Diabetes Page 2 of 39
1 The RabGAPs TBC1D1 and TBC1D4 control uptake of long-chain fatty
2 acids into skeletal muscle via fatty acid transporter SLC27A4/FATP4
3 Short title: RabGAPs in skeletal muscle lipid metabolism
4 Tim Benninghoff1,2, Lena Espelage1,2, Samaneh Eickelschulte1,2, Isabel Zeinert1, Isabelle
5 Sinowenka1, Frank Müller1, Christina Schöndeling1, Hannah Batchelor1, Sandra Cames1,2,
6 Zhou Zhou1, Jörg Kotzka1,2, Alexandra Chadt §1,2 and Hadi Al-Hasani1,2
7
8 1Institute for Clinical Biochemistry and Pathobiochemistry, German Diabetes Center, Leibniz
9 Center for Diabetes Research at Heinrich Heine University Duesseldorf
10 2German Center for Diabetes Research, München-Neuherberg, Germany.
11
12 § Corresponding author
13 Dr. Alexandra Chadt
14 Institute for Clinical Biochemistry and Pathobiochemistry
15 German Diabetes Center, Leibniz Center for Diabetes Research at Heinrich Heine University
16 Duesseldorf
17 Auf'm Hennekamp 65
18 40225 Duesseldorf
19 Germany
20 tel/fax +49-211-3382-577/ -430
22
23 Word count: 4946 (Introduction, Methods, Results, Discussion)
24 Figures: 5
25 Tables: 0
1
Diabetes Publish Ahead of Print, published online August 31, 2020 Page 3 of 39 Diabetes
26 Abstract
27 The two closely related RabGTPase-activating proteins (RabGAPs) TBC1D1 and TBC1D4
28 play a crucial role in the regulation of GLUT4 translocation in response to insulin and
29 contraction in skeletal muscle. In mice, deficiency in one or both RabGAPs leads to reduced
30 insulin and contraction-stimulated glucose uptake, and to elevated fatty acid uptake and
31 oxidation in both glycolytic and oxidative muscle fibers without altering mitochondrial copy
32 number and the abundance of OXPHOS proteins. Here we present evidence for a novel
33 mechanism of skeletal muscle lipid utilization involving the two RabGAPs and the fatty acid
34 transporter SLC27A4/FATP4. Both RabGAPs control the uptake of saturated and unsaturated
35 long-chain fatty acids (LCFAs) into skeletal muscle and knockdown of a subset of RabGAP
36 substrates, Rab8, Rab10 or Rab14, decreased LCFA uptake into these cells. In skeletal muscle
37 from Tbc1d1/Tbc1d4 knockout animals, SLC27A4/FATP4 abundance was increased and
38 depletion of SLC27A4/FATP4 but not FAT/CD36 completely abrogated the enhanced fatty
39 acid oxidation in RabGAP-deficient skeletal muscle and cultivated C2C12 myotubes.
40 Collectively, our data demonstrate that RabGAP-mediated control of skeletal muscle lipid
41 metabolism converges with glucose metabolism at the level of downstream RabGTPases and
42 involves regulated transport of LCFAs via SLC27A4/FATP4.
43
44
45
2 Diabetes Page 4 of 39
46 Introduction
47 As direct downstream effectors of both, AKT (= protein kinase B, PKB) and AMP-dependent
48 kinase AMPK, the two RabGTPase-activating proteins (RabGAPs) TBC1D1 and TBC1D4
49 have been shown in previous studies to act as critical regulators of skeletal muscle glucose
50 metabolism [1-5]. RabGAPs accelerate the intrinsic GTP hydrolysis activity of Rab proteins, a
51 large family of small GTPases that control a multiplicity of cellular vesicle trafficking and
52 organelle translocation processes [6-8]. In the past, several Rab proteins have been described
53 to be direct targets of the two RabGAPs and, in addition, to be associated to GLUT4 vesicles,
54 namely Rabs 8a, 10, 14 and 28 [3, 4, 9-11]. Rab8b, in addition, has been described as direct
55 downstream effector of TBC1D1 but its role in skeletal muscle substrate metabolism is not yet
56 clear [4, 12]. Interestingly, both TBC1D1 and TBC1D4 have been implicated to play an
57 important role in lipid metabolism as well. Deficiency in either Tbc1d1 or Tbc1d4 as well as
58 the combined knockout of both RabGAPs in mice leads to enhanced in vivo lipid utilization,
59 indicated by a lowered respiratory quotient [5, 13]. In fact, TBC1D-family GAPs reciprocally
60 regulate glucose uptake and fatty acid oxidation in skeletal muscle through independent
61 signaling pathways and, at least in mice, dependent on the muscle fiber composition [5]. We
62 have previously demonstrated that insulin- and AICAR-stimulated glucose uptake is normal in
63 glycolytic EDL muscle from D4KO mice, whereas muscles from D1KO mice show impaired
64 response towards these stimuli [5]. In accordance, EDL muscle from D1KO but not D4KO
65 mice shows lower abundance of GLUT4, presumably resulting from missorting of the protein,
66 and may in part explain the reduced glucose transport. At that point is seems to be clear that
67 insulin- and AMPK-signaling pathways converge at the level of the two RabGAPs and that
68 TBC1D1 and TBC1D4 are required for sorting of GLUT4 in skeletal muscle with TBC1D1
69 representing the major signal transducer for glucose transport in glycolytic skeletal muscle and
70 TBC1D4 in oxidative skeletal muscle and adipose tissue [1, 5, 14, 15]. Most importantly, basal
71 FAO is equally elevated in EDL muscle from D1KO and D4KO mice but only the former show
3 Page 5 of 39 Diabetes
72 this increase also in the oxidative Soleus muscle [5]. These data indicate that, despite of the fact
73 that both RabGAPs contribute to the effect on FAO, this influence is not directly related to
74 skeletal muscle glucose uptake, as D4KO mice demonstrate normal glucose uptake but
75 increased FAO in EDL muscle. Importantly, these effects are strictly dependent on the
76 functional GAP domain since no changes in lipid utilization were monitored in cultivated
77 muscle cells overexpressing a non-functional R941K mutant of Tbc1d1 [16].
78 Skeletal muscle fatty acid uptake has been shown to be dependent on several distinct
79 mechanisms including diffusion through the plasma membrane, as postulated for short-chain
80 fatty acids (SCFAs), and complex transport systems specific for long-chain fatty acids (LCFAs)
81 involving a variety of different membrane transporter and binding proteins [17, 18]. At least
82 three different fatty acid transporters have been described to control skeletal muscle LCFA
83 uptake [19]. The most extensively studied fatty acid transporter is FAT/CD36 which
84 exclusively binds LCFAs and has been implicated in lipid storage of different tissues and also
85 pathophysiological impairments such as obesity and type 2 diabetes (T2D) [20]. Besides
86 FAT/CD36, at least two more fatty acid transporters, both members of the SLC27 family of
87 fatty acid transport proteins (FATP), have been reported to be relevant in skeletal muscle lipid
88 metabolism, FATP1 (SLC27A1) and FATP4 (SLC27A4) [21]. In L6 rat muscle cells, Tbc1d4
89 deficiency led to enhanced influx of fatty acids associated with an increase in fatty acid
90 translocase FAT/CD36 and fatty acid binding protein FABPpm expression [22], and in mouse
91 cardiomyocytes, knockdown of Tbc1d4 led to redistribution of FAT/CD36 to the cell surface
92 [23]. Of note, previous studies have provided evidence for the involvement of a regulated
93 translocation mechanism for fatty acid uptake facilitators (e.g. FAT/CD36, fatty acid transport
94 proteins FATP1 and FATP4) [19, 24-26] in analogy to the mechanism described for the uptake
95 of glucose through GLUT4 in insulin-sensitive cells [27, 28]. However, there are no data
96 available so far on the specificity of RabGAP-regulated lipid metabolism with regard to the
97 fatty acid species [17-19].
4 Diabetes Page 6 of 39
98 The aim of the present study was to characterize the molecular mechanisms that are responsible
99 for the increased fatty acid use upon inactivation of Tbc1d1 or Tbc1d4 in skeletal muscle cells,
100 and to determine the responsible downstream targets of the RabGAPs.
101
102 Research Design and Methods
103 Chemicals and buffer
104 Chemicals and buffer ingredients are listed in Supplemental Table 1. Buffers and cell culture
105 media are listed in Supplemental Table 2.
106 Experimental Animals
107 Mice were kept in accordance with the NIH guidelines for the care and use of laboratory
108 animals, and all experiments were approved by the Ethics Committee of the State Ministry of
109 Agriculture, Nutrition and Forestry (Reference numbers 84-02.04.2013.A352 and 84-
110 02.04.2017.A345, State of North Rhine-Westphalia, Germany). Unless indicated otherwise,
111 three to six mice per cage were housed at 22 °C and a 12-h light–dark cycle with ad libitum
112 access to food and water. After weaning, animals received a standard chow diet (Ssniff, Soest,
113 Germany). Male mice were used at the age of 12-25 weeks. Generation of Tbc1d1- (D1KO)
114 and Tbc1d4- (D4KO) mice was described previously [5, 16, 29]. Heterozygous Cd36-knockout
115 mice [30] were bred with either Tbc1d1- or Tbc1d4-deficient mice and the F1 generation was
116 intercrossed to generate homozygous double-deficient D1/CD36KO and D4/CD36KO mice.
