Disruption of the Anaphase-Promoting Complex Confers Resistance to TTK Inhibitors in Triple-Negative Breast Cancer

Home , ANAPC1, ANAPC10, ANAPC2, ANAPC4, ANAPC5, ANAPC7

Disruption of the anaphase-promoting complex confers resistance to TTK inhibitors in triple-negative breast cancer

K. L. Thua,b, J. Silvestera,b, M. J. Elliotta,b, W. Ba-alawib,c, M. H. Duncana,b, A. C. Eliaa,b, A. S. Merb, P. Smirnovb,c, Z. Safikhanib, B. Haibe-Kainsb,c,d,e, T. W. Maka,b,c,1, and D. W. Cescona,b,f,1

aCampbell Family Institute for Breast Cancer Research, Princess Margaret Cancer Centre, University Health Network, Toronto, ON, Canada M5G 1L7; bPrincess Margaret Cancer Centre, University Health Network, Toronto, ON, Canada M5G 1L7; cDepartment of Medical Biophysics, University of Toronto, Toronto, ON, Canada M5G 1L7; dDepartment of Computer Science, University of Toronto, Toronto, ON, Canada M5G 1L7; eOntario Institute for Cancer Research, Toronto, ON, Canada M5G 0A3; and fDepartment of Medicine, University of Toronto, Toronto, ON, Canada M5G 1L7

Contributed by T. W. Mak, December 27, 2017 (sent for review November 9, 2017; reviewed by Mark E. Burkard and Sabine Elowe) TTK protein kinase (TTK), also known as Monopolar spindle 1 (MPS1), ator of the spindle assembly checkpoint (SAC), which delays is a key regulator of the spindle assembly checkpoint (SAC), which anaphase until all chromosomes are properly attached to the functions to maintain genomic integrity. TTK has emerged as a mitotic spindle, TTK has an integral role in maintaining genomic promising therapeutic target in human cancers, including triple- integrity (6). Because most cancer cells are aneuploid, they are negative breast cancer (TNBC). Several TTK inhibitors (TTKis) are heavily reliant on the SAC to adequately segregate their abnormal being evaluated in clinical trials, and an understanding of karyotypes during mitosis. This is evidenced by the fact that the the mechanisms mediating TTKi sensitivity and resistance could inform SAC is often weakened but rarely completely inactivated in cancer the successful development of this class of agents. We evaluated the cells (7–9). Abrogation of the SAC by TTK inhibition results in cellular effects of the potent clinical TTKi CFI-402257 in TNBC models. intolerable levels of genomic instability that are incompatible with CFI-402257 induced apoptosis and potentiated aneuploidy in TNBC cancer cell survival (10, 11). With several TTK inhibitors (TTKis) lines by accelerating progression through mitosis and inducing mitotic currently being evaluated as anticancer therapeutics in clinical segregation errors. We used genome-wide CRISPR/Cas9 screens in trials, a more complete understanding of the mechanisms medi- multiple TNBC cell lines to identify mechanisms of resistance to CFI- ating TTKi sensitivity and resistance could have a significant im- 402257. Our functional genomic screens identified members of the pact by guiding their successful clinical development. anaphase-promoting complex/cyclosome (APC/C) complex, which In this study, we aimed to identify cellular mechanisms of promotes mitotic progression following inactivation of the SAC. resistance to the clinical TTKi CFI-402257. Importantly, we in- Several screen candidates were validated to confer resistance to CFI- vestigated this question in biologically relevant, aneuploid TNBC 402257 and other TTKis using CRISPR/Cas9 and siRNA methods. These cell lines that model one of the principal human malignancies findings extend the observation that impairment of the APC/C enables for which CFI-402257 is being developed. Using genome-wide cells to tolerate genomic instability caused by SAC inactivation, and CRISPR/Cas9 enrichment screens in three TNBC models, we support the notion that a measure of APC/C function could predict found that genetic disruption of anaphase-promoting complex/ the response to TTK inhibition. Indeed, an APC/C gene expression cyclosome (APC/C) components or other genes involved in mitotic signature is significantly associated with CFI-402257 response in breast andlungadenocarcinomacelllinepanels. This expression signature, Significance along with somatic alterations in genes involved in mitotic progression, represent potential biomarkers that could be evaluated in ongoing clinical trials of CFI-402257 or other TTKis. Using functional genomic screens, we have identified resistance mechanisms to the clinical TTK protein kinase inhibitor (TTKi) CFI-402257 in breast cancer. As this and other TTKi are currently TTK inhibitor | drug resistance | APC/C | CRISPR/Cas9 | breast cancer in clinical trials, understanding determinants of tumor drug response could permit rational selection of patients for treatment. riple-negative breast cancer (TNBC), characterized by lack of We found that TTKi resistance is conferred by impairing Texpression of estrogen and progesterone receptors or am- anaphase-promoting complex/cyclosome (APC/C) function to plification of HER2, is recognized as an aggressive disease with minimize the lethal effects of mitotic segregation errors. Dis- poor outcomes and short survival in the metastatic setting. While covery of this mechanism in aneuploid cancer cells builds on TNBC is a heterogeneous disease, the majority exhibit high levels previous reports indicating that weakening the APC/C pro- of aneuploidy and a dearth of actionable genetic alterations (e.g., motes tolerance of chromosomal instability in diploid cells. Our focal DNA amplifications or activating point mutations that can work suggests that APC/C functional capacity may serve as a be targeted) (1–3). The latter explains in part the current lack clinically useful biomarker of tumor response to TTKi that of targeted treatment options for this disease, and underscores warrants investigation in ongoing clinical trials. the need for novel treatment strategies. The recurrent somatic changes that occur in TNBC include nearly ubiquitous TP53 Author contributions: K.L.T., J.S., M.J.E., W.B.-a., B.H.-K., T.W.M., and D.W.C. designed mutations, as well as genetic alterations to other tumor sup- research; K.L.T., J.S., M.J.E., W.B.-a., M.H.D., and A.S.M. performed research; A.S.M., P.S., PTEN RB1 BRCA1 and Z.S. contributed new reagents/analytic tools; K.L.T., J.S., M.J.E., W.B.-a., M.H.D., pressors including , , and components of the A.C.E., B.H.-K., T.W.M., and D.W.C. analyzed data; and K.L.T., W.B.-a., B.H.-K., T.W.M., DNA damage response pathway (1). The loss of these critical and D.W.C. wrote the paper. regulators of the cell cycle and genome maintenance contribute Reviewers: M.E.B., University of Wisconsin; and S.E., Université Laval. to the genomic instability characteristic of TNBC, a hallmark The authors declare no conflict of interest. that represents a potential therapeutic vulnerability (4, 5). Published under the PNAS license. Inhibition of TTK protein kinase (TTK), also known as 1 To whom correspondence may be addressed. Email: [email protected] or dave. monopolar spindle 1 (MPS1), has emerged as a promising [email protected]. therapeutic strategy for the treatment of aneuploid tumors, with This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. TNBCs an important focus of clinical development. As a medi- 1073/pnas.1719577115/-/DCSupplemental.

