Proceeding Book Proceeding book of the 49 th Pokjanas T OI International Seminar Proceeding Book: The 49th Pokjanas TOI International Seminar ISBN: 978-602-72418-2-4 Published : 2016
Advisory Team Rector of Pancasila University Prof. Dr. rer. nat. Wahono Sumaryono, Apt. Dean of Pharmacy Faculty Pancasila University Prof. Dr. Shirly Kumala, M.Biomed., Apt.
Editor Chief Yesi Desmiaty, S.Si., M.Si., Apt.
Editorial Board Member Prof. Dr. rer. nat. Wahono Sumaryono, Apt. Prof. Dr. Shirly Kumala, M.Biomed., Apt. Prof (ris). Swasono R. Tamat, M.Sc., Ph.D., Apt. Prof (ris). Dr. Partomuan Simanjutak, M.Sc., APU Prof. Dr. Syamsudin, M.Biomed., Apt.
Redactional Board Member Sesilia Andriani Keban, MSi., Apt. Mita Restinia, M.Farm., Apt Retno Ayu Pratiwi, S.Si.
Publisher Faculty of Pharmacy, Pancasila University Srengseng Sawah, Jagakarsa, Jakarta 12640 Phone/ Fax (021)7864727-28/ 23
PREFACE
The 49th Pokjanas TOI International seminar has been scheduled organized by the Faculty of Pharmacy University Pancasila in collaboration with Pokjanas TOI Organization at Jakarta, Indonesia, 21-22 October 2015. Which is aimed to share information, findings and collaboration between researches, pharmacists, institution and natural product industries.
Finally we were able to publish the proceedings and it is now ready for circulation among the researchers, industries, and scientists. This proceeding is consisted of 43 titles manuscripts which were presented as oral and poster in seminar. The topic of manuscript contain many fields including natural product chemistry, analytical technique in phytochemistry, biological activity, pharmacological study, herbal drugs and formulation.. The Organizing Committe gratefully acknowledges the Rector of University Pancasila, Pokjanas TOI Organization, as well us all sponsors in bringing forth this seminar. Furthermore, personally, I would like to express my deep apreciation to the members of the Organizing Committee, for the good teamwork and their great effort to bring success to the seminar.
Jakarta, November 2015
Chairman of Committee Dr. Ratna Djamil M.Si., Apt
i
ISBN : 978-602-72418-2-4
CONTENTS
Pages
Citotoxicity and Radical Scavenging Activity Test of Gambir (Uncaria gambir (HUNTER) ROXB.) In Vitro Sri Ningsih, Churiyah, Fahri Fahrudin, Rini Damayanti, Eriawan Rismana …………....………... 1
The Biological Activity of Eurycomanone Derivatives On T47d, MCF-7, HELA, and WIDR Cancer Cells Hanifah Yusuf, Darma Satria, Zulkarnain ………………………………………………...... 6
Antibacterial Activities of Dayak Paser Medicinal Plants Against Escherichia Coli Septina Asih Widuri, Noorcahyati ………………………………………………………...... 11
Isolation of Anticancer Active Compound From Trigonella Foenumgraecum Leading by MCF7 Cytotoxicity Kurnia Agustin, Sriningsih, Julham Effendi ……………………………………………..……… 16
Issues of Halal Standardization of Food, Drug and Cosmetic for the Implementation the Mandatory of Halal Certification According to Halal Product Guarantee M. Yanis Musdja ………………………………………………………………………………..... 21
Virtual Screening Compounds in Fabaceae Plants as Ligands on Alfa Estrogen Receptor (ER-α) Esti Mumpuni, LH Gulo ………………………………………………………………………... 26
Preparation of Standardized Aqueous Extract of Annona Muricata Linn. Leaf, Its Potency as Antioxidant, and Total Flavonoid Content Assay Yesi Desmiaty, Deni Rahmat, Nilam Sari Maulidina ……………………………………...... 30
Phytochemical Screening and Toxicity Test BSLT of 70 % Ethanol Extract of Gaharu Leaves (Aquilaria beccariana Tiegh.) Ahmad Musir, Wiwi Winarti, Siti Hasnah P. Siregar …………………………………………...... 34
Optimization of Production of Β-Carotene and Astaxanthin from Microalgae Chlorella pyrenoidosa and Its Potential as an Antioxidant Ni Wayan Sri Agustini …………………………………………………………………………... 40
Antioxidant Compound Isolated from Bioproduction of Endophytic Fungi of Turmeric (Curcuma longa L.) Hindra Rahmawati, Partomuan Simanjuntak …………………………………………………...... 45
Analysis of Beta-Carotene In Green Melon and Orange Melon (Cucumis melo L. var. sky rock and var. cantaloupe) by TLC-Densitometry Rifa Rizkiyah, Zuhelmi Aziz …………………………………………………………………...... 49
Spectrophotometric Method Precision to Assay of Lycopene in Tomatoes Fruit (Solanum lycopersicum Lam.) Liliek Nurhidayati, Wening Ariwanty …………………………………………………....………. 54
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University ii ISBN : 978-602-72418-2-4
Optimization and Validation of High Performance Liquid Chromatography for Determination of Coffein In White Tea Zuhelmi Aziz, Dhiah Resti …………………………………………………………………....…... 58
The Effect of Extraction Method on Total Alkaloid Levels of Jembirit Leaves (Tabernaemontana sphaerocarpa BL) with Spectrofotometric Method Nina Salamah, Miftahul Rozak ………………………………………………………………....… 62
Integration of Herbal or Traditional Medicine through Evidence Based Practice Anny Lumban Toruan, Galih Ajeng Kencana Ayu ……………………………………...... 69
Identification of Soursop Seeds (Annona muricata L.) Extract as a Candidate Against the Aedes aegypti L. Musquito Vector Control DBD Sarah Zaidan, Ratna Djamil, Siti Nuraini ……………………………………………………...... 74
Antimicrobial and Biology Activity from Parasite Soursop (Dendropthoe pentandra L.) Extract Herbs Erlindha G, Lia Kartika Sari …………………………………………………………..………...... 81
Antioxidant, Cytotoxic and Apoptotic Induction Activity of Ethanolic Extract of Andrographis paniculata on MCF-7 Cancer Cell Line Churiyah, Kurnia Agustini, Siska Andrina Kusumastuti ...... 85
In Vitro α-Glucosidase Inhibition Activities Test from Standardized Sambung Nyawa (Gynura procumbens (Lour.) Merr.) Leaves Extract Wiwi Winarti, Ratna Djamil, Sarah Zaidan, Raymond …………………………………….....….. 90
Identification of Sugar-Apple Seeds (Annona squamosa L.) Extract as a Candidate Against the Aedes aegypti L. Musquito Vector Control DBD Ratna Djamil, Sarah Zaidan,Siti Nuraini ……………………………………………………...... 94
Anticancer Activity of Jatropha SP. on Breast Cancer Cells and Cervix Cells Siti Rofida, Nailis Syifa, Nurkhasanah, Laela Hayu Nurani …………………………………...... 102
Antihyperlipidemia Effect of Red Cabbage Juice (Brassica Oleracea VAR CAPITATA L. FORMA RUBRA) in Mice Lestari Rahayu, Yati Sumiyati, Desti Dwi Nandini ……………………………………………..... 108
Hepatoprotective Study of Cosolvent Solution from Mangosteen (Garcinia mangostana L.) Rind in Rats Ros Sumarny, Liliek Nurhayati, Yati Sumiyati, Astri Yuliastri Permana ………………...... 112
Immunomodulatory Activitiy of Lutein Extract from Sweet Corn Seeds (Zea mays L.) Through In Vivo Measurement of Activity and Phagocytic Capacity of Peritoneal Macrophage Cells of Mice Kusmiati, Yudha Prasetya, Erlindha Gangga …………………………………………………...... 115
Effect of Ethanolic Extract of Bawang Tiwai (Eleutherine bulbosa (Mill.) Urb.) in Monosodium Urate-Induced Inflammation in Rat Hind Paw Dian R. Laksmitawati, Siti R.Rani ……………………………………………………...... 120
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University iii ISBN : 978-602-72418-2-4
Acute Toxicity of Ethanolic Extract of Fenugreek Seeds (Trigonella foenum-graecum L.) on White Rats Kurnia Agustini, Sriningsih, Julham Effendi ...... 124
Antihypertensive and Diuretic Effects of the Ethanol Extract of Colocasia esculenta (L.) Schott. Leaves Rini Prastiwi, Siska, Ervina Bhakti Utami, Gigih Pangestu Witji ……………………………...... 128
The Antioxidant Activity of Ethanol Extract of White-Oyster Mushroom in Decrease MDA and Increase the Activity of Catalase in Mice Hypercholesterolemia Vera Ladeska, Priyanto,Juju Jumiati …………………………………………………………...... 133
Soursop Leaf (Annona muricata L.) Infusion in Lipid Profile of Hyperlipidemic Mice Ni Made Dwi Sandhiutami, Neni Anggraini ……………………………………………….…...... 141
Xanthine Oxidase Inhibitory Activity of Secang (Caesalpiniasappan L.), Tempuyung (Sonchusarvensis L.), and Kepel (Stelechocarpusburahol) Extracts Pertamawati, Mutia Hardhiyuna, Shelvi Listiana, Rian Triana ………………………………...... 146
Potency of Curcuma Mangga Val Rhizome Extract as a Selective Anti-Proliferative Agent on Breast Cancer Cell Line MCF-7 Siska Andrina, Churiyah, Nuralih ……………………………………………………………….... 151
Assessment of Antibacterial Activity of Herbal Toothpastes to the Bacteria Causing Halitosis Syarmalina, Syahdu A. Ekowati dan Dwi A. Maulana ………………………………………...... 155
Formulation and the Antioxidant Activity of Green Cincau Leaves (Cyclea barbata L.MIERS) from the Ethanol Extract 70% Yunahara Farida, Erlindha Gangga, Kartiningsih, Arsila ……………………………...... 158
Accelerated Stability Test and Antioxidant Activity of Ethanol Extract Green Cincau Leaves (Cyclea barbata L.Miers) with Gelling Agent HPCM AND HPMC Kartiningsih, Erlindha Gangga, Yunahara Farida, Maria Ulfah …….....………………….……… 162
Capsule Formulation of Standardized 70% Ethanol Extract Johar Leaves (Senna siamea (Lam.) Irwin and Barneby) as α-Glucosidase Inhibitor Risma Marisi Tambunan, Kartiningsih, Everly Hendra ………………...... ………….…… 166
Formulation and Evaluation of Herbal Tablets Containing Voacanga foetida (Bl.) K.Schum Extract Fahleni, Yandi Syukri, Novelta Femmy Rischa, Adriani Susanty …………………...... ….. 172
Optimization of Patchouli Oil and Tea Tree Oil Emulgel Formulation Yuslia Noviani, Teti Indrawati, Shelly Taurhesia ……………………………………...... 176
Formulation of Liquorice Extract (Glycyrrhiza glabra L) as Skin Whitening Cream Siti Umrah Noor, Faridah, Michico …………………………………………….………...... 180
Accelerated Stability Test of Liquorice Extract (Glycyrrhiza glabra L) Cream Faridah, Siti Umrah Noor, Sulih Probo Sindi …………………………………...... ………. 187
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University iv ISBN : 978-602-72418-2-4
The Variation of Tofu’s Wastewater Concentrations as Culture Medium to the Protein, Lipid and Chlorophyl Contents from Microalgae Nannochloropsis sp. Rian Nurul Hidayat, Sudjaswadi Wiryowidagdo, Ni Wayan Sri Agustini ……….……...... 193
Utilization of Corn Husk Waste to Produce Cellulase Enzymes by Trichoderma viride FNCC 6013 199 Mira Andam Dewi, Ririn Puspadewi, Sylvia Heryanti ………………………………...... Clinical Trials Efficacy Of Hyperglycemia Herbs Formula Agus Triyono, Zuraida Zulkarnain ……………………………………………….……...... 207
Antihiperkolesterolemia Jamu Formula Effect on Plasma Cholesterol Levels in Patients with Mild Hypercholesterolemiam in Rumah Riset Jamu 'Hortus Medicus' Tawangmangu Zuraida Zulkarnain, Agus Triyono ……………………………………………….……...... 211
Lineage Group Identification of LM 25722248, Listeria monocytogenes Isolate Moordiani, Cath Rees, Phil Richards ...... 216
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University v ISBN : 978-602-72418-2-4
ISSUES OF HALAL STANDARDIZATION OF FOOD, DRUG AND COSMETIC FOR THE IMPLEMENTATION THE MANDATORY OF HALAL CERTIFICATION ACCORDING TO HALAL PRODUCT GUARANTEE NUMBER 33 YEAR 2014
Dr. Muhammad Yanis Musdja, M.Sc Email : [email protected]
Former of Head of Study Program of Pharmacy, Islamic State University, Jakarta Former Dean of School of Pharmacy Muhammadiyah, Tangerang Chairman of Indonesian Halal Products Foundation
ABSTRACT
INTRODUCTION: Indonesian parliament has ratified law of the Halal Products Guarantee (LHPG) number 33 year 2014 (Undang-undang Jaminan Produk Halal No. 33 Tahun 2014) on September 25, 2014 ago. The basic principles on LHPG No. 33 Year 2014 is the change of halal certificate from voluntary becomes mandatory for food, drug and cosmetic, which will begin in 2017 and will be implemented gradually in Indonesia. For the implementation of halal certification mandatory, the Indonesian government does not yet have halal standardization, especially for drugs and cosmetics, and already there are some standardization of halal for food made by Majelis Ulama Indonesia (MUI). OBJECTIVES: How to prepare Halal Standardization for the implementation of LHPG No. 33 Year 2014, so that mandatory halal certification for food, drug and cosmetic can be implemented in Indonesia. ANALYSIS ISSUES AND CHALLENGES: Halal standardization must exist in order to implement of LHPG No. 33 Year 2014. To be able to make halal Standardization, necessary Muslim pharmacists and other experts that so much know halal Standardization. Based on the SWOT theory, it can be said briefly about: STRENGTHS; Islamic concept for consuming Halalanthoyyiban food is the best concept not only for Muslims but for all mankind. WEAKNESS: Until now, Indonesia does not have halal standardization of food, drug and cosmetic. OPPORTUNITIES: Make halal standardization is a good opportunity to make the food, drug and cosmetic that qualified in accordance with halalanthoyyiban concept in Islam. For make halal standardization can do verification food ingredients that exist on the Codex Alimentarius, Pharmacopoeia and standards books for food, drugs and cosmetics. THREATHENS: On Article 56 and 57 of this LHPG, there are severe legal sanctions for Industry Player and everyone that involved in the implementation of process Halal Products Guarantee shall be punished with imprisonment for a maximum of 5 (five) years or a fine of Rp 2,000,000,000.00, (two billion rupiah), if there is no halal standardization, the article No. 56 and 57 of LHPG No. 33, year 2014 can not be executed. CONCLUSION: Halal standardization should be made as soon as possible, if it is not exist. LHPG No. 33, year 2014 can not be implemented. The easiest way to create a standardization of halal with a faster time, low cost and easily understood and accepted by the international community is with do clarification about halal, mubaah, makruh or haram of material content in the book Codex Alimentarius for food and the book Martindale & Indonesia Pharmacopoeia for drugs and cosmetic.
Key Words: Halal food standardization; Halal drugs standardization; Halal cosmetics standardization; LHPG No. 33 year 2014; Muslim pharmacists law experts.
International Seminar Pokjanas TOI 1 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
INTRODUCTION
As it is said in the Quran on surah Al Baqarah verse 168, “O mankind, eat from whatever is on earth that is lawful and good (Halalan thayyiban) and do not follow the footsteps of Satan. Indeed, he is to you a clear enemy”. Verse in the Qur'an mentioned above, emphasize, that consuming of halal food and good (Halalanthoyyiban) is an obligation not just for Islamic people but for all mankind. As has been shown, according to evidence based medicine, that due to consuming of Haram foods, such as, alcohol, pork, beast animal, blood, disgusting animal and animals were slaughtered in a way not true, all of this haram food will have an adverse effect to the people who had consumed it. On the other hand, in Quran, Surah Al A’raaf Verse 31, “O Children of Adam, take your adornment at every place of worship, and eat, and drink, but do not overdoses. Certainly, He (Allah) loves not the extravagant” The meaning of eat and drink do not overdoses in this verse is Standardization. Therefore, eat food, drugs and cosmetics are not standard is dangerous and may disturb of health. Because of standardization of food, drugs and cosmetics are mandatory in Islam, then this provision is set in law of the Halal Products Guarantee (LHPG) number 33 year 2014 (Undang-undang Jaminan Produk Halal No. 33 Tahun 2014)
On the other hand at Article 56 of LHPG No. 33 Year 2014: Industry Player that does not keep halal products have gained the Halal Certificate referred to in Article 25 letter b shall be punished with imprisonment for a maximum of 5 (five) years or a fine of Rp 2,000,000,000.00 (two billion rupiah ). At article 57 of LHPG No. 33 Year 2014: Everyone involved in the implementation of process Halal Products Guarantee that is not maintain the confidentiality of formulas that contained in information is submitted by industry player as referred to in Article 43 shall be punished with imprisonment for a maximum 2 (two) years or a maximum fine Rp. 2,000,000,000.00 (two billion Rupiah).
Due to the fairly heavy sanctions to industry players and Everyone involved in the implementation of process Halal Products Guarantee, then, there will be many disputes in the implementation of mandatory Halal in the future. To be able to resolve the dispute with justice certainly needed Halal Standardization for food, drugs and cosmetics. If standardization of halal for food, drugs and cosmetics can not be determined, the implementation of the LHPG number 33 year 2014 will fail.
On one side, standards are essential tools for local and international businesses, which shape the contribution of economic progress through industry development and trade, as well as, a guideline in the assurance of consumer protection. On the other hand, standards are able to be eliminators of trade barriers, which means that, they play a critical role to facilitate goods and services exchange across borders. Orriss and Whitehead (2000),
On the other hand, Halal logistics is a new phenomenon, driven by the halal industry to extend halal from source to the point of consumer purchase, to ensure the integrity of the halal product for the end- consumer and export markets. The large discussion group shows that the conventional logistics handling of halal products does not provide sufficient assurance for the Muslim consumer in both Muslim and non-Muslim countries. Tieman, M. (2011).
International Seminar Pokjanas TOI 2 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
METHODS
Make a compilations or attachment to the standard book for food, drugs and cosmetics by doing the clarification of these materials are halal, mubaah, makruh or haram with make the selection of a few books, to obtain book which more appropriate for clarification. Clarification of these materials carried out by Majelis Ulama Indonesia (MUI) in cooperation with experts of Pharmacy and other experts who are familiar with standardization of halal.
RESULTS
Results of the main choice of books to make a compilation or an appendix on halal standards are: 1. Codex Alimentarius new edition for food 2. Martindale new edition and Indonesian Pharmacopoeia new edition for drugs and cosmetics
DISCUSSION
Make books for the standardization of halal food, drugs and cosmetics are a very difficult job, need a long time and need very expensive cost. If we take a lesson from the history of the making of books Codex Alimentarius, the present, it takes about 52 years to become a book as it is now. The making of this book are result of synergy of several countries. Which is regulated by the Food Administraion Organization (FAO) The Codex Alimentarius (Latin for "Book of Food") is a collection of internationally recognized standards, codes of practice, guidelines and other recommendations relating to foods, food production and food safety. The Codex Alimentarius covers all foods, whether processed, semi-processed or raw. In addition to standards for specific foods, the Codex Alimentarius contains general standards covering matters such as food labeling, food hygiene, food additives and pesticide residues, and procedures for assessing the safety of foods derived from modern biotechnology. It also contains guidelines for the management of official i.e. governmental import and export inspection and certification systems for foods.
Advantages the using of result clarification (halal, mubaah, makruh and haram) ingredients of Codex Alimentarius book as Halal Standart for food: Indonesia can make a book that integration Halal Standart with Thayyiban Standart become Halalanthayyiban Standart Readily accepted by every country and the international community, because the Codex Alimentarius is the main book used as a standard book for food by countries that are members of FAO and WHO. Provide substantial economic benefits, because Indonesia does not need to spend a huge cost to conduct research by spending big to establish halal Standart Indonesia only needs to perform the clarification of ingredients which foods are halal, mubaah, makruh and haram in the Codex Alimentarius and add it as a compilations or attachment in the book.of codex alimentarius. Halal standart that exist on compilations or attachment on the codex alimentarius will easily be used as a manuals halal standards by any countries in the world, therefore the book codex alimentarius is the worldwide for food standard thayyiban
International Seminar Pokjanas TOI 3 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
Advantages the using of result clarification (halal, mubaah, makruh and haram) ingredients of Martindale book as Halal Standart for drugs and cosmetics, because of Martindale book contains : Monographs on drugs and ancillary substances, listing over 6,000 monographs arranged in 49 chapters based on clinical use with the corresponding disease treatment reviews. Monographs summarize the nomenclature, properties, and actions of each substance. A chapter on supplementary drugs and other substances covers some 1190 monographs on new drugs, those not easily classified, herbals, and drugs no longer clinically used but still of interest. Monographs of some toxic substances are also included. Preparations - including over 180,000 items from 43 countries and regions, including China. Directory of Manufacturers listing some 20,000 entries. Pharmaceutical Terms in Various Languages: this index lists nearly 5,600 pharmaceutical terms and routes of administration in 13 major European languages as an aid to the non-native speaker in interpreting packaging, product information, or prescriptions written in another language. General index: prepared from 175,000 entries it includes approved names, synonyms and chemical names; a separate Cyrillic section lists nonproprietary and proprietary names in Russian and Ukrainian.
Advantages the using of result clarification (halal, mubaah, makruh and haram) ingredients of Indonesia Pharmacopoeia as Halal Standart for drugs and cosmetics, because of Indonesia Pharmacopoeia book :
Indonesia Pharmacopoeia is book standard used by the Indonesian people for drugs and cosmetics. Indonesia Pharmacopoeia using Indonesian language. therefore it is easily understood by the people of Indonesia.
On the other hand, at this time. There is one institution that made under Organization for Islamic Cooperation (OIC). The name of institution is Standardization and Metrology of Industry for Islamic Country (SMIIC). Headquarters of SMIIC is located in Istanbul turkey. Because of this new institution was founded in 2011 ago. then they also have not been able to make halal standardization manual that can be used as a standard for food, drugs and cosmetics. Then, Indonesia has not been able to use the halal standard from the SMIIC.
To be able to do the work above, should be started immediately. Therefore clarification halal, mubaah, makruh and haram for thousands of food drugs and cosmetics is not easy. Therefore, there are some ingredients of food, drugs and cosmetics that are difficult to set their status.
5. CONCLUSION 1. To be successful implementation of law of the Halal Products Guarantee (LHPG) number 33 year 2014, where its implementation will begin in early 2017. Then, Halal standardization should be made as soon as possible, if it is not exist. LHPG Number 33, year 2014 can not be implemented.
2. The easiest way to create a standardization of halal with a faster time, low cost and easily understood and accepted by the international community is with do clarification about halal, mubaah, makruh or haram of material content in the book Codex Alimentarius for food and the book Martindale & Indonesia Pharmacopoeia for drugs and cosmetic.
International Seminar Pokjanas TOI 4 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
REFERENCES
1. Yanis Muhammad, Musdja, Majalah SWARA FBN, Edisi 1, Juni – Juli 2015, ISSN: 2443- 1982,Bahaya Mengkonsumsi Makanan Haram Ditinjau dari Aspek Ilmiah Medis (Harmful of Consuming Food Based on Evidence Based Medicine) 2. Law of the Halal Products Guarantee (LHPG) number 33 year 2014 (Undang-undang Jaminan Produk Halal No. 33 Tahun 2014). 3. Al Quran, Terjemahan Kementerian Agama RI 2003. 4. Orriss, D. G. and J.A. Whitehead, 2000. Hazard Analysis and Critical Control Point (HACCP) as a Part of an Overall Quality Assurance System in InternationalFood Trade. Food Control, 11: 345- 351 5. Tieman, M. (2011). The application of Halal in supply chain management: in -depth interviews. Journal of Islamic Marketing, 2(2), 186 – 195. 6. CODEX Alimentarius: Understanding Codex". FAO and WHO. 1999. Retrieved 6 September 2012 7. Martindale : The Complete Drug Reference Thirty-eighth edition. 8. Farmakope Indonesia edisi V, Tahun 2014. 9. OIC/SMIIC 2:2011, “Guidelines for Bodies Providing Halal Certification” (with the references of ISO/IEC 17020, ISO/IEC 17021, ISO/IEC 17025, ISO/TS 22003 + Islamic Fiqh Rules),
International Seminar Pokjanas TOI 5 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
THE BIOLOGICAL ACTIVITY OF EURYCOMANONE DERIVATIVES ON T47D, MCF-7, HELA, AND WIDR CANCER CELLS
1Hanifah Yusuf, 2Darma Satria, 3Zulkarnain
1Departement of Pharmacology and Therapeutic Faculty of Medicine University of Syiah Kuala, Tanoh Abee Street, Darussalam, Banda Aceh, Indonesia 2Departement of Pathology Anatomi Faculty of Medicine University of Syiah Kuala, Tanoh Abee Street, Darussalam, Banda Aceh, Indonesia 3Departement of Physiology Faculty of Medicine University of Syiah Kuala, Tanoh Abee Street, Darussalam, Banda Aceh, Indonesia Email: [email protected]
ABSTRACT
Eurycomanone from the roots of Eurycoma longifolia Jack, has been reported to exhibit anticancer activity. Four of ester eurycomanone derivatives: eurycomanone dibutyrate, eurycomanone monovalerate, eurycomanone dimethoxybenzoate and eurycomanone disuccinate were synthesized for knowing their potencies on cancer cell lines T47D, MCF-7, Hela, WIDR and normal cells (Vero cells). The activity of eurycomanone derivatives as anticancer were evaluated by MTT colorimetric assay method. The results showed that eurycomanone has anticancer activity on T47D, MCF-7, Hela, WIDR cancer cells with IC50 values (1.17 ± 0.09; 3.96 ± 0.02; 2.95 ± 0.08;1.45 ± 0.01 µg/mL), respectively and no toxic to Vero cells (IC50 609.89± 29.77 µg/mL). Eurycomanone derivatives namely: eurycomanone dibutyrate have anticancer activity on T47D, MCF-7, Hela, WIDR cancer cells with IC50 values (25.16± 2.25; 21.56 ± 4.55; 29.32 ± 1.25; 149.42 ± 12.50 µg/mL), eurycomanone monovalerate (25.59 ± 1.31; 22.48 ± 1.25; 30.14 ± 1.89; 91.88 ± 8.90 µg/mL), eurycomanone dimethoxybenzoate ( 102.77 ± 2.56; 38.83 ± 2.55; 66.65 ± 1.90; 51.61 ± 2.37 µg/mL), eurycomanone disuccinate (218.94 ± 9.30; 198.87± 5.50; 166.67 ± 12.34; 145.39 ± 6.67 µg/mL)respectively. Eurycomanone dibutyrate, eurycomanone monovalerate and eurycomanone dimethoxybenzoate are safe to Vero cells with selectivity index (IS) more than 3, besides that eurycomanone disuccinate toxic to Vero cells.
Keywords: Anticancer, Eurycomanone, Eurycoma longifolia Jack, Synthesis
INTRODUCTION
Natural compounds from plants have been proven as a source of lead compounds for developing of new drugs (1,2). Eurycomanone is a natural pentacyclic quassinoid obtained from the roots of Eurycoma longifolia Jack (3) in the family Simaroubaceae. Eurycoma longifolia Jack (ElJ) or commercially known as Tongkat Ali in Malaysia, Pasak Bumi in Indonesia, Tung Saw in Thailand and Cay Ba Binh in Vietnam (4) is very popular plant as aphrodisiac and usually taken after 4 years of cultivation for preparing pharmaceutical products(5). Various natural compounds have been isolated and characterized from ElJ, mostly from the roots. Natural compounds from ElJ have been reported to have a wide pharmacological activities such as antimalarial (6,7,8), anticancer (6,7,8,9,10), antipyretic (10) and anti ulcer (11). Eurycomanone is one of the major natural quassinoids isolated from the roots of ElJ and has exhibited cytotoxic activities against selected cancer cell lines (12,13). Its pharmacological potency has been proven in numerous in vitro and in vivo experimental laboratory. But until now very limited efforts to develope this compound for obtaining its derivatives. Therefore this investigation was conducted to examine the anticancer activity of synthesized eurycomanone derivatives on selected cancer cells line. In this study, design and synthesis of eurycomanone derivatives were done by using eurycomanone natural compound and esterified without using protecting agent by using pharmacophore agents such as butirylchloride, valeroylchloride, para methoxy benzoyl chloride and succinate anhydride. International Seminar Pokjanas TOI 6 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
METHODS
Materials: The plant and roots of E. longifolia Jack were taken after 4 years of cultivation and identified by a specialist. Pharmacophore agents such as butirylchloride, valeroylchloride, para methoxy benzoyl chloride and succinate anhydride (p.a, Merck). Chloroform, ethyl acetate, methanol, pyridine, all chemical substances and selective cancer cell lines for study of anticancer activity
Extraction: The roots (10kg) of E. longifolia were cleaned with tap water and then dried in the oven at 400C. After cutting in small pieces, the dried roots were ground into crude powder and stored in the desiccators. Then the crude powder was soaked in 30L methanol at room temperature and stirred regularly. The liquid extract was filtered and concentrated in rotary evaporator at 400C to produce methanolic extract.
Isolation of eurycomanone Before isolation the methanolic extract of ElJ was subjected to vacum liquid chromatography by using stationary phase silica gel and the mixed mobile phase chloroform: methanol: water in ratio (5:5:1; 3:7:1: 1:9:1). Fractions with similar Rf values on thin layer chromatography (TLC) which were monitored at UV lamp at 254 nm, then pooled and used for isolation of eurycomanone as starting material for synthesizing its derivatives. Isolation of eurycomanone was done by preparative thin layer chromatography (PTLC) using silica gel PF254 as stationary phase and the mixed mobile phase ethylacetate: methanol : water in ratio 80: 20: 1. Repeated isolation, purification and crystallization were done to get the pure compound. The structure and its purity were confirmed by comparison with detailed spectroscopic data in published reports (UV, IR, NMR, LCMS-ESI positive ion, DEPT, COSY, HMQC and HMBC).
Synthesis of eurycomanone derivatives Synthesis of eurycomanone derivatives can be performed by simple esterification without using protecting agent. Eurycomanone which is isolated from the E. longifolia roots (50 mg, 0,1225 mmol) was dissolved in cold pyridine (1 mL) and pharmacophore agent (butiryl chloride, valeroyl chloride, para methoxy benzoyl chloride and succinate anhydride 0,49 mmol, respectively) dissolved in cold chloroform. The solution of pharmacophore agent was added slowly to the eurycomanone solution at 00C and the reaction mixture was stirred for 1 hour in ice bath. After that, the reaction mixture was refluxed and stirred using magnetic heat stirrer for 6-8 hour and every 2 hours checked the product by TLC. After esterification process ended, the mixture was extracted three times with 10 ml of cold ethyl acetate. The ethyl acetate layer is washed three times with 10 mL cold water and then dried with sodium sulfate anhydrate. After filtration and drying, the cooled precipitate is poured in methanol and preparing for detailed spectroscopic analysis.
Testing of Anticancer activity The anticancer activity test of eurycomanone and its derivatives on Vero cells and cancer cell lines (T47D, MCF-7, Hela, WIDR) were carried out by MTT Colorimetric Assay Methods (Mosman, 1983). The tested compounds were used at concentration 25; 12,5; 6,25; 3,125; 1,57625, 0,78125 µg/mL and prepared from the substock solutions by serial dilution of media to give a volume of 100 µL in each microtitre plate well. The concentration of tested compounds were prepared in triplicate. As standard drug used doxorubicine and 5 fluorouracil in same concentration. Then each well was added with 100 µL of 104/ mL of cells in complete growth media, respectively. As controls were used the cells and media that 0 were placed into 96 well microplate then incubated for 24 hours at 37 C, 5% CO2 and 90% humidity. After incubation, the media was removed and 100 µL of new medium and 10 µL MTT was added. Then, it was incubated again for 4 hours and next the media was aspirated and 100 µL SDS 10% in 0,001N HCl added. The microplate was re-incubated for 24 hours in room temperature and its absorbance was read at λ 405 nm (Vero cells) and 595 nm (cancer cell lines) by ELISA reader. The IC50 value on Vero cells and cancer cell lines were determined by probit or linear regression analysis.
International Seminar Pokjanas TOI 7 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
RESULTS
The result of eurycomanone isolation Investigating of new anticancer compound was originated from pasak bumi roots (E. longifolia, Jack.), we macerated the powdered of pasak bumi roots with methanol and after evaporation the liquid extract in vacum condition gave ± 6% solid extract. Fractionation were done to the extract by vacum liqiud chromatography (VLC) for obtaining the concentrated eurycomanone and yielded ± 2,5%. Isolation of eurycomanone from this fraction was performed by preparative thin layer chromatography (TLC) and yielded ± 0,04%.
The result of eurycomanone derivatives synthesis Eurycomanone is the potential quasinoid anticancer was structurally esterified by using acyl chloride and carboxyclic anhydride to influence their activity and cytotoxicity to cancer cell lines. Synthesis of its derivatives by esterification is attempted with the aim of increasing activity, decreasing toxicity, or improving other pharmacological profiles. In finding new anticancer with better activity than previous compound, it was esterificated OH group in eurycomanone structure by butiryl chloride, valeryl chloride, para-methoxybenzoyl chloride and succinic anhydride. The result of esterification gave, eurycomanone dibutyrate (60,35%), eurycomanone monovalerate (55,10%), eurycomanone dimethoxybenzoate (60,10%) and eurycomanone disuccinate (65,25%).
The result of identifying eurycomanone and its derivatives by spectroscopic analysis The chemical structure of all tested compounds had been analyzed by spectroscopic analysis. 0 0 Eurycomanone as starting material has formula C20H24O9 (MW 408.02; m.p 254 -257 C) and its 0 derivatives eurycomanone dibutyrate C28H36O11 (MW 548,94; m.p 241-243 C), eurycomanone 0 monovalerate C25H32O10 (MW492,8; m.p 235-237 C), eurycomanone dimethoxybenzoate C36H36O13 0 0 (MW 676,13; m.p 225-228 C) and eurycomanone disuccinate C28H30O15 (MW 606,86, m.p 251-254 C).
The result of anticancer activity test The evaluation of tested compounds on Vero cell is aimed for knowing the safety of these compounds on normal cells. In addition, these compounds are also used for examining their potencies on growth inhibition of cancer cell lines. The test was performed by MTT colorimetric assay method which was 14,15 modified ( ). The IC50 and selectivity index values of these compounds on cancer cell lines and Vero cells are showed in Table 1 and 2.
DISCUSSION
In vitro screening of anticancer activity of eurycomanone and its derivatives is based on the ability of the compounds to inhibit the growth of cancerous cel lines in medium culture. Several derivatives of eurycomanone: eurycomanone dibutyrate, eurycomanone monovalerate, eurycomanone dimethoxybenzoate and eurycomanone disuccinate were synthesized. Previous studies showed the anticancer activity of eurycomanone on various cancer cell lines has IC50 value on MCF-7 is 4.40 ± 0.42 µg/mL (16); 3.63 ± 0.11 µg/mL(17); and less than 2.5 µg/mL (9); 1,1µg/mL (7). The anticancer activity of 17 eurycomanone on Hela cells has IC50 value 2.13 ± 0.09 µg/mL ( ). The result of the test toward four semisynthesized compounds showed that eurycomanone more potent than monoacetylated and diacetylated eurycomanone to selected cancer cell lines above. Some structural requirements, like an α, β-unsaturated ketone in the A ring, an oxymethylene bridge in the C ring and an ester function in C-15 in the D ring are considered very important for the anticancer activity and antimalarial activity presented by quassinoids (18,19).
International Seminar Pokjanas TOI 8 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Table 1. The IC50 of eurycomanone and its derivatives on selected cancer cell lines and Vero cells
Tested compounds IC50 Values (µg/mL) Vero T47D MCF-7 Hela WIDR Eurycomanone 609.89 ± 29.77 1.17 ± 0.09 3.96 ± 0.02 2.95 ± 0.08 1.45 ± 0.01 E. dibutyrate 219.29 ± 11.38 25.16 ± 2.25 21.56 ± 4.55 29.32 ± 1.25 149.42 ± 12.50 E. monovalerate 92.40 ± 7.51 25.5 ± 1.31 22.48 ± 1.25 30.14 ± 1.89 91.88 ± 8.90 E dimethoxy benzoate 132.22± 6.98 102.77± 2.56 38.83 ± 2.55 66.65 ± 1.90 51.61 ± 2.37 E. disuccinate 12.75 ± 2.88 218.94 ± 9.30 198.87 ± 5.50 166.67 ± 12.34 145.39 ± 6.67 Doxorubicine 3.54 ± 0.64 1.97 ± 0.05 4.6 8 ± 0.10 3.51 ± 0.05 41.81 ± 2.25 5-Fluouracil 280.54 ± 10.11 4.03 ± 0.23 3.16 ± 0.11 1.99 ± 0.0 1 5.41 ± 1.33
Table 2. The selectivity index of eurycomanone and its derivetives on selected cancer cell lines Tested compounds Selectivity Indexs T47D MCF-7 Hela WIDR Eurycomanone 521.27 154.00 206.54 420.20 E. dibutyrate 8.72 10.17 7.48 1.47 E. monovalerate 3.61 3.41 3.07 1.00 E dimethoxy benzoate 128.70 340.61 198.44 256.27 E. disuccinate 0.05 0.06 0.08 0.09 Doxorubicine 1.80 0.76 1.01 0.08 5-Fluouracil 69.61 88.78 140.97 52.86
CONCLUSION
The data suggest that eurycomanone has anticancer activity more potential than its derivatives on selected cancer cell lines (T47D, MCF-7, Hela and WIDR) and safe to normal Vero cells. Eurycomanone dibutyrate, eurycomanone monovalerate and eurycomanone dimethoxybenzoate are safe to Vero cells with selectivity index (IS) more than 3, besides that eurycomanone disuccinate toxic to Vero cells.
ACKNOWLEDGMENTS
This study was supported by Ministry of Education and Culture of Indonesia. The authors would like to thank University of Syiah Kuala for this grant. The authors are grateful to Indonesian Institute of Sciences (LIPI) for analyzing our synthesis compounds (Mrs.Sofa Fajriah for NMR analysis and Mrs. Puspa Dewi for helping in LC-MS analysis).
International Seminar Pokjanas TOI 9 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
REFERENCES
1. Newman, D.J., Cragg, G.M., Snader, K.M. 2003. Natural products as sources of new drugs over the period 1981–2002. J. Nat Prod. 66(7):1022-1037. 2. Kinghorn, A.D., Farnsworth, N.R., Soejarto, D.D., Cordell, G.A., Pezzuto, J.M., Udeani, G.O., Wani, M.C., Wall. M.E., Navarro, H.A., Kramer, H.A., Menendez, A.T., Fairchild, C.R., Lane, K.E., Forenza, S., Vyas, D.M., Lam, K.S., Shu, Y.Z. 1999. Novel strategies for the discovery of plant-derived anticancer agents. Pure Appl Chem, 71:1611-1618.) 3. Darise, M., Kohda, H., Mizutani, K., Tanaka, O. 1982. Eurycomanone and eurycomanol, quassinoids from the roots of Eurycoma longifolia. Phytochemistry. 21:20912093 4. Kuo, P.C., Shi, L.S., Damu, A.G., Su, C.R., Huang, C.H., Ke, C.H. 2003. Cytotoxic and antimalarial betacarboline alkaloids from the roots of Eurycoma longifolia. J Nat Prod. 66:13241327. 5. Chan, K.L., Lee, S.P.,Yuen, K.H. 1995. Antipyretic activity of quassinoids from Eurycoma longifolia Jack. Planta Medica : 219 . 6. Chan, K.L., O’Neill, M.J., Phillipson, J.D., and Warhurst, D.C. 1986. Plants as Source of Antimalarial Drugs. Part 3. Eurycoma longifolia. Planta Medica 52(2): 105 – 107. 7. Kardono, L.B.S., Angerhofer, C.K., Tsauri, S., Padmawinata, K., Pezzuto, J.M., and Kinghorn, A.D., 1991. Cytotoxic and Antimalarial Constituents of The Roots of Eurycoma longifolia. Journal of Natural Product. 54: 1360-1367 8. Jiwajinda, S., Santisopasri, V., Murakami, A., Kawanaka, M., Kawanaka, H., Gasquet, M. 2002. In Vitro Anti-tumor promoting and Anti-parasitic Activities of the Quassinoids from Eurycoma longifolia, a Medicinal Plant in Southeast Asia. J. Ethnopharmacol. 82: 55–58. 9. Kuo, P.C., Damu, A.G., Lee, K.K., and Wu, T.S. 2004. Cytotoxic and Antimalarial Constituent from The Roots of Eurycoma longifolia. Journal of Bioorganic Medicinal Chemistry. 12: 537 -544. 10. Tee, T.T., Cheah, Y.H., Hawariah, L.P. 2007. F16, a fraction from Eurycoma longifolia Jack extract, induces apoptosis via a caspase9independent manner in MCF7 cells. Anticancer Res. 27:34253430. 11. Tada, H., Yasuda, F., Otani, K., Dotenchi, M., Ishihara, Y., and Shiro, W. 1991. New Antiulcer Quassinoids from Eurycoma longifolia. European Journal of Medicinal Chemistry. 26: 345 – 349. 12. Wong, P., Cheong, W., Shu, M., Teh, C., Chan, K. and Bakar, S. A. 2012. Eurycomanone Suppresses Expression of Lung Cancer Cell Tumor Markers, Prohibitin, Annexin 1 and Endoplasmic Reticulum Protein 28. Phytomedicine. 19: 138–144 13. Zakaria Y, Rahmat A, Pihie AH, Abdullah NR, Houghton PJ (2009) Eurycomanone induce apoptosis in HepG2 cells via upregulation of p53. Cancer Cell Int 9:16 14. Mosman, T. 1983. Rapid Colorimetric Assay for Celluler Growth and Survival Application to Proliferation and Cytotoxicity Assays. Journal of Immunology Method. 65: 55 – 63. 15. Tada, H., Shiho, O., Kuroshima, K., Koyama, M., and Tsukamoto. 1986. An Improved Colorometric Assay for Interleukin-2. Journal of Immunology Method. 93 (2): 157-165. 16. Tee, T.T., and Hawariah, L.P. 2005. Induces of Apoptosiss by Eurycoma longifolia Jack Extract. Anticancer Res. 25 : 2205 -2214. 17. Nurhasanah, M., Hawariah L.P. 2007. Eurycomanone Induces Apoptosis Through The Up Regulation of p53 in Human Cervical Carcinoma Cells. Paper Research International Coference on Chemical Sciences (ICCS-2007), Yogyakarta, Indonesia. 18. Kupchan, S.M., Britton, R.W., Lacadie, J.A., Ziegler, M.F., and Siegel, C.W.J. 1975. The Isolation and Structural Elucidation of Bruceantin and Bruceantinol, New Potent Antileukemic Quassinoids from Bruceae antidysenterica. Journal Organic Chemistry 40: 648 – 654. 19. Kupchan, S.M., Fessler, D.C., Eakin, M.A., and Giacobbe, T.J. 1970. Reaction of Alpha Methylen Lactone Tumor Promoter Inhibitors with Model Biological Nucleophiles. Science 168, 376 – 377.
International Seminar Pokjanas TOI 10 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
ANTIBACTERIAL ACTIVITIES OF DAYAK PASER MEDICINAL PLANTS AGAINST Escherichia coli
Septina Asih Widuri* and Noorcahyati* * Research Institute for Natural Resources Conservation and Technology, Ministry of Environment and Forestry, Republic of Indonesia Jl. Soekarno Hatta Km 38 Samboja PO Box 578 Balikpapan 76112, East Kalimantan, Indonesia [email protected]
ABSTRACT
Increasing resistance of infectious microorganisms to antibiotics leads to a challenge to develop new and more effective antibacterial agents. Traditional medicine is a potential source of antibacterial agents derived from screening ethnomedicinal plants. This study examined the antibacterial activities of five Dayak Paser medicinal plants from Paser, East Kalimantan namely Spatholobus ferrugineus, Melicope glabra, Ardisia serrata, Gonocaryum calleryanum, and Neonauclea gigantea against Escherichia coli by a disc diffusion method. All the ethanol extracts of these plants exhibited antibacterial performance at concentrations of 5000 ppm and 10000 ppm. The diameter of inhibition zone ranged between 7.17-10.65 mm at a concentration of 5000 ppm and 8.00-15.05 mm at a concentration of 10000 ppm. Melicope glabra showed the highest activity at both of concentration. Keywords: Antibacterial, Spatholobus ferrugineus, Melicope glabra, Ardisia serrata, Gonocaryum calleryanum, Neonauclea gigantea, Escherichia coli
INTRODUCTION
Infectious diseases caused by pathogenic bacteria have been considered as a major cause of morbidity and mortality in humans not only in Indonesia but also worldwide(1). Consequently, a number of new antibiotics have been produced but resistance of infectious microorganisms to antibiotics has also increased(2). This circumstance eventually leads to a challenge to develop new and more effective antibacterial agents. Natural products have been used in traditional medicine all over the world for thousands of years. Plants have been investigated as sources of many bioactive compounds. Tropical rain forests of Kalimantan have a vast diversity of bioactive potential plants. Tribes living around the forests have depended on forests for their needs especially for food and medicine. The local tribes’ knowledge about traditional medicine is a potential source of antibacterial agents derived from screening the plants. Dayak Paser is one of local tribe in East Kalimantan. Traditionally, they use plants from forest around them to treat some diseases such as diarrhea, dysentery, cold, toothache, wound, even stamina booster, high blood pressure and diabetic (3). The objective of this study was to examine antibacterial activities from selected Dayak Paser medicinal plants used for treatment of diseases that mostly caused by microorganisms. The phytochemicals and antibacterial properties from the plants which were focused in this study have not been widely reported.
METHODS
Plants material and extraction The plants material was collected from Petangis village, Batu Engau district, Paser, East Kalimantan in September 2014. The information about the plants and their traditional use were obtained by interviewing traditional healer and people at Petangis village. Spatholobus ferrugineus, Melicope glabra, Gonocaryum calleryanum and Neonauclea gigantea were selected in this study due to their properties in Dayak Paser International Seminar Pokjanas TOI 11 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
traditional medicine to treat bacterial infection symptoms while Ardisia serrata was subjected to represent traditional medicine to treat non bacterial infection symptoms. They were further identified at the Herbarium of Research Institute for Natural Resources Conservation and Technology at Samboja, East Kalimantan. Roots, stem, stem barks, and leaves (Table 1) were dried at room temperature (27oC) and sent to LPPM Biofarmaka Laboratory, Bogor for further analysis. The dried samples were extracted using maceration with 70% ethanol. The concentration of extracts used in all assays was 5000 ppm and 10000 ppm.
Table 1. Summary of plants, part of plants and medicinal properties based on Dayak Paser traditional medicine. Species Family Local name Traditional usea Part of plantsb Spatholobus ferrugineus Benth. Leguminosae Rayak akar mouth ulcer roots Melicope glabra (Blume) T.G. Rutaceae Kotep stomachache leaves Hartley Ardisia serrata (Cov.) Pers. Primulaceae Tetung ngrengat arthritis stem bulu Gonocaryum calleryanum Stemonuraceae Kembayan wound leaves (Baill.) Becc. bintang Neonauclea gigantea (Valeton) Rubiaceae Memberatan wound Stem bark Merr. a based on interview with traditional healers at Petangis village b Part of plant used in antibacterial activity determinations
Antibacterial activity determinations Extracts were screened against Escherichia coli (Biofarmaka IPB collection). It was maintained on Liquid Broth (LB) slant cultures and kept at 37oC. The turbidity of liquid culture for use in the assay was adjusted to 1x108 CFU/mL (4). The antibacterial activity of plant extracts was measured using a standard disc diffusion assay(5). 100µL of liquid E coli culture was spread onto plates using a sterile technique and 10 µL of each concentration of extract was pipetted onto a 6 mm sterile filter paper disc. Ampicillin 10000 ppm served as a positive control and DMSO served as a negative control. Each extract was tested on two replicate plates. The plates were incubated at 37oC for 24 hours before zone of inhibition calculated.
RESULTS
All the ethanol extracts of the selected plants exhibited antibacterial performance at concentrations of 5000 ppm and 10000 ppm. The zone of inhibition ranged between 7.17-10.65 mm at a concentration of 5000 ppm and 8.00-15.05 mm at a concentration of 10000 ppm (Figure 1).
International Seminar Pokjanas TOI 12 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Figure 1. Mean diameter of inhibition zones at concentrations of 10000 ppm and 5000 ppm
DISCUSSION
The results of present investigation indicated that the ethanol extract of the plants inhibited the growth of E coli. Antibacterial activities vary with the species of plants (Figure 1). These differences could be due to the difference in the chemical composition of these plant secondary metabolites that affected antibacterial activity(6). The increase in concentration of the extracts increased the diameter of inhibition zones due to the higher concentration of the extracts contained the higher secondary metabolites compounds(7). Ethanol extract of M. glabra leaves showed the highest diameter of inhibition zone in this study (15.05 mm and 10.65 mm) as seen at Figure 1. Dayak Paser tribe has used M. glabra leaves to treat stomachache. The leaves of M. glabra were heated above the flame then bandaged over the stomach. Not only used by Dayak Paser, M. glabra has also been used by Dayak Banuaq tribe at Kutai Barat as medicinal plant but for different diseases such as influenza(8). Regardless of how the treatment was performed by Dayak Paser tribe, scientifically, M. glabra indicate efficacy as medicine. An experiment study (9) reported that the barks of M. glabra have a high phenolic content which were also thought to contribute to antibacterial activity. This report(9) also summarized that various Melicope species revealed the presence of alkaloid, flavonoids and terpenoids and some of these compounds have antibacterial activities. However, phytochemical and antibacterial activities from M. glabra leaves specifically have not been reported. The roots of S. ferrugineus were used by Dayak Paser tribe to treat mouth ulcer by drinking its boiled water. Mouth ulcer usually related to microorganisms contamination on mouth. The ethanol extracts of S. ferrugineus roots delivered 9.11 mm and 8.07 mm diameter of inhibition zone (Figure 1). The barks extract of S. ferrugineus contained alkaloid, flavonoid, and terpenes(10). These chemical compounds played a role in antibacterial activities(9). The roots were expected contain the chemical compound as the barks, thus the phytochemical screening of S. ferrugineus roots need to be done. Dayak Paser tribe has used the boiled water of G. calleryanum leaves to treat a wound inside the body and utilized the stem barks of N. gigantea to heal a wound on skin. These plants exhibited antibacterial activities (Figure 1). In fact, G. calleryanum possessed flavonoids(11) meanwhile chemical compounds of N. gigantea have not been reported yet . In accordance with their indications, G. calleryanum and N. gigantea were assumed to have tannins which were reported to have antibacterial International Seminar Pokjanas TOI 13 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
activities against E. coli (12). Tannins also could accelerate the wound healing through several cellular mechanism(13). A. serrata was used by Dayak Paser tribe to cure arthritis. They boil the stem and drink the water. Although it was non-bacterial symptom, A. serrata exhibited antibacterial activities against E coli. This plant was expected to have bioactive compounds that have a role in either antiinflammatory, analgesic or antibacterial activities. Therefore, it becomes important to investigate the phytochemical and bioactivities of this plant since there are no reports about it. The result obtained from this study showed that medicinal plants used by Dayak Paser to treat bacterial and non bacterial infection symptoms exhibited antibacterial properties. This in vitro antibacterial determination was the first step towards to development of new antibacterial agents from ethnomedicinal plants. Although these selected plants produced less activity than positive control against E coli, however they were still potential for further investigation. Phythochemical screening, identification for the specific bioactive compounds and antibacterial activities determination of these plants against various pathogen bacteria are needed.
CONCLUSION
Ethanol extracts of S. ferrugineus, M. glabra, G. calleryanum, N. gigantea and A. serrata exhibited antibacterial performance against E. coli with zone of inhibition ranged between 7.17-10.65 mm at a concentration of 5000 ppm and 8.00-15.05 mm at a concentration of 10000 ppm. M. glabra showed the highest activity. They are potential as source of antibacterial agents.
ACKNOWLEDGMENTS
This work was part of the research program of Research Institute for Natural Resources Conservation and Technology, Ministry of Environment and Forestry, Republic of Indonesia. REFERENCES
1. Nathan C. Antibiotics at the crossroads. Nature 2004, 431:899-902. 2. Adwan G, Mhanna M. Synergistic effects of plant extracts and antibiotics on Staphylococcus aureus strains isolated from clinical specimens. Middle East J Sci Res [Internet]. 2008 [cited 2015 Sep 28]; 3:134-139. Available from: www.idosi.org/mejsr/mejsr3(3)/5.pdf. 3. Noorcahyati, Widuri SA, Sitepu BS, Mediawati I, Arifin Z, Wibisono Y. Kajian etnobotani dan uji fitokimia jenis bahan baku obat kurang dikenal. Laporan Hasil Penelitian. Balai Penelitian Teknologi Konservasi Sumberdaya Alam. Tidak diterbitkan. 2014. 4. Frey FM, Meyers R. Antibacterial activity of traditional medicinal plants used by Haudenosaunee peoples of New York State. BMC Complement Altern Med [Internet]. 2010 Nov [cited 2015 Jan 25]; 10(64):1-10. Available from: http://www.biomedcentral.com/1472-6882/14/122. 5. Bauer AW, Kirby WMM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Amer J Clin Pathol [Internet]. 1966 Aug [cited 2014 Des 12]; 45:493-496. Available from: garfield.library.upenn.edu/classics1985/A1985ANC2900001.pdf. 6. Noumedem J, Mihasan M, Lacmata S, Stefan M, Kuiate J, Kuete V: Antibacterial activities of the methanol extracts of ten Cameroonian vegetables against Gram-negative multidrug resistant bacteria. BMC Complement Altern Med [Internet]. 2013 Jan [cited 2015 Sep 28];13(26):[about 5pp]. Available from: http://www.biomedcentral.com/1472-6882/13/26. 7. Setha B, Laga A, Mahendradatta M, Firdaus. Antibacterial activity of leaves extracts of Jatropha curcas, Linn against Enterobacter aerogenes. International Journal of Scientific & Technology Research [Internet]. 2014 Jan [cited 2015 Oct 1];3(1):129-131. Available from: http://www.ijstr.org/final-print/jan2014/Antibacterial-Activity-Of-Leaves-Extracts-Of-Jatropha- Curcas-Linn-Against-Enterobacter-Aerogenes.pdf.
International Seminar Pokjanas TOI 14 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
8. Falah F, Sayektiningsih T, Noorcahyati. Keanekaragaaman jenis dan pemanfaatan tumbuhan berkhasiat obat oleh masyarakat sekitar Hutan Lindung Gunung Beratus, Kalimantan Timur. Jurnal Penelitian Hutan dan Konservasi Alam. 2013;10(1): 1-18. 9. Kassim NK, Rahmani M, Ismail A, Sukari MA, Ee GC, Nasir NM, Awang K. Antioxidant activity-guided separation of coumarins and lignan from Melicope glabra (Rutaceae). Food Chem [Internet]. 2013 Aug [cited 2015 Sep 28];139(1-4):87-92. Available from: www.ncbi.nlm.nih.gov/pubmed/23561082. 10. Marliana E. Analisis senyawa metabolit sekunder dari batang Sptaholobus ferrugineus (Zoll&Moritzi) Benth yang berfungsi sebagai antioksidan. Jurnal Penelitian MIPA [Internet]. 2007 Dec [cited 2015 Sep 27];1(1):23-29. Available from: http://repository.usu.ac.id/bitstream/123456789/21203/1/kpm-des2007-1%20(2).pdf. 11. Kaneko T, Sakamoto M, Ohtani K, Ito A, Kasai, R, Yamasaki K. Secoiridoid and flavonoid glycosides from Gonocaryum calleryanum. Phytochemistry [Internet]. 1995 May [cited 2015 Oct 6];39(1):115-120. Available from: http://www.researchgate.net/publication/222585377_Secoiridoid_and_flavonoid_glycosides_fro m_Gonocaryum_calleryanum 12. Oboh G. Antioxidant and antimicrobial properties of ethanolic extract of Ocimum gratissimum leaves. J Pharmacol Toxicol [Internet]. 2010 [cited 2015 Sep 18]; 5(7):396-402. Available from: www.doi:10.3923/jpt.2006.47-53. 13. Sheikh AA, Sayyed Z, Siddiqui AR, Pratapwar, Sheakh SS. Wound healing activity of Sesbania grandiflora Linn flower ethanolic extract using excision and incision wound model in wistar rats. International Journal of PharmTech Research [Internet]. 2011 April-June [cited 2015 Oct 6];3(2):895-898. Available from: sphinxsai.com/vol3.no2/pharm/pharmpdf/PT=43(895- 898)AJ11.pdf.
