sign in sign up
<<
Home , Danazol

BIOLOGY OF REPRODUCTION (2016) 94(3):60, 1–10 Published online before print 27 January 2016. DOI 10.1095/biolreprod.115.133330

Synthetic Hormones Regulated Cell Proliferation Through MicroRNA-34a-5p in Human Ovarian Endometrioma1

Chia-Yi Hsu,3 Tsung-Hua Hsieh,4 Cheng-Fang Tsai,3 Hung-Sheng Chen,4 Peir-In Liang,5 Ya-Ling Hsu,3 and Eing-Mei Tsai2,3,4,6

3Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung City, Taiwan 4Department of Obstetrics and Gynecology, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Downloaded from https://academic.oup.com/biolreprod/article/94/3/60, 1-10/2434415 by guest on 24 September 2021 Kaohsiung City, Taiwan 5Department of Pathology, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung City, Taiwan 6Center for Research Resources and Development, Kaohsiung Medical University, Kaohsiung City, Taiwan

ABSTRACT steroid hormones and suggest a potential mechanism for treatment. Endometriosis is the hormone-dependent product of endo- metrial tissue found outside the uterus. Recently, micro-RNAs danazol, endometrial mesenchymal stem cells, medroxypro- (miRNAs) were shown to play a role in endometriotic lesion gesterone acetate, development. However, the mechanism of steroid hormones Downloaded from www.biolreprod.org. responsible for miRNA remains obscure. In the present study, INTRODUCTION we assayed for the effects of synthetic steroid hormones Endometriosis, defined as the presence of endometriallike (danazol, progesterone, and acetate tissue outside the uterus, is a common -dependent [MPA]) on miRNAs in endometriosis. We used a global miRNA gynecological disorder with a complex, multifactorial etiology expression profile microarray to evaluate miRNA expression in that affects approximately 10%–15% of women of reproduc- endometrial mesenchymal stem cells (EN-MSCs) of ovarian tive age. Several theories explaining endometriosis pathogen- l following treatment with 1 M danazol, esis have been proposed, including the widely accepted theory progesterone, or MPA. Furthermore, we selected candidate miRNAs whose expression changed more than fivefold and of retrograde transplantation and subsequent implantation of compared the effects of danazol, progesterone, and MPA endometrial tissue fragments into ectopic locations after treatments and also compared those results with controls in retrograde menstruation [1]. The theories of coelomic meta- EN-MSCs. Among those with a fivefold change, we found 13 plasia, lymphovascular metastasis, embryonic rest, and stem ectopically upregulated miRNAs in EN-MSCs. To understand cell involvement may also potentially explain the development the function of these 13 miRNAs, we subjected their sequences of endometriosis [2, 3]. However, endometriosis is an to Ingenuity Pathway Analysis. According to both the etiology enigmatic disease with unsolved pathogenesis. Recently, there and pathogenesis of endometriosis, we found that miR-199a- is growing evidence indicating that stem cells act as the root 5p and miR-34a-5p showed specific association with the etiology of endometriosis [2, 4–7]. This theory postulates that disease, including molecular and cellular functions. Steroid endometriotic lesions result from endometrial stem/progenitor hormone treatment elevated the levels of miR-199a-5p and cells [2]. The human is a dynamic tissue, miR-34a-5p. An inhibitor of miR-34a-5p also reduced the undergoing cycles of growth, differentiation, shedding, and synthetic steroid hormones effects on cell proliferation. In vivo regeneration, throughout a woman’s reproductive years. data revealed that miRNA levels in endometriotic lesions Therefore, endometrial stem/progenitor cells are thought to correlated with findings following in vitro synthetic hormone have regenerative capacity. Owing to these regenerative traits, treatment. Our data show the effects of synthetic steroid endometrial stem/progenitor cells may actually contribute to hormones on miRNA regulation. These findings contribute to endometriosis formation. In our previous study, we demon- our understanding of the molecular impact of the synthetic strated the presence of mesenchymal stem cells (MSCs) in stromal cells of ectopic endometrial tissues and established 1This work was supported by a grant from the Kaohsiung Medical MSCs from patients with endometriosis. The results of the University Hospital Research Fund (KMUH104-4R27 and KMUH103- study showed that ectopic endometrial MSCs (EN-MSCs) have 10V07), and Ministry of Science and Technology, Taiwan (Grant No. higher cell invasion ability in vitro and in vivo [8]. In addition, NSC102-2628-B-037-011-MY3 and 102-2632-B-037-001-MY3). 2 we also demonstrated that ectopic EN-MSCs application in the Correspondence: Eing-Mei Tsai, Department of Obstetrics and Gynecology, Kaohsiung Medical University Hospital, Kaohsiung nude mice can form the endometrioticlike lesion [9]. Therefore, Medical University, No. 100, Zihyou 1st Rd., Sanmin District, we used the ectopic EN-MSCs as the model for the study of Kaohsiung City 807, Taiwan. E-mail: [email protected] endometriosis and to investigate the effect of the synthetic . Received: 10 July 2015. In addition, endometriosis is a multifactorial disease caused First decision: 9 August 2015. by hormonal milieu [10], genetic predisposition [11, 12], and Accepted: 19 January 2016. environmental factors [13]. The high incidence of recurrence Ó 2016 by the Society for the Study of Reproduction, Inc. This article is following treatment illustrates that the established theories may available under a Creative Commons License 4.0 (Attribution-Non- not fully explain the etiology of endometriosis. Implanted Commercial), as described at http://creativecommons.org/licenses/by-nc/ 4.0 ectopic endometrial tissue can resist apoptosis [14, 15], invade eISSN: 1529-7268 http://www.biolreprod.org the extracellular matrix [16], induce neovascularization [17], ISSN: 0006-3363 and acquire steroidogenic capacity [18]. 1 Article 60 HSU ET AL.

