distinguish epitopic differences among the coat proteins of SMV strains were used to suggest that complementation occurs between some SMV strains (Mansky et al., 1995). Soybean lines Davis, PI 96983, and L78-379 resistant to SMV strain G2 were co-inoculated with either SMV 07 or 07a and 02. Using the local lesion assay, systemic spread of both strains 02 and 07 was shown to occur in the line Davis, but not in PI 96983 and L78-379. In contrast, inoculation of the resistant lines witii 02 and 07a led to apparent systemic spread of botii viruses in all the soybean lines. The systemic spread of both the avirulent and the virulent strains was determined by re- isolation of virus using local lesion assay and subsequent inoculation of differential soybean lines resistant to the avirulent strain 02. However, the test virus strains did not produce local lesions that were distinguishable in the Phaseolus vulgaris cultivar Top Crop that was used. Furthermore, a differential line that could be infected by 02 only and resistant to strain 07 or 07a was not utilised. As an alternative approach, Mansky et al. (1995) used signature analysis to demonstrate movement of SMV 02 in soybean lines co-inoculated with 02 and 07. The strain 02 or 07 83 from trifoliates of Williams 82 inoculated with either strain could be distinguished using specific monoclonal antibodies S-9 and S-10. Additionally, binding curves of extracts fixam trifoliate leaves of lines PI 96983 and Davis co-inoculated with G2 and 07 were distinct firom those of either SMV G2 or G7 as were curves of extracts fiom leaves of Williams 82. The conclusions about movement of 02 and G7 were based on non-alignment of antigen-antibody binding curves of extracts fixMn leaf samples of soybean plants inoculated with 02 and 07, as compared to binding curves from 02 or 07-infected leaf tissue. The comparisons required use of a panel of several antibodies. A sanqjle from infected plants of a line inoculated with both 02 and G7 displayed a single curve that showed presence of infection but does little to defmitively distinguish two different antigens in a single host. Additionally, the presence of strain 02 was reported in trifoliate leaves of PI 96983 (inoculated with both 02 and 07) for which 02 movement was not demcmstrated by the local lesion assay. The recent development of the reverse transcriptim (RT)-PCR assay pennits the direct detection of SMV genomic RNA (Chapter 1.). Therefwe, the objective of this study was to use RT-PCR to more directiy clarify the potential for strain complementation among SMV strains in soybeans carrying the Rsvl gene. Materials and Methods Plants and viruses SMV strains 02 (isolate Ia-75-16-1, ATCC PV-723), 07 (ATCC PV-722) and 07a (ATCC PV-724) have been described previously (Mansky et al., 1991). Soybean lines Williams 82, PI 96983, L78-379 and Davis, and the local lesion host P. vulgaris cultivar Top Crop have also been described (Roane et al., 1986; Yu et al., 1984, Milbrath and Soong, 1976). Table 1 summarizes the phenotypic responses of the soybean cultivars to the SMV strains. Test plants were grown and maintained in growth chambers operating at constant 84 temperatures of 20 C with a 16 h-day photoperiod and an irradiance of 50 w/mm^. All strains were maintained in Williams 82. Locd lesion time course assay To evaluate inoculated soybean lines fOT appropriate dme to detect SMV, twelve-day old seedlings of lines PI 96983 and L78-379 were mechanically inoculated with strain G7. Inoculum was prepared by grinding 1 g of virus-infected Mlliam 82 leaf tissue in 0.05 M sodium phosphate buffer (1:10 wtA^ol, pH 7.2). Trifoliate leaves and stems of inoculated plants were sampled separately, 10,15,20,25 and 30 days after inoculation. Inoculum prepared from the sampled tissues was mechanically applied onto primary leaves of plants of Phaseolus vulgaris cv Top Crop previously treated in the dark for 12 h. These leaves were detached and each placed in a petri dish and incubated at 30 C as described (Milbrath and Soong, 1976). At least four leaves were inoculated and one leaf was mock inoculated or left uninoculated as a control. Table 1. Phenotypic responses of soybean cultivars against soybean mosaic virus strains. Phenotypic responses of virus-inoculated plants to Soybean Resistance soybwn mosaic virus strains^ lines locus G2 G7 G7a Williams82 - S S PI 96983 Rsvl oc S L78-379 Rsvl 0 N N Davis Rsv?