117 Isolation of genomic DNA from mouse tail tips was performed with the InViSorb Genomic
118 DNA Kit II (Invitek, Berlin, Germany). Genotyping of mice was performed by PCR with
119 primers for the Tbc1d1 and Tbc1d4 knockout as described [5]. Genotyping of the Cd36
120 knockout was conducted as described [30]. Sequences of all genotyping primers are listed in
121 Supplemental Table 3.
122 In vivo muscle electroporation (IVE)
5 Page 7 of 39 Diabetes
123 The IVE protocol was adapted from previous reports [31-33]. Briefly, mice were anaesthetized
124 using isoflurane and their hind limbs were shaved. Then 30 µl saline containing 15 Units
125 hyaluronidase (Sigma-Aldrich, Steinheim, Germany) were injected in the proximal and distal
126 part of the front and the back of the shank to target EDL and Soleus muscle. Following a 1 h
127 recovery in their cages, the mice were anesthetized again with isoflurane and 4 µg siRNA
128 oligonucleotides specific for Rab8a, Rab10 or Slc27a4/Fatp4, respectively, in 30 ml sterile
129 saline were injected into the same leg regions as before. Slc27a4/Fatp4 siRNA oligonucleotides
130 were mixed with Invivofectamine 2.0 (Invitrogen, Carlsbad, California) according to the
131 manufacturer’s instructions to a final concentration of 0.7 mg/ml. In each animal, one muscle
132 was used as a control and therefore injected with non-target siRNA oligonucleotides. The
133 siRNA injection was followed by the application of a pair of tweezer electrodes across the distal
134 limb connected to an ECM-830 electroporator device (BTX, Square Wave Electroporation
135 System ECM 830). Eight pulses (80 V, 20 ms, 1 Hz) were applied to each leg following
136 recovery of the animals. Seven days after IVE intervention, mice were subjected to ex vivo
137 experiments. Only muscle samples with a minimum Rab protein reduction of 20 % were
138 considered for further statistical analysis.
139 Cell culture
140 C2C12 myoblasts were grown to 80% confluence in DMEM (PAA Laboratories) supplemented
141 with 10% FBS and 1% penicillin/streptomycin at 37°C and 5% CO2. Myotube differentiation
142 was induced by switching to DMEM containing 3% horse serum. Cells were used for assays
143 when fully differentiated (usually 7 d). For knockdown of Tbc1d1, Tbc1d4, the different Rab
144 GTPases or fatty acid transporters, C2C12 cells were transfected with 50 nM siRNA duplexes
145 using DharmaFECT1 on day 3 of differentiation. Experiments were conducted at day 6 of
146 differentiation. Sequences from siRNA oligonucleotides used are listed in Supplemental Table
147 4.
148 Fatty acid uptake and oxidation in C2C12 myotubes
6 Diabetes Page 8 of 39
149 C2C12 myotubes (6 days post differentiation) were serum-starved for 2 h (DMEM (high
150 glucose, 4.5 g/L) supplemented with 1 % FA-free BSA) before adding KRH buffer (see
151 Supplemental Table 2), supplemented with 40 µM FA-free BSA. To start the uptake assay, a
152 KRH-based buffer (HOT buffer) containing either 8.5 nM ³H-palmitate, ³H-oleate, or ³H-
153 butyrate (Supplemental Table 5), 2.5 µM FA-free BSA and 5 µM unlabeled palmitate, bound
154 in a molar ratio of 2:1 to BSA, was added to each well for 5 minutes at 37°C/ 5 % CO2.
155 Afterwards, cells were placed on ice, HOT buffer was immediately aspirated and each well was
156 intensively washed three times with ice-cold washing buffer. Residual washing buffer was
157 completely aspirated and cells were lysed in protein lysis buffer (w/ protease- and phosphatase
158 inhibitor cocktail) and cleared protein lysates were prepared. 50 µl of the lysates were used for
159 liquid scintillation counting, the rest was used for protein measurement. Radioactivity was
160 measured by scintillation counting and normalized to protein concentrations. [1-14C]-palmitic
161 acid oxidation assays were performed essentially as described [29, 34]. Briefly, C2C12
162 myotubes in 48-well plates were incubated with HOT oxidation buffer (11.8 µM 14C-palmitate,
163 6.24 µM fatty acid-free BSA and 1 µM L-carnitine in C2C12 differentiation medium) for 4 h
164 at 37 °C / 5 % CO2. Then, supernatants were transferred to fresh 48-well plates, acidified with
165 1 M HCl and incubated over night (O/N) with NaOH-soaked filter papers. The remaining cells
166 were washed with PBS and analyzed for protein content. Trapped radioactivity was determined
167 by scintillation counting and normalized to the amount of cellular protein.
168 Palmitate oxidation in intact isolated skeletal muscles
169 Assays were done essentially as described [16]. Briefly, EDL and Soleus muscles were
170 incubated in Krebs-Henseleit buffer containing 15 mM mannitol, 5 mM glucose, 3.5% fatty
171 acid-free BSA, 4 mCi/ml [3H]palmitate and 300 mM unlabeled palmitate at 30°C for 2 h. After
172 absorption of fatty acids to activated charcoal, fatty acid oxidation was determined by
173 measuring tritiated water using a scintillation counter.
174 Sample Processing, SDS-PAGE and Western Blotting
7 Page 9 of 39 Diabetes
175 Protein lysates (10-30 µg) were separated by 8-12 % SDS-PAGE and transferred by tank
176 blotting onto nitrocellulose membranes (Amersham Protran 0.45 µm). Membranes were
177 blocked for 1 h with 5 % fat-free powdered milk in TBS-T (Supplemental Table 2), incubated
178 with primary antibodies and secondary HRP-conjugated antibodies as described in
179 Supplemental Table 6 and developed with ECL reagent (Perkin Elmer). For analysis of
180 SLC27A4/FATP4 membrane localization, knockdown of Tbc1d1 was conducted in C2C12
181 myotubes as described above and subjected to a fractionation protocol modified from [35].
182 Briefly, cells were dissolved in homogenization buffer A and centrifuged at 500 x g for 5
183 minutes at 4°C to remove cell debris. A fraction of the supernatant was stored for later
184 determination of total SLC27A4/FATP4, the rest was subjected to an ultracentrifugation step
185 (100,000 x g, 4°C, 30 minutes) to spin down membranes. Supernatants were discarded and
186 crude membrane pellets were resuspended in homogenization buffer B. Buffer compositions
187 are listed in Supplemental Table 2. Fractions A and B were analyzed via Western Blot analysis
188 as described above.
189 RNA Extraction, cDNA Synthesis and Quantitative Real-Time PCR
190 RNA was isolated using RNeasy Mini Kit and cDNA was synthesized using GoScript™
191 Reverse Transcriptase Kit (Promega) with 1 µg RNA with random hexanucleotide primers
192 (Roche). For qPCR, specific primers were used with the GoTaq® qPCR Master Mix on a
193 StepOne Plus device (Applied Biosystems). Primer sequences are shown in Supplemental Table
194 7. Analysis was performed using the 2-∆∆Ct-method [36] with Tbp (TATA-box binding
195 protein) as reference gene. Quantification of Tbc1d1 and Tbc1d4 copy number was performed
196 as described previously [29].
197 Lipid profiling
198 Skeletal muscle total fatty acid (TFA) content, and specific fractional compositions of FAs were
199 determined by gas chromatography [37]. Fatty acids data were further used to calculate the Δ9-
200 desaturase index (C16:1/C16:0 or C18:1/C18:0) and the Δ5-desaturase index (C18:2/C20:4) as
8 Diabetes Page 10 of 39
201 well as the sums of TFA, non-saturated fatty acids, monounsaturated fatty acids, saturated fatty
202 acids, essential fatty acids (C18:2 + C18:3) or non-essential fatty acids (C16:0 + C16:1 + C18:0
203 + C18:1) [38, 39]. Nomenclature used indicates Cx:y (x, number of carbons in the FA; y,
204 number of double bonds in the fatty acids).
205 Statistical analysis
206 All experiments were performed with at least n = 3 independent samples and shown as mean
207 values ± SEM. Statistical significance (p < 0.05) was calculated with appropriate tests (unpaired
208 or paired two-tailed Student's t-test, one- or two-way ANOVA) using GraphPad Prism 8
209 software as detailed in the respective figure legends.
210 Data and Resource Availability
211 The data and critical resources supporting their reported findings, methods, and conclusions are
212 available from the corresponding author upon reasonable request.
213
214 Results
215 TBC1D1 and TBC1D4 regulate fatty acid influx into skeletal muscle cells and specifically
216 control LCFA metabolism.
217 In order to investigate the mechanism of RabGAP-regulated fatty acid utilization, we performed
218 siRNA-mediated knockdown of Tbc1d1 and Tbc1d4 in differentiated C2C12 myotubes and,
219 subsequently, determined uptake of long-chain fatty acids 3H-palmitate and 3H-oleate or the
220 short-chain fatty acid 3H-butyrate, respectively. The rationale behind this experiment was to
221 determine the specificity for the uptake of distinct lipid species such as saturated vs. unsaturated
222 (palmitate, oleate) and LCFA vs. SCFA in RabGAP deficient muscle cells. To validate
223 successful knockdown of the two target genes, expression of Tbc1d1 and Tbc1d4 mRNA was
224 determined via qRT-PCR. Treatment of the cells with target-specific siRNA oligonucleotides
225 reduced the mRNA expression of Tbc1d1 or Tbc1d4 by 70-85 % (Figure 1A, B). 3H-palmitate
226 uptake was increased in C2C12 myotubes after knockdown of Tbc1d1 and Tbc1d4 compared
9 Page 11 of 39 Diabetes
227 to cells transfected with unspecific non-target (NT) siRNA duplexes (Figure 1A, B). Moreover,
228 both Tbc1d1 and Tbc1d4 deficiency led to a significantly increased oxidation of 14C-palmitate
229 (Figure 1C). Interestingly, knockdown of Tbc1d1 and Tbc1d4 resulted in increased uptake of
230 3H-oleate into the muscle cells as well (Figure 1D). In contrast, uptake of 3H-butyrate was
231 unchanged in C2C12 myotubes following either Tbc1d1 or Tbc1d4 depletion (Figure 1E). In
232 order to assess the relative contribution of each of the two RabGAPs in skeletal muscle fatty
233 acid uptake and oxidation, we determined expression levels of Tbc1d1 and Tbc1d4 transcripts
234 by measuring mRNA copy numbers via qRT-PCR using a standard calibration curve as
235 described [29]. Tbc1d1 gene expression increased during the course of differentiation, whereas
236 Tbc1d4 transcript levels were unchanged in differentiated C2C12 myotubes compared to the
237 undifferentiated myoblasts (Figure 1F).