E1570–E1577 | PNAS | Published online January 29, 2018 www.pnas.org/cgi/doi/10.1073/pnas.1719577115 Downloaded by guest on September 25, 2021 PNAS PLUS progression confers resistance to CFI-402257 and other TTKis. Our A 132-BM-ADM MDA-MB-436 864-BM-ADM work independently validates and extends findings from a previous 120 *** 120 *** 120 *** study reporting that APC/C dysfunction promotes diploid cell tol- 100 100 100 (min) erability of genomic instability induced by reversine, a chemical 80 80 80 probe that inhibits TTK (12). Furthermore, we report an APC/C ase gene expression signature that is associated with response to CFI- 60 60 60 402257 in breast and lung cancer cell line panels. This genetic sig- 40 40 40 nature represents a promising biomarker for further development 20 20 20 NEBD - Anaph - NEBD NEBD - Anaphase (min) Anaphase - NEBD NEBD - Anaphase (min) Anaphase - NEBD and evaluation in ongoing clinical trials, where its application in 0 0 0 evaluating APC/C function could inform patient selection or predict DMSO CFI-402257 DMSO CFI-402257 DMSO CFI-402257 150nM 150nM 150nM drug response to clinical TTKis. MDA-MB-231 MDA-MB-436 MDA-MB-468 B ER MP LC AB N Results ** ** *** 100 CFI-402257 Accelerates Mitosis and Induces Mitotic Segregation 100 100 Errors and Apoptosis in TNBC. To study the cellular effects of 80 80 80 CFI-402257 in TNBC, we selected three commonly used cell 60 60 60 line models: MDA-MB-231, MDA-MB-468, and MDA-MB-436. Each line is reportedly aneuploid and contains a TP53 mutation 40 40 40 % of Mitoses % of Mitoses % of Mitoses (13), characteristic of clinical TNBC. The SAC functions to 20 20 20 prevent anaphase onset until all chromosomes are sufficiently 0 0 0 attached to the mitotic spindle, thereby ensuring proper chro- DMSO CFI-402257 DMSO CFI-402257 DMSO CFI-402257 mosome segregation during mitosis (6). TTK inhibition causes 150nM 150nM 150nM SAC inactivation and premature onset of anaphase with im- C DMSO 100nM 400nM properly segregated chromosomes. To assess the effects of TTK MDA-MB-231 MDA-MB-436 MDA-MB-468 100 100 100 inhibition on mitotic timing, live-cell microscopy was used to 0.33 4.41 1.39 80 1.28 80 8.52 80 3.36 measure the time from nuclear envelope breakdown (NEBD) to 18.6 43.1 49.7 onset of anaphase. CFI-402257 treatment (150 nM) significantly 60 60 60 reduced mitotic timing by twofold to threefold in all three cell 40 40 40 A lines (Fig. 1 ). As expected, scoring of mitotic cells identified 20 20 20 significantly more mitotic errors (e.g., lagging chromosomes, Mode To Normalized 0 0 0 anaphase bridges, and multipolar divisions) in CFI-402257– 103 104 103 104 103 104 treated compared with DMSO control-treated cells (Fig. 1B Propidium Iodide Propidium Iodide Propidium Iodide and Fig. S1). We next assessed whether treatment with CFI- D AnV+PI- Anv+PI+ 402257 potentiated aneuploidy using propidium iodide (PI) MDA-MB-231 MDA-MB-436 MDA-MB-468 ** ** * staining to measure DNA content. While 72 h of low-dose CFI- 50 ** 50 * 50 *** 402257 (100 nM) had a modest effect on DNA content, a higher 40 40 40 dose (400 nM) reproducibly increased the fraction of cells 30 30 30 with >4n content in all three lines (Fig. 1C). Finally, we de- 20 20 20 termined that aneuploidy induced by 72 h of treatment was as- 10 10 10 sociated with induction of apoptosis (Fig. 1D). Taken together, of Cells Percentage 0 0 0 these cellular effects in TNBC are consistent with TTK inhibition- DMSO 100nM 400nM DMSO 100nM 400nM DMSO 100nM 400nM driven abrogation of the SAC, which accelerates mitotic progression Fig. 1. CFI-402257 induces mitotic errors and leads to cell death. (A)Live-cell and induces mitotic errors, aneuploidy, and apoptosis, consistent imaging was used to measure mitotic timing. Cells were synchronized with with reports for other TTKis (12, 14–17). double-thymidine block and released into DMSO or CFI-402257 for at least 4 h before time-lapse imaging. Each dot represents a single cell, and at least Genome-Wide CRISPR/Cas9 Screen Reveals APC/C Impairment Confers 100 cells were counted per experiment. (B) Classification of mitoses in treated Resistance to CFI-402257. To understand mediators of CFI- cells. Mitoses observed were scored as normal (N) or as abnormal if 402257 response, we used a functional genomics approach. Stable they exhibited segregation errors, including lagging chromosomes (LC), endoreduplication (ER), anaphase bridges (AB), or multipolar divisions (MP). Cas9-expressing lines were generated for each model and used to (C) DNA content analysis of treated cells. Cells were synchronized as above and conduct genome-wide CRISPR screens with the Toronto Human released into DMSO or CFI-402257 for 72 h. Live cells were stained with PI and Knockout Pooled Library (18). We used a positive enrichment analyzed by flow cytometry. (Inset) Numbers indicate the percentage of cells approach to select gene knockouts that confer resistance to CFI- exhibiting >4n DNA content. (D) Assessment of apoptosis induction by CFI- 402257. Cells were continuously cultured in media containing 402257. Cells were collected and costained with Annexin-V and PI to de- CFI-402257 or DMSO vehicle control. Three different concen- termine the percentage of cells undergoing apoptosis after 72 h of treatment. P trations of CFI-402257 were attempted for each cell line. Of the values indicate significance for two-tailed Student’s t tests (mitotic timing and 2 nine screens attempted, six were successful, as evidenced by the apoptosis) and χ tests (mitotic errors, normal vs. abnormal). All statistics were < < < emergence of a drug-resistant cell population (one in MDA-MB- calculated using GraphPad Prism software. *P 0.05; **P 0.01; ***P 0.001; ns, not significant. Error bars indicate mean ± SD. 468, two in MDA-MB-436, and three in MDA-MB-231), and three were unsuccessful (i.e., no drug resistant cell population emerged because drug concentrations were too high). Screens algorithm to identify sgRNAs significantly enriched in the resistant were ended once a drug-resistant population had clearly emerged population (19). Comparison of the CRISPR library representation following the initial lagging period where CFI-402257 impaired survival and proliferation of the pooled cells (Fig. 2A). Impor- at the beginning and end of the screens indicated that represen- – tantly, cells transduced with an sgRNA targeting LacZ were cul- tation was reduced in the final CFI-402257 resistant population, as tured with CFI-402257 in parallel to ensure that cell death expected (Fig. S2A). occurred at the concentrations used for the screens. Targeted Single guide RNAs enriched in the final drug-resistant pop- sequencing of sgRNA inserts in baseline, DMSO-treated, and ulation are those that target genes whose inactivation promotes drug-resistant cell populations were evaluated using the MAGeCK resistance to CFI-402257. To identify the most robust candidates, MEDICAL SCIENCES