International Seminar Pokjanas TOI 15 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
CITOTOXICITY AND RADICAL SCAVENGING ACTIVITY TEST OF GAMBIR (Uncaria gambir (HUNTER) ROXB.) IN VITRO Sri Ningsih1*, Churiyah1, Fahri Fahrudin1, Rini Damayanti2, Eriawan Rismana3 1Center of Phamaceutical and Medical Technology – Agency for the Assessment and Application of Technology - LAPTIAB 610-611 Bld. Kawasan Puspiptek Serpong , Tangerang Selatan, Banten, Indonesia 2Indonesian Research Center for Veterinary Science - Jl. RE Martadinata 30 Bogor, West Java, Indonesia 3BPPT *Corresponding author : [email protected]
ABSTRACT Gambir (Uncariagambir(Hunter) Roxb.) is a native Indonesian medical shrub and used as traditional medicine for treating various diseases because of its highly polyphenol content. The aim of this studies were to evaluate the toxic effect of some gambir extracts on normal cell line in vitro and to determine their antioxidant activity. The samples were consist of 5 kinds of extracts, namely, gambir, ethanolic 50%extract of gambir, ethanolic 96% extract of gambir, ethanolic 50% extract of gambir leaves and ethanolic 96% extract of gambir leaves. Cytotoxicity assay was conducted on Vero normal cell line by 4,5-dimethylthiazol-2yl (MTT) assay, and showed that the Inhibitory Concentration 50(IC50) values of the 3samples of gambir extract were more than 1000 ppm resulted in the absent of proliferative effect, as well as both gambir leaves extracts were less than 1000 ppm. The 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging activities of all samples measured at 4 ppm final concentration had range of 29.5%- 49.7% with standard Vitamin C value of 53.1%. The activities decreased in the following order: ethanolic 96% extract of gambir>ethanolic 96% extract of gambir leaves>gambir >ethanolic 50% extract of gambir>ethanolic 50% extract of gambir leaves, respectively. These results showed that all gambir extract were categorized as non-cytotoxic with highly antioxidant activities.
Keywords: Gambir (Uncariagambir(Hunter) Roxb.), cytotoxicity assay, radical scavenging, DPPH, antioxidant.
INTRODUCTION
Gambir or Uncaria gambir (Hunter) Roxb. belonging to Rubiaceae family, is a native plant especially found in Sumatera inland and Malaysia peninsula (Hussin MH. et al, 2011). Indonesia produce very high gambir that fulfill almost 80% of the worldwide need (Dhalimi A., 2006). The polyphenol compound of gambir is sufficiently high with flavonoid (+)-catechin content as the major compound. (+)Catechin content is almost 40-80% of dried water extract depending on the preparation process (Hayani E. et al, 2003). According to the natural compounds, gambir demonstrated some pharmacological benefits such as antiflatulence, antibacterial, skin tanning, remedies for diarrhea and sore throat and pesticides properties (Kassim MJ. et al., 2011).These polyphenol also exhibit antioxidant activity in some in vitro test (Widiyarti G. et al., 2011; Amir M., 2012, Anggraini T. et al., 2011). According to The National Agency of Drugs and Food Control (NA-DFC) regulation, the development of new medicines, including traditional medicines, cosmetics, and products complement as well as food and hazardous materials, beside of the efficacy assessment, it is also necessary to perform a set of toxicity evaluation (Anonim, 2014). Cell culture technique is frequently used as the first tool for estimating toxic effect of new material (Anussavice KJ., 2003).This methods is conducted in normal cells such as fibroblast (Graidist P. et al., 2015) and Vero(Pour BM, et al., 2011)cells. Toxicity levels is related to the cell viability as exposure to material tested in which the number of living cells is measured with MTT colorimetric (Graidist P. dkk., 2015). The studies were conducted to demonstrate the viability of Vero cells and the radical scavenging activity after exposing of some gambir extracts.
International Seminar Pokjanas TOI 16 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
METHODS
Preparation of gambir extracts Fresh gambir simplisia (leaves and twigs) were collected from Limapuluh Kota – West Sumatera Province on February 2013. The shrubs was identified in Bogoriense Herbarium Research Center for Biology Indonesian Institute of Science (LIPI) Bogor, before being processed. The samples tested were gambir, ethanolic 50% extract of gambir, ethanolic 96% extract of gambir, ethanolic 50% extract of gambir leaves and ethanolic 96% extract of gambir leaves. Gambir was prepared based on Farmakope Herbal Indonesia with modification. Briefly, 1 kg of fresh gambir was steam for 60minutes and then pressed until gambir gum collected. Gum was separated from water with decantation for 10-12 hours followed by drying the obtained semisolid sediment in oven at temperature of 45-500C for overnight.Then, it was powdered by electric blender. Both ethanolic extracts of gambir were prepared with the agitating maceration technique at room temperature for 16-18 hours using ethanolic 96% and ethanolic 50%, respectively. Each collected filtrate was then separately evaporated under vacuum at 450C to get dried mass. The similar method was applied to obtain both extracts of gambir leaves in which the final extracts were semisolid mass.
4,5-dimethylthiazol-2yl (MTT) assay Cytotoxicity effect of gambir extract was estimated through the MTT assay. It is a colorimetric assay for assessing cell metabolic activities, conducted based on protocol test developed by Laboratory of Center of Phamaceutical and Medical Technology – Agency for the Assessment and Application of Technology. Vero cells was maintained in RPMI-1640 medium supplemented with 10% FBV, 1% 0 penicillin-streptomicin, and 0.2% NaHCO3. The cells were cultured at 30 C in humidified 5% CO2 incubator. Vero cells were diluted with Roswell Park Memorial Institute (RPMI) medium to 5x105 cells/mL and aliquots (5x104 cells/0,1mL) were placed in individual wells in 96-well micro plate. After attaching into the wells with incubating at CO2 5%, 370C for overnight, cells were treated with a diluted 2-fold series of concentration of each sample ranged from 62.5 to 1000 ppm in final solution. Samples were dissolved in medium with maximal dimethyl sulphoxide (DMSO) 0.1% each well. Next, the cells were incubated at the above conditions for 24 h and then their viability was determined by MTT color. The MTT solution (0.5 mg/mL in medium, 100 uL each well) was added to each well and incubated for 4 h. The 10% Sodium dodecyl sulphate (SDS) solution in 0.1 N HCl was added to each well to dissolve the formed formazan crystals, followed by incubating of the plate for 24 hours at room temperature for completing dissolution process. The absorbance was read at 570 nm on a microplate reader after shaking at 120 rpm for 15 minutes. Blank and control absorbance were prepared similar to samples treatment by using reagent only and reagent plus cells without samples, respectively. The tests were performed in triplicate. Percent viability was calculated with this equation
% viability = [ a – b ] x 100% [ c – b ]
a: sample absorbance, b: blank absorbance, c: control absorbance
1,1-diphenyl-2picrylhydrazyl (DPPH) radical scavenging assay The antioxidant activity that is measured from free radical scavenging activity of the extracts was measured by using the stable DPPH free radical based on previous paperwith modifications (Hanani E. et al., 2005). Briefly, into 5 mL glass tube, it put in 3000 uL samples solution, 150 uL DPPH solution, consecutively. The concentration of sample solution was prepared by dissolving each extract with DMSO and methanol to get 4 ppm of final solution and DPPH solution was 0,004% in methanol as well. The absorbance was measured at 517 nm after being incubated at room temperature for 30 minutes. Ascorbic
International Seminar Pokjanas TOI 17 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
acid was used as standard. The control absorbance was prepared from similar to the above reaction without sample, and blank absorbance was used methanol. The experiments were done in triplicates. The activity of radical scavenging was calculated with this equation.
% radical scavenging activity = [ a – b ] x 100% [ c – b ] a: sample/standart absorbance, b: blank absorbance, c: control absorbance
Data Analysis Microsoft excel program was applied to calculate IC50 value of percent proliferation from proliferative percentage figure (concentration caused 50% Vero cells proliferate). T-test for two independent samples by SPSS 14.00 software was to analyze intergroup difference of free radical scavenging activity each extract against to standard vitamin C.
RESULTS
Cytotoxicity test The toxicity tests of all samples were conducted on kidney pig normal cell line, Vero cells, followed by MTT assay was depicted at Figure 1. The cytotoxicity level stated as IC50 value of percent viability was performed at Table 1. The IC50 value was indicated as concentration of tested sample that caused 50% of cell population survived.
Figure 1. Percent viability of Vero cells after extract treatment
Table 1. The IC50 value of percent viability Vero cells after treated with gambir extracts Samples IC50 (ppm) Gambir > 1000 Ethanolic 96% extract of gambir leaves 692 Ethanolic 50% extract of gambir leaves 716 Ethanolic 96% extract of gambir > 1000 Ethanolic 50% extract of gambir > 1000
1,1-diphenyl-2picrylhydrazyl (DPPH) radical scavenging activity The antioxidant activity of all samples was tested using DPPH free radical scavenging method. The level of antioxidant activity of each sample was compared to standard vitamin C, which the results were as shown in Table 2.
International Seminar Pokjanas TOI 18 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Table 2. Percentage free radical scavenging activity of samples Radical p value Compared to scavenging Vit C Samples activity Gambir 40,2% 0,040* 76% Ethanolic 96% extract of gambir leaves 43,1% 0,018* 81% Ethanolic 50% extract of gambir leaves 29,5% 0,001* 56% Ethanolic 96% extract of gambir 49,7% 0,264 93% Ethanolic 50% extract of gambir 37,1% 0,003* 70% VIT C 53,1% -- 100% * p < 0,05 versus Vitamin C. Experiment was conducted at concentration 4 ppm of final solution
DISCUSSIONS
Cytoxicity test To get the complete solution, preparation extracts were by added DMSO before diluting with RPMI media. Dimethyl sulfoxide (DMSO) is a polar aprotic solvent that dissolves both polar and non- polar compounds and is miscible in a wide range of organic solvent and water. Therefore, DMSO is claimed as an excellent and selective solvent for many organic compound contained in some type of plant derived extracts (Martin HD. et al., 1967). It can give beneficial effect when used at optimal concentration. In culture cell experiments, it may not influence cell mortality when used at the concentration less than 2%. However, at high concentration, DMSO demonstrated cytotoxic effect. Studies by Anguilar JS. et al., 2002 claimed that incubation of Vero cells with 5% DMSO for 24 hours caused in mortality of about 20% by sulforhodamine B assay. In this research, for eliminating false negative due to toxic effect, DMSO was used at 1% of final solution in each well. Figure 1 showed the percentage of Vero cells viability after being treated with each gambir extract. The extract showed dose-dependent inhibition of cell viability in Vero cells. Among the extract, ethanolic 96% extract of gambir leaves caused cell proliferation when treated at low concentration. This was also occurred with gambir which had slight proliferative effect. However, both ethanolic extracts of gambir (ethanol96% and ethanol50%) did not initiate cells proliferation. Hence, extraction with ethanol could separate compounds that induced proliferation selectively. Furthermore, each extract at high concentration showed different effect toward cell viability. Both extract that prepared from gambir leaves (ethanolic96% and ethanolic50% extracts) demonstrated cytotoxic effect, but there were not demonstrated by both extracts of gambir. These results were also confirmed by the IC50 value of percent viability as illustrated at Table 1. However, based on earlier study, all of the samples were categorized as non-toxic category. It stated that non-toxic category when the IC50 value of some extract against to normal cells was more than 80 ppm (Graidist P. et al., 2015). Hence, the viability effect of the whole extract toward Vero cells could be attributed to the presence of a variety of compound.
1,1-diphenyl-2picrylhydrazyl (DPPH) radical scavenging activity The results of antioxidant evaluation using DPPH method demonstrated that extract ethanolic 96% of gambir exhibited the highest activity, 49.7% at concentration 4ppm as stated at Table 2. This antioxidant activity did not differ compared to standard Vitamin C significantly. Antioxidant activity was caused by donating hydrogen atom to free radical stable, DPPH, to form a stable DPPH-H molecule (Kassim MJ. et al., 2011) in which was characterized by reduced color intensity from purple into yellow. These results were in line with other previous studies in which gambir performed antioxidant activity (Widiyarti G. et al., 2011, Amir M., 2012, Anggraini T. et al., 2011). The activity of the radical DPPH scavenging activities varied among studies depend on the sources of gambir, sample preparation andthe analyzing method(Ningsih S. et al., 2014). Antioxidant activity of gambir was mainly caused by polyphenol compounds (Kassim MJ. et al., 2011). It had been reported that there were some antioxidant mechanisms of polyphenol compounds such as donating hydrogen atom and single electron toward radical compound, complexion with metal ion that played as oxidative inducer (Sugihara N. et al., 2001).
International Seminar Pokjanas TOI 19 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
It was concluded that all of gambir extracts prepared in the study demonstrated radical scavenging activity and non-toxic properties to normal Vero cells, therefore this advantages can be thoroughly studied more deeply as potential traditional herbs.
ACKNOWLEDGMENT
Authors would like to deeply thank toward Insentif Sinas Ristek 2014 Program for providing this research funding.
REFERENCES
1. Aguilar JS, Roy D, Ghazal P, Wagner EK. Dimethyl sulfoxide blocks herpes simplex virus-1 productiveinfection in vitro acting at different stages with positivecooperativity. Application of micro-array analysis. BMC Infectious Diseases2002;2(9):1-10. 2. Amir M,Mujeeb M, Khan A, Ashraf K, Sharma D, Aqil M, Phytochemical analysis andin vitroantioxidant activity ofUncaria gambir. International Journal of Green Pharmacy 2012;6(1):67- 72. 3. Anggraini T, Tai A, Yoshino T, Itani T. Antioxidative activity and catechin content of four kinds of Uncaria gambir extracts from West Sumatra Indonesia. African Journal of Biochemistry Research 2011;5(1):33-8. 4. Anonim, Peraturan Kepala Badan Pengawas Obat Dan Makanan Republik Indonesia Nomor 7 Tahun 2014 tentang Pedoman Uji Toksisitas Nonklinik secara in vivo, Kementrerian Kesehatan Republik Indonesia 2014, Jakarta. 5. Anussavice KJ. Phillips' science of dental materials. 11st ed. Elsevier Science (USA) Saunders; 2003:172–94. 6. Dhalimi A. Permasalahan gambir (Uncaria gambir L.) di Sumatera Barat dan alternatif pemecahannya. Perspektif 2006;5(1):46-59. 7. Graidist P, Martla M, Sukpondma Y. Cytotoxic activity of Piper cubebaextract in breast cancer cell lines. Nutrients 2015;7:2707-18. 8. Hanani E, Mun’im A dan Sekarini R. Identifikasi senyawa antioksidan dalam spons Callyspongia sp dari kepulauan seribu. Majalah Ilmu Kefarmasian. 2005;2(3):127 – 133Sugihara N, Ohnishi M, Imamura M, Furuno K. Differences in Antioxidative Efficiency ofCatechins in Various Metal- Induced Lipid Peroxidations in Cultured Hepatocytes. Journal of HealthScience 2001;47(2):99-106. 9. Hussin MH, Kassim MJ. The corrosion inhibition and adsorption behavior ofUncaria gambir extract on mild steel in 1 M HCl. Materials Chemistry and Physics 2011;125(3):461–8. 10. Kassim MJ, Hussin MH, Achmad A, Dahon NH, Suan TK, Hamdan HS. Determination of total phenol, condensed tannin and flavonoid contents and antioxidant activity of Uncaria gambir extracts. Majalah Farmasi Indonesia 2011;22(1):50–9. 11. Martin HD, Weise A, Niclas HJ. The solvent dimethyl sulfoxide. Angewande Chemie 1967;6(4):318-334 (abstract). 12. Ningsih S, Fachrudin F, Rismana E, Purwaningsih EH,Sumaryono W, Jusman SWA. Evaluation of antilipid peroxidationactivity of gambir extract on liver homogenat in vitro. International Journal of PharmTech Research 2014;6(3):982-9. 13. Pour BM, Latha LY, Sasidharan S. Cytotoxicity and oral acute toxicity studies of Lantana camaraleaf extract. Molecules 2011;16:3663-74. 14. Widiyarti G, Sundowo A, Hanafi M. The free radical scavenging and anti-hyperglycemic activities of various gambiers available in Indonesian market. Makara Sains 2011;15(2):129-34.
International Seminar Pokjanas TOI 20 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Acute Toxicity of Ethanolic Extract of Fenugreek Seeds (Trigonella foenum-graecum L.) on White Rats
KURNIA AGUSTINI*, SRININGSIH, JULHAM EFFENDI
Center for Pharmaceutical and Medical Technology, Agency for the Asessment and Application of Technology, BPPT, Jakarta.
correspondence author: [email protected]
Abstract: Fenugreek seed or biji klabet (Trigonella foenum-graecum L.) was known having activity to handle some of degenerative diseases such as diabetes mellitus, hypercholesterolemia and also postmenopausal symptoms. This study was conducted to investigate the safety of ethanolic extract of biji klabet on white rat, especially to count the value of Lethal Concentration 50 (LC50). This in-vivo assay referred to WHO protocols for toxicity assay of natural medicines. We used Spraque dawley white rats, female and male, 6 weeks age, which divided into one group normal and five treatment groups (1g/kgBW, 4g/kgBW, 8g/kgBW, 12g/kgBW, 16g/kgBW). Sample was given once orally then animal were monitored for two weeks. Observation of toxic effect e.g physical symptom of central nerve system, autonom nerve system and digestive system. All lethality animal were observed and LC50 were counted. Result showed that there was no toxic effect and no lethal animal until 16g/kgBW dose. We can conclude that ethanolic extract of Fenugreek is practically non toxic.
Keywords : Fenugreek seeds, Trigonella foenum-graecum L., acute toxicity.
INTRODUCTION
Fenugreek seed or Foenigraeci semen is dried seed from Trigonella foenum-graecum L., Leguminosae(1) (WHO, 2007). In Indonesia, it calls Biji Klabet. Empirically, biji klabet was used for hemorrhoids, asthma, ulcers, muscle pain and often used as a preventative hair loss and skin softener. Many studies showed its activity as antidiabetic, anticancer and for hypercholesterolemia handling(2) (Mills, 2000). Biji Klabet has antiandrogen activities, due to its active compounds as beta-sitosterol, palmitic-acid and stearic-acid, and also has the ability to decrease of total cholesterol, LDL, VLDL cholesterol and triglycerides significantly. The anti-hyperglycemic and anti-inflammatory properties investigated in fenugreek are additional benefit. Agustini’s study (2007) showed that ethanolic extract of Biji Klabet have estrogenic effect on ovariectomized and immature female Wistar rats(3). Biji Klabet contains some sapogenin steroid ingredients, e.g. diosgenin, precursor for sexual hormone(4) (Evans, 2002), its isomer Yamogenin, gitogenin, tigogenin, and trigoneoside(5) (Dewick, 1997). Biji Klabet contains diosgenin in free base form 0.8 – 2.2 %(6) (Wiryowidagdo, 2000). Biji Klabet also contains fatty oil 20-30%, alkaloids (trigonelline, an alkaloid pyridine, gentianin and karpain), flavonoids e.g. vitexin in glycoside or ester form, isovitexin, orientin, vicenin, quercetin and luteolin, essential oil, saponine, nicotinamide, choline, bitter compound and mucilage(4). This study was carried out to investigate safety effect of ethanolic extract of Fenugreek in white rat. Acute toxicity assay also known as short term toxicity assay. Sample are given once in various grade of doses and observation are carried out for two weeks. All physical symptoms and lethal animal were analysed then compare to normal group. This acute toxicity study was meant to count the value of Lethal
International Seminar Pokjanas TOI 21 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
Dose 50% (LD50) from sample. LD50 is a dose that can cause 50% lethality of animal test. Sample can categorized as safe material when they have LD50 value bigger than 15g/kgBW(7) (Lu, 1995).
MATERIAL AND METHODS
Sampel preparation. Biji klabet were obtained from Tawangmangu, Central Java, Indonesia. Seed were dried and grind, then were extracted with ethanol 96% food grade. Crude extracts were suspense with Carboxy Methyl Celulose (CMC) 0.5%. Animal preparation. Experimental animals used in this study were 30 males and 30 females Spraque Dawley (SD) white rats, 5-6 weeks age, obtained from Indonesian Food and Drug Administration (FDA/BPOM). The animal were kept in the animal room (25 + 20C) under 12 h light/dark cycle and fed with standard diet of pellet rat diet and free access to distilled water prior to the start of the study. Animal were kept for acclimatization for one week. Animal were maintained and handled according to ethical committee which approved the design of the animal experiment. Ethical clearance was approve by Ethical Committee of Indonesian Agency for Health Research and Development (Badan Penelitian dan Pengembangan Kesehatan/Balitbangkes). Animal treatment. Animals were divided into one group normal and five treatment groups (1g/kgBW, 4g/kgBW, 8g/kgBW, 12g/kgBW, 16g/kgBW), each 5 males and 5 females. Sample was given once orally then animal were monitored for two weeks. Observation of toxic effects were done, e.g. physical symptom of central nerve system, autonomy nerve system and digestive system. Body weights were weighing at day 1, 6,9,12,14. After two weeks all animal were autopsied.
Table 1. Group of animal treatment. No. Groups Treatment N 1. N Normal Diet + CMC Na 0,5% suspense 5 Male + 5 Female 2. D1 Normal Diet + Sample 1 g/kgBW 5 Male + 5 Female 3. D2 Normal Diet + Sample 4 g/kgBW 5 Male + 5 Female 4. D3 Normal Diet + Sample 8 g/kgBW 5 Male + 5 Female 5. D4 Normal Diet + Sample 12g/kgBW 5 Male + 5 Female 6. D5 Normal Diet + Sample 16 g/kgBW 5 Male + 5 Female
RESULT AND DISCUSSION
All animal treated with dose 1 (1g/kgBW) until dose 5 (16g/kgBW) showed no toxic effect significantly. Normally, after orally given sample treatment, all animal showed decrease of motoric activity for some minutes. But after 30 minutes, all activity back to normal. This spontaneous effect is normal after orally gavage treatment. The results of observation of physical symptom of central nerve system, autonom nerve system and digestive system observation, can be seen on Table 2.
Table 2. Physical toxic effect observation. Groups Observation N D1 D2 D3 D4 D5 Central Nerve System 1. Sedasi ------2. Motoric Activity +/- +/- +/- +/- +/- +/-
International Seminar Pokjanas TOI 22 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
Groups Observation N D1 D2 D3 D4 D5 3. Convulsion ------4. Tremor ------Autonom Nerve System 1. Open eye +/- +/- +/- +/- +/- +/- 2. Salivation ------3. Urination ------Breath Rate +/- +/- +/- +/- +/- +/- Heart Rate +/- +/- +/- +/- +/- +/- Digestive System 1. Diarrhea ------2. Constipation ------3. Bloody Fesses ------Stress hair ------Note: - : No symptom + : There are symptom +/- : Normal
Body weight analysis from all animal, both male and female, with treatment dose 1g/kgBW until 16g/kgBW gives no significant difference compare to normal control. Both male and female rats in all groups gives increasing of body weight almost similar to normal control for 14 days.
Figure 1. Body weight of male rats from all group for 14 days observation.
International Seminar Pokjanas TOI 23 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
Figure 2. Body weight of female rats from all group for 14 days observation.
There was no lethality case of animal found in all group after 14 days observation. Therefor this assay should be repeat using higher level doses than 16g/kgBW. But technically it’s so difficult to treat orally to the animal. Beside that, regulation from Indonesian FDA says that if until dose 15g/kgBW no lethality case occur, then its not necessary to repeat the assay. The sample can be categorized having LD50 higher than 15g/kgBW or categorized practically non toxic. The data about lethality case can be seen on Table 3.
Table 3. Lethality case of animal from all groups. Male Female Total Groups % Lethality n Lethal n Lethal Lethal Normal 5 0 5 0 0 0% D1 5 0 5 0 0 0% D2 5 0 5 0 0 0% D3 5 0 5 0 0 0% D4 5 0 5 0 0 0% D5 5 0 5 0 0 0%
Table 4. Catagorization of Toxic Effect(8). (Lu,FC, 1996) Toxic Category LD50 Value Super toxic < 5 mg/kgBB Very hard toxic 5-50 mg/kgBB Very toxic 50-500 mg/kgBB Medium Toxic 0,5-5 g/kgBB Mild Toxic 5-15 g/kgBB Practically Non Toxic > 15 g/kgBB
CONCLUSION
International Seminar Pokjanas TOI 24 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
No delayed toxic effect and lethality was observed in all rats during fourteen days of recovery period. Orally treatment of Fenugreek within this range and treatment duration would not cause any severe toxic effects and organ damages in rats. In conclusion, ethanolic extract of Fenugreek have pseudo LD50 and categorized as practically non toxic.
REFERENCES
1. Agustini, K, Sumali W., Dadang K. 2007. Estrogenic Effect of Fenugreek (Trigonellafoenum- graecum L.) on White Female Rats. Conference Proceedings "Women's Health and Traditional Medicine", International Medicine and Medicinal Plants, Surabaya. 2. Agustini, Kurnia, Sumali W., Dadang K. 2005. Pengaruh Pemberian Biji Klabet (Trigonella foenum-graecum L.) terhadap Kadar Hormon Estradiol dan FSH Plasma Tikus Putih Betina Galur Wistar yang Diovariektomi. Prosiding Seminar Nasional Penggalian Potensi Sembilan Tanaman Obat Unggulan Indonesia, Purwokerto. 3. Agustini, Kurnia, Sumali W., Dadang K. 2005. Efek Estrogenik Biji Klabet (Trigonella foenum- graecum L.) Terhadap Perkembangan Uterus Tikus Putih Betina. Jurnal Bahan Alam Indonesia, Perhimpunan Peneliti Bahan Obat Alami (PERHIPBA), Vol.4, No.2, Juli 4. Anonim. 2000. Pedoman Pelaksanaan Uji Klinik Obat Tradisional. BPOM Departemen Kesehatan RI, Jakarta: vi + 47p 5. Anonim. 2000. Parameter Standar Umum Ekstrak Tumbuhan Obat. BPOM Departemen Kesehatan RI, Jakarta: viii + 68p 6. Dewick PM. Medicinal Natural Products. A Biosynthetic Approach. New York: John Wiley & Sons; 1997. 7. Evans CW. Pharmacognosy. 15th edition. London: W.B. Saunders; 2002. 8. General guideline for methodologies on research and evaluation of traditional medicine. 2000. Geneva: World Health Organization. 9. Guyton, C.Arthur. 1995. Fisiologi manusia dan mekanisme penyakit. Translate from Human Physiology and mechanism of disease, by Petrus Andrianto. EGC, Jakarta: xii + 821p. 10. Lu F.C., Toksikologi dasar, asas, organ sasaran dan penilaian resiko. [Translate by Edi Nugroho]. Ed. 2, Jakarta:UI Press; 1995. 11. Mills, Simon & K. Bone. 2000. Principles and Practice of Phytoterapy. Modern Herbal Medicine. Churcill Livingstone, Edinburgh: xx + 643p. 12. Wiryowidagdo S. Kimia dan Farmakologi Bahan Alam. Jakarta: Universitas Indonesia. 2001; 318-328
International Seminar Pokjanas TOI 25 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
VIRTUAL SCREENING COMPOUNDS IN FABACEAE PLANTS AS LIGANDS ON ALPHA ESTROGEN RECEPTOR (ER-α)
Gulo LH1, Mumpuni E1* 1 Faculty of Pharmacy Pancasila University Jakarta
[email protected]; [email protected]
ABSTRACT Family Fabaceae has about 730 genera and 19.400 species. Some plant of family Fabaceae are known to have activity as an anti-breast cancer. This study does a series of computational chemistry method in virtual or in silico screening to compounds in the plant of family Fabaceae that are Abrus schimperi, Caesalpinia bonduc, Dalbergia vacciniifolia, Eriosema robustum, Erythrina falcata,Flemingia macrophylla, Genista saharae, Trifolium pratense L., Pachyrhizus erosus, Pissum sativum and dan DNP (Dictionary of Natural Products). The aim of this study is to find candidates of compounds as active ligands on estrogen receptor alpha (ER-α) by in silico and elucidating the amino acids contained in the binding site of compounds by using virtual screening validated Anita et al (2012) protocol. This protocol uses operating system LINUX Ubuntu LTS 14.04 with integrated applications such as SPORES, PLANTS 1.2, BKChem, Open Babel, R Computational Statistics and PyMOL, ZINC 01914469 as comparator compound, 4-[4-hydroxy-3-(prop-2-en-1-yl) fenil]-2-(prop- 2-en-1-yl) (dimer compound number 11) as reference compound and 4-hidroksitamoksifen as positive control. The results of virtual screening conducted on 60 compounds from ten plant of family Fabaceae obtained 24 compounds be active and 38 inactive compounds in the binding pocket of ER-α. The important amino acids to affinity compounds with estrogen receptor alpha (ER-α) that is GLU353, ARG394, ASP351 and THR347.
Key words: Fabaceae, Virtual Screening, Estrogen Receptor Alpha (ER-α).
INTRODUCTION
In an era new drug design, drug plants were interested as materials of new drug design. One of strategy to developing molecule design a new drug is utilization of computational chemistry methods by virtual screening or in silico screening. Virtual screening can be reduced, cost and time can be more efficient. This study does a series of virtual screening to compounds in the plant of family Fabaceae. Isoflavon was contained in family Fabaceae has known as anti breast cancer. The most of breast cancers are selective on estrogen receptor alpha (ER-α). The important of breast cancer treatment is to inhibit the activity of estrogen on estrogen receptor alpha (ER-α). In this study using virtual screening validated Anita et al (2012) protocol. The protocol used to identify ligands can be active on estrogen receptor.
MATERIALS
Tools: Hardwere: A computer TOSHIBA with processor Intel(R) Core(TM) i5-4200M CPU @ 2.50GHZ, NVIDIA 2GB, RAM 4GB, HDD 750GB.
Software: LINUX Ubuntu operating system (version 14.04), screening virtual applications (SPORES, PLANTS, BKChem, Open Babel, PyMOL), Statistical analysis application R i386 3.1.3.
International Seminar Pokjanas TOI 26 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Materials:
The 2D structure of compounds: Abrus schimperi, Caesalpinia bonduc, Dalbergia vacciniifolia, Eriosema robustum, Erythrina falcata,Flemingia macrophylla, Genista saharae, Trifolium pratense L., Pachyrhizus erosus, Pissum sativum and DNP (Dictionary of Natural Products)
The 2D structure of comparison ligand: ZINC 01914469
The 2D structure of reference compound: 4-[4-hidroksi-3-(prop-2-en-1-y1)fenil]-2-(prop-2-en-1-y1) (senyawa dimer no.11)
The 2D structure of positive control: 4-hidroksitamoksifen
METHODS
This study using a protocol of screening virtual validated Anita et al., for the screening virtual in silico compounds in the plant of family Fabaceae that areAbrus schimperi, Caesalpinia bonduc, Dalbergia vacciniifolia, Eriosema robustum, Erythrina falcata, Flemingia macrophylla, Genista saharae, Trifolium pratense L., Pachyrhizus erosus, Pissum sativum and DNP (Dictionary of Natural Products), which is used as a test compounds. BKChem application for drawing the structure of the test compound in the form of 2-dimensional (2D), and then type your converted files by using applications Open Babel. Ligands and receptors were prepared using Spores application. PLANTS application is used to simulate the docking of test compound to ER-α at least 3 times replication. Virtual screening results were analyzed using a statistical test one-tailed paired t-test (to see the match data between pairs of samples tested). PyMOL application used to display the active compounds representative of the test compound in the form of three-dimensional (3D) and the elucidation of amino acids in the binding pocket of ER-α.
RESULTS Table 1. Compounds Score and In Silico Activity
Ligand activity as Score estrogen receptor alfa Compound Chem PLP ± p-value (ER- SD α) (in silico) Caesalpinia bonduc Asam asetat 5-hidroksi-4,4,7,11b-tetrametil- 9-okso-1,2,3,4,4a,5,6,7,9,11,11a,11b- -87,6484 ± 0,9989 Active dodekahidro-6aH-10-oksa- 0,3821 siklopenta[b]fenantren-10a-il ester Dalbergia vacciniifolia 7-[6-(3,4-Dihidroksimetil-tetrahidro-furan-2- iloksimetil)-3,4,5,-trihidroksi-tetrahidro- -99,2499 ± 0,9949 Active pyran-2-iloksi]-5-hidroksi-3-(5-hidroksi-2,4- 1,8347 dimetoksi-fenil) 7-[6-(3,4-Dihidroksimetil-tetrahidro-furan-2- iloksimetil)-3,4,5,-trihidroksi-tetrahidro- -92,4449 ± 0,9953 Active piran-2-iloksi]-6-metoksi-3-(5-hidroksi-2,4- 0,5732 dimetoksi-fenill) Eriosema robustum
-85,8764 ± 5,7-Dihidroksi-6-(3-metil-but-2-enil)-2-fenil 0.9991 Active 0,6143
InternationalErythrina Seminar falcata Pokjanas TOI 27 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
5,7-Dihidroksi-2-(4-hidroksi-fenil)-8-(3,4,5- trihidroksi-6-hidroksimetil-tetrahidro-piran-2- -84,5962 ± 0,9997 Active il)-6-(3,4,5-trihidroksi-6-hidroksimetil- 0,1870 tetrahidro-piran-2-il) 5,7-Dihidroksi-2-(4-hidroksi-fenil)-8-(3,4,5- -84,7865 ± trihidroksi-6-hidroksimetil-tetrahidro-piran-2- 0,9984 Active 0,5025 il) 5,7-Dihidroksi-2-(4-hidroksi-fenil)-6-(3,4,5- -85,1969 ± trihidroksi-6-hidroksimetil-tetrahidro-piran-2- 0,9991 Active 0,2934 il) 5,7-Dihidroksi-2-(3-hidroksi-4-metoksi- -84,5379 ± fenil)-6-(3,4,5-trihidroksi-6-hidroksimetil- 0,998 Active 0,2995 tetrahidro-piran-2-il) Flemingia macrophylla 2-(3,7-3-Dihidroksi-2,2-dimetil-6-il)-5- -99,4763 ± hidroksi-8,8,dimetil-10(3-metil-but-2-enil)- 0,9966 Active 0,1407 2,3-dihidro-8H-piranol[3,2-g] 5,7-Dihidroksi-3-(4-hidroksi-fenil) -86,6118 ± 0,9991 Active 0,0303 5,7-Dihidroksi-3-[4-hidroksi-2-(3-metil-but- -88,4177 ± 0,9975 Active enil)-fenil] 0,5095 4-(4-Metoksi-7,7-dimetil-7H-furo[3,2-g] -2- -93,6756 ± 0,9941 Active il)-benzen-1,3-diol 0,6518 5-Hidroksi-2-(2-hidroksi-4-metil-fenil)-8,8- -111,2990 ± dimetil-10-(3-metil-but-2-enil)-2,3-dihidro- 0,9743 Active 0,6015 8H-pirano[3,2-g]-2-il) 5-Hidroksi-2-[2-hidroksi-5-(3-metil-but-2- -103,3447 ± enil)-fenil]-8,8-dimetil-10-(3-metil-but-2- 0,997 Active 0,4218 enil)-2,3-dihidro-8H-pirano[3,2-g] 5-Hidroksi-2-[2-hidroksi-5-(3-metil-but-2- -90,3197 ± enil)-fenil]-8,8-dimetil-10-(3-metil-but-2- 0,9998 Active 0,2126 enil)-2,3-dihidro-8H-pirano[3,2-g] 2-(2,4-Dihidroksi-fenil)-5,7-dihidroksi-6,8- -90,5774 ± 0,9998 Active bis-(3-metil-but-2-enil) 0,1828 2-(2,4-Dihidroksi-fenil)-5,7-dihidroksi-6,8- -87,6588 ± 0,997 Active bis-(3-metil-but-2-enil) 0,2543 Genista saharae 3-(3,4-Dihidroksi-fenil)-5,7-dihidroksi -84,7146 ± 1 Active 0,0203 Dihidroalpinumisoflavon -84,5062 ± 0,9996 Active 0,1480 Trifolium pratense L. 5,7-Dihidroksi-3-(4-hidroksi-fenil) -95,0540 ± 0,9978 Active 0,0032 5,7-Dihidroksi-3-(4-metoksi-fenil) -85,5595 ± 0,9971 Active 0,0503 Pachyrhizus erosus 2-(3,4,5-Trihidroksi-fenil) -3,5,7-triol -85,7861 ± 0,9999 Active 0,0055 Pissum sativum 2-(4-Hidroksi-fenil)- 3,5,7-triol -87,3650 ± 0,9997 Active 0,0174 2-(3,4-Dihidroksi-fenil)-,5,7-triol -84,7334 ± 0,9989 Active 0,0543
International Seminar Pokjanas TOI 28 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Figure A. 5-Hydroxy-2-[2-hydroxy-5-(3-methyl-but-2-enyl)-phenyl]-8,8- Figure B. Pentanoic acid. A. representative inaktive compound dimetyhl-10-(3-methyl-but-2-enyl)-phenyl)-2,3-dihydro-8H-pyrano[3,2-g] from Eriosema robustum plantss visualized 3D and showed the chromen-2-yl)-chromen-4-one. A. representative active compound from compound position in binding pocket ER-α. Fleminga macrophylla plantss visualized 3D and showed the compound position in binding pocket ER-α.
DISCUSSION
Based on the score Chem PLP from the docking simulation of 60 compounds in the plants of family Fabaceae with using reference ligand 4-[4-hidroksi-3-(prop-2-en-1-yl) fenil]-2-(prop-2-en-1- yl) (dimer compound number 11) obtained 24 active compounds (Table.1) on binding pocket ER-α by in silico. Figure A and B is a 3D visualized from active and inactive representative compounds using PyMOL application. The compounds were elucidated using PyMOL to explore some active amino acid residues.
CONCLUSION
1. The results of virtual screening conducted on 60 compounds from ten plant of family Fabaceae obtained 24 compounds be active and 38 inactive compounds in the binding pocket of ER-α. 2. The important amino acids to affinity compounds with the protein that is GLU353, ARG394, ASP351 and THR347.
REFERENCE
[1 Anita Y, Radifar M, Kardono LBS, Hanafi M, Enade P. Structure-Based Design Of Eugenol Analogs As Potential Estrogen Receptor Antagonists. 2012. p. 8(19). [2] Huang, Niu. Schoichet BKIJ. Benchmarking Sets for Molecular Docking. JMed Chem: 2006. p. 801. [3] Pranowo Dwi Harno HA. Pengantar Kimia Komputasi. Bandung: Lubuk Agung. 2011. 4-5:118. [4] Molares S, Ladio A. The Usefulness of Edible and Medicinal Fabaceae in Argentine and Chilean Patagonia : Environmental Availability and Other Sources of Supply. 2012.
International Seminar Pokjanas TOI 29 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Preparation of Standardized Aqueous Extract of Annona Muricata Linn. Leaf and Its Potency as Antioxidant
Yesi Desmiaty, Deni Rahmat, Nilam Sari Maulidina
Faculty of Pharmacy, University of Pancasila, Srengseng Sawah, Jagakarsa, South Jakarta, 12460
ABSTRACT
Extracts from various parts of Soursop leaves (Annona muricata Linn.) are widely used medicinally in all over the world for the management, control and/or treatment of cancer. Based on in vitro and animal studies, the presence of exogenous antioxidant has been shown to prevent free radicals activities associated with cancer development. Soursop leaves is one of medicinal herbals containing flavonoid compounds and has a potency as an antioxidant. Flavonoids are polyphenolic compounds and generally present as constituents of flowering plants, particularly dietary plants. The role of dietary flavonoids in cancer prevention has been widely discussed. The present study was carried out to investigate the intensity of free-radical scavenging activity, pharmacognosy characteristics and phytochemical screening of soursop leaves extract. The results of extract quality showed that water soluble extract of 45.30%, ethanol soluble extract of 39.99%, water content of 8.99%, loss on drying of 9.69%, total ash content of 5.53%, acid insoluble ash content of 1.14%, total plate count of 0.389 x 104 colony/g, yeast plate count of 0.9970 x 103 colony/g, and total flavonoid of 3.40%. From the study of antioxidant activity in vitro the extract has a powerful antioxidant with IC50 value of 76.91 ppm. Keywords: Soursop leaf, Annona muricata Linn., DPPH, radical scavenging activity, flavonoid.
INTRODUCTIONS
Various degenerative diseases such as diabetes, cancer, tissue inflammation, immune disorders, cardiac infarction and premature aging are caused by high levels of free radicals in the body. Free radicals that damage the body can be neutralized by antioxidants. Antioxidants are compounds that can inhibit reactive oxygen and free radicals in the body. These antioxidant compounds will share one or more electrons to free radicals to make a normal form of the molecule back and prevent the harmful reactions. One of the compounds containing a potential as antioxidants is flavonoid (1). Based on research Ni Putu, et al, n-butanol extract of soursop leaves has a value of DPPH free radical reduction of 91.10% (2). While Kunthi, et al, demonstrated the results of the phytochemical screening indicated that the leaves contain alkaloids, flavonoids, saponins, essential oils, quinones, coumarins, steroids/triterpenoids and tannins. The antioxidant activity of 70% ethanolic extract of the leaves displays the IC50 value of 22.25 ppm (3). According to the study, the leaves have an antioxidant activity and the potential as a standardized herbal medicine. Accordingly, the leaves can be developed as a preparation containing standardized herbal medicine which has been proven its safety and efficacy scientifically with preclinical trials and standardization of raw material (4). Therefore, in this research, the determination of extract quality (specific and non-specific parameters) was carried out to guarantee their consistency. To prove its efficacy in vitro, the antioxidant activity of the extract was performed using the method of scavenging of DPPH (1,1-diphenyl-2-picrylhydrazyl) free radical.
International Seminar Pokjanas TOI 30 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
MATERIALS AND INSTRUMENTS
Materials Dry simplicia of soursop leaves (Annona muricata L.), DPPH (1,1-difenil-2-pikrilhidrazil), and standard reference of quercetin..
INSTRUMENTS
Spectrophotometer (Shimadzu UV-Visible Spectrophotometer), furnace (Nabertherm-Germany), oven (Memmert), and air Karl-Fischer (Metrohm 870 KF Titrino plus).
METHODS
1. Collecting of dry soursop leaves Soursop leaves used in this study was obtained from Balitro, Cimanggu, Bogor and the determination was conducted in the Laboratory of Biological Research Center, Institute of Sciences Research Indonesia, Cibinong. 2. Preparation of soursop leaves infusion A total of 80 g of soursop leaves simplicia was poured into an infusion pot and added 1.6 L of water. Afterwards, the pot was heated in water bath for 15 minutes at the temperature of 90 °C, while stirring occasionally. The infusion was filtered through a flannel. The whole process was repeated for 7 times. 3. Phytochemical screening Phytochemical screening of the extract included alkaloids, falvonoid, saponins, tannins, essential oils, quinones, coumarin, and steroid/triterpenoid. 4. Determination of extract parameter The study included the determination of specific parameters (organoleptic, water soluble compounds, ethanol soluble compounds) and non-specific parameters (loss on drying, moisture content, total ash content, acid-insoluble ash content and microbial contamination). 5. Determination of total flavonoid 1) The test solution unless otherwise stated the amount of the concentrated extract equivalent to 200 mg of simplicia was carefully weighed and poured into a round-bottom flask. 1 ml HMT solution, 20 ml acetone and 2 ml of hydrochloric acid were added successively and refluxed for 30 minutes. The resulting extract was filtered through the cotton. The filtrate was collected into a 100 ml flask. The residue was refluxed with 20 ml acetone for 30 minutes and filtered. The filtrate was also collected into the same flask. Acetone was added up to the mark. 20 ml of the mixture was put into a separating funnel, added 20 ml of water and extracted three times, each time using 15 ml of ethyl acetate. Ethyl acetate phase was put into 50 ml flask, added ethyl acetate up to the mark. 2) Dilution of test solution Pipette 10 ml of test solution into a 25 ml flask; add 5% v/v of glacial-acetic acid solution in methanol up to the mark. 3) Measurement of total flavonoid Pipette 10 ml of the test solution into a 25 ml flask; add 1 ml aluminum chloride solution in 5% v/v glacial-acetic acid solution in methanol up to the mark. In different flask, 10 ml of 0.001% quercetin solution was added 1 ml aluminum chloride solution. The measurements were performed after incubation time of 30 minutes using a spectrophotometer at the wavelength of 429.5 nm. The total flavonoid content is calculated as indicated in the monograph by the formula :
F (%) = X 1.25 X 100 ml/ W (g)
Where, F = Total flavonoid Cp = Concentration of standard solution (ppm) Au = Absorbance of test solution with aluminum chloride
International Seminar Pokjanas TOI 31 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Abu = Absorbance of test solution without aluminum chloride Ap = Absorbance of standard solution with aluminum chloride Abp = Absorbance of standard solution without aluminum chloride
DPPH-Radical Scavenging Activity The free radical scavenging activity of the fractions was measured in vitro by 2,20- diphenyl-1- picrylhydrazyl (DPPH) assay. The stock solution was prepared by dissolving 8 mg DPPH with 50 ml methanol and stored at 20°C in the dark. A 1 ml aliquot of this solution was mixed with the sample solution in methanol and added methanol to get various final concentrations (5 - 100 μg/ml) in 5 ml flask. The reaction mixture was shaken well and incubated in the dark for 15 min at room temperature. Vitamin C served as standard and was treated in the same manner with the final concentration in the range of 2 – 10 μg/mL. Both the sample and the standard solution were incubated at temperature of 37 oC for 30 minutes. Afterwards, the absorbance was measured at 517 nm. The control was prepared in the same manner excluding any sample. The scavenging activity was estimated based on the percentage of DPPH radical scavenged as the following equation: Inhibition (%) = (Blank absorbance – Sample absorbance)/ Blank absorbance x 100%
RESULTS
1. Phytochemical Screening Table 1. Phytochemical Screening Secondary metabolite Result Alkaloid + Flavonoid + Saponin + Polyphenol + Quinone + Steroid/triterpenoid +/- Volatile oil + Qoumarin +
2. Quality Parameter and Total Flavonoid
Table 2. Quality Parameter and Total Flavonoid Parameter Soursop leaves extract Requirement (Materi Medika Indonesia) Water soluble content 45.30% ≥ 18% Ethanol soluble content 39.99% ≥ 12.5% Water content 8.99% ≤ 10% Loss on drying 9.69% Total ash content 5.53% ≤ 6% Acid-insoluble ash content 1.14% ≤ 1.5% Total plate count 0.3888x104 colony/g ≤ 104 colony/g Yeast plate count 0.9970x103 colony/g ≤ 103 colony/g Total flavonoid 3.40%
3. Antioxidant Activity Study The antioxidant activity was expressed in the relationship between concentration (x) versus % inhibition (y) by soursop leaves extract.
International Seminar Pokjanas TOI 32 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Figure 1. Inhibition Percentage of DPPH Free Radical by The Extract
Table 3. IC50 and Antioxidant Intensity of Soursop Leaves Extract Sampel IC Intensity 50 Soursop leaves extract 76,91 Strong
CONCLUSION
Phytochemical screening displayed that soursop leaves extract (Annona muricata L.) possesses alkaloid, flavonoid, saponin, polyphenol, quinon, steroid, volatile oil and qoumarin. The results of the extract evaluation demonstrated that the extract was fulfill all the requirement as mentioned in Materia Medica Indonesia where water soluble content of 45.30%; ethanol soluble content of 39.99%; water content of 8.99%; loss on drying 9.69%; total ash content of 5.53%, acid- insoluble ash content of 1.14%; total plate count of 0.389 x 104 colony/g; yeast plate count of 0.997 x 103 colony/g; and total flavonoid of 3.40%. Soursop leaves extract has a potential as a strong antioxidant with 1C50 value of 76.91ppm.
ACKNOWLEDGEMENT
This research was supported by Hibah Bersaing Ristek Dikti 2015.
REFERENCES
1. S Adewole, J Ojewole , Protective effects of Annona muricata linn. (Annonaceae) leaf aqueous extract on serum lipid profiles and oxidative stress in hepatocytes of streptozotocin-treated diabetic rats, African Journal of Traditional, Complementary and Alternative Medicines. Vol 6, No 1 (2009) ISSN: 0189-6016. 2. Putu N, Wahjuni S, Dwijani W. Ekstrak daun sirsak (Annona muricata L.) sebagai antioksidan pada penurunan kadar asam urat tikus wistar. 2012 (2);1-2. 3. Marisi R, Desmiaty Y, Wida K. Uji pendahuluan aktivitas sitotoksik dan antioksidan ekstrak etanol daun sirsak (Annona muricata L.) dan batang brotowali (Tinospora crispa). 2012;1-2. 4. Badan Pengawas Obat dan Makanan RI. Ketentuan pokok pengelompokan dan penandaan obat bahan alam Indonesia. Taken from: http://www.pom.go.id/ pom/hukum_perundangan/pdf/penandaan_oai.pdf. Accessed on 11 Desember 2014.
International Seminar Pokjanas TOI 33 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
PHYTOCHEMICAL SCREENING AND TOXICITY TEST BSLT OF 70 % ETHANOL EXTRACT OF GAHARU LEAVES (Aquilaria beccariana Tiegh.)
Ahmad Musir1, Wiwi Winarti1, Siti Hasnah P. Siregar1 1 Faculty of Pharmacy, University of Pancasila, Jakarta 12640 Jagakarsa
E-mail: [email protected]
ABSTRACT Gaharu or agarwood (Aquilaria beccariana Tiegh.) is a forest plant in Indonesia that has been developed with the cultivation by the public and can be used as anti-tumor drugs, anti-cancer, diarrhea and others This research aimed to determine the toxicity of 70% ethanol extract of gaharu leaves using Brine Shrimp Lethality Test (BSLT). The study was conducted on the phytochemical screening and toxicity testing of ethanol extract of gaharu leaves is not inoculated and inoculated. Results of phytochemical screening of the powder and condensed extract of gaharu leaves to non-inoculated and inoculated showed the presence of compounds flavonoids, saponins, catechuic and gallic tannins , quinons, coumarins, steroids/ triterpenoids, but on the inoculated also showed the presence of volatile oil compounds. The toxicity test of 70% ethanol extract of non inoculated gaharu leaves that does have a LC50 value of 113.73 ppm and 60.60 ppm LC50 inoculated. Key words: Agarwood, Aquilaria beccariana Tiegh, BSLT
INTRODUCTION
Plants gaharu (Aquilaria beccariana Tiegh ) is a forest plant that has been developed with the cultivation by the public and can be used as a diarrhea medication, anti-tumor, anti-cancer, and others. Agarwood is also commonly used as fragrances, body by burning (fumigation) at religious events. Currently no less than 46 (forty six) types of plants that can produce agarwood, plants most frequently used is (Aquilaria beccariana Tiegh ) from thymeleaceae family, where one of the benefits as anticancer. Broadly speaking, the process of formation of aloes consists of 2 kinds: natural or artificial and not at inoculation or inoculation. The process of formation of gaharu inoculation include: hurt / trunk section, include the injection of a microorganism of the genus Fusarium sp that play a role in the formation of agarwood. Thus aloes contain secondary metabolites are thought to have anticancer activity. Based on this crude drug powder in this study were extracted by the method of kinetic maceration with 70% ethanol, and the extracts obtained, further toxicity tests with the method BSLT (Brine Shrimp Lethality Test).
MATERIALS AND METHODS MATERIALS Gaharu leavest powder (Aquilaria beccariana Tiegh ) that is not in the inoculation and inoculation used were obtained from the Center for Conservation and Rehabilitation Research Development and the Ministry of Forestry in the Ministry of Forestry determined Forestry Research and Development Agency Bogor, after the wood is dried and pulverized. Chemicals: ethanol 96%, Dragendorf LP, LP Mayer, p HCl, amylalcohol, ether, anhydrous acetic acid, FeCl3 1% , H2SO4 cons., chloroform, ammonia 10% LP, water, salt NaCl, shrimp larvae (Artemisia salina Leach). Instruments: vacuum rotary evaporator (Buchi 205), analytical balance (Sartorius) ,macerator kinetic (Heidolph), glass tools. 18 watt fluorescent lamp, a magnifying glass, bottles vials and micro pipette.
International Seminar Pokjanas TOI 34 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
METHODS Preparation of extracts. A total of approximately 250 grams of gaharu leaves is pulverized dried macerated using 70 % ethanol (by means of kinetic maserator) and filtered, then filtered. Remaceration until all secondary metabolites extracted perfectly. The filtrate obtained was collected, further concentrated by vacuum rotary evaporator, then evaporated on a water bath at a temperature of 40 ° C to obtain a viscous extract. Phytochemical screening : Performed by identifying classes of secondary metabolites, compounds contained in the leaves powder and extracts
Biological activity test using larval shrimp Artemia salina Leach a. Hatching eggs Artemia salina Leach. Prepare by dissolving synthetic sea water (38 g Sodium Chloride (NaCl) in 1000 mL of water) and filtered with Whatman paper. Brooders sealed vessel that has two sides of the room, which is open and closed sides. Then enter the egg Artemia salina Leach. into the incubator vessel which already contains the synthetic sea water and irradiated with 18 watt fluorescent lamp. After 24 hours the eggs that have hatched into nauplii were transferred to another place, 24 hours after the nauplii is ready to be used as test animals. b. Preparation of test solutions Extract solution of each sample were made in 9 vials for three concentration is 10 ppm, 100 ppm, 1000 ppm and one vial for control. The mother liquor is made by weighing 20 mg of extract, dissolved in 2 ml of sea water that has been filtered if it is poorly soluble samples added dimethylsulfoxide (DMSO) 1% as much as 0.1 to 50.0 mL to increase the solubility. c. Toxicity tests Pipetted mother liquor of 500, 50 and 5 mL in a row is inserted into the vial and then evaporated to dryness. Each concentration was made with three repetitions, then into each vial inserted + 3 ml of sea water, if samples of poorly soluble in sea water, then add dimethyl sulfoxide (DMSO) 1% as much as 0.1 to 50.0 mL. The solution was stirred until homogeneous and enter 10 nauplii tail, sea water is then added to 5 mL. For each concentration performed three repetitions. Determination of LC50 in mg/ mL performed using probit analysis.
RESULTS AND DISCUSSION Gaharu wood extraction . Extraction by maceration kinetic gaharu leaves pulvered was not inoculated and inoculated each with 70 % ethanol, producing a viscous ethanol extract of gaharu leaves 54,40 grams not inoculated with a yield of 21.76 % and condensed ethanol extract of gaharu leaves were inoculated 59.00 grams with a yield of 23.58 %.
The content of chemical powder and extract of gaharu leaves The study of the content of the extract of gaharu leaves (Aquilaria beccariana Tiegh ) both powder and ethanol extracts of gaharu leaves that was not inoculated and inoculated showed a class of compounds flavonoids, saponins,catechuic and gallic tannins, steroids / terpenoids, quinons and coumarins, but on the inoculated also showed the presence of volatile oil compounds. Content of the test results can be seen in Table 1.
International Seminar Pokjanas TOI 35 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Table 1. Result of phytochemical screening the leaves powder and extract Result
Extract of Extract of Class of Powder of Powder of No. Gaharu leaves Gaharu Compounds Gaharu leaves Gaharu leaves non non inoculation in inoculation leaves in inoculation inoculation
1 Alkaloids - - - - 2 Flavonoids + + + + 3 Saponins + + + + Catechuic Tannins + + + + 4 Gallic tannins + + + +
5 Quinons + + + + Steroids/ 6 +/+ +/+ +/+ +/+ triterpenoids 7 Coumarins + + + + 8 Essential oils - - + + Description : + = positive results - = negative results
BSLT biological activity test (Brine Shrimp LethalityTest) Biological activity test with metod (BSLT), 70 % ethanol extract of gaharu leaves turns inoculation showed the toxic with LC50 values of 60.60 ppm, while the ethanol extract of gaharu leaves not inoculated at 113.73 ppm LC50, Based on this it can be said that the ethanol extract of 70 % ethanol of inoculated gaharu leaves are toxic and ethanol extracts were not inoculated gaharu leaves is less toxic. The data can be seen in Table 2 and Table 3.
Table 2. Ethanol extract toxicity test results were inoculated gaharu
Concentration Log C Dead Life MR NL MR/T % of LC50 (ppm) (X) Mortality (ppm) (Y) 1000 3 27 3 53 3 53/56 94.64 60.60 100 2 20 10 25 15 25/40 64.50
10 1 7 23 7 37 7/44 15.91
International Seminar Pokjanas TOI 36 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Graph LC50 Of 70 % Ethanol Extract Agarwood Inoculation 120
100
80
60
40 % of % mortality
20
0 1 2 3 4 Log D
Figure 1 Graphs the relationship between the concentration (ug/ ml) and mortality (%) of 70% ethanol extract of the inoculated agarwood
Table 3. Ethanol extract toxicity test results were not inoculated agarwood
Concentration Log C Dead Life MR NL MR/T % of LC50 (ppm) (X) Mortality (ppm) (Y) 1000 3 23 8 43 8 43/51 84.31 113.73 100 2 13 17 20 25 20/46 45.87
10 1 7 23 7 47 7/54 12.96
International Seminar Pokjanas TOI 37 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Graph LC50 Of 70% Ehanol Extract Agarwood non Inoculation 100 90 80 70 60 50 40
% of of % mortality 30 20 10 0 1 2 3 4 Log D
Figure 2. Graphs the relationship between the concentration (ug/ ml) and mortality (%) of 70 % ethanol extract of agarwood were not inoculated
An extract contains compounds that are included in the category of very active or are highly toxic if LC50 values ≤ 30 ppm, a plant extract said to be toxic if its LC50 value is 30 - 1000 ppm. results test showed that the extract Agarwood leaves so have the cytotoxic activity as antitumor or anticancer potential.