238
239 Uptake and oxidation of LCFA in skeletal muscle cells is dependent on distinct
240 RabGTPases downstream of TBC1D1 and TBC1D4.
241 We conducted knockdown experiments of the previously reported RabGAP-target Rab-
242 GTPases Rab8a, Rab8b, Rab10, Rab14 and Rab28 in C2C12 myotubes and analyzed 3H-
243 palmitate uptake in these cells. Gene expression levels of the different Rab genes were reduced
244 between 40-60% four days after transfection of target-specific siRNA oligonucleotides (Figure
245 2A-E). Whereas 3H-palmitate uptake was significantly reduced in C2C12 myotubes after
246 knockdown of Rab8a, Rab8b, Rab10, Rab14, depletion of Rab28 did not result in alterations
247 of fatty acid influx (Figure 2A-E). Next, we conducted knockdown of Rab8a and Rab10 in
248 skeletal muscle from C57BL/6J mice via in vivo electroporation (IVE) as described in the
249 methods section. The knockdown efficiency was ~35% in the EDL and ~41% in the Soleus
250 muscle (Supplemental Figure 1A). Seven days after transfection of siRNA, 3H-palmitate
251 oxidation was measured ex vivo in intact skeletal muscles. Interestingly, fatty acid oxidation
252 was decreased by ~24% in the oxidative Soleus muscle but not in the glycolytic EDL muscle
10 Diabetes Page 12 of 39
253 following Rab8a silencing (Figure 2F). Rab10 knockdown, however, did not lead to changes
254 in 3H-palmitate oxidation (Supplemental Figure 1B). Gene expression levels of Rab8a, Rab10
255 and Rab14 were not affected by either Tbc1d1 or Tbc1d4 knockdown in C2C12 myotubes
256 (Supplemental Figure 1C, D).
257
258 Fatty acid transporter SLC27A4/FATP4 but not FAT/CD36 is elevated in Tbc1d1 and
259 Tbc1d4-deficient skeletal muscle
260 In order to further elucidate the function of the RabGAPs as signaling hub between lipid and
261 glucose metabolism in skeletal muscle, we determined gene expression as well as protein
262 abundance of key enzymes of energy substrate flux in RabGAP-deficient skeletal muscle and
263 cultured muscle cells (Supplemental Figure 2). Pdk4 mRNA and protein were increased in
264 Tbc1d1 knockdown myotubes and Tibialis anterior (TA) skeletal muscle from D1KO mice
265 (Supplemental Figure 2A) but not in EDL and Soleus muscle from D1KO and D4KO animals
266 (Figure 3A-D). Also, proteins for oxidative phosphorylation (OXPHOS) in EDL and Soleus
267 muscle were not altered compared to WT controls. (Supplemental Figure 2D-G). The fatty acid
268 transporter FAT/CD36 has been shown to contribute to fatty acid uptake in skeletal muscle
269 [20]. However, protein abundance of FAT/CD36 was not altered in either EDL or Soleus
270 muscle from D1KO and D4KO mice, respectively (Fig. 3A-D), or in Tbc1d1 knockdown
271 myotubes and TA muscle from D1KO animals (Supplemental Figure 2B and 3A). In contrast,
272 protein abundance of the fatty acid transporter SLC27A4/FATP4 was significantly increased in
273 both EDL and Soleus muscles from D1KO and D4KO mice compared to the WT littermate
274 controls (Figure 3A-B, G-H). However, this difference did not reach significance level in TA
275 muscle from D1KO animals or C2C12 myotubes following Tbc1d1 knockdown (Supplemental
276 Figure 2C and 3A).
277
11 Page 13 of 39 Diabetes
278 Fatty acid transporter 4 (SLC27A4/FATP4) but not FAT/CD36 contributes to increased
279 fatty acid uptake in RabGAP-deficient muscle cells.
280 To study the relation of Cd36, Tbc1d1 and Tbc1d4, we generated global Cd36-RabGAP double-
281 deficient mice by crossbreeding CD36KO animals with either D1KO or D4KO animals
282 respectively, as described in the methods section. Intact isolated skeletal muscles from 12-16
283 weeks old male knockout mice and respective wildtype littermate controls were used to analyze
284 fatty acid uptake ex vivo. As illustrated in Figure 4A, uptake of 3H-palmitate was moderately
285 reduced in EDL muscles from CD36KO animals, but substantially increased in D1KO or D4KO
286 muscles, respectively. Importantly, the elevated fatty acid uptake in muscles from D1KO mice
287 was maintained or even further increased in muscles double-deficient in Cd36 and Tbc1d1
288 (D1/CD36KO). Similarly, Tbc1d4 knockout increased fatty acid uptake in Cd36-deficient
289 muscles (D4/CD36KO). Interestingly, D1/CD36KO muscles showed higher fatty acid uptake
290 than D4/CD36KO muscles (Figure 4A).
291 To investigate the contribution of SLC27A4/FATP4 in the elevated fatty acid uptake in
292 RabGAP-deficient muscle cells, we conducted knockdown experiments in C2C12 myotubes
293 and measured 3H-palmitate uptake following depletion of Slc27a4/Fatp4 and Cd36,
294 respectively, as well as combined knockdown of Slc27a4/Fatp4 plus Tbc1d1 or Tbc1d4
295 (knockdown efficiency shown in Supplemental Figure 3B). In C2C12 myotubes, knockdown
296 of Slc27a4/Fatp4 results in a moderate reduction in 3H-palmitate uptake that did not reach
297 statistical significance (Figure 4B) whereas Cd36 depletion had no effect on FA uptake
298 (Supplemental Figure 3C). Conversely, knockdown of Tbc1d1 or Tbc1d4 resulted in a
299 substantial increase in fatty acid uptake compared to control cells. Combined knockdown of
300 Slc27a4/Fatp4 and each of the RabGAPs completely abrogated the increase in fatty acid
301 transport observed in either Tbc1d1 or Tbc1d4 knockdown cells (Figure 4B). Knockdown of
302 Slc27a4/Fatp4 did not lead to changes in Cd36 gene expression and vice versa (Supplemental
303 Figure 3D).
12 Diabetes Page 14 of 39
304 To further investigate the potential mechanism of RabGAP-regulated fatty acid transport, we
305 conducted siRNA-mediated knockdown experiments of Tbc1d1 in C2C12 myotubes and
306 measured plasma membrane and total SLC27A4/FATP4 abundance via Western Blot analysis.
307 Interestingly, membrane SLC27A4/FATP4 localization was increased upon Tbc1d1-deficiency
308 compared to non-target-control cells (Figure 4C). In accordance to our previous results [5], ex
309 vivo FAO was enhanced in EDL muscle from D1KO and D4KO and Soleus muscle from D1KO
310 mice, respectively, following IVE of non-target siRNA oligonucleotides. Most notable,
311 knockdown of Slc27a4/Fatp4 via IVE technology abolished the elevated rate of FAO in EDL
312 and Soleus muscle of D1KO and D4KO, respectively (Figure 4D-F).
313
314 Tbc1d1-deficiency leads to a redistribution of fatty acid species in skeletal muscle.
315 Next, we investigated distribution of different lipid species in skeletal muscle from Tbc1d1-
316 deficient mice (D1KO). Despite the fact that the overall gene expression profile of cultured
317 muscle cells or skeletal muscle after TBC1D1 depletion did not show marked changes
318 (Supplemental Figure 4A, C), we speculated that the proportions of cellular lipid species might
319 be altered due the enhanced FA uptake and oxidation in D1KO skeletal muscle. Total amount
320 of fatty acids showed a trend to increase in Gastrocnemius muscle of D1KO (Figure 5A) with
321 changes in the composition of different fatty acid species. In skeletal muscle from D1KO mice,
322 the amount of saturated fatty acids (SFA) was reduced (Figure 5B, E), MUFA content
323 (monounsaturated fatty acids) was increased (Figure 5C, E), and no change in PUFA (poly-
324 unsaturated fatty acid) levels were observed (Figure 5D, E). A more detailed analysis of the
325 individual percent of distinct fatty acid species within the muscle revealed that the amount of
326 four distinct fatty acid species was different between the two genotypes. Skeletal muscle from
327 D1KO mice showed lower amounts of saturated palmitic acid (C16:0) and polyunsaturated
328 arachidonic acid (C20:4). In contrast, levels of monounsaturated palmitoleic acid (C16:1) and
329 oleic acid (C18:1) were significantly increased in Gastrocnemius muscle samples from D1KO
13 Page 15 of 39 Diabetes
330 animals (Figure 5F). Deduced from the measured values for each fatty acid, enzyme activity of
331 stearoyl-CoA desaturase-1 (SCD1), an enzyme that catalyzes the conversion of C16:0 and
332 C18:0 saturated fatty acids into the monounsaturated fatty acids palmitoleic acid (C16:1)
333 (Figure 5G) and oleic acid (C18:1) (Figure 5H) was increased in D1KO skeletal muscle. In
334 contrast, activity of Δ5-desaturase, calculated as the ratio of arachidonic acid (C20:4) and α-
335 Linoleic acid (C18:3) was significantly decreased in Gastrocnemius muscle from D1KO mice
336 (Figure 5I).
337
338 Discussion
339 In the present study we investigated the contribution of the RabGAPs TBC1D1 and TBC1D4
340 to fatty acid uptake and oxidation in skeletal muscle. Our results demonstrate that both
341 RabGAPs regulate entry of long-chain fatty acids (LCFAs) through a RabGTPase-dependent
342 pathway that involves the long-chain fatty acid transport protein 4 (SLC27A4/FATP4).
343 Previous studies showed that ablation of either Tbc1d1, Tbc1d4 or both RabGAPs in skeletal
344 muscle results in greatly reduced insulin-stimulated glucose uptake due to compromised
345 trafficking of the glucose transporter GLUT4 [1, 5, 13-16, 40, 41]. Moreover, we and others
346 reported that RabGAP-deficiency also results in increased uptake and oxidation of palmitic acid
347 in skeletal muscle and cultured muscle cells [16, 42]. Because overexpression of intact Tbc1d1,
348 but not a GAP-inactive R941K mutant, decreased palmitate uptake and oxidation in both
349 isolated skeletal muscle and cultured muscle cells [16, 43], we speculated that the two
350 RabGAPs may regulate uptake of glucose and fatty acids through distinct Rab-dependent
351 pathways.