Steroid hormones are produced in the , and they adipogenic, osteogenic, and chondrogenic markers, FABP4, Runx2, and regulate the growth of endometrial tissue by stimulating or collagen II, respectively, were determined by quantitative RT-PCR (qPCR). inhibiting cell proliferation. Steroid hormones play a role in According to our previous reports [8], we collected the total population (which contains epithelium and stromal cells of ovarian endometrioma) after uterine diseases such as endometriosis. Disruption of steroid passing through 70 lm wire sieves. Then, passing through a 40 lm strainer hormone control of endometrial cell proliferation and differ- (which contains stromal cells), we purified MSCs from endometriotic stromal entiation can lead to endometriosis. Furthermore, implantation cells after limiting dilution and colony formation. We collected MSCs from the and maintenance of endometrial lesions are estrogen depen- large colony formation after identification. Those without large colony dent. formation are defined as non-MSCs. Eventually, three EN-MSC cultures were obtained by this process. EN-MSCs were cultured in Dulbecco modified Eagle Therefore, a variety of synthetic hormones, such as danazol, medium: Nutrient Mixture F12 (Gibco-Life Technologies) and MCDB 153 progesterone, and medroxyprogesterone acetate (MPA) have medium (Keratinocyte-SFM; Gibco-Life Technologies) (2:1, v/v) supplement- been contrived for the treatment of endometriosis [19–21]. ed with 10% fetal bovine serum (Gibco-Life Technologies), 2 mM N-acetyl-L- They have been widely used in clinical therapy. These drugs cysteine (Sigma-Aldrich), and 0.2 mM Asc-2P (Sigma-Aldrich). EN-MSCs act as a progestin or an androgenlike hormone inhibiting both were incubated at 378C under humidified atmosphere with 5% CO2. Downloaded from https://academic.oup.com/biolreprod/article/94/3/60, 1-10/2434415 by guest on 24 September 2021 ovarian estrogen production and the pituitary-based surge of . However, steroid-related molecular Chemicals and Reagents mechanisms—especially those related to micro-RNA (miRNA) Danazol, progesterone, MPA, and b- were purchased from Sigma- regulation in endometriosis—are not well known. Aldrich. Primers were commercially synthesized at Genemessenger Scientific The miRNAs are short (;19–22 nucleotides), highly Co. The primers used in this study were the following: 18S, 50-GAGGTAGT conserved, noncoding RNAs that control gene expression by GACGAAAAATAACAAT-30 (sense) and 50-TTGCCCTCCAATGGATCCT- 0 30 (antisense); NOTCH1, 50-GACCTCATCAACTCACACGC-30 (sense) and targeting a specific sequence within the 3 untranslated region 0 0 0 of mRNAs, resulting in mRNA degradation or repression of 5 -TATGATCCGTGATGTCCCGG-3 (antisense); b-ACTIN,5- GTGGGGCGCCCCAGGCACCA-30 (sense) and 50-CTCCTTAATGTCACG translation. The miRNAs have been implicated in the CACGATTTC-30 (antisense); CD29, 50-CTGCAAGAACGGGGTGAATG-30 regulation of cellular functions such as cell cycle progression (sense) and 50-CACAATGTCTACCAACACGCCC-30 (antisense); CD44, 50- Downloaded from www.biolreprod.org. [22], proliferation [22–25], apoptosis [26, 27], cell motility AGAAGGTGTGGGCAGAAGAA-30 (sense) and 50-AAATGCAC [28], and angiogenesis [9]. Therefore, aberrant miRNA CATTTCCTGAGA-30 (antisense); CD90, 5 0-CGCTCTCCTGCTAA CAGTCTT-30 (sense) and 50-CAGGCTGAACTCGTACTGGA-30 (antisense); expression correlates with various human diseases, including 0 0 0 hepatocarcinoma [29], endometriosis [9, 30], and others. In CD105, 5 -ACGCTCCCTCTGGCTGTTG-3 (sense) and 5 -GCCCTTCGA GACCTGGCTAG-30 (antisense); OCT-4, 50-GGAAAGGCTTCCCCCT addition, a number of miRNAs are involved in the hormonal CAGGGAAAGG-30 (sense) and 50-AAGAACATGTGTAAGCTGCGGCCC regulation of steroidogenic cells [31]. Here, we report our -30 (antisense). The qPCR primer sequences for miR-199a-5p and miR-34a-5p investigation of whether synthetic steroid hormones, by were as follows: Stem loop primer for miR-199a-5p, GCCAACCCAGUGUU- regulating the expression of certain miRNAs, modulate the CAGACUACCUGUU CAGGAGGCUCUCAAUGUGUACAGUAGUCUG function of EN-MSCs. CACAUUGGUUAGGC; Stem loop primer for miR-34a-5p, GGCCAGCU GUGAGUGUUUCUUUGG CAGUGUCUUAGCUGGUUGUUGUGAG CAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUG MATERIALS AND METHODS CUGCACGUUGUGGGGCCC (Applied Biosystems). Cell Culture Cell Viability Assay This study was approved by the Institutional Review Board of Kaohsiung Medical University Hospital. Participants provided their written informed Cells were seeded into 96-well plates at 5000 cells/well and incubated at consent (KMUH-IRB-20140031) to participate in this study. Ovarian 378Cin5%CO2. The cells were changed to serum-free medium the following endometrial tissue was obtained from women who received operations for day and left to acclimatize for 24 h prior to the experiment. After 24 h, the cells indications of endometriosis at the Department of Obstetrics and Gynecology of were treated with synthetic steroid hormones and transfected with a specific Kaohsiung Medical University Hospital. We previously reported the proce- miRNA inhibitor, MH11030. Viable cells were counted using the 2-(2- dures we used to isolate EN-MSCs from ovarian endometrial tissue [8]. Briefly, methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2, 4-disulfophenyl)-2H-tetrazoli- the tissues were minced with sterile scissors and digested with type II um monosodium salt (WST-8) assay. The WST-8 assay was performed using collagenase. Then, stromal cells were separated from epithelial cells using wire Cell Counting Kit-8 (Fluka Chemika-Biochemika). To begin, 90 ll of culture sieves. To isolate EN-MSCs, large colonies of stromal cells were selected and medium and 10 ll of Cell Counting Kit-8 reagent were added to each well. Cell processed via limiting dilution, and colony formation potential was viability was assayed after 2 h using an -linked immunosorbent assay subsequently assessed. The EN-MSCs were characterized using MSC reader (Multiskan EX; Labsystems) at 450 nm (reference, 650 nm). In each phenotypes, differentiation induction (i.e., adipogenesis, osteogenesis, chon- case, three independent experiments were performed. drogenesis) and gene expression (i.e., OCT4, CD29, CD44, CD49f, CD90, Musashi-1, CD146, PDGF-Rb, and CD105) by flow cytometric analysis RNA Extraction and qPCR (Supplemental Materials and Methods; Supplemental Data are available online at www.biolreprod.org). For differentiation assays, EN-MSCs were seeded at 5 To assess miRNA and mRNA expression, total RNA was isolated from EN- 3 104 cells per well in a six-well plate, and on the next day, differentiation MSCs and endometriotic lesions from mice using TRIzol (Sigma-Aldrich). For conditions were applied to the EN-MSCs as follows. Adipogenic differentiation qPCR, reverse transcription was carried out using the Deoxyþ HiSpec Reverse of EN-MSCs was induced by treatment with 500 lM 3-isobutyl-1- Transcription kit (Yeastern) and TaqMan Micro-RNA Reverse Transcription kit methylxanthine, 1 lM , 1 lM indomethacin, and 10 lg/ml (Applied Biosystems). Subsequent qPCR was performed using an ABI 7900 insulin for 2 days and insulin for 1 day. After four cycles of treatment for 12 Real-Time PCR system (Applied Biosystems). days, these cells were fixed with 4% paraformaldehyde (Sigma-Aldrich) and The product was amplified using the Power SYBR Green PCR Master Mix stained using Oil Red O staining of the lipid droplets. For osteogenesis (Applied Biosystems). Mature miRNA expression levels were measured using differentiation, 10 nM dexamethasone, 50 lM L-ascorbic acid-2-phosphate the TaqMan Micro-RNA Assay (Applied Biosystems). Expression levels were (Asc-2P) and 10 mM b-glycerophosphate disodium were added to the growth normalized to that of 18S mRNA, an endogenous control. Relative miRNA 44Ct medium for 2 wk with medium change and treatment renewed once every 3 expression was calculated using the 2 method. days; the cells were then stained with Alizarin Red S to visualize the 14 days after the initiation of differentiation for the existence of osteocytes. Expression Profiles and Quantification of miRNA Chondrogenesis differentiation of EN-MSCs was induced by treatment with 10 ng/ml TGF-b1, 50 lM Asc-2P, and 6.25 lg/ml insulin; the medium was Total RNA (3 lg) from EN-MSCs was reverse transcribed using the changed every 3 days. After 14 days, the micromass were fixed in 4% QuantiMir RT kit (System Biosciences). Expression profiling of miRNA was paraformaldehyde and then examined for the presence of chondrocytes by performed using the SeraMir 384 Profile kit (System Biosciences). The array Alcian Blue 8-Gx staining of the extracellular matrix. The expression of consisted of 380 antisense miRNA oligonucleotide primers and triplicate 2 Article 60 ENDOMETRIOSIS-SPECIFIC miRNA MODULATION reactions for the RNA spike-in control in the kit. The miRNA expression RESULTS profiles were measured by qPCR. Samples from three independent experiments were analyzed. Synthetic Hormone Attenuates Ectopic EN-MSC The comparative threshold cycle (Ct) method was used to quantify the Proliferation in Both a Time- and Dose-Dependent Manner expression levels where 4Ct represents the threshold cycle of the target minus that of the spike-in control and 44Ct represents the 4Ct of each target minus To assess the response of EN-MSCs to synthetic steroid that of the calibrator. Fold changes in expression from treated samples to (DDCt) hormone drugs, we observed cell proliferation in the presence untreated samples were calculated with the 2 method. of danazol, progesterone, MPA, or the control. First, we examined the effect of various concentrations of these drugs Functional Analysis of miRNA Target Genes (0.1, 1, and 10 lM) and discovered that each inhibited the We applied the Ingenuity Pathway Analysis (IPA) (Ingenuity Systems) tool proliferation of EN-MSCs in a dose-dependent manner after 48 for canonical pathways and participating networks analysis of the hormone- h (Supplemental Fig. S1, A and B, and Fig. 1A). A time-course induced miRNA target genes. study was performed using 1 lM danazol, progesterone, or MPA to assess cell proliferation (Fig. 1B). Each of the Downloaded from https://academic.oup.com/biolreprod/article/94/3/60, 1-10/2434415 by guest on 24 September 2021 Transfection synthetic steroid hormones inhibited EN-MSC proliferation in both a time- and dose-dependent manner. Synthetic steroid The miR-34a-5p inhibitor or a negative control was transfected into EN- hormones are often considered as an antagonist in modulating MSCs using Trans-IT-LT1 Transfection Reagent (Mirus Bio). The mirVana miRNA inhibitor (MH11030) and scramble control (4464078) were purchased the effects of estrogen. Therefore, we applied 100 nM estrogen from Ambion/Life Technologies. After 24 h of transfection, the cells were to examine the cell viability by WST-8 assay after 48 h. The cultured in fresh medium. All cells achieved about 70%–80% of transfection data indicated that synthetic steroid hormones affect the cell efficiencies before being subjected to the assays described. proliferation in the presence and absence of estrogen. Therefore, this result was interpreted that the effect of synthetic Western Blot Analysis was independent of estrogen action (Fig. 1C).