® 0 S S ® Sources: Chen et al., (1988); Cho and Goodman (1979); Roane et al., (1986b); ^ Systemic mottling; c No reaction; ^ Systemic necrosis; ® Unknown. 85 Reverse transcription (RT)-PCR Based upon previous results, total RNA was extracted from trifoliate leaves and stems of infected lines PI 96983, L78-379 and Davis by the method of Wadsworth et al. (1988), 20 and 25 days after inoculation. The first strand synthesis and PGR amplification were done as described previously (Chapter 1). First, a primer specific for each virus (G2-3'CI [5'GCAGTCTTGTGTCAATCACG-3'] for G2 and G7-3'a [5- GCAATCTGTGGATCTCTGGG-3'] for G7) was used for first strand synthesis, and utilized total RNA as the template. Next, the DNA was an^lified by using both the downstream and the upstream primers specific for each virus (G2-5'CI [5'-CCACACTTCATAGTCGCAAC- 3'] and G7-5'CI [5'-CTTGGCAGAGrrGGTCG1TG-3'] for G2 and G7, respectively). All the SMV specific primers were synthesized by the Iowa State University Nucleic Acids facility or Keystone Laboratories, Inc. (for the G2 specific primer pair). As a positive control, total RNA was extracted fi:om uninoculated plants maintained in the same growth chambers as inoculated plants of cuMvar Williams 82. To evaluate potential ccnoplementation of G2 by G7, the primary leaf of a seedling of each of the lines PI 96983, L78-379 and Davis [immune to G2, but systemically infected with G7 (Roane et al., 1986a, b; Mansky et al., 1995) (Table 1)] was inoculated with G7 and the opposite leaf with G2,0 (same day), 2,4 or 6 days after inoculation with G7. Inoculating the same leaf with both isolates was tried, but was discontinued due to the risk of losing the leaf. Plants were maintained in the growth chamber together with an uninoculated plant used as a control. Using this approach, the potential for complementation of G2 by G7a in L78-379 was also tested. Detection of SMV strains isolated from single local lesions by RT-PCR Inoculum prepared finom trifoliate leaves of the soybean line Davis, 25 days after co- inoculation with strains G7 and G2, was mechanically applied onto primary leaves of plants of Phaseolus vulgaris cultivar Top dlrop previously treated in the dark for 12 h (Milbrath and 86 Soong, 1976). Individual local lesions were used to prepare sap to inoculate primary leaves of the soybean line Williams 82. After 4-5 wks, the 3rd and the 4th trifoliate leaves of William 82 plants were pooled and used for virus detection by ELISA (Chapter 1) and RT-PCR. Results Time course assay of SMV strain G7 To determine the appropriate time for detection of SMV strain G7, presence of virus was determined by using a local lesion assay. We detected virus most often from 20 -25 days in both lines L73-379 and PI 96983 (Fig. 1). To correlate local lesions with presence of viral RNA in inoculated plants, RT-PCR was done 20 and 25 days after inoculation. RT-PCR detected viral RNA in both lines L78-379 and PI 96983 (Fig. 2). Thus, subsequent extraction of G7 RNA fix)m infected plants was made between 20 and 25 days after inoculation when it was certain that virus was present in both genotypes. Potential for complementation of SMV strains First, movement in PI 96983 was tested by inoculating one primary leaf of seedlings with G7 as a helper virus and the opposite leaf widi 02 on the same day or two days later. Plants of the cultivar Williams 82 were similarly treated as positive controls. A plant of PI 96983 was left uninoculated as a negative control. Amplification products of RT-PCR analysis of leaves showed presence of 07, but not 02, in infected plants of PI 96983 (Fig. 3A). Products of both 02 and 07 were present in infected Williams 82 plants. Similarly, products of 07 only were observed in the analysis of stems of PI 96983 (Fig. 3B) that were inoculated with 02,2,4, and 6 days after inoculation with 07 while both 02 and 07 were present in positive control plants. In the next experiment we investigated the potential for complementation of 02 by 07 in the line L78-379. RT-PCR amplification products for 07 only, but not 02, were observed 87 in all plants