Thu et al. PNAS | Published online January 29, 2018 | E1571 Downloaded by guest on September 25, 2021 A genes led to increased TNBC resistance to TTK inhibition (Fig. MDA-MB-231 30 MDA-MB-436 A–C 30 DMSO DMSO 3 ). Furthermore, we found that resistance conferred by 65nM 65nM knockdown of these genes was associated with reduced apoptosis, 80nM 100nM 20 95nM 20 dampened aneuploidy induction, and elongated mitotic timing with CFI-402257 treatment in MDA-MB-231 cells (Fig. 3 D–I). Despite 10 10 the high rate of mitotic errors in basal conditions (Fig. 1), we found Cell Doublings Cell Doublings an increase in the number of normal mitoses when knockdown 0 0 cells were treated with CFI-402257 (Fig. 3 G–I). Similar effects 0 4 8 1216202428323640 0204060 Screen Day Screen Day were observed in MDA-MB-436 cells (Fig. S3). MDA-MB-468 B Go Cellular Component: Enrichr Combined Score We next asked whether genetic manipulation of ANAPC4, 30 DMSO 0 51015 110nM anaphase-promoting complex ANAPC13,andMAD2L1BP affected sensitivity to additional pub- peroxisome P2 peroxisome 20 P2 peroxisome lished selective TTKis, including MPI-0479605 (17), NMS-P715 P5 peroxisome P1 peroxisome (23) and Mps-Bay2a (15). Compared with CFI-402257, these peroxisomal part 10 P4 peroxisome exhibited similar effects on TNBC viability in sulforhodamine B mannosome –

Cell Doublings P3 peroxisome (SRB) dose response assays, although their potency was lower glyoxysome A 0 glycosome (Fig. 4 ). Consistent with our results for CFI-402257, CRISPR/Cas9 0 4 8 121620242832mitochondrial outer membrane ANAPC4 ANAPC13 Screen Day andsiRNA-mediatedknockdownof , ,and MAD2L1BP also conferred resistance to these TTKis, although with Fig. 2. CRISPR/Cas9 screens identify the anaphase-promoting complex as a variable penetrance across cell lines and the genes manipulated at mediator of CFI-402257 sensitivity. (A) Screen growth curves for MDA-MB- the concentrations tested (Fig. 4 B and C and Fig. S4). 231, MDA-MB-436, and MDA-MB-468 during CFI-402257 induced selection of drug-resistant cells. (B) Gene Ontology analyses conducted using Enrichr Response to CFI-402257 Is Associated with Reduced APC/C Gene reveal that genes identified by the CFI-402257 resistance screens are enriched for involvement in the anaphase-promoting complex. Expression Signature in Breast and Lung Cancer Cell Lines. Finally, we sought to investigate whether the biological mechanism revealed by our functional genomics screens could be useful to we trimmed each screen’s list of candidate genes to only those with identify a biomarker correlate of intrinsic CFI-402257 response. an enrichment P value < 0.05, and then compared these lists across Drug response profiles were generated for a panel of 52 breast the six screens. This stringent analysis revealed 15 genes that were cancer cell lines for which gene expression profiles were avail- significantly enriched in at least one screen per cell line and in at able (Fig. 5A and Table S4). We hypothesized that cancers with least four of the six screens conducted (Table 1 and Fig. S2B). low expression of APC/C components or MAD2L1BP would be Assessment of these candidates using Enrichr analysis identified relatively resistant to CFI-402257. To test this, we evaluated the the APC/C as the most significantly enriched cellular component association between a gene set comprising 16 APC/C genes and for two different Gene Ontology databases (GO and Jensen) (20, 21) MAD2L1BP (Fig. 5B), and CFI-402257 response using gene set (Fig. 2B and Table S1). ANAPC13 and ANAPC15 are both compo- enrichment analysis (GSEA) (24). We found that the APC/C- nents of the APC/C itself, while MAD2L1BP, better known as MAD2L1BP gene set was significantly associated with the in vitro p31(comet), is a negative regulator of the SAC through its antago- response to CFI-402257 (Fig. 5C). Interestingly, among breast nism of the mitotic checkpoint complex (22). In light of the identifi- cancer subtypes, the APC/C-MAD2L1BP gene set association cation of APC/C components in our top hits, we examined the sgRNA with CFI-402257 response was most significant in TNBC models lists and identified other APC/C components in individual cell lines, (Fig. 5D). Assessment of the gene set in an independent panel of including ANAPC4, ANAPC5, CDC16, CDC20,andCDC23 in 20 lung adenocarcinoma cell lines confirmed the association MDA-MB-468; ANAPC4, CDC20,andCDC16 in MDA-MB-436; (Fig. S5A). We then evaluated an APC/C-MAD2L1BP gene and ANAPC5, ANAPC10,andCDC27 in MDA-MB-231. Taken to- signature defined as the mean expression of the 16 APC/C genes gether, our functional genomics approach revealed numerous com- and MAD2L1BP (Fig. 5B), and found a significant association ponents of the complex responsible for anaphase initiation following between this metagene and CFI-402257 response in breast can- SAC inactivation, implicating a delay in anaphase onset and mitotic cer cell lines (Fig. S5B). Furthermore, of the 17 genes composing progression as a mechanism mediating resistance to CFI-402257, the APC/C-MAD2L1BP gene set, we found that a metagene and thus a potentially important determinant of drug response.