352 Neither the abundance of proteins involved in mitochondrial oxidative phosphorylation, nor
353 mitochondrial copy number or citrate synthase activity was altered in Tbc1d1-deficient skeletal
354 muscle [40]. Electroporation-mediated overexpression of Tbc1d1 was reported to reduce fatty
355 acid oxidation and β-HAD (beta-hydroxyacyl-CoA dehydrogenase) activity, a key enzyme of
14 Diabetes Page 16 of 39
356 mitochondrial β-oxidation [43] whereas β-HAD activity was unaltered in skeletal muscle from
357 Tbc1d1 knockout rats that displayed increased in vivo and ex vivo skeletal muscle fat oxidation
358 [42]. In this study, mitochondrial OXPHOS proteins were not altered in EDL and Soleus muscle
359 of D1KO and D4KO mice, and consistent differences in key enzymes for energy metabolism
360 such as PDK4 were not observed in the muscles, presumably reflecting the complexity of
361 energy metabolism in different muscle types and fibers [44, 45]. An increased influx of LCFAs
362 may therefore not be driven by increased mitochondrial activity but rather result from elevated
363 activity or abundance of fatty acid transporters or other non-mitochondrial metabolizing
364 enzymes [46]. In accordance to previous studies in skeletal muscle [16, 42], we show here that
365 knockdown of both Tbc1d1 or Tbc1d4 specifically increases uptake of both saturated and
366 unsaturated LCFAs whereas uptake of short-chain fatty acids (SCFAs) into skeletal muscle
367 cells remains unaltered. This indicates that RabGAP-deficiency increases fatty acid transport
368 via specialized long-chain fatty acid transporter enzymes rather than activating passive
369 diffusion through the plasma membrane, which has been proposed to be the predominant
370 mechanism for SCFA uptake [19, 20, 47].
371 Several RabGTPases have been implicated to play roles in translocation of GLUT4 including
372 Rab4, Rab8a, Rab8b, Rab10, Rab11, Rab13, and Rab14 [48, 49]. Here, we show that
373 knockdown of Rab8a, Rab8b, Rab10, and Rab14 decreases palmitate uptake in both basal and
374 insulin-stimulated muscle cells (Supplemental Figure 4B), whereas depletion of Rab28, which
375 is also a substrate for TBC1D1 and TBC1D4 [3], has no effect (Figure 2E). These data suggest
376 that fatty acid uptake utilizes a specific subset of RabGTPases downstream of TBC1D1 and
377 TBC1D4 which partially overlaps with the substrate specificity of the RabGAPs in vitro [3].
378 More specifically, Rab8a may represent the major RabGAP substrate mediating FAO as
379 knockdown of Rab8a but not Rab10 in intact isolated skeletal muscle via IVE technology led
380 to a decrease of 3H-palmitate oxidation (Figure 2F and Supplemental Figure 1B). A reduction
381 in FAO was detected following Rab8a knockdown in intact Soleus but not EDL muscle,
15 Page 17 of 39 Diabetes
382 indicating a more complex relationship between RabGAP-RabGTPase interaction and different
383 types of skeletal muscle fibers. Divergent mechanisms of lipid accumulation and mitochondrial
384 function have already been described for oxidative/slow-twitch and glycolytic/fast-twitch
385 muscle fibers [50, 51]. Further studies are required to investigate the specific contribution of
386 individual Rab GTPases to fatty acid uptake and metabolism in muscle cells.
387 Our findings indicate a possible involvement of LCFA-specific metabolizing enzymes and/or
388 transporters expressed in skeletal muscle including fatty acid translocase FAT/CD36 and fatty
389 acid transporters of the FATP protein family [25, 52]. FAT/CD36 has been implicated in fatty
390 acid uptake in skeletal muscle and the heart [30, 53]. In analogy to the insulin-regulated glucose
391 transporter GLUT4, FAT/CD36 was found to undergo recruitment from intracellular pools to
392 the plasma membrane in response to insulin and contraction [24, 54, 55]. Consistent with a
393 possible role of RabGAPs in the regulation of FAT/CD36 traffic and subcellular localization,
394 knockdown of Tbc1d4 as well as overexpression of constitutively active Rab8a, Rab10 and
395 Rab14 led to a redistribution of FAT/CD36-associated immunofluorescence to the plasma
396 membrane in cardiomyocytes [23]. In previous studies, RabGAPs were also related to the
397 expression levels of Cd36. Miklosz and colleagues found in rat L6 myotubes that Tbc1d4
398 silencing increased the expression levels of Cd36 whereas transient overexpression of Tbc1d1
399 in mouse skeletal muscle led to reduced palmitate oxidation without altering FAT/CD36 protein
400 abundance [22, 43, 56]. Tbc1d1-deficient TA muscles from our knockout mice did not display
401 increased mRNA and protein levels of FAT/CD36, albeit there was a trend towards increased
402 levels of expression. For further in-depth analysis of a possible function of FAT/CD36 in
403 RabGAP deficiency, we followed a genetic approach by generating Cd36/RabGAP-double-
404 deficient mice (D1/CD36KO; D4/CD36KO) and analyzing fatty acid uptake into intact isolated
405 skeletal muscle. As expected, skeletal muscle from Cd36-knockout mice displayed reduced
406 uptake of palmitate compared to wildtype littermates as reported previously [30]. However,
407 muscles from D1/CD36KO and D4/CD36KO double knockout animals showed similarly
16 Diabetes Page 18 of 39
408 elevated fatty acid uptake as compared to the single RabGAP knockout muscles with an intact
409 Cd36 gene. These findings rule out a major contribution of FAT/CD36 in the observed elevated
410 fatty acid uptake in response to RabGAP-deficiency in mouse skeletal muscle. In addition to
411 FAT/CD36, the fatty acid transport protein SLC27A4/FATP4 has been reported to catalyze
412 uptake of LCFAs into skeletal muscle where its intrinsic acyl-CoA activity may contribute to
413 its transport activity [57]. Similar to FAT/CD36, plasma membrane SLC27A4/FATP4 was
414 found to be increased in response to stimuli such as insulin and contraction in skeletal muscle
415 [54]. EDL and Soleus skeletal muscle from both D1KO and D4KO mice displayed an increase
416 in SLC27A4/FATP4 protein, indicating that this transporter might contribute at least in part to
417 the elevated FAO in RabGAP-deficient skeletal muscle. However, a contribution of this fatty
418 acid transporter in the elevated fat utilization of the animals may not be strictly dependent on
419 protein amount alone but involve intracellular trafficking and translocation processes. As
420 FATP4-null mice display neonatal lethality [58, 59], crossbreeding and generation of
421 FATP4/RabGAP double-deficient mice was not possible. Therefore, we first analyzed
422 palmitate uptake in cultured muscle cells after knockdown of the FATP4 gene Slc27a4 and each
423 of the two RabGAPs, revealing that the increase in palmitate uptake in RabGAP-deficiency is
424 strictly dependent on the presence of SLC27A4/FATP4 in these cells. Likewise, knockdown of
425 Slc27a4/FATP4 completely abrogated the elevated FAO in intact isolated EDL and Soleus
426 muscle from D1KO and D4KO mice. Interestingly, knockdown of Tbc1d1 or Tbc1d4 was
427 associated with an enrichment of Slc27a4/FATP4 protein in the plasma membrane, indicating
428 that RabGAPs may regulate both abundance and subcellular localization of the protein. Further
429 studies however are required to elucidate the precise molecular mechanism of RabGAP-
430 dependent regulation of FA transport.
431 Global Tbc1d1-deficiency in mice is associated with a moderate increase in mono-unsaturated
432 fatty acids (MUFA) and a concomitant decrease of saturated fatty acids (SFA) in skeletal
433 muscle. As MUFA content of muscle lipids is increased with insulin resistance and obesity and
17 Page 19 of 39 Diabetes
434 has been shown to correlate with Δ9 desaturase activity in human muscle cells, it appears that
435 RabGAPs may contribute to systemic insulin sensitivity through alterations in lipid
436 composition [60]. A recent study in L6 myotubes showed that knockdown of Tbc1d4 also led
437 to alterations in the ratio of SFA and MUFA [56]. Interestingly, indigenous people of Greenland
438 frequently carry a loss-of-function mutation in the related TBC1D4 gene which may reflect a
439 genetic adaptation to the traditional hypoglycemic, fat-rich diet of the Inuits [61, 62]. However,
440 the alterations in the fatty acid profile of Gastrocnemius muscle from D1KO mice were rather
441 minor which might be due to the diet and age of the mice, as well as the skeletal muscle type
442 analyzed. Further studies are required to investigate alteration in metabolic fluxes of RabGAP-
443 deficient muscle tissue.
444 Collectively, our data demonstrate that both TBC1D1 and TBC1D4 specifically control entry
445 of LCFAs into skeletal muscle through a mechanism that requires a subset of RabGTPases
446 involved also in GLUT4 translocation. Fatty acid transporter SLC27A4/FATP4 is a likely
447 candidate mediating RabGAP-dependent lipid uptake, resulting in an altered lipid composition.
448 A possible regulatory pathway of RabGAP-dependent SLC27A4/FATP4 trafficking within the
449 muscle cell can be hypothesized, the exact mechanisms, however, remain to be determined.
450 Unraveling the mechanisms underlying RabGAP-dependent lipid flux in skeletal muscle are an
451 important step towards the understanding of skeletal muscle adaptations during the
452 pathophysiology of insulin resistance and type-2 diabetes.