inoculated with both strains (Fig. 4). Infected Williams 82 plants showed G2 signals for PGR. To test frar ccxnplementation of G2 by G7a in L78-379, primary leaves of seedlings were inoculated with G7a bef(»% or simultaneously with G2. At least 20 days after inoculation, the leaves were analyzed for presence of both viruses. The plants of L78-379 showed RT-PCR products of G7a only (Fig. 5). No products of either strain G7a or G2 were present in control plants, but products of both G2 and G7a were obtained in Williams 82 that was used as a positive control. In addition, we investigated the potential of complementation of G2 by G7 in the cultivar Davis by inoculating primary leaves of seedlings witii G2 simultaneously with G7 or two days later. Again, RT-PCR products of G7 only, but not G2, were observed in all plants inoculated with both strains (Fig. 6). Analysis of SMV strains isolated from local lesions by RT-PCR To test pathogenicity of SMV strains (Xi the cultivar Davis by using biological infectivity and RT-PCR assays, we isolated 110 lesions firom the cultivar Top Crop and used each to inoculate a plant seedling of the cultivar Williams 82. Forty three plants tested virus- positive by ELISA. Of these, 26 were tested by RT-PCR and all showed products of strain G7 only, but not G2. The reaction was still negative at increased starting RNA concentration (80 - 200 ng) (data not shown). Products of G2 were obtained, only from plants of Williams 82 used as control. Discussion Virus movement is important in vkus disease development, host range and host specificity. Evidence for virus cell-to-cell nK)vement has come from subliminal infection of plants, infection of protoplasts (Sulzinski and Zaitlin, 1982) and complementation experiments (Taliansky et al., 1982a). Complementation experiments in which infection of a plant with the 88 helper virus allowed systemic infection of a second virus have been reported between related and unrelated viruses; e.g., potato leaf roll and PVY (Baricer, 1987); bean golden mosaic virus and TMV (Cair and Kim, 1983); TMV mutants (Taliansky et al., 1982b; Holt and Beachy, 1991); geminivirus AL2 and AL3 genes (Sunter et al., 1994); and cowpea mosaic and sunhemp mosaic viruses (Taliansky et al., 1993). However, examples also exist of non- complementation between viruses or viruses and viroids, regardless of the nature of the host system used (Von-Amim and Stanley, 1992). The SMV-soybean system [(soybean lines PI 96983, L78-379 and Davis; immune to G2 strain, but susceptible to 07) (Mansky et al., 1991)], provides a good model to test complementation. Previous studies showed that inoculation of immune lines with 07 or 07 a followed 2 days by inoculation with 02 resulted in systemic spread of the avirulent SMV 02 strain (Mansky et al., 1995). These findings were based on local lesion assay and monoclonal antibodies that distinguish epitopic differences among coat proteins of SMV. Local lesion assay has been reported to be a useful tool for assessment of relative infectivity of individual virus infection (Holmes, 1929; Milteath and Soong, 1976), and P. vulgaris (cultivar Top Crop) is ideal for SMV as it gives clear-cut necrotic lesions. However, for diagnosis of mixed infections such as closely related strains of SMV by biological activity, both host differential Unes and the ability for the two viruses to cause distinct local lesions in a single host are preferable for uneqivocal strain identification (Matthews, 1991). Further, unlike polyclonal antibodies (Shukla et al., 1988), monoclonal antibodies for the most part avoid problems of insensitivity to different viruses or strains because those that are directed towards the variable region of the coat protein can be selected. However, the observation that they can react with epitopes from the variable region that happen to be present on relatively distantly related potyviruses (Shukla et al., 1988; Shukla and Ward, 1989; Shukla and Luricella, 1992), may provide ambigous results. If so, a more robust technique would be preferred for studying very closely related virus strains. 