It has been reported that synthetic steroid hormones exerting Downloaded from www.biolreprod.org. EN-MSCs were lysed using RIPA reagent (Millipore) supplemented with biological effects at the cellular level are mediated by several protease and phosphatase inhibitors (G-Biosciences). Protein concen- tration was determined using the Bio-Rad protein assay method (Bio-Rad). intracellular steroid receptors. Thus, we used Western blot Proteins were separated by 10% SDS-PAGE and transferred onto a analysis to examine the expression of PGRA, PGRB, and polyvinylidene fluoride membrane. After blocking with 5% nonfat milk in ESR1 after treatment with synthetic steroid hormones for 48 h. PBS with 0.1% Tween for 1 h, the membranes were incubated with primary We found that the expression of PGRA and ESR1were antibodies dissolved in 5% bovine serum albumin in PBS with 0.1% Tween decreased (about 50%–70%), whereas PGRB was increased overnight at 48C. The following primary antibodies were used: NOTCH1 in EN-MSCs when treated with synthetic steroid hormones (1:1000, 4380; Cell Signaling), PGRA/B (1:800, 8757; Cell Signaling), ESR1 (Fig. 1D). (1:1000, sc-8002; Santa Cruz Biotechnology), or ACTIN (1:5000; Sigma- Aldrich). Horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology) and ECL reagents (Millipore) were used to detect the signal. Functional Analysis of Upregulated miRNAs by Synthetic Steroid Hormones in Endometriosis Animal Experiments To investigate whether miRNAs are involved in synthetic All procedures were performed in accordance with the Guidelines of the steroid hormone regulation of EN-MSCs, we selected optimal Institutional Animal Care and Use Committee of Kaohsiung Medical conditions for miRNA profile array studies. EN-MSCs were University Hospital. The protocol was approved by the Institutional Animal treated with 1 lM danazol, progesterone, or MPA, and the Care and Use Committee of Kaohsiung Medical University Hospital. Mature miRNA microarrays were analyzed after 48 h of treatment. (8- to 10-wk-old) female C57BL/6NCrj mice were purchased from the National Laboratory Animal Centre (Taipei, Taiwan). Endometriosis was surgically According to the global miRNA expression profile arrays, we induced as described [9, 32]. Briefly, to increase the amount of endometrium selected candidate miRNAs whose expression changed more harvested, the donor mice were implanted subcutaneously with capsules than fivefold following the addition of each synthetic steroid containing 17b-estradiol (25 mg/ml dissolved in sesame oil) for 2 days, and hormone. Figure 2A shows the numbers of miRNAs their uterine horn were removed. For the implanted capsule surgery, mice were upregulated or downregulated by danazol, progesterone, or anesthetized with isoflurane in combination with carprofen. Carprofen (5 mg/ MPA. We found 13 miRNAs that were upregulated more than kg body weight) was injected subcutaneously before the surgery. fivefold following synthetic hormone treatment when com- The uterine horns were removed, and endometrial fragments were obtained by peeling off the serosa and myometrium gently. Endometrial fragments were pared with untreated EN-MSCs (Fig. 2B). Upregulated cut to 5 mm 3 5 mm pieces using a scalpel. Eight pieces of minced endometrial miRNAs are listed in Figure 2C. Further, to gain insight into fragments suspended in 0.5 ml PBS were injected into recipients with an 18- miRNA function or , we subjected them to gauge needle through the abdominal wall just below the umbilicus into the IPA. The top five diseases, disorders, and molecular and peritoneal cavity. On the next day of surgery, the mice (n ¼ 5) were cellular functions predicted by IPA are shown in Figure 2D. intraperitoneally injected with danazol (4 mg/kg body weight), progesterone (5 The associated diseases and disorders include cancer, connec- mg/kg body weight), or MPA (2.5 mg/kg body weight) every day and 16 llin tive tissue disorders, organismal injury and abnormalities, vivo-jetPEI and 100 lg miR-34a-5p inhibitor (or a control) in 5% glucose every reproductive system disease, and inflammatory disease. MiR- other day for 4 wk, after which all the mice were killed by CO2 asphyxiation to evaluate the extent of endometriosis. The number of endometriotic lesions was 199a-5p was noted multiple times in the IPA prediction results. counted with the aid of a dissecting microscope. The diameters of each lesion The top molecular and cellular functions consist of cell cycle, were measured using the caliper. Lesion volumes calculated using the cell-to-cell signaling and interaction, cellular development, following formula: lw2/2, where l is length and w is width. cellular growth and proliferation, and cell death and survival. Among the upregulated miRNAs related to the molecular and Statistical Analysis cellular functions, miR-34a-5p was noted multiple times in IPA prediction results. In addition, we employed TargetScan Data represent the mean 6 standard deviation unless otherwise indicated. One-way ANOVA followed by Tukey honestly significant difference test was Human 6.0 to predict the target genes induced by miR-34a- used for comparing differences between multiple groups. Student t-test was 5p [33]. Supplemental Table S1 shows the classification of used to compare differences between two groups. Statistical significance was predicted target genes for miR-34a-5p based on their cellular set at P , 0.05. function. 3 Article 60 HSU ET AL. Downloaded from https://academic.oup.com/biolreprod/article/94/3/60, 1-10/2434415 by guest on 24 September 2021 Downloaded from www.biolreprod.org.