CONCLUSION
The survey results revealed that 70 % ethanol extract of Agarwood leaves not inoculated and inoculated class of compounds containing flavonoids, saponins, catechuic and gallic tannins , steroids / triterpenoids, quinons and coumarins, but in addition it also inoculated existence of this class of compounds containing volatile oil. In BSLT biological activity test showed that ethanol extract of agarwood leaves inoculated with LC50 values of 60.60 ppm had higher active of ethanol extract of agarwood leaves is not inoculated with LC50 values of (113.73 ppm).
International Seminar Pokjanas TOI 38 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
REFERENCES 1. Kartasubrata J. 2010. Successful cultivation of medicinal plants. Bogor: IPB Press. Department of Forestry in 2004, Utilization profile (cultivation) Agarwood. Jakarta. Forestry Extension Development Center. Jakarta; p. 41-45 2. Farnsworth NR, 1966. Biological and phytocemycal of plant. J. Pharm, Sci; . p. 224 - 264. 3. Novriyanti Eka 2008. Role of Extractive Substances In Formation Agarwood on Aquilaria crassna Pierre ex Lecomte and Aquilaria microcarpa Baill. Bogor Agricultural University. 4. Meyer BN, et al. 1982 . Brine shrimp a convenient general bioassay for active plant constituent, Planta Medika 45; things. page 31-34
International Seminar Pokjanas TOI 39 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
OPTIMIZATION OF PRODUCTION OF Β-CAROTENE AND ASTAXANTHIN FROM MICROALGAE Chlorella pyrenoidosa AND ITS POTENTIAL AS AN ANTIOXIDANT
Ni Wayan Sri Agustini Research Centre for Biotechnology-LIPI
e-mail : [email protected]
ABSTRACT
Astaxanthin and -carotene is a carotenoid pigment that is known to be useful as an antioxidant. One microorganism producing Astaxanthin and -carotene is Chlorella pyrenoidosa. Increased content of pigments in microalgae cells are affected by the availability of nutrients in the growth medium, based on that research is conducted with the optimization of production is -carotene and astaxanthin in Chlorella pyrenoidosa were cultivated in various kinds of foliar fertilizer and its potential as an antioxidant. Type of foliar fertilizer used are Gandasil D, Growmore and Hyponex and Technical medium (Urea, TSP and ZA) as a control. Analysis of astaxanthin and -carotene using extraction method based Hua Bin Li (2002), while the antioxidant activity using of reduction of free radicals (DPPH) and vitamin C as a positive control. The results obtained showed that Hyponex is the best fertilizer that can optimize the production of -carotene and astaxanthin in C. pyrenoidosa is 679.780 ppm ( -carotene) and 217.444 ppm (astaxanthin), while its antioxidant activity, namely the LC50 values 111.417 ppm. Based upon these results the carotenoid from C. pyrenoidosa containing astaxanthin and -carotene can be as an alternative source of antioxidant natural. Keywords: Chlorella pyroneidosa, -carotene, astaxanthin, an antioxidant
INTRODUCTION
Some species of microalgae are a source of carotenoids include Chlorella pyrenoidosa, Spirulina platensis, Dunaliella salina, and Nannocloropsis sp. Carotenoids are a group of yellow or orange pigment. Carotenoids can have a positive influence to health because it has potent antioxidant activity, also potentially reduces the chances of the formation of cancer cells(1). Carotenoid are divided into two derivative, namely carotene and xantofil. Carotene is a carotenoid derivative of the compound that does not contain elements oxygen such as ɑ-carotene, -carotene, -carotene and ε-carotene. While xantofil is a derivative of a compound containing the oxygen such as lutein, rubixantin, astaxantin, zeaxantin and violaxatin(2). -carotene is widely used in the food industry, pharmaceuticals, and cosmetics. so many of research to finding sources of -carotene derived from a variety of biological resources(3). While astaxanthin is derived xantofil, which is one of the most important properties is an antioxidant with a stronger effect because it has 10 methyl groups and two hydroxy groups which allows the esterification. A drink containing astaxanthin has been shown to prevent arteriosclerosis, ischemic heart disease or ischemic encephalopathy(4). The beneficial effects of astaxanthin for heart health by reducing inflammation associated coronary heart disease(5). In addition astaxanthin has anti-cancer activity in several studies conducted by Tanaka et al (1995) reported the inhibition of bladder carcinogenesis in rats chemically by astaxanthin. Astaxanthin was also found to be effective in protecting mice against azometane induction in colon cancer(6). Based on the above and will need astaxanthin and -carotene continues to increase, it is necessary to optimize the cultivation of -carotene and astaxanthin produced by microalgae. Microalgae cultivation depends on a sufficient supply of nutrients to the growing medium and a light source to perform photosynthesis. The addition of nutrients to grow the right media can promote the growth of microalgae in inorganic synthetic medium(7). International Seminar Pokjanas TOI 40 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Cultivation of microalgae in laboratory scale, the type of fertilizer frequently used type of fertilizer such as Conwy and Knops. Economically, this type of fertilizer has a price that is quite expensive, so it is necessary to find a replacement fertilizer price is relatively cheaper, but it is expected the fertilizer is capable of producing -carotene and astaxanthin maximum. Fertilizers such as Gandasil D, Hyponex and Growmore fertilizer which is technical and has some elements of nutrients such as nitrogen, phosphorus, sulfur is needed in culture and are cheaper and easily available in the market. Based on the above, then do research on the effect of several types of synthetic fertilizers on the production of -carotene and astaxanthin in microalgae Chlorella pyrenoidosa, and its potential as an antioxidant
METHODOLOGY a. Cultivation of Microalgae Stock cultures of microalgae Chlorella pyrenoidosa cultivation in a 2-liter bottle size. The composition of media of stock culture consists of urea (1 g / L), TSP (0.3 g / L) and ZA (0.8 g / L) (technical media ). After reaching the logarithmic phase of stock cultures are harvested by means of centrifuge. Biomass of C. pyrenoidosa cultivated again in 4 bottles that have added 4 different kinds of fertilizers are Gandasil D, Hyponex, Growmore and Medium Control (Urea 1 g/L, TSP 0,3 g/, and ZA 0,8 g/L). The concentration of fertilizer used is 1 g / L. Cultivasi performed in a 2-liter bottle size.C. pyrenoidosa cultivated again to 4 bottles in a 2 -litre bottle size. . Cultivation is carried out with the addition of continuous aeration using a blower, the light intensity of 2500 lux and a neutral pH 7. Sampling was done when the culture reaches logarithmic and stationary phases b. Analysis β-carotene and astaxanthin(8) Extraction use of Hua Bin Li (2002). 0.5 gram of wet biomass is suspended with 4 ml of 10 M KOH then heated above the bath at 60°C for 10 minutes, then cooled at room temperature. Once cool, plus 2.6 ml dichloromethane were homogenized with a homogenizer for 5 min and centrifuged at a speed of 3500 rpm for 10 minutes. The resulting filtrate is collected and re-extracted sludge treatment as above to obtain a pale yellow filtrate. once collected, centrifuged and the filtrate evaporated at 40 ° C. Rest of evaporation added 10 ml of ethanol and 10 ml of n-hexane Furthermore, inserted into the separating funnel, shaken and allowed to separate and form a second layer of the phase of ethanol and n-hexane phase, the measured absorption at a wavelength of 455 nm (beta carotene) and 479 nm (astaxanthin) using a UV-Vis spectrophotometer. Uptake value obtained plotted on a standard that was created regression equation c. Antioxidant Activity of Free Radicals Reduction Method Using 1,1-Diphenyl-2- Picrylhydrazyl (DPPH). Free radical scavenging activity of extracts carotenois from C. pyrenoidosa were measured by 1, 1- diphenyl-2-picryl hydrazyl (DPPH). In brief, 0,4 mM solution of DPPH in methanol was prepared. Pipette stok solution as much as 25, 50, 125, 250 and 500 mL. DPPH solution was added 1.0 mL into each tube and added with methanol pro analysis up to add 5 mL, to obtain the concentration of the sample 5, 10, 25, 50 and 100 mg / mL. The mixture was shaken vigorously and allowed to stand at room temp for 30 min. then, absorbance was measured at 517 nm. by using spectrophotometer (UV-VIS Shimadzu). Reference standard compound being used was ascorbic acid and experiment was done in triplicate. The IC50 value of the sample was calculated using following equation: DPPH scavenging effect (%) or Percent inhibition = A0 - A1/ A0× 100. Where A0 was the Absorbance of control reaction and A1 was the Absorbance in presence of test or standard sample (Taylor
International Seminar Pokjanas TOI 41 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
RESULT AND DISCUSSION
a. GROWTH of Chlorella pyrenoidosa
(A) (B) Figure 1. Optical dencity (A) and Biomass (B) of Chlorella pyrenoidosa cultivated in Various of Media Cultivation(Gandasil D, Hyponex, Growmore and Control).
Media for the growth of microalgae Chlorella pyrenoidosa using technical media with the addition of various types of fertilizers with of fertilizers concentration of each 1 g / L. Fertilizers used in this cultivation is Gandasil, Hyponex and Growmore while the technical media as a control. The third composition of this fertilizer has the same nutrients are nitrogen, phosphorus and potassium, with different concentrations. The function of the nitrogen is known as a major component of cell protein which is a basic part of life of all organisms. Phosphorus is needed for the formation of protoplasm and the cell nucleus. Phosphorus is the base material forming nucleic acids, phospholipids, enzymes and vitamins. The function of potassium is one of the main organic in the cell and a cofactor for several coenzyme (Fogg, 1975; Becker, EW., 1994). Cultivation of Chlorella pyrenoidosa growth observed from day 1 to day 13. The growth curve was made using turbidimetry method based on the value of the absorption optical density or OD in a spectrophotometer with a wavelength of 680 nm. Based on the above curve on day three to nine Chlorella pyrenoidosa cells show logarithmic phase, while the day 10 to 11 shows the stationary phase. Chlorella pyrenoidosa growth is best generated by fertilizer Hyponex. This dimugkinkan because the composition ratio between nitrogen, phosphorus and potassium from fertilizer Hyponex better than other fertilizers. On the composition of Hyponex there is the content of N: P: K as many (20%: 20%: 20%), Growmore (32%: 10%: 10), Gandasil D (4.2%: 1%: 16%). Growmore has a higher nitrogen content and the Gandasil D have a lower nitrogen content compared to Hyponex, but the growth of C. pyrenoidosa lower than Hyponex, this suggests that a deficiency or excess nitrogen content in the media can be a limiting factor for metabolism and biosynthetesis processes microalgae cells (Healey, 1973). In Figure 1, seen biomass obtained in the stationary phase is higher than when logarithmic, this suggests that the higher the growth of microalgae (OD) the higher the biomass obtained. b. β-CAROTENE -Carotene is a strongly colored red-orange pigment abundant in plants, fruits, microorganism like is microalgae. It is an organic compound and chemically is classified as a hydrocarbon and specifically as a terpenoid (isoprenoid), reflecting its derivation from isoprene units.
International Seminar Pokjanas TOI 42 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Figure 2. β-carotene of Chlorella pyrenoidosa cultivated in Various of Media Cultivation (Gandasil D, Hyponex, Growmore and Control).
Β-carotene in microalgae cells to function to absorb light energy for use in photosynthesis and also serve to protect chlorophyll from damage caused by light(9).In this study the content of -carotene logarithmic phase current is smaller than the stationary phase. The highest beta carotene obtained in C. pyrenoidosa were cultivated on Hyponex that is equal to 697.716 ppm, followed Growmore in the amount of 389.945 ppm and the lowest in the media Gandasil D is 194.065 ppm (Figure 2). It is also consistent with the results obtained in this study that the maximum achievable beta carotene when the cells undergo stationary phase. According Fogg, 1975 when the stationary phase cell density reaches a maximum so that frequent self-shading among cells, chlorophyll will suffer destruction was replaced by secondary carotenoid pigments as photosynthetic pigments. And it is known that the Beta carotene is a carotenoid part of the maximum will accumulate in the cell when the stationary phase(10).
b. ASTAXANTHIN Astaxanthin, unlike some carotenoids and the other carotenoids are known, are not converted to vitamin A (retinol) in the human body. As with beta-carotene, astaxanthin in microalgae cells to function as a secondary photosynthetic pigments so that the accumulation of the pigment astaxanthin in the cells associated with the growth and cell density. In this study, the maximum content of astaxanthin obtained during the stationary phase is 47.722 ppm on Gandasil D, 217.444 ppm in Hyponex, 119.018 ppm on Growmore and 80.870 ppm on Control. Visually visible as yellowish stationary phase cells and showed that chlorophyll suffered destruction and was replaced by carotenoids to perform photosynthesis
Figure 3. Astaxanthin of Chlorella pyrenoidosa cultivated in Various of Media Cultivation (Gandasil D, Hyponex, Growmore and Control).
C. ANTIOXIDANT ACTIVITY DPPH method measures the ability of an antioxidant compound in capturing free radicals. Radical scavenging ability relates to the ability of the compound components in donating electrons or hydrogen. Each molecule that can donate electrons or hydrogen will react and will dilute DPPH. DPPH color intensity will change from purple to yellow by electrons derived from antioxidant compounds. DPPH concentration at the end of the reaction depends on the initial concentration and structural components catcher compound radical(11). In this study was obtained, with a concentration of 150 ppm carotenoid extract containing beta carotene and astaxanthin have a value of inhibition of 55.66%, whereas vitamin C (positive control) has a value of 49.83% inhibition at a concentration of 8 ppm IC50 is a number that indicates the extract concentration (ppm), which is able to inhibit the oxidation process by 50%. The smaller the IC50 value means the higher the antioxidant activity. Specifically a International Seminar Pokjanas TOI 43 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
compound said to be a very powerful antioxidant if the IC50 value of less than 50 ppm, strong for the IC50 value-50-100 ppm, while if it is worth 100-150 ppm, and weak if the IC50 value worth 151-200 ppm (Anonymous, 2005). Based on the results obtained carotenoid extract of C. pyrenoidosa including weak category because it had LC50 values of 111.42 ppm . Nevertheless these carotenoid can be used as an alternative as natural antioxidant.
CONCLUSION
C. pyrenoidosa can grow well in growth media used Hyponex and resulted in -carotene and Astaxanthin respectively 697.716 ppm and 217.444 ppm on the stationary phase. The antioxidant activity of the carotenoid extract of C. pyrenoidosa at 111.417 ppm so that it can be used as asource of natural antioxidant
REFERENCES
1. Leach G, G Oliveira, and R Morais. Production of a caretonoid-rich product by Alginate en modern trapment and fluid-bed drying of Dunaliella salina. J Sci Food Agric. 1998. 76:298-302. 2. Becker EW. Biotechnology and Microbiology, 1st edition. New York: Cambridge University Press; 1994. p. 9-12,51-58,253. 3. Vega PJ, MO Balaban, CA Sims, SF O’Keefe, and JA Cornell. 1996. Supercritical carbon dioxide extraction efficiency for carotene 4. Miki, W., K Hosoda, K Kondo, and Itakura, H. Astaxanthin containing drink. 1998. Patent abstract JP10155459 5. Tracy, R. P. Inflamantion Markers And Coronary Heart Disease. Current Opinion In Lipidologi . 1999. 10, 435-441 6. Tanaka, T., T Kawamori., M Ohnishi., H Makita., H Mori,. K Satoh, and A Ha. Suppression of azomethan-induced rat colon carcinogenesis by dietary administration of naturally occurring xanthophylls astaxanthin and canthaxanthin during the postinitiation phase. Carcinogenesis 1995. 16,2957-2963 7. Teresa M, Mata., Antonio A, Martins., Nidia, S, Caetano. Microalga for Biodiesel Production And Other Applications. 2010. Portugal. 8. Li Hua-Bin, Jiang You and Cheng Feng. Isolation and purification of lutei from the microlaga Chlorella vulgaris by extraction after saponifonification. Journal of agricultural and food chemistry. 2002, p. 1070-1072. 9. Armstrong GA, Hearst JE. Carotenoids 2: Genetics and molecular biology of carotenoid pigment biosynthesis. FASEB J. 1996. 10 (2): 228–37. PMID 8641556 10 Fogg GE. Algal Culture and Phytoplankton Ecologi. London: The University of Wisconsin Press from carrot by RSM. J. Food Sci. 1975. 61(4):757 11 Naik, G.H., Priyadarsini, K.I., Satav, J.G., Banavalikar, M.M., Sohoni, D.P., Biyani, M.K., and Mohan H. Comparative antioxidant activity of individual herbal components used in ayurvedic medicine, Phytochemistry. 2003. 63(1): 97-104
International Seminar Pokjanas TOI 44 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
ANTIOXIDANT COMPOUND ISOLATED FROM BIOPRODUCTION OF ENDOPHYTIC FUNGI OF TURMERIC (Curcuma longa L.)
Hindra Rahmawati1, Partomuan Simanjuntak1,2 1Faculty of Pharmacy, Pancasila University, Jl. Srengseng Sawah, Jagakarsa, Jakarta 12640, Indonesia 2Research Centre for Biotechnology - Indonesian Institute of Sciences (LIPI), Jl. Raya Bogor Km 46 Cibinong 16911, Indonesia
Email: [email protected]
ABSTRACT Endophytic fungi are microorganisms that live in the plants and do mutualism symbiosis with the hosts in order to produce chemical compounds which are similar to what the hosts do. Five endophytic fungi isolates were successfully obtained from various parts of turmeric (Curcuma longa L.) from Cibinong. Bioproduction of those five isolates were tested for their antioxidant activity by free radical scavenging method using 1,1-diphenyl-2-picrylhydrazyl (DPPH). One of the isolates, K.CI.Cb.U.1, produced compound(s) with highest antioxidant activity. Bioproduction of K.CI.Cb.U.1 in large amount was obtained by fermentation method using Potato Sucrose Broth (PSB) medium. Fermentation result showed that the ethyl acetate extract of the biomass had higher antioxidant activity than that of the filtrate. The biomass extract was fractionated by gradient column chromatography (silica gel 60; n-hexane-ethyl acetate 10:1 to 2:1). Three combined fractions were obtained and their IC50 values were determined by DPPH. Fraction no. 2 had the highest IC50 value (67.18 ppm), and was selected for further purification using preparative TLC method to produce isolate X. Based on FTIR and GC-MS spectra of isolate X, it could be estimated that the bioproduction compound of K.CI.Cb.U.1 endophytic fungi isolate was a glycoside with one saccharide molecule and mass weight of 578, and its aglycone was supposed to be 3,7-Dimethyl-7-(4-methyl-3-pentenyl)-8-(2,6,10-trimethyl-1,5,9-undecartrienyl)bicyclo[4.2.0]oct-2- ene. Keywords: antioxidant, bioproduction, endophytic fungi, turmeric (Curcuma longa L.)
INTRODUCTION
The level of pollution in the world becomes higher from day to day. Indonesia has become one of the countries that have pretty high levels of pollution. Pollution is a source of free radicals that can cause dangerous diseases, therefore we need antioxidants that can counteract and prevent the effect of pollution. Antioxidants are substances which can prevent oxidation process by scavenging free radicals that attack our body cells. Biodiversity of medicinal plants in Indonesia reveals high potency to discover new antioxidant compound. One of the plants that can be a source of antioxidants is turmeric (Curcuma longa L.). Endophytic fungi are microorganisms that live in the plants and do mutualism symbiosis with the hosts in order to produce chemical compounds which are similar to what the hosts do. The plants provide the nutrition for the endophytes and this microorganism convert the nutrition into secondary metabolite compounds (1,2). In this study, endophytic fungi of turmeric was fermented to produce antioxidant compound(s). The bioproduction obtained was then isolated and identified.
International Seminar Pokjanas TOI 45 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
METHODS
Material Five endophytic fungi isolates, with codes K.Cl.Cb.Bu.1, K.Cl.Cb.Bu.2, K.Cl.Cb.U.1, K.Cl.Cb.U.2 and K.Cl.Cb.B.1, were successfully obtained from various parts of turmeric from Cibinong. These isolates were collection of Natural Product Laboratory, Research Centre for Biotechnology - Indonesian Institute of Sciences (LIPI), Cibinong. The filtrates and biomasses extracts of their bioproductions were examined their antioxidant activities and revealed that the biomass extract of the isolate K.Cl.Cb.U.1 had the highest antioxidant activity with Inhibition Concentration value of 86.41%. This isolate was selected to be examined further to isolate its bioproduction antioxidant compound.
Bioproduction The endophytic fungi isolate K.Cl.Cb.U.1 was inoculated in Potato Dextrose Agar (PDA) medium in Petri dish and incubated for seven days at room temperature. The morphology of the fungi was performed at Figure 1. The culture was then transferred into Potato Sucrose Broth (PSB) medium and fermented for 14 days while being shaken using the rotary shaker at room temperature.
(a) (b) Figure 1. Endophytic fungi of K.Cl.Cb.U.1; top side (a); bottom side (b)
Extraction Procedure The fermentation yield was filtered to seperate the biomass from the filtrate. The biomass, which had higher antioxidant activity than the filtrate, was dried and extracted using ethyl acetate as solvent and evaporated under reduced pressure using rotary evaporator.
Antioxidant Activity Test The extracts of the filtrates and the biomasses of the five fungi isolates, the biomass extract of isolate K.Cl.Cb.U.1 and its fractions were tested for their antioxidant activity by free radical scavenging method using 1,1-diphenyl-2-picrylhydrazyl (DPPH)(3). Series of concentration of the extracts and fractions were made and each solution was added with one mL of 1,1-diphenyl-2-picrylhydrazyl (DPPH) solution (0.4 mM in methanol) and diluted until 5 mL with methanol. After being homogenized, the solutions were o incubated for 30 minutes at 37 C. The absorptions were measured spectrometrically at 517 nm. The IC50 value of each extract or fraction was calculated using its linear regression curve (4). The ascorbic acid was used as standard. Fractionation and Purification Fractionation and purification procedure was carried out using column chromatography, followed by preparative TLC to get pure substance(s). The column chromatography procedure was performed using silica gel 60 with gradient solvent system of n-hexane-ethyl acetate 10:1 to 2:1. TLC monitoring was carried out during the fractionation using silica gel GF254 plate developed in n-hexane-ethyl acetate 2:1. The spots were examined visually after being sprayed with cerium sulphate solution (1% in 10% sulphuric acid) and heated electrically until the spots were appeared.
International Seminar Pokjanas TOI 46 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Purification was performed by preparative TLC using silica gel GF254 plate and n-hexane-ethyl acetate 2:1 as mobile phase. The band was extracted with ethyl acetate solvent, and after filtering the extract was evaporated until the pure substance was obtained.
RESULT Three combined fractions obtained from column chromatography were tested their antioxidant activity and indicating that the fraction 2 was the most active fraction with IC50 value of 67.18 ppm compared to vitamine C as positive standard with IC50 value of 4.07 ppm. Further purification by preparative TLC revealed single band of substance. After being extracted, the compound of the isolate (isolate X) was identified using FTIR Spectrophotometer and Gas Chromatography-Mass Spectrometer.
Figure 2. FTIR Spectrum of the isolate X
Figure 3. GC-MS spectrum of the isolate X The peak with Retention Time (tR) 25.346 was the highest peak
Figure 4. The mass spectrum of the isolate X
DISCUSSION
International Seminar Pokjanas TOI 47 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
The FTIR spectrum performed by Figure 2, indicated that the isolate X had stretching vibrations of hydroxyl group at 3538.17 cm-1, aliphatic C-H bonding at 2950.89, 2920.03 and 2853.49 cm-1, and carbonyl group which appeared at 1733.89 cm-1 . GC-MS analysis revealed several peaks at the chromatogram, indicating that the isolate was not pure enough although the preparative TLC performed only a single band. The GC-MS spectrum at Figure 3 indicated that the peak with Retention Time (tR) 25.346 was the highest peak and had the biggest % area (24.00% ). This peak that had molecular weight (MW) 578 was supposed to be the most active compound, and its mass spectrum could be seen at Figure 4. According to Willey09th.L database used in GC-MS instrumentation this highest peak was indicated as 3,7-Dimethyl-7-(4-methyl-3-pentenyl)-8-(2,6,10-trimethyl-1,5,9-undecartrienyl) bicyclo[4.2.0]oct-2-ene . Because of its low similarity (42 % quality and MW = 408) it was predicted that the substance had one sugar moiety (MW about 170), indicating that it was a glycoside compound with one saccharide molecule. The chemical structure of the aglycone of the isolate could be seen at Figure 5.
Figure 5. The chemical structure of the aglycone of the isolate X
CONCLUSION
Based on FTIR and GS-MS spectra, the compound of isolate X produced by bioproduction of endophytic fungi isolate K.Cl.Cb.U.1 that had antioxidant activity was predicted as a glycoside with one saccharide molecule and mass weight of 578, and its aglycone was supposed to be 3,7-Dimethyl-7-(4-methyl-3- pentenyl)-8-(2,6,10-trimethyl-1,5,9-undecartri- en yl)bicyclo[4.2.0]oct-2-ene.
ACKNOWLEDGEMENTS
The authors wish to thank Ms. Felicia Chikita Fredi for her assistance, and Research Centre for Biotechnology - Indonesian Institute of Sciences (LIPI) for financial support and laboratory facility.
REFERENCES
1. Strobel G. Endophytic fungi: New sources for old and new pharmaceuticals. Pharmaceutical News.1996. (3)6:7-9. 2. Simanjuntak P, Parwati T, Kurnia N, Rahmat J, Rosalinda N. Investigation of bioactive compounds from microbial resources in Indonesia: Bioactive metabolites from endophytic microbes of “Kina” Cinchina spp. J Pharm Sci; 1999. 3. Molyneux P. The use of the stable free radical diphenylpicrylhydrazyl (DPPH) for estimating antioxidant activity. Songklanakarin J Sci Technol. 2004. Mar-Apr; (26)2:212-219. 4. Rohman A, Sugeng R, Diah. Antioxidant activities, total phenolic and flavonoid contents of ethyl acetate extract of mengkudu (Morinda citrifolia L.) fruit and its fractions. Yogyakarta: Fakultas Farmasi Universitas Gadjah Mada, 2005.
International Seminar Pokjanas TOI 48 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
ANALYSIS OF BETA-CAROTENE IN GREEN MELON AND ORANGE MELON (Cucumis melo L. var. Sky Rock and var. Cantaloupe) BY TLC-DENSITOMETRY
Rifa Rizkiyah1, Zuhelmi Aziz2 Fakultas Farmasi UniversitasPancasila, Jakarta
ABSTRACT
Two kinds of melon are ubiquitously found in the market nowadays which are green flesh melon (var. Sky Rock) and orange flesh melon colour (var. Cantaloupe). Melon contains natural coloring pigment which one of them is beta-carotene. The presence of beta-carotene contributes to the redness and orangeness of a fruit or vegetable. An experiment was conducted to analyze the content of beta-carotene in green melon and orange melon through thin layer chromatography — densitometry method. Beta-carotene in melon was extracted using chloroform and the analyzed through TLC using silica gel GF254 as stationary phase and n-hexane-ethyl acetate (8:2) as mobile phase.The beta-carotene was determined by densitometre on maximum wavelength of 457 nm. The content of beta-carotene in green melon is 0.22 mg/ 100 g, with % recovery of 98.76% and RSD of 1.50%, and the content of beta-carotene in orange melon is 2.05 mg/100 g, with % recovery of 98.81% and RSD of 1.14%. The result shows beta-carotene content in green and orange melon significantly differ; orange flesh melon contained higher beta-carotene than green flesh melon.
INTRODUCTION
Melon (Cucumis melo L.) is a fruit that comes from Cucurbitaceae . Currently in the market is found melons with green (var. Sky Rock) and orange flesh (var. Cantaloupe) (1). Orange-flesh melon has a sweeter taste than the green-flesh melon. Fruits as a melon in addition it contains many nutrients also contain pigments such as beta-carotene that make it more colorful. The color of fruits which is contain beta-carotene usually orange-red or may have different colors caused by other pigments that blend together with beta-carotene so as to form a unique color. (2) Beta-carotene is the pigment carotene which is a precursor of vitamin A. It is consisting of two groups of retinol, and when it was in the dehydrogenation will decompose to retinol and retinoic acid or vitamin A. In accordance with literature, melon contained vitamin A total 2140.00 SI / 100 grams. (3) and vitamin A has antioxidant activity. The content of vitamin A in melon indicate the presence of beta-carotene in the melon. The difference flesh color in the two types of melon varieties strengthen the suspicion of beta-carotene in the melon. Research on determination of beta-carotene in fruits and vegetables has previously been carried out as in carrots, papaya, Cantaloupe, pumpkin, and spinach, using spectrophotometry and high performance liquid chromatography (HPLC). In the previous studies have been conducted assay of beta-carotene in the fruit and vegetables carried out as in carrots, papaya, Cantaloupe, pumpkin and spinach. The method used is a spectrophotometric method and high performance liquid chromatography (HPLC), and the determination of beta-carotene in honey kapok (Ceiba pentandra) and longan honey (Nephelium longata L.) has been also carried out by TLC-densitometry.(4) In this research, analysis of beta-carotene in fruits green and orange melon (Cucumis melo L. var. Sky Rock and var. Cantaloupe) with TLC-densitometry method with reference to the condition of the research I Purwata Adi M. Oka, K. Ratnayani, and Ana Listya by changing the composition of the mobile phase into n-hexane-ethyl acetate (8: 2). (4)
International Seminar Pokjanas TOI 49 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
METHODOLOGY
Green and orange melon (Cucumis melo L. var. Sky Rock and var. Cantaloupe) from supermarkets in Depok area were used as sample. Chloroform (pa), n-hexane (distilled) , ethyl acetate (distilled), reference standard of beta-carotene (Sigma Aldrich). Analysis was performed by Densitometer Camag-TLC scanner 3, Digistore Camag-Reprostar 3, chamber, separating funnel, rotary evaporator, analytical balance, silica gel GF254 TLC plate, vial, linomat, capillary tube, filter paper, water bath, set of glassware used in laboratory. Sample Processing and Extraction: green and orange flesh melon (Cucumis melo L. var. Sky Rock and var. Cantaloupe) cleaned and peeled as generally for consumption, and extracted with chloroform 20 ml disposed cloroformnya phase. The extraction process be repeated 4 times with each 20 mL of chloroform, disposed of all phases of chloroform in a 100-mL volumetric flask and diluted with chloroform until the line mark. Chloroform phase concentrated by rotary evaporator to obtain a concentrated extract. Preparation reference standard of beta-carotene solution at concentration 200 ppm, and sample solution of green melon extract 10mg/2.0 mL of chloroform and sample solution of orange melon extract 10mg/5.0 mL of chloroform Optimization of TLC-Densitometry performed with selection of the mobile phase based on the mobile phase used by previous studies (4), which is a mixture of chloroform - ethyl acetate (7: 3) with a various composition, besides that it also performed the mobile phase composition of n-hexane - ethyl acetate with a various composition. It also carried out optimization the distance of migration mobile phase were used 8, 10 and 15 cm using silica gel GF254 plate, and determining the maximum wavelength by densitometer at specific wavelengths (200-700 nm) Qualitative Analysis was performed usde TLC by comparing Rf spot in sample with Rf reference standard of beta-carotene. It were observed visually, and a 254 nm UV lamp. Linearity test was performed to determine whether there is an influence of the sample matrix on the relationship between the concentration with peak area using a series solution consisting a minimum 5 samples of different concentrations and then the data is processed by using linear regression. Spotted a certain number of samples with 5 different concentration levels side by side, then eluated using the best mobile phase, then spotting gained broad peak measured using a densitometer at maximum wavelength of beta-carotene. Quantitative Analysis of Beta-Carotene was performed by spotted reference standard of beta- carotene and samples solution each 20 µL on the plates side by side chromatographs, then eluated using the best mobile phase in a chamber . The plates were dried at room temperature and then measured peak area of beta-carotene with a densitometre at maximum wavelength 457 nm. Precision and accuracy test were performed by standard addition method, the determination of precision accuracy test performed 3 times.
RESULT AND DISCUSSION
Optimization Mobile Phase and Distance of Migration The selection starts with a mobile phase of chloroform-ethyl acetate in various compositions with the distance of migration mobile phase 8 cm, obtained Rf is too high. Then try to reduce the polarity of the mobile phase, replacing the mobile phase with a mixture of n-hexane -ethyl acetate in various compositions. Best separation was obtained from the mobile phase n-heksan- ethyl acetate (8: 2) with successive Rf value for reference standards of beta-carotene and analyte in orange melon extract: 0.77 and 0.75. Analysis of Beta-Carotene In Green And Orange Melon (Cucumis melo L. Var. Sky Rock And Var. Cantaloupe) By Thin Layer Chromatography International Seminar Pokjanas TOI 50 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
In the qualitative analysis, the chloroform melon extract tested TLC using the mobile phase n-hexane - ethyl acetate (8: 2) with a distance of migration of 10 cm, yielding one real orange patches on a sample of orange melon (var. Cantaloupe) with Rf 0.73 which is equal to the value of Rf reference standard of beta-carotene 0.73. Whereas in the samples of green melon (var. Sky Rock) produced three spots. First spots yellow with Rf 0.20, second spot dark green with Rf 0.39, and the third orange with Rf 0.725 approaching the value of Rf reference standard of beta-carotene. Results of identification by TLC can be seen in Fig 1. and Table 1. The results of the qualitative analysis showed the green and orange melon contain beta-carotene.
Table 1. Rf value of beta-carotene
Spot Rf Reference Standar Beta-carotene 0.73 Green melon (var. Sky Rock) 0.725 Orange melon (var. Cantaloupe) 0.73
Figure 1. TLC Chromatogram of green and orange melon
Determination of the Maximum Wavelength of Beta-Carotene Determination of the maximum wavelength is done by making spectrum reference standard of beta- carotene in the range 200-700 nm. The results of determination can be seen in Figure 2, the maximum absorption is obtained at a wavelength of 457 nm.
Figure 2. Spectrum reference standard of beta-carotene
International Seminar Pokjanas TOI 51 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Linearity test The linearity test showed a linear relationship between spot area with the concentration, linearity test results can be seen in Figures 3 and 4.
Figure 3. Linearity test curve of green melon (var. Sky Rock)
Figure 4. Linearity test curve of orange melon (var. Cantaloupe)
Data from linearity test is used to calculate the limit of quantitation (LOQ) of green melon and orange, respectively for 89.83 (mg / mL); 32.81 (mg / mL)
Determination of Beta-carotene on green dan orange melon (Cucumis melo L. Var. Sky Rock Dan Var. Cantaloupe) by TLC-Densitometry The result of determination of beta-carotene in green and orange melon can be seen in Table 2.
Table 2. Quantitative Analyze Result of Beta-carotene on Green and Orange Melons
Average content Material Content (mg/100g) (mg/100g) 0.22 Green Melon (var. Sky Rock) 0.22 0.22 0.23 2.04 Orange Melon (var. Cantaloupe) 2.11 2.05 2.00
The average content of beta-carotene in green melon is 0.22 mg/ 100 g and orange melon is 2.05 mg/ 100 g. Meanwhile according to literature, content of beta-carotene in the melon is 1.284 mg/100 g. Based on these results showed that there is a correlation between the colour of the fruit with higher levels of
International Seminar Pokjanas TOI 52 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
beta-carotene contained in it. The more orange-red color of the fruit, the higher the content of beta- carotene.
Accuracy Precision Test The result of recovery test obtained by comparing the difference in the total weight of beta-carotene contained in the sample after the addition of reference standard of beta-carotene solution with the weight of beta-carotene contained sample to the reference standard weight of beta-carotene which is actually added. Precision test results obtained by calculating the relative standard deviation (RSD) from third 3% recovery of the sample solution is added a solution of reference standard beta-carotene. The test results reacquisition and precision green melon (var. Sky Rock) and orange melon (var. Cantaloupe) can be seen in Table 3.
Table 3. The Results of Accuracy Precision Test in Green and Orange Melons Material Recovery (%) RSD (%) Melon hijau (var. Sky Rock) 98.76 1.50 Melon jingga (var. Cantaloupe) 98.81 1.14
The method used to meet the requirements of linearity with R2 = 0.9955 for green melon and 0.9854 for orange melon . The precision of the method is shown by the coefficient of variation of less than 2%, while accuracy indicated by the value recovery of 98.76% - 98.81% and limit of quantitation of green melon and orange, respectively for 89.83 (mg / mL); 32.81 (mg / mL). The method has been successfully to determine of beta-carotene in green melon is 0.22 mg/ 100 g and orange melon is 2.05 mg/ 100 g.
CONCLUSION
1. The content of beta-carotene in green melon is 0.22 mg/ 100 g, with % recovery of 98.76% and RSD of 1.50%, and the content of beta-carotene in orange melon is 2.05 mg/100 g, with % recovery of 98.81% and RSD of 1.14%. 2. The result shows beta-carotene content in green and orange melon significantly differ; orange flesh melon contained higher beta-carotene than green flesh melon.
REFERENCES
1. Tim Redaksi Agromedia. Budi Daya Melon. Jakarta: Agromedia Pustaka; 2007. p. 1-14 2. Beta-karoten [Internet]. [cited 2015 May 5]. Available from: http://www. bbppbinuang.info/news17-beta-karoten.html. 3. Rukmana R. Melon Hibrida. Yogyakarta: Kanisius; 1995. p 14 4. Parwata IM; OA, K. Ratnayani, Ana L. Aktivitas Antiradikal Bebas Serta Kadar Betakaroten Pada Madu Randu (Ceiba pentandra) dan Madu Kelengkeng (Nephelium longata L.). Bukit Jimbaran, Bali : Jurnal Fakultas Kimia FMIPA Universitas Udayana; 2010 5. International Conference On Harmonization (ICH). (2005). Validation of analytical procedure of: text and methodology.
International Seminar Pokjanas TOI 53 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
SPECTROPHOTOMETRIC METHOD PRECISION TO ASSAY OF LYCOPENE IN TOMATOES FRUIT (Solanum lycopersicum Lam.)
Liliek Nurhidayati, Wening Ariwanty Faculty of Pharmacy, Pancasila University, Jakarta
ABSTRACT
The main active substance in tomatoes fruit (Solanum lycopersicum Lam.) which found in large quantities was lycopene. Lycopene was one of the natural carotenoid antioxidants, as well as a pigment which give the red color in tomatoes. In this study, lycopene was extracted using Low Volume Hexane Method by addition of butylated hydroxytoluene. The mixture was filtered, and the absorbtion of n-hexane phase was measured at ±503 nm. Lycopene content in ripe fruits was 6.15 mg/100g , This method met the precision requirements with the relative standard deviation of 1.03%. Keywords : lycopene, tomatoes, visible spectrophotometry, precision
INTRODUCTION
Tomatoes (Solanum lycopersicum Lam) is one of the Solanaceae plant. The main active compound in tomatoes fruit was lycopene. Lycopene was good for health because of its antioxidant activity(1). Lycopene was one of potential antioxidant with the ability to reduce singlet oxygen twofold better than beta-carotene and tenfold better than the tocopherol (2). Lycopene content in tomatoes were interesting to be studied. It could be extracted using Fish et al, method. Lycopene was cool macerated using aceton, ethanol of 95%, and n-hexane and added with butylated hydroxytoluene (BHT) as antioxidant in aceton (3). Since it was a color pigment so the absorbance of lycopene could be measured in visible region . It has 11 conjugated double bond and the absobance could be measured at the longer (4) wavelength (λmax 444, 470, 502 nm in n-hexane) . Before applied to assay the lycopene in tomatoes fruit this methods must be validated. In this research, the precision of visible spectrophotometry was tested.
METHODS
Ripened tomatoes (± 3.5 months) fruit was obtained from a local fruit farm at Gunung Cibiuk, Sukabumi. Taxonomic determination was performed by Herbarium Bogoriense LIPI, Bogor. Lycopene working standard was obtained from PT. Soho Industri Farmasi. Spectroscopic analysis was carried out on Shimadzu 1700 double beam UV/Visible spectrophotometer.
Determination of maximum wavelength of lycopene Absorbtion spectrum of working standard lycopene solution (2.5 ppm in n-hexane) were recorded over the wavelength range of 300 to 700 nm against solvent blank, in quartz cuvetts with 1 cm diameters.
Absorbance stability Absorption of working standar 2.5 ppm lycopene solution were recorded on 502.5 nm during 60 minute against solvent blank, in quartz cuvetts with 1 cm diameters.
Calibration curve Preparation of calibration curve was performed by measuring the absorption of lycopene working standard solution of 1.0; 1.5; 2.0; 2.5; 3.0; 3.5; 4.0 and 4.5 ppm in 502.5 nm.
International Seminar Pokjanas TOI 54 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Precision test of spectrophotometry methods for determination of lycopene in tomatoes. Fresh tomatoes was cut into small pieces, blended. About 0.2 g of tomatoes juice was poured into Erlenmeyer, then added of 0.05% (w/v) BHT in 5 ml of acetone, 5 ml of 95% ethanol, 10.0 ml of n- hexane. Put the Erlenmeyer inside the beaker glass with ice and placed on orbital shaker, rotated 180 rpm for 15 minutes. After 15 minutes of agitation, 3 ml aquademineralisata neutral was added, and shake again for 5 minutes. Filtered, the filtrate was transferred to a separating funnel and then allowed to stand 5 minutes at room temperature. Take n-hexane phase. The absorption of sample solution was measured in 502.5 nm against n-hexane as blank . Lycopene content was calculated using calibration curve equation. It was conducted six times to test the precision method. To identify of lycopene in tomatoes, absorption spectrum of sample solution were recorded over the wavelength range of 300 to 700 nm against solvent blank, in quartz cuvetts with 1 cm diameters.
RESULTS
Report from research Center for Biology, Indonesian Institute of Sciences mentioned that tomatoes has species name that is Solanum lycopersicum Lam. The spectrum of lycopene standard solution was showed in Fig.1.
Fig. 1. Absorption spectra of lycopene working standard solution in n-hexane
Absorbance stability Fig 2. Showed the result of absorbance stability test.
Fig. 2. The absorbance stability of lycopene solution in 502.5 nm
International Seminar Pokjanas TOI 55 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Qualitative analysis The spectrum of solution extracted from tomatoes was shown in Fig 3.
Fig 3. Spectrum of sample solution I n-hexane
Determination of lycopene content in tomatoes fruit Determination of lycopene content was conducted five times to assay the precision of this methods. The results was showed in Table 1.
Table 1. The results of lycopene content determination
Sample Absorption Content of lycopene (mg/100g) weight (g)
0.2783 0.3545 215.1 =6.15 0.2746 0.3534 225.5 SD= 0.0636 0.2871 0.3585 210.4 RSD = 1.03 0.2850 0.3573 211.2 0.2823 0.3567 214.2
DISCUSSION
Determination of maximum wavelength was performed to choose the wavelength where the absorbance of both standard solution and samples were measured. Fig. 1 shows that the maximum wavelength of lycopene were 444.0 nm; 470.5 nm; and 502,5 nm. The highest absorption was in 502.5 nm. This wavelength was choosen to conducted the lycopene analysis. In this wavelength there was no disturbance of the other carotenoid(4). Absorbance stability test was performed to determine the correct time to measure the absorbance solution. The lycopene solution had stable absorbance during minute of 15 until 40. Calibration curve of
International Seminar Pokjanas TOI 56 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
lycopene that performed using seven different consentration of lycopene showed that the equation of regression line was y = 0.0866 + 0.1557x with correlation coeffisient of 0.9913. This equation was used to calculate lycopene content. The solution spectrum of samples (Fig 3) was similar with the spectrum of lycopene working standard (Fig 1). It indicated that there were lycopene in ripe tomatoes. Detemination results with five replication showed that the tomatoes fruit has lycopene content of 6.15 mg/100 g with RSD of 1.03%. RSD is not allowed more than 2.0% (5) or based on the analyte content not more than 11.31% (6). The precision of this methods fulfill both of them.
CONCLUSION
The visible spectrophotometry using n-hexane as solvent in 502.5 nm fulfill the precision requirement to determination of lycopene in tomatoes fruit.
REFERENCES
1. Kailaku SI, Dewandari KT, Sunarmani. Potensi likopen dalam tomat untuk kesehatan. Buletin Teknologi Pascapanen Pertanian Volume 3 2007. pp .50-8 2. Sanjiv A. Rao AV. Tomato lycopene and its role in human health and chronic disease. Canadian Medical Association Journal. Vol. 163 (6). 2000. p.734-44 3. Fish WW, Veazie PP, Collins JK. A quantitative assay for lycopene that utilizes reduced volumes of organic solvents. J. Food Comp. and Anal. 15; 2002. p.309-17 4. Delia B, Amaya R, Mieko K. Harvestplus handbook for carotenoid analysis second ed. Washington DC and California: Harvestplus; 2004. p.4, 13-20 5. United States Pharmacopeial Convention. The United States Pharmacopeia 35-The National Formulary 30. Rockville: United States Pharmacopeial Convention. 2012. pp. 877-81. 6. Harmita. Petunjuk Pelaksanaan Validasi Metode dengan Cara Perhitungannya. Majalah Ilmu Kefarmasian. Vol 1No.3 Desember 2004.h.119
International Seminar Pokjanas TOI 57 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
OPTIMIZATION AND VALIDATION OF HIGH PERFORMANCE LIQUID CHROMATOGRAPHY FOR DETERMINATION OF CAFFEINE IN WHITE TEA
Zuhelmi Aziz*, Dhiah Resti Fakultas Farmasi Universitas Pancasila Srengseng Sawah, Jagakarsa, Jakarta 12640
email: [email protected]
ABSTRACT
White tea comes from the terminal buds and leaves of Camellia sinensis, L which are still unopened and covered with a fine silvery-white hairs. Thence, white tea has more caffeine than green and black tea because active of biosynthesis of caffeine occurs in young tea leaves. In accordance with United State Pharmacopeae (USP) 35th, reverse phase high performance liquid chromatography (HPLC) is used to determination of caffeine. HPLC method has been optimized and validated for determination of caffeine in white tea. Optimum conditions for the HPLC in the experiment are as follows: stationary phase; Waters C18 (150 mmx 3.9 mm), column temperature 40oC, mobile phase; methanol - water (30:70) with a flow rate of 1.0 mL / min and UV detector with the maximum wavelength 273 nm. The result of validation as follow: the linearity test showed a linear relationship with a correlation coefficient; r = 0.9989, the accuracy and precision test appropriate ICH requirements. The experiment found that the contain of caffeine in white tea which is determine by HPLC in the optimum condition is 3.84%, with precision indicated by RSD value ≤ 2%, and accuracy indicated by recovery value 98.97% -99.72% with t-score which is less than the corrresponding value on the t-table (DoF=4, p=0.05) Keywords: Caffeine, High Performance Liquid Chromatography, White tea, Validation
INTRODUCTION
White tea comes from the terminal buds and leaves of Camellia sinensis, L which are still unopened and covered with a fine silvery-white hairs. White tea has a higher polyphenol and has more caffeine than green and black tea, because active of biosynthesis of caffeine occurs in young tea leaves. Therefore, it is necessary to the determination of caffeine in white tea. In accordance with United State Pharmacopeae (USP) 35th, reverse phase high performance liqiud chromatography (HPLC) is used to determination of caffeine . In this study, HPLC method has been optimized and validated for determination of caffeine in white tea. Optimization of HPLC performed with determining the maximum wavelength and composition of the mobile phase. Validation methode of HPLC performed on several parameters such as: linearity test, accuracy and precision test and sensitivity according to the International Conference On Harmonization (ICH). (8,9)
METHODOLOGY
Commercial Products white tea A and B were used as sample, reference standard of caffeine, methanol pro-HPLC, distilled water, aquabidest, chloroform, ammonium 30%. Analysis was performed by HPLC (Shimadzu Autosampler LC-20AD), Spectrophotometer Shimadzu 1800, analytical balance (Mettler AB 204), thermometer (Jena), ultrasonic cleaner (Elma LC 30 H), filter Millipore, syringe (special HPLC), rotary evaporator (IKA RV-10), and a glass tools that are commonly used in laboratory analysis (Pyrex Iwaki Glass). Optimization of HPLC performed with determining the maximum wavelength and composition of the mobile phase. The linearity test were used reference standard of caffeine solution at concentrations of 40, 60, 80, 100, 120, 140, and 160 ppm and each of which are added of the sample solution. Limit of detection and International Seminar Pokjanas TOI 58 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4 quantitation were determined based on linear line equation. Precision and accuracy test were performed by standard addition method.
RESULTS AND DISCUSSION
Optimum conditions for the HPLC in the experiment are as follows: stationary phase; Waters C18 (150 mmx 3.9 mm), column temperature 40oC, mobile phase; methanol - water (30:70) with a flow rate of 1.0 mL / min and UV detector with the maximum wavelength 273 nm. The standard curve equation is y = -8239.90 + 56507.23 x, with coefficient correlation (r) of 0.9986. While the result of the linearity test showed that the equation is y = 3306287.62 + 27932.56 x with coefficient correlation (r) of 0.9989 and limit of detection and quantitation of the method were 7.4 and 22.3 ppm.
Figure 1: The Curve of Linearity Test ; relationship between concentration(X) and peak area (Y). Accuracy of the method can be showed by the value of recoveries of with the addition of reference standards caffeine 400 ug, 600 ug and 800 ug in white tea. The experiments were performed three times repetitions for each analyte concentration. Method is precise and accurate with the relative standard deviation (RSD) of ≤ 2% and precent recoveries of 98.97 – 99.72% are included in the range of requirements 97-103% with t-score which is less than the corrresponding value on the t-table. (DOF = 4, p = 0 05. The result of precision and accuracy test of caffeine in white tea can be seen in Table 1. Table 1: Results of precision and accuracy test of caffeine in white tea.
The method used to meet the requirements of linearity with r = 0.9989. The precision of the method is shown by the coefficient of variation of less than 2%, while accuracy indicated by the value recovery of 98.97% -99.72% and the t value smaller than t table in the degrees of freedom (df) = 4 and p = 0 05. The value of the limit of detection of 7.4 ppm and 22.3 ppm limit of quantitation. International Seminar Pokjanas TOI 59 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
The method has been successfully to determine caffeine in white tea by HPLC in the optimum condition with the result is 3.84%.
CONCLUSION
Reverse phase HPLC method with in condition of: a stationary phase; Waters C18 (150 mmx 3.9 mm), column temperature 40oC, mobile phase; methanol - water (30:70), flow rate of 1.0 mL / min and UV detector with the maximum wavelength 273 nm met the requirements of ICH for determination of caffein in white tea, with limit of detection and quantitation of the method were 7.4 and 22.3 ppm. The content of caffeine in white tea is 3.84%.
International Seminar Pokjanas TOI 60 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
REFERENCES
1. Dalimartha, Setiawan. Atlas Tumbuhan Obat Indonesia. Jilid I. Jakarta: Trubus Agriwidya; 1999. h. 150-3. 2. Kubota, H. Patterns of Adenine Metabolism and Caffeine Biosynthesis in Different Parts of Tea Seedlings. Plant Physiology; 1986. h. 275-281. 3. Tiurmaida, Yuliana. Penetapan Kadar Kofein dalam Minuman Teh Kemasan secara Kromatografi Cair Kinerja Tinggi (Essay). Jakarta: Fakultas Farmasi Universitas Pancasila; 2012. 4. Komes, D. et. al. Determination of Caffeine Content in Tea and Mat Tea by using Different Methods. Czech J. Food Sci (journal) 2009; vol. 27:p.S213-6. 5. Skoog, D. A. Principles of Instrumental Analysis. Sixth Edition. Canada: Standford University; 2007. h. 818-48. 6. Harmita. Petunjuk Pelaksanaan Validasi Metode dan Cara Perhitungannya. Majalah Ilmu Kefarmasian. 2004; 1(3).h. 117-34. 7. Is White Tea Better Than Other Teas as a Potential Anticarcinogen?. Diambil dari: http://lpi.oregonstate.edu/news/whitetea.html. Diakes: 1 Februari 2014. 8. International Conference On Harmonization (ICH). (2005). Validation of analytical procedure of: text and methodology. 9. United States Pharmacopeial Convention (USP) 35th. (2012). The United States Pharmacopeia The National Formulary 32 27. Rockville: The United States Pharmacopeial Convention Inc., pp. 734-6.
International Seminar Pokjanas TOI 61 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
THE EFFECT OF EXTRACTION METHOD ON TOTAL ALKALOID LEVELS OF JEMBIRIT LEAVES (Tabernaemontana sphaerocarpa BL) WITH SPECTROFOTOMETRIC METHOD
Nina Salamah, Miftahul Rozak Pharmacy Faculty, Universitas of Ahmad Dahlan Yogyakarta Jl. Prof. Dr. Soepomo, Janturan, Yogyakarta, phone 0274 – 385123
Email: [email protected]
ABSTRACT One of the plants which contain the alkaloid is a plant jembirit (Tabernaemontana sphaerocarpa BL. ). Sap and leaves from this plants have been used to treat skin diseases and sprain. Alkaloid from jembirit plants showed potent cytotoxicity against various human cancer cell. The goal of this research is to find out the influence of the extraction method against the level of total alkaloid jembirit leaves. Jembirit leaves were extracted by maceration method and extraction with Soxhlet apparatus used ethanol 70 % as a solvent. Standardization of extracts conducted by test of ash content, test of moisture content, and extract yield. Qualitative analysis conducted by alkaloid test. Determination of total alkaloid was analyzed with visible spectrophotometry method using Bromocresol green as complexing agent. The results showed that jembirit leaves contained alkaloid compounds. The determination resulted the levels of total alkaloid of maceration was 0.727% ± 0.0032, levels of total alkaloid extraction with Soxhlet apparatus was 0.666% ± 0.0022. The stastitical analysis showed significance differences of total alkaloid levels between maceration method and extraction with Soxhlet apparatus viewed from siginificancy value (0.001<0.005).
Key Words : Jembirit leaves, Tabernaemontana sphaerocarpa BL, Levels of total alkaloid, extraction method, maseration, extraction with Soxhlet apparatus
INTRODUCTION Many alkaloid used as an organic compounds that is alkaline is obtained from plants. The chemical structure having heterocyclic alkaloid arrangement with nitrogen as hetero atomic. In the treatment, a compound alkaloid have an effect analgetic (morphine and kodein), antitusif (kodein), antimalaria (quinin), spasmolitic (papaverin), antiamuba, and antiemetic (emetin) (Damin sumardjo, 2008). To research against a stem plants jembirit have been found two compounds alkaloid bisindol namely biscarpamontamine A and B. Compound biscarpamontamine B effective as cytotoxic cancer cells in humans (Zaima et al , 2009). It is therefore necessary to optimize extraction process leaves and stems plant jembirit (Anonym, 2001). Technique to get extract leaves and stems jembirit, can be done by several methods, of them are maceration and extraction with a soxhlet. Maceration is the process of extraction by means of soaking the in water or organic solvents until percolate to soften the arrangement of cells, so that substance is contained in it will be dissolved (Ansel, 2005). Extraction with a soxhlet is by means of heat that is generally used a soxhlet, so there the process of extracting sustainable by the number of a solvent is relatively constant with the cooling turning . As many alkaloid benefits for human life, but research on influence extraction method of the total alkaloid contained in the jembirit leaves necessary. The use of jembirit plants optimally and directed at the best extraction method used in medicine .
International Seminar Pokjanas TOI 62 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
METHODS
Sample used in this research was jembirit leaves obtained from in Samigaluh, district Kulonprogo on 20 january 2014. The leaves used is a dark green leaves with 9-15 cm length and breadth 7-12 cm. A chemical used are ethanol 70 % v/v, bromocresol green, sodium hydroxide p.a, phosphate of sodium p.a, chloroform p.a, citric acid p.a, aquades, reserpin tablet . Equipment used in this research is the balance of analytic, cuvette, rotary evaporators (shimadzu), waterbath, pipet volume, propipet, pipet measuring instrument, a funnel buchner, an oven, instrument soxhlet, a separating funnel , and the spectrophotometer uv-visible (Shimadzu) type 1700 .