89 In this study, an RT-PCR which specifically discriminates between SMV strains, was used as an alternative approach to the question of complementation between related SMV strains. PGR of gene fragments is the preferred technique for analysis of viruses that occur or can occur in mixed infection (Langeveld et al, 1991; Dekker et al., 1993). Amplification of products of inoculated plants of soybean lines PI 96983 and L78-379, using the specifically- designed assay, demonstrate that G2 was not detected in plants also inoculated with strain 07. Failure of strain 02 to move in PI 96983 is in agreement with previous results of Mansky et al (1995) in which RT-PCR analyses were not performed. However, the absence of strain 02 in plants of either L 78379 or Davis was not in agreement with results reported by Mansky et al (1995). Several reasons may be used to explain differences between the results of this study and those of Mansky et al. (1995). The more likely possibility is that the RT-PCR is a more robust approach for distinction of mixed infection than that based on biological properties. Mixed infections based on biological properties alone have been shown to complicate detection of viruses as well as related strains (Zink and Duffus, 1972; Matthews, 1991). Mansky et al. (1995) demonstrated apparent systemic movement of 02 in the lines L78-379 and Davis by re- isolation of virus from local lesions and identification of viral coat protein present in infected tissue. For the local lesion assay, both the avinilent (02) and the virulent (07 or 07a) strains induced on the assay host local lesions that were re-isolated for subsequent inoculation of differential lines. Unfortunately, the lesions induced by the different strains were not distinctive in the assay host, and no differential line susceptible to 02 only, but resistant to helper viruses was used to facilitate distinction of tiie viruses. Thus identification of 02 was based solely on lack of infection of resistant lines. Furthermore, the approach involved several steps of manual virus inoculations and re-isolations that could increase the chances of error. The alternative approach to demonstrate systemic movement of 02 was by use of serology. With this approach, conclusions about movement of 02 and 07 were based on non-alignment 90 of antigen-andbody binding curves of extracts from soybean samples inoculated with G2 and 07 as compared to those frcMn 02 or 07-infected tissue. A san^le from a plant inoculated with both 02 and 07 displayed a single curve that seemed to show presence of virus rather than distinction of two antigens from a single host The other reason, but less likely one, for differences between these results and those of Mansky et al. (1995) is the possibility that putative nucleotide change(s) in the SMV isolates maintained under conditions of repetitive mechanical transfer, could alter the response of a plant when inoculated with both isolates. Further investigation will be necessary to test this possibility. The study shows RT-PCR does detect spread of a virus strain readily when virulence is operative. The results suggest that this technique is likely to facilitate understanding of interactions between virus strains within a single plant host and yield insight into complex biological processes. Acknowledgements This research was supported in part by fellowships to M. E. O. fh>m FAQ, United Nations/Kenya Agricultural Research Institute Project and USAID/NARP program. We thank A. L. Eggenberger for helpful suggestions during this study. References Barker H (1987) Invasion of non-phloem tissue in Nicotiana clevelandii by potato leafroll luteovirus is enhanced in plants also infected with potato Y potyvirus. J Oen Virol 68: 1223-1227 Bamett OW (1991) Potyviridae, a proposed family of plant viruses. Arch Virol 118:139-141 Bowers ORJr, Paschal EH n, Bernard RL, Ooodman RM (1992) Inheritance of resistance to soybean mosaic virus in 'Buffalo' and HLS soybean. Crop Sci 32: 67-72 91 Buzzell RI, Tu JC (1984) Inheritance of soybean resistance to soybean mosaic vims. J Hered75:82 Buzzell RI, Tu JC (1989) Inheritance of a soybean stem-tip necrosis reaction to soybean mosaic virus. J Hered 80:400-401 Carr RJ, Kim KS (1983) Evidence that bean golden mosaic virus invades non-phloem tissue in double infections with tobacco mosaic virus. J Gen Virol 64:2489-2492 Chen P, Buss GR, Roane CW, ToUn SA (1991) Allelism