FIG. 1. WST-8 assay was used to measure cell proliferation. WST-8 assay of cell proliferation in studies of dose dependence (0.1, 1, and 10 lM; A) and a time course (24 and 48 h; B) in EN-MSCs treated with each of three synthetic steroid hormones. Error bars represent the standard deviation for the average of fold change (*P , 0.05). This experiment was repeated three times using different batches of cells. C) Cells were treated with each of three synthetic steroid hormones with and without 100 nM estrogen. After 48 h, the WST-8 assay was used to measure cell proliferation. D) Western blot analysis showed the effects of danazol, progesterone, and MPA on NOTCH1, ESR1, and PGRA/B in EN-MSCs. Band intensity was quantified by ImageJ software.

Validation of miRNA Expression Changes with Synthetic which prompted us to perform the following experiments using Steroid Hormone Treatment in EN-MSCs the MSCs. First, we used RT-PCR to confirm the results obtained with Figure 2 shows that 13 miRNAs were upregulated following the miRNA microarray following synthetic steroid hormone synthetic hormone treatment in EN-MSCs. Therefore, we treatment. The levels of miR-34a-5p and miR-199a-5p were speculated that miRNAs had reduced expression in EN-MSCs. increased in EN-MSCs after synthetic steroid hormone We used RT-PCR to validate the expression of miRNAs treatment (Fig. 3B). The RT-PCR results for these miRNAs identified in the total population, non-MSCs, and isolated in EN-MSCs were consistent with those of the miRNA profile MSCs from the ovarian endometrioma. The lowest expression arrays. In addition, the levels of miR-34a-5p were increased in of miR-34a-5p/miR-199a-5p was found in the isolated MSCs non-MSCs after synthetic steroid hormone treatment (Supple- compared with total population and non-MSCs (Fig. 3A), mental Fig. S1C). 4 Article 60 ENDOMETRIOSIS-SPECIFIC miRNA MODULATION Downloaded from https://academic.oup.com/biolreprod/article/94/3/60, 1-10/2434415 by guest on 24 September 2021 Downloaded from www.biolreprod.org.

FIG. 2. The levels of miRNA are regulated by synthetic steroid hormones in EN-MSCs. A) The levels of miRNA are regulated by synthetic steroid hormones. Thirteen identified miRNAs were simultaneously related to danazol, progesterone, and MPA exposure. B) List of miRNAs that were upregulated more than fivefold by each of the synthetic steroid hormones that were applied ectopically in EN-MSCs. C) IPA revealed predictions for the top diseases and cellular functions for each miRNA. D) The top five different diseases and disorders and molecular and cellular functions associated with the miRNAs of interest are shown.

Based on the molecular and cellular function predictions may play a role related to cell cycle, cell-to-cell signaling, using IPA, we further assessed cell proliferation of EN-MSCs cellular development, cellular growth and proliferation, or cell following the addition of an inhibitor of miR-34a-5p. We death and survival (Fig. 2D). Therefore, we examined the conducted Western blot analysis to evaluate the efficacy of the effects of synthetic steroid hormones on the proliferation and miR-34a-5p inhibitor on its target expression; we chose 5, 10, cell progression of EN-MSCs and found that the synthetic and 15 nM inhibitor and treated for 48 h (Fig. 3C). Optimal steroid hormones reduced cell viability of MSCs in treatment results were achieved with 15 nM. groups compared to the untreated control group within the Figure 1 shows synthetic steroid hormone attenuation of cell negative control but not the miR inhibitor group (Fig. 3D). proliferation in EN-MSCs. According to the IPA, miR-34a-5p These data indicate that synthetic steroid hormones inhibit EN- 5 Article 60 HSU ET AL. Downloaded from https://academic.oup.com/biolreprod/article/94/3/60, 1-10/2434415 by guest on 24 September 2021 Downloaded from www.biolreprod.org.

FIG. 3. Levels of miRNAs in EN-MSCs. A) Levels of miR-34a-5p and miR-199a-5p in total population, non-MSCs, and isolated MSCs. Data show results from three independent experiments using different batches of cells. B) Expression of miR-34a-5p and miR-199a-5p were significantly higher in the drug treatment group than in the control, as assessed by qPCR (*P , 0.05). Data show results from three independent experiments using different batches of cells. C) Western blot analysis was used to analyze NOTCH1 expression in miR-34a-5p inhibitor-transfected (5, 10, and 15 nM) EN-MSCs and control cells. D) EN-MSCs were treated with synthetic steroid hormones (1 lM danazol, progesterone, or MPA) and inhibitor of miR-34a-5p. The WST-8 assay was used to quantify cell proliferation. E) Analysis revealed the top five different molecular and cellular functions associated with miR-34a-5p target genes. F) Relative level of NOTCH1 in total population, non-MSCs, and isolated MSCs. G) NOTCH1 expression was significantly decreased in the drug treatment