1. Determination of Jembirit (Tabernaemontana sphaerocarpa.BL) leaves Determination conducted in biological laboratories the faculty mipa ahmad dahlan university yogyakarta use plant and jembirit leaves powder. 2. The Processing Sample Sample processing jembirit leaves that has been collected then dried with an oven temperature 600C, until easily crushed. Then the dried leaves of powdered to obtain the pollen. Powder tested with a halogen moisture analyzer. After tested levels of the water, the pollen sifted use sieving machine with high-rise buildings, until obtained the pollen size 50 / 60 mesh . 3. Extraction Method a. Maceration The jembirit leaves (Tabernaemontana sphaerocarpa.BL) with size mesh 50/60 each 200 gram, macerated with ethanol 70 % v/v as many as 1.0 liters. Maceration carried out for 24 hours by stirring for three hours. Maserat who filtered with a buchner use some help a vacuum, then moved in a porcelain, volatilized use rotary evaporators (600C). A solvent which is left volatilized above waterbath at a temperature 500C until obtained extract viscous . b. Extraction with Soxhlet The jembirit leaves with size mesh 50/60, 65 grams extracted with a soxhlet use ethanol 70 % v/v as many as 300,0 ml . Filtrat obtained with water bath at a temperature 500C until obtained extract viscous . 4. Standarization extract a. Rendemen Rendemen obtained by means weigh yield heavy the end of are produced (extract compared with heavy early the before extraction). b. Moisture content of extract Number of extract ethanol jembirit leaves (Tabernaemontana sphaerocarpa) measured used a halogen moisture analyzer. c. The ashes the determination The ashes extract ethanol leaves jembirit done with mengkonstankan exchange rate porcelain empty with warm up temperature 100-105oC for two hours, and cooled in a desiccator. As many as 1.0 g extract included in krus who has constant in furnace at a temperature 600oC to sample to ashes, then cooled and is weighed. Weighing be done in repeated until obtained heavy constant. The ashes counted in percent against heavy sample early (Anonym, 2000). 5. Qualitative analysis alkaloid Extract dissolved in 3 ml ethanol 70 % v / v with 5,0 ml HCl 2 M and 0.5 g NaCl . Then filtrat filtered and added 3 drops HCl 2 M divided into 4 tube. Filtrat A as their forms , filtrat B added reagents meyer , filtrate C with H2SO4 dilute and filtrate D plus reagents Dragendorf (Sumardjo, Damin, 2008). 6. A total alkaloid level analysis To research analysis was conducted alkaloid to levels total with the spektrofotometri methods. As for stage analysis total alkaloid with the spektrofotometri methods is as follows: a. Preparasi Larutan 1 ) Solution bromocresol green (BCG) Solution bromocresol green (1x10-4) made by heating 69,8 mg bromochresol green with 3.0 ml NaOH 2N and 5.0 ml aquades up completely soluble. Then diluted until 1000,0 ml with aquades International Seminar Pokjanas TOI 63 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
2) Dapar phosphate-citric pH 2.2 For solution sodium phosphate 2M (71.6 g Na2HPO4 in 1000,0 ml aquades) then adjust pH 2.2 with a solution of citric acid 0.2M (42.02 g citric acid in 1000.0 ml aquades) 3) Standard solutions of reserpin Standard solutions of reserpin have weigh equivalent 25 µg/ml reserpin in 10.0 ml acetic acid glacial, and add until 100.0 ml aquades. b. The determination of operating time Standard solutions of reserpin by concentration of the 25 ug / ml with 5.0 ml dapar phosphate pH 2,2 and 5.0 ml solution bcg , then extracted by 5.0 ml chloroform (2 times) and extracted phase chloroform. The extraction was collected in squash measures 10.0 ml, then add by chloroform to sign. Then examined time absorption a stable at wavelengths 420.8 nm. The data collected used to make a curve the relationship between absorbansi to the time . c. The determination of maximum Wavelenghth Standard solutions of reserpin with low 25 µg/ml included in a separating funnel coupled with 5 ml dapar phosphate pH 2.2 and 5.0 ml solution BCG, then extracted by 5.0 ml chloroform (2 times) and extracted phase chloroform. The extraction brought in squash 10.0 ml measures, then add with chloroform to sign. Checked absorbansinya at wavelengths 350-700 nm using the operating time has received. The data used to make a curve the relationship between absorbansi and wavelength. d. The Determination of Standart Curve Standard solutions of reserpin by concentration of the 25 µg/ml taken 4,0; 5.0; at 6; 7,0; 8.0; 9; 10.0 ml then put in a funnel break coupled with 5.0 ml dapar phosphate ph 2.2 and 5.0 ml solution bcg, then extracted by 5.0 ml chloroform (2 times) and extracted phase chloroform. The extraction was collected in squash measures 10.0 ml, then add by chloroform to sign. Then examined absorbansinya at wavelengths maximum. e. Sample Preparation Preparasi samples from 50,0 mg extract ethanol leaves jembirit dissolved in 3 ml HCl 2 N. Then 1.0 ml filtrat extracted use 5.0 ml chloroform ( 3 times). After extracted, pH solution neutralized use 0.1 N NaOH. Then added 5.0 ml dapar phosphate pH 2.2 and 5.0 ml solution BCG. A mixture of the extracted back with 5.0 ml chloroform (2 times). Phase chloroform was collected in squash measures 10.0 ml, then in addition to with chloroform to sign. Read absorbansi at wavelengths maximum (Amrizal, 2010). f. Data Analysis An alkaloid levels total with the maceration methods and extraction with a Soxhlet tested normality and homogeneity use application SPSS. Test normality done with kolmogorov-smirnov analysis . Test of homogeneity done with levene analysis . When data normally distributed and homogeneous , then the analysis continued with the methods t-test. But if results showing that the data not normally distributed and not homogeneous or one of them , the continued with the methods non parametric .
RESULT AND DISCUSSION a. The Determinasi of Jembirit (Tabernaemontana sphaerocarpa BL) From the determination be seen that plant used in this research was leaves jembirit ( Tabernaemontana sphaerocarpa BL ). Leaves a deep green, and the powder of leaves green brownish . Materials Pollinated collection and Jembirit Leaves then dried in an oven with a temperature of 600C to reduce the water content of simplicia. Dried leaves diserbuk and sifted using a sieve mesh 50/60, until retrieved the powder with size 50/60. The purpose of the pollination is done to minimize the size of the particle surface area so that particle simplisia becomes large so that the liquid penyari that will easily dissolve the active compounds of simplicia.
International Seminar Pokjanas TOI 64 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
b. The determination of the moisture content of jembirit leaves powder Drying shrinkage Measurements-dust powder is done by using Halogen Moisture Analyzer. Shrinkage of drying powders can be measured as a reference of the moisture contained in simplisia, because it does not contain jembirit leaf essential oil so that experience evaporation in drying shrinkage is the determination of the moisture content contained in the extract. Table I. Moisture content of jembirit leaves powder
Moisture Replication Weight X ± LE CV Based on content the data 1 1,224 g 5,51 % moisture 2 1,145 g 5,41 % (5,48% ± 0,015) 1,09 % content can 3 1,312 g 5,54 % be concluded that the simplisia leaves jembirit meet the requirements because the water level contained less than 10 % ( Anonym, 2000 ). c. Extraction Making extract leaves jembirit done variation method that is by using a method of maceration and with a soxhlet. Maceration methode are liquids would pass through the cell walls, an active substance will dissolved because of differences in concentration between solution an active substance in in the cells and outside a cell, so that solution of high concentration will out from cells (Anonym, 1986 ). Maserat obtained concentrated with rotary vaporator and water bath until obtained extract viscous the process extraction with the methods of using tools soxhlet done by heating a solvent at a temperature 700C .When a solvent ethanol 70 % v /v heated, a solvent would evaporate and will form fluid back when about cooling turning. A solvent fluid drop on the simplisia, and will dissolving back an active substance from the powder. The warming can affect levels of an active substance from the powder. To compound active that do not bear warming cannot be done with this method (Dayanti and suyatno, 2012). An extract obtained concentrated by water bath until obtained extract viscous. d. Standarisation extract 1. Rendemen The size of value of a rendemen show effectiveness of the process extraction .
Table II. Rendemen based on extraction method Mass Extraction Method Mass Ekstrak Rendemen Simplisia Maceration 200,250 g 89,290 g 44,59 % Soxhlet 64,990 g 32,226 g 49,58 %
Efectivitas extraction process influenced by the types of solvent, size of particles, a method of the extraction and long process of extraction . 2. Moisture content On jembirit leaves does not contain volatile oil, so as to the result of moisture content can as the reference are contained in extract .
Table III. Moisture content of extract Extraction Methode Moisture Content X ± LE CV 5,69 % Maceration 5,80% 5,67 % ± 0,03 2,30 % 5,54 % 9,30 % Soxhlet 9,35 % 9,27 % ±0,02 0,90 % 8,89 %
International Seminar Pokjanas TOI 65 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
From the results of the determination of moisture content extract ethanol leaves jembirit with variations method penyarian above can be concluded that extract produced meet the requirements at less than 10 %. Moisture content to the extraction method with a soxhlet higher than with the maceration. 3. The determination of ashes The determination of ashes total can be used for various purposes , among others to determine good or failure a processing , the knowledge of the material used (Apriantono, 1989) . Tabel IV. The Determination of ashes ethanolic extract of jembirit leaves Extraction Methode The determination of X ± LE CV ashes 9,61 % Maceration 9,98 % 9,80% ± 0,186 1,898 % 9,82 % 5,75 % Soxhlet 5,76 % 5,79% ± 0,061 1,050 % 5,86 % e. Qualitative of Alkaloid Qualitative analysis alkaloid identification extract to compound the alkaloid was conducted qualitativ by using test tube with reagent mayer, dragendorf, and H2SO4 dilute. Extract ethanol leaves jembirit dissolved in HCl 2 N tested positive contain the alkaloid if when sample with reagent mayer will form the sediment yellowish white, reagent dragendorf produce precipitate brown orange, and add H2SO4 are not formed the sediment (Dayanti and suyatno, 2012). f. The levels of Alkaloid The levels of total alkaloid done with the complex bromocresol green (BCG) in spectrophotometri visible. The principle of this method is based on the levels of alkaloid the formation of complex reagents between alkaloid with BCG to form a compound yellow.
Picture 1. Complex BCG and Alcaloid g. The determination of operating time (OT) The research obtained for operating time standard reserpin is from 43-50 minutes .While to extract the results of maceration is in the to 53-57 , and to extract the results with a soxhlet is in the to 10-12. h. Determination of a wavelength on absorbansi maximum In this research obtained a wavelength on absorbansi maximum solution reserpin is 420,8 nm, extract the results of maceration 415,5 nm and extract the with a soxhlet 417,5 nm.
International Seminar Pokjanas TOI 66 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
420.8 nm
Picture 2. A wavelength on absorbansi maximum Complex Reserpin-BCG 25 µg/ml i. Standart Curve of Reserpin
Table V. Standart Curve of Reserpin
Consentration (µg/10 ml) Absorbansi 1,00 0,231 1,25 0,307 1,50 0,459 1,75 0,501 2,00 0,556 2,25 0,614 2,50 0,703
y = 0,3x - 0,05 j. The determination of total alkaloid The determination of total alkaloid jembirit leaves used spektrofotometri methods. Samples from 50,0 mg , dissolved in HCl 2 N to form a salt an alkaloid soluble in a solvent polar , then 3 ml sample extraction with 5.0 ml chloroform twice to deprive of compound non polar other having the structure of almost the same with the alkaloid. Sample separated and extracted phase acid, with NaoH 0.1 N to form an alkaloid bases soluble in organic solvents. Added dapar phosphate pH 2.2 as buffer solution , and added solution bromocresol green (BCG) as to be a solution produced yellow.
Table VI. The Determination of Total alkaloid based on extraction method Mass Volume Total Extraction Rep sample Sample Absorbansi Alkaloid X ± LE CV Method (mg) (mL) (%) 1 50,10 3,0 0,559 0,675 2 50,10 3,0 0,432 0,536* 3 50,20 3,0 0,562 0,677 0,666% ± 1,651 Soxhlet 4 50,50 3,0 0,547 0,657 0,0022 % 5 50,60 3,0 0,545 0,652 6 50,20 3,0 0,461 0,677 7 50,50 3,0 0,551 0,660 1 50,30 3,0 0,589 0,706 2 50,30 3,0 0,611 0,729 3 50,50 3,0 0,627 0,743 0,727% ± 2,202 Maceration 4 50,20 3,0 0,620 0,740 0,0032 % 5 50,30 3,0 0,618 0,739 6 50,30 3,0 0,608 0,726 7 50,20 3,0 0,585 0,704 note : * : Data delete
A total alkaloid levels jembirit leaves that the results with the maceration methods higher than with a soxhlet. Factors that influential of the results is temperature. Extraction with a soxhlet use International Seminar Pokjanas TOI 67 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4 some help temperatures of roughly 700C so that there is alkaloid compound that do not bear warming damaged a consequence of the warming. In addition , in extract the results with a soxhlet the water level contained is greater than the maceration, so that influential in the alkaloid total obtained . Based on the t-test obtained significance 0,001 (<0,005 ) where HO rejected which means there is a difference meaningful so that can be concluded that extraction method impact on the alkaloid total leaves jembirit (Tabernaemontana sphaerocarpa ) .
CONCLUSION
Jembirit Leaves (Tabernaemontana sphaerocarpa Bl) compound containing alkaloid. A total alkaloid levels jembirit leaves with the maceration methods is 0.727 % ± 0.0032 , a total alkaloid levels jembirit leaves with a soxhlet is 0.666 % ± 0.0022. Different calculation extraction methods impact on the total alkaloid jembirit leaves. The stastitical analysis showed significance differences of total alkaloid levels between maceration method and extraction with Soxhlet apparatus viewed from siginificancy value (0.001<0.005).
REFERENCE
1. Amrizal. Isolasi Senyawa Alkaloid Dari Ekstrak Metanol Daun Tumbuhan Tabernaemontana sphaerocarpa BI (Apocynaceae). Pekanbaru. Fakultas F-MIPA Universitas Riau. 2010 2. Anonim. Tabernaemontana sphaerocarpa BL, Jakarta : Departemen Kesehatan Indonesia.Jakarta. 2001 3. Anonim. Sediaan Galenik. Departemen Kesehatan Republik Indonesi. Jakarta.Hal 19-20. 1986 4. Anonim. Paremeter Standar Umum Ekstrak Tumbuhan Obat, EDISI I. Departemen Kesehatan Republik Indonesia. Jakarta. Hal 10-12. 2000. 5. Ansel. H.C. Pengantar Bentuk Sediaan Farmasi. Edisi keempat. Jakarta.UI Press. Hal 103- 105. 2005. 6. Apriyantono, A., D. Fardiaz, N. L. Puspitasari, Sedamawati dan S. Budiyanto., Analisis Pangan. PAU Pangan dan Gizi. IPB Press. 1989. 7. Dayanti, R., dan Suyatno.. Aktifitas Anti Oksidan Ekstrak Metanol Bagian Batang Tumbuhan Paku Nephrolepis radicans (Burm) Kuhn. UNESA Journal of Chemistry. 1(1) ; 86-92. 2012. 8. Sumardjo, Damin. Pengantar Kimia. Jakarta: EGC. Hal 26. 2008. 9. Zaima K, Hirata T, Hosoya T, Hirasawa Y, Koyama K, Rahman A, Kusumawati I, Zaini NC, Shiro M, Morita H.. Biscarpamontamines A and B, an Aspidosperma-iboga Bisindole Alkaloid and an Aspidosperma-aspidosperma Bisindole Alkaloid,From Tabernaemontana sphaerocarpa. Faculty of Pharmaceutical Sciences, Hoshi University, Ebara 2-4-41 Shinagawa, Tokyo, Japan. 2009.
International Seminar Pokjanas TOI 68 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
INTEGRATION OF HERBAL OR TRADITIONAL MEDICINE THROUGH EVIDENCE BASED PRACTICE
Anny Lumban Toruan*, Galih Ajeng Kencana Ayu ** *Graduate Pharmacy Program, University of Pancasila, Indonesia ** Public Health Technology Intervention Center, National Institute Health Research and Development, Ministry of Health of Indonesia.
Corresponding: [email protected]
ABSTRACT
Traditional medicines are used by some 60% of the world’s population and in some countries are extensively incorporated into the public health system. Herbal medicines are plant extracts that have been used for medicinal purposes for thousands of years. The integration of herbal and other forms of traditional medicine (TM) can be done as follows: incorporation of traditional and modern evidence- based medicine (EBM) as integral parts of a country’s formal health care system. It is most likely to be achieved and has been demonstrated to be practicable in many countries, particularly in Asian countries such as China, Japan, Korea, and India, among others it can be practice integrated with modern medicine by individual health care practitioners and also it can be integrated as two branches of medical science, with the ultimate incorporation of elements of both to form a new branch. A range of interrelated quality, safety and efficacy issues could contribute to the rational and successful integration of herbal medicine into modern medical practices. The issues related to the integration such as herb quality, quality assurance/quality in processing and manufacturing/preparation of herbal medicines (good Manufacturing practical) issues, herbal mechanisms of action, bioavailability and herbs’ chemical constituents, herb drug interactions, herb-herb interactions, efficacy measurements objective quantiviable versus subjective quality of life and other safety issues has to be done. Key words: traditional medicines, herbal medicines, evidence based practice, formal health care
INTRODUCTION
In the last few decades biomedicine has been revolutionized by; the application of the principles of Evidence Based Medicine (EBM) as a way of establishing the effectiveness and safety of modern medical intervention.1
In Western countries, such as the United States, Australia, Canada, and members of the European Union, the popular use of herbal medicine in the form of complementary and alternative medicine (CAM) or phytomedicine in the last two to three decades has led to a multinational, multibillion dollar industry, professional and trade organizations, national and international practice and research conferences, establishment of specialized integrated medicine practices and clinics in pain management and adjunctive cancer therapy, incorporation of CAM courses in conventional medical colleges, introduction of CAM degree-level education programs, and establishment of research funding agencies such as the U.S. National Institutes of Health (NIH) National Center for Complementary and Alternative Medicine. 1
Indonesian herbal medicines, called JAMU, have been widely used by Indonesian to maintain their health and to cure the diseases since many centuries ago. In the future, the development and the use of Indonesian herbal medicines must be based on the stronger scientific evidence, especially through R&D and standardization, so that they can be integrated into national health care system.2 The integration of herbal and other forms of traditional medicine (TM) can be done in one of the following three ways: First, it can be incorporated as an integral part of a country’s formal health care system, with each being separately recognized as legitimate forms of health care within the same framework. Second, it can be practice integrated with modern medicine by individual health care International Seminar Pokjanas TOI 69 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4 practitioners. Third, traditional and modern practices can be integrated as two branches of medical science, with the ultimate incorporation of elements of both to form a new branch. 3
METHODS
A. FACTORS INFLUENCING THE INTEGRATION: Several factors influencing the integration of herbal medicine in evidence based medical therapy were discussed below: a. Current status and major issues of integration of herbal medicine in evidence-based medical therapy Currently, thousands of TM and other CAM herbal products are available as therapeutic agents worldwide. Yet few of these products have been subjected to randomized clinical trials (RCTs) under the International Conference on Harmonization (ICH) Good Clinical Practice Guidelines to determine their efficacy and/or safety.4. Of the nearly 2000 herbal medicine clinical studies listed on the Cochrane Controlled Trials Register as of June 2009, most concern single-plant herbal or phytomedicine. In recent years, in the case of multicomponent herbal medicines, an increased number of RCTs on traditional herbal medicine has been reported in the literature. Concluded that the majority of these studies suffered from methodological defects. For example, only 15% of these studies used blinding, the sample size was mostly less than 300 patients, the controls were inadequate, few studies used quantitative outcome measures, and the studies were short term.5 b. Factors Relevant Affecting Integration of Herbal Medicine Into Modern Medical Practices. A range of interrelated quality, safety and efficacy issues could contribute to the rational and successful integration of herbal medicine into modern medical practices.
1. Herb Quality Issues Fundamental to assuring the efficacy and reproducibility of any medicinal agent, be it a single chemical or a complex herbal mixture, is the assured quality of the product. In the case of single chemical drugs, the quality and properties are well defined and documented in pharmacopoeias or on file with regulatory agencies or marketing authorities. On the other hand, herbal medicines, be they single herbs or polyherbal products, suffer from a lack of uniformity in their chemical and physical qualities due to various factors as mentioned above.6 Unintentional in-process adulteration with heavy metals, microbial and chemical agents (pesticides, herbicides, and heavy metals), as well as with foreign matter such as insects, animals, animal parts, and animal excreta during any of the stages of source plant material production or procurement can result in unsafe source materials. Multicomponent Chinese or Ayurvedic herbal medicines have long been documented to be adulterated with synthetic anti-inflammatory drugs such as phenylbutazone, Indomethacin, and/or corticoid steroids in arthritis remedies.7
2. Good Manufacturing Practices Issues. The most important extrinsic factor affecting the quality of herbal medicines is the lack of effective policies on quality assurance (QA)/QC in the processing and manufacturing of herbal products under good manufacturing practices (GMP). The majority of herbal medicines marketed in the United States are sold as dietary supplements under the provisions of the Dietary Supplement Health and Education Act (DSHEA) of 1994, and only recently been mandated by law to be produced under cGMP.8
3. Herbal Mechanisms of Action, Bioavailability, and Herbs′ Chemical Constituents The underlying mechanisms of action of herbal medicine, whether single herbal or multiple herbal formulations, have generally not been elucidated due to the lack of knowledge of identifying their contained active and/or adjuvant phytochemical constituents. The same problem applies to the study of pharmacokinetics and bioavailability.9
4. Herb–Drug Interactions International Seminar Pokjanas TOI 70 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
The potential of interactions of herbal medicine with prescribed drugs or OTC drugs has been a major safety concern for clinicians as such interactions are difficult to predict and the general lack of available information on the herbs’ composition and pharmacological actions. If the definition of the herbal medicine extended to botanicals including fungi, algae, and other component matters, nearly 80 herbal medicines would be identified that had clinically significant interactions with drugs. Garlic, ginger, and ginkgo are among the herbs most commonly involved in herb–drug interactions.10
5. Herb-Herb Interactions Herb–herb interactions, sometimes referred to as contraindications in the application of herbs or prescription incompatibility, were documented in ancient textbooks on TCM medicinal formulae (i.e., a mixture of herbs). Herbal medicine practice routinely uses combination herbal formulations, termed polypharmacy, designed to enhance the effectiveness and minimize any potential side effects of treatment. Synergy between active ingredients is a characteristic aspect of herbal treatment and occurs at both a pharmacodynamic level and at a pharmacokinetic level. In both cases, active ingredients demonstrate potentiated effects—in other words, the therapeutic effect of herbal medicines is greater then the sum of its constituents parts.1
6. Efficacy Measurements: Objective Quantifiable versus Subjective Quality of Life The evidence needs to be verified legitimately and scientifically according to the conventional EBM framework. If possible, evidence generated for herbal medicine should be derived from the most powerful method of testing the effect of treatment intervention, the RCT. With a plausible biological basis, herbal products can be evaluated through double-blinded, placebo-controlled, multicenter trials. Reflecting this, the World Health Organization (WHO) has published a number of guidelines for clinical evaluation of the herbal and TMs.10 Within the EBM paradigm, RCTs are suggested to be reported in accordance with the 22-item Consolidated Standards of Reporting Trials (CONSORT) checklist, such as a detailed description on patient eligibility criteria, sample size calculation, specific objectives and hypotheses, implementation of the trial, and statistical methods, regardless of whether the intervention is conventional or herbal.11
7. Other Safety Issues Other safety issues include cultural and behavioral contexts as well as efficient communication on its use among patients, conventional medical practitioners, and herbal medicine practitioners. Over a few decades of development and with more scientific research data being published, although not all convincing, at least some promising evidence has met the EBM standard. Nevertheless, it is of critical concern to clinicians that many herbal medicine users take herbal remedies and conventional therapies concurrently without informing their medical doctors. Such communication gaps can lead to herb–drug interactions that may be otherwise avoided.12 c. Quality Assurance, Quality Control and Standardization of Herbal Medicines QA of herbal medicine for integrative medical use is a process spanning from the acquisition of the source material to the production of the clinical formulation. Therefore, QA/ QC research on source materials should begin from the point at which a specific plant part to be used is acquired by cultivation or field collection through Good agricultural practice GACP. GACP Guidelines have been established by a number of countries, and the WHO has also published a guideline on GACP to assist member states in the production of quality herbs. A most essential part of botanical QA is that plant materials should be identified by their scientific names (Latin binomial) rather than by common names and should be authenticated botanically according to pharmacopoeial standards employing macroscopic/organoleptic and microscopic methods. Each herb should be subjected to purity as well as contaminant tests for the presence of foreign matters, toxic metals, pesticide residues, mycotoxins, and microorganisms.13 d. Preclinical Pharmacological Assessments and Action Mechanisms In current practice, acute and chronic toxicities are usually determined by experimental studies using animal models. Suitable methods for testing toxicity need to be established so that herbal ingredients and their derived products can be reliably assessed. However, the biological response to a drug product may International Seminar Pokjanas TOI 71 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4 not be species transferable, and an active substance in animals may be entirely inactive in humans. On the other hand, acute and/or chronic toxicity manifestations in animal models are reliable indicators of drug safety. 7 e. Clinical Efficacy and Safety Assessments Fundamentally, conducting and reporting clinical studies on the efficacy and safety of herbal medicine should follow the context-specific elaborations of the CONSORT statement.11 In addition to the documentation of all general aspects of RCTs (e.g., randomization, blinding, and analysis) that are known to influence the estimation of treatment effects, specific considerations are needed to attend to the unique obstacles of implementing herbal medicine trials.
B. RESEARCH NEEDS For effective integration of herbal medicine into modern therapeutic practices, the level of research on the preclinical and clinical efficacy of these products and their complementation of or interaction with modern pharmaceuticals must be elevated to much higher levels than is presently the case. Preliminary to these studies, clinical products must be produced by GMP from source materials acquired through good agriculture and collection practices (GACP),14,16 be botanically validated, be chemically and/or biologically standardized, and their stability be established. Hence, the research on herbal medicines for the integrated medical use must begin with the acquisition and QC of source materials and processed starting materials. The three most important major areas of research can be defined as (1) herbal medicine quality and standardization, (2) preclinical pharmacological assessments and action mechanisms, and (3) clinical efficacy and safety assessments.
CONCLUSIONS
WHO member states and other stakeholders were called upon to take steps to integrate TM into national health systems. But integration of herbal medicine into modern clinical practice must be based on an EBM approach. Prior to the clinical evaluation of herbal medicine, be it a single compound, a mixture of herbal ingredients, or a complex herbal formula based on historic evidence of use, the QA/QC in source material acquisition and processing and manufacturing of the products under GMP must be addressed to assure efficacy and reproducibility. In addition to the use of scientifically irrefutable efficacy measurements, clinical studies should monitor and report adverse events, including potential drug–herb interactions. When the safety and efficacy are established in accordance with conventional scientific principles, the integration of herbal medicine into evidence-based clinical practice will likely occur.
REFERENCES
1. McClure L, Flowler A, and Price S., Scoping the evidence for the effectiveness of Herbal Medicines. January 2014:1 2. WHO traditional medicine strategy 2014-2023. World Health Organization 2013:38 3. WHO. 2008. http://www.who.int/dg /speeches/2008/ 20081107/en/index.html WHO Congress on traditional medicine. (Accessed August 2, 2009). 4. International Conference on Harmonization. 2010. http.//www.ich.org/cache/compo/276-254-1.html ICH guidelines. (accessed September 2014 . 5. Cochrane Collaboration. 2009. www.thecochranelibrary.com The Cochrane Library. (accessed May 22, 2011). 4. Gagnier J. J, DeMelo J, Boon H, Rochon P, Bombardier C. Quality of reporting of randomized controlled trials of herbal medicine interventions. Am J Med. 2006;119(9):800.e1–11.. [PubMed] 5. Hu Z, Yang X, Ho P. C, Chan S. Y, Heng P. W, Chan E, Duan W, Koh H. L, Zhou S. Herb- drug interactions. A literature review. Drugs. 2005;65(9):1239–82. [PubMed] 6. Ulbricht C, Chao W, Costa D, Rusie-Seamon E, Weissner W, Woods J. Clinical evidence of herb-drug interactions. A systematic review by the natural standard research collaboration. Curr Drug Metab. 2008;9(10):1063–120. [PubMed]
International Seminar Pokjanas TOI 72 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
7. Fong H. H. S, Pauli G. F, Bolton J. L, van Breemen R. N, Banuvar S, Shulman L, Geller S. E, Farnsworth N. R. Evidence-based herbal medicine: challenges in efficacy and safety assessments. In: Leung P. C, Fong H. H. S, Xue C. C, editors. Annals of Traditional Chinese 8. World Health Organization. WHO Guidelines on Good Manufacturing Practices (GMP) for Herbal Medicines. Geneva: World Health Organization; 2007. 9. Fong H. H. S, Pauli G. F, Bolton J. L, van Breemen R. N, Banuvar S, Shulman L, Geller S. E, Farnsworth N. R. Evidence-based herbal medicine: challenges in efficacy and safety assessments. In: Leung P. C, Fong H. H. S, Xue C. C, editors. Annals of Traditional Chinese Medicine Vol 2: Current Review of Chinese Medicine. Singapore: World Scientific; 2006. pp. 11–26. 10. WHO, 2000. General Guidelines for Methodologies on Research and Evaluation of Traditional Medicine, World Health Organization, Geneva 2000:9-17. 11. CONSORT 2010 Statement, Published online March 24, 2010 Webappendix (available at www.consort-statement.org), access Jan 11, 2012. 12. Chadwick L, Fong H. H. S. Herb quality assurance and standardization in herb-drug interaction evaluation and documentation. In: Lam Y. W. F, Huang S. M, Hall S. D, editors. Herbal Supplement-Drug Interactions. New York: Taylor & Francis; 2006. pp. 191–203. 13. World Health Organization. WHO Guidelines on Good Agricultural and Collection Practices (GACP) for Medicinal Plants. Geneva: World Health Organization; 2003.
International Seminar Pokjanas TOI 73 Faculty of Pharmacy Pancasila University ISBN : 978-602-72418-2-4
Identification of Soursop Seeds (Annona Muricata L.)Extract as A Candidate Against The Aedes Aegypti L. Musquito Vector Control DBD
SARAH ZAIDAN, RATNA DJAMIL, SITI NURAINI
Faculty of Pharmacy, Pancasila University Jln. Srengseng Sawah Jagakarsa, Pasar Minggu, Jakarta Selatan 12640.
Abstract: Aedes aegypti L. mosquitos are the disease vectors of dangue hemorrhagie fever (DHF), caused by dengue virus which is transmitted by Ae. Aegypti mosquito. The effort to control Ae. aegypti vector have been done in so many times, including chemical, physical, and biological control method. Multilevel extraction by kinetic maceration have been done with soursop seeds (Annona muricata L.) with the solvent of n-hexane, ethyl acetate and 70% of ethanol. Subsequently, the obtained extract is tested phytochemical screening along with the powder and larvicidal activity against Ae. aegypti. The results of phytochemical screening of the powder and 70% ethanol extract of soursop seeds have obtained the compound of saponin, triterpenoid and coumarin. In the n-hexane extract have obtained triterpenoids and in ethyl acetate extract which is found triterpenoids and coumarin. Based on the activity test against the larva of Ae. aegypti from n-hexane extract, ethyl acetate and ethanol 70% of soursop seeds sequentially, show LC50 values were about 198,610 ppm, 74,798 ppm and 67,042 ppm. Soursop seeds extract that has the highest activity is 70% ethanol extract. These are indicate that the chemical compounds which is found in soursop seeds have a potential as a larvicides.
Keywords:Aedes aegyti L., Annona muricata L., soursop seeds, larvasida.
INTRODUCTION
Mosquitoes are insects that are often found in tropical countries such as Indonesia. Besides disturbing human life, the presence of mosquitoes act as vectors of some diseases. In Indonesia, a disease transmitted by mosquitoes is still a health problem because of the high mortality rate caused. Some diseases transmitted by mosquito vectors such as filariasis, malaria and dengue fever (DBD)(1,2). Aedes aegypti L. mosquitoes are diurnal, or active during the morning and afternoon. Ae. aegypti mosquitoes carrying dengue virus causes dengue which is obtained from infected individuals and multiply in the body and the salivary glands of mosquitoes (2). Dengue disease not only in children but in all ages. DBD becoming known in Indonesia in 1968 in Surabaya and Jakarta, and then continue to expand as the spread of dengue endemic area. The number of cases of dengue and widely spread is increasing along with the increasing mobility and population density. There are 150,000 cases of dengue in 2007 and continued to increase until 2010. In addition, WHO reported more than 35% of the population living in urban areas affected by the disease. Until now there is no specific vaccine to treat dengue fever, and the only control vector for controlling the spread of the disease(2, 3, 4, 5). Vector control mosquitoes until today, still put emphasis on the use of insecticides, for example, is a synthetic larviciding. Larvicides in general have a higher efficacy and the results can be seen quickly. The use of continuous and repetitive can cause environmental pollution and resistance against the target organism. This encourages biological larviciding as controlling mosquito vectors (Biolarvasida). These biological larvicides are safer for humans, readily available and environmentally friendly(2, 6). Biological larvicides useful for the improvement of local natural resources. Local plant as a potential biological larvicides generally from families Annonaceae, including soursop (Annona muricata L.). Empirically, it has been much research done on the soursop as larvicides. The plant parts are potentially as larvicides are seed (semen)(7). Soursop seed (with shell beans) have larvicidal activity against Ae. 6, 8 aegypti with LC50 value of 244.27 ppm for the ethanol extract of the seeds of soursop . In addition, Ward et.all, reported that seeds of soursop and sugar apple seed (without seed coat) effect on mortality Chrysomya bezziana fly larvae(9, 10). International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 74
ISBN : 978-602-72418-2-4
The main active compounds from the seeds of the soursop is annonacin and squamocin belonging asetogenin compound. Squamocin annonacin compound of the family Annonaceae and is reported to have toxicity properties are quite effective against insects of the order Diptera (Ae.aegypti L.) which are cytotoxic, and neurotoxic. Asetogenin compounds can inhibit the action of the enzyme NADH in the mitochondria, causing the death of larvae, as well as toxic contact and stomach poison to insects(6, 9, 10). This research is continuing efforts to obtain biological larvicides. In this study, conducted Qualitative identification through screening phytochemicals and seen the activity of seed extracts of soursop (Annona muricata L.) (without seed coat) against Ae. aegypti. Extract obtained from extraction method using a multi-storey penyari with different polarities ie n-hexane, ethyl acetate and ethanol 70% and seen the highest larvicidal activity of the three fractions of the extract. Extract larvicidal activity test using 11 Standard Methods of Pesticide Efficacy Testing Households and Vector Control . The data seen LC50 values were obtained by probit analysis using Probit Analysis Program Epa Used For Calculating LC / EC Values Version 1.5.
MATERIAL AND METHODS
MATERIAL. Soursop seeds (Annona muricata L.) were obtained from Balitro (Research Institute for Spices and Medicinal Plants) Cimanggis, Bogor. Determination at Bogoriense Herbarium, Research Center, LIPI Cibinong , Bogor. Extraction. Seed Soursop (Annona muricata L.) which have been dried in the sun was directly crushed and blended into a fine powder. Powdered crude drug was extracted by maceration kinetic in stages using different solvent polarity is n-hexane, ethyl acetate, and ethanol 70% at room temperature until the extracted perfectly, then filtered with cotton and proceed with filter paper, pulp, and each extract n -heksan, ethyl acetate, and ethanol is 70% separated. Each extract was concentrated by vacuum rotary evaporator at a temperature of 450 C to obtain a viscous extract n-hexane, ethyl acetate and ethanol 70%. Identification with phytochemical screening. Phytochemical screening performed on pollen and seed extract of soursop with Farnsworth method in Biological and phytochemical screening of Plant seed sirsakdilakukan to identify the qualitative content of secondary metabolites in seed soursop. Flavonoids. 2 grams of powder simplisia or 0,67 g of n-hexane extract and ethyl acetate extract; 0.15g of extract ethanol 70% boil with 100 ml of hot water for 5 minutes, then filtered with filter paper, 5 mL filtrate of extract solution coupled with a bit of powdered zinc or magnesium and 1 mL of 2 N HCl and 5 mL amyl alcohol . Flavonoids compounds would pose orange to red(12) . Saponins. Entering 10 ml sample into a test tube and shake for 30 seconds and observe what happens. If the foam is formed solid (not lost for 30 seconds) the identification showed the presence of saponins(12). Coumarin. 2.12 grams of powder simplisia or 0.67 g of n-hexane extract and ethyl acetate extract; 0.15g of extract ethanol 70% included in the test tube and add 10 ml of chloroform, heated 20 minutes on waterbath is then cooled. After it is filtered with filter paper, the filtrate waterbath until dry. The residue was added 10 mL of hot water, then cooled and put into a test tube, add 0.5 mL of 10 % ammonia solution and then observed under UV light at a wavelength of 365 nm (blue or green fluorescence showed the presence of cumarin(12). Volatile oil. 2 of powder simplicia and 0.67 g extract put into a test tube, then added 10 mL of petroleum ether, at the mouth of the tube fitted with a mouthpiece that has given cotton that has been moistened with water, then heated above waterbath10 minutes after the cold water and filtered with a filter paper. The Obtained filtrate is evaporated in the vaporizer cup, the residue is dissolved in 5 mL ethanol and then filtered with filter paper. If residues smelling aromatic indicate a of compounds volatile oils(12). Kuinon. 5 ml of solution experiments inserted into a test tube, add a few drops of 1 N sodium hydroxide solution, Occurs in red indicate a compounds of quinine(12). Steroids/Triterpenes. 1.10 grams of powder or soursop seed extract: 0.33 g extract of n-hexane; 0.34 g of ethyl acetate extract; 0.67 g of ethanol extract 70% extract, macerated with 20 mL eter for 2 hours, then filtrated the solution, and A total of 5 mL of the extract solution evaporated to dryness, then added with a reagent Lieberman- Burchard. green - red color arising indicates compounds terpenoids or steroids(12).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 75
ISBN : 978-602-72418-2-4
Tannin. 2 grams of powder simplisia or 0.67 g of n-hexane extract and ethyl acetate extract; 0.15g of extract ethanol 70% added 100 mL of water, boil for 15 Minutes, cooled and filtered. divided to each 5 mL filtrate (reaction tubes) : Added a few drops of solution of iron (III) chloride 1 %, Changes blue or blackish green and Added a few drops of 1 % solution of gelatin to form white precipitate indicates the compounds of tannins . To 5 mL Second filtrate was added 15 mL reagent Stiasny (formaldehyde 30% - hydrochloric acid = 2:1), the precipitate formed pink color indicates the presence of tannins katekuat. Subsequently the precipitate is filtered, the filtrate who saturated with sodium acetate powder, add a few drops of solution of iron (III) chloride 1 %, occurred in blue ink Showed the presence of tannins galat(12). Alkaloids. 2.12 grams of powder simplisia or 0.67 g of n-hexane extract and ethyl acetate extract; 0.15g of extract ethanol 70% is inserted in a porcelain bowl and then add 5 mL of ammonia 30% crushed and then added 20 mL chloroform and crushed again, then filtered. The filtrate obtained was added HCl 1 N as much as 5 ml and then separated into 2 sections namely A and B. The filtrate A coupled with Mayer reagent, filtrate B coupled with Dragrendroff reagent. With reagent Meyer gives a white precipitate, and Dragendorff reagent give an red brick precipitate(12). Larvasidal activity test. Larvae Maintenance. Mosquito eggs incubated in a plastic container (tray) measuring 20 x 15 x 10 cm3yang containing distilled water. The eggs will hatch within 24 hours of becoming the first instar larvae, then the 2nd day will have become instar II stage of development, at this stage larvae fed chicken liver, then after 1-2 days will be changed again to the third instar. Implementation of Experimental Test larvicidal activity. Larvicidal activity test was conducted using ”Pesticide Efficacy Testing Standards Household and Vector Control”. Carefully weigh approximately 100 mg extract and then dissolved in 100 mL of of solvent. This solution is a mother liquor (1000 ppm). The mother liquor 18.750 ml pipette; 12.500 mL; 6.250 mL; 3.125 mL; 1.250 mL respectively inserted into plastic cups that have ditara 25 mL to obtain a concentration of 750 ppm, 500 ppm, 250 ppm, 125 ppm, 50 ppm, then evaporated completely. Each concentration was made in 3 plastic cups (triplo), then into individual plastic cups partially added to 25 mL of distilled water homogenkan, and included 20 third instar larvae of Ae. aegypti. Observations were made after 24 hours of exposure to the test solution and counted the number of larvae were dead and stated in the presentation of death. Negative controls only solvent without the extract, in the same way. Positive controls carried out on Temephos 1 ppm. Data Processing Methods. Test data processing is done systematically using probit analysis method. Probit analysis is used to determine the percentage of larval mortality LC50 of Ae. aegypti L. uses Epa Probit Analysis Program Used For Calculating LC/EC Values Version 1.5. In Epa Probit Analysis Program Used For Calculating LC/EC Values Version 1.5. the data entered is the relationship with the concentration of the value of the average percentage mortality of larvae of Ae. aegypti.
RESULT AND DISCUSSION
Phytochemical Screening. The phytochemical screening via Farnsworth method was conducted using powder of simplicia and Soursop seeds and sugar-apple seeds extract. In powder and extract having metabolite compound such as saponin, triterpenoid, and cumarin. The result of phytochemical test is shown in Table 1. Table 1. Result of phytochemical screening of Soursop seeds (Annona muricata L.) and sugar- apple seeds (Annona squamosa L.) powder and extract.
No Secondary Simplicia Ethanol 70% Ethyl acetate N-heksan Metabolites powder Extract Extract Extract 1. Alkaloids - - - - 2. Flavonoids - - - - 3. Saponins + + - - 4. Kuinon - - - - 5. Tannin - - - - 6. Steroids / - /+ - / + - / + - / + triterpenoids 7. Volatile oil - - - - 8. Coumarin + + + - Notes : + = giving positive reaction − = giving negative reaction International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 76
ISBN : 978-602-72418-2-4
In Table 1 it can be seen that the results of the qualitative identification of secondary metabolite content of the seed powder soursop (Annona muricata L.) by means of screening phytochemical compounds derived class of saponins, triterpenoids, and coumarin. In the n-hexane extract obtained compound class of triterpenoids. At the ethyl acetate extract obtained triterpenoids groups and coumarin compounds. While the 70% ethanol extract derived class compound saponin, triterpenoids, and coumarin. Larvicidal Activity Test. Larvicidal activity test extract n-hexane, ethyl acetate, and ethanol 70% seed soursop done by the method of “Pesticide Efficacy Testing Standards Household and Vector Control” for mosquito larvae Ae.aegypti L. larvae used test is the third instar larvae of mosquitoes Ae.aegypti because has a fairly good resistance against external environment and durability stronger mechanically when the transfer of the larvae, and have a long time to turn into adult mosquitoes. Test solution at a concentration of 50, 125, 250, 500 and 750 ppm generated triplo, then put 20 third instar larvae of Ae. aegypti L. and counted the number of larvae mortality after 24 hours of observation. Negative controls only the solvent used and Temephos (larvicidal commonly used) as a positive control.
Table 2. The average percentage mortality of larvae of Ae. aegyptiL. extract after exposure to n-hexane, ethyl acetate and ethanol 70% soursop seeds on a 24-hour observation.
% Mortality Concentration (ppm) Type Solvent Control n-hexane Ethyl acetate Ethanol 70% Negative Positive (Solvent) (Temephos 1 ppm) 750 93.35 95 100 0 100 500 78.35 88.35 100 0 100 250 50 73.35 98,35 0 100 125 20 65 58,35 0 100 50 15 40 45 0 100 LC50 (ppm) 198.610 74.798 67,042 - - Linear a = -115.7371 a = -34.9054 a = -43.2775 regression b = 70.9888 b = 45.5671 b = 52.5234 - - r = 0.9654 r = 0.9926 r = 0.9302
The results showed that the larvae of Ae. aegypti exposed seed extract of soursop (without skin) for 24 hours to come LC50 ie, n-hexane extract of soursop seeds of 198.610 ppm, ethyl acetate extract had LC50 values of 74.798 ppm and 70% ethanol extract of the seeds of the soursop has a value of 67.042 ppm LC50. This shows that the 70% ethanol extract of soursop seed having the highest activity as larvicides. This study can be interpreted that the seed extract of soursop (without skin) also has larvicidal activity. This can be caused by secondary metabolites contained in the soursop seed saponin, coumarin suspected triterepenoid and potentially as larvasida(13). Saponins allegedly able to diffuse into the cuticle layer of larvae that can damage cell membranes and toxic compounds can be entered and off the larvae. Saponins have a bitter taste and sharp and can cause irritation of the stomach. Larvae digestive tract, particularly the midgut (midgut) is the major site of absorption of nutrients and digestive enzymes seksresi. Saponin absorption into the intestine larvae can inhibit the action of digestive enzymes and cause damage to the cells in the channel pencernaan(14). Triterpenoids also thought to be as antifeedant on the larvae so that the larvae loss of appetite, this led to the loss of energy and development of larvae will be hampered even can cause mortality15. In addition, coumarin is also reported as larvicides because potentially able to change the detoxification ability to reversibly or irreversibly inhibit the enzyme cytochrome P45016.Dari third ability of secondary metabolites in seed soursop concluded that sugar apple seeds potentially sebagaii larvicides against mosquito larvae Ae. aegypti L. Mortality of larvae on seed extract of soursop seeds (Annona muricata L.) allegedly also because of the effects of the component compounds acetogenin toxic squamosin contact. Where after the larvae exposed to International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 77
ISBN : 978-602-72418-2-4 the extract, the compound into the body of Ae. aegypti through physical contact and the case of death of the larva. Prijono (1994) in Ward et.al (2005) states that the absorption of toxic insecticides contact occurs largely in the cuticle. Active compounds will penetrate into the insect's body through the part that is covered by a thin cuticle, such as membrane between segments. The ability of the compound asetogenin stomach poison works by absorption seyawa on soursop seed extract into the wall fosfolirasi larvae and able to inhibit oxidative chain so that the cell respiration is inhibited activity of Ae. aegypti because of breathing stopped. Squamocin compounds in the seeds of soursop allegedly able to diffuse from the thin cuticle layer to spread throughout the body Ae. Aegypti through hemolimfa flow(17). Mortaitas larvae of Ae. aegypti showed signs as follows: larvae do not move when touched, bodies pale white larvae, elongated body shape or kaku1. The color can be seen more clearly with the aid of a stereo microscope and optilab. Differences larvae of Ae. aegypti normal and who have died can be seen in Figure 1. .
A B Figure 1. The third instar larvae of Ae. aegypti normal (A); and third instar larvae of Ae. aegypti die (B)
Figure 2. Graph average percentage mortality soursop seed extract on a 24 hour observation (x-axis:% average mortality of larvae and the y-axis: concentration soursop seeds extract (ppm)).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 78
ISBN : 978-602-72418-2-4
From Figure 2 shows that the higher the concentration of soursop seed extract, the higher the death rate of Ae. aegypti L. The solvent n-hexane, ethyl acetate and 70% ethanol and distilled water as a negative control test the same activity against larvae of Ae. aegypti, and the results obtained all the larvae do not occur death. This indicates that the solvent does not affect the mortality of larvae. Temephos as a positive control, in which the larvicidal activity at a concentration of 1 ppm trials have demonstrated 100% mortality against larvae of Ae. aegypti L.
CONCLUSION
Based on the results of phytochemical screening of the seeds of soursop (Annona muricata L.) obtained by the content of secondary metabolites. The test results with the larvicidal activity and data analysis has been done, it can be concluded that the 70% ethanol extract of the seeds of the soursop has the highest activity as larvicides against Ae. aegypti L. with LC50 values of 97, 462 ppm.Ethanol 70% extract of the seeds of soursop (Annona muricata L.) has a good chance to be used as biological insecticides to control mosquito larvae that are environmentally friendly.
REFERENCES
1. Kaihena M, Vika L, Maria N. Efektivitas ekstrak etanol daun sirih (Piper betle L) terhadap mortalitas larva nyamuk Anopheles sp dan Culex . Molluca medica. ISSN: 1979-6358 2. Susanti PD, Danang B, Dini S, Susilawati. Penggunaan ekstrak kulit kayu gemor (Nothaphoebe coriacea K.) sebagai larvasida hayati terhadap tingkat mortalitas jentik nyamuk Aedes aegypti serta dampaknya pada kualitas air hujan. ISSN 1978-8096. 2013;9:117–22. 3. Hadi, Upik Kesumawati. Penyakit tular vektor: demam berdarah dengue. Bogor: Fakultas Kedokteran Hewan IPB. 2005 4. World Health Organization. Dengue: guidelines for diagnosis, trearment, prevention and control, new edition. Swiss. 2010. h.5. 5. Palgunadi BU, Asih Rahayu. Aedes aegypti sebagai vektor penyakit demam berdarah dengue. Surabaya: Universitas Wijaya Kusuma. 2011. 6. Rosmayanti, Kiki. Uji efektivitas ekstrak biji sirsak (Annona muricata L ) sebagai larvasida pada larva Aedes segypti instar III/IV (skripsi). Jakarta: Fakultas Kedokteran Dan Ilmu Kesehatan Universitas Islam Negeri Syarif Hidayatullah. 2014. 1-3, 16-17, 37-40. 7. Mulyawati AP, Hayati EK, Nashihuddin A, Tukimin. uji efektivitas dan identifikassi senyawa ekstrak biji sirsak (Annona muricata Linn.) yang besifat bioaktif insektisida nabati terhadap hama thrips. Alchemy 2010;2(1): 104-1575. 8. Taslimah. Uji efikasi biji srikaya (Annona squamosa L.) sebagai bioinsektisida dalam upaya integrated vector management terhadap Aedes aegypti (skripsi). Jakarta: Fakultas Kedokteran Dan Ilmu Kesehatan Universitas Islam Negeri Syarif Hidayatullah. 2014. h.1-6, 23-28,76-81. 9. Wardhana A.H, Amir H, Muharsini S, dan Yuningsih, Veteriner BP. Uji Keefektifan Biji Sirsak (Annona muricata) dan Akar tuba (Derris edliptica) terhadap Larva Chrysomya bezziana secara In Vitro. 2006; 1013-1017. 10. Wardhana AH, Amir H, dan J Manurung, Veteriner BP. Uji efikasi ekstrak heksan daging biji srikaya ( Annona squamosa L ) terhadap pertumbuhan larva lalat Chrysomya bezziana secara in vitro. 2004. 134-142. 11. Departemen Pertanian Indonesia. Metode standar pengujian efikasi pestisida rumah tangga dan pengendalian vektor. Direktorat Pupuk dan Pestisida dan Direktorat Jenderal Prasarana dan Sarana Pertanian Kementrian Pertanian. 2012.h.20-23
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 79
ISBN : 978-602-72418-2-4
12. Farnsworth NR. Biological and phytochemical screening of plants. Journal of pharmaceutical, Sci. 1966. (55). No 3. 13. Riswanto S. Uji Efektivitas Pestisida Nabati terhadap Hama Spodoptera litura (Lepidoptera: Noctuidae) pada Tanaman Tembakau (Nicotiaana tabaccum L.). Medan: Universitas Sumatera Utara. 2009.20-23. 14. Susilowati D, Rahayu MP, Prastiwi R. Efek Penolak Serangga (Insecct Repellent) dan Larvasida Ekstrak Daun Jeruk Purut (Citrus hystrix D. C.) terhadap Aedes aegypti. Surakarta:Fakultas Farmasi, Universitas Setia Budi. 15. Nopitasari. Uji Aktivitas Ekstrak Biji Langsat (Lansium domesticum Cor.) sebagai Larvasida Aedes aegypti. Universitas Tanjungpura. 2013. 12-14. 16. Venugopala KN, Raquel MG, Kabange K, Bandar EA, Mahesh VA, Bharti O. Evaluation of halogenated coumarins for antimosquito properties. Hindawi Publishing Corporation The Scientific World Journal, Vol. 2014, 4. 17. Wardhana A.H, Amir H, dan J.Manurung, Veteriner BP. Efektifitas ekstrak biji srikaya (Annona squamosa L ) dengan pelarut air , metanol dan heksan terhadap mortalitas larva caplak boophilus microplus secara In Vitro. 2005.134–42.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 80
ISBN : 978-602-72418-2-4
Antimicrobial and Biology Activity from Extract Herbs Parasite Soursop (Dendropthoe pentandra L.)
ERLINDHA GANGGA*, LIA KARTIKA SARI
Faculty of Pharmacy Pancasila University, Jl Srengseng Sawah, Jakarta 12640.
e-mail: [email protected]
Abstract: Parasite of Soursop (Dendropthoe pentandra L.) is one of many plants that grow in Indonesia.Indonesia is a country who has a many plants of drugs, where the plant has been used since the time of our ancestors to cure various diseases. The parts of the plants used leaves, rods, roots or whole plant. Besides that parts, the people also used Loranthus for medicine. Loranthus is a plant parasite and a half parasite or substances that still have green leaves (chlorophyll) used for the assimilation process. In addition parasite also absorb the food from its host plant, so the loranthus has the same activity with host plants. The species of loranthus usually used is the parasite of the species Dendropthoe pentandra which grows on a soursop. hosts. Parasite of soursop plants has been cleaned from dust and then dried in powder. The powder and the extract herbal parasite soursop conducted phytochemical screening.After that, did the antimicrobial activity by diffusion methode and the biological activity test (LC50) used the BSLT method. In testing the antimicrobial activity of Escherichia coli and Staphylococcus aureus from ethyl acetate and methanol extracts retrived power resistor from concentration 2,43.10-3%. The activity results of Candida albicans from n-hexane, ethyl acetate and methanol extract had retrived inhibitory from concentration 28.14%. The biological result used the BSLT method in soursop loranthus showed that methanol extract has a high (LC50) activity is 21.22 ppm; 510.07 ppm from n-hexane extract and ethyl acetate extract of 87.78 ppm.
Keyword : Herbs parasite of soursop (Dendropthie pentandra L.), biology activity methode, diffusion methode Escherichia coli, Staphylococcus aureus ,Candida albicans
INTRODUCTION
Indonesia is a rich country of biological resources and known as one of the larger mega biodiversity in the world. Indonesia has about 17% species from all around the world. Large tropical forest with biological diversity is natural resources which is priceless. And known as a warehouse of herb, Indonesia has a nickname as live laboratory. Parasite of Soursop ( Dendropthoe pentandra L.) is one of many plants that grow in Indonesia has been used empirically as medicinal plant which is a herbaceous that can be grown easilyon tropical land. According to literature this plant containing highly Flavonoid, saponine, alcaloid, tanine, amino acid, lorantilalkohol, kholin, and fat. To get the biological activity test (LC50) and antimicrobe Parasite of Soursop ( Dendropthoe pentandra L.) using extraction was done by maceration with ethanol 70 % , and partitioned gradient started from n – hexan, ethyl acetat, and n- buthanol . after that the extracts were done phytochemical screening method biological activity (cytotoxic ) with BSLT method and antioxidant activity with DPPH free radical scavenging.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 81
ISBN : 978-602-72418-2-4
MATERIAL AND METHODS
MATERIAL. Parasite of Soursop ( Dendropthoe pentandra L.), n–hexan, ethyl acetat, Methanol, shrimp larvae (Artemia salina Leach), NaCl. Escherichia coli, Staphylococcus aureus, dan Candida.
METHODS. Extraction was done by maceration with started from n–hexan, ethyl acetat, and n- methanol . after that the extracts were done phytochemical screening method , biological activity with BSLT method and antimicrobial activity with. Research Stages. 1.Sample preparation 2. Extract forming and fractionation 3. Phytochemical screening 4. Toxicity Test 5. Antimicrobial Activity Test Extract Forming and Fractionation. As much as 300.1 g kelor leaf ( Moringa oleifera Lamk L.) leaf powder was placed in a jar, then maceration with ethanol 70 % and partitioned gradient started from n-hexane, saturated ethyl acetate, and n- butanol. Rotavapor was used to saturate the filtrate until thick extract formed. The waste was then thrown. Phytochemical Screening. Content identification of kelor leaf’s secondary metabolite was done using fresh leaf and thick extract of n-hexane, ethyl acetate, and methanol, which include: 1. Alkaloids identification, 2. Flavonoid identification, 3. Saponin identification, 4. Tannin identification 5. Kuinon identification 6. Steroid / triterpenoid identification 7. Aetheric oil identification 8. Coumarin identification. Cytotoxic Test. Writer chose BSLT (Brine Shrimp Lethality Test) method for cytotoxic test using natural ingredients of shrimp larvae (Artemia salina Leach) and sea water as the media. All substances were tested three times in a vial of 5mL sea water and 10 larvae. Observation was done after 24 hours, the data was analyzed to get LC50 using probit analysis. The next step was placing ± 20mg of Artemia salina Leach.’s egg inside the hatching container filled with synthetic sea water. The sea water was prepared by weighing 38 g salt without iodine and dissolve it with 1L of water, then filter it with Whatman paper and radiate it with 18 watt lamp. After 24 hours, hatched egg became nauplii and relocated to other place. After the next 24 hours, nauplii is ready to be used as a test animal. Antimicrobial Test. Anti-microbial assay was done by diffusion using paper disc with 6 mm diameter. The paper disc contains anti-bacterial substance and then placed in the jelly’s surface which has been inoculated and incubated at 37°C for 18-24 hours. Activities decided by the blocked zone which formed by the clear zone around the anti-bacterial substance. Other than diffusion, this research also used positive control chloramphenicol and amphotericin B. Chloramphenicol has anti-microbes spectrum activities for both Gram Positive Bacteria and Gram Negative Bacteria, and has bacteriostatic characteristic where it blocked microbes’ protein synthesis. Amphotericin B also has similar characteristics where it served as wide spectrum anti-fungus.