453
454 Acknowledgements
455 We thank Angelika Horrighs, Anette Kurowski, Heidrun Podini, Carina Heitmann, Dagmar
456 Grittner, Antonia Osmers, Annette Schober, Lothar Bohne, Martina Schiller, Jennifer
457 Schwettmann and Denise Schauer for expert technical assistance. We also thank Dr. Maria
458 Febbraio for generously providing the Cd36 knockout mice. This work was supported by the
459 German Center for Diabetes Research (DZD e.V.) of the Federal Ministry for Education and
18 Diabetes Page 20 of 39
460 Research (BMBF) and the Ministry of Science and Research of the State North Rhine-
461 Westphalia (MIWF NRW) and funded in part by grants from the Deutsche
462 Forschungsgemeinschaft (CH1659 to AC), and the EFSD/Novo Nordisk program (to HA).
463
464 Author contributions
465 T.B., A.C. and H.A-H. wrote the manuscript and analyzed and interpreted the data. T.B., L.E.,
466 S.E., I.Z., I.S., F.M., C.K., H.B., S.C., J.K. and Z.Z. performed the experiments and analyzed
467 data. A.C. and H.A-H. were involved in the study design and contributed to data interpretation.
468 A.C. is the guarantor of this work and, as such, had full access to all of the data in the study and
469 takes responsibility for the integrity of the data and the accuracy of the data analysis.
470
471 Duality of interest
472 The authors declare no duality of interests associated with this manuscript.
473
474 References
475 1. Hargett, S.R., N.N. Walker, and S.R. Keller, Rab GAPs AS160 and Tbc1d1 play 476 nonredundant roles in the regulation of glucose and energy homeostasis in mice. Am J 477 Physiol Endocrinol Metab, 2016. 310(4): p. E276-88. 478 2. Mafakheri, S., A. Chadt, and H. Al-Hasani, Regulation of RabGAPs involved in insulin 479 action. Biochem Soc Trans, 2018. 46(3): p. 683-690. 480 3. Zhou, Z., et al., Rab28 is a TBC1D1/TBC1D4 substrate involved in GLUT4 trafficking. 481 FEBS Lett, 2017. 591(1): p. 88-96. 482 4. Roach, W.G., et al., Substrate specificity and effect on GLUT4 translocation of the Rab 483 GTPase-activating protein Tbc1d1. Biochem J, 2007. 403(2): p. 353-8. 484 5. Chadt, A., et al., "Deletion of both Rab-GTPase-activating proteins TBC1D1 and 485 TBC1D4 in mice eliminates insulin- and AICAR-stimulated glucose transport 486 [corrected]. Diabetes, 2015. 64(3): p. 746-59. 487 6. Eathiraj, S., et al., Structural basis of family-wide Rab GTPase recognition by 488 rabenosyn-5. Nature, 2005. 436(7049): p. 415-9. 489 7. Novick, P., Regulation of membrane traffic by Rab GEF and GAP cascades. Small 490 GTPases, 2016. 7(4): p. 252-256. 491 8. Stenmark, H., Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol, 492 2009. 10(8): p. 513-25. 493 9. Miinea, C.P., et al., AS160, the Akt substrate regulating GLUT4 translocation, has a 494 functional Rab GTPase-activating protein domain. Biochem J, 2005. 391(Pt 1): p. 87- 495 93.
19 Page 21 of 39 Diabetes
496 10. Gorgens, S.W., et al., Hypoxia in Combination With Muscle Contraction Improves 497 Insulin Action and Glucose Metabolism in Human Skeletal Muscle via the HIF-1alpha 498 Pathway. Diabetes, 2017. 66(11): p. 2800-2807. 499 11. Mafakheri, S., et al., AKT and AMP-activated protein kinase regulate TBC1D1 through 500 phosphorylation and its interaction with the cytosolic tail of insulin-regulated 501 aminopeptidase IRAP. J Biol Chem, 2018. 293(46): p. 17853-17862. 502 12. Ishikura, S. and A. Klip, Muscle cells engage Rab8A and myosin Vb in insulin- 503 dependent GLUT4 translocation. Am J Physiol Cell Physiol, 2008. 295(4): p. C1016- 504 25. 505 13. Hargett, S.R., et al., Deletion of the Rab GAP Tbc1d1 modifies glucose, lipid, and 506 energy homeostasis in mice. Am J Physiol Endocrinol Metab, 2015. 309(3): p. E233- 507 45. 508 14. Lansey, M.N., et al., Deletion of Rab GAP AS160 modifies glucose uptake and GLUT4 509 translocation in primary skeletal muscles and adipocytes and impairs glucose 510 homeostasis. Am J Physiol Endocrinol Metab, 2012. 303(10): p. E1273-86. 511 15. Wang, H.Y., et al., AS160 deficiency causes whole-body insulin resistance via 512 composite effects in multiple tissues. Biochem J, 2013. 449(2): p. 479-89. 513 16. Chadt, A., et al., Tbc1d1 mutation in lean mouse strain confers leanness and protects 514 from diet-induced obesity. Nat Genet, 2008. 40(11): p. 1354-9. 515 17. Charney, A.N., L. Micic, and R.W. Egnor, Nonionic diffusion of short-chain fatty acids 516 across rat colon. Am J Physiol, 1998. 274(3): p. G518-24. 517 18. Kamp, F. and J.A. Hamilton, How fatty acids of different chain length enter and leave 518 cells by free diffusion. Prostaglandins Leukot Essent Fatty Acids, 2006. 75(3): p. 149- 519 59. 520 19. Schwenk, R.W., et al., Fatty acid transport across the cell membrane: regulation by 521 fatty acid transporters. Prostaglandins Leukot Essent Fatty Acids, 2010. 82(4-6): p. 522 149-54. 523 20. Glatz, J.F.C. and J. Luiken, Dynamic role of the transmembrane glycoprotein CD36 524 (SR-B2) in cellular fatty acid uptake and utilization. J Lipid Res, 2018. 59(7): p. 1084- 525 1093. 526 21. Anderson, C.M. and A. Stahl, SLC27 fatty acid transport proteins. Mol Aspects Med, 527 2013. 34(2-3): p. 516-28. 528 22. Miklosz, A., et al., The Effects of AS160 Modulation on Fatty Acid Transporters 529 Expression and Lipid Profile in L6 Myotubes. Cell Physiol Biochem, 2016. 38(1): p. 530 267-82. 531 23. Samovski, D., et al., Insulin and AMPK regulate FA translocase/CD36 plasma 532 membrane recruitment in cardiomyocytes via Rab GAP AS160 and Rab8a Rab GTPase. 533 J Lipid Res, 2012. 53(4): p. 709-17. 534 24. Luiken, J.J., et al., Insulin induces the translocation of the fatty acid transporter 535 FAT/CD36 to the plasma membrane. Am J Physiol Endocrinol Metab, 2002. 282(2): p. 536 E491-5. 537 25. Nickerson, J.G., et al., Greater transport efficiencies of the membrane fatty acid 538 transporters FAT/CD36 and FATP4 compared with FABPpm and FATP1 and 539 differential effects on fatty acid esterification and oxidation in rat skeletal muscle. J Biol 540 Chem, 2009. 284(24): p. 16522-30. 541 26. Glatz, J.F., et al., Regulation of the subcellular trafficking of CD36, a major determinant 542 of cardiac fatty acid utilization. Biochim Biophys Acta, 2016. 1861(10): p. 1461-71. 543 27. Sun, Y., et al., Rab8A and Rab13 are activated by insulin and regulate GLUT4 544 translocation in muscle cells. Proc Natl Acad Sci U S A, 2010. 107(46): p. 19909-14. 545 28. Stockli, J., D.J. Fazakerley, and D.E. James, GLUT4 exocytosis. J Cell Sci, 2011. 124(Pt 546 24): p. 4147-59.
20 Diabetes Page 22 of 39
547 29. Stermann, T., et al., Deletion of the RabGAP TBC1D1 Leads to Enhanced Insulin 548 Secretion and Fatty Acid Oxidation in Islets From Male Mice. Endocrinology, 2018. 549 159(4): p. 1748-1761. 550 30. Febbraio, M., et al., A null mutation in murine CD36 reveals an important role in fatty 551 acid and lipoprotein metabolism. J Biol Chem, 1999. 274(27): p. 19055-62. 552 31. Cleasby, M.E., et al., Acute bidirectional manipulation of muscle glucose uptake by in 553 vivo electrotransfer of constructs targeting glucose transporter genes. Diabetes, 2005. 554 54(9): p. 2702-11. 555 32. Satkauskas, S., et al., Mechanisms of in vivo DNA electrotransfer: respective 556 contributions of cell electropermeabilization and DNA electrophoresis. Mol Ther, 2002. 557 5(2): p. 133-40. 558 33. Wiza, C., et al., Over-expression of PRAS40 enhances insulin sensitivity in skeletal 559 muscle. Arch Physiol Biochem, 2014. 120(2): p. 64-72. 560 34. Lambernd, S., et al., Contractile activity of human skeletal muscle cells prevents insulin 561 resistance by inhibiting pro-inflammatory signalling pathways. Diabetologia, 2012. 562 55(4): p. 1128-39. 563 35. Czech, M.P. and J.M. Buxton, Insulin action on the internalization of the GLUT4 564 glucose transporter in isolated rat adipocytes. J Biol Chem, 1993. 268(13): p. 9187-90. 565 36. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real- 566 time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 567 402-8. 568 37. Knebel, B., et al., Adipokinome Signatures in Obese Mouse Models Reflect Adipose 569 Tissue Health and Are Associated with Serum Lipid Composition. Int J Mol Sci, 2019. 570 20(10). 571 38. Cinci, G., et al., Fatty acid composition of phospholipids, triglycerides and cholesterol 572 in serum of castrated and estradiol treated rats. Life Sci, 2000. 66(17): p. 1647-54. 573 39. Knebel, B., et al., Fatty Liver Due to Increased de novo Lipogenesis: Alterations in the 574 Hepatic Peroxisomal Proteome. Front Cell Dev Biol, 2019. 7: p. 248. 575 40. Dokas, J., et al., Conventional knockout of Tbc1d1 in mice impairs insulin- and AICAR- 576 stimulated glucose uptake in skeletal muscle. Endocrinology, 2013. 154(10): p. 3502- 577 14. 578 41. Xie, B., et al., The Inactivation of RabGAP Function of AS160 Promotes Lysosomal 579 Degradation of GLUT4 and Causes Postprandial Hyperglycemia and 580 Hyperinsulinemia. Diabetes, 2016. 65(11): p. 3327-3340. 581 42. Whitfield, J., et al., Ablating the protein TBC1D1 impairs contraction-induced 582 sarcolemmal glucose transporter 4 redistribution but not insulin-mediated responses in 583 rats. J Biol Chem, 2017. 292(40): p. 16653-16664. 584 43. Maher, A.C., et al., TBC1D1 reduces palmitate oxidation by inhibiting beta-HAD 585 activity in skeletal muscle. Am J Physiol Regul Integr Comp Physiol, 2014. 307(9): p. 586 R1115-23. 587 44. Pette, D., The adaptive potential of skeletal muscle fibers. Can J Appl Physiol, 2002. 588 27(4): p. 423-48. 589 45. Lacour, J.R., [Muscle activity and energy expenditure]. Rev Mal Respir, 2011. 28(10): 590 p. 1278-92. 591 46. Ikeda, S., et al., Up-regulation of SREBP-1c and lipogenic genes in skeletal muscles 592 after exercise training. Biochem Biophys Res Commun, 2002. 296(2): p. 395-400. 593 47. Luiken, J.J., et al., Skeletal muscle fatty acid transport and transporters. Int J Sport Nutr 594 Exerc Metab, 2001. 11 Suppl: p. S92-6. 595 48. Jaldin-Fincati, J.R., et al., Update on GLUT4 Vesicle Traffic: A Cornerstone of Insulin 596 Action. Trends Endocrinol Metab, 2017. 28(8): p. 597-611.