6 Article 60 ENDOMETRIOSIS-SPECIFIC miRNA MODULATION

MSCs proliferation through induction of miR-34a-5p expres- proliferation by synthetic steroid hormones was transient. EN- sion. MSCs were treated with synthetic steroid hormones for 48 h, To further determine cell cycle progression, we analyzed the and then the degree of cell proliferation after 24 h removal of effect of synthetic steroid hormones on cell cycle by flow synthetic steroid hormones was determined. The data indicate cytometry using EN-MSCs treated with synthetic steroid that cell proliferation was rescued after removal of synthetic hormones. The data show that the antiproliferative effect of steroid hormones (Supplemental Fig. S2C). Taken together, the synthetic steroid hormones on EN-MSCs is mediated by synthetic steroid hormones did not affect terminal differenti- disrupting cell cycle progression, resulting in cell cycle arrest ation of MSCs, and repressed proliferation was transiently in in the G0/G1 phase and inhibition of cell proliferation our study. Therefore, we hypothesized that the effects of (Supplemental Fig. S2A). synthetic steroid hormones on EN-MSCs were reversible Supplemental Table S1 presents predicted miR-34a-5p (Supplemental Fig. S2, B and C). target genes based on their cellular function. Among these target genes, we found one mutual gene, NOTCH1, which is Synthetic Steroid Hormones Regulates the Expression of Downloaded from https://academic.oup.com/biolreprod/article/94/3/60, 1-10/2434415 by guest on 24 September 2021 related to cell cycle, cell-to-cell signaling and interaction, miR-34a-5p and Notch1 In Vivo cellular development, cellular growth and proliferation, and cell death and survival (Supplemental Table S1 and Fig. 3E). In vitro, we demonstrated that synthetic steroid hormones The data in Figure 3C show that NOTCH1 was decreased inhibited proliferation and regulated the level of miRNAs in by miR-34a-5p inhibitor in a dose-dependent manner. Next, we EN-MSCs. Next, we asked whether synthetic steroid hormone compared the expression levels of NOTCH1 in total popula- affect endometriotic lesion formation and the level of Notch1 tion, non-MSCs, and isolated MSCs from the ovarian through miR-34a-5p in vivo. Endometriosis was induced in endometrioma. The expression of NOTCH1 was significantly mice as reported previously [32]. highest in the isolated MSCs (Fig. 3F), but its expression After 28 days of synthetic steroid hormones or miR-34a-5p

decreased after synthetic steroid hormone treatment (Fig. 3G). inhibitor treatment, we found that the endometriotic lesion Downloaded from www.biolreprod.org. In addition, the level of NOTCH1 was decreased in non-MSCs sizes of the synthetic steroid hormone treatment group were after synthetic steroid hormone treatment (Supplemental Fig. smaller than those in the control. The lesion sizes of miR-34a- S1D). 5p inhibitor and synthetic steroid hormone treatment group Figure 3, A and F, shows that miR-34a-5p levels negatively were smaller than those in the miR-34a-5p inhibitor group (Fig. correlated with NOTCH1 expression. To confirm whether the 4A). The degree of successful implantation and the size of the synthetic steroid hormones affect the levels of NOTHC1 via endometriotic lesions in the mice are shown in Table 1. miR-34a-5p in EN-MSCs, we performed a gain and loss study Hematoxylin and eosin staining of the lesions in the controls of miR-34a-5p expression under synthetic steroid hormones showed a typical endometrial appearance, with endometrial and miR-34a-5p inhibitor treatments. Figure 3E shows that glandular epithelium and stromal cells (Fig. 4B). In contrast, EN-MSCs transfected with miR-34a-5p inhibitor exhibited the lesions of the treatment group lacked the typical glandular increased levels of NOTCH1. The cells treated with synthetic structure organization. We evaluated the levels of miR-34a-5p steroid hormones decreased the level of NOTCH1, whereas in the animal model of endometriotic lesion. The levels of miR- downregulation of miR-34a-5p rescued the level of NOTCH1 34a-5p were increased by synthetic steroid hormone treatment, in EN-MSCs (Fig. 3H). The results, therefore, suggest that whereas Notch1 expression was decreased. In contrast, the synthetic steroid hormones regulate NOTCH1 through miR- mice transfected with miR-34a-5p inhibitor exhibited increased 34a-5p in EN-MSCs. levels of Notch1, whereas synthetic steroid hormone treatment These data suggested that miR-34a-5p affects NOTCH1 decreased the levels of Notch1 (Fig. 4, C and D). Our in vivo level in EN-MSCs. In a previous study, NOTCH1 was reported study showed that the levels of miRNAs in endometriotic to be downregulated by miR-34a, resulting in reduced cancer lesions correlated with the in vitro data following synthetic stemness [34]. Owing to the regenerative traits of endometrial hormone treatment. The in vitro and in vivo data thus stem/progenitor cells that may actually contribute to endome- supported the assumption that the synthetic steroid hormones triosis formation, we carried experiments to study whether we administered upregulated miR-34a-5p and downregulated synthetic steroid hormones affect the properties of MSCs and Notch1. to understand the mechanism of synthetic hormone actions on EN-MSCs. We performed RT-PCR to detect the expression of DISCUSSION stem cell markers in EN-MSCs by synthetic steroid hormones. We found that synthetic steroid hormones decreased the Danazol, progesterone, and MPA have been used to treat expression of CD29, CD44, CD90, CD105, and OCT-4, patients with endometriosis to attenuate symptoms and shrink whereas the expressions of stem cell markers were reversible at the resulting lesions. The steroid hormone is the key regulator 24 h following synthetic steroid hormones withdrawal in the endometriosis growth, and its use in the treatment of (Supplemental Fig. S2B). Therefore, we hypothesized that endometriosis is based on depressing the output of follicle- synthetic steroid hormones may regulate certain genes and then stimulating hormone, luteinizing hormone, or estrogen pro- modulate the characteristics of EN-MSCs. duced by the ovaries. Progesterone resistance is a hallmark of We also analyzed the effect of synthetic steroid hormones endometriosis, and endometriotic tissues are still considered on the cell cycle, and the results showed that synthetic steroid estrogen responsive. Differential expression of ESR1 and hormones induce G0/G1 arrest (Supplemental Figure S2A). PGRA/B in ovarian endometrioma is considered to reflect their Thus, the WST-8 assay was used to test whether the cell response to ovarian steroid action [35]. Although the in vitro

3 group compared with control group in EN-MSCs as assessed by RT-PCR (*P , 0.05). H) Western blot analysis was used to analyze NOTCH1 expression in miR-34a-5p inhibitor-transfected and synthetic steroid hormone treatment in EN-MSCs. Band intensity was quantified by ImageJ software. Each experiment was performed three times using different batches of cells.

7 Article 60 HSU ET AL. Downloaded from https://academic.oup.com/biolreprod/article/94/3/60, 1-10/2434415 by guest on 24 September 2021 Downloaded from www.biolreprod.org.