Inactivation of ANAPC4, ANAPC13, and MAD2L1BP Confers Resistance Table 1. Top 15 candidate genes from CRISPR/Cas9 screens to Multiple TTKis. We chose to further investigate the mitotic Gene Number of screens checkpoint complex antagonist MAD2L1BP and the APC/C component ANAPC13 identified in our CFI-402257 screen as ANAPC13 6 mediators of TTKi resistance. We also investigated ANAPC4, ANKS1A 5 which was previously described to be involved in diploid cell ETS1 5 tolerance of chromosomal instability in an siRNA screen (Table LRTM1 5 MAD2L1BP S2) (12). To confirm that these candidate genes enable TNBC 5 resistance to CFI-402257, we disrupted them using CRISPR/ PLA2G16 5 ANAPC15 Cas9 editing with sgRNAs identified in our screens and with 4 siRNA as an orthogonal method. Knockdowns and genome edits BID 4 were confirmed by quantitative PCR (qPCR), Western blot CMIP 4 analysis (when sufficient antibodies were available), or se- ENPP5 4 quencing (Fig. 3, Figs. S3 and S4, and Table S3). Following GPSM3 4 CRISPR editing or siRNA knockdown, we conducted colony KCNH8 4 LACE1 4 survival assays to determine the effects of gene manipulation on SERPINA7 4 sensitivity to CFI-402257. Both of these methods confirmed that VSIG1 4 ANAPC4, ANAPC13, and MAD2L1BP mediate CFI-402257 response in MDA-MB-231 cells, as genetic interference with these Bold indicates candidate genes validated in this study.

E1572 | www.pnas.org/cgi/doi/10.1073/pnas.1719577115 Thu et al. Downloaded by guest on September 25, 2021 ns PNAS PLUS siNTC ABCFI-402257 CD ** DMSO 100nM 200nM siNTC siGene 40 siANAPC4 *** 1.5 DMSO 1.0 ANAPC4 siANAPC13 siNTC 100nM siMAD2L1BP 30 MAD2L1BP *** siANAPC4 1.0 *** 20 *** 0.5 VINC siANAPC13

0.5 % AnV+PI+ 10

siMAD2L1BP siNTC Relative Expression

Proportion of Control 0.0 0.0 0 siANAPC4siANAPC13 4 siMAD2L1BP DMSO 100nM 400nM TC N 1BP si L1BP ANAPC4 ANAPC si ANAPC13 siANAPC13 MAD2 ns DMSO 100nM 400nM siMAD2L EF** ** siNTC 100 siNTC siANAPC4 siANAPC13 siMAD2L1BP 50 siANAPC4 80 siANAPC13 40 siMAD2L1BP 60 30 40 * 20 * ** 20 > 4N % of Cells 10

Normalized To Mode To Normalized 0 3 4 3 4 3 4 3 4 0 10 10 10 10 10 10 10 10 DMSO 100nM 400nM Propidium Iodide Propidium Iodide Propidium Iodide Propidium Iodide GH I *** *** *** ** ER MP LC AB N *** ER MP LC AB N *** ER MP LC AB N 250 *** 250 ** 250 *** *** ns ns 200 100 200 *** 100 200 *** 100 * 150 80 150 80 150 80 60 60 60 100 100 100 40 40 40 50 20 50 20 50 20 % of Mitoses % of Mitoses % of Mitoses 0 0 0 0 0 0 NEBD - Anaphase (min) NEBD - NEBD - Anaphase (min) NEBD - NEBD - Anaphase (min) NEBD - siNTC siANAPC4 siNTC siANAPC13 siNTC siMAD2L1BP CFI-402257 150nM CFI-402257 150nM CFI-402257 150nM DMSO 150nM DMSO 150nM DMSO 150nM DMSO 150nM DMSO 150nM DMSO 150nM siNTC siANAPC4 siNTC siANAPC13 siNTC siMAD2L1BP

Fig. 3. Inhibition of genes regulating mitotic progression promotes resistance of MDA-MB-231 to CFI-402257. (A) Colony survival assay for MDA-MB-231 cells transfected with siRNAs targeting ANAPC4, ANAPC13,andMAD2L1BP and treated with DMSO or CFI-402257. Colonies surviving 10–14 d of treatment were stained with SRB, solubilized, and quantified by spectrophotometry. Survival is illustrated as the proportion of drug-treated colonies relative to DMSO-treated (control) colonies. Dotted lines indicate colony growth in siNTC control cells. A representative assay is shown. (B and C) siRNA knockdown efficiencies were determined by qRT-PCR [error bars indicate maximum/minimum relative quantification (RQ) values] and Western blot analysis. (D) Quantitation of apoptosis induction in siRNA-transfected cells treated with DMSO or CFI-402257 for 72 h. (E and F) DNA content analysis of siRNA-transfected cells treated with DMSO or CFI-402257 at 100 nM or 400 nM doses for 72 h. (G–I) Mitotic timing and error analysis of siRNA-transfected cells treated with 150 nM CFI-402257. Error bars indicate mean ± SD. P values indicate significance for two-tailed Student’s t tests (apoptosis, DNA content, and mitotic timing) or χ2 tests (mitotic errors, normal vs. abnormal). All statistics were calculated using GraphPad Prism software. *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant. Error bars indicate mean ± SD.

consisting of only ANAPC4 and CDC20 was most strongly as- NCT02792465, NCT02138812, NCT02366949; EudraCT no. sociated with CFI-402257 response (Fig. 5E). 2014–002023-10) (25) as monotherapy or in combination with To address the potential utility of the APC/C metagene as a taxane chemotherapy. For several of the agents under investigation, clinical correlate of CFI-402257 response, we investigated the var- breast cancer (and TNBC in particular) is a primary indication of iability in the two-gene metagene score across various tumor types interest. Patient stratification is becoming increasingly important for using public gene expression data from The Cancer Genome Atlas the development of novel therapies, in order to improve the (TCGA). This showed substantial variability within breast and other probability of success in the clinic. This effort can benefit signifi- tumors, and importantly, revealed numerous outliers with very low cantly from an understanding of mechanisms of sensitivity and re- scores that could represent tumors with intrinsic resistance to CFI- sistance characterized in nonclinical settings (26). Previous reports 402257 (Fig. 5F). The variation we observed in APC/C metagene have identified gatekeeper mutations in the TTK kinase domain scores prompted us to assess the frequency of APC/C complex as potential mechanisms of acquired resistance to TTKi (anal- genetic disruption in clinical tumors. A previous study reported that ogous to those observed in many clinically approved kinase in- point mutations in APC/C complex components occur in up to 23% hibitors) (27), or have suggested somatic mutations and alterations of nearly 8,000 tumors in the TCGA pan-cancer dataset (12). Our associated with response (28), but the relevance of these to in- focusedanalysisofTCGAbreastcancers considering somatic DNA trinsic TNBC response are uncertain. alterations with potential loss of function consequences (i.e., point Our approach, using functional genomic screens followed mutations and homozygous deletions) identified these in 4% of by validation and correlative analyses in TNBC models, was primary tumors (17/482), while down-regulation of gene expression designed to identify biologically relevant processes or pathways was apparent in 46% of cases (222/482) (Fig. S6). Thus, clinical that could be linked to drug response for the clinical TTKi CFI- cancers exhibit measurable differences in markers of APC/C func- 402257. The identification of the APC/C as a central complex tion, which are predicted to be associated with TTKi response mediating sensitivity to CFI-402257 is directly relevant to the based on our functional and correlative studies. rationale for TTK inhibition in TNBC, whereby the characteristic genomic instability of these tumors was identified as a Discussion therapeutic vulnerability that can be exploited by TTK-targeting Several TTKis, including CFI-402257, are currently being tested agents (11). Inhibition of TTK in these tumors will cause synthetic in early-phase clinical trials to characterize their safety and lethality by abrogating the SAC and consequently increase aneuploidy explore their antitumor activity as cancer therapeutics (e.g., to intolerable levels that lead to cancer cell death (29). MEDICAL SCIENCES