among genes for resistance to soybean mosaic virus in strain-differential soybean cultivars. Crop Sci 31:305-308 Chen P, Buss GR, Tolin SA (1988) Inheritance of reaction to strains G5 and G6 of soybean mosaic virus (SMV) in differential soybean cultivars. Soybean Gen Newsl 15:130- 134 Cho E, Goodman RM (1979) Strains of soybean mosaic virus: classification based on virulence in resistant soybean cultivars. Phytopathology 69:467-470 Cho EK, Goodman RM (1982) Evaluation of resistance in soybeans to soybean mosaic virus strains. Crop Sci 22:1133-1136 E>eom CM, Oliver MJ, Beachy RN (1987) The 30-Kilodalton gene product of tobacco mosaic virus potentiates virus movement. Science 237:389-394 Dougherty WG, Carrington JC (1988) Expressi(Mi and function of potyviral gene products. Annu Rev Phytopathol 26:123-143 Eggenberger AL, Static DM, Beachy RN (1989) The nucleotide sequence of a soybean mosaic virus coat protein-coding region and its expression in Escherichia coli, Agrobactenwn\wnefaciensdXiCi\ohzccocs3\as. J Gen Virol 70:1853-1860 Ghabrial SA, Smith HA, Parks TD, Dougherty WG (1990) Molecular genetic analyses of the soybean mosaic virus NIa proteinase. J. Gen Virology 71:1921-1927 92 Hanley-Bowdoin L, Elmer JS, Rogers SG (1990) Expression of functional replication protein ficom tomato golden mosaic virus in transgenic tobacco plants. Proc Natl Acad Sci USA 87:1446-1450 Hill JH, Benner HI, Permar TA, Bailey TB, Andrews RE, Jr. Durand DP, Van Deusen RA (1989) Differentiation of soybean mosaic virus isolates by one-dimensional trypsin peptide maps immunoblotted with monoclonal antibodies. Phytopathology 79; 1261- 1265 Hill JH, Benner HI, Van Deusen RA (1994) Rapid differentiation of soybean mosaic virus isolates by antigenic signature analysis. J Phytopathol 142:152-162 Holmes, FO (1929) Local lesions in tobacco mosaic. BotGaz 87:39-55 Holt CA, Beachy RN (1991) In vivo complementation of infectious transcripts from mutant tobacco virus cDNAs in transgenic plants. Virology 181:109-117 Hull R, Brown F, Payne C (1989) Virology: directory and dictionary of animal and plant viruses. Stockton Press, New York Jayaram Ch., Hill JH, Miller WA (1992) Complete nucleotide sequences of two soybean mosaic strains differentiated by response to soybean containing the Rsv resistance gene. J Gen Viiol 73:2067-2077 Klein PG, Shaw JG (1993) Qimplementation smdies on transgenic plants of a lethal mutant tobacco vein mottling potyvirus. In: IX International conference of virology. Abstract P60-11 Kwon SH, Oh JH (1980) Resistance to a necrotic strain of soybean mosaic virus in soybeans. Crop Sci 20:403-404 Langeveld SA, Dore JM, Memelink J, Derics AFLM, Van der Vlugt CIM, Asjes CJ, Bol JF (1991) Identification of potyvimses using polymerase chain reaction with degenerate primers. J Gen Virol 72:1531-1541 93 Lim SM (1985) Resistance to soybean mosaic virus in soybeans. Phytopathology 75:199- 201 Lucas BS, Hill JH (1980) Qiaracteristics of the transmission of three soybean mosaic virus isolates by Myius persicae and Rhopalosiphum maidis. Phytopath Z 99:47-53 Mansky LM, Durand DP, Hill JH (1991) Effect of temperature on the maintenance of resistance to soybean mosaic virus in soybean. Phytopathology 81: 535-538 Mansky LM, Durand DP, Hill JH (1995) Evidence for complementation of plant potyvirus pathogenic strains in mixed infection. J Phytopathol 143:247-250 Matthews REF (1991) Plant virology (3rd ed.). Academic Press, New York and London, pp 11-52 Milbrath GM, Soong MM (1976) A local lesion assay for soybean mosaic virus using Phaseolus vulgaris culdvar Top Crop. Phytopathol. Z. 87: 255-259 Roane CW, Tolin SA, Buss GR (1986a) Genetics of reaction to soybean mosaic virus (SMV) in the cultivars Kwanggyo, Marshall, and PI 96983. Soybean Genet Newsl 13:134- 135 Roane CW, Tolin SA, Buss GR (1986b) Application of the gene-for-gene hypothesis to soybean mosaic virus interactions. Soybean Genet Newsl 13:136-139 Shukla DD, Luricella R, Ward CW (1992) Serology of potyviruses: current problems and some solutions. In: Bamett, OW (ed.) Potyvirus taxonomy. Springer-Verlag, Wein and New York (Arch Virol [Supplement] 5) pp 57-69 Shukla DD, Strike PM, Tracy SL, Gough KH, Ward CW (1988) The N and C termini of the coat proteins of potyviruses are