FIG. 4. Representative images of endometriosislike lesions. A) Endometriallike lesions in mice treated with vehicle control, danazol (4 mg/kg body weight), progesterone (5 mg/kg body weight), or MPA (2.5 mg/kg body weight), and 100 lg miR-34a-5p inhibitor or a control. B) Hematoxylin and eosin staining of endometriallike lesions. The upper panel is a high-magnification image from the square indicated in the lower panel. S, stroma; Epi: epithelium. Bars ¼ 200 lm. C and D) Quantification of miR-34a-5p, and Notch1 were measured by qPCR of endometriotic lesions from mice treated with danazol, progesterone, or MPA and miR-34a-5p inhibitor (*P , 0.05). condition does not reflect the complex in vivo condition, in this showed that miR-199a-5p helps to regulate endometriosis study, we present evidence that the synthetic steroid hormones progression in EN-MSCs [9]. However, the effects of synthetic affect ESR1 and PGRA/B expression. steroid hormones on miRNAs and their subsequent effects on The miRNAs within endometrial stem cells play important endometrial stem cells were unclear. Our present study reveals roles in endometriosis progression [2, 36]. We previously that the addition of specific synthetic steroid hormones can

TABLE 1. Gross morphologic analysis of endometriosislike lesions derived from syngeneic donor mice.

No. of endometriotic lesions Size of endometriotic lesions (mm2)b Total no. of No. of animals with Treatmenta animals used endometriotic lesions Total no. Mean 6 SD Range Mean 6 SD P valuec

Negative control Control 5 5 (100%) 15 3.0 6 0.71 13.57–139.86 54.08 6 43.62 Danazol 5 5 (100%) 10 2.0 6 0.71 6.00–57.28 22.99 6 17.88 0.044 Progesterone 5 4 (80%) 8 1.6 6 0.55 4.52–34.72 19.05 6 10.48 0.037 MPA 5 5 (100%) 9 1.8 6 1.10 4.15–29.73 10.59 6 8.06 0.007 miR-34a-5p inhibitor Control 5 5 (100%) 17 3.4 6 1.14 53.42–197.99 107.36 6 48.71 0.002 Danazol 5 5 (100%) 14 2.8 6 0.84 19.63–154.35 61.02 6 42.73 0.668 Progesterone 5 5 (100%) 13 2.6 6 0.55 19.41–124.32 50.44 6 30.13 0.802 MPA 5 5 (100%) 14 2.8 6 0.84 19.28–126.62 52.10 6 32.51 0.891 a MPA, medroxyprogesterone acetate. b The lesions were measured using a caliper as described in Materials and Methods. c P , 0.05 versus control (negative control) as determined by Tukey honestly significant difference test. 8 Article 60 ENDOMETRIOSIS-SPECIFIC miRNA MODULATION modulate miRNA levels in EN-MSCs, subsequently causing a Our results show a strong relationship between synthetic change in endometriotic tissue in an animal model. steroid hormonal action and subsequent downstream effects on Several studies have shown that specific miRNAs may miRNA levels in ovarian endometrioma. Further studies are regulate the inflammatory response, embryonic implantation necessary to understand the molecular mechanism related to [37], and differentiation [38]. Among these miRNAs, miR- the steroid hormone-based stimulation of miRNAs and the 199a-5p, miR-299a-3p, and miR-346 have been reported to be subsequent regulation of the signaling pathway in endometri- associated with inflammation; furthermore, miR-199a-5p was osis. reported to be related to [39–41]. In addition, several studies have shown that specific steroid hormones may REFERENCES regulate the inflammatory response [42, 43]. 1. Sampson JA. Metastatic or embolic endometriosis, due to the menstrual Pan et al. [44] and Dai et al. [45] have shown that miR- dissemination of endometrial tissue into the venous circulation. Am J 199a-5p is downregulated in ectopic endometrial tissue Pathol 1927; 3:93–110.