21 Page 23 of 39 Diabetes
597 49. Foster, L.J. and A. Klip, Mechanism and regulation of GLUT-4 vesicle fusion in muscle 598 and fat cells. Am J Physiol Cell Physiol, 2000. 279(4): p. C877-90. 599 50. Komiya, Y., et al., Mouse soleus (slow) muscle shows greater intramyocellular lipid 600 droplet accumulation than EDL (fast) muscle: fiber type-specific analysis. J Muscle Res 601 Cell Motil, 2017. 38(2): p. 163-173. 602 51. Warren, B.E., et al., Early mitochondrial dysfunction in glycolytic muscle, but not 603 oxidative muscle, of the fructose-fed insulin-resistant rat. Am J Physiol Endocrinol 604 Metab, 2014. 306(6): p. E658-67. 605 52. Glatz, J.F., J.J. Luiken, and A. Bonen, Membrane fatty acid transporters as regulators 606 of lipid metabolism: implications for metabolic disease. Physiol Rev, 2010. 90(1): p. 607 367-417. 608 53. Coburn, C.T., et al., Defective uptake and utilization of long chain fatty acids in muscle 609 and adipose tissues of CD36 knockout mice. J Biol Chem, 2000. 275(42): p. 32523-9. 610 54. Jain, S.S., et al., Additive effects of insulin and muscle contraction on fatty acid 611 transport and fatty acid transporters, FAT/CD36, FABPpm, FATP1, 4 and 6. FEBS 612 Lett, 2009. 583(13): p. 2294-300. 613 55. Steinbusch, L.K., et al., Subcellular trafficking of the substrate transporters GLUT4 and 614 CD36 in cardiomyocytes. Cell Mol Life Sci, 2011. 68(15): p. 2525-38. 615 56. Miklosz, A., et al., Challenging of AS160/TBC1D4 Alters Intracellular Lipid milieu in 616 L6 Myotubes Incubated With Palmitate. J Cell Physiol, 2017. 232(9): p. 2373-2386. 617 57. Coe, N.R., et al., The fatty acid transport protein (FATP1) is a very long chain acyl- 618 CoA synthetase. J Biol Chem, 1999. 274(51): p. 36300-4. 619 58. Herrmann, T., et al., Mice with targeted disruption of the fatty acid transport protein 4 620 (Fatp 4, Slc27a4) gene show features of lethal restrictive dermopathy. J Cell Biol, 2003. 621 161(6): p. 1105-15. 622 59. Gimeno, R.E., et al., Targeted deletion of fatty acid transport protein-4 results in early 623 embryonic lethality. J Biol Chem, 2003. 278(49): p. 49512-6. 624 60. Hulver, M.W., et al., Elevated stearoyl-CoA desaturase-1 expression in skeletal muscle 625 contributes to abnormal fatty acid partitioning in obese humans. Cell Metab, 2005. 2(4): 626 p. 251-61. 627 61. Fumagalli, M., et al., Greenlandic Inuit show genetic signatures of diet and climate 628 adaptation. Science, 2015. 349(6254): p. 1343-7. 629 62. Moltke, I., et al., A common Greenlandic TBC1D4 variant confers muscle insulin 630 resistance and type 2 diabetes. Nature, 2014. 512(7513): p. 190-3. 631 632
22 Diabetes Page 24 of 39
633 Figure legends
634 Figure 1: Tbc1d1 and Tbc1d4 deficiency increases long-chain fatty acid uptake in vitro. Uptake
635 of ³H-Palmitate into C2C12 myotubes after siRNA-mediated Tbc1d1 (A) and Tbc1d4 (B)
636 knockdown, respectively. Knockdown (Kd) efficiency for both RabGAPs can be seen in the
637 interlaced graph of either panel figure A or B. (C) Oxidation of ³H-Palmitate after silencing of
638 Tbc1d1 and Tbc1d4, respectively. Uptake of (D) ³H-Oleate and (E) ³H-Butyrate after silencing
639 of either Tbc1d1 or Tbc1d4. Data are presented as mean ± SEM (n = 6-10). *p < 0.05, non-
640 target control vs. Tbc1d1 siRNA or Tbc1d4 siRNA kd (paired two-tailed Student's t-test).
641 (F) Normalized mRNA expression of Tbc1d1 and Tbc1d4 in C2C12 myoblasts and myotubes,
642 respectively. ΔCt-values (with the geometric mean of Tbp and Rplp0 as housekeeping genes)
643 were measured by quantitative real time PCR, corrected and normalized using standard
644 concentration curves [29]. Data are presented as mean ± SEM (n = 6). *p < 0.05, non-target
645 control vs. Tbc1d1 siRNA or Tbc1d4 siRNA kd (unpaired two-tailed Student's t-test).
646
647 Figure 2: Downstream targets of TBC1D1 and TBC1D4 critically regulate fatty acid uptake
648 and oxidation in vitro and ex vivo. Uptake of ³H-palmitate into C2C12 myotubes after siRNA-
649 mediated knockdown of Rab8a (A), Rab8b (B), Rab10 (C) Rab14 (D) and Rab28 (E).
650 Knockdown (Kd) efficiency for all five Rab genes can be seen in the interlaced graph of either
651 panel figure A - E. (F) Ex vivo ³H-Palmitate oxidation of EDL and Soleus (SOL) skeletal
652 muscles after in vivo electrotransfection-mediated knockdown of Rab8a. Data are presented as
653 mean ± SEM (n = 7-13). *p < 0.05, **p < 0.01, ***p < 0.001, non-target control vs. respective
654 Rab siRNA kd (paired two-tailed Student's t-test).
655
656 Figure 3: Tbc1d1- and Tbc1d4-deficiency leads to increased SLC27A4/FATP4, but not PDK4
657 or FAT/CD36 protein abundance in EDL and Soleus skeletal muscles. Representative Western
658 Blot membranes from (A) D1KO and (B) D4KO skeletal muscles after analysis of TBC1D1,
23 Page 25 of 39 Diabetes
659 TBC1D4, PDK4, Fat/CD36 and FATP4. Quantification of protein abundance for (C, D) PDK4,
660 (E, F) FAT/CD36 and (G, H) FATP4 in EDL and Soleus (SOL) muscles from D1KO and D4KO
661 animals, respectively. Data are presented as mean ± SEM (n = 6-13). *p < 0.05, **p < 0.01,
662 WT vs. RabGAP-KO (unpaired two-tailed Student's t-test).
663
664 Figure 4: Fatty acid transporter FATP4 but not FAT/CD36 is specifically regulating RabGAP-
665 dependent fatty acid uptake into skeletal muscle.
666 (A) Ex vivo ³H-Palmitate uptake in mouse EDL muscles from WT, Tbc1d1- (D1KO), Tbc1d4-
667 (D4KO), Cd36- (CD36KO), Tbc1d1-Cd36- (D1CD36KO), and Tbc1d4-Cd36-double-deficient
668 (D4CD36KO) animals. Data are presented as mean ± SEM (n = 5-22). ***p < 0.001, ****p <
669 0.0001 between RabGAP genotypes; ##p < 0.01, ####p < 0.0001 compared to the WT control
670 (two-way ANOVA with Tukey post hoc test). (B) In vitro ³H-Palmitate uptake into C2C12
671 myotubes after silencing of Slc27a4 (FATP4), Tbc1d1, Tbc1d4 or combined siRNA-mediated
672 knockdown of Tbc1d1 and Slc27a4/Fatp4, or Tbc1d4 and Slc27a4/Fatp4, respectively. Data
673 presented as mean ± SEM (n = 7). **p < 0.01, ***p < 0.001, ****p < 0.0001 between indicated
674 groups (two-way ANOVA with Tukey post hoc test. (C) FATP4 membrane localization
675 following knockdown of Tbc1d1 in C2C12 myotubes using siRNA-technology. Tbc1d1
676 knockdown efficiency can be seen in the interlaced graph of the panel figure, depicted as protein
677 abundance measured by Western Blot analysis. FATP4 membrane localization was calculated
678 as ratio between membrane FATP4 (mFATP4) and total FATP4 (tFATP4), both determined by
679 Western Blot analysis. Data are presented as mean ± SEM (n = 5). *p < 0.05, non-target control
680 vs. Tbc1d1 kd (paired two-tailed Student's t-test). (D) FATP4 protein abundance following
681 knockdown of Tbc1d1 in EDL and Soleus muscles from D1KO and D4KO animals and
682 respective WT controls using siRNA and in vivo electroporation (IVE). Slc27a4/Fatp4
683 knockdown efficiency was determined by Western Blot analysis. Data are presented as mean ±
684 SEM (n = 3-5). *p < 0.05, non-target control vs. Tbc1d1 kd (paired two-tailed Student's t-test).
24 Diabetes Page 26 of 39
685 Ex vivo Oxidation of ³H-Palmitate after silencing of Slc27a4/Fatp4 in EDL (E) and Soleus (E)
686 muscles from D1KO and D4KO animals, respectively, via IVE technology. Data are presented
687 as mean ± SEM (n = 5-11). *p < 0.05, **p < 0.01 between indicated genotypes; #p < 0.05 non-
688 target control vs. Slc27a4/Fatp4 Kd (mixed model two-way ANOVA with repeated measures
689 analysis for the Kd condition and Tukey post hoc test). Knockdown conditions were treated as
690 pairs in the analysis due to the experimental design (one leg transfected with non-target, the
691 second leg transfected with Kd siRNA oligonucleotides), whereas comparisons between
692 genotypes were treated as independent parameters.