surface-located and the N terminus contains the major virus specific epitopes. J Gen Virol 69:1497-1508 Shukla DD, Ward CW (1989) Structure of potyvirus coat proteins and its application in the taxonomy of the potyvirus group. Adv Virus Res 36:273-314 94 Sulzinsld MA, Zaitlin M (1982) Tobacco mosaic virus replication in resistant and susceptible plants: in some resistant species virus is conHned to a small number of initially infected cells. Virology 121:12-19 Sunter G, Stenger DC, Bisaio DM (1994) Heterologous complementation by geminivirus AL2 and AL3 genes. Virology 203:203-210 Taliansky ME, Atabekov TI, Kaplan IB, Morozov SY, Malyshenko SI, Atabekov JG (1982a) A study of TMV ts-mutant Ni2519 1. Complementation experiments. Virology 118: 301-308 Taliansky ME, Malyshenko SI, Pshennikova ES, Kaplan IB, Ulanova EF, Atabekov JG (1982b) Plant virus-speciHc transport function I. Virus genetic control required for systemic spread. Virology 122:318-326 Taliansky ME, Jager CP, Wellink J, Lent JWM van, Goldbach RW (1993) Defective movement of cowpea mosaic virus mutant N123 is efficiently complemented by sunhemp mosaic virus. J Gen Virol 74:1895-1901 van Dun CMP, van Volten-Doting L, Bol JF (1988) Expression of alfalfa mosaic virus cDNA 1 and 2 in transgenic tobacco plants. Virology 163:572-578 Von-Amim A, Stanley J (1992) Inhibition of afiican cassava mosaic virus systemic infection by a movement protein from the related geminivirus tomato golden mosaic virus. Virology 187: 555-564 Wadsworth GJ, Redinbaugh MG, Scandalios JG (1988) A procedure for the small-scale isolation of plant RNA suitable for RNA lot analysis. Anal Biochem 172:279-283 Yu YG, Saghai Maroof MA, Buss GR, Maughan PJ, ToUn SA (1994) RFLP and microsatellite mapping of a gene for soybean mosaic virus resistance. Phytopathology 84:60-64 Zink FW, Duffiis JE (1972) Association of beet western yellows and lettuce mosaic viruses with internal rib necrosis of lettuce. Phytopathology 62:1141-1144 Fig. 1A, Number of leaves of Phaeolus vulgaris cultivar Top Crop that produced local lesions after inoculation with s^ from stems or leaves of the soybean line L78-379 inoculated widi SMV strain G7. A total of four leaves were inoculated per determination. B, Number of leaves of P. vulgaris cultivar Top Crop that produced local lesions after inoculation with siq) firom stems and leaves of the soybean line PI 96983 infected with SMV strain G7. A total of four leaves were inoculated per determination. 96 • Uninoculated leaves • Stem 15 20 25 Days after inoculation • Uninoculated leaves • Stem Days after inoculation Fig. 2. Gel analysis of the 277 bp aiiq)liflcation product from san^les of soybean genotypes, 20 and 25 days after inoculation with soybean mosaic virus (SMV) strain 07. RNA was extracted from trifoliate leaves of inoculated soybean plants. Rrst strand synthesis and anq>lification employed the primer specific for G7 in the CI region of the SMV genome. DNA marker (M) was ICQ bp. Williams 82 was used as control Uninoculated omtrol of Williams 82 gave no bands (data not shown). Days after 20 25 20 inoculation m o^ m o^ C/3— 00 r- 00 t--. c ^ CO 0^ CO SS Genotype S » S oo M E J E ^ Fig. 3. Agarose gel electrophoiedc analysis of PGR an^lified cDNA products from total RNA extracted frc»n plants of the soybean line PI 96983 inoculated with soybean mosaic virus (SMV) strains G7 and G2. RT-PCR was done with G2 and 07 specific primers. A. RT-PCR of total RNA extracted frcxn leaves. Lanes M, maikers ranging from 2072 to 100 bp; lanes 1 and 2, <^posite leaves inoculated with SMV strains G2 and G7 simultaneously; lanes 3 and 4, leaves inoculated with G2, two days after G7; lanes S and 6 were replications of 3 and 4; lanes 7 and 8, uninoculated controls; lanes 9 and 10 positive ccmtrols of the cultivar Williams 82 inoculated with G2 and G7, respectively. Data used are representative oi four samples. B. RT-PCR ctf total RNA extracted from stems. Lane M, DNA markers ranging from 2072 to 1001^; lanes 1 and 2, opposite leaves inoculated with SMV strain G2, two days after G7; lanes 3 and 4, leaves inoculated with G2, four days after G7; lanes S and 6, leaves inoculated with G2, six days after G7; lane 7, uninoculated control of PI 96983; and lane 8 and 9, positive controls