RESULT AND DISCUSSION
Phytochemical Screening Result. Results from the phytochemical screening powder of Parasite of Soursop (Dendropthoe pentandra L.) and the extract n- hexan,aetyl acetat, methanol showed that the herbs powder contained, flavonoid, saponine, tannin, quinon and steroid, where as n-hexane extract contained steroide, and ethyl acetate extract contained, flavonoide, tannin, steroide,. Furthermore, methanol extract contained flavonoide, saponine, tannin and quinon
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 82
ISBN : 978-602-72418-2-4
Table 1. Phytochemical screening result.
No Compound Herbs Powder n- Hexane Ethyl acetate Methanol 1. Alkaloid - - = - 2 Flavanoid + - + + 3 Saponine + - - + 4 Tannine +/- - +/- +/- 5 Quinon + - - +
6 Steroide/ +/- +/- +/- +/- triterpenoide 7 Volatile oil - - - - 8 Coumarine - - - -
Table 2. Cytotoxic test by BSLT method.
E LC Extract 50 Value( ppm)
n- Heksan 510.07
Ethyl Acetat 87.78
Methanol 21.22
Ekstrak Nilai IC50 ( bpj )
Table 3. Antimicrobial activity.
NO Extract Microbe Escherichia colli Staphylococcus aureus Candida albicans 1 n- Hexane Negative Negative Positive 2 Ethyl acetate Positive Positive Positive 3 Methanol Positive Positive Positive
CONCLUSION
1. Flavonoid, saponin, tannine, steroid and coumarin compound were found from phytochemical screening of herbs powder and Parasite of Soursop (Dendropthoe pentandra L.). 2. Cytotoxic test by BSLT method found that thick methanol extract has the highest toxicity level of LC50 21.22 ppm, ethyl acetate extract of 87.78 ppm and n-hexane extract of 501, 07 ppm, 3. Antimicrobe activity test found that methanol extract has, ethyl acetate extract has activities to Escherichia coli, Staphylococcus aureus, and Candida albicans and has anti-microbes spectrum activities for both Gram Positive Bacteria and Gram Negative Bacteria, and anti fungus (broad spectrum ), n-hexane extract has activities to Candida albicans and has anti microbes/ anti-fungus only.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 83
ISBN : 978-602-72418-2-4
REFERENCES
1. Meyer BN, et. al. Brine shrimp: a convenient general bioassay for active plant constituens. Planta medica. Volume 45. 1982. h. 31-4. 2. Famsworth, NR. Biological and phytochemical screening of plant 55(3). J Pharm. Sci; Chicago. 1985. h. 28-58. 3. Jawetz E, Melnick JL, Adelberg EA. Mikrobiolog kedokteran. Edisi 20. Alih bahasa Nugroho E, Maulany RF. Jakarta: Penerbit Buku Kedokteran. 1996. h. 153-64, 177-78, 238-9, 245.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 84
ISBN : 978-602-72418-2-4
Antioxidant, Cytotoxic and Apoptotic Induction Activity of Ethanolic Extract of Andrographis paniculata on Mcf-7 Cancer Cell Line
CHURIYAH*, KURNIA AGUSTINI AND SISKA ANDRINA KUSUMASTUTI
Center for Pharmaceutical and Medical Technology Agency for the Assessment and Application of Technology (BPPT) LAPTIAB Building 611, Puspiptek area Serpong, Tangerang – Selatan. Telp/Fax: +62-21-7560536, email: [email protected]
Abstract: Andrographis paniculata is usually used as a traditional medicine to treat various diseases including cancer . The research purposes was to evaluate the antioxidant activity of the ethanolic extract of A. paniculata and also to evaluate the cytotoxic and apoptotic induction activity of this extract against breast cancer cell line MCF-7. Cytotoxic activity of the extract was performed using enzymatic reaction of 3-(4,5- dimethylthiazoyl-2-yl) 2,5 diphenyltetrazolium bromide (MTT) method and the anti oxidant-activity was determine relatively to 1,1-diphenyl-2-picrylhydrazyl (DPPH) acivity, and further apoptotic cell was determined by flowcytometry using Propidium Iodide (PI). The radical scavenging activity resulted from the antioxidant assay using DPPH methods showed that ethanolic extract of A. paniculata gave very low activity with IC50 value was 201.95 µg/ml compared to the positive control of α-tocopherol with its IC50 value was 41.58 ppm. The cyototoxic analysis using MTT method indicated that the its extract exhibited toxic effect on MCF-7 cell line with IC50 value was 111.37 µg/ml and in its concentration induced apoptotic cell about 64% by flow cytometry analysis. A. paniculata extract can be developed as a potential anticancer agent for breast cancer deseases.
Keyword : A. paniculata, antioxidant, cytotoxic, apoptotic, MCF-7 cell.
INTRODUCTION
Apoptosis is a mechanism of cell death for the purpose of maintaining a stable cell population and plays an important role in tumorigenesis. Inhibition of apoptosis results in uncontrolled growth, such as occurs in the development of malignancy. The induction of apoptosis, which is not accompanied by an inflammatory reaction, is one of the strategies has been developed for cancer therapy(1). There are various studies emphasizing that free radicals contribute to the development of many diseases, including tumor promotion and carcinogenesis. Antioxidants are substances that play an important role in delaying or preventing degenerative diseases caused by oxidative damage of living cell components or by free radicals(2). Andrographis paniculata (Burm. F) Nees, is an herbaceous plant belonging to the Acanthaceae and is found throughout tropical and subtropical Asia, Southeast Asia, Indonesia and India. Extracts of this plant exhibit pharmacological activities such as immunostimulatory, antiviral and antibacterial. As major active constituent, andrographolide exhibits biological activities, including anti-inflammatory, antidiabetic and antitumor(3). Hydroalcoholic extract of A. paniculata increased the activities of antioxidant enzymes such as super oxide dismutase, catalase, glutathione peroxidase in rats(4), then ethanolic extrac was promising as antioxidant(5).
International Seminar Pokjanas TOI 85 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Andrographolide isolated from A. paniculata induced apoptosis of prostate cancer (PC-3) cells(6), also exhibited cytotoxic effect and induced apoptosis in HeLa cells(7) and breast cancer cell line T-47D(8). The A. paniculata extracts using different solvent, namely water, ethanol and acetone was reported that those extract indicated excellent cytotoxic effect against neuroblastima IMR-32 and human colon HT-29 cancer cell line(9). This research was purposed to determine antioxidant activity of the ethanolic extract of A. paniculata using DPPH scavenging method and also to evaluate the cytotoxic activity against breast cancer cell line MCF-7 by MTT method, followed with apoptotic cell analysis by flow cytometry
METERIALS AND METHODS
Extract preparation. The dried powdered of A. paniculata simplicia was extracted by macerating in ethanol solvent. Afterward the maserate was filtered, followed by evaporation using rotary evaporator until excess solvent was evaporated and obtained the viscuous extract. Antioxidant Assay Using DPPH Radical Scavenging Method. Free radical scavenging activity of extracts was measured by 1,1-diphenyl-2-picryl hydrazyl (DPPH). In brief, 500 µl of 0.1 mM solution of DPPH in ethanol was added to 1 ml of extracts in ethanol at different concentration (5, 10, 20, 50 and 100 μg/ml), it was shaken vigorously and allowed to stand at room temperature for 30 minutes, then the absorbance was measured at 517 nm using spectrophotometer. The positive control being used was α- tocopherol and the experiment was done in triplicate. The percent DPPH scavenging activity was calculated by following equation: DPPH scavenging activity (%) = (Abs DPPH-Abs sample)/Abs DPPH × 100, The IC50 value of the sample, which is the concentration of sample required to inhibit 50% of the DPPH free radical, was calculated using dose inhibition curve. Cytotoxic Activity Assay Using MTT Method. MCF-7 cells were cultured in 96-wells plates at a density of 5x104 cells/well. After 24 hours, the medium culture was discarded, cell then was treated with various concentrations (10, 20, 50, 100, 250 and 500 µg/ml) of the A. paniculata extract, and incubated for 24 hours. Next, the medium cultured were aspirated and 100 µl culture medium contain 0,5 mg/mL MTT was added, then the cell was incubated for 4 hours. Further 100 µl of 10% SDS 10% was added to stop the MTT reaction and dissolved formazan crystals, incubated overnight, than was measured at 570 nm using a multiwell plate reader. The IC 50 value of the sample, which is the concentration of sample required to inhibit 50% of cell viability was calculated using dose inhibition curve. Apoptotic Cell Assay Using Flow Cytometry. MCF-7 cells was plated in 24 well plates with density about 3 x 104 cells / well, incubated in 5% CO2 incubator at 37°C. After 24 hours, cell was treated with A. paniculata extract at a concentration equal to the IC50 value and incubated for 24 hours. Next, cell was harvested and centrifuged at 1500rpm for 5 minutes. After supernatant discarded, the pellet cell was fixed by 70% of EtOH for 15 minutes in the 4°C. Then cell was centrifuged at 1500 rpm for 5 min, and the pellet cell was stained by 50 µl Propidium Iodide (1mg of PI/ml of deionized water) in 450 µl PBS and incubated at room temperature in dark for at least 30 minutes, then was observed using flow cytometry.
RESULTS AND DISCUSSION
The result of free radical scavenging activity of A. paniculata extract and positive control of α–tocopherol by 1,1-diphenyl-2-picryl hydrazyl (DPPH)method (Figure 1A) indicated that the extract gave lower DPPH scavenging activity compared with positive control of α–tocopherol in the all of concentration treatments (5, 10, 20, 50 and 100 μg/ml). So as described in the IC50 value between extract and positive control, the IC50 value of A. paniculata extract (201.95 µg/ml) was much higher then IC50 value α-tocopherol (41.58 µg/ml ). Cytotoxic activity assay using MTT method showed that the effect of A. paniculata extract treatment in the cell viability was dose dependent, where the increasing extract concentration resulted in the lower cell viability (Figure 1B). The IC 50 value of the sample, which is the concentration of sample required to inhibit International Seminar Pokjanas TOI 86 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
50% of cell viability was calculated using dose inhibition curve, indicated that the A. paniculata extract exhibited toxic effect on MCF-7 cell line with IC50 value was 111.37 µg/ml. Whereas the IC50 value of control positive Doxorubicin was very low only 0.094 µg/ml (Table 1). Results of the Flow cytometry analysis of apoptotic cell induced by A. paniculata extract described in the cytogram (Figure2) indicated that in the IC50 value concentration of its extract (111.37 ug/ml) induced cell apoptotic about 64% (Table 1). Whereas, the control negative without any extract treatment nearly did not exhibit cell apoptotic only found about 5%, in the contrary the positive control of doxorubicin treatment gaved very hight percentage of apoptotic cell it was about 94% of total cell analyzed.
DPPH Scavenging Activity A. paniculata vs MCF-7 Doxorubicin vs MCF-7 120 120 80 100 100 80 80 60 60 60 40 40 40
20 viabiliy % Cell 20 20 0 viability % Cell 0 10 20 50 100 250 500 0 5 10 25 50 100 0,03 0,06 0,13 0,25 0,50 1,00 % radical scavenging activity activity scavenging % radical Extract Concentration (µg/ml) Extract concentration (µg/ml) Doxorubicin concentration (µg/ml) A. paniculata -Tocopherol α A B C
Figure 1. A = DPPH radical scavenging activity of A. paniculata extract and positive control α-tocopherol; B = cytotoxic activity of A. paniculata extract against MCF-7 cancer cell line. C = cytotoxic activity of doxorubicin against MCF-7 cancer cell line
A C B B Figure 2. Cytogram of MCF-7 cell treated and untreated with A. paniculata extract and positive control of doxorubicin A = the normal cell untreated with extract, B = the treated cell with A. paniculata extract and C = cell treated with positive control of doxorubicin.
Table1. The IC50 value of DPPH radical scavenging activity and cytotoxic activity by MTT assay of A. paniculata extract. No Antioxidant activity by Cytotoxic activity DPPH radical scavecging by MTT methode Extract IC50 (µg/ml) Exctract IC50 (µg/ml) 1 A. paniculata 201.95 A. paniculata 111.37 2 α-tocopherol 41.58 Doxorubicin 0.094
International Seminar Pokjanas TOI 87 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
Table 2. Apoptotic cell of MCF-7 cancer cell line induced by A. paniculata extract and positive control Doxorubicin compared with normal cell without any treatment. Total of cell % of Total of No. Cell Treatments analyzed apoptotic cell apoptotic cell 1 Normal cell (negative control) without any 250 5 4843 treatment 2 Cell treated with A. paniculata extract 4109 64 2522
3 Cell treated with positive control 2869 94 3039 Doxorubicin
The DPPH radical scavenging activity of A. paniculata extract were resulted in IC50 value of A. paniculata extract (201.95 µg/ml) much higher then positive control α-tocopherol (41.58 µg/ml ). Previous research also reported similarly, that 200 µg/ml of its extract inhibited DPPH radical scavenging activity only about 28.74%(10). Cytotoxic activity assay using MTT method showed that the IC50 value of the A. paniculata extract (111.37 µg/ml) was lower than positive control doxorubicin (0.094 µg/ml). Then other research reported that this extract showed IC50 value for neuroblastima IMR-32 and human colon cancer HT-29 cell lines was 200 μg/ml(9). Interestingly, previous research reported that its extract did not exhibit any toxic in human (2) normal lung fibroblast cell line (Hs888Lu) with highly IC50 value about 500 µg/ml . Fluorescent labelling is the suitable method for apoptotic analysis, through observe the morphological and biochemical change of apoptosis for differentiate of normal, apoptotic, and dead cells, or cell cycles. Cell Apoptosis assay using PI provides a rapid and convenient method for apoptosis analysis observed by flow cytometry, cell DNA is degraded by endogenous nuclease activated and diffuse out of cells with the process of apoptosis. A highly definable sub-G1 peak occurred is easily quantified by PI(11). Using this method, A. paniculata extract could induced apoptotic cell relatively high about 64%, whereas the percentage of apoptotic cell in the negative control without any extract treatment only 5% of the total cell analyzed. This research concluded that A.paniculata extract exhibit lower antioxidant activity compared with α- tocopherol, but this extract showed excellent anticancer activity. So, it could be develop as potential anticancer through apoptotic induction pathway. Further research was needed to observe the molecular mechanism of apoptotic induction and the cytotoxic effect of its extract on normal cell to obtaine the selectivity of its extract against cancer cell.
REFERENCES
1. Nugrahaningsih, Sarjadi, Dharmana E, Subagio HW. Andrographis paniculata extract induced apoptosis of adenocarcinoma mammae in C3H mice. Univ Med. 2013. Vol.32 - No.2: 99-107 2. Qader SW, Abdulla MA, Chua LS, Najim N, Zain MM, Hamdan S. Antioxidant, total phenolic content and cytotoxicity evaluation of selected malaysian plants. Molecules. 2011. 16: 3433-3443; Doi:10.3390/molecules16043433 3. Jayakumar T, Hsieh CY, Lee JJ, Sheu JR. Experimental and clinical pharmacology of Andrographis paniculata and its major bioactive phytoconstituent andrographolide. Evidence-based complementary and alternative medicine. Volume 2013. Article ID 846740, 16 pages.
International Seminar Pokjanas TOI 88 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
4. Ojha SK, Nandave M, Kumari S, Arya IDS. Antioxidant activity of Andrographis paniculata in ischemic myocardium of rats. Global Journal of Pharmacology. 2009. 3 (3): 154-157. 5. Vijayakumar AD, Kalaichelvan, PT. In vitro antimicrobial and antioxidant activity screening of andrographis paniculata leaf ethanolic extract in Tamil Nadu. Int J Pharm Pharm Sci. 2012. 4(1): 227- 229. 6. Zhao F, He EQ, Wang L, Liu K. Anti-tumor activities of andrographolide, a diterpene from Andrographis paniculata, by inducing apoptosis and inhibiting VEGF level. J Asian Nat Prod Res. 2008. 10(5-6):467-73. 7. Sukardiman, Rahman A, Ekasari W, Sismindari. Induction of apoptosis by Androgra-pholide compound from sambiloto (Andrographis paniculata Nees) in Cancer Cells Culture. 2005. Media Kedokteran Hewan 21(3):105-110. 8. Harjotaruno S, Widyawaruyanti A, Sismindari, Zaini NC. Apoptosis inducing effect of andrographolide on T-47D human breast cancer cell line. Afr. J. Trad. CAM .2007. 4 (3): 345 – 351. 9. Rajeshkumar S, Nagalingam M, Ponnanikajamideen M, Vanaja M, Malarkodi C. Anticancer activity of Andrographis paniculata leaves extract against neuroblastima (Imr-32) and human colon (Ht-29) cancer cell line. World J Pharm Pharm Sci. 2015. 4(6): 1667-1675. 10. Doss VA, Kalaichelvan PT. In vitro antimicrobial and antioxidant activity screening of Andrographis paniculata leaf ethanolic extract in Tamil Nadu. Int J Pharm Pharm Sci. 2012. 4(1):227-229. 11. Liu K, Liu PC, Liu R, Wu X. Dual AO/EB staining to detect apoptosis in osteosarcoma cells compared with flow cytometry. Med Sci Monit Basic Res. 2015. 21: 15-20
International Seminar Pokjanas TOI 89 Faculty of Pharmacy Pancasila University
ISBN : 978-602-72418-2-4
In-Vitro α-Glucosidase Inhibition Activities Test from Standardized sambung nyawa (Gynura procumbens (Lour.) Merr.) Leaves Extract
WIWI WINARTI*, RATNA DJAMIL, SARAH ZAIDAN, RAYMOND
Faculty of Pharmacy Pancasila University, Jakarta 12640, Indonesia.
email : [email protected].
Abstract: Diabetes is a disease that is not curable, but the risk of diabetes can be reduced. Diabetes therapy can be done by taking traditional medicine or modern medicine. Based on literature searches, Sambung Nyawa leaves can be used in the treatment of diabetes mellitus because Sambung Nyawa compound contains flavonoids, saponins, tannins, triterpenoids, and essential oils, caffeic acids, vanilic acid, chlorogenic acid, and p-cumaric acid. This study aims to determine the activity of the enzyme α-glucosidase inhibition to 70% ethanol extract of the leaf powder propped Sambung Nyawa. In this study we test the enzyme α-glucosidase inhibition by in- vitro by using p-nitrophenyl-α-D-glucopiranosida as a substrate to 70% ethanol extract of Sambung Nyawa leaves. Results of in- vitro study by inhibition activity against α-glucosidase showed that 70% ethanol extract of Sambung Nyawa leaves acquired 72.37% inhibition at concentrations of 200 ppm with IC50 value of 56.75 ppm.
Keyword: 70% ethanol extract of Sambung Nyawa leaves (Gynura procumbens (Lour.) Merr.). α-glucosidase.
INTRODUCTION
Diabetes mellitus is characterized by excessive glucose levels in the blood are often called hyperglycemia. Hyperglycemia that lasts for a long time would cause serious damage to the body's systems, especially the nerves and blood vessels. Sambung Nyawa leaves (Gynura procumbens (Lour.) Merr.) , this one of the plants that have potential as antidiabetic agent. Based on the research of June et.al (2012), the fraction of n- hexane, ethyl acetate and n-butanol from Sambung Nyawa can reduce blood glucose levels respectively in rats induced by streptozotocin as much as 29.7%, 60.1%, and 33.5% in the provision for 14 days in rats induced by streptozotocin. Liver glycogen content in diabetic rats were given three fractions increased (p <0.05) in the provision for 14 days (1). Agariri K et al (2013) conducted a study regarding the antihyperglycemic effect of the ethanol extract 95, 75 , 50 , and 25% of the Sambung Nyawa leaves of the rats induced by Streptozotocin. Khalid research results Agariri showed that 25% ethanol extract of the leaves continued life can lower blood level of glucose levels in a rat model of diabetes by 47% within 2 hours of the acute dose of 1 g/ kg(2). Mean while, Hassan Z (2010) conducted a study on the effect of Sambung Nyawa leaves extract to blood level sugar in mice model of diabetes induced by streptozotocin. The results showed that the water extract of Sambung Nyawaleaves with dose of 500 and 1000 mg / kg body weight can lower blood glucose levels significantly different (p <0.05) to the controls after administration of the extract for 14 days(3).
MATERIALS AND METHODS
MATERIAL. Sambung Nyawa leaves (Gynura procumbens (Lour.) Merr.); Ethanol 70%; P dilute hydrochloric acid; distilled water; chloroform; ethanol 96%; ammonia 30%; 1:10 hydrochloric acid; concentrated hydrochloric acid; amyl alcohol; iron (III) chloride 1%; sodium hydroxide 1N; eter P; acetic
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 90
ISBN : 978-602-72418-2-4
acid anhydride; concentrated sulfuric acid; ammonia 10%; Mg pulv: Mayer reagent; Dragendorff reagent; Stiasny reagent: potassium phosphate monobase; phosphate buffer pH 6.8; 7.0; 7.2; p-nitrophenyl-α-D- glucopiranoside; α-glucosidase enzyme; bovine serum albumin; dimethyl sulfoxide (DMSO); 0.2 M sodium carbonate; acarbose. METHODS. In this study used a standardized 70% ethanol extract of the Sambung Nyawa leaves powder, then carried out phytochemical screening and the inhibition of the enzyme α-glucosidase test. Stages include phytochemical screening study, a preliminary test to determine the concentration, pH, incubation time and the optimum substrate concentration. Test of inhibition of the enzyme α-glucosidase, acarbose used as positive control. Measurements were made using Absorbance Mikroplate Reader EL x 800 at a wavelength of 405 nm.
RESULTS AND DISCUSSION
Test Activities α-Glucosidase Enzyme Inhibition. 1. Preliminary Test. Before testing the activity of the enzyme α-glucosidase inhibitory done, a preliminary test which aims to find the optimum conditions for activity test. The principle of preliminary test and the enzyme inhibitory activity of α-glucosidase is α- glucosidase enzyme will hydrolyze p-nitrophenyl-α-D-glukopiranosida into p-nitrophenol which is yellow and glucose. The enzyme activity was measured based on the absorbance of the yellow p-nitrophenol. Optimization is done to optimize the enzyme concentration, pH, incubation time and the concentration of the substrate. Enzymes are used as much as 1.2 to 29.4 mg solid enzyme specification contains 25% protein and there are 200 units per mg protein. The solution was tested consisting of DMSO, phosphate buffer, substrate p-nitrophenyl-α-D- glukopiranosida (pNPG), α-glucosidase, and sodium carbonate. The addition of sodium carbonate was to stop the enzyme reaction, sodium carbonate chosen as a stopper because the reaction is able to increase the pH of the test solution becomes alkaline, so the enzyme will be denatured. Uptake is measured is the absorban of the test solution, the control solution test, blank solution and blank control solution. Test solution is a solution of the extract while the blank solution ie the extract solution without control solution for correcting the results of uptake of the test solution and blank solution, observations were made on the activity of the enzyme by swapping positions between the addition of the enzyme α-glucosidase and sodium carbonate. The results of the test control and blank control can be used to see whether the enzyme activity was stopped when the condition first mixture was basified with sodium carbonate so that no product that is formed. The incubation process consists of two stages. The first stage, aimed pre-incubated for 5 minutes to allow time for the test solutions to achieve a temperature of 37˚C. The second stage, which is a 15-min incubation time for enzymatic reaction. Results of α-glucosidase enzyme optimization can be seen in Table 1.
Table 1. Results of α-glucosidase enzyme optimization. No. Optimization Optimum Results 1. The enzyme concentration 0.025 U / mL 2. pH 7.0 3. Incubation time 15 minutes 4. The substrate concentration 10 mM a. Determination of the optimum enzyme concentration. The determination of the optimum concentration of the enzyme is done by units of α-glucosidase 0.015 U/ml, 0.020 U/ml, 0.025 U/ml, and 0.030 U/ml, the concentration of the substrate p-nitrophenyl-α-D-glukopiranosida 10 mM, pH 7.0, 37˚C and incubation time of 15 min. The results obtained showed the greatest enzyme activity are at a concentration of 0.030 U/ml is 49.9139 U/mg. But uptake obtained at concentrations of more than 1.0, the selected optimum enzyme concentration was 0.025 U/ml with enzyme activity of 20.8889 U/mg which has an absorption of 0.4. Enzyme activity is eligible activeness on the label enzyme > 10 U/mg.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 91
ISBN : 978-602-72418-2-4
b. Determination of the optimum pH. pH determination is done using phosphate buffer at pH 6.8, 7.0, and 7.2, enzyme concentration of 0.025 U/ml, concentration substrat p-nitrophenyl-α-D-glucopiranoside 10 mM, at 37˚C and incubation time of 15 min. The results showed that at pH 7.0 the enzyme to work optimally with the enzyme activity 21.3194 U/mg. c. Determination of the optimum incubation time. Variations incubation time used 15, 20 and 30 min. Determination of the optimum incubation time is done with α-glucosidase units of 0,025 U/ml, the concentration of the substrate p-nitrophenyl-α-D-glukopiranosida 10 mM, pH 7.0, 37˚C. The results showed the greatest enzyme activity present in the incubation time of 20 min is 33.3139 U/mg, but uptake obtained at the incubation time is more than 0.8. Therefore, selected the optimum incubation time 15 min with the enzyme activity 20.8861 U/mg. d. Determination of the optimum substrate concentration. Variation of substrate concentration used 2.5 mM, 5 mM, 10 mM, and 20 mM. At a concentration of 20 mM substrate enzyme activity decreased. Decline in activity is expected due to the formation of the reaction product of the enzyme inhibitors such as α-D-glucose and p-nitrophenyl which have similar structures to the substrate p-nitrophenyl-α-D- glucopiranoside, so it can compete with the substrate to occupy the active site of the enzyme. Based on the results obtained, the concentration of substrate which is used to test the inhibitory activity of α- glucosidase enzyme was 10 mM with enzyme activity 18.0278 U/mg. The inhibition of α-glucosidase Test. Testing was conducted with 0.025 units of α-glucosidase U/ml, the concentration of the substrate p-nitrophenyl-α-D-glucopiranoside 10 mM, pH 7.0, at 37˚C and incubation time of 15 min. Test α-glucosidase inhibition of the enzyme is done by measuring the uptake of the product at a wavelength of 405 nm using Absorbance Mikroplate Reader EL x 800. Uptake is measured absorbance of the sample solution, sample control solution, a solution of acarbose, acarbose control solution, a blank solution and blank control solution , The sample solution is it self a viscous extract solution with 5 variations of concentration of 12.5 ppm, 25 ppm, 50 ppm, 100 ppm , and 200 ppm. Concentration variation is made so that it can be used to create a regression equation to calculate the IC50. Acarbose standardized testing done first. It is intended so that the IC50 and IC50 acarbose samples (extracts) can be compared. Acarbose chosen for comparison because acarbose is an antidiabetic drug that works to inhibit the enzyme α-glucosidase derived from nature. In the blank solution instead of the sample solution is used dimethyl sulfoxide (DMSO). Blank made as a comparison of data difference between the absorbance of the extract solution suspected of having α-glucosidase inhibitor agent. Activity test results are shown in Table 2.
Table 2. The activity of the enzyme α-glucosidase inhibitory No. Inhibitor IC50 (ppm) % Inhibition 1. Acarbose 50.37 78.11 2. Sambung Nyawa leaves 56.75 72.37 extract
IC50 values indicate that the concentrations of extracts that can inhibit 50% of enzyme activity of α- glucosidase. On the results showed that % inhibition at the highest extract is at a concentration 0f 200 ug/ ml with 72.37 % as a result, it is equivalent to % inhibition at acarbose with the same concentration of 200 ug / ml which is 78.11 %. IC50 result of Sambung Nyawa leaves extract 56.75 ppm and acarbose as a positive control (50.37 ppm).
CONCLUSION
The result of the research activities of leaves 70% ethanol extract from Sambung Nyawa leaves (Gynura procumbens (Lour.) Merr.) has idicated as antidiabetic activity (56.75 ppm )
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 92
ISBN : 978-602-72418-2-4
ACKNOWLEDGEMENT
The authors are grateful to Ditlitabmas Ditjen Dikti for Hibah Bersaing Research Funding as Dipa Kopertis region III, Year 14/15.
REFERENCES
1. June CC, Wen LH, Chin LP, Embi N. Hypoglycemic effect of gynura procumbens fraction on streptozotocin-induced diabetic rats involved phosphorylation pf GSK3β (Ser-9) in Liver. Malaysia: Universiti Kebangsaan Malaysia. 2012. 2. Algariri K, Meng YK, Atangwho JI, Asmawi ZM. Hypoglicemic and anti-hyperglicemic study of Gynura procumbens leaf extracts. Malaysia : School of Pharmaceutical Science, Universiti Sains Malaysia. 2013. 3. Hassan Z, Yam FM, Ahmad M. Antidiabetic properties and mechanism of action of Gynuraprocumbens water extract in streptozotocin induced diabetic rats. Malaysia: School of Pharmaceutical Science, Universiti Sains Malaysia. 2010. 4. Kumar GS, Naidu RS. Hypoglicemic effects of aqueous extract of Gynura procumbens. Malaysia: School of Pharmaceutical Science, Universiti Sains Malaysia; 2008 5. Farnsworth NR. Phytochemical screening. Chicago: Department of Pharmacognosy and Pharmacology College of Pharmacy. 1966. P. 26-62. 6. Acarbose. Diambil dari :http://dinkes.tasikmalayakota.go.id/index.php/informasi-obat/176- acarbose.html diakses tanggal 20 April 2014; pukul 19:40 WIB.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 93
ISBN : 978-602-72418-2-4
Identification of Sugar-Apple Seeds (Annona squamosa L.) Extract as A Candidate Against The Aedes aegypti L. Musquito Vector Control DBD
RATNA DJAMIL, SARAH ZAIDAN,SITI NURAINI
Fakultas Farmasi Universitas Pancasila.
Abstract: Aedes aegypti L. mosquitos are the disease vectors of dangue hemorrhagie fever (DHF). This diseases is caused by dengue virus which is transmitted by Ae. Aegypti mosquito. The effort to control Ae. aegypti vector have been done in so many times, including chemical, physical, and biological control method. Extraction by kinetic maceration have been done with sugar-apple seeds (Annona squamosa L.) with the solvent of 70% of ethanol. Subsequently, the obtained extract is tested phytochemical screening along with the powder and larvicidal activity against Ae. aegypti. The results of phytochemical screening of the powder and 70% ethanol extract of sugar apple seeds have obtained the compound of saponin, triterpenoid and coumarin. Based on the activity test against the larva of Ae. aegypti from ethanol 70% extract of of sugar-apple seeds, show LC50 values is 97,462 ppm. These are indicate that the compound which is found in sugar-apple seeds have a potential as a larvicides.
Keyword : Aedes aegypti L., Annona squamosa L., sugar-apple seeds, larvasida.
INTRODUCTION
The existence of a mosquito that is close to human life pose a serious health problem, because mosquitoes act as vectors of some diseases with high rates of morbidity and mortality caused. Ae. L. aegypti mosquito is getting attention because it is one of the vectors penyakit(1). Ae. aegypti is diurnal, or active during the morning and afternoon. This mosquito-colored striped black and white, would rather be in a protected area as home. Transmission of the disease carried by female mosquitoes, because only the female mosquito sucks blood. This was done to obtain the protein to produce eggs. The virus is transmitted by Ae. aegypti is the dengue virus, the virus that causes dengue hemorrhagic fever (DHF). Ae. aegypti mosquitoes carrying dengue virus obtained from infected individuals and multiply in the body and salivary glands of female mosquitoes. Dengue disease not only in children but in all ages. DBD becoming known in Indonesia in 1968 in Surabaya and Jakarta, and then continue to expand as the spread of dengue endemic area. The number of cases of dengue and widely spread is increasing along with the increasing mobility and population density. There are 150,000 cases of dengue in 2007 and continued to increase until 2010. In addition, WHO reported more than 35% of the population living in urban areas affected by the disease. Until now there is no specific vaccine to treat dengue fever, and the only control vector disease control(2,3,4,5). Controlling the mosquito vector can be done with the use of biological larvicides to control mosquito larvae stage. Biological larvicides are safer for humans and the environment and poses no resistance penyemaran target organisms. One of the plants that can be used as larvicides are sugar apple (Annona squamosa L.) of the family Annonaceae. The plant parts are potentially as larvicides are seed (semen)(6). Previous research reported the main active compound of sugar apple seed is annonain and squamocin belonging asetogenin compound. Squamocin annonain compound of the family Annonaceae and is reported to have toxicity properties cukupefektif against Chrysomya bezziana fly larvae and insects of the order Diptera (Ae.aegypti L.) which are cytotoxic, and neurotoxic. Asetogenin
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 94
ISBN : 978-602-72418-2-4
compounds can inhibit the action of the enzyme NADH in the mitochondria, causing the death of larvae, as well as toxic contact and stomach poison to insects(7,8,9). Based on these results, the authors want to identify the qualitative content of secondary metabolites and activity test seed extract sugar apple (Annona squamosa L.) against Ae. aegypti. Larvicidal activity test seed extract srikaya with some variation of the concentration method Efficacy Testing Standards Pestisda Household and vector control to determine the optimal concentration of sugar apple seed extract used 20 third instar larvae of Ae. aegypti. The data seen LC50 values were obtained by probit analysis. The research objective is to identify chemical compounds / secondary metabolites qualitatively and larvicidal activity of seed extract sugar apple (Annona squamosa L.) against larvae of Aedes aegypti L. Results from this study are expected seed extract sugar apple (Annona squamosa L.) can be used as a biological larvicides dengue vector control with chemical compounds / secondary metabolites contained in sugar-apple seeds.
MATERIAL AND METHODS
MATERIAL. Sugar-Apple seeds (Annona squamosa L.) were obtained from Balitro (Research Institute for Spices and Medicinal Plants) Cimanggis, Bogor. Determination at Bogoriense Herbarium, Research Center, LIPI Cibinong , Bogor. Extraction. Sugar-Appleseeds (Annona muricata L.) which have been dried in the sun was directly crushed and blended into a fine powder. Powdered crude drug was extracted by maceration kinetic in stages using different solvent polarity is n-hexane, ethyl acetate, and ethanol 70% at room temperature until the extracted perfectly, then filtered with cotton and proceed with filter paper, pulp, and each extract n -heksan, ethyl acetate, and ethanol is 70% separated. Each extract was concentrated by vacuum rotary evaporator at a temperature of 450 C to obtain a viscous extract n-hexane, ethyl acetate and ethanol 70%. Identification with phytochemical screening. Phytochemical screening performed on pollen and seed extract of soursop with Farnsworth method in Biological and phytochemical screening of Plant seed sirsakdilakukan to identify the qualitative content of secondary metabolites in seed soursop. Flavonoids. 2 grams of powder simplisia or 0.15g of extract ethanol 70% boil with 100 ml of hot water for 5 minutes, then filtered with filter paper, 5 mL filtrate of extract solution coupled with a bit of powdered zinc or magnesium and 1 mL of 2 N HCl and 5 mL amyl alcohol. Flavonoids compounds would pose orange to red(12) . Saponins. Entering 10 ml sample into a test tube and shake for 30 seconds and observe what happens. If the foam is formed solid (not lost for 30 seconds) the identification showed the presence of saponins(12). Coumarin. 2.12 grams of powder simplisia or 0,15g of extract ethanol 70% included in the test tube and add 10 ml of chloroform, heated 20 minutes on waterbath is then cooled. After it is filtered with filter paper, the filtrate waterbath until dry. The residue was added 10 mL of hot water, then cooled and put into a test tube, add 0.5 mL of 10 % ammonia solution and then observed under UV light at a wavelength of 365 nm (blue or green fluorescence showed the presence of cumarin(12). Volatile oil. 2 of powder simplicia and 0.67 g extract put into a test tube, then added 10 mL of petroleum ether, at the mouth of the tube fitted with a mouthpiece that has given cotton that has been moistened with water, then heated above waterbath10 minutes after the cold water and filtered with a filter paper. The Obtained filtrate is evaporated in the vaporizer cup, the residue is dissolved in 5 mL ethanol and then filtered with filter paper. If residues smelling aromatic indicate a of compounds volatile oils(12). Kuinon. 5 ml of solution experiments inserted into a test tube, add a few drops of 1 N sodium hydroxide solution, Occurs in red indicate a compounds of quinine(12). Steroids/Triterpenes. 1.10 grams of powder or sugar-apple seed extract: 0.67 g of ethanol extract 70% extract, macerated with 20 mL eter for 2 hours, then filtrated the solution, and A total of 5 mL of the extract solution evaporated to dryness, then added with a reagent Lieberman- Burchard. green - red color arising indicates compounds terpenoids or steroids(12).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 95
ISBN : 978-602-72418-2-4
Tannin. 2 grams of powder simplisia or 0.15g of extract ethanol 70% added 100 mL of water, boil for 15 Minutes, cooled and filtered. divided to each 5 mL filtrate (reaction tubes): Added a few drops of solution of iron (III) chloride 1 %, Changes blue or blackish green and Added a few drops of 1 % solution of gelatin to form white precipitate indicates the compounds of tannins . To 5 mL Second filtrate was added 15 mL reagent Stiasny (formaldehyde 30% - hydrochloric acid = 2 : 1), the precipitate formed pink color indicates the presence of tannins katekuat . Subsequently the precipitate is filtered, the filtrate who saturated with sodium acetate powder, add a few drops of solution of iron (III) chloride 1 %, occurred in blue ink Showed the presence of tannins galat(12). Alkaloids. 2.12 grams of powder simplisia or 0.15g of extract ethanol 70% is inserted in a porcelain bowl and then add 5 mL of ammonia 30% crushed and then added 20 mL chloroform and crushed again, then filtered. The filtrate obtained was added HCl 1 N as much as 5 ml and then separated into 2 sections namely A and B. The filtrate A coupled with Mayer reagent, filtrate B coupled with Dragrendroff reagent. With reagent Meyer gives a white precipitate, and Dragendorff reagent give an red brick precipitate(12). Larvasidal activity test. Larvae Maintenance. Mosquito eggs incubated in a plastic container (tray) measuring 20 x 15 x 10 cm3yang containing distilled water. The eggs will hatch within 24 hours of becoming the first instar larvae, then the 2nd day will have become instar II stage of development, at this stage larvae fed chicken liver, then after 1-2 days will be changed again to the third instar.
Figure 1. Larvae rearing.
Implementation of Experimental Test Larvicidal Activity. Larvicidal activity test was conducted using ”Pesticide Efficacy Testing Standards Household and Vector Control”. Carefully weigh approximately 100 mg extract and then dissolved in 100 mL of of solvent. This solution is a mother liquor (1000 ppm). The mother liquor 18.750 ml pipette; 12.500 mL; 6.250 mL; 3.125 mL; 1.250 mL respectively inserted into plastic cups that have ditara 25 mL to obtain a concentration of 750 ppm, 500 ppm, 250 ppm, 125 ppm, 50 ppm, then evaporated completely. Each concentration was made in 3 plastic cups (triplo), then into individual plastic cups partially added to 25 mL of distilled water homogenkan, and included 20 third instar larvae of Ae. aegypti. Observations were made after
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 96
ISBN : 978-602-72418-2-4
24 hours of exposure to the test solution and counted the number of larvae were dead and stated in the presentation of death. Negative controls only solvent without the extract, in the same way. Positive controls carried out on Temephos 1 ppm. Data Processing Methods. Test data processing is done systematically using probit analysis method. Probit analysis is used to determine the percentage of larval mortality LC50 of Ae. aegypti L. uses Epa Probit Analysis Program Used For Calculating LC/EC Values Version 1.5.In Epa Probit Analysis Program Used For Calculating LC/EC Values Version 1.5. the data entered is the relationship with the concentration of the value of the average percentage mortality of larvae of Ae. aegypti.
RESULT AND DISCUSSION
Making the Ethanol 70% Extract. Sugar apple seed is extracted by cold by maceration kinetic (use maserator). The solvent used for extraction is 70% ethanol. Extracts were obtained in the form of extracts viscous blackish brown. 36.9 g of 506.2 g of crude drug powder sugar apple seeds with 7.29% yield. Phytochemical screening. The phytochemical screening via Farnsworth method was conducted using powder of simplicia and Soursop seeds and sugar-apple seeds extract. In powder and extract having metabolite compound such as saponin, triterpenoid, and cumarin. The result of phytochemical test is shown in Table 1.
Table 1. Result of phytochemical screening of soursop seeds (Annona muricata L.) and sugar- apple seeds (Annona squamosa L.) powder and extract. No Secondary Simplicia Ethanol Metabolites powder 70% Extract 1 Alkaloids - - 2 Flavonoids - - 3 Saponins + + 4 Kuinon - - 5 Tannin - - 6 Steroids / - /+ - / + triterpenoids 7 Volatile oil - - 8 Coumarin + + Notes : + = giving positive reaction − = giving negative reaction
In Table 1 it can be seen that the results of the qualitative identification of secondary metabolite content of the seed powder soursop (Annona muricata L.) by means of screening phytochemical compounds derived class of saponins, triterpenoids, and coumarin. While the 70% ethanol extract derived class compound saponin, triterpenoids, and coumarin. Larvicidal Activity Test. Larvicidal activity test 70% ethanol extract sugar apple seeds is done by the method of Pesticide Efficacy Testing Standards Household and Vector Control for mosquito larvae Ae.aegypti L. larvae used test is the third instar larvae of mosquitoes Ae.aegypti because it has a fairly good resistance against external environment and durability stronger mechanically when the transfer of the larvae, and have a long time to turn into adult mosquitoes. Test solution at a concentration of 50, 125, 250, 500 and 750 ppm generated triplo, then put 20 third instar larvae of Ae. aegypti L. and counted the number of larvae mortality after 24 hours of observation. Negative controls only the solvent used and Temephos (larvicidal commonly used) as a positive control.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 97
ISBN : 978-602-72418-2-4
Table 2.The average percentage mortality of larvae of Ae.aegypti L., after exposure to 70% ethanol extract sugar-apple seeds in the 24-hour observation. % Kematian Concentration Control (ppm) Sugar-apple Seeds Negative Positive Ethanol 70% Extract (Solvent) (Temephos 1 ppm) 750 100 0 100 500 100 0 100 250 98,35 0 100 125 48,35 0 100 50 18,35 0 100
LC50 (ppm) 97,462 - - Linear regression a = -103,6709 b = 75,0693 - - r = 0,9372 The test results larvicidal activity against sugar-apple seed LC50 values obtained from the ethanol 70%extract is 97,462 ppm. From the LC50 values of 97.462 ppm can be concluded that the sugar apple seed extract has larvicidal activity against Ae. aegypti. This can be caused by chemical compounds / secondary metabolites contained in the sugar-apple seed saponin, coumarin suspected triterepenoid and potentially as larvicidal(23). Saponins allegedly able to diffuse into the cuticle layer of larvae that can damage cell membranes and toxic compounds can be entered and off the larvae. Saponins have a bitter taste and sharp and can cause irritation of the stomach. Larvae digestive tract, particularly the midgut (midgut) is the major site of absorption of nutrients and digestive enzymes seksresi. Saponin absorption into the intestine larvae can inhibit the action of digestive enzymes and cause damage to the cells in the channel pencernaan(1). Triterpenoids also thought to be as antifeedant (antimakan) on the larvae so that the larvae loss of appetite, this led to the loss of energy and development of larvae will be hampered even can cause death 24. In addition, coumarin is also reported as larvicides because potentially able to change the ability of detoxification with reversible and irreversible inhibits the enzyme cytochrome P450(25).Dari third ability of secondary metabolites in seed srikaya concluded that sugar apple seeds potentially sebagaii larvicides against mosquito larvae Ae. aegypti L. Mortality of larvae on seed extract sugar apple (Annonasquamosa L.) allegedly also because of the effects of the component compounds acetogenindansquamosin toxic contact. Where after the larvae exposed to the extract, the compound into the body of Ae. aegypti through physical contact and the case of death of the larva. Prijono (1994) in Wardhanaet.al (2005) states that the absorption of toxic insecticides contact occurs largely in the cuticle. Active compounds will penetrate into the insect's body through the part that is covered by a thin cuticle, such as membrane between segments. Stomach poison ability of the compound to absorb seyawaasetogenin work on sugar apple seed extract into the wall fosfolirasi larvae and able to inhibit oxidative chain so that the cell respiration is inhibited activity of Ae.aegypti because of breathing stopped. Squamocin compounds in seeds srikaya allegedly able to diffuse from the thin cuticle layer to spread throughout the body Ae. aegypti through hemolimfa flow(15). Mortaitas larvae of Ae.aegypti showed signs as follows: larvae do not move when touched, bodies pale white larvae, elongated body shape or rigid(1). The color can be seen more clearly with the aid of a stereo microscope and optilab. Differences larvae of Ae.aegypti normal and who have died can be seen in Figure 2.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 98
ISBN : 978-602-72418-2-4
A B
Figure 2. Third instar larvae of Ae. aegypti normal (A); and third instar larvae of Ae. aegypti die (B).
Figure 3. Graph average percentage mortality soursop seed extract on a 24 hour observation (x-axis:% average mortality of larvae and the y-axis: concentration sugar apple seeds extract (ppm)).
From Figure 3 shows that the higher the concentration of sugar apple seed extract, the higher the death rate of Ae. aegypti L. Ethanol 70% and distilled water as a negative control test the same activity against larvae of Ae. aegypti, and the results obtained all the larvae do not occur death. This indicates that the solvent does not affect the mortality of larvae. Temephos as a positive control, in which the larvicidal activity at a concentration of 1 ppm trials have demonstrated 100% mortality against larvae of Ae. aegypti L.
CONCLUSION
Based on the results of phytochemical screening of the seeds sugar apple (Annonasquamosa L.) obtained secondary metabolites content of saponins, triterpenoids, and coumarin., Test results with the larvicidal activity and data analysis has been done, it can be concluded that the 70% ethanol extract of the seeds have activity sugar apple seeds against larvae of Ae. aegypti L. with LC50 values of 97, 462 ppm. Suggestion. Ethanol 70% extract of the seeds sugar apple (Annonasquamosa L.) has a good chance to be used as biological insecticides to control mosquito larvae that are environmentally friendly. International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 99
ISBN : 978-602-72418-2-4
REFERENCES
1. Kaihena M, Vika L, Maria N. Efektivitas ekstrak etanol daun sirih (Piper betle L) terhadap mortalitas larva nyamuk Anopheles sp dan Culex. Molluca medica. ISSN: 1979-6358. 2. Susanti PD, Danang B, Dini S, Susilawati. Penggunaan ekstrak kulit kayu gemor (Nothaphoebe coriacea K.) sebagai larvasida hayati terhadap tingkat mortalitas jentik nyamuk Aedes aegypti serta dampaknya pada kualitas air hujan. ISSN 1978-8096. 2013.9:117–22. 3. Hadi, Upik Kesumawati. Penyakit tular vektor: demam berdarah dengue. Bogor: Fakultas Kedokteran Hewan IPB. 2005. 4. World Health Organization. Dengue: guidelines for diagnosis, trearment, prevention and control, new edition. Swiss. 2010. h.5. 5. Palgunadi BU, Asih Rahayu. Aedes aegypti sebagai vektor penyakit demam berdarah dengue. Surabaya: Universitas Wijaya Kusuma. 2011. 6. Mulyawati AP, Hayati EK, Nashihuddin A, Tukimin. uji efektivitas dan identifikassi senyawa ekstrak biji sirsak (Annona muricata Linn.) yang besifat bioaktif insektisida nabati terhadap hama thrips. Alchemy 2010;2(1): 104-1575. 7. Rosmayanti, Kiki. Uji efektivitas ekstrak biji sirsak (Annona muricata L ) sebagai larvasida pada larva Aedes segypti instar III/IV (skripsi). Jakarta: Fakultas Kedokteran Dan Ilmu Kesehatan Universitas Islam Negeri Syarif Hidayatullah. 2014. 1-3, 16-17, 37-40. 8. Wardhana AH, Amir H, Muharsini S, dan Yuningsih, Veteriner BP. Uji keefektifan biji sirsak (Annona muricata) dan aar tuba (Derris edliptica) terhadap larva Chrysomya bezziana secara in vitro. 2006. 1013-1017. 9. Wardhana AH, Amir H, dan J Manurung, Veteriner BP. Uji efikasi ekstrak heksan daging biji srikaya ( Annona squamosa L ) terhadap pertumbuhan larva lalat Chrysomya bezziana secara in vitro. 2004. 134-142. 10. Syamsuhidayat Ss, Hutapea JR. Inventaris tanaman obat indonesia. Jilid I. Jakarta: Departemen Kesehatan Indonesia. 1991. h. 50,56-57. 11. Standard of Asean herbal medicine. jilid 1. Asean Countries. 1993. h.51. 12. Dalimartha S. Atlas tumbuhan obat Indonesia. Jilid III. Jakarta: Trubus Agriwidya. 2003. 145- 147. 13. Asyiyah, Nur. Perluasan hama sasaran formulasi insektisida nabati pada tiga spesies serangga hama sayuran (skripsi). Bogor: Fakultas Pertanian Institut Pertanian Bogor. 2010. h.17. 14. Taslimah. Uji efikasi biji srikaya (Annona squamosa L.) sebagai bioinsektisida dalam upaya integrated vector management terhadap Aedes aegypti (skripsi). Jakarta: Fakultas Kedokteran Dan Ilmu Kesehatan Universitas Islam Negeri Syarif Hidayatullah. 2014. h.1-6, 23-28,76-81. 15. Wardhana AH, Amir H, dan J.Manurung, Veteriner BP. Efektifitas ekstrak biji srikaya (Annona squamosa L ) dengan pelarut air, metanol dan heksan terhadap mortalitas larva caplak boophilus microplus secara in vitro. 2005. 134–42. 16. Supartha, I wayan. Pengendalian terpadu vektor virus demam berdarah dengue, Aedes aegypti (Linn) dan Aedes albopictus (Skuse) (Diptera: Culicidae). Denpasar: Fakultas Pertanian Universitas Udayana. 2008. 17. Suyanto, Darnoto S, Astuti D. Hubungan pengetahuan dan sikap pengendalian nyamuk Aedes aegypti di kelurahan sangkrah kecamatan pasar kliwon kota Surakarta. 2002. 705:1-13. 18. Sigit SH, Hadi UK. Hama Pemukiman Indonesia. Bogor: Unit kajian pengendalian hama pemukiman. Fakultas Kedokteran Hewan IPB. 2006. h.34,37-45. 19. Gandahusada S, Llahude HD, Pribadi W. Parasitologi kedokteran, edisi ketiga. Jakarta: Fakultas Kedokteran Universitas Indonesia. 1998. h.219. 20. Soeharto. Beberapa sifat kehidupan Aedes aegypti L. Jakarta: Universitas Nasional; 1974. h.55. 21. Antonius, P.Rumengan. Uji larvasida nyamuk (Aedes aegypti) dari Ascidian (Didemnum molle). 2010. VI-2.h.83. 22. Soedarto. Entomologi kedokteran. Jakarta: Penerbit Buku Kedokteran EGC. 1989. h.104.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 100
ISBN : 978-602-72418-2-4
23. Riswanto S. Uji efektivitas pestisida nabati terhadap hama Spodoptera litura (Lepidoptera: Noctuidae) pada tanaman tembakau (Nicotiaana tabaccum L.). Medan: Universitas Sumatera Utara. 2009. 20-23. 24. Nopitasari. Uji aktivitas ekstrak biji langsat (Lansium domesticum Cor.) sebagai larvasida Aedes aegypti. Universitas Tanjungpura. 2013. 12-14. 25. Venugopala KN, Raquel MG, Kabange K, Bandar EA, Mahesh VA, Bharti O. Evaluation of halogenated coumarins for antimosquito properties. Hindawi Publishing Corporation The Scientific World Journal. 2014. Vol.4.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 101
ISBN : 978-602-72418-2-4 Anticancer Activity of Jatropha sp. on Breast and Cervix Cancer Cells Lines
SITI ROFIDA1*, NAILIS SYIFA’1, NURKHASANAH2, LAELA HAYU NURANI2
1Pharmacy Departement, Health Science Faculty, University of Muhammadiyah Malang, Indonesia. 2Faculty of Pharmacy, University of Ahmad Dahlan Yogyakarta, Indonesia.
Corresponding: [email protected]
Abstract: Jatropha sp. is a plant that comes from Euphorbiaceae which has 70 species and some of them reported have activity as a drug. Secondary metabolites contained in Jatropha sp. are alkaloids, tannins, flavonoids, steroid, saponins, and phenol. Based on research, Jatropha sp. has the potential to be developed as the raw materials of anticancer drug. This study aims to obtain raw materials traditional medicines standardized from Jatropha sp. which have anticancer activity against breast and cervical cancer. This study has been testing the anticancer activity of J.curcas L. and J.gossypifolia L. using MTT assay cytotoxicity method. Thin Layer Chromatography technique applied to identified the secondary metabolites on parts of plants which have anticancer activity. The results showed roots extract of J.gossypifolia L. have activity as breast and cervix anticancer. Cytotoxicity on T47D breast cancer cell lines and HeLa cervical cancer cell lines with IC50 values respectively 43.57 and 4.32 µg/mL. The identification using TLC showing chemical compounds such as terpenoids, flavonoids, polyphenols and anthraquinone.
Keyword: Anticancer activity, J.curcas L., J.gossypifolia L., MTT assay method.
INTRODUCTION
In Indonesia, breast cancer and cervical cancer are the highest cancer incidence rates. According to data from the Hospital Information System (SIRS) in 2008, breast cancer patients as much as 18.4%, ranked first in-patients in all hospitals in Indonesia, followed by cervical cancer at 10.3% (1). Treatment of cancer through surgery, radiation, chemotherapy and immunotherapy give adverse effects such as pain, wounding and causing the death of normal cells, bone marrow depression, anorexia and nausea (2). The use of several natural products especially plant has been recommended by doctors in the treatment of cancer, such as vinca alkaloids (Catharanthus), epipodophyllotoxins, taxanes and camptothecins (3,4). Jatropha sp. is a plant that comes from family Euphorbiaceae which has 70 species and some of them have been reported to have activity as a drug. Its use as a popular drug that is as a laxative. Parts of plants which had this activity is part of the seeds and leaves. Besides oil seeds, latex, bark, leaves and roots are used to treat skin diseases, stomach aches and teeth, inflammatory, antioxidant, dysentery, vertigo, malaria, anemia, diabetes, bronchitis, asthma and aphrodisiac (5). Classes of compounds in Jatropha sp. ie alkaloids, tannins, flavonoids, steroid, saponins, and phenol (6,7,8). Several studies have reported the activity of Jatropha sp. as anticancer colon (9), liver (10), cervix (11) and breast cancer (12). Based on research that has been done, jatropa sp. has the potential to be developed as an anticancer drug raw materials. The aim of this study is to get information anticancer activity of extracts of Jatropha sp specifically J. curcas L. and J.gossypifolia L. which selectively in T47D breast cancer cells lines and Hela cervical cancer cells lines, so its use is not only based on empirical, but based on scientific data.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 102
ISBN : 978-602-72418-2-4 J.curcas L leaves and stems contain chemical compounds saponins, flavonoids and polyphenols, while the leaves also contain tannins. Empirically, the leaves efficacious as an anthelmintic, flatulence drugs and drug injuries. J.gossypifolia L. leaves, contained chemical compounds alkaloids, saponins, flavonoids and polyphenols. Empirically, the leaves efficacious as a laxative and anti-inflammatory agent ear children (13).