693
694 Figure 5: Fatty acid profile in Gastrocnemius skeletal muscle from WT vs. D1KO mice differs
695 with regard to the fatty acid saturation grade. Amount of (A) total fatty acids. (B) Percentage
696 of saturated fatty acids (SFAs), (C) mono-unsaturated fatty acids (MUFAs), and (D) poly-
697 unsaturated fatty acids (PUFAs) of total fatty acid content (A). The results are summarized as
698 contribution of each class to total fatty acid content (E). Total evaluated fatty acid profile as
699 percentage of total fatty acids measured (F). Calculated C16 Δ9-desaturase activity index
700 (16:1/16:0) (G), C18 Δ9-desaturase activity index (18:1/18:0) (H) and Δ5-desaturase activity
701 index (C20:4/C18:2) (I). Data presented as mean ± SEM (n = 9-11). *p < 0.05, **p < 0.01, WT
702 vs. D1KO Gastrocnemius skeletal muscle samples (unpaired two-tailed Student's t-test).
25 Page 27 of 39 Diabetes
209x264mm (300 x 300 DPI) Diabetes Page 28 of 39
209x266mm (300 x 300 DPI) Page 29 of 39 Diabetes
209x250mm (300 x 300 DPI) Diabetes Page 30 of 39
209x297mm (300 x 300 DPI) Page 31 of 39 Diabetes
209x266mm (300 x 300 DPI) Diabetes Page 32 of 39
Supplemental material
Supplemental Figure 1. (A) Protein abundance of Rab8a following siRNA-mediated knockdown of Rab8 via IVE in EDL and Soleus muscle from C57BL/6J mice. Data are presented as mean ± SEM (n = 4). *p < 0.05, non-target control vs. Rab8a kd (paired two-tailed Student's t-test). (B) Ex vivo fatty acid oxidation in intact isolated Soleus skeletal muscle after in vivo electrotransfection-mediated knockdown of Rab10. Data are presented as mean ± SEM (n = 3). non-target control vs. Rab10 kd (paired two-tailed Student's t-test). (C) Relative mRNA expression of Tbc1d1, Rab8a, Rab10 and Rab14 in C2C12 myotubes following siRNA- mediated silencing of Tbc1d1. Data are presented as mean ± SEM (n = 4). *p < 0.05, non-target control vs. Tbc1d1 kd, (paired two-tailed Student's t-test). (D) Relative mRNA expression of Tbc1d4, Rab8a, Rab10 and Rab14 in C2C12 myotubes following siRNA-mediated silencing of Tbc1d4. Data are presented as mean ± SEM (n = 4-5). *p < 0.05, non-target control vs. Tbc1d1 kd (paired two-tailed Student's t-test). Page 33 of 39 Diabetes
Supplemental Figure 2. Protein abundance of (A) PDK4, (B) FAT/CD36 and (C) SLC27A4/FATP4 in WT vs. D1KO mouse Tibialis anterior (TA) muscle samples. The corresponding gene expression analysis for Pdk4, Cd36 and Slc27a4/Fatp4, respectively, can be seen in the interlaced graphs of either panel figure A, B and C. Data are presented as mean Diabetes Page 34 of 39
± SEM (n = 7-16). *p < 0.05 (unpaired two-tailed Student`s t-test). Protein abundance of Complexes I – V of the OXPHOS complex in EDL muscle from WT vs. (D) D1KO or (F) D4KO mice and Soleus (SOL) muscle from WT vs. (E) D1KO or (G) D4KO mice. Data are presented as mean ± SEM (n = 3-7). *p < 0.05 (unpaired two-tailed Student`s t-test).
Supplemental Figure 3. (A) Relative mRNA expression of Pdk4, Cd36 and Slc27a4 (= FATP4) in C2C12 myotubes following siRNA-mediated silencing of Tbc1d1. Data are presented as mean ± SEM (n = 6), non-target control vs. Tbc1d1 kd (paired two-tailed Student's t-test). (B) Validation of knockdown efficiency via quantitative Realtime-PCR in C2C12 myotubes following siRNA-mediated silencing of both, Tbc1d1 and FATP4 (Slc27a4). Data are presented as mean ± SEM (n = 4), non-target control vs. Tbc1d1/Fatp4 kd (paired two-tailed Student's t- test). (C) Uptake of ³H-palmitate into C2C12 myotubes after siRNA-mediated knockdown of Cd36. Knockdown (Kd) efficiency for Cd36 can be seen in the interlaced graph of the panel figure F. Data are presented as mean ± SEM (n = 6-7). ***p < 0.001, non-target control vs. Cd36 kd (paired two-tailed Student's t-test). (D) Relative mRNA expression of Cd36 and Slc27a4 (= FATP4) in C2C12 myotubes following siRNA-mediated silencing of Cd36 and Page 35 of 39 Diabetes
Slc27a4/Fatp4, respectively. Data are presented as mean ± SEM (n = 4-6), non-target control vs. Cd36 or Slc27a4/Fatp4 kd, respectively (one-way ANOVA with Dunnett post hoc test).
Supplemental Figure 4. (A) Relative gene expression of genes involved in the myocellular regulation of fatty acid metabolism in skeletal muscle from WT and D1KO mice, respectively. Data are presented as mean ± SEM (n = 4-14). *p < 0.05 (unpaired two-tailed t-test). (B) Uptake of ³H-palmitate into C2C12 myotubes after siRNA-mediated knockdown of Rab8a, Rab10 and Rab14 under basal and insulin-stimulated conditions, respectively. Data are presented as mean ± SEM (n = 5-11). **p < 0.01 between knockdown conditions and ##p < 0.01 for the stimulation with insulin within the respective genotype. (mixed model two-way ANOVA with repeated measures analysis for the Kd condition and Tukey post hoc test). (C) Relative gene expression of genes involved in the myocellular regulation of fatty acid metabolism in C2C12 myotubes following siRNA-mediated silencing of Tbc1d1. Data are presented as mean ± SEM (n = 6), non-target control vs. respective Tbc1d1 kd (paired two-tailed Student's t-test). Diabetes Page 36 of 39
Supplemental Table 1: Chemicals and buffer ingredients Compound Supplier 5-aminoimidazole-4-carboxyamide-1-β-D- Toronto Research Chemicals, North York ribofuranoside (AICAR) ON, Canada BSA Fraction V, fatty acid free Carl Roth, Karlsruhe, Germany Butyric Acid Sigma Aldrich, Steinheim, Germany Complete protease inhibitor cocktail Roche Diagnostics, Mannheim, Germany D(+)-Glucose, ≥99.5 % Sigma Aldrich, Steinheim, Germany Dulbecco´s modified eagle medium Gibco at Thermo Fisher Scientific, (DMEM), high glucose, L-Glutamine, Darmstadt, Germany sodium pyruvate, phenol red, w/o HEPES Thermo Fisher Scientific, Darmstadt, Fetal Bovine Serum (FBS) Germany Horse Serum (HS) ATCC at LGC Standards, Wesel, Germany Invivofectamine 2.0 Invitrogen, Carlsbad, California Isoflurane Piramal, Morpeth, UK Oleic Acid Sigma Aldrich, Steinheim, Germany Palmitic Acid Sigma Ultra approx. 99 % Sigma Aldrich, Steinheim, Germany Pentadecanoic acid Sigma Aldrich, Steinheim, Germany PhosSTOP phosphatase inhibitor cocktail Roche Diagnostics, Mannheim, Germany Protease inhibitor cocktail Roche Diagnostics, Mannheim, Germany