Thu et al. PNAS | Published online January 29, 2018 | E1573 Downloaded by guest on September 25, 2021 Fig. 4. Delaying anaphase confers resistance to multiple TTKis. (A) Response of MDA-MB-231, MDA-MB-436, and MDA-MB-468 to various TTKis. Dose–response curves were generated using SRB assays with nine-point serial drug dilutions. For each drug dose, cell viability is plotted as the proportion of viability observed in DMSO-treated control cells. Curves were plotted with GraphPad Prism software, with error bars indicating SD. (B) Colony survival assays for MDA-MB-231 cells transfected with siRNAs targeting ANAPC4, ANAPC13,andMAD2L1BP.(C) Quantitation of colony survival assays after solubilizing SRB. Colony survival is plotted as the proportion of drug-treated colonies relative to DMSO-treated (control) colonies. Error bars indicate mean ± SD. Dotted lines indicate colony growth in siNTC control cells. Representative experiments are shown.

Our study carried out in TNBC cell lines has revealed multiple anaphase or mitotic exit: MAD2L1BP/p31(comet), DYNC1LI1, components of the APC/C, which promotes mitotic progression DYNC1LI2, TRIP13,andRNF8 (30–34). Importantly, siRNA into anaphase, as well as additional genes involved in initiating knockdown of ANAPC15 and MAD2L1BP, two of the top candi- mitotic exit. These models harbor TP53 mutations and exhibit dates identified in our screens, have been shown to delay mitotic aneuploidy, characteristic features of clinical TNBCs, supporting progression in HeLa and RPE1 cells (35–37) providing mechanistic the clinical relevance of our findings. Another group has recently insight for their association with TTKi resistance and corroborating reported their investigation of diploid cell tolerance to chro- our mechanistic studies. The shared finding of the APC/C as a mosomal instability using reversine, a chemical probe that in- central mediator of resistance to TTK inhibition, despite the dif- hibits TTK, to model this phenomenon (12). Sansregret et al. ferences in approach and cellular contexts, lends strong support to conducted a 4-day siRNA screen in immortalized nonmalignant, the biological importance of these discoveries. diploid retinal-pigment epithelial (RPE1) cells, and validated Also relevant to our findings, Wild et al. (14) studied the candidate genes in RPE1 and HCT116, a near-diploid colon impact of deletion of the E2 ubiquitin-conjugating enzymes, cancer cell line. These authors reported that APC/C dysfunction UBE2C and UBE2S, on APC/C function in HCT116 cells. These enables these cells to tolerate excessive chromosomal instability E2s are used by the APC/C to ubiquitinate mitotic proteins, in- induced by reversine treatment (12). Interestingly, this siRNA- cluding CCNB1 and securin, whose degradation is required for screen identified both overlapping and nonoverlapping candi- mitotic exit (22). Concordant with our findings, Wild et al. (14) dates compared with our screen. Among other factors, this may showed that UBE2C and UBE2S deletion weakened APC/C reflect the differing ploidy states or genetic backgrounds of the function and elongated NEBD to anaphase time, rendering cells models studied or the use of CRISPR/Cas9 vs. siRNA systems insensitive to reversine or deletion of the spindle assembly (Table S3). For instance, TP53 was identified in the Sansregret checkpoint gene, MAD2. Collectively, these data support the screen, but not in our screen, where the TNBC models already hypothesis that prolonging anaphase onset provides time for harbor TP53 mutations, like nearly all TNBC tumors. Although cancer cells to avoid otherwise lethal mitotic segregation errors we did not identify ANAPC1 and UBE2C, the APC/C compo- induced by TTK inhibition. Our study provides independent nents ANAPC13, ANAPC15,andCDC20 were uniquely identified support of these findings, but does so in multiple aneuploid in our screens, as were other genes implicated in progression to cancer models, which is the clinically relevant disease being

E1574 | www.pnas.org/cgi/doi/10.1073/pnas.1719577115 Thu et al. Downloaded by guest on September 25, 2021 APC/C-MAD2L1BP gene set: 52 Breast Cancer Cell Lines PNAS PLUS Genes ranked by association with CFI-402257 response ABResponse to CFI-402257 C Enrichment Score: 0.715, p-value = 4.3 x 10-4 0.6 MAD2L1BP p = 0.0399 APC/C- gene set ANAPC1 ANAPC16 0.6 0.4 ANAPC2 CDC16 ANAPC4 CDC20 ANAPC5 CDC23

AAC ANAPC7 CDC26 0.4 0.2 ANAPC10 CDC27 ANAPC11 UBE2C ANAPC13 MAD2L1BP 0.2 ANAPC15 Enrichment Score 0.0 TNBC HER2 Luminal B N=26 N=11 N=15 0 0 10000 20000 30000 40000 50000 D EFRank APC/C-MAD2L1BP gene set: 26 TNBC Cell Lines ANAPC4/CDC20 Metagene Score Across Genes ranked by association with CFI-402257 response CFI-402257 response association Various TCGA Tumour Types Enrichment Score: 0.711, p-value = 8.2 x 10 -4 with 2-gene metagene 5.0 ρ: 0.693, p-value = 1.3 x 10 -8 50 2.5 0.6 40 0 30 0.4 -2.5 20

-5.0 0.2 10 Enrichment Score Area the Curve (%) Above 0 ANAPC4/CDC20 Metagene Score -7.5 4.0 4.5 5.0 5.5 6.0 6.5 0 ANAPC4/CDC20 Metagene Score Brain Colon Lung Ovary Breast Kidney Thyroid 0 10000 20000 30000 40000 50000 ProstateStomach Rank Endometrium Head and Neck