MATERIAL AND METHODS
MATERIAL and equipment. Ethanol 96%, n-hexan, ethyl acetat, TLC Plate silica gel F254, T47D breast cancer cells lines and Hela cervical cancer cells lines collected from parasitology laboratory, Medicine Faculty, University of Gajahmada, Yogyakarta, medium RPMI, fetal bovine serum 10%, penicillin- streptomicyn 1%, fungison 0,5 %, Phosphat Buffer Saline 20 %; Dimethyl sulfoxide; 3-(4,5- Dimetiltiazol-2-il)-2,5-difeniltetrazolium bromide; Sodium Dodecyl Sulphate 10 %. Plant Material. The leaves, stembark, fruits and roots of J.curcas L. and J. gossypifolia L. were obtained from Pasuruan in January 2015 and identified by UPT Materia Medica, Batu, Malang. The leaves, bark, fruits and roots cleaned with running tap water, and dried in an oven at 45 ° for 3 days for the leaves, stembark and root for 4 days and fruits for 5 days. Then milled to obtain fine powder for extraction. Preparation of Extract. One hundred grams of leaves, stembark, fruits and roots powder J.curcas L. and J. gossypifolia L., macerated using 1 L ethanol 96% for 24 hours (3 times). The filtrate was collected and concentrated by evaporation with a vacuum rotary evaporator at 50°C to obtain a viscous extract, the extract then dried in an oven at 40°C. The crude ethanolic extract was also stored in the refrigerator at 5°C until required for use. The sample for cytotoxicity assay was dissolved into DMSO. MTT assay. Cancer cells are distributed into 96 well plate and then incubated in 5% CO2 conditions at 37 °C for overnight. Test solution with a certain concentration is inserted into cancer cells cultured and incubated under conditions of 5% CO2 at 37 °C. After 24 hours, the liquid was pipetted and discarded, then washed with PBS solution with a rocked then discarded. Added 100 mL of culture medium per well and 10 mL solution of MTT in PBS at a concentration of 5 mg / ml. Then incubated under conditions 5% CO2 of 37 °C. After 4-6 hours stopper added reagents (SDS 10%) and incubated overnight at room temperature and stored in a dark place. Absorptions is read by ELISA reader at a wavelength of 550-600 nm. The percentage of life cells was calculated to obtain the IC 50 value. The data were analyzed with probit analysis. Phytochemical identification. To identify the components of chemical compounds in the crude ethanolic extract from leaves, stembark, fruits and root J.curcas L. and J.gossypifolia L., TLC technique were applied. Derivatization for the compound alkaloids, flavonoids, terpenoida, polyphenols and anthraquinone, used reagent dragendorf, ammonia fumes, anisaldehid-sulfuric acid, FeCl3 and KOH respectively.
RESULTS AND DISCUSSION
Powder simplicia from leaves and stem bark were obtained have a fine degree from rather crude to fine. While powder simplicia of fruits and roots have a fine degree rather crude to crude. The water content that contained in powder simplicia ranged between 2.76 to 8.78%. Ethanolic extract that obtained from maceration process of simplicia powder of J.curcas L and J.gossypifolia L presented in Table 1.
Table 1. Results of extraction the simplicia powder of J.curcas L and J. gossypifolia L No Simplicia Organoleptic Yield 1 J.curcas L leaves Dark green 9.86 % 2 J.curcas L fruits Brown greenish 7.50 % 3 J.curcas L stem bark Brown blackish 4.76 % 4 J.curcas L roots Dark brown 9.10 % 5 J.gossypifolia L leaves Green brownish 9.20 % 6 J. gossypifolia fruits Brown blackish 7.40% 7 J.gossypifolia L stem bark Dark brown 12.17 %
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 103
ISBN : 978-602-72418-2-4
8 J.gossypifolia L roots Dark brown 9.03 %
Based on cytotoxicity assay on J.curcas L. and J.gossypifolia L.by MTT assay, obtained the percentage of life cells and then was calculated to obtain the IC 50 value are presented in Table 2.
Table 2. The potential for cytotoxicity of J.curcas L. and J.gossypifolia L. IC (µg/mL) No Samples 50 T47D Cell lines Hela Cell lines Vero Cell lines 1 J.curcas L leaves 1030.15 1031.84 545.22 2 J.curcas L fruits 1627.66 1280.33 1155.05 3 J.curcas L stem bark 1283.76 260.30 472.78 4 J.curcas L roots 131.12 191.47 52.50 5 J.gossypifolia L leaves 189.55 191.09 62.55 6 J. gossypifolia fruits 25687.36 1902.92 2460.96 7 J.gossypifolia L stem bark 430.53 401.39 83.12 8 J.gossypifolia L roots 43.57 4.32 9.46
According to the National Cancer Institute (NCI), the extracts that had IC50 values less than 20 µg/mL (14) against cancer cell cultures could be considered effective as anticancer . The samples that had IC50 values < 30 µg/mL, identified secondary metabolites with chromatographic techniques and derivatized with dragendorf, ammonia fumes, anisaldehid-sulfuric acid, FeCl3 and KOH reagents for indicating the presence of compounds alkaloids, flavonoids, terpenoida, polyphenols and anthraquinone were is presented in figure 1-5.
A B C D A B C D
1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 Figure 1. TLC profile roots extract of Figure 2. TLC profile roots extract of J. Gossypifolia L., stationary phase: J.gossypifolia L., stationary phase : silica gel F254; mobile phase: silica gel F254; mobile phase: hexan:choloroform: aethyl acetat = hexan:chloroform:aethyl acetat=5:3:3; 5:3:3 (A. UV 254; B. UV 366; C. derivatized: (A. UV 254; B. UV 366; C. derivatized: ammonia fumes, UV 366; D. reagent dragendorf, UV 366; D. derivatized: ammonia fumes, visual). derivatized: reagent dragendorf,
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 104
ISBN : 978-602-72418-2-4
A B C D A B C D
1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 Figure 3. TLC profile roots extract Figure 4. TLC profile roots extract
of J.gossypifolia L., stationary of J.gossypifolia L., stationary phase phase : silica gel F ; mobile : silica gel F254; mobile phase: 254 phase: hexan:chloroform:aethyl hexan:chloroform:aethyl acetat=5:3:3; (A. UV 254; B. UV acetat=5:3:3; (A. UV 254; B. UV 366; C. derivatized: reagent FeCl3, 366; C. derivatized: reagent UV 366; D. derivatized: reagent anisaldehid-sulfuric acid, UV 366; FeCl3, visual). D. derivatized: reagent anisaldehid-sulfuric acid, visual).
A B C D
1 2 1 2 1 2 1 2 Figure 5. TLC profile roots extract of J.gossypifolia L., stationary phase : silica gel F254; mobile phase: hexan:chloroform:aethyl acetat=5:3:3; (A. UV 254; B. UV 366; C. derivatized: reagent KOH, UV 366; D. derivatized: reagent KOH, visual).
Results of investigation the cytotoxicity by MTT assay indicates that the root extract of J.gossypifolia L. has potential as an anticancer of breast and cervix cancer. According to the National Cancer Institute (NCI), the extracts that had IC50 values less than 20 µg/mL against cancer cell cultures (14) could be considered effective as anticancer . This is indicated by IC50 value are 43.57 µg/mL; 4.32 µg/mL and 9.46 µg/mL on T47D, Hela and Vero respectively. Based on the value IC50 of T47D and Hela cancer cell lines and vero normal cell lines of the roots extract of J.gossypifolia L. has potential as an anticancer. Anticancer mechanism of them similarity of the products of natural materials were have been developed from plants such as vinca alkaloids (vinblastine together derivates vincristine), taxanes (paclitaxel and docetaxel), and Camptotesin. The mechanism of anticancer on the cell cycle so that in terms of selectivity had raised various problems and side effects are quite detrimental (15). The identification results with the technique of thin layer chromatography on root extract of J.gossypifolia L., contained that flavonoida, terpenoida, polyphenols and anthraquinone. Phenolic compounds, and flavonoids in particular, are capable of inhibiting cancer cells through multiple means. These include inhibition of PTK, PKC, and other enzymes involved in signal transduction, and inhibition of NF-kB, cyclooxygenase, and lipoxygenase. Monoterpenes, tend to inhibit isoprenoid synthesis via International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 105
ISBN : 978-602-72418-2-4 feedback inhibition of HMGR, and others, such as boswellic acid, tend to produce anti-inflammatory effects. Others may cause anticancer effects through other direct or indirect actions. Because they are lipid-soluble, they are more easily absorbed, and therefore lower doses can be used to reach the plasma target concentration (16).
CONCLUSION
Anticancer activity of root extract of J.gossypifolia L. with MTT assay had cytotoxicity in T47D breast cancer cell lines and HeLa cervical cancer cell lines with IC50 values respectively 43.57 and 4.32 µg/mL. The identification using TLC showing chemical compounds such as terpenoids, flavonoids, polyphenols and anthraquinone.
ACKNOWLEDGMENT
Thanks to Deputy Minister for Science and Technology Relevance and Productivity, State Ministry of Research and Technology to founded this reseach at 2015 period.
REFERENCE
1. Depkes RI. 143 milyar dana jamkesmas untuk biaya rawat inap pengobatan kanker. http://www.depkes.go.id/index.php/berita/press-release/1831-143-milyar-dana-jamkesmas-untuk- biaya-rawat-inap-pengobatan-kanker.html. 2012. [cited 2014 Mar 15]. 2. Corwin JE. Buku saku patofisiologi (terjemahan Nike B.S.).Ed.3, Jakarta: EGC, 2009. p. 66-94. 3. Nobili S, Lippi D, Witort E, Donninic M, Bausi L, Mini E, Capacciolic S. Natural compounds for cancer treatment and prevention. Pharmacological Research. 2009, 59: 365-378. Available from: (http://citeseerx.ist.psu.edu/viewdoc/download? doi=10.1.1.468.6501&rep=rep1&type=pdf). 4. Balunas MJ, Kinghorn AD, Drug discovery from medicinal plants. Life sciences. 2005. 78: 431-441. Available from: (http://webspace.pugetsound.edu/facultypages/bdasher /Chem361/Review_Articles_files/Drugs%20from%20Plants.pdf). 5. Sabandar CW, Ahmat N, Jaafar FM, Sahidi I. Medicinal property, phytochemistry and pharmacology of several Jatropha species (Euphorbiaceae): A review. Phytochemistry. 2013., 59:7-29. (doi: 10.1016/j.phytochem.2012.10.009.). 6. Kafagy SM, Mohamed YA, Abdel Salam NA, Mahmoud ZF, Phytochemical study of Jatropha curcas. Planta Medica Med, 1977, 31(3):274-277. (Doi: 10.1055/s-0028-1097529). 7. Nwokocha A., Blessing IO, Agbagwa Okoli BE. Comparative phytochemical screening of Jatropha L. Spesies in the Niger Delta. Research Journal of Phytochemistry. 2011, (DOI: 10.3923/rjphyto.2011.107.114 ). 8. Gupta DD, Haque MD, Islam NM, Rahman S, Hasan AKMM, Shibib BA. Alkaloid and steroid from the stem bark of Jatropha curcas (Euphorbiaceae). Journal Pharmaceutical Science. 2011, 10(1):9-11. (DOI: http://dx.doi.org/10.3329/dujps.v10i1.10009). 9. Prakash E. Gupta DK, Cytotoxic activities of extracts of medicinal plants of euphorbiaceae family studied on seven human cancer cell lines. Universal Journal of Plant Science, 1(4):113-117. (DOI: 10.13189/ujps.2013.010401). 10. Lin J, Yan F, Tang L, Chen F. 2003. Antitumor effects of curcin from seeds of Jatropha curcas. Acta Pharmacol Sin. 2013, 24(3):241-246. (http://www.chinaphar.com/1671-4083/24/241.pdf) 11. Ee GCL, Lim CK., Taufiq-Yap YH, Go R. Ferulic ester from Jatropha podagrica (Euphorbiaceae). Malaysian Journal of Chemistry. 2005. 1(7):045-048. Available from: (: http://www.researchgate.net/publication/229429819) 12. Oskoueian E, Abdullah N, Ahmad S. Phorbol esters from jatropha meal triggered apoptosis, activated PKC-δ, caspase-3 proteins and down-regulated the proto-oncogenes in MCF-7 and hela cancer cell lines. Molecules. 2012, 17:10816-10830. (doi:10.3390/molecules170910816) 13. Hutpea JR. Inventaris tanaman obat Indonesia (III), Jakarta: Badan Penelitian dan Pengembangan Kesehatan Departemen Kesehatan Republik Indonesia. 1994. hal.113. International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 106
ISBN : 978-602-72418-2-4
14. Ampasavate C, Okonogi S, Anuchapreeda S, Cytotoxic of extracts from fruit plants against leukemic cell lines. African Journal of Pharmacy and Pharmacology. 2010, 4(1):13-21. Available from: (http://www.researchgate.net/publication/228663822_Cytotoxicity_of_extracts_from_fruit_plants_a gainst_leukemic_cell_lines). 15. Fajarningsih ND, Nursid M, WikantaT, Marraskuranto E. Bioaktivitas ekstrak Turbinaria decurrens Sebagai antitumor (Hela dan T47D) serta efeknya terhadap proliferasi limfosit. Jurnal Pascapanen dan Bioteknologi Kelautan dan Perikanan. 2008. 3(1):21-27. 16. Boik J. Natural compounds in cancer theraphy. Ed. 1st, Minnesota: Oregon Medical Press. 2001. P: 251-266; 297-311.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 107
ISBN : 978-602-72418-2-4
Anti-Hyperlipidemia Effect of Red Cabbage Juice (Brassica oleracea Var Capitata L. Forma Rubra) in Mice
LESTARI RAHAYU, YATI SUMIYATI*, DESTI DWI NANDINI
Faculty of Pharmacy, Pancasila University, Jakarta, Indonesia.
Email: [email protected]
Abstract: Hyperlipidemia is an increased of cholesterol, triglyceride, or both and be predominant risk factors for atherosclerosis which can manifest as cardio-reno-cerebrovascular disease. Brassica oleracea var. capitata L. forma rubra or red cabbage is considerable as potential herbal with anti-hyperlipidemia effect, the role of its anthocyianin compound. The aim of this study was to investigate anti-hyperlipidemia effect of red cabbage juice based on cholesterol and triglyceride parameters. Mice were given additional food consist of egg yolk (80%), 65% sucrose solution (15%) and animal fat (5%) for 14 days. Thirty mice were divided into 6 groups: normal (I), negative (II) and positive controls (III), and test groups which given red cabbage juice, dose of 0.13 g/20 g mice (IV), 0.26 g/20 g mice (V) and 0.52 g/20 g mice (VI). Cholesterol and triglyceride levels were measured at 21st day and result of cholesterol levels were 88±10.3 mg/dL (I), 148±5.9 mg/dL (II), 93±7.1 mg/dL (III), 114±8.4 mg/dL (IV), 101±10.5 mg/dL (V), 94±16.7 mg/dL (VI) meanwhile triglyceride level were 59±3.6 mg/dL (I), 80±2.9 mg/dL (II), 64±3.1 mg/dL (III), 77±2.4 mg/dL (IV), 69±6.1 mg/dL (V) dan 69±5.0 mg/dL (VI). Cholesterol and triglyceride levels were not significantly different between group V and VI with group III (p<0.05). It showed anti- hyperlipidemia effect of red cabbage in lowering cholesterol and triglyceride levels.
Keywords: Red cabbage, Brassica oleracea, anti-hyperlipidemia, cholesterol, triglyceride.
INTRODUCTION
Hyperlipidemia is a disease characterized by hypercholesterolemia hypertriglyceridemia, or both. High levels of cholesterol triglycerides accelerate the progression of atherosclerosis. Framingham heart study showed the highest incidence for new cases of coronary heart disease (CHD) found in the group with highest lipid and lipoprotein concentrations(1). Hyperlipidemia treatment generally begin with lifestyle modification and if it's not adequate, anti- hyperlipidemia drugs were used. In addition to synthetic drugs, utilization of traditional medicine with natural ingredients derived from plants is increased(2). Consumption of flavonoid in plants regularly can protect the body from CHD and other degenerative diseases(3). Flavonoids can reduce LDL sensitivity against free radicals and act as antioxidant, has anti-inflammatory and hypolipidemic effect(4). Anthocyanin pigments is one of flavonoid that have been studied to have beneficial effect on mammal cells such as antioxidant, anti-mutagenic, hepatoprotective, anti-hyperlipidemia and anti- hypertensive effects. Anthocyanin is presumed to inhibit cholesterol absorption in the gastrointestinal tract and can inhibit cholesterol synthesis in the liver(5). Red cabbage (Brassica oleracea var. Capitata L. forma rubra) contain cyanidin cyanidin, a purple colored anthocyanin which water soluble. Cyanidin in red cabbage is 113 mg/100 g(6). The use of red cabbage to decrease cholesterol has been used empirically, but no pre-clinical trials to ensure the efficacy of red cabbage as anti-hyperlipidemia.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 108
ISBN : 978-602-72418-2-4
MATERIAL AND METHODS
Preparation of Materials. Red cabbage juice was prepared from fifty grams red cabbage by using a juicer. Additional food with the composition of egg yolk (80%), 65% sucrose solution (15%) and animal fat (5%) was prepared for 20 mL by mixing all the components homogeneously. The food was fresh for each day. Animals and Treatment. Thirty mice were acclimatized for a week to adjust the environment, health and weight control, and uniform the food. Mice were divided into 6 groups: I (normal control) were given standard food and distilled water; II (negative control) were given 1 mL/day additional food followed by 1% CMC solution; III (positive control) were given 1 mL/day additional food followed by 0.026 mg/20 g simvastatin; IV (low dose) were given 1 mL/day additional food followed by 0.13 g/20 g mice red cabbage juice; V (medium dose) were given 1 mL/day additional food followed by 0.26 g/20 g mice red cabbage juice; VI (high dose) were given 1 mL/day additional food followed by 0.52 g/20 g mice red cabbage juice. Additional food was given for 14 days to all groups except the normal group and continued by test materials in accordance with the treatment in each arm for 7 days. Blood collection performed on days 0, 14, and 21. Measurement of Total Cholesterol and Triglyceride Concentration Total cholesterol and triglyceride determined by using Biolabo, a commercial reagent. Intravenous blood was taken via the tail for 0.1-0.2 mL. It was collected in eppendorf tubes with EDTA as an anticoagulant. Blood was centrifuged for 10 minutes at 3000 rpm. Ten L of plasma was analysis in accordance to procedure at the package insert, by spectrophotometry method.
RESULTS AND DISCUSSION
Measurement of total cholesterol and triglyceride concentration at day 0 was conducted to determine the baseline level. The result showed concentration total cholesterol were range between 99.2±3.56 – 104.4±6.84 mg/dL. It met the requirements of normal blood total cholesterol concentration in mice, 55- 128 mg/dL. The concentration of triglyceride in mice on day 0 conditions ranged between 40.4±5.03 – 49.4±3.05 mg/dL. The data met the requirement of normal blood triglyceride concentrations in mice, 13- 67 mg/Dl(7). Kolmogorov-Smirnov and Levene test showed no significant difference between groups mean normal and homogeneous data. One-way ANOVA showed no significantly different between groups for cholesterol (p=0.789) and triglyceride (p=0.077) concentration. Measurement of total cholesterol and triglyceride on day 14 was conducted to determine whether the mice in group II, III, IV, V, and VI being hypercholesterolemia after given additional food. There were significant increase in mean total cholesterol concentrations ranged 165.2±2.95 – 184.4±11.4 mg/dL and triglyceride concentrations ranged 101.2±3.49 – 112.0±4.30 mg/dL compared to Group I. Kolmogorov- Smirnov and Levene test showed no significant difference (p>0.05) between groups, mean a normal and homogeneous data. One-way ANOVA test showed no significant different for total cholesterol (p=0.640) and trigyceride (p=0.840) concentration. Measurement of total cholesterol and triglyceride concentration on day 21 was conducted to determine effect of the treatment. One-way ANOVA showed significance difference between groups for total cholesterol and triglycerides (p= 0.00) thus LSD test was performed to explore further and compare the mean of one group with the mean of another. Figure 1 a,b showed mean of total cholesterol and trigyceride concentration on day 0, 14 and 21.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 109
ISBN : 978-602-72418-2-4
da
Normal control
Negative control
Positive control
Low dose
Medium dose
High dose Triglyceride conc
Totalcholesterol conc (mg/dL)
Figure 1a. Mean of total cholesterol Figure 1b. Mean of triglyceride concentration. concentration.
Summary of LSD test can be found in Table 1 and 2.
Tabel 1. Summary of LSD test for total cholesterol concentration. Group Mean I II III IV V VI I 87,60 II 148,40 * III 92,80 * IV 114,40 * * * V 100,60 * * VI 94,20 * * Note: * no significantly different.
Tabel 2. Summary of LSD test for triglyceride concentration. Group Mean I II III IV V VI I 59,20 II 79,60 * III 64,00 * IV 77,20 * * V 69,20 * * * VI 68,60 * * * Note: * no significantly different.
The Tables showed that low, medium and high dose groups had lower mean concentration of total cholesterol and triglycerides compared to negative control. Medium and high dose groups showed no significant different compare to positive controls, mean red cabbage juices had the same ability with simvastatin in lowering total cholesterol and triglyceride concentrations. Total cholesterol concentration close to normal levels. Lower concentration of total cholesterol and triglyceride after treatment of red cabbage juice allegedly because Anthocyanin- cyanidin which has hypolipidemic effect. The underlying mechanism possibly by increasing the activity of LDL receptors in the liver so that activated LDL catabolism. A decrease in total cholesterol and triglyceride concentration may be associated with a decrease in the concentration of plasma LDL in which the two compounds are constituent of LDL molecules. Anthocyanin is suspected to inhibit the absorption of cholesterol in the gastrointestinal tract or inhibit cholesterol synthesis in the liver(3). High fiber contained in red cabbage can also be able to lower total cholesterol concentration(8). International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 110
ISBN : 978-602-72418-2-4
CONCLUSION
Red cabbage juice can decrease concentration of total cholesterol and triglyceride in hyperlipidemia mice; Reduction level of medium and high dise as effective as simvastatin, close to normal levels for cholesterol where dosage II is the most effective for lowering the concentration of total cholesterol and triglycerides.
ACKNOWLEDGMENTS
The Authors are Grateful to Pharmacy Faculty of Pancasila University for Incentive Research Funding.
REFERENCES
1. Murray RK. Biochemistry harper. XXII Edition. Translated by A Hartono. EGC. Jakarta: 1995. p. 252-93, 308-10. 2. Kelompok kerja ilmiah. Penapisan farmakologi, pengujian fitokimia dan pengujian klinik. Jakarta: Yayasan Pengembangan Obat Bahan Alam Phyto Medica; 1993. h.191. 3. Davalos A, Fernandez-Hernando C, Cerrato F, Martinez-Botas J, et al. Red grape juice and polyphenols alter cholesterol homeostasis and increase LDL-receptor activity in human cells in vitro. J Nutr, 2006. 136. 1766-1773. 4. Middleton E, Kandaswami C, Theoharides CT. The effect of plant flavonoids on mammalian cells: implication for inflammation, heart disease, and cancer. Pharmacological Reviews, 52 (4).2000.673- 751. 5. Huang D J, Lin C D, Chen H J, Lin Y H. Antioxidant and antiproliferative activities of sweet potato (Ipomoea batatas L. Lam Tainong 57) constituents. Bot Bull Acad. Sin, 45: 179-186. 6. Kwon SH, et al. Anti-obesity and hypolipidemic effects of black soybean anthocyanins. JM Food. 2007. 10 (3).552-556. 7. Fox GJ, Barthold WS, Davisson TM, Newcomer EC, Quimby WF, Smith LA. The mouse in biomedical research: normative biology, husbandry, and model. 2nd edition. UK: Academy Press; 2007. P. 188. 8. El mowafy, A. Maha. Treatment effect of red cabbage and cystein against paracetamol induced hepatotoxicity in experimental rats. Journal of Applied Science Research. 2012; 8(12): 5852-5859.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 111
ISBN : 978-602-72418-2-4 Hepatoprotective Study of Cosolvent Solution From Mangosteen (GARCINIA MANGOSTANA L.) Rind in Rats
ROS SUMARNY*, LILIEK NURHAYATI, YATI SUMIYATI, ASTRI YULIASTRI PERMANA
Faculty of Pharmacy, Pancasila University, Jakarta, Indonesia.
Email: [email protected]
Abstract: Garcinia mangostana L. rind consist of -mangostin, an active compound that considerably can protect the liver -mangostin which prepared as cosolvent solution and ethanolic extract suspension. This was experimental study where hepatoprotective effect was assessed using Aspartate transminase (AST) and Alanine transminase (ALT). Twenty five rats were divided into 5 groups: negative (I) and positive controls (II); cosolvent (III), extract (IV) and commercial extract® suspensions (V) of 33,1 mg/kg BW -mangostin. Rats were treated for 14 days, and then induced by carbon tetrachloride to produce trichlorometylperoxyl, a free radical which cause lipid peroxidation. AST and ALT levels were analyzed by using kinetic UV method. Kruskall Wallis and Mann Whitney test were used in statistical analysis. AST levels were 207.08±9.17; 111.98±29.90; 134.54±30.00; 128.10±21.84 and 138.84± 16.62 UI/L meanwhile ALT levels were 79.18±17.29; 28.02±5.17; 37.1±5.25; 46.34±13.19 and 34.5±4.09 UI/L for group I, II, III, IV, V respectively. There were no significant differences between groups II with group III, IV and V (p<0.05) for AST, meaning comparable ability to inhibit AST and ALT increment between positive control with cosolvent and extracts solution. There were no significant differences between group III with group IV and V (p>0.05) for ALT and AST, meaning cosolvent, extract and extract® has comparable ability to inhibit enzymes increment.
Keywords: α-mangostin, Garcinia mangostana L, AST, ALT, hepatoprotective.
INTRODUCTION
Mangosteen (Garcinia mangostana L.) is a tropical fruit where mangosteen rind mostly thrown away as a waste. The rinds previously has been utilized only for tanning leather, anti-rust and textile dyes. Research showed that mangosteen rind contains many compounds that are beneficial to health such as anthocyanins, tannins, polyphenols, epicatechin and xanthone, including α-, -, -mangostin(1). Mangosteen rind extract were marketed in capsule dosage form, meanwhile it is known that mangostin has very low solubility in water (1:>10.000). Enhancement of α-mangostin solubility has been studied by Fatimah who formulates oral solution of mangosteen rind extract by using cosolvency technique(2). Liver has complex role of metabolism in the body. Hepatotoxic compounds such as carbon tetrachloride, is metabolized by liver which produce free radicals that bind unsaturated fatty acids cause lipid peroxidation and lead to liver damage(3). Antioxidant activity of mangosteen rind cosolvent solution has similarities mechanism in preventing free radicals that cause liver damage, presumed mangosteen rind has an activity as hepatoprotector. Thus, to investigate in vivo hepatoprotective activity of cosolvent mangosteen rind solution, a comparative study against mangosteen rind extracts suspension was conducted. There were two types of extracts: the same extracts of cosolvent solution (hereinafter referred as extract) and marketed extract from capsule dosage form (hereinafter referred as extract®). Levels of α-mangostin in cosolvent solution and extracts is equated, 33.1 mg/kg.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 112
ISBN : 978-602-72418-2-4
METHODS
Materials. Mangosteen rind extract solution with 8,94% α-mangostin; mangosteen rind extract capsule with 15,32% α-mangostin; curcumin; PEG 400, glycerin, aqua demineralization, Diagnostic kit for AST and ALT, alcohol 70, 80, 90 and 100%; formalin 40%; glacial acetic acid; solid paraffin; xylol; hematoxylin 2%; hydrochloric acid. Equipment. Analytical balance (Kern KB 3600-2N), laboratory glassware, rotary evaporator (Buchi R-205), rat cage, animal scales, syringes (Terumo), oral sonde, surgical tools, eppendorf tube, microcentrifuge (Kubota m6800), micropipette (Transferpette), MicroLab 300, microscope (Olympus BH2), object and cover glass. Cosolvent Solution and Extracts Suspension Preparation. Determination of mangosteen rind was performed at “Herbarium Bogoriense”, Indonesian Institute of Sciences - Cibinong. One kg of mangosteen rind powder was extracted by maceration using 70% ethanol (1:4) for 3x24 hours with stirring. The filtrate is evaporated at 400C and 120 mBar, and evaporated on a water bath to obtain a viscous extract. Solution is made from the extract by cosolvency techniques. Extract and extract® suspension were suspended into CMC. Animals. Twenty five of Sprague-Dawley strain rats were adapted to the laboratory environment for a week and divided into 5 groups: group I (negative control) were given cosolvent, group II (positive control) were given curcumin dose of 75 mg/kg bw, group III (cosolvent solution), group IV (extract suspension), group V (extract® suspension). Treatments were given for 14 days. CCl4 (dose of 1 mL/kg bw) were induced on day 14, two hours after the last administration of preparation. Blood was collected on day 16. AST/ALT measurement. 50 uL of serum was added to 500 uL mixture of R1-R2 AST/ALT (1:4); After Incubation for a minute, measurement was performed by using Microlab 300.
RESULTS
Average of AST and ALT concentration is shown at Table 1 and 2.
Table 1. Summary of Mann Whitney Test for AST (IU/L).
Group Average of AST(UI/L) a I (negative ) 207.08 ± 9.17 II (positive) 111.98 ± 29.90bc bcd III (cosolvent) 134.54 ± 30.00 IV (extract solution) 128.10 ± 21.84bcde ® bcde V ( extract solution) 138.84 ± 16.62 Note: Different sign at the same column showed significant different (p<0.05).
The analysis showed that there were significant difference between group I with groups II, III, IV, and V for levels of AST on day 16.The averages of AST levels was increasing compare to baseline. There were no significant difference between group II with group III, IV and V, showed comparable activities between curcumin dose of 75 mg/kg with cosolvent and extracts solution. No significant difference between test groups showed same activities performed by all dosage forms in lowering AST level.
Table 2. Summary of Mann Whitney Test for ALT (IU/L). Group Average of AST (IU/L) I (negative ) 79.18 ± 17.29a II (positive) 28.02± 5.17bc III (cosolvent) 37.1 ± 5.25 bdc International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 113
ISBN : 978-602-72418-2-4
IV (extract solution) 46.34 ± 13.19bdef V ( extract® solution) 34.50 ± 4.09 bdef
Note: Different sign at the same column showed significant different (p<0.05).
The result showed significant differences between group II with group III, IV, and V which mean lower activity performed by test groups compared to curcumin in reducing ALT levels. No significant difference between group III, IV and V showed the same activity in all dosage forms.
DISCUSSION
No significant difference between group I with other groups for AST and ALT parameters showed the production of trichloromethyl peroxyl, a free radicals from CCl4 damage the hepatocytes by altering cell membrane permeability cause increasing AST and ALT level in the blood, while group I gave no protection treatment(4). There were no significant difference between group II with test groups (III, IV, V) showed the test formulation have comparable activity to curcumin (dose of 75 mg/kg) as positive control in lowering levels of AST. Lower level of AST and ALT possibly caused by reduction activity of trichloromethyl peroxyl by a-mangostin so that hepatocyte damage can be prevented(5.6).
CONCLUSION
Mangosteen cosolvent, extract and extract® solutions have comparable ability in lowering levels of AST and ALT while the test formulation have similarities in reducing AST level with curcumin.
ACKNOWLEDGMENTS
The Authors are Grateful to Ditlitabmas Ditjend Dikti For Hibah Bersaing Research Funding As Dipa Kopertis Wilayah III Number 023.04.189705/2014
REFERENCES
1. Aisha AFA, Abu-Salah KM, Ismail Z, Majid AMSA. Determination of total xanthones in Garcinia mangostana fruit rind exstracts by ultraviolet (UV) spectrophotometri. J Med Plants Res 2013. 7(1):29. 2. Fatimah. Formulasi larutan oral ekstrak kulit buah manggis (Garcinia mangostana L.) sebagai antioksidan dengan teknik kosolvensi (script). Jakarta: Fakultas Farmasi Universitas Pancasila; 2013. 24-32. 3. Panjaitan, RGP, et al. Pengaruh pemberian karbon tetraklorida terhadap fungsi hati dan ginjal tikus. Makara Kesehatan. 2007. 11: 11-16. 4. Sun F, Hamagawa E, Tsutsui C, Ono Y, Ogini Y, Kojo S. Evaluating of oxidative stress during apoptosis and necrosis caused by carbon tetrachloride in rat liver. Biochem Biophys Acta. 2001. 1535: 186-91. 5. Eidi A, Mortazavi P, Bazargan M, Zaringhalam J. Hepatoprotective activity of cinnamon ethanolic extract against CCl4 induced liver injury in rats. EXCLI journal. 2012. 6. Natsume M, Tsuji H, Harada A, Akiyama M, Yano T, Ishikura H, et al. 1999. Attenuated liver fibrosis and depressed serum albumin level in carbon tetrachloride treated IL-6-deficient mice. J Leukoc Biol. 1992.66:601-8.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 114
ISBN : 978-602-72418-2-4
Immunomodulatory Activitiy of Lutein Extract From Sweet Corn Seeds (Zea mays L.) through In Vivo Measurement of Activity and Phagocytic Capacity of Peritoneal Macrophage Cells of Mice
KUSMIATI1*, YUDHA PRASETYA2, ERLINDHA GANGGA2
1 Research Center for Biotechnology–LIPI, Jl Raya Bogor Km 46, Cibinong 16911-Indonesia. 2Fac of Pharmacy–Univ. of Pancasila, Srengseng Sawah Jagakarsa, Jakarta 12640,Indonesia.
E-mail: [email protected]
Abstract: Sweet corn (Zea mays L.) is a plant that contains lutein as known to have potential as an immunomodulatory which may improve immune system function. This study was aimed to determine the potential of sweet corn extract lutein as an immunomodulatory. Identification of lutein by TLC on silica gel GF254 plate showed that Rf of extract sweet corn seed lutein was the same as Rf of lutein standard, i.e. 0.61. HPLC results showed that there was chromatogram peak at a retention time approaching the lutein standard in 3.6 minutes. Identification of the functional group of lutein extract using FTIR showed similar results with the lutein standard, i.e. there was a group C=C (Alkenyl), C-C (alkyl), -C=C (aromatic), and - OH (Hydroxyl). Immunomodulatory activity test was performed in vivo against peritoneal macrophage cells of mice induced by Staphylococcus aureus. The experiments were divided into 7 treatment groups, each group consisted of 4 mice. The lutein extract with consecutive doses of 0.15, 0.3, 0.6, and 0.9 mg/day. The results showed the highest activity and phagocytic capacity and approaching the positive control (84.5% and 682).
Keywords: Sweet corn (Zea mays L), lutein, immunomodulatory, phagocytosis, macrophage.
INTRODUCTION
Immunity is such a resistance to diseases, especially infectious diseases. The activity of the immune system can be decreased due to various factors, such as age or illness. The presence of compounds that can increase the activity of the immune system is very helpful to overcome the decline in immune system activity. One example of immunostimulatory is lutein contained in sweet corn kernels(1). Lutein is a natural pigmen belonging to the carotenoid that is easily found naturally in fruits, vegetables, and also in the seeds of sweet corn (Zea mays L.) which content of lutein (0.41 mg/100 g fresh weight)(5). Carotenoids act as antioxidants that can increase immunity and become immunomodulation in the human body. Its other benefits are to prevent eye-macular degeneration (cataracts), to protect skin from UV radiation, and to prevent of degenerative diseases due to aging (2). Results of previous studies reported that lutein has immune regulatory activity. Test in vivo in mice given lutein intake has increased proliferation of lymphocytes response stimulated by phytohemaglutinin (PHA) and has increased the production of antibodies that respond to T dependent antigen cells. Lutein and zeaxanthin compounds have physiological functions, i.e. protecting cells and tissues from oxidative damage and stimulating the immune system. Further research showed that 10 mg of lutein consumed per day by cats for 12 weeks led to an increase of the percentage of CD4 + and CD21 + lymphocytes, plasma concentrations of IgG, and NK cell activities. The results showed that lutein could stimulate cell-mediated immunity and humoral immunity in cats conducted in vivo (3,4). This research was focused to test the compounds lutein from the seeds of sweet corn (Zea mays L.) as an immunomodulation in vivo in macrophage cells obtained from mice peritoneal fluid. Macrophage
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 115
ISBN : 978-602-72418-2-4
cells are the main mononuclear phagocytic cells in tissues in the process of phagocytosis of microorganisms or other foreign molecules. Based on a research on cats, result of conversion of lutein dose was obtained at 0.3 mg for the mice (4).
MATERIAL AND METHODS
This study used sweet corn (Zea mays L.) obtained from Bogor, West Java. Animals used in this study was the strain DDY mice aged 4 months, weight 22-24 g. Before treatment mice were adapted for one week. Bacteria Staphylococcus aureus with a density of 108 cells/mL were obtained from the Faculty of Veterinary of Bogor Agricultural Institute, West Java. Phytochemical Screening. Preliminary phyto chemical screening was performed to identify the various classes of active chemical constituents i.e alcaloid, flavonoids, saponins, tannin, quinone, volatile oil, steroids / triterpenoids, and coumarin. Extraction Lutein From Sweet Corn Seeds (Zea Mays L.). One hundred gram of sweet corn seed powdered were maseraced with 1L of n-heksan for 48 hours. The extracts were collected and evaporated to dryness by rotavapor. The oleoresin was mixed with isopropanol and heated 60°C. An aqueous 50% NaOH was added slowly at 60°C with stirring for 90 min. The saponifed mixture was allowed to cool and then diluted with Deionized Water. The mixture was allowed to stand for approximately 60 min followed by addition of 4 times (v/v) deionized water. The lutein precipitate was collected using a centrifuge and it was dried under incubator vacuum at 40°C(6). Analysis by Thin Layer Chromatography. Sample of lutein extract from Sweet corn seeds (Zea mays L.) was spotted by 20 μL on the plates of silica gel 60 GF254, then eluated with the mobile phase n- hexane-chloroform-acetone (6:2:2). Analysis of Lutein from Sweet Corn (Zea mays L.) by High Performance Liquid Chromatography (HPLC). Lutein extract solution injected into HPLC. instrument. Instrument conditions were used Column SunFireTM C18 5 µm (4,6 x 150 mm), Mobile phase Methanol; Acetonitrile (70:30), Detector PDA@450 nm and Flow rate 1,0 ml/min. Identification of Lutein by FTIR. FT-IR analysis of lutein extracts from Sweet corn (Zea mays L.) was done for the purpose of functional groups associated was determined. Mice Oral Treatment. The experiments were carried out towards 7 treatment groups, each group consisted of 4 mice. Each group was given treatment 0.5 mL orally every day for 14 days. Group I was given Stimuno (positive control), group II was given non-cholesterol oil (negative control), group III was given distilled water (normal control), group IV-VII consecutively were given extract lutein doses of 0.15, 0.3, 0.6, and 0,9mg/day. Phagocytosis Test. Mice were infected with bacteria S. aureus suspension intraperitoneally, then were incubated for one hour. Mice were euthanated, dislocated, then their stomachs were dissected. Peritoneal fluid containing macrophages was pippeted and preparate was made. The liquid was fixed with methanol and stained with Giemsa. The preparate rinsed, dried and observation under a microscope. Phagocytosis macrophage activity and capacity was calculated (8). The data of effect of various doses of lutein extract from the seeds of sweet corn on the activity and phagocytic capacity of macrophage cells were analyzed using one-way ANOVA, followed by Duncan test.
RESULTS AND DISCUSSION
Determination of Water Content by Karl Fischer. The water content average of sweet corn seed powder obtained was 9.31%. The result qualifies for simplicia powder according Herbal Pharmacopoeia, i.e. below 10%. Phytochemical Screening. Pollen grains of sweet corn (Zea mays L.) contains compounds of flavonoids, saponins, steroids/triterpenoids, and coumarin, while the hexane extract contains steroids/triterpenoids and coumarin. Lutein Extraction of Sweet Corn Seed. Yield of sweet corn lutein extract obtained was at 1.035% with a value of DER-native was at 96.62.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 116
ISBN : 978-602-72418-2-4
Analysis Of Lutein Using Thin Layer Chromatography. Results showed that there was yellow spotting on samples of sweet corn seed lutein which was the same with the standard reference of lutein with Rf value of 0.61 and hRf 61. Lutein Analysis Using FTIR. Analysis of the comparative standard lutein compounds and lutein extract of sweet corn seeds with a fourier transform infrared spectrophotometer (FTIR) showed a similar infrared spectra (Figure 1).
Figure 1. The infrared absorption spectrum of lutein standard (left) and lutein extract of sweet corn seed (right).
Table 1. Analysis of spectrum of lutein standard and lutein extract of seed sweet corn (Zea mays L.) by FTIR. Waves (cm-1) Lutein Function Cluster Reference BP Lutein Extract 717.47 723.26 847.66 844.76 Alkenyl 675 995 930.59 923.84 – C = C 987.49 958.56 1325.97 1351.04 1350.08 Alkyl 1406.97 1409.87 1340 1470 – C C 1441.69 1465.80 – 1469.66 Aromatic 1662.52 1664,45 1600 – 1680 – C = C 3317.34 Hidroxy 3370.37 3345.30 3300 - 3600 -OH 3422.45
Lutein Analysis Using High Performance Liquid Chromatography. Chromatogram observations was done by comparing the results of the HPLC of lutein from the seeds of sweet corn (Zea mays L.) with lutein standard reference (Figures 2). 0.020 0.020
0.015 3.681 0.015
0.010 0.010 AU AU
0.005 0.005
3.635 0.000 0.000 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 Minutes Minutes Figure 2. HPLC Chromatogram of lutein standard (left) and Sweet Corn Seed Lutein (right).
Table 2. Results of lutein standard and lutein extract of Zea mays L by HPLC. Name Retention Time(min) Area Lutein Level (bpj) 1 Lutein Standard 10 ppm 3.681 112524 10 2 Lutein Extract 3.635 8816 0.78
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 117
ISBN : 978-602-72418-2-4
Phagocytic activity and capacity of macrophages. Phagocytic activity of macrophages of each group listed in Figure 3.
100 e c d b c a a 50
0 agositic Activity (%) (%) Activity agositic
Ph I II III IV V VI VII Treatment Groups
Figure 3. Percentage macrophage phagocytic activity of peritoneal fluid of mice against the use of lutein from seeds Sweet Corn (Zea mays L.).
An increase in phagocytic activity after the administration of lutein extract of seeds Sweet Corn (Zea mays L.) for 14 days with a dose of 0.15mg/mice, 0.3mg/mice, 0,6mg/mouse, and 0.9 mg/mouse per day in a row was 16.51%, 30.66%, 42.45% and 52.36%. The increase in value is calculated from the difference between the phagocytic activity of each group IV, group V, group VI, and VII group reduced phagocytic activity of negative group. Figure 4 shows a fairly good linear relationship between the dose of extract lutein of Sweet Corn seeds (Zea mays L.) with the capacity of macrophages. The higher the dose of lutein, the greater the increase in phagocytic activity, up to the observation dosage 0,9mg/ mouse/day.
60 40 (%) 20 0 Phagocytic Phagocytic Activity Activity 0,15 0,3 0,6 0,9 dose of lutein (mg /mouse)
Figure 4. The increase in phagocytic activity in the treatment of various concentrations of lutein extract from seeds sweet corn (Zea mays L.) for 14 days.
800 f d e b c 600 a a 400 200 Capacity
Phagocytic 0 I II III IV V VI VII Treatment Group
Figure 5. Phagocytic capacity of macrophage cells in the peritoneal fluid of mice in the treatment of lutein extract from sweet corn seeds (Zea mays L.).
Figure 5 shows the phagocytic capacity of macrophages of each group. DMRT analysis shows a fairly good linear relationship between the dose of lutein extract of Sweet Corn seeds (Zea mays L.) with the capacity of macrophages. The higher the daily dose of lutein extract, the greater the increase in phagocytic capacity, up to the observation of a dose of 0,9mg/ mouse/day.
Sweet corn ( Zea mays L. ) were extracted to obtain lutein extract. The FT-IR analysis of the lutein seed corn was done and the functional groups associated were determined. The FT-IR spectrum of the sample was obtained effective peaks. The FTIR spectra were obtained functional group of –OH, -CH2,-C-O- and –C=O- (Table 1). Table 2 shows the results of HPLC analysis of lutein standard reference producing International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 118
ISBN : 978-602-72418-2-4
chromatogram with peak in the a retention time of 3.681 and an area of 112524. Analysis of lutein samples from sweet corn seeds shown in Figure 2 and Table 2 which shows the peak area at the retention time of 3.635 minutes and an area of 8816. It approaches the standard compound lutein that has a peak area at the retention time of 3.681.In the chromatogram, it is shown that there are two peaks in the standard samples of lutein and lutein sweet corn seeds. It is because the sample was not pure so it produced more than one peak. Lutein extract was tested the capacity of phagocytosis and activity using in vivo methods . Macrophages cells activated were given extract lutein doses of 0.15, 0.3, 0.6, and 0.9mg/day. Stimuno used as a positive control. Cells that have been stained purplish red Giemsa will consist of vacuoles and the cell nucleus. The cell nucleus color is more concentrated than the vacuole (7). The activity of the macrophages of the group I was (84% ± 2.08); Group II (53% ± 0.82); group III (51% ± 1.41); group IV (61.5% ± 1.91); V group (69% ± 1.25) and group VI (75.5% ± 2.08), and Group VII (80.75% ± 1.89). Duncan test shows that there was no difference between the distilled water control group and vegetable oil control group. Each dose of lutein extract from the seeds of sweet corn had a different activity. The higher the dose of lutein extract from the seeds of sweet corn, the higher the activity of the macrophages. The capacity of macrophages group I was (682 ± 20); group II was (427.74 ± 6.70); group III was (410 ± 12.08); group IV was (497.25 ± 13.62); group V was (563.5 ± 15.35); group VI was (608 ± 8.79); and Group VII was (647.75 ± 16.26). Duncan test shows that there is no difference between thee control group with distilled water and the group vegetable oil is no different. Each dose lutein extract from the seeds of sweet corn has a different activity. The higher the dose of lutein extract from the seeds of sweet corn, it would increase the activity of the macrophages.
CONCLUSIONS
Screening of phytochemical seed powder Sweet Corn (Zea mays L.) contained flavonoids, saponins, steroids/ triterpenoids, and coumarin, while the n-hexane extract contains compounds steroid/triterpenoid and coumarin.TLC analysis shows that lutein extract of sweet corn seeds has the same Rf with lutein standard. HPLC results of lutein extract of corn seeds showed chromatogram peak at a retention time of 3.6 minutes, the same with the lutein standard. Functional group analysis with FTIR showed the same group with a lutein standard.The administration of lutein extract from Sweet Corn seeds with different doses to mice showed the various phagocytic activity and capacity of macrophages cells. The higher the dose of lutein extract, the higher the activity and phagocytic capacity macropag cells. The lutein extract from the Sweet Corn seeds can be used as an immunomodulator that works as an immunostimulant.
REFERENCES
1. "Immunology". School of Medicine, University of South Carolina. From http://pathmicro.med.sc.edu/book/immunol-sta.html. November 2014. 2. Kusmiati, Ni Wayan SA, Swasono RT, and Mellia I. Extraction and purification of lutein from microalgal C. pyrenoidosa local strains INK. 2010. Vol. 5(1):30-34. 3. Jung I. Effect of natural oxycarotenoid on the imune function of Japanese Quails. Hungary: Department of Animal Physiology & Health, St. István University; 2009. p. 21. 4. Kim, HW, et al. Dietary lutein stimulates cell-mediated and humoral immunity in cats. 1999. Experimental Biology 99. 5. Hamulka J, Koczara J, Gronek M. Lutein content of selected polish foods and estimation of its intake. Warsaw: Warsaw Agricultural Unversity; 2005.Vol. 14/55(2): 201-206. 6. Madhavi DL, dan Kagan DI. Process for the isolation of mixed carotenoids from Plants. United States Pantent Documents, United States. 2002. 6,380,442. 7. Ellis R. Giemsa’s staining protocol for tissue sections. IMVS Division of Pathology Queen Elizabeth Hospital. 2007.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 119
ISBN : 978-602-72418-2-4 Effect of Bawang Tiwai (Eleutherine bulbosa (Mill.) Urb.) Ethanol Extract on Monosodium Urate-Induced Rat Hind Paw Inflammation
DIAN R. LAKSMITAWATI*, SITI R.RANI
Faculty of Pharmacy, Pancasila University Srengseng Sawah, Jagakarsa, Jakarta.
Corresponding email : [email protected]
Abstract: Bawang tiwai ((Eleutherine bulbosa (Mill.) Urb.) also named bawang berlian grown in Kalimantan. Local people in Kalimantan have used the bulbous of bawang tiwai for their health. Our previous research showed that the bulbous of bawang tiwai have decreased plasma uric acid in hyperuricemic rat. The aim of this study was to investigate the antiinflamation effect of bawang tiwai on Mono Sodium Urate (MSU)-induced rat hind paw inflammation. Male Sprague-Dawley rat were divided into 6 groups as follows: normal group, negative group received Sodium CMC suspension, positive group received diclofenac sodium (9mg/kg, p.o) and tests groups received different doses of bawang tiwai extract (140 mg/kgBB, 280 mg/kgBB, 560mg/kgBB, p.o). Edema was induced on the left hind paw of the rat by a subplantar injection of Mono Sodium Urate (MSU) suspension (0,4 mL 20mg/mL). At 1, 2, 4, 24, 48 and 72 hours after injection, the edema volume was measured using pletismometer and inhibitory percentage of edema was calculated. The percentage inhibition of rat hind paw edema at the doses 140 mg/kgBW, 280 mg/kgBW dan 560 mg/kgBW of bawang tiwai were 7,67%, 2,11%, 52,31% respectively and diclofenac sodium inhibited 57,44% of edema. In conclusion, this research demonstrated antiinflammatory effect of extract ethanol bawang tiwai in MSU-induced rat hind paw edema. In line with previous research of antihyperuricemic effect, bawang tiwai could be proposed further as herbal antigout.
Keywords : Eleutherine bulbosa (Mill.) Urb., monosodium urate, antiinflammation.
INTRODUCTION
Disorder of purine metabolism in human could result in gouty arthritis detected from higher uric acid level in blood. This increased uric acid level may progress to saturated uric crystal in the synovial joints that cause an inflammation. The treatment of gouty arthritis entails several approches those are by lowering blood uric acid level, increasing the urate excretion and relieving the symptoms of pain and swelling associated with inflammation at the joints. To date, the most frequently used urate lowering drug is alopurinol and antialgetics and antiinflamation drugs are groups of non steroid antiinflammation drug. The greatest disadvantage in presently available potent synthetic drugs for the treatment of inflammation lies in their toxicity and reappearance of symptoms after discontinuation especially for antiinflammation drug. The side effect of non steroid antiinflammation drug was ulcers, bleeding, kidney failure. Therefore the screening and development of drugs for their anti-inflammatory activity is still in progress and there is much hope for finding anti-inflammatory drugs from indigenous medicinal plants. Bawang tiwai ((Eleutherine bulbosa (Mill.) Urb.) also named bawang berlian grown in Kalimantan. Local people in Kalimantan have used the bulbous of bawang tiwai for their health. Our previous research showed that the bulbous of bawang tiwai have decreased plasma uric acid in hyperuricemic rat(1). The aim of this study was to investigate the antiinflamation effect of bawang tiwai in MSU-induced inflammation in rat hind paw.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 120
ISBN : 978-602-72418-2-4
MATERIAL AND METHODS
Plant Material. The plants were collected from Borneo (Kalimantan) and authenticated by Herbarium of Indonesian Institute of Science (LIPI) Bogor as Eleutherine palmifolia (L.) Merr. Their bulbous were sorted from its skin and other contaminant materials, washed by running water then cut into small pieces and dried at 50°C. The dried bulbous were grinded. Dry powder of bawang tiwai was macerated with ethanol 70% 24 hours with occasional shaking. The maceration process was repeated 4 times. The filtrat was concentrated under reduced pressure 50oC. Chemical. MSU crystal preparation. MSU crystal preparation was modified from Murakami’s method(2). Four g of uric acid (Merck) was dissolved in 800 mL of boiling water containing 24.5 mL 1N NaOH. The pH value was adjusted to 7.4, cooled gradually at room temperature, stayed overnight at 4° C, washed, and dried. Needle-like crystals were recovered and suspended in sterile saline (20mg/mL). Monosodium Urate (MSU) crystals, was used to induce the inflammation. Animal.Thirty male Sprague Dawley rats of age 2-3 months weighing 100-200 g were obtained from Laboratorium Non Ruminansia dan Satwa Harapan Fakultas Peternakan Institut Pertanian Bogor. They were fed with standard diet fed and allowed food and water ad libitum for 1 week acclimatization. They were handled according to the recomendation of local ethics commitee. They randomly divided into 6 groups as follows: normal group, negative group received CMC Na suspension, positive group received diclofenac sodium (9mg/kg, p.o) and three tests groups received different doses of Bawang Tiwai Extract 140 mg/kgBW, 280 mg/kgBW, 560mg/kgBW, p.o, respectively. The doses of Bawang tiwai extract were prepared by suspending extract with 1% of Na.CMC. Antiinflammation Evaluation. MSU crystal-induced rats paw edema and assessment of inflammation. Rats were divided into six groups each contained of five rats. Group I was normal group. The left hind paw of rat in All groups unless normal group was induced inflammation by injected intracutaneous on subplantar injection of 0.4 mL suspense MSU crystals. 9 mg/kg/BW sodium diclofenac , bawang tiwai extract (140 mg/kgBB, 280 mg/kgBB, 560mg/kgBW, p.o) were given an hour before the injection of suspense MSU crystals and is repeated for the next 3 days (at 23, 47, 71 hr). Edema on left hind paw of each rat was measured by plethysmometer at 0, 1, 2, 4, 24, 48,72 hr. Percentage of edema volume was calculated with Xn formula. The edema inhibitory activity was calculated with AUC value, according to the following formula :
Xn = (V)n – (V)o x 100% (V)o AUC0-72 = (Xn-1 + Xn) (tn – tn-1) 2 Edema inhibition percentage = (AUC0-72)0 - (AUC0-72)n X 100 (AUC0-72)0
(V) n = Volume of rat’s paw at n hr ; (V) o = Volume of rat’s paw at 0 hr. X n-1 = % of Rat’s paw edema in (n-1) hours X n = % of Rat’s paw edema in (n) hours t n = n- hours (hr) t n-1 = (n-1) hours (hr) (AUC0-72)0 = mean of AUC0-72 of negative control goup (%.hr) (AUC0-72)n = mean of AUC0-72 of test group at a dose of n (%.hr)
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 121
ISBN : 978-602-72418-2-4
RESULTS AND DISCUSSION
Data of edema volume that resulted from this study was treated as a percentage of edema. The graph and percentage values can be seen in Figure 1. Figure 1 showed that each group has different line profile. The group without treatment (negative) has higher line profile than extract group and diclofenac sodium (positive) group, whereas diclofenac sodium group showed lower line profile than negative group and extract group. These result showed that edema volume on the negative group was higher than bawang tiwai extract group. It can be said that bawang tiwai extract reduced edema volume but not as potent as sodium diclofenac.
30 25 20 15 10 5 volume (%)volume 0 0 1 2 4 24 48 72 Mean percentageMean of edema Normal Negative control Na.diclofenac 9 mg/kg EEBT 140 mg/kg EEBT 280 mg/kg EEBT 560 mg/kg
Figure 1. Mean of edema volume percentage Vs time.
Due to the different patterns of line profil between groups on the chart, we compared the strength of antiinflammatory effect by calculating area under the curve (AUC). The calculation results is shown in Table 1. Area under the curve (AUC) is a value which represents total edema volume for 72 hours observation. Table 1 showed that the biggest of AUC values was negative group and this value was significantly different from the normal group. This result indicated that MSU inflammation induction has significantly succeeded.
Table 1. Mean of AUC and percentage of edema inhibition.
Mean of AUC Groups Inhibition of edema (%) (%edema.hr) I. Normal 0,00a 0,00
II. Negative Control 1147,043b 0,00 III. Na diclofenac 9 mg/kg 488,23c 57,44 IV. EEBT 140 mg/kg 1059,028bc 7,67
V. EEBT 280 mg/kg 1122,87b 2,11 VI. EEBT 560 mg/kgBB 891,67bc 52,31
Statistical analysis showed that the AUC value of sodium diclofenac group was not significantly different with the dose of 140 mg/kg and 560 mg/kg of bawang tiwai extract groups. Calculation of International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 122
ISBN : 978-602-72418-2-4 edema inhibitory percentage of bawang tiwai extract showed that 560 mg/kg of bawang tiwai extract has 52.31% inhibit paw edema. This value statistically similar with 9 mg/kg sodium diclofenac (57.44%). Induction using monosodium urate is intended to be similiar with pathophysiology of inflammation due to accumulation of uric acid. From this study it appears that bawang tiwai has potential as an anti- inflammatory. From the results of phytochemical screening that has been done by Yulinda, there are quinones, flavonoids, tannins and alkaloids in bawang tiwai(1). Based on the supporting literature, isoeleutherine (naphthoquinone derivative) compound which isolated from the bulbs of bawang tiwai can (3) inhibit nitric oxidase activity by in vitro with IC50 value is 30 μM , where in nitric oxidase is the one of inflammatory mediator that released while inflammation mechanisms happen. It causes vasodilatation that increase capillary permeability, therefore plasma fluid move from capillaries to the tissue (extravasation) and generate an edema response.
CONCLUSION
This research demonstrated the anti-inflammatory effect of extract ethanol of bawang tiwai in MSU induced rat hind paw edema. At high doses of bawang tiwai 560 mg/kg BW, its antiinflammatory effect was significantly as same as sodium diclofenac 9 mg/kgBW, p.o.