compared with normal controls. Several studies have also 2. Maruyama T, Yoshimura Y. Stem cell theory for the pathogenesis of Downloaded from https://academic.oup.com/biolreprod/article/94/3/60, 1-10/2434415 by guest on 24 September 2021 shown that miR-199a-5p targets multiple genes and modulates endometriosis. Front Biosci 2012; 4:2854–2863. tumor progression and cell invasion [39, 45]. In addition, we 3. Bulun SE. Endometriosis. N Engl J Med 2009; 360:268–279. have reported important aspects of miR-199a-5p function in 4. Gargett CE. Stem cells in gynaecology. Aust N Z J Obstet Gynaecol 2004; 44:380–386. endometriosis, including angiogenesis and cell motility [9]. In 5. Figueira PG, Abrao MS, Krikun G, Taylor HS. Stem cells in endometrium the present study, we focused on miR-34a-5p, which, by IPA, and their role in the pathogenesis of endometriosis. Ann N Y Acad Sci is predicted to function during the cell cycle, cell-to-cell 2011; 1221:10–17. signaling and interaction, cellular development, cellular 6. Gotte M, Wolf M, Staebler A, Buchweitz O, Kelsch R, Schuring AN, growth/ proliferation, and cell death/survival. Kiesel L. Increased expression of the adult stem cell marker Musashi-1 in MiR-34a is known as a tumor-suppressor miRNA. Several endometriosis and endometrial carcinoma. J Pathol 2008; 215:317–329. 7. Sasson IE, Taylor HS. Stem cells and the pathogenesis of endometriosis. studies have reported that miR-34a can target a variety of genes Ann N Y Acad Sci 2008; 1127:106–115. Downloaded from www.biolreprod.org. involved in tumor progression, such as C-MET, E2F, and 8. Kao AP, Wang KH, Chang CC, Lee JN, Long CY, Chen HS, Tsai CF, SNAIL, and is dysregulated in many cancer types, such as Hsieh TH, Tsai EM. Comparative study of human eutopic and ectopic glioblastoma, endometrial carcinoma, and ovarian cancer [22, endometrial mesenchymal stem cells and the development of an in vivo 46–49]. MiR-34a affects cell cycle arrest by downregulating endometriotic invasion model. Fertil Steril 2011; 95:1308–1315. E2F, CCND1, and CDK6 [50, 51]. It has been reported that 9. Hsu CY, Hsieh TH, Tsai CF, Tsai HP, Chen HS, Chang Y, Chuang HY, Lee JN, Hsu YL, Tsai EM. miRNA-199a-5p regulates VEGFA in miR-34a is associated with regulation of cancer stem cells endometrial mesenchymal stem cells and contributes to the pathogenesis function in various cancer types such as glioblastoma and of endometriosis. J Pathol 2014; 232:330–343. prostate cancer [52, 53]. Repression of C-KIT mediated by 10. Balasch J, Creus M, Fabregues F, Carmona F, Ordi J, Martinez-Roman S, miR-34a was associated with reduced chemoresistance, Vanrell JA. Visible and non-visible endometriosis at laparoscopy in fertile migration, and stemness in colon cancer [54]. Interestingly, and infertile women and in patients with chronic pelvic pain: a prospective study. Hum Reprod 1996; 11:387–391. one of the miR-34a target genes, namely NOTCH1, is a stem 11. Guo SW. Epigenetics of endometriosis. Mol Hum Reprod 2009; 15: cell-associated gene and important in cancer progression. It is 587–607. involved in the regulation of self-renewal, differentiation, and 12. Juo SH, Wu R, Lin CS, Wu MT, Lee JN, Tsai EM. A functional promoter survival of cancer stem cells [55, 56]. NOTCH1 reportedly is polymorphism in interleukin-10 gene influences susceptibility to endo- also downregulated by miR-34a, resulting in reduced cancer metriosis. Fertil Steril 2009; 92:1228–1233. stemness and chemoresistance in [34]. Addition- 13. Kim SH, Chun S, Jang JY, Chae HD, Kim CH, Kang BM. Increased plasma levels of esters in women with advanced-stage ally, aberrant stem cell function has been implicated in endometriosis: a prospective case-control study. Fertil Steril 2011; 95: endometriosis progression. Supplemental Figure S1 shows that 357–359. the synthetic steroid hormones affect the properties of stem 14. Beliard A, Noel A, Foidart JM. Reduction of apoptosis and proliferation in cells. Therefore, we speculate that synthetic steroid hormones endometriosis. Fertil Steril 2004; 82:80–85. may contribute to regulate stemness in endometriotic stem- 15. Harada T, Kaponis A, Iwabe T, Taniguchi F, Makrydimas G, Sofikitis N, progenitor cells through the miR-34a-NOTCH1 interaction in Paschopoulos M, Paraskevaidis E, Terakawa N. Apoptosis in human disordered endometrial cells. Moreover, miR-34a inhibits the endometrium and endometriosis. Hum Reprod Update 2004; 10:29–38. 0 16. Sharpe-Timms KL, Zimmer RL, Jolliff WJ, Wright JA, Nothnick WB, NOTCH1 level by binding the 3 untranslated region of its Curry TE. -releasing hormone (GnRH-a) therapy mRNA, thereby targeting the mRNA for degradation [22, 57]. alters activity of plasminogen activators, matrix metalloproteinases, and Although the in vitro condition does not reflect the complex in their inhibitors in rat models for adhesion formation and endometriosis: vivo situation, these results imply that miR-34a is hormonally potential GnRH-a-regulated mechanisms reducing adhesion formation. regulated in endometriosis, potentially influencing the expres- Fertil Steril 1998; 69:916–923. 17. Groothuis PG, Nap AW, Winterhager E, Grummer R. Vascular sion of genes targeted by miR-34a. development in endometriosis. Angiogenesis 2005; 8:147–156. In the present study, we demonstrate that specific synthetic 18. Bulun SE, Fang Z, Imir G, Gurates B, Tamura M, Yilmaz B, Langoi D, steroid hormones upregulate miR-34a-5p in endometriotic Amin S, Yang S, Deb S. and endometriosis. Semin Reprod cells. Further study is needed to identify the upstream regulator Med 2004; 22:45–50. of miR-34a-5p affected by the synthetic steroid hormones. In 19. Kokko E, Janne O, Kauppila A, Ronnberg L, Vihko R. Danazol has this study, we also show that danazol can upregulate miR- progestin-like actions on the human endometrium. Acta Endocrinol (Copenh) 1982; 99:588–593. 199a-5p level in EN-MSCs. Our previous study demonstrated 20. Vercellini P, Cortesi I, Crosignani PG. Progestins for symptomatic that SMAD4, which is a tumor suppressor gene, elevates the endometriosis: a critical analysis of the evidence. Fertil Steril 1997; 68: level of miR-199a-5p expression and inhibits proliferation and 393–401. angiogenesis in EN-MSCs [9]. Those findings point to the 21. Harrison RF, Barry-Kinsella C. Efficacy of medroxyprogesterone possibility that ectopic danazol might inhibit proliferation and treatment in infertile women with endometriosis: a prospective, random- angiogenesis in EN-MSCs and that the SMAD4-miR-199a-5p ized, placebo-controlled study. Fertil Steril 2000; 74:24–30. 22. Li Y, Guessous F, Zhang Y, Dipierro C, Kefas B, Johnson E, pathway may be the target of danazol action. It thus may be Marcinkiewicz L, Jiang J, Yang Y, Schmittgen TD, Lopes B, Schiff D, informative to investigate this potential mechanism related to et al. MicroRNA-34a inhibits glioblastoma growth by targeting multiple the steroid hormonal effects on miRNAs. oncogenes. Cancer Res 2009; 69:7569–7576. 9 Article 60 HSU ET AL.