Fig. 5. The APC/C gene signature is associated with CFI-402257 response in vitro. (A) Distribution of CFI-402257 sensitivity across 52 breast cancer cell lines. The AAC was calculated from dose–response assays and used as a metric of cell line drug sensitivity. The P value for an ANOVA comparing AACs across breast cancer subtypes is indicated. (B) List of 17 genes composing the APC/C-MAD2L1BP gene set investigated. The genes composing the two-gene metagene (below) are indicated in bold. (C and D)GSEAofAPC/C-MAD2L1BP gene set association with CFI-402257 response in all breast cancer cell lines (n = 52) (C), and only in TNBC lines (n = 26) (D). (E) Correlation between the two-gene metagene and CFI-402257 response in 52 breast cancer cell lines. The metagene score was calculated as the mean expression of the genes for each sample. Pearson correlation coefficients and P values are indicated. (F) Violin plots displaying the distribution and probability density of the two-gene metagene scores across various TCGA tumor types. Only tumor types with 500 or more patients were assessed.

targeted by TTKi in development. Moreover, we demonstrated different tumor types, and identified outliers with very low scores that this mechanism confers resistance not only to CFI-402257, a in multiple tumor types. These markers could potentially indicate clinical TTKi, but also several other selective TTKis. patients with intrinsic resistance to CFI-402257. Characterization To extend these mechanism-based discoveries toward predictors of these APC/C low cancers may reveal alternative vulnerabilities of TTKi response that could be applied clinically, we pursued a that could be exploited (29). Assessment of the APC/C metagene, gene expression-based approach, with the rationale that gene ex- other biomarkers of APC/C functional capacity, or somatic al- pression might capture various alterations affecting the mitotic exit terations in components of the APC/C pathway in ongoing clinical pathway, and supported by the observation that gene expression trials will determine the clinical significance of our findings. If predictors are often the strongest predictors of cancer dependencies validated in the clinic, these discoveries could have an important (38). To do so, we assembled a metagene expression signature impact on the successful development of TTKis, such as CFI- based on the biological findings from our functional genomic 402257, as novel cancer therapeutics for TNBC and other cancers. screens. The metagene comprised 16 APC/C complex components and MAD2L1BP, another governor of anaphase progression iden- Methods tified by our screens. Analysis of this metagene in both breast and Cell Lines. The breast cancer cell line (39) and the lung adenocarcinoma cell lung cancer cell lines revealed a significant association with re- line (40) panels were generous gifts from Drs. Benjamin Neel and Adi Gazdar, respectively. Cas9 was introduced into MDA-MB-231, MDA-MB- sponse to CFI-402257: models with low APC/C metagene scores MAD2L1BP 468, and MDA-MB-436 using lenti-Cas9-blast (52962; Addgene). For MDA- (i.e., low expression of APC/C and genes) exhibited MB-231 and MDA-MB-468, cells stably expressing Cas9 were subcloned to relative resistance to TTK inhibition, consistent with our CRISPR/ select lines with efficient Cas9 editing activity, evaluated by transduction of Cas9 screen findings. Subsequent analyses revealed that a two-gene cells with sgRNAs targeting essential genes followed by assessment of cell signature of CDC20 and ANAPC4 expression alone was even more viability. A nonclonal Cas9 expressing population of MDA-MB-436 cells was strongly associated with CFI-402257 response in breast cancer cell used for the screens. lines. Interestingly, we observed the strongest TTKi resistance phenotypes with ANAPC4 depletion in our validation studies. CRISPR/Cas9 Screens. The Toronto Human Knockout pooled library (TKO) was a To investigate the potential clinical utility of the APC/C gift from Dr. Jason Moffat (1000000069; Addgene) (18). Cas9-expressing cell lines were transduced with the TKO library at low multiplicity of infection to metagene for stratifying or selecting patients for TTKi therapy, ensure single viral integrations per cell with 200× library coverage. Follow- we assessed the reduced metagene signature in 11 different tu- ing puromycin selection, library infected cells were expanded for 7–10 d. mor types from TCGA’s pan-cancer dataset. We observed sub- Genomic DNA (gDNA) was harvested to determine baseline library repre- stantial variability in metagene scores both across and within sentation and cells were plated at densities to maintain 200× library MEDICAL SCIENCES

Thu et al. PNAS | Published online January 29, 2018 | E1575 Downloaded by guest on September 25, 2021 coverage at the onset of CFI-402257 or DMSO (vehicle) treatments. For each collected following treatment, fixed, and stained with AnV-FITC at 2.25 μg/mL