REFERENCES
1. Yulinda. Pengaruh ekstrak etanol bawang tiwai (Eleutherine palmifolia L. Merr) terhadap kadar asam urat darah mencit yang diberi suspensi ragi dan kalium oksonat (skripsi). Jakarta: Fakultas Farmasi Universitas Pancasila; 2013: h.27. 2. Murakami Y, Akahoshi T, Kawai S, Inoue M, Kitasato H. Antiinflammatory effect of retrovirally transfected interleukin-10 on monosodium urate monohydrate crystal-induced acute inflammation in murine air pouches. Arthritis Rheum. 2002.46:2504–2513. doi: 10.1002/art.10468. 3. Kelly GS. Monograph quercetin. Alternative Medicine Review. 2011.16(2):172-194.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 123
ISBN : 978-602-72418-2-4
Acute Toxicity of Ethanolic Extract of Fenugreek Seeds (Trigonella foenum-graecum L.) on White Rats
KURNIA AGUSTINI*, SRININGSIH, JULHAM EFFENDI
Center for Pharmaceutical and Medical Technology, Agency for the Asessment and Application of Technology, BPPT, Jakarta.
correspondence author: [email protected]
Abstract: Fenugreek seed or biji klabet (Trigonella foenum-graecum L.) was known having activity to handle some of degenerative diseases such as diabetes mellitus, hypercholesterolemia and also postmenopausal symptoms. This study was conducted to investigate the safety of ethanolic extract of biji klabet on white rat, especially to count the value of Lethal Concentration 50 (LC50). This in-vivo assay referred to WHO protocols for toxicity assay of natural medicines. We used Spraque dawley white rats, female and male, 6 weeks age, which divided into one group normal and five treatment groups (1g/kgBW, 4g/kgBW, 8g/kgBW, 12g/kgBW, 16g/kgBW). Sample was given once orally then animal were monitored for two weeks. Observation of toxic effect e.g physical symptom of central nerve system, autonom nerve system and digestive system. All lethality animal were observed and LC50 were counted. Result showed that there was no toxic effect and no lethal animal until 16g/kgBW dose. We can conclude that ethanolic extract of Fenugreek is practically non toxic.
Keywords : Fenugreek seeds, Trigonella foenum-graecum L., acute toxicity.
INTRODUCTION
Fenugreek seed or Foenigraeci semen is dried seed from Trigonella foenum-graecum L., Leguminosae(1). In Indonesia, it calls Biji Klabet. Empirically, biji klabet was used for hemorrhoids, asthma, ulcers, muscle pain and often used as a preventative hair loss and skin softener. Many studies showed its activity as antidiabetic, anticancer and for hypercholesterolemia handling(2). Biji Klabet has antiandrogen activities, due to its active compounds as beta-sitosterol, palmitic-acid and stearic-acid, and also has the ability to decrease of total cholesterol, LDL, VLDL cholesterol and triglycerides significantly. The anti- hyperglycemic and anti-inflammatory properties investigated in fenugreek are additional benefit. Agustini’s study (2007) showed that ethanolic extract of Biji Klabet have estrogenic effect on ovariectomized and immature female Wistar rats(3). Biji Klabet contains some sapogenin steroid ingredients, e.g. diosgenin, precursor for sexual hormone(4), its isomer Yamogenin, gitogenin, tigogenin, and trigoneoside(5). Biji Klabet contains diosgenin in free base form 0.8 – 2.2 %(6). Biji Klabet also contains fatty oil 20-30%, alkaloids (trigonelline, an alkaloid pyridine, gentianin and karpain), flavonoids e.g. vitexin in glycoside or ester form, isovitexin, orientin, vicenin, quercetin and luteolin, essential oil, saponine, nicotinamide, choline, bitter compound and mucilage(4). This study was carried out to investigate safety effect of ethanolic extract of Fenugreek in white rat. Acute toxicity assay also known as short term toxicity assay. Sample are given once in various grade of doses and observation are carried out for two weeks. All physical symptoms and lethal animal were analysed then compare to normal group. This acute toxicity study was meant to count the value of Lethal Dose 50% (LD50) from sample. LD50 is a dose that can cause 50% lethality of animal test. Sample can categorized as safe material when they have LD50 value bigger than 15g/kgBW(7).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 124
ISBN : 978-602-72418-2-4
MATERIAL AND METHODS
Sampel preparation. Biji klabet were obtained from Tawangmangu, Central Java, Indonesia. Seed were dried and grind, then were extracted with ethanol 96% food grade. Crude extracts were suspense with Carboxy Methyl Celulose (CMC) 0.5%. Animal preparation. Experimental animals used in this study were 30 males and 30 females Spraque Dawley (SD) white rats, 5-6 weeks age, obtained from Indonesian Food and Drug Administration (FDA/BPOM). The animal were kept in the animal room (25 + 20C) under 12 h light/dark cycle and fed with standard diet of pellet rat diet and free access to distilled water prior to the start of the study. Animal were kept for acclimatization for one week. Animal were maintained and handled according to ethical committee which approved the design of the animal experiment. Ethical clearance was approve by Ethical Committee of Indonesian Agency for Health Research and Development (Badan Penelitian dan Pengembangan Kesehatan/Balitbangkes). Animal treatment. Animals were divided into one group normal and five treatment groups (1g/kgBW, 4g/kgBW, 8g/kgBW, 12g/kgBW, 16g/kgBW), each 5 males and 5 females. Sample was given once orally then animal were monitored for two weeks. Observation of toxic effects were done, e.g. physical symptom of central nerve system, autonomy nerve system and digestive system. Body weights were weighing at day 1, 6,9,12,14. After two weeks all animal were autopsied.
Table 1. Group of animal treatment. No. Groups Treatment N 1. N Normal Diet + CMC Na 0,5% suspense 5 Male + 5 Female 2. D1 Normal Diet + Sample 1 g/kgBW 5 Male + 5 Female 3. D2 Normal Diet + Sample 4 g/kgBW 5 Male + 5 Female 4. D3 Normal Diet + Sample 8 g/kgBW 5 Male + 5 Female 5. D4 Normal Diet + Sample 12g/kgBW 5 Male + 5 Female 6. D5 Normal Diet + Sample 16 g/kgBW 5 Male + 5 Female
RESULT AND DISCUSSION
All animal treated with dose 1 (1g/kgBW) until dose 5 (16g/kgBW) showed no toxic effect significantly. Normally, after orally given sample treatment, all animal showed decrease of motoric activity for some minutes. But after 30 minutes, all activity back to normal. This spontaneous effect is normal after orally gavage treatment. The results of observation of physical symptom of central nerve system, autonom nerve system and digestive system observation, can be seen on Table 2.
Table 2. Physical toxic effect observation. Groups Observation N D1 D2 D3 D4 D5 Central Nerve System 1. Sedasi ------2. Motoric Activity +/- +/- +/- +/- +/- +/- 3. Convulsion ------4. Tremor ------Autonom Nerve System 1. Open eye +/- +/- +/- +/- +/- +/- 2. Salivation ------3. Urination ------Breath Rate +/- +/- +/- +/- +/- +/- Heart Rate +/- +/- +/- +/- +/- +/-
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 125
ISBN : 978-602-72418-2-4
Groups Observation N D1 D2 D3 D4 D5 Digestive System 1. Diarrhea ------2. Constipation ------3. Bloody Fesses ------Stress hair ------Note: - : No symptom + : There are symptom +/- : Normal
Body weight analysis from all animal, both male and female, with treatment dose 1g/kgBW until 16g/kgBW gives no significant difference compare to normal control. Both male and female rats in all groups gives increasing of body weight almost similar to normal control for 14 days.
Males Body Weight 180 160 140 120 100 80 NORMA L 60 BW (gr) 40 20 0 Day1 Day 6 Day 9 Day 12 Day 14 Time Weighing-
Figure 1. Body weight of male rats from all group for 14 days observation.
Females Body Weight 160 140 120 100 NORMAL 80 DOSIS1 DOSIS2 BW (gr) 60 40 DOSIS3 DOSIS4 20 DOSIS5 0 Day 1 Day 6 Day 9 Day 12 Day 14 Time weighing
Figure 2. Body weight of female rats from all group for 14 days observation.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 126
ISBN : 978-602-72418-2-4
There was no lethality case of animal found in all group after 14 days observation. Therefor this assay should be repeat using higher level doses than 16g/kgBW. But technically it’s so difficult to treat orally to the animal. Beside that, regulation from Indonesian FDA says that if until dose 15g/kgBW no lethality case occur, then its not necessary to repeat the assay. The sample can be categorized having LD50 higher than 15g/kgBW or categorized practically non toxic. The data about lethality case can be seen on Table 3.
Table 3. Lethality case of animal from all groups. Male Female Total Groups % Lethality n Lethal n Lethal Lethal Normal 5 0 5 0 0 0% D1 5 0 5 0 0 0% D2 5 0 5 0 0 0% D3 5 0 5 0 0 0% D4 5 0 5 0 0 0% D5 5 0 5 0 0 0%
Table 4. Catagorization of Toxic Effect(8). (Lu,FC, 1996) Toxic Category LD50 Value Super toxic < 5 mg/kgBB Very hard toxic 5-50 mg/kgBB Very toxic 50-500 mg/kgBB Medium Toxic 0,5-5 g/kgBB Mild Toxic 5-15 g/kgBB Practically Non Toxic > 15 g/kgBB
CONCLUSION
No delayed toxic effect and lethality was observed in all rats during fourteen days of recovery period. Orally treatment of Fenugreek within this range and treatment duration would not cause any severe toxic effects and organ damages in rats. In conclusion, ethanolic extract of Fenugreek have pseudo LD50 and categorized as practically non toxic.
REFERENCES
1. General guideline for methodologies on research and evaluation of traditional medicine. Geneva: World Health Organization. 2000. 2. Mills, Simon & K Bone. Principles and practice of phytoterapy. Modern Herbal Medicine. Churcill Livingstone, Edinburgh. 2000. xx + 643p. 3. Agustini K, Sumali W, Dadang K. Estrogenic effect of Fenugreek (Trigonellafoenum-graecum L.) on white female rats. Conference Proceedings "Women's Health and Traditional Medicine", International Medicine and Medicinal Plants, Surabaya. 2007. 4. Evans CW. Pharmacognosy 15th edition. London: W.B. Saunders. 2002. 5. Dewick PM. Medicinal natural products. A biosynthetic approach. New York: John Wiley & Sons.1997. 6. Wiryowidagdo S. Kimia dan farmakologi bahan alam. Jakarta: Universitas Indonesia; 2001.318- 328. 7. Lu FC. Toksikologi dasar, asas, organ sasaran dan penilaian resiko. [Translate by Edi Nugroho]. Ed. 2, Jakarta:UI Press. 1995.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 127
ISBN : 978-602-72418-2-4
Antihypertensive and Diuretic Effects of the Ethanol Extract of Colocasia esculenta (L.) Schott. Leaves
RINI PRASTIWI*, SISKA, ERVINA BHAKTI UTAMI, GIGIH PANGESTU WITJI
Department of Pharmacology, Department of Phytochemical, Department of Clinical Pathology: Pharmacy and Science Faculty Muhammadiyah Prof. Dr. Hamka University, Jakarta.
Abstract: Colocasia esculenta (L.) Schott (CE) is traditionally used for the treatment of various ailments such as high blood pressure, diarrhea, rheumatic pain, pulmonary congestion, etc. Hence in present study, the effect of Ethanol extract of CE leaves (EECE) was evaluated for antihypertensive and diuretic activity in rats. Male Sprague dawley rats were randomly divided into five groups (n=5), and treated as follow: Positive control group (hydrochlortiazide 0.2569 mg / 200g), negative control (NaCl 8%) and EECE (20, 40 and 80 mg / 200g) was given 14 days. The parameters systole blood pressure (SBP) and diastole blood pressure (DBP) was estimate by Kent Scientific's CODA Non-invasive Blood Pressure on the days 0, 15 and 29. Diuretic activity of EECE was studied based on the volume of urine for 6 hours and measuring the levels of sodium in urine 24 hours. The result of the study showed that EECE 40 mg/200 g/day significant (p<0.05) decreased in SBP 16.07% and in DBP 13.67%. EECE 40 mg/200 g/day showed positive diuretic activity and significantly (p<0.05) increased sodium levels in urine. Preliminary phytochemical evaluation revealed the presence of saponins, tannin, triterpenoid and flavonoids in EECE.
Keywords : Colocasia esculenta, antihypertensive, diuretic activity, NaCl induced, flavonoids.
INTRODUCTION
Hypertension is an increase blood pressure (BP) above normal and permanent, or when systole blood pressure (SBP) is above 140 mmHg and diastole blood pressure (DBP) above 90 mmHg(1). Pharmacological therapy for hypertension is using synthetic drugs. Hypertension drugs are use in long term lead to increase cost and side effects. Medicinal plant which is owned by Indonesia has enough potential to be utilized and developed as raw materials and herbal medicines. Herbal medicines for therapy is also no longer something new to the community. In line with the trend of 'back to nature' that developed among the public at this time, the use of herbal as alternative medicine continues to grow bigger. One of the them is used as an alternative medicine are the leaves of taro (Colocasia esculenta (L.) Schott.) (CE)(2). Taro is known as the tuber which can be used as food substitute. All parts of this plant can be used for treatment, including the petiole and leaf. The content of the active compounds in CE is polyphenols. Taro leaves have medicinal properties as diarrhea, arthritis, pulmonary edema(3). And based on previous research was showed that taro leaf aqueous extract at a dose of 400 mg/Kg has efficacy as an antihypertensive and diuretic activity(4).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 128
ISBN : 978-602-72418-2-4
MATERIAL AND METHODS
Collection and identification of plant material. The leaves of Colocasia esculenta (CE) were collected from Badan Penelitian Tanaman Rempah dan Obat (BALITRO), Bogor, Indonesia. The plant specimen was authenticated and herbarium was deposited at Indonesian Institute of Science, Cibinong, Indonesia. Preparation of Ethanol extract of CE leaves (EECE). The leaves were dried under the shade and powdered using a grinder mixer. The powdered material (25 g) was filled in soxhlet apparatus containing 250 mL of ethanol 70%. The obtain filtrate was concentrated and stored in a desiccators till use(5). Drug and Chemical. Hydrochlorthiazide (HCT) and sodium chloride were obtained from PT. Kimia Farma (Bandung, Indonesia), sodium estimation kit (Research Lab, Indonesia), polysorbat 80, ethanol 70% and other reagents used were purchased from local vendor from Jakarta, Indonesia. Preparation of Drug Solution. EECE and HCT were powdered and suspended in 1% polysorbat 80 in distillled water. Sodium Chloride (NaCl) was powdered and dissolved in distillated water. All solutions were prepared freshly and stored in glass bottles. Preliminary phytochemical evaluation of EECE. EECE was subjected for the qualitative analysis by using the standard phytochemical test to evaluate the presence of various phytoconstituens. Effect of EECE on NaCl 8% induced hypertension in rats. Male Sprague dawley rats (3-4 month old, weight between 150 and 200 g) were randomly divide into five groups (n=5) and treated as follows: negative control (NaCl 8% induced); positive control (HCT 0.2569 mg/ 200 gBW); EECE 20, 40, 80 mg/ 200 gBW. NaCl 8% induced given orally 3 ml/ day in rats every day for 28 days to obtain the condition of hypertension. EECE and HCT provided during the last 14 days orally once daily according to the group. Systolic blood pressure (SBP) and diastolic blood pressure (DBP) was estimated for each animal on day 0 (zero), 15 and 29. Blood pressure measurements made by the indirect method using a Kent Scientific's CODA Non-invasive Blood Pressure. Diuretic activity of EECE in rats. Diuretic activity was determinate by following methods of Depkes RI(6), with minor modification. Male Sprague dawley rats (2-4 month old, weight between 150 and 250 g) were randomly divide into five groups (n=5) and treated as follows: negative control (NaCl 4.5% and tween 80 1%); positive control (HCT 0.514 mg/ 200 gBW); EECE 20, 40, 80 mg/ 200 gBW. The rats were fasted overnight (18 hr) prior to the test. After that, the rats were given an oral loading NaCl 4.5% of 2 mL/ 200 gBW and the treatment according to each group. Immediately after administration, the rats were placed in metabolism cages. Urine volume was collected and calculated at 6 hr and sodium level was estimated using urine 24 hr. Statistical analysis. The results were expressed as mean ± S.E.M (n=5). The statistical comparison was carried out by one way ANOVA followed by LSD test. The result were considered statistically significant when p < 0.05.
RESULTS AND DISCUSSION
Preliminary phytochemical evaluation of EECE. Preliminary phytochemical evaluation revealed the presence of saponins, tannin, triterpenoid and flavonoids in EECE. Effect of EECE on NaCl 8% induced hypertension in rats. The administration of NaCl 8% in rats for 28 days showed increase in SBP and DBP. The treatment with EECE and HCT showed significantly (p < 0.05) decrease in SBP and DBP as compared with negative control. EECE (40 mg/ 200g) showed the greatest reduction in SBP 16.07% and DBP 13.65% but the effect is still smaller as compared with HCT.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 129
ISBN : 978-602-72418-2-4
25 19.72 20 16.07 15 12.57
10 4.15 5
0 NaCl 8% HCT EECE 20 EECE 40 EECE 80 -5 mg/ 200g mg/ 200g mg/ 200g % Blood Pressure % Systole -10 -8.69 -15
Figure 1. Effect of EECE on systole blood pressure in NaCl 8% induced hypertension. Value are expressed as mean ± S.E.M (n=5).
20 16.54 15 13.65 10.51 10
5 4.22
0 NaCl 8% HCT EECE 20 EECE 40 EECE 80
% Diastole Blood Pressure Pressure % Blood Diastole mg/ 200g mg/ 200g mg/ 200g -5
-6.37 -10
Figure 2. Effect of EECE on diastole blood pressure in NaCl 8% induced hypertension. Value are expressed as mean ± S.E.M (n=5).
Diuretic activity of EECE in rats. The administration of EECE and HCT showed a significant (p<0.05) increase in urine volume as compared with negative control group at 6 h. Analysis sodium levels with clinical photometer showed that EECE and HCT significantly (p<0.05) increase sodium content in urine 24 h. EECE 40 mg/ 200g showed the greatest diuretic effect 142.50% and sodium levels but the effect is smaller than HCT.
Table 1. Effect of EECE on percentage urine volume 6 h and sodium levels in 24 h urine volume. Value are expressed as mean ± S.E.M (n=5). Treatment Urine Volume 6h (ml) Diuretic percentage (%) Sodium levels (meq/L) Negative control 1.4±0.32 74.70±11.65 98.48±2.45 HCT 6.1±0.76 240.68±9.56 268.92±7.87 EECE 20mg/ 200g 2.44±0.34 91.24±8.06 138.18±3.53 EECE 40mg/ 200g 3.94±0.19 142.50±10.88 161.12±3.87 EECE 80 mg/ 200g 2.56±0.51 90.21±9.73 133.23±3.59 International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 130
ISBN : 978-602-72418-2-4
Sodium Chloride (NaCl) as an inducer experimental hypertension was studied. The administration NaCl 8% for 28 days has been managed to increase blood pressure(7). NaCl shows hypertensive action through increasing plasma volume, cardiac output and ultimately increase in BP(8). BP measurements by the indirect method using a Kent Scientific's CODA Non-invasive Blood Pressure. This device is works by recording systolic and diastolic blood pressure simultaneously through a transducer that is in the tail-cuff(9). In the present study, the administration of NaCl 8% for 28 day showed increase in SBP and DBP. BP was significantly decreased after the treatment with EECE 20 and 40 mg/ 200g. Herbal plants used as diuretic in traditional medicinal system might be useful in the treatment of hypertension. In the present study, EECE at a dose of 40 mg/ 200g showed positive diuretic activity at 6 h, as evident from the diuretic percentage. Furthermore, EECE showed significant increase in sodium content of urine at 24 h but the result revealed the weak diuretic activity of EECE. The results showed that there was an increase in the activity of the first dose to the second dose. But at the third dose of the extract decreased the activity of diuretics when compared with the second dose. This is possible because the levels of the compounds that are too high, causing a decrease in affinity so that the effects produced are not in accordance with the increase in dose (10). The preliminary phytochemical investigations in the present study revealed the presence of flavonoid, saponins, tannins and triterpenoid. The flavonoids isoquercitrin showed inhibition of ACE activity (11). Flavonoids suspected to have efficacy as a diuretic to stimulate blood flow to the kidneys and lead to the inhibition of tubular reabsorption of water and ions that cause diuretic effect (12). The result of the present study were suggested that the flavonoids presence in EECE may be responsible for the antihypertensive and weak diuretic effect.
CONCLUSION
Our result show that the greatest effect of antihypertensive and diuretic is EECE 40 mg/ 200g but the effect still lower than HCT. Futher studies are necessary to be performed for the purification, isolation and characterization of the pyhtoconstituens responsible for the anthypertensive and diuretic effect and to explore the exact mechanism of the action.
REFERENCES
1. Priyanto. Farmakoterapi & terminologi medis. LESKONFI. Depok. 2008; 183. 2. Wasito H. Obat kekayaan Indonesia. Graha Ilmu. Yogyakarta. 2011; 5-7. 3. Departemen Kesehatan RI. Inventaris tanaman obat Indonesia (II). Departemen Kesehatan Republik Indonesia, Jakarta. 1993: 145. 4. Vasant, Otari Kishor et al.. Antihypertensive and diuretic effect of the aqueous extract of Colocasia esculenta Linn. Leaves in experimental paradigms. Iranian Journal of Pharmacutical Research. 2012; 11(2): 621-634. 5. Voight R. Buku pelajaran teknologi farmasi. Terjemahan : Soendani NS. Gadjah Mada University Press. Yogyakarta. 1995: 561-577. 6. Depkes RI. Penapisan farmakologi, pengujian fitokimia dan pengujian klinik. Depkes RI Pusat Pemeriksaan Obat dan Makanan. Jakarta. 1993: 49-51. 7. Lailani Mutia, Zulkarnain Edward, Rahmatina BH. Gambaran tekanan darah tikus wistar jantan dan betina setelah pemberian diet tinggi garam. Jurnal Kesehatan Andalas. Fakultas Kedokteran Universitas Andalas. Padang. 2013: 146-149. 8. Dipiro JT. et al. Pharmacotherapy principles & practice. McGraw-Hill. United Stated of America. 2008: 143, 148-154. 9. Kent Scientific Corporation. Buku panduan CODA™ non-invasive blood pressure. Kent Scientific Corporation. 2011: 6.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 131
ISBN : 978-602-72418-2-4
10. Bourne, Henry R, & Mark von Zastrow. Basic and clinical pharmacology. Editor: Bertram G. Katzung. Department of Pharmacology University of California. San Francisco. 2012: 12-16 11. Junior, Arquimedes Gasparotto et al. Antihypertensive effect of isoquercitrin and extract from Tropaeolum majus L.: Evidence for the Inhibition of Angiotensin Converting Enzym. Journal of Ethnopharmacology. 2011; 134: 363-372. 12. Patel Umang, Mukul Kulkarni et al. Evaluation of diuretic activity of aqueos and methanol extracts of Lepidium sativum garden cress in rats. Tropical Journal of Pharmaceutical Research. 2009; 8 (3): 215- 219.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 132
ISBN : 978-602-72418-2-4
The Antioxidant Activity of Ethanol Extract of White-Oyster Mushroom (Pleurotus ostreatus ( Jacq) P Kumm) in Decrease MDA and Increase the Activity of Catalase in Mice Hypercholesterolemia
VERA LADESKA,PRIYANTO,JUJU JUMIATI
Faculty of Pharmacy and Sciences, Prof.Dr.HAMKA Muhammadiyah University.
Abstract: This study aimed to determine the effect of the 70% ethanol extract of white oyster mushroom in decrease the levels of MDA and increase the activity of catalase mice hypercholesterolemia.This study uses 6 groups: normal group,positive group which was given atorvastatin 5.2 mg/kg BW, negative group and 3 treatment groups were each given ekstract. Treatment animals fed cholesterol for 28 days to undergo hypercholesterolemia and then given treatment for 14 days. On day 44 of MDA and catalase were measured using a spectrophotometer UV-Vis. Test one way ANOVA statistical analysis showed white oyster mushroom extract dose of 168 mg/kg BW comparable to the positive control group in decreasing the MDA and increase the activity of catalase. White-Oyster mushroom extract dose of 168 mg/kg BW can lower the levels of MDA and increase catalase activity comparable to atorvastatin 5.2 mg/kg BW.
Keyword : White-oyster mushroom, antioxidant, MDA, activity of catalase.
INTRODUCTION
Coronary heart disease is the leading cause of morbidity and mortality in industrialized countries and resulted in approximately 30% of deaths in the United States, heart disease is also in Indonesia tends to increase as the primary cause of death. One of the causes of coronary heart disease is atherosclerosis. Atherosclerosis is the hardening of the arteries due to a change, loss of elasticity and narrowing of blood vessels, although the cause is uncertain but one of the main risk factors are the increased levels of blood cholesterol (hypercholesterolemia). Prevention of atherosclerosis can be done by inhibiting LDL oxidation using antioxidants found in many foodstuffs(1). Malonildialdehide (MDA) is one of the end products manufactured for lipid peroxidation and membrane damage by free radicals. MDA spread and increase udema cells and affect the permeability of blood vessels, causing platelet aggregation, causing inflammation and reduce the activity of the enzyme, whereas catalase is an enzyme that converts H2O2 into water and oxygen, the role of catalase is very important because H2O2 is very dangerous for the life of cells, both in shape or after changing into hydroxyl radicals (OH*)(2). Terpenoids are the most active antioxidant compounds in white-oyster mushroom, test results of antioxidant activity with DPPH that the ethyl acetate fraction oyster mushroom produces IC 50 73.24 ug / ml(3). The test results of antioxidant activity of 70% ethanol extract of white oyster mushroom with (4) DPPH methode IC50 79.03 ug / ml and water extract of oyster mushroom 94.47 ug / ml . Feeding raw oyster mushroom, oyster mushroom stew, white oyster mushrooms grilled and fried oyster mushroom can decrease levels of plasma MDA by 66.92%, 57.21%, 63.59% and 36.81%(5). In the previous study 96% ethanol extract of white oyster mushroom with a dose of 30 mg / kg BW and 60 mg / kg BW can lower the concentration of cholesterol in the blood of mice by 53.89% and 66.43%.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 133
ISBN : 978-602-72418-2-4
MATERIALS AND METHODS
Drug Test. White-oyster mushroom determined in Bogoriense Herbarium, Research Center for Biology LIPI-Botany-Bogor. Mushroom weighed as much as 13 kg were cleaned, then dried under direct sunlight then were crushed by a blender.Dried powder obtained is then extracted using 70% ethanol and suspended in Na-CMC 5% before tested on experimental animals. Induction hypercholesterolemia performed by administering food ingredients consisting of 12% egg yolk. Experimental Protocol. Mice were divided into 6 groups each consisting of 4 mice .The weight of all mice was taken before starting the research. All mice were fed with atherogenic to induce hypercholesterolemic by feeding a high cholesterol (except the normal group) for 28 days. On day 29 mice were treated for 14 days as follows: Group 1 nornal mice were given standard food, group 2 mice hypercholesterolemia as a negative control, group III: Mice hypercholesterolemia + Atorvastatin 5.2 mg / kg BW as positive control. Group IV: Mice hypercholesterolemia + extract of white oyster mushroom dose of 42 mg / kg BW, group V: Mice hypercholesterolemia + extract of white oyster mushroom dose of 84 mg / kg BW and Group VI: Mice hypercholesterolemia + extract of white oyster mushroom dose of 168 mg / kg BW. On day 29 and on day 43 taking blood through the venous sinus orbital. Biochemical Analysis in Blood. Mice were anesthetized with ketamine and taking blood through the venous sinus orbital using capillary tube. Blood sample of 1 ml volume was taken.Blood plasma and serum were separated by centrifuge at 4000 rpm rotation for 15 minutes at a temperature of 40 °C. Serum is used for the measurement of MDA while the blood plasma are used for the measurement of catalase. 1. Measurement of levels cholesterol Total Serum taken 10 mL, and then mixed with the enzyme reagent (kit) of 1000 mL, and then mixed using a homogenizer and incubated for 10 minutes at a temperature of 20-25°C or 5 minutes at a temperature of 37°C, and measured with a clinical photometer(6). 2. Determination of Levels of MDA and activity of catalase a. Determination of Levels of MDA. The sample being measured is blood plasma with the method TBA test consisting of 0.375% TBA and 15% TCA in HCl 0.01 N. Blood plasma taken 250 µl, then add 3.0 ml TBA heated in boiling water for 15 minutes, then cool the tube at room temperature, centrifugation at 1000 rpm for 15 minutes. Absorbent supernatant was measured at a wavelength of 532 nm. MDA calculated based on the molar extinction MDA (1,56.105/ μmolar cm)(7). b. Determination of catalase activity. Determination of catalase activity by measuring levels of peroxide based on the molar extinction coefficient of 43.6 M/cm. Then work peroxide solution made 19 mM in phosphate buffer.Catalase activity at 25 ° C was defined as micromoles of peroxide consumed per minute per ml of sample(8).
Catalase activity (unit / ml) = Δ abs / min X 1000 43.6 x ml sample ml vol Reaction
Statistical Analysis. The data obtained is of MDA and catalase activity analyzed statistically using one way analysis of variance (ANOVA) followed by the multiple comparison test tuckey.
RESULT AND DISCUSSION
Blood sample was taken after induced hypercholesterolemia, then that is the end of the blood sampling after treatment for 14 days. Before blood sampling, the mice were fasted beforehand for ± 16 hours in order to avoid the effect of increasing cholesterol levels resulting from food. Retrieval of the data obtained by high International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 134
ISBN : 978-602-72418-2-4 initial blood total cholesterol level is different in each group, the results can be seen in Table 3. Taking the blood of mice obtained from orbital venous sinus, because more blood than in other regions. Mice were anesthetized until unconscious, then the corner of the eye pierced by a capillary tube. Blood obtained microtube accommodated in the tube, then centrifuged at 4000 rpm for 15 minutes, resulting in a separation of the serum blood cells. Serum obtained is then separated into the tube microtube. Samples were tested with clinical photometer to look at total cholesterol levels. In the second blood sampling, microtube added Na EDTA as an anticoagulant to obtain plasma and blood plasma and centrifuged at a speed of 4000 rpm for 15 minutes at a temperature of 40 °C and then obtained for the measurement of MDA plasma and blood plasma for measurement of catalase activity. Malonildialdehide levels (MDA) Blood Mice. This study using TBA test method as a parameter of lipid peroxidation that occurs .The principle of measurement MDA is the reaction of one molecule of MDA with two molecules form a complex compound TBA, MDA-TBA pink that can be read with a spectrophotometer. Cholesterol can be eliminated from the body after first converted into bile acids. This process takes place with 7α-hydroxylation reaction as a key reaction that is catalyzed by 7α-hydroxylase and require oxygen, this stage causes the oxygen molecules is reduced to superoxide anion(9). Thus, the higher the concentration of cholesterol in hyperlipidemic cases can improve 7α-hydroxylase activity so that more superoxide radicals are formed and attacked the unsaturated fatty acid chains. Disconnection chain unsaturated fatty acids will produce various compounds, among others, malonilaldehyde (MDA). Results of the analysis of MDA levels from each experimental group can be seen in Table 4. Based on Table 1, the measurement results showed decreased levels of MDA. The highest levels of 3.777 ± 0.233 g / ml is the negative control group mice. High levels of MDA are influenced by feeding hypercholesterolemia causes the mice became hypercholesterolemia. This condition can increase free radicals in the body. High levels of free radicals can lead to increased levels of lipid peroxidation which the MDA as a final product. At dose levels of MDA III produces low and comparable to the positive control group. This can happen because in the white oyster mushrooms are antioxidant compounds. In the study(3) terpenoids are the most active antioxidant compounds in white-oyster mushrooms. Terpenoids white-oyster mushroom capable of donating one electron sole deciding a chain reaction with the way it reacts with radicals, and turn it into a stable product. Normality test results obtained significance value 0.261 >0.05 and homogenity test results obtained significance value 0.196 > 0.05 so that the data normally distributed and homogeneous, followed by analysis using one-way ANOVA. From the results of the ANOVA table for MDA significance value 0.000 < 0.05. This shows the significant difference between treatments. It can be concluded that the effect of the test preparation to decreased levels of MDA. Later analysis followed by Tukey's test. MDA to Tukey test showed that the positive control significantly different with all groups, except group III dose. Levels of catalase activity Mice. This test is called calorimetric method using color as an indicator. One unit of catalase activity is expressed as the amount of H2O2 (in micromoles) were destroyed by catalase per minute in each 10 µL sample. Catalase function as a catalyst to accelerate the decomposition of H2O2 into H2O and water. Catalase activity will be decreased when oxidative stress occurs. A decrease in the catalase activity associated with damage to the lipid membranes due to increased free radicals in the body. According to research3 white- oyster mushroom capable of donating one electron sole deciding a chain reaction with the way it reacts with radicals, and turn it into a product that is stable, so that the free radicals in the body decreases and increased catalase activity. Results of the analysis of the catalase enzyme levels from each experimental group can be seen in Table 5.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 135
ISBN : 978-602-72418-2-4
Table 1. Results of measurement of MDA levels. Group Average (µg/ml) ± SD Normal 1.396 ± 0.098 a Negatif 3.777 ± 0.233 b Positif 1.713 ± 0.085 c Dosis I 2.464 ± 0.173 d Dosis II 2.057 ± 0.054 e Dosis III 1.743 ± 0.110 c
Based on the Table 2, that the analysis of the activity of catalase in mice using a UV-VIS spectrophotometer showed the normal group had the highest catalase activity is 119.835 ± 7.46 unit / mL and a negative group showed the lowest catalase activity is 54.067 ± 2.97 unit / mL. Catalase activity decrease due to the condition of hypercholesterolemia causes the production of free radicals produced by high resulting in lower activity of catalase. Catalase activity increased significantly demonstrated by the third dose is 88.567 ± 4.80 units / mL.Statistically there was no significant difference between the dose III with positive control group. Normality test results obtained significance value 0.760 > α 0.05 and homogeneity test results obtained significance value 0.676 > α 0.05. ANOVA table of the results of the activity of catalase significance value 0,000 < α 0.05. This shows the significant difference between treatments. It can be concluded that the effect of the test preparation to the decrease of catalase activity. Catalase activities for Tukey test showed that the first dose group there was no significant difference in dose group II and III dose there was no significant difference in the positive control group.
Table 2. Results of measurement of catalase activity. Group Average (Unit/mL) ± SD Normal 119,835 ± 7,46 a Negatif 22,415 ± 2,97 b Positif 94,615 ± 5,61 c Dosis I 54,067 ± 5,67 d Dosis II 65,902 ± 4,09 d Dosis III 88,567 ± 4,80 c,e
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 136
ISBN : 978-602-72418-2-4
Table 3. Results of measurement of total cholesterol levels.
Measurement of Total Cholesterol Levels Group Average (mg/dl) ± SD
Repeat Total cholesterol 1 73.22
2 67.9 Normal 76.445 ± 7.427 3 84.86 4 79.8
1 249.23 2 229.75 Negatif 249.34 ± 16.317
3 248.68
4 269.7 1 232.14
2 270.93 Positif 247.867 ± 17,428 3 251.45 4 236.95
1 260.33 2 237.14 Dosis I 242. 703 ± 13.940 3 227.49
4 245.85 1 244.03 2 241.91 Dosis II 238.582 ± 13.466 3 209.44 4 218.95
1 247.05
2 229.19 Dosis III 247.723 ±13.270 3 257.23
4 217.42
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 137
ISBN : 978-602-72418-2-4
Table 4. Results measurement MDA levels.
Measurement MDA levels Group Average (µg/ml) ± SD Repeat Absorbansi MDA levels 1 0.227 1.255 2 0.263 1.454 Normal 1.396 ± 0.098 3 0.266 1.471 4 0.254 1.405 1 0.642 3.550 2 0.675 3.733 Negatif 3.777 ± 0.233 3 0.742 4.103 4 0.673 3.722 1 0.328 1.814 2 0.293 1.620 Positif 1.713 ± 0.085 3 0.316 1.747 4 0.302 1.670 1 0.457 2.527 2 0.427 2.361 Dosis I 2.464 ± 0.173 3 0.484 2.677 4 0.414 2.289 1 0.361 1.996 2 0.382 2.112 Dosis II 2.057 ± 0.054 3 0.367 2.030 4 0.378 2.090 1 0.327 1.808 2 0.289 1.598 Dosis III 1.743 ± 0.110 3 0.311 1.720 4 0.334 1.847
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 138
ISBN : 978-602-72418-2-4
Table 5. Results of measurement of catalase activity.
Measurement of Catalase Activity Group Average (Unit/mL) ± SD Repeat Activity Catalase 1 123.89 2 118.2 Normal 119.835 ± 7.46 3 127.14 4 110.11 1 23.88 2 20.12 Negatif 22.415 ± 2.97 3 19.77 4 25.89 1 102.34 2 94.76 Positif 94.615 ± 5.61 3 89.32 4 92.04 1 51.97 2 48.03 Dosis I 54.067 ± 5.67 3 54.78 4 61.49 1 63.14 2 68.05 Dosis II 65.902 ± 4.09 3 61.87 4 70.55 1 89.19 2 81.72 Dosis III 88.567 ± 4.80 3 92.82 4 90.54
CONCLUSION
Based on the results of this study concluded that 70% ethanol extract of white-oyster mushroom (Pleurotus ostreatus (Jacq.) P. Kumm at a dose of 42 mg/ kg BW, 84 mg / kg BW, and 168 mg / kg BW was able to reduce levels of MDA and increased activity catalase. Dose of 168 mg / kg BW was able to reduce levels of MDA and increase catalase activity comparable to atorvastatin dose of 5.2 mg / kg BW.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 139
ISBN : 978-602-72418-2-4
REFERENCES
1. Trilaksani W. 2003. Antioksidan: jenis, sumber, mekanisme kerja dan peran terhadap kesehatan. Tesis. Institut Pertanian Bogor, Bogor. Hlm.12. 2. Priyanto. Toksikologi, mekanisme, terapi antioksidan dan penilaian resiko. Editor Hadi Sunaryo. Leskonfi, Depok. 2009. Hlm.73-86. 3. Mutiasari IR. Uji Aktifitas antioksidan jamur (pleurotus ostreatus) dengan metode DPPH dan identifikasi golongan senyawa kimia dari fraksi teraktif. Skripsi. Fakultas FMIPA Universitas Indonesia, Depok. 2012 .Hlm.41. 4. Nawawi RH. Uji aktivitas, stabilitas fisik dan keamanan sediaan gel pencerah kulit yang mengandung ekstrak jamur tiram. Tesis. FMIPA Universitas Indonesia. Depok. 2012. Hlm. 94 5. Suniarti FRT. Aktifitas antioksidan jamur tiram putih (Pleurotus ostreatus) rebus, panggang dan goreng pada tikus sparague dawley hiperkolesterolemia. Tesis. UGM, Yogyakarta. 2014. Abstrak. 6. Asri DS. Aktivitas antihiperkolesterolemia fraksi etanol ekstrak daun kelor (Moringa Oleifera Lam.) Berdasarkan kadar kolesterol total dan LDL kolesterol. Skripsi. Fakultas Farmasi dan Sains. UHAMKA, Jakarta. 2014. Hlm. 17. 7. Soewoto, H. dkk. Biokimia eksperimen laboratorium. Widya Medika. Jakarta. 2001. Hlm. 153. 8. Priyanto. Status oksidan dan antioksidan serta pengaruh pemberian kombinasi vitamin (E + C) pada Polantas di kota besar dan polisi di pedesaan. Tesis. Program Pasca Sarjana Bidang Ilmu Kesehatan. Universitas Indonesia. Depok. 1999. Hlm. 36. 9. Mayes PA, Botham PA. Cholesterol synthesis, transport, and excretion. McGraw-Hill. New York. 1996. Hlm 26: 219-230.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 140
141
Soursop Leaf (Annona muricata L.) Infusion in Lipid Profile of Hyperlipidemic Mice
NI MADE DWI SANDHIUTAMI*, NENI ANGGRAINI
Faculty of Pharmacy, Pancasila University.
Email : [email protected]
Abstract: The increase of blood lipid levels can be leaded into atherosclerosis. Soursop leaf (Annona muricata L.) contains flavonoid, that can be used as anti hyperlipidemia. This study aims to determine the effect of soursop leaf (Annona muricata L.) infusion for the reduction of Total Cholesterol, Triglyceride, LDL, and also the elevation of HDL. In this experiment, male mice (DDY strain) were induced by 80% yolk, 65% sucrose solution 15%, and 5% animal-fats two times/day, for 14 days. 30 mice were divided into 6 groups of 5 mice each: a normal group (I), a negative control group (II), a positive control group treated with simvastatin (III), and a final group had been treated with soursop leaf infusion (1.4 g/kg BW, 2.1 g/kg BW, and 2.8 g/kg BW) (IV). The preparation given at 15th – 21st day and were observed on 0, 14th, and 21st days with a photometer 4010. On the 21st day, the measurement of Total Cholesterol, Triglyceride and LDL decreased to 33.12%, 35.95%, and 46.05%, while HDL increased to 36.36% in mice that had been given soursop leaf infusion dose 2.8 g/kg BW. The results showed that a soursop leaf infusion dose 2.8 g/kg BW is equal to simvastatin dose 1.3 mg/kg BW.
Keywords: Soursop leaf, Annona muricata L., flavonoid, hyperlipidemic.
INTRODUCTION
Nutritious food is needed as an additional health factor. One of the effects potentially experienced if a lot of food high in saturated fat is consumed is hyperlipidemia. Hyperlipidemia is an increase in the total level of cholesterol, LDL, triglyceride, or several of them, or a decrease in HDL(1). Hyperlipidemia can lead to atherosclerosis, which in turn can lead to coronary heart disease(2). The blood lipid level can be reduced with hypolipidemic drugs, one of which is klofibrat. Klofibrat was withdrawn from circulation because increased mortality had been documented in users of the drug(2). The potential of natural material for treatment is being investigated because it is cheap and has a smaller risk than chemical treatment. Soursop (Annona muricata L.) has long been known as a medicinal plant; its leaves, flowers, fruits, seeds, roots and bark can be used for medical purposes(3). The results showed that the ethanol extract from the soursop bark (Annona muricata L.) has antihyperglycemic and hypolipidemic activity, especially in lowering the state of hypertriglyceridemia and hypercholesterolemia induced by alloxan in rats(4). Soursop leaves contain flavonoid compounds that can be used as agents for antihiperlipidemia. Commonly, soursop leaves are used to lower blood cholesterol levels by boiling them in water. Given the hypolipidemic activity found in the bark of the soursop, the public assumption that the leaves of the soursop lower cholesterol levels requires further testing.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 141
ISBN : 978-602-72418-2-4 MATERIAL AND METHODS
MATERIAL : Soursop leaf (Annona muricata L.), simvastatin, inducer of hyperlipidemia, and reagents kits (Biolabo). Tools. Oral probes, syringes, animal scales, analytical scales, glasses, surgical instruments, cottons, eppendorf tubes, centrifuge, and the photometer 4010. Animal preparation : Mice, DDY strain, male, 2-3 months old, weight 25-30 grams. Preparation of the soursop leaf infusion (Annona muricata L.) Fresh leaves were collected and washed in tap water to remove feces, and then drained, also dried, however do not dry it in direct sunlight. Soursop leaf infusion was made by boil 11.2 grams soursop leaf simplicia (equivalent to 35 sheets soursop leaf simplicia) with 125 mL water. Heating begins at 900 C for 15 minutes. Infusaion was filtered while hot with flannel. Infusion volume was obtained 100 mL, So that, the concentration of soursop leaf is 11.2%. Administration volume was given according to dose 1.4 g / kg, 2.1 g / kg, and 2.8 g / kg. Preparation of Hyperlipidemia Inducers. Animal-fat was obtained from chicken skin. It weighed in 100 grams, then heated it in a non-stick frying pan until all the oil come out. 65% sucrose solution was prepared by dissolve 65 grams of sugar in 100 ml hot water. Yolk were used as an emulsifier. Each ingredients is were mixed according to its weight and volume. inducers was made every day and given it orally two times/day. Preaparation of simvastatin suspense dose 1.3 mg/kg. 0.5% CMC Na solution was made by weigh in 0.5 gram CMC Na in hot water with volume 20 times of weight of CMC Na, that is 10 mL and let it stand for approximately 30 minutes until its expands. 20 tablets simvastatin which has been weighed, and crushed into powder and converted into the dose used in mice. 0.1 grams simvastatin powder is mixed with CMC Na which has expanded and crushed until homogeneous, then added to 100 mL distilled water. Soursop leaf (Annona muricata) Infusion in Lipid Profile of Hyperlipidemic Mice. Animals were divided into 6 groups of 5 mice each: a normal group, a negative control group, a positive control group treated with simvastatin dose 1.3 mg/kg, and a final group had been treated with soursop leaf infusion (1.4 g/kg BW, 2.1 g/kg BW, and 2.8 g/kg BW) The lipid levels was measured in all groups on day 0 and furthermore given a hyperlipidemia inducers dose 17.5 g/kg BW two time/day for 14 days. Re- measurement of lipid levels and given the preparation test for 7 days.
RESULTS AND DISCUSSION
Soursop leaf infuse (Annona muricata L.) positively contains flavonoids in the form of yellow color in amyl alcohol layers. Flavonoid compounds can be used as anti hiperlipidemia which affect total cholesterol, triglycerides, LDL, and HDL blood levels. The average total cholesterol levels (mg/dL) 200 150 Normal 100 Control Negative Control 50 Positive Control 0 Average Average total of Low Dose 0 14 21 cholesterol cholesterol levels (mg/dL) Experimental time (days)
Average total cholesterol levels in mice (mg/dL).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 142
ISBN : 978-602-72418-2-4 The total cholesterol levels in mice on day 0 is in normal range. According to the literature, the levels in normal mice is between 55-128 mg/dL(5)). On the 14th day 14 the total cholesterol levels increased in all groups, except a normal group. Measurements on day 21 showed that a moderate dose (2.1 g/kg) and high dose (2.8 g/kg) were able to reduce total cholesterol compared to a negative control group. A decrease of total cholesterol levels were significantly occurred in a positive control group. It had a total cholesterol levels of 92.40 ± 11.82 mg/dL on day 21. A high doses of 2.8 g/kg body weight show no significant difference to positive control group with a percentage 33.12%, so that it has proven its effectiveness in lowering total cholesterol levels. The average triglyceride levels (mg/dL) 150
100 Normal Control Negative Control 50 Positive Control Low Dose
levels (mg/dL) levels 0 Medium Dose High Dose Average of triglyceride of triglyceride Average 0 14 21 Experimental time (days)
Average triglyceride levels in mice (mg/dL).
Based on the chart above that triglyceride levels in mice on day 0 are in the normal range. According to the literature, the levels in normal is between 13-67mg / dL(5). The triglyceride levels in all groups increased On day 14, except a normal group. However, the triglyceride levels decreased on day 21. A decreased significantly in a positive control group, in low-dose (1.4 g / kg), moderate-dose (2.1 g / kg) and high-dose (2.8 g / kg). A positive control group has the higher levels of triglycerides 60.20 ± 7.22 mg / dL on day 21. Low-dose (1.4 g / kg), medium-dose (2.1 g / kg) and high-dose (2.8 g / kg) have no significant difference with a positive control group, so that, all of three doses is are effective in hypertriglyceridemia. High-dose 2.8 g / kg could reduce triglyceride levels to 35.95%. The average LDL levels (mg/dL) 150
Normal Control 100 Negative Control 50 Positive Control (mg/dL) Low Dose 0 Medium Dose Average of LDL levels of levels LDL Average 0 14 21 Experimental time (days)
Average mice LDL levels (mg/dL).
The average LDL levels in mice has changed during study. On day 14, an increased in LDL cholesterol levels show any significant in all groups compared to a normal control group. A decreased in LDL levels at low-doses (1.4 g / kg) and low-dose (2.1 g/kg) do not show any significant difference to a negative control group. A decreased in LDL levels at high-dose (2.8 g/kg) does not show significant different with a positive control group and normal group, so that, high-dose (2.8 g / kg) is able to reduce LDL levels and it effect is similar to simvastatin with precetage is 46.05%.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 143
ISBN : 978-602-72418-2-4
Average HDL levels in mice (mg / dL).
The chart above shows the changes in HDL levels in mice during study, especially on days 0, 14, and 21. On Day 0, the range of HDL levels in all groups is between 27.60 ± 3.58 mg/dL ─ 30 60 ± 2.97 mg/d. On day 14, a decreased HDL levels in mice occurred in the group II, III and IV. On day 21, an increased HDL levels in low-dose (1.4 g / kg) and moderate-dose (2.1 g / kg) do not show any significant difference compared to a normal group and a negative control group. High-dose (2.8 g / kg) could elevate the HDL levels which is has no significant difference to a positive control groups and normal controls group. So that, high-dose (2.8 g / kg) could increase the HDL levels with percentation is 36.36%, and this effect is similar to simvastatin. Results of in vitro studies indicate that flavonoids work as inhibitors of HMG-CoA reductase enzyme that decreases cholesterol synthesis(6). Flavonoids also increases the activity of lipoprotein lipase, and therefore contributes to a decrease in blood triglyceride levels(7). In addition, flavonoids can affect the metabolism of LDL cholesterol by increasing LDL ability to bind to its receptor. LDL bound to the receptor to be metabolized into cholesterol ester in the network. HDL binds cholesterol esters contained in the network and then excreted into the small intestine(8).
CONCLUSION
Soursop leaf infuse a dose of 2.8 g/kg BW can decreases total cholesterol, triglycerides, and LDL, also increase HDL levels.
REFERENCES
1. Wells BG, Dipiro JT, Schwinghammer TL, Dipiro CV. Pharmacotherapy handbook seventh edition. The McGraw-Hill Companies; 2009. p. 98, 102-103. 2. Gunawan SG, Setiabudy R, Nafrialdi, Elysabeth. Pharmacology and therapeutics 5th edition (reprinted with improvements). Jakarta: Department of Pharmacology and Therapeutics Faculty of Medicine, University of Indonesia; 2008. p. 373-77, 379-88. 3. Mardiana L, Ratnasari J. Herb and efficacy of soursop. Jakarta: Penebar Organization; 2011. p. 17, 38-40. 4. Ahalya B, Shankar KR, Kiranmayi GVN. Exploration of anti-hyperglycemic and hypolipidemic activities of Ethanolic extract of Annona muricata bark in alloxan induced diabetic rats. Int J Pharm Sci Rev Res. 2014; 25 (2): 21.26. 5. Fox JG, Barthold SW, MT Davisson, Newcomer CE, Quimby FW, Smith AL. The mouse in biomedical research: normative biology, husbandry, and models, second edition.UK: Academy Press; 2007. p. 188. International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 144
ISBN : 978-602-72418-2-4 6. Prahastuti S, Tjahjani S, Hartini E. Effect bay leaf infusion (Syzygium polyanthum (Wight) Walp) against a decrease in total blood cholesterol levels of rat models of dyslipidemia wistar strain. Medical journal Planta. 2011; 1 (4): 27-9. 7. Arauna Y, Aulanni 'am, Oktavianie DA. Study triglyceride levels and histopathological picture liver animal model rat (Rattus norvegicus) hypercholesterolemia treated with aqueous extracts of mango parasites (Dendrophthoe petandra). Malang: Study Program of the University of Brawijaya Veterinarian; 2012. p. 2. 8. Rofida S, Firdiansyah A, Fitriyastuti E. Activities antihiperlipidemia ethanol extract of leaves of Annona squamosa L. J Pharm Sci Pharm Pract. 2015; 2 (1): 1-3.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 145
ISBN : 978-602-72418-2-4
Xanthine Oxidase Inhibitory Activity of Secang (Caesalpiniasappan L.), Tempuyung (Sonchusarvensis L.), and Kepel (Stelechocarpusburahol) Extracts
PERTAMAWATI*, MUTIA HARDHIYUNA, SHELVI LISTIANA, RIAN TRIANA
Center for Pharmaceutical and Medical Technology – LAPTIAB – BPPT PUSPIPTEK Area – Serpong – Banten.
e-mail : [email protected]
Abstract: As we all know that xanthine oxidase is an enzyme that act as catalyst in the process of oxidizing hypoxanthine to become xanthine and then into uric acid. Uric acid is the product of metabolism of purine that settles in the joints and form crystal that sparks great pain and stiffness, also an enlargement and protrusion of swollen joints. As synthetic drug commonly used to overcome uric acid is allopurinol. Allopurinol work by inhibiting the formation of uric acid precursor (xanthine and hypoxanthine), however allopurinol have few side effects, sometimes occurs in gastrointestinal toxicity and increase gout attack acute at the beginning of therapy. Hence, many people use medicinal plants as anti uric acid because it has less side effects, easy to get and are relatively inexpensive as opposed to synhesis medicine. Bark of secang, tempuyung leaves and kepel leaves have the capability to inhibit of the activity of the xanthine oxidase until 56,473%, 20,154% and 12,071% while allopurinol capable of inhibiting the activity of the xanthine oxidase until 87,474%. The result of this research proves that bark of secang, tempuyung leaves and kepel leaves having activity to inhibit of xanthine oxidase, so that it can be used as traditional medicines for anti uric acid.
Keywords : Xanthine oxidase, secang, tempuyung, kepel, inhibitory activity.
INTRODUCTION
Xanthine oxidase is an enzyme acting as catalyst in the oxidation process ofhypoxanthine to xanthine and later became uric acid. Xanthine oxidation reduces O2 to H2O2 in cytosol and is expected to be a mayor factor ischemia injury, especially on cells of the intestinal mucosa. Xanthine oxidase is homodimer catalytic subunit independent, an enzyme that catalyzes hipoxanthine to xanthine and xanthine to uric acid, which is the relegation of purine. Xanthine Oxidase oxidizes oxypurine to xanthine and hypoxanthine to become uric acid. So everything septal on the metabolism of purine will produce uric acid and will cause deposit of sodium hydrogen urate monohydrate crystal. In an individual with the lack of O2, the body will form Xanthin Oxidase through degradation of ADP. In a person with high intake of purine can produced uric acid more easily. If alcaloida is present at high level in the blood, the existence of enzyme Xanthine Oxidase will form uric acid. Uric acid is the metabolism product of purine that settles at joints and form small crystals that may caused great pain and stiffness, also an enlargement and protrusion joints that swollen. In certain conditions, elevated levels of uric acid can occur in the blood exceeding normal limits called hiperurisemia(1). Hiperurisemia can be caused by excess production level of uric acid, the excretion of uric acid through the kidneys that diminished or combination both of them(2). Hiperurisemia can develop
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 146
ISBN : 978-602-72418-2-4
into gout. Gout is a type of metabolic disease. Its existence is quite popular among the community as pirai(3). A synthetic drug commonly used to overcome uric acid is allopurinol. Allopurinol is an analogous of uric acid, works by inhibiting the formation of uric acid from their precursor (Xanthine and Hipoxanthine) by inhibiting the activity of the Xanthine Oxidase(3). However allopurinol have few side effects such as redness of the skin, leukopenia, sometimes toxic in gastrointestinal and increase acute attack in early therapy(4). Therefore, nowaday people use medicinal plant as a traditional remedy because it has relatively small side effects, easy to get and are relatively inexpensive as opposed to synthesis medicine. Bark of secang (Caesalpinia sappan L.), has been empirical used as material for the treatment of uric acid disease. Various substance contained in the bark secang include brazilin, an alkaloid, flavonoid, saponin, tannin, phenyl propane and terpenoid . It also contain gallic acid , brasilein, delta-a phellandrene, oscimene, resins and resorin(5). Perceived research is weak in terms of effect anti-hiperurisemia. Because of the great biology potential of secang needs to be surveyed as agent of anti hiperurisemia. Tempuyung (Sonchus arvesnsis) is a herb found in the wild that grows in the mois areas that have high enough intensity of rainfall. The chemical content contained in this plant are mineral ions include silica , potassium , magnesium , sodium and compound organic kind of flavonoid (kaemferol, luteolin-7- o-glukosida and apigenin-7-o-glukosida), coumarin (scepoletin) , taracsasterol , inositol , and acid fenolat (cinnamic , cumarat and vanilat). In a report, the total flavonoid content in the tempuyung leaves is 0,1044 %. Whereas tempuyung root contain a total alkaloid of more or less 0,5 % and the highest flavonoid is apigenin-7-0-glukosida. Apigenin-7-0-glukosida is one of the flavonoid that have the potential to hinder the activity of Xanthine Oxidase and superoxidase, so that the formation of uric acid can be constrained or reduced(6). Kepel or burahol (Stelechocarpus burahol)l is a tree producing the fruit Kepel fruit is popular with women because is believed to make fragant scented sweat and make water odorless. For medicine, meat this fruit serves as deciduous urine, prevent inflamation of the kidney and cause sterility (temporary) in women. Its timber is suitable to wrench households and reported to last 50 years. The purpose of this experiment is to find out the Xanthine Oxidase inhibitory effect of three extracts of secang bark (Caesalpinia sappan L.), tempuyung (Sonchus arvesnsis) and kepel (Stelechocarpus burahol). Data processing acquired is carried out a statistical analysis of the variants and methods to test the difference between the average values of the two treatment used the methods of Multiple Region Test Duncan. The results of the experiment are expected to provide information to improve health by developing Obat Herbal Terstandar/ Standardisea Herbal Medicine (OHT). This research was carried out in April until June 2014 in the laboratory of Center of Pharmaceutical and Medical Technology – LAPTIAB - TAB - BPPT.