Supplemental Table 2: Buffers and cell culture media Description Ingredients DMEM (4.5 g/L glucose), 10 vol % FCS, 1 C2C12 culture medium vol % P/S DMEM (4.5 g/L glucose), 2 vol % HS, 1 vol C2C12 differentiation medium % P/S C2C12 starvation medium DMEM (4.5 g/L glucose), 1 vol % P/S C2C12 transfection medium DMEM (4.5 g/l glucose) KHB, 15 mM mannitol, 5 mM glucose, 0.6 Ex vivo fatty acid oxidation/uptake HOT mM cold palmitate, 20 % fatty acid-free incubation buffer BSA, 1.4 µM ³H-palmitate Ex vivo fatty acid oxidation/uptake pre- KHB, 15 mM mannitol, 5 mM glucose, 3.5 incubation buffer mM fatty acid-free BSA C2C12 differentiation medium, 11.8 µM In vitro fatty acid oxidation HOT buffer 14C-palmitate, 6.24 µM fatty acid-free BSA, 1 µM L-carnitine KRH, 8.5 nM ³H-palmitate/-oleate/-butyrate, In vitro fatty acid uptake HOT buffer 2.5 µM fatty acid-free BSA, 5 µM unlabeled cold palmitate/oleate/butyrate In vitro fatty acid uptake pre-HOT buffer KRH, 40 µM fatty acid-free BSA In vitro fatty acid uptake washing buffer KRH, 0.1 % fatty acid-free BSA Stock I: 118.5 mM NaCl, 0.047 mM KCl, 0.012 mM KH PO , 0.25 mM NaHCO Krebs-Henseleit buffer (KHB) 2 4 3 Stock II: 0.025 mM CaCl2, 0.012 mM MgSO4, 0.05 mM HEPES Page 37 of 39 Diabetes
Description Ingredients Krebs-Ringer-HEPES (KRH) buffer (pH 136 mM NaCl, 4.7 mM KCl, 1.25 mM 7.4) MgSO4, 1.25 mM CaCl2, 10 mM HEPES Lysis buffer (for tissue and cell protein 20 mM Tris-HCl, 150 mM NaCl, 1 mM isolation) EDTA, 1 mM EGTA, 1 % Triton X-100 20 mM Tris-HCL, 150 mM NaCl, 1 mM Protein lysis buffer EDTA, 1 mM EGTA, 1% Triton X-100 SDS-PAGE 1x electrophoresis buffer 25 mM Tris-HCl, 192 mM Glycine, 0.1 % (w/v) SDS SDS-PAGE 1x separation gel buffer (pH 500 mM Tris-HCl, 0.4 % SDS 8.8) SDS-PAGE 1x stacking gel buffer (pH 6.8) 0.5 M Tris, 0.4 % SDS Transfer buffer (Tank blotting) 25 mM Tris-HCl, 192 mM Glycine, 20 % Methanol Tris-buffered saline with Tween-20 (TBS- 10 mM Tris-HCl, 150 nM NaCl, 0.5 % T) Tween-20, pH 8.0
Supplemental Table 3: Genotyping primers Primer Sequence (5’ 3’) Tbc1d1-WT Fwd: GGACAAGCAGCTTTCTTGTTT Rev: TCCTGGTCCAGAAGCGAG Tbc1d1-KO Fwd: CAACATTCTGAAGGCCTTCTG Rev: TCCCTGGCTACAAGCTGAGT Tbc1d4 Fwd: AGTAGACTCAGAGTGGTCTTGG Tbc1d4-WT Rev: GTCTTCCGACTCCATATTTGC Tbc1d4-KO Rev: GCAGCGCATCGCCTTCTATC Cd36 Fwd: AGCTCATACATTGCTGTTTATGCATG Cd36-NEO Fwd: GGTACAATCACAGTGTTTTCTACGTGG Cd36 Rev: CCGCTTCCTCGTGCTTTACGGTATC
Supplemental Table 4: siRNA oligonucleotide sequences All siRNA oligonucleotides utilized in this study were purchased from Dharmacon (now: Horizon). The sequence and ordering information are listed in the following table. Designation Sequence (5’ 3’) Ordering Number siCd36 GAAAGGAUAACAUAAGCAAUU D-062017-01 siFatp1 UGACGGUGGUACUGCGCAA J-061607-09 siFatp4 AGACCAAGGUGCGACGGUA J-063631-09 siNT UAGCGACUAAACACAUCAAUU D-001210-01 siRab10 GGGCAAAGACCUGCGUCCUU J-040862-12 siRab14 GGUGUUGAAUUUGGUACAA J-040866-09 siRab28 GAGCAUAUGCGAACAGUAA J-040871-11 siRab8a CAGGAGCGGUUUCGAACAA J-040860-09 siRab8b CGAACAAUUACGACAGCAU J-055301-10 siTbc1d1 GAUCAGAGGUCAUAUUUAAUU D-040360-01 siTbc1d4 AAGCUAUACACCAGCAAAU J-040174-05 Diabetes Page 38 of 39
Supplemental Table 5: Radiochemicals Concentration Specific activity Compound Supplier [mCi/ml] [Ci/mmol] [1-14C]-Palmitic Hartmann Analytic, 0.1 0.056 Acid Braunschweig, Germany American Radiolabeled [9,10-³H(N)]-Oleic 5 60 Chemicals, Acid St. Louis MO, USA American Radiolabeled n-[2.3-³H]-Butyric 1 120 Chemicals, Acid St. Louis MO, USA [9,10-³H(N)]- Hartmann Analytic, 1 50 Palmitate Braunschweig, Germany
Supplemental Table 6: Antibodies Name Host Species Supplier Ordering # Dilution used in TBS-T FAT/CD36 Rabbit Sigma-Aldrich HPA002018 1:1000 + 5 % BSA FATP4 Rabbit Abcam ab200353 1:1000 + 5 % milk powder PDK4 Rabbit Abcam ab214938 1:1000 + 5 % milk powder RAB10 Rabbit Cell Signaling #4262 1:1000 + 5 % milk powder RAB8a Mouse BD 610845 1:2000 + 5 % milk Biosciences powder TBC1D1 Rabbit Cell Signaling #4629 1:1000 + 5 % milk powder GAPDH Rabbit Cell Signaling #2118 1:1000 + 5 % BSA Anti-Rabbit- Goat Dianova 111-035- HRP 003 1:10,000; 1:20,000 Anti-Mouse- Rabbit Dianova 315-035- HRP 008
Supplemental Table 7: qRT-PCR primers All qRT-PCR primers used throughout this study were designed using the NCBI primer blast online tool and purchased from Eurogentec. Target gene Primer sequences (5’ 3’) Product length Fwd: ATTGCTGAGTTGGCGATTTC Acadl 112 bp Rev: GCTGCACCGTCTGTATGTGT Fwd: CCTAGTAGGCGTGGGTCTGA Cd36 99 bp Rev: ACGGGGTCTCAACCATTCATC Fwd: CTCAGTGGGAGCGACTCTTCA Cpt1a 103 bp Rev: GGCCTCTGTGGTACACGACAA Fwd: CAGCGCTTTGGGAACCACAT Cpt1b 105 bp Rev: CACTGCCTCAAGAGCTGTTCTC Page 39 of 39 Diabetes
Target gene Primer sequences (5’ 3’) Product length Fwd: ACCTGGAAGCTAGTGGACAG Fabp3 106 bp Rev: TGATGGTAGTAGGCTTGGTCAT Fwd: TGAAATCACCGCAGACGACA Fabp4 141 bp Rev: ACACATTCCACCACCAGCTT Fwd: CTCGTGATCGACCGGAAGG Fads1 114 bp Rev: TGCCACAAAAGGATCCGTGG Fwd: GCCCCTTGAGTATGGCAAGA Fads2 99 bp Rev: TACATAGGGATGAGCAGCGG Fwd: TTGCTGGCACTACAGAATGC Fasn 192 bp Rev: AACAGCCTCAGAGCGACAAT Fwd: GAGGCGATGCGTCTAAGGAA Hadh 136 bp Rev: TCCATTTCATGCCACCCGTC Fwd: CAAGATCTCGGCGAAGCAA Hif1a 113 bp Rev: GGTGAGCCTCATAACAGAAGCTTT Fwd: GGAGCTCCAGTCGGAAGAGG Lipe 98 bp Rev: GTCTTCTGCGAGTGTCACCA Fwd: CAGCTGGGCCTAACTTTGAG Lpl 206 bp Rev: AATCACACGGATGGCTTCTC Fwd: CCTTTGGCTGGTTTTGGTTA Pdk4 225 bp Rev: CCTGCTTGGGATACACCAGT Fwd: ACCGAGTTCGCCAAGAACAT Ppard 128 bp Rev: AGCCCGTCTTTGTTGACGAT Fwd: CGGGCTGAGAAGTCACGTT Pparg 200 bp Rev: TGCGAGTGGTCTTCCATCAC Fwd: GAGTCTGAAAGGGCCAAACA Ppargc1a 148 bp Rev: TGCATTCCTCAATTTCACCA Fwd: CGGACGATGCCTTCAATACC Rab10 144 bp Rev: AGGAGGTTGTGATGGTGTGA Fwd: CAGGTCATCATCATCGGCTC Rab12 113 bp Rev: ATTTTAAAGTCAACACCCACGG Fwd: GTTCAGAGCGGTTACACGGA Rab14 116 bp Rev: TCCTTGCGTCTGTCAACCAG Fwd: GCACAGGGAATCCTCTTGGT Rab28 123 bp Rev: TAAAGCAACCAGGGGCTGAG Fwd: CCAGTGCAAAGGCCAACATC Rab8a 151 bp Rev: CTGGTCCTCTTCTGCTGCTC Fwd: AGGAAAATGAACGACAGCAAT Rab8b 104 bp Rev: CATCAAAGCAGAGAACAGCG Fwd: TGCTTTGGTTTCTGGGACTT Scl27a1 149 bp Rev: CCGAACACGAATCAGAACAG Fwd: ACTGTTCTCCAAGCTAGTGCT Scl27a4 106 bp Rev: GATGAAGACCCGGATGAAACG Fwd: GCTGACGACTTCGACGACG Sirt1 101 bp Rev: TCGGTCAACAGGAGGTTGTCT Fwd: GCCTGGGTTCCCAAAAGGAG Sirt2 145 bp Rev: GAGCGGAAGTCAGGGATACC Fwd: ATCCCGGACTTCAGATCCCC Sirt3 126 bp Rev: CAACATGAAAAAGGGCTTGGG Diabetes Page 40 of 39
Target gene Primer sequences (5’ 3’) Product length Fwd: ACAGTGTGGGAAAAGATGCT Tbc1d1 143 bp Rev: AGGTGGAACTGCTCAGCTAG Fwd: CCAACAGTCTTGCCTCAGAG Tbc1d4 146 bp Rev: GAATGTGTGAGCCCGTCTTC Fwd: GCGGCACTGCCCATTTATTT TBP 236 bp Rev: GGCGGAATGTATCTGGCACA Fwd: GGGAATGTGGAGCGTGCTAA Tfam 96 bp Rev: CAGACAAGACTGATAGACGAGGG Fwd: GTCTGCCTCATCAGGGTGTT Ucp3 204 bp Rev: CCTGGTCCTTACCATGCAGT Fwd: CCACCATGTACCCAGGCATT β-Actin 253 bp Rev: AGGGTGTAAAACGCAGCTCA
Supplemental Table 8: Fatty acid reference standard for gas chromatography. Trivial name Carboxyl- double bond reference ω-reference reference (Δx) Mystiric acid C14:0 Pentadecanoic acid C15:0 Palmitic acid C16:0 Palmitoleic acid C16:1 cis-Δ9 ω-7 Stearic acid C18:0 Oleic acid C18:1 cis-Δ9 ω-9 Linoleic acid C18:2 cis,cis-Δ9, 12 ω-6 α-Linolenic acid C18:3 cis,cis,cis-Δ9, 12, 15 ω-3 Arachidonic acid C20:4 cis,cis,cis,cis-Δ5, 8, 11, 14 ω-6