cell line, three doses ranging from IC60–IC90 concentrations were attempted. (BioLegend) and PI at 10 μg/mL (Sigma-Aldrich), and measured on a BD Cas9 lines transduced with sgLacZ were used as a negative control to ensure FACSCanto II flow cytometer. For ploidy analysis, viable cells were fixed with that screen drug doses resulted in cell death. During the screens, cells were ethanol, stained with PI (10 μg/mL), and measured on a BD FACSCanto II flow + − cultured as usual and counted at each passage to monitor cell doublings for cytometer. FlowJo software was used to quantify the proportion of AnV PI 30–50 d. At the end of the screen, gDNA was extracted from CFI-402257– and AnV+PI+ cells as a readout of apoptosis, and to determine the fraction of treated cells and doubling-matched DMSO controls, and together with cells with 2n, 4n, or >4n DNA content based on PI staining. baseline gDNA, was subjected to targeted sequencing of the sgRNA locus. Enriched sgRNAs were identified using the MAGeCK algorithm (19), and Pharmacogenomic Analyses. CFI-402257 dose–response curves were generated Gene Ontology analyses were conducted using Enrichr (20, 21). for a panel of 52 breast cancer cell lines and 20 lung adenocarcinoma cell lines. The PharmacoGx pipeline was used to generate drug response metrics for each Candidate Gene Validation Studies. To validate candidate genes, MDA-MB- cell line, including area above the drug dose–response curve (AAC) (41–45). 231 and MDA-MB-436 were transduced with lentiCRISPR-V2 (LCV2) encoding Drug response data were integrated with publicly available gene expression Cas9 and the candidate gene-targeting sgRNAs identified as most significantly profiles to evaluate the association between cell line CFI-402257 sensitivity enriched in our screens. sgRNA sequences were as follows: ANAPC4, CCTGCAG- (AAC) and a gene set comprising 16 APC/C genes and MAD2L1BP using GSEA CATCTAGTCCAAG; ANAPC13, CCTGAACCTGAACAAGACAA; MAD2L1BP,ACTT- (24). All genes in the genome were ranked according to their univariate as- GAGACAAGCTCTACGC; and GFP (negative control), GGGGCGAGGAGCTGTT- sociation with CFI-402257 response and entered into GSEA. GSEA was run with CACCG. Editing of candidate genes in LCV2 lines was confirmed by the 17-gene APC/C-MAD2L1BP gene list submitted as a gene set for testing TA-cloning and sequencing of the sgRNA-target sites. As an orthogonal enrichment compared with one million random permutations of the ranked approach, we conducted siRNA knockdowns to confirm their effects on gene list. Metagene scores were defined as the mean expression of the genes CFI-402257 response using ON-TARGETplus SMARTpools (Dharmacon). Lipofectamine 3000 (Thermo Fisher Scientific) was used to deliver 10 nM composing them (e.g., 17 genes composing the APC/C-MAD2L1BP gene set, or siRNA or nontargeting control (siNTC) to cells. Knockdown efficiencies ANAPC4 and CDC20 in the two-gene metagene). Breast cancer cell line gene were determined using qPCR and Western blot analysis (anti-ANAPC4, expression profiles were obtained from Marcotte et al. (39), and lung ade- A301-176A, Bethyl Laboratories; anti-MAD2L1BP, sc-134381, Santa Cruz nocarcinoma cell line gene expression profiles were obtained from the Cancer Biotechnology) at 48–72 h posttransfection. Cell Line Encyclopedia (CCLE) (46). All gene expression profiles were reproc- essed from raw data files using the Kallisto pipeline (47). TCGA gene expres- Drug Response Assays. Response of cell lines to TTKi (CFI-402257, MPI-0479605, sion profiles were obtained from University of California Santa Cruz Xena NMS-P715, and Mps-Bay2a) was evaluated using colony survival and SRB assays. browser (xena.ucsc.edu), and genetic analyses were conducted using the Na- For colony assays, cells were seeded sparsely and treated with DMSO or TTKi for ture 2012 breast cancer cohort in cBioPortal (48, 49). 10–14 d, and then fixed and stained with SRB. For quantification, SRB was solubilized with 10 mM Tris·HCl, and absorbance was quantified on a spec- Research Reproducibility. The genomic data used in this study are publicly trophotometer. For SRB dose–response assays, cells were seeded in 96-well available through our PharmacoGx platform. CCLE raw data are available at plates and treated with serial drug dilutions. After 5 d of treatment, cells were https://portals.broadinstitute.org/ccle/. The raw RNA-seq data for the breast fixed, stained with SRB, and solubilized, and absorbance was quantified on a cancer cell line panel are available from the National Center for Bio- spectrophotometer. CFI-402257 was synthesized as described previously (10), technology Information’s Gene Expression Omnibus (accession no. GSE73526). and MPI-0479605, NMS-P715, and Mps-Bay2a were synthesized by the Our code and documentation are open-source and publicly available through Campbell Family Institute for Breast Cancer Research. the GitHub repository (https://github.com/bhklab/). A detailed tutorial de- scribing how to run our pipeline and reproduce our analysis results is available Live-Cell, Time-Lapse Microscopy. Cells were synchronized with double thymi- in the GitHub repository. dine block, plated in Eppendorf chamber slides, and released into 167 nM siR- DNA stain (Cytoskeleton) and CFI-402257 at 150 nM or DMSO for a minimum of ACKNOWLEDGMENTS. We thank Dr. Troy Ketela and members of the 4 h before imaging. Cells were held in a humidified Chamlide stage incubator T.W.M. laboratory and Pelletier laboratory for experimental discussions, kept at 37 °C and 5% CO2 (Live Cell Instrument). Time-lapse images were Dr. Jacqueline Mason and the CFIBCR Therapeutics group for providing drugs captured using Volocity 6.3 software (Quorum Technologies) on a Yoko- and scientific input, Drs. Benjamin Neel and Adi Gazdar for sharing cancer cell gawa spinning disk confocal microscope (Quorum Technologies) equipped lines, The Cancer Genome Atlas for data access, and the Advanced Optical with a Hamamatsu ImageEM EM-CCD camera at 20× magnification every Microscopy Facility for technical support. This work was supported by the Terry 4 min for 20–28 h. The time from NEBD to anaphase was recorded for Fox Research Institute, Canadian Institutes of Health Research, the Princess – each dividing cell. For all dividing cells, mitoses were scored as normal or Margaret Cancer Foundation, and Stand Up To Cancer Canada Canadian Breast Cancer Foundation Breast Cancer Dream Team Research Funding, with abnormal (i.e., endoreduplication, lagging chromosomes, anaphase bridge, supplemental support of the Ontario Institute for Cancer Research through or multipolar divisions). funding provided by the Government of Ontario (Funding Award SU2C-AACR- DT-18-15). Stand Up To Cancer Canada is a program of the Entertainment Flow Cytometry. Induction of aneuploidy and apoptosis after 72 h of treat- Industry Foundation Canada. Research funding is administered by the American ment with CFI-402257 were measured by PI and annexin-V (AnV) combined Association for Cancer Research International–Canada, the Scientific Partner of with PI staining, respectively. To assess drug-induced apoptosis, cells were SU2C Canada.

1. Xu H, Eirew P, Mullaly SC, Aparicio S (2014) The omics of triple-negative breast can- 10. Liu Y, et al. (2016) Discovery of pyrazolo[1,5-a]pyrimidine TTK inhibitors: CFI-402257 is cers. Clin Chem 60:122–133. a potent, selective, bioavailable anticancer agent. ACS Med Chem Lett 7:671–675. 2. Dawson SJ, Rueda OM, Aparicio S, Caldas C (2013) A new genome-driven integrated 11. Mason JM, et al. (2017) Functional characterization of CFI-402257, a potent and se- classification of breast cancer and its implications. EMBO J 32:617–628. lective Mps1/TTK kinase inhibitor, for the treatment of cancer. Proc Natl Acad Sci USA 3. Curtis C, et al.; METABRIC Group (2012) The genomic and transcriptomic architecture 114:3127–3132. of 2,000 breast tumours reveals novel subgroups. Nature 486:346–352. 12. Sansregret L, et al. (2017) APC/C dysfunction limits excessive cancer chromosomal 4. Dominguez-Brauer C, et al. (2015) Targeting mitosis in cancer: Emerging strategies. instability. Cancer Discov 7:218–233. Mol Cell 60:524–536. 13. Forbes SA, et al. (2017) COSMIC: Somatic cancer genetics at high-resolution. Nucleic 5. Lehmann BD, Pietenpol JA (2014) Identification and use of biomarkers in treatment Acids Res 45:D777–D783. strategies for triple-negative breast cancer subtypes. J Pathol 232:142–150. 14. Wild T, et al. (2016) The spindle assembly checkpoint is not essential for viability of 6. Musacchio A (2015) The molecular biology of spindle assembly checkpoint signaling human cells with genetically lowered APC/C activity. Cell Rep 14:1829–1840. dynamics. Curr Biol 25:R1002–R1018. 15. Jemaà M, et al. (2013) Characterization of novel MPS1 inhibitors with preclinical 7. Kops GJPL, Foltz DR, Cleveland DW (2004) Lethality to human cancer cells through anticancer activity. Cell Death Differ 20:1532–1545. massive chromosome loss by inhibition of the mitotic checkpoint. Proc Natl Acad Sci 16. Slee RB, et al. (2014) Selective inhibition of pancreatic ductal adenocarcinoma cell USA 101:8699–8704. growth by the mitotic MPS1 kinase inhibitor NMS-P715. Mol Cancer Ther 13:307–315. 8. Michel L, et al. (2004) Complete loss of the tumor suppressor MAD2 causes premature 17. Tardif KD, et al. (2011) Characterization of the cellular and antitumor effects of MPI- cyclin B degradation and mitotic failure in human somatic cells. Proc Natl Acad Sci 0479605, a small-molecule inhibitor of the mitotic kinase Mps1. Mol Cancer Ther 10: USA 101:4459–4464. 2267–2275. 9. Bharadwaj R, Yu H (2004) The spindle checkpoint, aneuploidy, and cancer. Oncogene 18. Hart T, et al. (2015) High-resolution CRISPR screens reveal fitness genes and genotype- 23:2016–2027. specific cancer liabilities. Cell 163:1515–1526.