of Williams 82 inoculated with G2 and G7, respectively. Data used are representative of four samples. M12 345 67 8910M -380 -277 M123 45 67 89 -380 -211 Fig. 4. Agarose gel electioiriioresis of PGR amplified cDNA pioducts firom total RNA derived from leaves of soybean line L78-379 inoailated with soybean mosaic vims (SMV) strains G7 and G2. RT-PCR was performed with viral RNA -specific primers or primer pairs. Lane M, DNA maricers ranging from 2072 to 100 bp; lanes 1 and 2, opposite leaves inoculated with SMV strains G7 and G2 simultaneously; lanes 3 and 4, leaves inoculated with G2 two days after G7; lanes S and 6, leaves inoculated with G2 four days after G7; lanes 7 and 8, uninoculated controls; and lane 9, Williams 82 inoculated with G2. Data used are representative of four samples. M123456 789 bp 600 -380 300 -277 Fig. 5. RT-PCR of soybean mosaic virus RNA fiom leaf samples of the soybean line L78- 379 inoculated with strains G7a and 02. cDNA synthesis and ampliHcadon were performed with viral RNA-specific primers for G7 and G2. All samples were from trifoliate leaves. Lanes M, DNA size markers, lanes 1 and 2, q)posite leaves inoculated with 02, two days after 07a; lane 3 and 4, leaves inoculated with 02 and 07a simultaneously; lane 5 and 6, uninoculated controls; and lanes 7 and 8, Williams 82 inoculated with 02 and 07a, rcspecdvely. Data used ate representative of three samples. M23 4 56789M Fig. 6. Agarose gel electrophwesis of PGR amplified cDNA products from total RNA derived from leaves of the soybean cultivar Davis inoculated with soybean mosaic virus (SMV) strains G7 and G2. RT-PCR was performed with viral RNA-specific primers OT primer pairs. Lane M, DNA maiicers ranging from 2072 to 100 bp; lanes 1 and 2, opposite leaves inoculated with SMV strains G7 and G2 simultaneously; lanes 3 and 4, leaves inoculated with G2, two days after G7; lanes 5 and 6, leaves of plants inoculated either widi G7 or G2 only, respectively; lane 7, plants of Williams 82 inoculated with G2; lanes 8 and 9, uninoculated controls. Data used are representative of four samples. bp •380 •277 107 GENERAL CONCLUSION Soybean is valued worldwide as a source of vegetable oil and protein products. Soybean mosaic virus (SMV), a member of the large and economically important potyvirus family Potyviridae, affects soybean production. Use of SMV-free seed and soybean host resistance are the best approaches currently available to minimize losses by the virus. Correct detection of SMV or SMV strains is prerequisite to development of a successful strategy for virus control. Several strains of SMV have been identified fra* which different host resistance genes have been found. The availability of soybean lines that confer resistance to some, but not all virus strains raises the possibility of mixed virus infection particularly in the field. Therefore, highly sensitive methods to detect and differentiate closely related SMV strains are necessary. Additionally, highly sensitive methods may also be applicable in the efforts to understand soybean resistance to virus disease to preclude development of strains with enhanced vimlence. The first goal of this study was to develop a simple and accurate reverse-transcription polymerase chain reaction (RT-PCR)-based method to detect and discriminate between SMV strains. This was achieved. We were able to distinguish between individual SMV strains G2 and G7 in a mixed infection a single host plant by using unique RNA sequence-specific primers and RT-PCR. The method does not require fiuther analysis of amplified products and greatly increases the speed and ease of detecting two very closely related virus strains. The second part of the study dealt with virus-host interaction to assess the potential for complementation among SMV strains. The potential role of a helper strain (SMV strain G7 or G7a) to facilitate movement of an avirulent strain (SMV strain G2) under conducive conditions was analyzed. Results showed that strain G2 could not be complemented by either G7 or G7a. The RT-PCR assay was a more robust method for addressing die question of functional 108 complementation of an avirulent strain by a helper virus. The approach using transgenic soybeans has not been done, but would be worthwhile.