23. Ninio-Many L, Grossman H, Shomron N, Chuderland D, Shalgi R. 41. Alsaleh G, Suffert G, Semaan N, Juncker T, Frenzel L, Gottenberg JE, microRNA-125a-3p reduces cell proliferation and migration by targeting Sibilia J, Pfeffer S, Wachsmann D. Bruton’s tyrosine kinase is involved in Fyn. J Cell Sci 2013; 126:2867–2876. miR-346-related regulation of IL-18 release by lipopolysaccharide- 24. Weng C, Dong H, Chen G, Zhai Y, Bai R, Hu H, Lu L, Xu Z. miR-409-3p activated rheumatoid fibroblast-like synoviocytes. J Immunol 2009; 182: inhibits HT1080 cell proliferation, vascularization and metastasis by 5088–5097. targeting angiogenin. Cancer Lett 2012; 323:171–179. 42. Yang JH, Chen MJ, Wu MY, Chen YC, Yang YS, Ho HN. Decreased 25. Jin J, Zhou S, Li C, Xu R, Zu L, You J, Zhang B. MiR-517a-3p accelerates suppression of interleukin-6 after treatment with medroxyprogesterone lung cancer cell proliferation and invasion through inhibiting FOXJ3 acetate and danazol in endometrial stromal cells of women with expression. Life Sci 2014; 108:48–53. . Fertil Steril 2006; 86:1459–1465. 26. Cao W, Yang W, Fan R, Li H, Jiang J, Geng M, Jin Y, Wu Y. miR-34a 43. Kim SH, Kim SR, Ihm HJ, Oh YS, Chae HD, Kim CH, Kang BM. regulates cisplatin-induce gastric cancer cell death by modulating PI3K/ Regulation of P21-activated kinase-4 by progesterone and tumor necrosis AKT/survivin pathway. Tumour Biol 2014; 35:1287–1295. factor-alpha in human endometrium and its increased expression in 27. Jiang L, Chang J, Zhang Q, Sun L, Qiu X. MicroRNA hsa-miR-125a-3p advanced-stage endometriosis. J Clin Endocrinol Metab 2013; 98: activates p53 and induces apoptosis in lung cancer cells. Cancer Invest E238–E248. 2013; 31:538–544. 44. Pan Q, Luo X, Toloubeydokhti T, Chegini N. The expression profile of Downloaded from https://academic.oup.com/biolreprod/article/94/3/60, 1-10/2434415 by guest on 24 September 2021 28. Jiang L, Huang Q, Zhang S, Zhang Q, Chang J, Qiu X, Wang E. Hsa-miR- micro-RNA in endometrium and endometriosis and the influence of 125a-3p and hsa-miR-125a-5p are downregulated in non-small cell lung ovarian steroids on their expression. Mol Hum Reprod 2007; 13: cancer and have inverse effects on invasion and migration of lung cancer 797–806. cells. BMC Cancer 2010; 10:318. 45. Dai L, Gu L, Di W. MiR-199a attenuates endometrial stromal cell 29. Elfimova N, Sievers E, Eischeid H, Kwiecinski M, Noetel A, Hunt H, invasiveness through suppression of the IKKbeta/NF-kappaB pathway and Becker D, Frommolt P, Quasdorff M, Steffen HM, Nurnberg P, Buttner R, reduced interleukin-8 expression. Mol Hum Reprod 2012; 18:136–145. et al. Control of mitogenic and motogenic pathways by miR-198, 46. Schirmer U, Doberstein K, Rupp AK, Bretz NP, Wuttig D, Kiefel H, diminishing hepatoma cell growth and migration. Biochim Biophys Acta Breunig C, Fiegl H, Muller-Holzner E, Zeillinger R, Schuster E, Zeimet 2013; 1833:1190–1198. AG, et al. Role of miR-34a as a suppressor of L1CAM in endometrial 30. Braza-Boils A, Mari-Alexandre J, Gilabert J, Sanchez-Izquierdo D, carcinoma. Oncotarget 2014; 5:462–472. Espana F, Estelles A, Gilabert-Estelles J. MicroRNA expression profile 47. Corney DC, Hwang CI, Matoso A, Vogt M, Flesken-Nikitin A, Godwin in endometriosis: its relation to angiogenesis and fibrinolytic factors. Hum AK, Kamat AA, Sood AK, Ellenson LH, Hermeking H, Nikitin AY. Downloaded from www.biolreprod.org. Reprod 2014; 29:978–988. Frequent downregulation of miR-34 family in human ovarian cancers. Clin 31. Hu Z, Shen WJ, Cortez Y, Tang X, Liu LF, Kraemer FB, Azhar S. Cancer Res 2010; 16:1119–1128. Hormonal regulation of microRNA expression in steroid producing cells 48. Menges CW, Kadariya Y, Altomare D, Talarchek J, Neumann-Domer E, of the , testis and . PLoS One 2013; 8:e78040. Wu Y, Xiao GH, Shapiro IM, Kolev VN, Pachter JA, Klein-Szanto AJ, 32. Somigliana E, Vigano P, Rossi G, Carinelli S, Vignali M, Panina- Testa JR. Tumor suppressor alterations cooperate to drive aggressive Bordignon P. Endometrial ability to implant in ectopic sites can be mesotheliomas with enriched cancer stem cells via a p53-miR-34a-c-Met prevented by interleukin-12 in a murine model of endometriosis. Hum axis. Cancer Res 2014; 74:1261–1271. Reprod 1999; 14:2944–2950. 49. Siemens H, Jackstadt R, Hunten S, Kaller M, Menssen A, Gotz U, 33. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA Hermeking H. miR-34 and SNAIL form a double-negative feedback loop targets. Cell 2005; 120:15–20. to regulate epithelial-mesenchymal transitions. Cell Cycle 2011; 10: 34. Park EY, Chang E, Lee EJ, Lee HW, Kang HG, Chun KH, Woo Y, Kong 4256–4271. H, Ko JY, Suzuki H, Song E, Park JH. Targeting of miR-34a-NOTCH1 50. Sun F, Fu H, Liu Q, Tie Y, Zhu J, Xing R, Sun Z, Zheng X. axis reduced breast cancer stemness and chemoresistance. Cancer Res Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle 2014; 74:7573–7582. arrest. FEBS Lett 2008; 582:1564–1568. 35. Bulun SE, Cheng YH, Yin P, Imir G, Utsunomiya H, Attar E, Innes J, 51. Tazawa H, Tsuchiya N, Izumiya M, Nakagama H. Tumor-suppressive Julie Kim J. Progesterone resistance in endometriosis: link to failure to miR-34a induces senescence-like growth arrest through modulation of the metabolize estradiol. Mol Cell Endocrinol 2006; 248:94–103. E2F pathway in human colon cancer cells. Proc Natl Acad Sci U S A 36. Teague EM, Print CG, Hull ML. The role of microRNAs in endometriosis 2007; 104:15472–15477. and associated reproductive conditions. Hum Reprod Update 2010; 16: 52. Liu C, Kelnar K, Liu B, Chen X, Calhoun-Davis T, Li H, Patrawala L, 142–165. Yan H, Jeter C, Honorio S, Wiggins JF, Bader AG, et al. The microRNA 37. Xia HF, Jin XH, Song PP, Cui Y, Liu CM, Ma X. Temporal and spatial miR-34a inhibits prostate cancer stem cells and metastasis by directly regulation of miR-320 in the uterus during embryo implantation in the rat. repressing CD44. Nat Med 2011; 17:211–215. Int J Mol Sci 2010; 11:719–730. 53. Guessous F, Zhang Y, Kofman A, Catania A, Li Y, Schiff D, Purow B, 38. Tsuno S, Wang X, Shomori K, Hasegawa J, Miura N. Hsa-miR-520d Abounader R. microRNA-34a is tumor suppressive in brain tumors and induces hepatoma cells to form normal tissues via a stemness- glioma stem cells. Cell Cycle 2010; 9:1031–1036. mediated process. Sci Rep 2014; 4:3852. 54. Siemens H, Jackstadt R, Kaller M, Hermeking H. Repression of c-Kit by 39. Chen R, Alvero AB, Silasi DA, Kelly MG, Fest S, Visintin I, Leiser A, p53 is mediated by miR-34 and is associated with reduced chemoresis- Schwartz PE, Rutherford T, Mor G. Regulation of IKKbeta by miR-199a tance, migration and stemness. Oncotarget 2013; 4:1399–1415. affects NF-kappaB activity in ovarian cancer cells. Oncogene 2008; 27: 55. Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells, cancer, and 4712–4723. cancer stem cells. Nature 2001; 414:105–111. 40. Yeruva L, Myers GS, Spencer N, Creasy HH, Adams NE, Maurelli AT, 56. DeSano JT, Xu L. MicroRNA regulation of cancer stem cells and McChesney GR, Cleves MA, Ravel J, Bowlin A, Rank RG. Early therapeutic implications. AAPS J 2009; 11:682–692. microRNA expression profile as a prognostic biomarker for the 57. Li WB, Ma MW, Dong LJ, Wang F, Chen LX, Li XR. MicroRNA-34a development of pelvic inflammatory disease in a mouse model of targets notch1 and inhibits cell proliferation in glioblastoma multiforme. chlamydial genital infection. MBIo 2014; 5:e01241–14. Cancer Biol Ther 2011; 12:477–483.

10 Article 60