E1576 | www.pnas.org/cgi/doi/10.1073/pnas.1719577115 Thu et al. Downloaded by guest on September 25, 2021 19. Li W, et al. (2014) MAGeCK enables robust identification of essential genes from 34. Sivaram MVS, Wadzinski TL, Redick SD, Manna T, Doxsey SJ (2009) Dynein light in- PNAS PLUS genome-scale CRISPR/Cas9 knockout screens. Genome Biol 15:554. termediate chain 1 is required for progress through the spindle assembly checkpoint. 20. Kuleshov MV, et al. (2016) Enrichr: A comprehensive gene set enrichment analysis EMBO J 28:902–914. web server 2016 update. Nucleic Acids Res 44:W90–W97. 35. Westhorpe FG, Tighe A, Lara-Gonzalez P, Taylor SS (2011) p31comet-mediated ex- 21. Chen EY, et al. (2013) Enrichr: Interactive and collaborative HTML5 gene list enrich- traction of Mad2 from the MCC promotes efficient mitotic exit. J Cell Sci 124: – ment analysis tool. BMC Bioinformatics 14:128. 3905 3916. 22. Sivakumar S, Gorbsky GJ (2015) Spatiotemporal regulation of the anaphase- 36. Mansfeld J, Collin P, Collins MO, Choudhary JS, Pines J (2011) APC15 drives the turnover of MCC-CDC20 to make the spindle assembly checkpoint responsive to ki- promoting complex in mitosis. Nat Rev Mol Cell Biol 16:82–94. netochore attachment. Nat Cell Biol 13:1234–1243. 23. Colombo R, et al. (2010) Targeting the mitotic checkpoint for cancer therapy with 37. Jia L, et al. (2011) Defining pathways of spindle checkpoint silencing: Functional re- NMS-P715, an inhibitor of MPS1 kinase. Cancer Res 70:10255–10264. dundancy between Cdc20 ubiquitination and p31(comet). Mol Biol Cell 22:4227–4235. 24. Subramanian A, et al. (2005) Gene set enrichment analysis: A knowledge-based ap- 38. Tsherniak A, et al. (2017) Defining a cancer dependency map. Cell 170:564–576.e16. proach for interpreting genome-wide expression profiles. Proc Natl Acad Sci USA 102: 39. Marcotte R, et al. (2016) Functional genomic landscape of human breast cancer 15545–15550. drivers, vulnerabilities, and resistance. Cell 164:293–309. 25. Cescon DW, et al. (2017) Phase I study of CFI-402257, an oral TTK inhibitor, in patients 40. Gazdar AF, Girard L, Lockwood WW, Lam WL, Minna JD (2010) Lung cancer cell lines with advanced solid tumors. J Clin Orthod 35(15_suppl):TPS2619. as tools for biomedical discovery and research. J Natl Cancer Inst 102:1310–1321. 26. Cescon D, Siu LL (2017) Cancer clinical trials: The rear-view mirror and the crystal ball. 41. Smirnov P, et al. (2016) PharmacoGx: an R package for analysis of large pharmaco- Cell 168:575–578. genomic datasets. Bioinformatics 32:1244–1246. 27. Koch A, Maia A, Janssen A, Medema RH (2016) Molecular basis underlying resistance 42. Safikhani Z, et al. (2016) Revisiting inconsistency in large pharmacogenomic studies. to Mps1/TTK inhibitors. Oncogene 35:2518–2528. F1000 Res 5:2333. 28. Zaman GJR, et al. (2017) TTK inhibitors as a targeted therapy for CTNNB1 (β-catenin) 43. Safikhani Z, et al. (2017) Gene isoforms as expression-based biomarkers predictive of mutant cancers. Mol Cancer Ther 16:2609–2617. drug response in vitro. Nat Commun 8:1126. 29. Burkard ME, Weaver BA (2017) Tuning chromosomal instability to optimize tumor 44. El-Hachem N, et al. (2017) Integrative cancer pharmacogenomics to infer large-scale drug taxonomy. Cancer Res 77:3057–3069. fitness. Cancer Discov 7:134–136. 45. Safikhani Z, et al. (2016) Assessment of pharmacogenomic agreement. F1000 Res 5: 30. Plans V, Guerra-Rebollo M, Thomson TM (2008) Regulation of mitotic exit by the 825. RNF8 ubiquitin ligase. Oncogene 27:1355–1365. 46. Barretina J, et al. (2012) The cancer cell line encyclopedia enables predictive model- 31. Marks DH, et al. (2017) Mad2 overexpression uncovers a critical role for TRIP13 in ling of anticancer drug sensitivity. Nature 483:603–607. – mitotic exit. Cell Rep 19:1832 1845. 47. Bray NL, Pimentel H, Melsted P, Pachter L (2016) Near-optimal probabilistic RNA-seq 32. Ma HT, Poon RYC (2016) TRIP13 regulates both the activation and inactivation of the quantification. Nat Biotechnol 34:525–527. – spindle-assembly checkpoint. Cell Rep 14:1086 1099. 48. Cerami E, et al. (2012) The cBio cancer genomics portal: An open platform for ex- 33. Mahale SP, Sharma A, Mylavarapu SVS (2016) Dynein light intermediate chain 2 fa- ploring multidimensional cancer genomics data. Cancer Discov 2:401–404. cilitates the metaphase to anaphase transition by inactivating the spindle assembly 49. Cancer Genome Atlas Network (2012) Comprehensive molecular portraits of human checkpoint. PLoS One 11:e0159646. breast tumours. Nature 490:61–70. MEDICAL SCIENCES

Thu et al. PNAS | Published online January 29, 2018 | E1577 Downloaded by guest on September 25, 2021