MATERIAL AND METHODS
MATERIAL. Bark of secang, leaves of tempuyung and leaves of kepel are mashed into small pieces (approximately 1 mm). Chemicals. DMSO (Sigma), K2HPO4 (Sigma P-0662), NaOH (Sigma 221465), HCl (Merck), Xanthine (X 0626), Xanthine Oxidase (Sigma X 4375), ethanol 96%, aquadest free CO2, Allopurinol. Equipment. Percolator (BuchiPump Controller C-610 and Buchi Pump Module C-610: UV- VIS1700 Spectrophotometer Shimadzu PharmaspecGlassware. METHODS. Plant Identification. The plants were identified in Research Center for Biology, Indonesian Institute for Science (LIPI). Preparation of a solvent extraction simplisia.The solvent for simplisia are ethanol 96% as much as 30%, 50% and 70%. and for the comparison of simplisia are 1:10; 1:15 and 1:20. Preparation of Extract. The percolation used as usual, with material secang herbs, tempuyung herbs and kepel herbs. Percolation run for 2 hour until the expected extract is obtained.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 147
ISBN : 978-602-72418-2-4
Preparation of Solutions. Potasium phosphat dapar solution pH 7.5 (50 mM). Substrat solution 0.75 mM (Xanthine) make it fresh. Enzyme solution. Enzyme solution stock. Solution of enzyme 0.3 unit/ml. Sampel solution : - Stock solution (LS); Working solution (LK) Preparation of Comparison Solution. Allopurinol tablets crushed to smooth and put into squash measure. Add phosphat buffer and sonification for 5 minutes at room temperature. Move it into small Ependorf flask and centrifuge to get supernatan. Nex, the addition of phosphat buffer to achive 1000 ppm concentration. Implementation of Xanthine Oxidase Inhibitory Activity. The process of inhibition Xanthine Oxidase testing is performed using spectrophotometer UV-VIS with 3ml quatz cuvette at 290 nm wavelength.
Table 1.Composition reagent on measuring inhibition xanthine oxidase. Control Blanco Sampel/ Blanco Enzyme Enzyme Allopurinol Sampel
Sampel/allopurinol -- 100 100 bp 800 840 700 740 xantin 160 160 160 160 -----incubation at 370C for 5 minutes XO 40 -- 40 ------incubation at 370C andmeasuring absorbance every minute of the 4 minutes in λ mak 290 nM
Data analysis. The data collected of the measurement result absorption in UV spectrophotometri namely ΔA/minutes is used to calculate activity Xanthine Oxidase with the formula(7) (Anonymous, 1994). The data is used to calculate the percentage of Xanthine Oxidase inhibitory with the formula. The value of IC50 inhibitor (concentration that produces inhibitory Xanthine Oxidase avtivity worth (50%) can be determine with linear regression analysis between compound concentration test against the percentage of inhibitory Xanthine Oxidase activity, then continue with statistical test by test with confidence level of 95%.
RESULT AND DISCUSSION
The Xanthine Oxidase inhibitory activity of secang, tempuyung and kepel extracts conducted triplo using equipment UV-VIS spectrophotometry. The results obtained written in Table 2 as follows :
Table 2. The xanthine oxidase inhibitory activity of secang, tempuyung and kepel extracts.
No. Extract % Inhibition 1 Secang (1) 56.473 2 Secang (2) 55.808 3 Secang (3) 58.922 4 Tempuyung (1) 20.154 5 Tempuyung (2) 16.760 6 Tempuyung (3) 16.200 7 Kepel (1) 7.138 8 Kepel (2) 12.071 9 Kepel (3) 4.059 10 Allopurinol (positive control) 1000 ppm 87.474 From the table 2, it can be showed that percentage of inhibition of secang extract is the highest (52.922%), followed by percentage of inhibition of tempuyung extract (20.154%) and percentage of inhibition of kepel extract (12.072%). Meanwhile, the percentage of inhibition of Allopurinol is 87.474%. International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 148
ISBN : 978-602-72418-2-4
From the test, it was found that secang extract has higher Xanthine Oxidase percentage inhibition compared with Xanthine Oxidase percentage inhibition of tempuyung and kepel extracts.The percentage inhibition level of Allopurinol extract is the highest because Allopurinol is a synthetic drugs that decreased uric acid level. The Xanthine Oxidase inhibitory activity of secang, tempuyung and kepel extracts were described in Graphic 1 as follow.
Graphic 1. Xanthine oxidase percentage (%) inhibition of secang, tempuyung, kepel extracts and Allopurinol (+ controle 1000 ppm).
The Xanthine Oxidase inhibitory activity of ethanol extracts of secang showed the greatest inhibition among two other extracts, while Allopurinol as synthetic drugs with anti-uric acid capability has the highest percentage inhibition (87.474%). The results obtained from this research indicated that secang could be developed as anti uric acid. It can be used in the medicinal herbs industry with a relatively cheap and affordable price. The Xanthine Oxidase percentage inhibition of Allopurinol (as positive control) aimed to determine the trust calculated statistically. The results reflected in Graphic 2. From Graphic 2, it can be seen that the higher concentration of Allopurinol (1000 ppm) gives the higher Xanthine Oxidase percentage inhibition (87.474%). To reach 100% percentage inhibition, Allopurinol must be tested with more than 1000 ppm of concentration.
Graphic 2. Xanthine oxidase percentage (%) inhibition of different concentration of Allopurinol as a positive control
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 149
ISBN : 978-602-72418-2-4
CONCLUSION
1. Secang, tempuyung and kepel extracts are potential as anti uric acid with the inhibitory percentage of each extract are 58.922%, 20.154% and 12.071% respectively compared with the Allopurinol as a synthetic drugs with 87.474%. 2. This study was restricted to the preliminary screening of Xanthine Oxidase inhibitory activity from secang, tempuyung and kepel extracts. Further structural elucidation and characterization methodologies have to be carried out in order to identify the bioactive metabolites in the extracts.
REFERENCES
1. Walker R, &Edward C. Clinical pharmacy and therapeutics. Edisi3. USA: Churchill Livingstone. 2003. 2. Wibowo S. Asam Urat, http://suryo_wibowo.blogspot.com. 2006. Diakses pada tanggal 9 September 2015 3. Price S & Wilson L. Patofisiologi: Konsep klinis proses-proses penyakit. Edisi 6. EGC, Jakarta. 2005. 4. Joseph T DiPiro, Robert L, Talbert Gary C, Yee Gary R, Matzke Barbara G, Wells L, Michael Posey. Pharmacotherapy: A pathophysiological approach (Eds). 7th edition. 2005. 5. Xu H, Zhou Z, Yang J. Chemical constituents of caesalpiniasappan L. ZhongguoZhongyaoZazhi. 1994. 19, (8) 485-486. 6. Chairul. Tempuyung untuk menghadang asam urat. http://digilib.itb.ac.id/ files/disk1/615/jbptitbpp-gdl-drchairula-30748-1-tempuyun-t.pdf Accessed on October 12th 2015. Chapter 100. Acne Vulgaris : Treatment : Acne Vulgaris Accesspharmacy. http://www.accesspharmacy.com/content.aspx?aID=3212123 http://www.agrobisnisinfo.com/2015/07/daun-tempuyung-tanaman-obat-herbal-Accessed on 9th September 2015. https://id.wikipedia.org/wiki/Kepel. Accessed on 10th September 2015.. http://tyasistiqomah.blogspot.co.id/2011_02_01_archive.html xanthine oxidase Accessed on September 10th 2015.
.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 150
ISBN : 978-602-72418-2-4
Potency of Curcuma Mangga Val Rhizome Extract as a Selective Anti- Proliferative Agent on Breast Cancer Cell Line MCF-7
SISKA ANDRINA*, CHURIYAH, NURALIH
Center of Pharmaceutical and Medical Technology, Agency for the Assessment and Application of Technology.
Corresponding Author Email: [email protected]
Abstract: Curcuma Mangga Val is original plant from Indo-malesian which is distributed in Indonesia, Taiwan, Thailand, China, Pacific and North Australia. In Indonesia, Curcuma Mangga have been used for traditional medicine as an antioxidant, anti-diarrhea, and anti-pyretic. In this study, we investigate potency of ethanolic extract of Curcuma Mangga Rhizome as an anti-proliferative agent against Breast Cancer cell line MCF-7. We also measured the cytotoxicity effect of extract on Human Dermal Fibroblast as a normal cell to determine its selectivity. Rhizome of Curcuma Mangga Val was macerated by 70% ethanolic and tested for cytotoxicity using MTT cell viability assay on MCf-7 and Human Dermal Fibroblast. The result showed selectively inhibited of ethanolic extract of Curcuma Mangga Rhizome on MCF-7 Cell with IC50 6.05 ppm and less sensitivity on Human Dermal Fibroblas with IC50 31,9 ppm. We also observed apoptotic mechanism of Curcuma Mangga Val extract on MCF-7 by double staining using etidium bromide and acridin orange. The figure showed that half of cell was dead because of apoptotic and necrotic mechanism either in 7 ppm. This study demonstrate the potential of Curcuma Mangga Val Ethanolic Extract as a selective anti- proliferative agent on breast cancer cell line MCF-7.
Keyword: Curcuma Mangga Val, anti-proliferative, MCf-7, Human Dermal Fibroblast, apoptotic
INTRODUCTION Cancer is a major public health problem in the worldwide. Cancer is one of non-communicable disease which is the first leading causes of death all over the world. In 2012, WHO reported 8.2 billion of people in the world having cancer and it would be increasing up to 22 billion of cases in next two decades. In Indonesia, Ministry of Health has reported that breast cancer is the top leading cause of cancer deaths among Indonesian women in 2014. Chemotherapy is one of the commonly-used strategies in breast cancer treatment. This therapy is usually associated with adverse side effects, ranging from nausea to bone marrow failure(2) and development of multidrug resistance (MDR)(3). In a few last decades, herbal plants have been widely used for diseases treatment and immunological enhancement. The increasing trend of herbal application in traditional herbal industry is mainly due to numerous beneficial effects of natural sources compared to single synthetic drug. Natural herbal medicines usually offer less undesirable side effect, more efficiency and less toxic to patient. Therefore, finding natural compounds from plants may provide an alternative cancer treatment. Curcuma Mangga Val is original plant from Indo-malesian which is distributed in Indonesia, Taiwan, Thailand, China, Pacific and North Australia. Curcuma manga Val is a member of the family Zingiberacae. It is also known by its common Indonesian name Temu Mangga, because of its mango-like smell when fresh rhizomes are cut. In Indonesia, Curcuma Mangga Val have been used as traditional medicine for relieving stomachic complaint, gastric ulcer, chest International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 151
ISBN : 978-602-72418-2-4
pain, fever, hepato-protective and anti-allergic. Rhizome of Curcuma Mangga has been known containing phenolic, alkaloid, saponin and also natural antioxidant curcuminoid. As we know that those of substance have potential activity as a cancer killer from herbal plants In this study, we investigated the potential activity of ethanolic extract of Curcuma manga val as a cytotoxicity agent on breast cancer cell line MCF-7 and its apoptotic mechanism using staining assay. We also evaluated extract selectivity against human dermal fibroblast as a normal cell. Selectivity index between IC50 on breast cancer cell line and normal cell will inform its selectivity as an anti-proliferative agent against breast cancer cell. MATERIAL AND METHODS MATERIAL. Plant Material and Chemicals. Rhizome of Curcuma mangga Val, Ethanol 70% Analytical Grade, Cell line MCF.7, Human Dermal Fibroblas Cell, Roswell Park Memorial Institute medium (RPMI), Dulbecco’s Modified Eagle Medium Low Glucose (DMEM-LG), Fetal Bovine Serum (FBS) 10% v/v (Gibco), penisilin-streptomisin 1% v/v (Gibco), Dimethyl sulfoxide (DMSO), and 3-(4,5dimethylthiazol-2- yl)-2,5-diphenyltetrazoliu bromide (MTT) , Sodium Deodecyl Sulfate (SDS), Phosphate Buffer Saline (PBS). Sample Preparation. Rhizome of Curcuma manga Val cut and dried in the oven at 60o C, macerated all of dried sample in ethanol 70% for a night. Evaporated filtrate of ethanol using high pressure evaporation until viscous extract was obtained. Cell Line Culture. MCF-7 was obtained from Gadjah Mada University Faculty of Pharmacy Yogyakarta and Human Dermal Fibroblast was original cells from Center of Pharmacy and Medical Technology BPPT. MCF-Cells were cultured in RPMI 1640 and Human Dermal Fibroblas were cultured in DMEM-LG and both of medium were supplemented with 10% foetal bovine serum, glutamine (2mM) and 1% penicillin-streptomycin in static 75 cm T-Flask (Nunc, Denmark). The cells were incubated in a humidified atmosphere with 5% CO at 37 oC. Cell Cytotoxicity Assay. Cells were plated in a 96-well-plate with 50.000 cells/well of concentration. The cells were left to adhere for 24 hours before exposed to the plant extracts (1-50 µg/ml) administered in media containing 10% of FBS and returned to the incubator for 24 hrs. Subsequently, MTT reagent (0.5 mg/mL in sterile PBS) was added directly to the wells. Cells were returned to the incubator for 4 hrs. The formation of insoluble purple formazan from yellowish MTT by enzymatic reduction was dissolved in SDS. Incubate for a night and the optical density of solution was measured at 570 nm using a microplate reader. Analyze the absorbance to obtain percentage of inhibition Apoptotic Observation on MCF-7. Cells were plated in a 24 well plate with 100.000 cells/well growing in RPMI medium supplemented 10% of FBS and 1% Penicillin-Streptomycin. Incubate the cells for a night to adhere then add the extract with IC50 concentration. Incubating for 24 hours and observe the morphology and staining of the cell after acridin orange and etidium bromide (1:1) was added under fluorescence microscope 100x. RESULT
The Cytotoxicity Effect of Ethanolic Extract of Curcuma Manga Val Rhizome on Breast Cancer Cell Line MCF-7. MTT assay is a rapid and high accuracy colorimetric approach that widely used to determine cell growth and cell cytotoxicity, particularly in the development of new drug. It measures cell membrane integrity by determining mitochondrial activity through enzymatic reaction on the reduction of MTT to insoluble formazan salt. Ethanolic Extract of Curcuma mangga Val Rhizome was measured its potency to inhibit MCF-7 cell growth using MTT assay. This method will provide the percentage of cell proliferation inhibition and also Proliferation inhibition concentration 50 (IC50). The result showed that all concentration of extract inhibit the proliferation of cell with dose dependent manner. It means that increasing of concentration will give higher inhibition of proliferation cells (Figure 1). That graph represented IC50 of extract with values 6.05 ppm
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 152
ISBN : 978-602-72418-2-4
Rhizome of Curcuma Mangga Val. Ethanolict Extract 120.000 100.000 80.000 60.000
40.000 Inhibition 20.000 % Cell % Cell proliferation 0.000 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 Log Concentration (ug/mL) Fig 1. Cell proliferation inhibition of ethanolic etract of curcuma manga val rhizome on breast cancer cell line MCF-7 in 5 concentration of extract. The Cytotoxicity Effect of Ethanolic Extract of Curcuma manga Val Rhizome on Human Dermal Fibroblast Cell. Human Dermal Fibroblast cells as a normal cell were used to determine extract selectivity. Index selectivity between IC50 on HDF and MCF-7 more than 2 means that the extract has selectivity inhibiting cancer cells and does not has impact on normal cell. The result showed that Ethanolic Extract of Curcuma manga Val Rhizome has higher inhibition of percentage compared than cytotoxicity on MCF-7 (Figure 2). Extract has IC50 31.93 ppm and index selectivity 5 (Table 1). It means that Ethanolic Extract of Curcuma manga Val Rhizome has selectivity inhibiting MCF-7 breast cancer cell proliferation.
Comparison of inhibition proliferation on MCF-7 and HDF 120.000 100.000 80.000
60.000 MCF-7 40.000 HDF 20.000 0.000
% Proliferation Inhibition -20.000 0.194 0.796 1.398 1.699 Log Concentration Figure 2. Comparison of cell proliferation inhibition on MCF-7 and human dermal fibroblast cell.
Table 1. IC50 of ethanolic extract of curcuma manga val rhizome on MCF-7; human dermal fibroblast and index selectivity of extract. Extract IC50 value (ug/mL) Index Selectivity MCF-7 HDF Ethanolic Extract of Curcuma 6.05 31.93 5 manga Val Rhizome
Apoptotic Observation of Ethanolic Extract of Curcuma manga Val Rhizome on MCF-7. The apoptotic mechanism of the treated cells has been observed under an inverted microscope using ethidium bromide and acridine orange (EB/AO) as staining agent. The apoptotic cells are stained in orange with lighter in nucleus or green, the live cells are stained in green and the necrotic cells are stained in orange. The figure showed that early apoptotic, late apoptotic and necrotic was found in all treated cell as presented in figure 3. It means that in IC50 concentration of extract, cells were died because of apoptotic mechanism. International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 153
ISBN : 978-602-72418-2-4
(a) (b) Fig 3. Double staining of ethanolic extract of curcuma manga val rhizome on MCF.7 in (a) control cell; (b) extract at 7 ppm.
CONCLUSION
Ethanolic Extract of Curcuma Mangga Val has potency as cytotoxic agent on breast cancer cell line MCF-7. Ethanolic Extract of Curcuma Mangga Val Rhizome has selective proliferation inhibition due to value of index selectivity on HDF.Ethanolic Extract of Curcuma Mangga Val Rhizome has cytotoxicity effect through apoptotic mechanism.
REFERENCE 1. Castell J V, and Lechon MG. In vitro methods in pharmaceutical research. Academic Press, San Diego, California. 1997. 2. Da’i M. Uji aktivitas antiproliferatif pentagamavunon-o terhadap sel raji, sel hela, dan sel myeloma. Tesis. Fakultas Farmasi UGM. Yogyakarta. 2003. 3. Doyle A, and Griffiths JB. Cell and tissue culture for medical research. John Willey and Sons Ltd, New York.2000. 4. Fox M. Cancer deaths declining in U.S. Reuters Health, United States. 2007. 5. Franks LM, and Teich NM. Introduction to the cellular and molecular of cancer. Third Ed.,Oxford University Press, New York.1997. 6. Freimoser, F.M., Jakob, C.A., Aebi, M, and Tuor, U, 1999, The MTT [3-(4,5-Dimethylthiazol-2-yl)- 2,5-Diphenyltetrazolium Bromide] Assay Is a Fast and Reliable Method for Colorimetric Determination of Fungal Cell Densities, Applied and environmental microbiology, 65(8), 3727-3729. 7. Hanahan D, and Weinberg RA. The hallmark of cancer. Cell, 100, 57-70. 2000. 8. Harborne J B. Metode fitokimia, penuntun cara modern menganalisis tumbuhan. Penerbit ITB, Bandung. 1987. 9. Haridas V, Mujoo K, Hoffmann JJ, Wachter GA, Hutter LK, Lu Y, et.al. Triterpenoid saponins from Acacia victoriae (Bentham) decrease tumor cell proliferation and induce apoptosis.Cancer Research, 61, 5486–5490. 2001. 10. Hartwell JL. Plant used against cancer. a Survey, Lioydia. 1971. 30-34. 11. Jacobz. Tumbuhan berkhasiat obat sebagai obat. KTO Karyasari, Jakarta. 2003. 12. King RJB. Cancer biology, 2nd ed., Pearson Education Limited, London.2000. 13. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. Journal of Immunological Methods,1983. 65 (1-2): 55-63 cit. 14. Itagaki, H et.al. Validation study on five cytotoxicity assay. JSAAE-VII details of the MTT. 1997.1-12.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 154
ISBN : 978-602-72418-2-4
Assessment of Antibacterial Activity of Herbal Toothpastes to The Bacteria Causing Halitosis
SYARMALINA*, SYAHDU A. EKOWATI DAN DWI A. MAULANA
Faculty of Pharmacy,Pancasila University Jalan Srengseng Sawah, Jagakarsa,Jakarta Selatan 12640, Indonesia.
Email:[email protected]
Abstract: The use of toothpaste is now not only as a cosmetic, but also as a treatment of halitosis. The content of the herbal in the toothpaste can help halitosis therapy because of its antibacterial activity. The purpose of the study is toobtain pure isolates from saliva of halitosis patients and to test antibacterial activity of toothpaste to microbes causing halitosis. Microbial limit test of toothpaste, isolation of microbial testing from saliva of halitosis patients and antibacterial activity test of herbal toothpaste to microbes were accomplished. Microbial limit test toothpaste MYC (mold yeast count) and TPC (total plate count) values obtained toothpaste A, B and D are eligible not more than 103 colonies/g TPC is between 3.6x102-5.48x102 colonies/g; MYC between <10-2.76 x102 colonies/g while the value of TPC and MYC toothpaste C is 4.63x104 colonies/g and 9.84 x103 colonies/g as well as the entire sample there is no growth of microbial pathogens. The isolation of pure isolates produced 19 and then selection test is performed macroscopic, microscopic and biochemical reactions produced four pure isolates representative used as test microbes. Antibacterial activity test using agar diffusion method with paper discs. The results of the inhibition by effectiveness sample: toothpaste C with clove between 23.5-28 mm; toothpaste B with betel between 21-28 mm; toothpaste A with miswak between 18-23 mm; toothpaste D with sodium fluoride between 15.5-22.5 mm. Concluded toothpaste A, B, C and D are potential as antibacterial against four pure isolates from saliva of halitosis patients and bacteria Streptococcus mutans as comparison.
Keyword: Halitosis, herbal toothpaste, pure bacterial isolates, Streptococcus mutans, microbial contamination test, antibacterial activity test.
INTRODUCTION
The oral cavity is a reflection of a healthy body because the mouth is an integral part of the body. In a healthy state, the mouth is occupied by more than 6x107 microorganisms that can be recognized by the aroma of our mouth when wake up in the morning(1). If the growth of microorganisms in the mouth exceeded the maximum number coupled with the presence of infection in the oral cavity are likely to cause halitosis.Halitosis is the smell of bad breath that comes out of the oral cavity. Halitosis is one of oral health problems that many people complain after caries and periodontal disease(2). Gases containing sulfur that is released through breathing air. VSCs consists of hydrogen sulphide (H2S), methyl mercaptan (CH3SH) and dimethyl sulfide (CH3SCH3). These gases are the result of the production activity of bacteria in the mouth which form malodorous compounds and volatile(3). One of efforts to prevent and treat halitosis is to use toothpaste. The use of toothpaste is now not only as a cosmetic, but also as a treatment of halitosis. The content of the herbal in the toothpaste can help halitosis therapy because of its antibacterial activity.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 155
ISBN : 978-602-72418-2-4
MATERIAL AND METHODS
MATERIAL. Toothpaste contain siwak, betel, clove and Natrium fluoride, Microbes testing (pure isolate of bactery causing halitosis isolated from saliva halitosis patients and Streptococcus mutans ATCC 70061 as comparison), peptone water, Nutrient Agar (NA), Potato Dextrose Agar (PDA), glucosa, lactosa, sacarosa, maltosa, manitol, indol solution, MR-VP solution, Simmons Citrate Agar, Triple Sugar Iron Agar (TSIA), Lysine Iron Agar (LIA), pereaksi kovac’s, methyl red reagent, a-naftol reagent, KOH solution, phosphate buffer solution, Trypticase Soy Broth (TSB), Vogel Johnson Agar (VJA), Cetrimide Agar (CetA), Chromogenic Agar (CrA), NaCl 0,9% solution, crystal violet solution, lugol solution, carbol fuchsin solution, etanol 95% and aquadest. METHODS.
RESULT AND DISCUSSION
1. The Data of Toothpaste Samples Used in This Study.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 156
ISBN : 978-602-72418-2-4
2. Microbiology Tests of Toothpaste Sample.
3. Inhibition Zone Diameter Data of Pure Isolates to Toothpaste Sample and Sodium Fluoride.
CONCLUSION
Tothpaste A, B, C and D are potential as antibacterial to four pure isolates of bacteria causing halitosis which were isolated from saliva of halitosis patients and Streptococcus mutans .
REFERENCES
1. Tandelilin R. Oral health care: present oral biology approach and indigenous wisdom (disertation). Yogyakarta: Gadjah Mada University. 2009.h.107-115.2. 2. Pintauli S. Halitosis and management issues. DentJ. 2008. 5(3):74-79. 3. Tonzetich J. Production and origin of oral malodor: A review of mechanism and methods of analysis. JPeriodontal. 1974.48:13-20.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 157
ISBN : 978-602-72418-2-4
Formulation and the Antioxidant Activity of Cincau Hijau Leaves(Cyclea barbata L.Miers) from the Ethanol Extract 70%
YUNAHARA FARIDA*, ERLINDHA GANGGA, KARTININGSIH, ARSILA
Faculty of Pharmacy, Pancasila University Jakarta.
Email: [email protected]
Abstract : Cincau hijau(Cyclea barbata L.Miers) is a plant that has antioxidant activity because one of its the secondary metabolites is flavonoid.The research has done of the extract Cycleabarbata leavesmade with different gel formula and test the accelarated stability for 3 months at room temperature and at 40oC with a humidity of 75% and subsequently the antioxidant activity using DPPH free radical scavenger been tested on the gel formula. The results showed that all formulas changed after 3 months storage at o 40 C. Formula 2 has stronger antioxidant activity than formula 4, formula 1 and formula 3 with IC50 value of 57.60; 59.22; 67.73 and 72.14 µg/mLrespectively. All formulas show fairly strong antioxidant activity because it can inhibit the activity of free radicals that can inhibit the premature aging of the skin.
Keywords : Cincau hijau (Cyclea barbata L.Miers), antioxidant activity, DPPH, gel formula.
INTRODUCTION
Indonesia is famous as an agricultural country producing a variety of plants that are useful among other spices, herbs, vegetables, fruits and others. The use of plants to prevent has been done by the community. In recent years, many research using plants to obtain secondary metabolites to treat various diseases such as dibetes, high blood pressure, respiratory tract infections and everything that related to the damage caused by free radicals. Free radicals contain one or more unpaired electrons and usually make a molecule more reactive than the corresponding non-radical. The molecule acts as an electron acceptor and essentially steals electrons from other molecules. In an attempt to prevent free radical damage, it would require the presence of antioxidants. Antioxidant is a compound that slow or prevent damage caused by free radicals. Antioxidant are powerful electron donor and react with free radicals that damage biomolecules, antioxidant radicals formed should be stable and not reactive. Cincau hijau (Cyclea barbata L.Miers) leaves used for health, besides containing flavonoids, its also contains alkaloids, saponins, tannins and steroid/triterpenoids. These compounds work in synergy so as to increase its antioxidant activity. Cyclea barbata plants are vines that grow in the area of West Java. The plants usually made drinks in gel form and some people used as medicine for fever or hearthburn empirically. This study was done to create formulas in gel dosage form of Cyclea barbata leaves extract, then the formulas tested its activity as an atioxidant after three month.
MATERIALS AND METHODS
Materials. Cincau hijau leaves (Cyclea barbata (L) Miers) were obtained from the Medicinal Plant Garden, Research Institute for Spices and Medicinal Plants (Balittro), Bogor. DPPH, methanol, carbomer 940, Sepigel 305, TEA, HPC-m, HPMC, Propylene glycol, methyl paraben, propyl paraben, sodium benzoate, edetate disodium, sodium metabisulfite, ethanol.
Methods. Preparation of plats extracts
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 158
ISBN : 978-602-72418-2-4
The dried powdered leaves of Cyclea barbata (L) Miers was macerated with ethanol 70% at room temperature for 24 hours (three times), and the crude ethanolic solution was subsequently concentrated using rotary vacuum evaporator to obtain the respective extracts and stored in a freeze condition until used for further analysis. Preparation of gel formula containing extract The ingredient on formula 1 – 4
No. Ingredient Formula % (w/w) F1 F2 F3 F4 1 Cincau hijau extract (Cyclea 0.0522 0,0522 0,0522 0,0522 barbata L.Miers) 2 Carbomer 940 0,5 - - - 3 Sepigel 305 - 3 - - 4 Triethanolamine (TEA) 0,5 - - - 5 HPC-m - - 5 - 6 HPMC - - - 4 7 Propylene glycol 15 15 15 15 8 Methylparaben 0,03 0,03 - - 9 Propylparaben 0,01 0,01 - - 10 Sodium benzoate - - 0,1 0,1 11 Edetate disodium 0,05 0,05 0,05 0,05 12 Sodium metabisulfite 0,1 0,1 0,1 0,1 13 Ethanol - - 40 - 14 Distilled water qs 100 100 100 100
Formula 1 and 2 : Dispersed carbomer 940(gelling agent formula 1) and sepigel 305 (gelling agent formula 2) in distilled water at room temperature for 24 hours with continuous stirring at 2000 rpm in speed. Methyl paraben and propyl paraben were dissolved in propylene glycol. sodium metabisulfite and edetate disodium were dissolved indistilled water and mixed it with Cyclea barbataextract. Finally full mixed ingredients were mixed properly to the carbomer 940 gel with continuous stirring 10-15 min. with 2000 rpm speeduntil homogen and triethanolamine was added drop wise to the formulation to obtain the gel at required consistency.The same method was followed for preparation with basis gel formula in Table 1. Test the accelarated stability for 3 months at room temperature and at 40oc± 2°Cand 75% ± 5% RH in climatic chamber.
Formula 3 and 4: Dispersed carbomer 940 with aq.dest at room temperature for 24 hours and then homogenized with 2000 rpm speed (as gelling agent). Triethanolamine (TEA) was dissolved in distilled water, then mix with carbomer 940. Sodium benzoate, sodium metabisulfite and edetate disodium were dissolved in distilled water and the mixed with extract of Cyclea barbata. Formula 3 was used HPC-m and formula 4 was used HPMC as basis gel. HPC-m and HPMC were dispersed with ethanol (as gelling agent).
Antioxidant activity Test The antioxidant activity of Cyclea barbata extract and formulas were tested using DPPH scavenging. Briefly, samples (extract dan four formulas) of various concentrations were prepared 5, 10, 25, 50, and 100 µg/mL. Each sample concentration was mixed with 1.0 mL of 1mM methanolic DPPH solution. All the solution were prepared with methanol to 5.0 mL. Experiment was done in triplicate. The test sample were incubated for 30 min. at room temperature and the absorbance measured at 517 nm. Ascorbic acid was used as a standard and DPPH in methanol was used as a control. The different in absorbance between the test and the control was calculated and the expressed as % scavenging of DPPH radical. Percent scavenging of DPPH free radical was measured using following equation:
Absorbance of Control - Absorbance of Sample % DPPH radical scavenging = - x 100 International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 159
ISBN : 978-602-72418-2-4
Absorbance of Control
Then % inhibitions were plotted against respective concentration used and from the graph IC50 was calculated.
RESULTS AND DISCUSION
The result of antioxidant activity test using DPPH free radical scavenging of ascorbic acid as standard, the ethanol extract of cyclea barbata leaves was done in triplicate. The IC50 value of Ascorbic acid of 4.08µg/mL with r 0,9799 (Table 1). The results of extracts showed that IC50 value of 47.94 µg/mL (Table 2.). The IC50 value was obtained then its used as dosage of gel formula. The results showed that all formulas changed after 3 months ofstorage at 40oC, which is caused by the effect of temperature and time. However, green grass jelly extract still have high antioxidant activity with IC50 value is between 50-100µg/mL. Formula 2 is stronger antioxidant activity than the formula 1, because the formula 2 using a base gel modification (sepigel 305), so its more stable than the others. The IC50 value of formula 2,4,1 and formula 3 with IC50 value of 57.60; 59.22; 67.73 and 72.14 µg/mLrespectively (Table 3). The smaller the IC50 value, the higher the antioxidant activity. Figure 1 shows The graph of antioxidant activity of cincau hijau , the Formulas and Vit.C as a control. The gel formulation can be used as an antioxidant because it can inhibit the activity of free radicals that can inhibit premature aging of skin.
Table 1. IC50 value of vitamin C. C Acontrol Absorbance of vit.C % Inhibition IC50 (ppm) I II III I II III (µg/mL) 1 0,5615 0,6004 0,5671 26,2640 21,1556 25,5286 2 0,5353 0,5563 0,5449 29,7045 26,9468 28,4439 3 0,7615 0,4236 0,4240 0,4209 44,3729 44,3204 44,7275 4,08 4 0,4008 0,4182 0,4164 47,3670 45,0821 45,3185 5 0,3180 0,2219 0,3212 58,2403 70,8601 57,8201
Table 2. IC50 value of cincau hijau (Cyclea barbataL Miers) extract. C Ablank Absorbance of extract % Inhibition IC50 (ppm) I II III I II III (µg/mL) 5 0,7363 0,7484 0,7316 10,4585 8,9870 11,0300 10 0,6504 0,6407 0,6383 20,9048 22,0844 22,3763 25 0,8223 0,6060 0,5673 0,5619 26,3043 31,0106 31,6673 47,94 50 0,4716 0,4807 0,4571 42,6487 41,5420 44,4120 100 0,3671 0,3954 0,3935 55,3569 51,9154 52,1464
Table 3. IC50 value of cincau hijau (Cyclea barbataL.Miers) formulas after 3 months at room temperature and at 40oC ± 2°Cand 75% ± 5% RH.
IC50 value (µg/mL) Formula 1 Formula 2 Formula 3 Formula 4 Temp. Month Batch I Batch Batch I Batch II Batch I Batch II Batch I Batch II II Room temp. 0 61,763 60,974 51,782 59,4050 70,6755 68,0105 58,3833 62,8872 (15-30oC) 0 4 1 3 65,514 61,279 52,946 61,7707 71,9485 74,5973 62,9523 67,2856 1 2 5 40oC ± 2°C 0 ------3 67,682 67,725 57,603 63,2377 72,1391 92,2392 59,2221 67,2856 1 1 7 Blank/control 228,2685 International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 160
ISBN : 978-602-72418-2-4
72.14 80 67.73 70 57.6 59.22 60 47.94 50 40 30 20 4.08 10 0 Vit.C Extract Formula 1 Formula 2 Formula 3 Formula 4
Figure 1. Graph of antioxidant activity (µg/mL) of cincau hijau extract, the formulas, and vit C. as control.
CONCLUSION
Cincau hijau (Cyclea barbata L.Miers) is a plant that has antioxidant activity because one of its the secondary metabolites is flavonoid. The results showed that all formulas changed after 3 months storage o at 40 C. Formula 2 has stronger antioxidant activity than formula 4, formula 1 and formula 3 with IC50 value of 57.60; 59.22; 67.73 and 72.14 µg/mLrespectively. All formulas show fairly strong antioxidant activity because it can inhibit the activity of free radicals that can inhibit the premature aging of the skin.
ACKNOWLEDGMENTS
We are grateful to DITLITABMAS DIT.JEN DIKTI for Research Grant of Hibah Bersaing (2013) and Faculty Pharmacy of Pancasila University for facilities of this research.
REFERENCES
1. Allen and Loyd V, 2002. The Art, Science, and Technology of Pharmaceutical Compounding. 2nd edition. Washington DC: American Pharmaceutical Association; p. 301-312. 2. Barel AO, Paye M dan Maibach HI, editors, 2009.. Handbook of cosmetic science and technology 3rd ed. New York: Informa Healthcare, p.473-475. 3. DepKes RI, 2000. Panduan Teknologi Ekstrak. Jakarta: Ditjen POM; p. 6-14. 4. Molyneux P., 2004. The use of the stable free radical diphenylpicrylhydrazil (DPPH) for estimating antioxidant activity. Songklanakrin, Vol.26 No.2 p.211-219. 5. Rowe RC, Sheskey PJ, Quin ME, 1994. Handbook of Pharmaceutical Excipient. 6th edition. Washington: American Pharmaceutical Association, p. 61-63, 118-121, 317-321, 326-329, 506- 509, 592-593. 6. Winarsi, H, 2007. Antioksidan Alami dan Radikal Bebas. Yogyakarta, Penerbit Kanisius. 7. Winlkinson JB, Moore RJ,. 2000. Harry’s Cosmeticology. 8th Edition. London: George Godwin. 8. Yen Gow-chin, and Chen, HY., 1995.. Antioxidan activity of various tea extract in relation to their antimutagenicity. J. Agricultural and Food Chemistry; vol. 42. p. 27-32. 9. Yunahara F, Setyorini S, dan Sari, WL., 2009. Uji aktivitas antioksidan dalam buah talok (Muntingia Calabura L.) dengan metode DPPH dan Rancimat. Proceeding Seminar Nasional PATPI Univ. Sahid Jakarta, 3 – 4 November 2009. 10. Xing Zao, Song KB., Kim MR., 2004. Antioxidant activity of salad vegetables grown in Korea. J. of Food Sci. and nutrition, Vol.9 p.289-294.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 161
ISBN : 978-602-72418-2-4
Accelerated Stability Test of Green Grass Jelly (Cyclea barbata L.Miers) Leaves Extract Gel Preparation as Antioxidant With Gelling Agent HPCM and HPMC
KARTININGSIH, ERLINDHA GANGGA, YUNAHARA FARIDA, MARIA ULFAH
Faculty of Pharmacy, Pancasila University. Jl. Srengseng Sawah, Jagakarsa, Jakarta Selatan 12460.
Email: [email protected] Abstract : Green grass jelly leaves (Cyclea barbata L.Miers) which its upper and lower surfaces are hairy contain flavonoids as antioxidants, have a very strong activity for free radical scavenging in the body. Green grass jelly leaves were maserated by 70% ethanol and then the crude extract were formulated into 2 gel formulas using HPC-m 5% and HPMC 4% that have been dispersed and then added to crude extract of green grass jelly leaves. Green grass jelly leaves extract gel formed were accelerated stability testing for 3 months in room temperature 30oC ± 2oC and 40°C or 75% RH. The gels were evaluated physically and chemically, such as organoleptic test, homogenity, viscosity and rheology, spreadability, pH test, antioxidant activity test, and analysis of microbial contamination tests then were compared with gel in the market. The results showed the best formula was the first formula (F1) with greenish yellow gel, specific odor, homogeneous, viscosity of 16000 - 60800 cps, spreadability of 1962,5 - 3576.66 mm2, pH 5.73 - 6.37, and analysis of microbial contamination has a colonies not more than 103 colonies/g or colonies/mL. Statistical analysis using two ways ANOVA to see time and temperature effects toward gel preparations stability. There is no effect on the viscosity, spreadability, and pH tests, on the first formula with P = 0.00 > 0.05.
Keywords: accelerated stability test, cincau hijau leaves extract, gel, HPC-m, HPMC, antioxidant.
INTRODUCTION
Stability is ability of a product or cosmetic to be able to last or stay in standard specification range during storage time and use to ensure the identity, strength, quality dan purity of the product. Medicine product of each preparation has different stability quality, therefore, each preparation or product has to undergo stability test to ensure the medicine product manufucturing and storaging. Stability test proceed as instructed in Good Manufacturing Practice for medicine products (CPOB) such as testing method and storaging condition that must qualify the standard. In this paper, stability test will be held for three months in month 0, 1, 2, and 3 in room temperature 27 ± 20C dan temperature of 45o-50oC/RH 75% in climatic chamber. Green grass jelly leaf extracts have the most active chemical content of alkaloids and flavonoids. Flavonoids acts as natural antioxidant to decrease the number of free radical in body, make it able to reduce /prevent aging process, therefore, not only the stability test is held, but also the antioxidant activity test. There are two formulas with 4% HPCm gel base and 5% HPMC base under stability test in room temperature 27 ± 20C dan temperature of 40o RH 75% in climatic chamber for three months and then then the gel be chemically and physically evaluated, inculding organoleptic, homogenity, viscosity and rheology, spreadability, pH and antioxidant activity test.
MATERIALS AND METHODS
Materials. Fresh green grass jelly leaf extract (Cyclea barbata L.Miers), Hydroxypropyl cellulose (HPC- m), Hydroxypropylmethyl cellulose (HPMC), Propylene glycol, sodium benzoate, sodium metabisulfite, International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 162
ISBN : 978-602-72418-2-4 disodium EDTA, ethanol 96%, ethanol 70%, distilled water, DPPH (1,1-difenil-2-pikrilhidrazil), methanol pro analysis, dan vitamin C.
Tools. Analytic scale, rotary evaporator, Brookfield viscometer RV type, homogenizer, water bath, laboratory glass tools, digital pH meter, gel spreadability tester, spectrofotometer, and climatic chamber
Methods Grass jelly leaves concentrated extract production. Fresh grass jelly leaves are collected, washed until clean, cut and crushed, and then macerated with ethanol 70% with kinetic maceration technique with pedal for three hours. After that, filtered and concentrated using rotary evaporator until concentrated extract retrieved. The concentrated extract is physically tested.
Grass jelly leaves extract gel preparation. Two formulas are made with Hydroxy propyl cellulose medium (HPC-m), Hydroxy propyl methyl cellulose (HPMC). HPC-m dispersed with ethanol96%&stayed still for 24 hours. HPMC dispersed with distilled water temperature of 60- 700C&stayed for 24 hours. Sodium benzoate, propylene glycol , dinatrium EDTA, Na.metabisulfite dissolved with distilled water. The mixture are homogenized and added with Green grass jelly leaf extract. The gel is physically evaluated and Accelerated stability test in room temperature and temperature of 400C.
Evaluation. Organoleptics. The color and odor of the gels were observed. Viscosity and Rheology. The viscosity of different samples gel formulations were determinated at room temperature and 400C (Brookfield). Spreadability. The spreadability of different samples of gel formulations were determinated with spreadability tester at room temperature and 400C. pH. pH meter was submerged in gel until stable pH value obtained at room temperature and 400C.
RESULTS AND DISCUSSION
Green grass jelly leaves extract gel which was proven for having flavonoids that have antioxidant activity. Antioxidant activity analysis with DPPH submersion method showed that Green grass jelly leaves extract gel has strong antioxidant activity with IC50 value of 60,73 – 67,47 µg/mL.
12 12 Room 10 10 temperature 8 8 6 6 RPM 4 Batch RPM 4 Batch 1 2 1 2 0 0 Batch 2 0 200000 400000 Batch 2 0 500000 1000000 F (dyne/cm2) F (dyne/cm2)
Graph 1. Rheogram green grass jelly leaf extract gel preparation of Fomula 1.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 163
ISBN : 978-602-72418-2-4
Viscosity stability evaluation. Rheogram green grass jelly leaf extract gel preparation of Fomula 1 was shown in graph 1. Gel preparation has stable rheogram for three months, which is plastic. Plastic flow of the gel preparation did not change after 3 months storage. Spreability Stability evaluation. Spreability Stability results of formula 1 was shown in table 1. Spreadability of the gel decreased after 3 months storage due to the increase of viscosity which increased each month. pH stability evaluation. pH stability evaluation results were shown in table 2. pH value of room temperature and 400C of the gels were decreased each month. pH is affected by time. In room temperature 3 months storage, the pH decreased from 6,31 ± 0,02 to 6,04 ± 0 and in 400C 3 months storage, the pH decreased from 6,02 ± 0,01 to 5,76 ± 0,03.
Table 1. Spreadability Stability results of green grass jelly leaves extract gel preparation Formula 1. Temperature Time 1 2 3 (months) D (mm) F (mm2) D (mm) F (mm2) D (mm) F (mm2) Room 0 66,80 3502,86 66,50 3471,47 67,10 3534,39 1 67,00 3523,87 66,50 3471,47 67,10 3534,39 2 67,10 3534,39 66,70 3492,38 67,30 3555,49 3 67,30 3555,49 66,90 3513,35 67,50 3576,66 40oC 1 65,20 3337,07 65,60 3378,14 65,00 3316,63 2 62,80 3095,91 61,00 2920,99 61,70 2988,41 3 55,00 2374,63 53,30 2230,10 53,00 2205,07
Table 2. pH stability test results of green grass jelly leaves extract gel preparation. Temperature Time (Months) Batch 1 1 2 3 Mean ± SD 0 6,29 6,33 6,30 6,31 ± 0,02 Room 1 6,24 6,25 6,26 6,25 ± 0,01 2 6,10 6,12 6,12 6,11 ± 0,01 3 6,04 6,04 6,04 6,04 ± 0 1 6,01 6,02 6,03 6,02 ± 0,01 40oC 2 5,90 5,76 5,80 5,82 ± 0,07 3 5,78 5,73 5,77 5,76 ± 0,03
CONCLUSION
Different gelling agent in Formula 1 HPC-m and Formula 2 HPMC have different physical quality. In Formula 1, green grass jelly leaf extract gel preparation has more stable physical quality after 3 months storage time in room temperature 30oC ± 2oC and temperature of 400C / RH 75% which is a gel with greenish yellow gel, specific odor, homogeneous. Statistic Analysis with two way ANVA on viscosity test, spreadability, and pH test. Gel preparation Formula 1 Batch 1 dan 2 in room temperature 30oC ± 2oC and 40oC for 3 months storage time have P value =0,00 > 0,05, Means that there is no effect on viscosity, spreadability and pH Formula 1 and 2 during storage time of 3 months.
ACKNOWLEDGEMENT
Special thanks are devote for Directorate General of Higher Education of Indonesia which has given grants in this research. International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 164
ISBN : 978-602-72418-2-4
REFERENCES
1. Lieberman HA, Rieger, Martin M, Banker, Gilbert S. Pharmaceutical Dosage Forms Dieperse System. Vol 2. USA. Marcel Dekker, Inc. 1996. P. 403 2. Carstensen JT. Drug Stability Principles and Practices. Third Edition. New York. Marcel Dekker, Inc. 2000. P. 516 3. Ansel HC. Pharmaceutical Dosage Forms and Drug Delivery System. Eight Edition. Lippincott Williams and Wilkins, 2010. 4. Aulton, ME. Pharmaceutical The Science of Dosage Form Design. Second Edition. New York: Churchill Livingstone. 2007.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 165
ISBN : 978-602-72418-2-4
Capsule Formulation of Standardized 70% Ethanol Extract Johar Leaves (Senna siamea (Lam.) Irwin and Barneby) as Α-Glucosidase Inhibitor
RISMA MARISI TAMBUNAN, KARTININGSIH, EVERLY HENDRA
Faculty of Pharmacy, Pancasila University. Srengseng sawah, Jagakarsa, South Jakarta 12640.
Email: [email protected]
Abstract : Standardized 70% ethanol extract of johar leaves showed that the extract has the consistency viscous, fulfill the requirements parameters of quality extract and has inhibitory activity α-glucosidase at 225 ppm is 90,88% equivalent to acarbose 95,21%. In this study, dried extract of johar leaves was formulated into capsule dosage form for practical use as an oral antidiabetic. The extract was dried with freeze drying using maltodextrin 10%. Dried extract was formulated into capsule dosage form using three variety diluents, namely dibasic calcium phosphate, lactose and avicel pH 102. Based on the evaluation results obtained that avicel pH 102 as the optimal formula that showed weight uniformity 0,4234 g and disintegration time 7 minutes 2 second with inhibitory activity α-glucosidase 85,88%.
Keywords: Johar leaves, capsule, diluent
INTRODUCTION
Johar leaves (Senna siamea (Lam.) Irwin and Barneby) is a plant that people using empirically as a antidiabetic drug (1). 70% ethanol extract of johar leaves known to inhibits α-glucosidase at 225 ppm is 85,88% equivalent to acarbose 77,49%. In this study, 70% ethanol extract of johar leaves was made into capsule dosage form for practically use and cover the bitter taste of johar leaves. 70% ethanol extract of johar leaves was dried by freeze drying using maltodextrin 10%. Dried extract was made into capsule dosage form using variation diluent to obtain formula of capsule dosage form with good characteristics. Capsule dosage form was evaluated physical quality, ie weight uniformity and disintegration time (2, 3, 4).
MATERIALS AND METHODS
Materials Crude drug of johar leaves (Senna siamea (Lam.) Irwin dan Barneby), ethanol 70%, maltodextrin, pvp, dibasic calcium phosphate, lactose and avicel pH 102, aquadest, hard gelatin capsule no. 0, α-glucosidase (G5003-100UN, Sigma), p-nitrophenyl-α-D-glucopyranoside (N1377-1G, Sigma), bovine serum albumin (Sigma), acarbose (Bayer), phosphate buffer pH 7,0, dimethyl sulfoxide, sodium carbonate, sodium hydroxide. Tools Analytical scales, glass tools, vacuum rotary evaporator, desiccators, mortar and stamfer, water bath, freeze dryer (LABCONCO), moisturemeter karl fischer, flow rate tools (LES-AUTONICS), stopwatch, sieve shaker (shive shakers of BBS product, BCL 601), bulk density Omron H3CR Tester, oven (Memmert), capsule filler, disintegration time tools (Guoming BJ-2), micropipette, absorbance microplate reader Elx 800. International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 166
ISBN : 978-602-72418-2-4
Methods Determination of Extract Quality Parameters. Performed of determination of parameters quality extract includes determination of the ash content, the determination of ash content acid insoluble, water soluble extract assay, content of ethanol soluble extract, loss on drying, water content, residual solvent, contamination of metals (Pb and Cd), Microbial contaminations, and total flavonoid content From the determination of parameter quality extract johar leaves by methods “Parameter standart mutu ekstrak tumbuhan obat” results can be seen in Table 1.
Table 1. Result of determination of parameters quality extract. Pharameters extract Result Water soluble extract (%) 65,27 Content of ethanol soluble extract (%) 72,60 Loss on drying (%) 13,27 Water content (%) 10,45 Ash content (%) 0,48 Ash content acid insoluble (%) 0,05 Residual solvent (%) 0,10 Contamination of metals (mg/kg) Pb 0,0301 Cd 0,003 Microbial contaminations (colonies/g) ALT 9,1x103 AKK 3,98x102 Total Flavonoids content (%) 8,44
Preparation of Capsules Dried extract of johar leaves is the active ingredients. Additional materials (excipients) ie avicel pH 102, lactose, dibasic calcium phosphate as diluent. Three formula was made into capsule dosage form using hard gelatin capsule no. 0 (table 2). Dried extract of johar leaves added diluent and mixed until homogeneous. Homogeneous mass inserted into the capsule shell using capsule filler tools.
Table 2. Capsule formulation. Formulation Weight (g) Materials I II III Dried extract 35,08 35,08 35,08 CaHPO4 8,06337 - - Lactose - 8,9357 - Avicel pH 102 - - 4,4736
Evaluation Of Capsule Weight Uniformity A number of 20 capsules were weighed. Then one by one capsule weighed and removed its contents. Empty capsule shells then weighed. Calculated weight of the contents of each capsule and the average weight of the content. Capsule weight uniformity requirement is there should not be any deviation capsules larger percentage of column A (±7,5%) and there should be no more than 2 capsules a greater percentage deviation from column B (±15%).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 167
ISBN : 978-602-72418-2-4
Disintegration time Six capsules are put into the basket on the medium water-temperature 37 C ± 2 C as much as 1000 mL, then run the tool. Automatically, the basket will be up and down on a regular basis. When the basket fell, the basket into the medium of water. For each capsule, which was disintegrated,⁰ note⁰ the time. The capsule was disintegrated if there is no part of the capsule remains, except parts of the outer shell of the capsule. When 2 capsules not disintegrated completely, repeat the test with 12 other capsules with terms no less 16 of 18 capsules tested must be crushed completely. Terms of the time disintegrated is not more than 15 minutes (4). α-Glucosidase Inhibitory Activity of Johar Leaves Capsule Dosage Form The same concentration of each capsule formula and acarbose as positive control were conducted to α- glucosidase inhibitory activity using p-nitrophenyl-α-D-glucopyranoside as substrate. α-glucosidase activity was determined by kawanishi method at 405 nm wave length. 200 mg bovine serum albumin and 1,0 mg α- glucosidase were diluted in buffer phosphate pH (7,0). The mixing solution contains 250 µl solution of 2 mM p-nitrophenyl-α-D-glucopiranoside, 400 µl buffer phosphate (pH 7,0), and series of 10 µl, 30 µl, 50 µl, 70 µl dan 90 µl sample. Then, it was pre-incubated at 37 C for 5 minutes. Reaction was started by adding 250 µl α- glucosidase, then incubated it at 37 C for 15 minutes. The reaction was stopped by adding 1000 µl Na2CO3 solution. The amount of p-nitrophenol obtained was⁰ measured at 405 nm wave length. The percentage of the inhibitory activity was counted by using⁰ this formula :
Where C = absorbance of enzyme activity without inhibitor (absorbance of DMSO), and S = absorbance of enzyme activity with sample examined.
RESULTS AND DISCUSSION
Determination of extract quality parameters The result determination of parameters quality specific extract of (Senna siamea (Lam.) Irwin and Barneby) leaves obtained shows that the extract has the consistency viscous, brown, and distinctive smell. Assay of compounds that are dissolved in two solvents was conducted to compare the number of secondary metabolites compound who extracted in a solvent of water and ethanol . Assay of compounds dissolved in a solvent of water shows the amount of inorganic compounds contained in extracts . While compounds assay dissolved in ethanol shows the amount of organic compounds present in the extract. From the results of the determination showed that the concentration of substances dissolved in ethanol (72,60%) and compounds that are dissolved in water (65,27%). Determination of total ash and ash insoluble in acid the conducted to determine the presence of trace elements in extracts who known as inorganic matter or ash. In the process of combustion in furnaces with a temperature of 4500C , organic materials in the extract can be burned but not for inorganic substances, namely ash. Ash total is the ash produced from a number of extracts which incandescent in the furnace. Ash total can be use to determine the mineral content of both physiological compounds such as K, Mg, Ca, or non-physiological such as pollutants, dust, soil contained in the extract. Results of the determination of total ash content obtained by 0,48%. While the levels of acid insoluble ash conducted to determine heavy metals compounds that do not dissolve in acid such as Hg, Pb, Cd and silicates. Acid insoluble ash content of 0,05% were obtained. These results meet the requirements of acid insoluble ash content of the extract is generally less than 1%. Assay of compounds that are dissolved in two solvents was conducted to compare the number of secondary metabolites compound who extracted in a solvent of water and ethanol . Assay of compounds dissolved in a solvent of water shows the amount of inorganic compounds contained in extracts. While compounds assay dissolved in ethanol shows the amount of organic compounds present in the extract . From International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 168
ISBN : 978-602-72418-2-4 the results of the determination Showed that the concentration of substances dissolved in ethanol (72,60%) and compounds that are dissolved in water (65,27%). Loss on drying was conducted to determine the water content and the compounds in the extract evaporated after the drying process in oven at 1050C. Obtained loss on drying is 13,27%. Water content of extract is 10,45%. These results meet the requirements of the general extract moisture content of less than 10%. Low water levels can guarantee the stability of the extract to long period. If the moisture content is too high then extract will not be stable for a long period of time because it is vulnerable over grown microbes. Results of the determination of residual solvent ethanol with gas liquid chromatography in extracts obtained 0,10% ethanol content. The determination results still meet the requirements of the maximum threshold of residual solvent in the extract is less than 1%. The content of Pb and Cd in Extract can comes from the Environment And Crop Production Process. Heavy metal Pb and Cd in the body are limited in number because it is dangerous to health . Pb metal can cause nerve damage , urogenetal , reproduction and hemopoitik. Cd metal can cause poisoning and organ damage and kidney damage of the research showed Pb content in the extract 0,0301 mg/kg while the level Cd 0,003 mg/kg. From the result obtained the microbial contamination with total plate count 9,1x103 colonies/g, number of mold and yeasts 3,98x102colonies/g, and total flavonoids 8,44%.
Results of The Evaluation of Weights Uniformity Capsule weight uniformity evaluation results can be seen in Table 3 below.
Table 3. Result of weight uniformity evaluation. No. Formulation Weight uniformity (g) SD 1. I 462,3 3,57 2. II 466,3 3,31 3. III 423,4 1,14
The results of the evaluation of weight uniformity of formula I, II and III quality ie weight of the capsule of the formula I, II and III do not deviate much from column A (±7,5%) and column B (±15%) of the average weight each capsule. This is caused by the flow properties of powders are eligible. If the flow properties good then process of filling into the shell, particles flowing continuously and uniformly, so that will be produced capsules with uniform weight or the smaller the coefficient of variation.
Evaluation Results of Disintegration Time Evaluation results of disintegration time results can be seen in Table 4 below.
Table 4. Evaluation results of disintegration time results. No. Formulation Disintegration time 1. I 6 minute 10 second 2. II 7 minute 28 second 3. III 7 minute 02 second
Terms of the time disintegrated is not more than 15 minutes. The evaluation results indicate that the disintegration time of the three formulas are eligible, ie less than 15 minutes even though used three different diluents.
The Result of α-Glucosidase Inhibitory Activity The result of α-glucosidase inhibitory activity can be seen in Table 5 and Graphic 1 below. International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 169
ISBN : 978-602-72418-2-4
Table 5. The results of α-glucosidase inhibitory activity. Inhibitor Inhibitory (%) Acarbose 95,21 Quercetin 77,49 70% ethanol extract of johar leaves 90,88 Dried extract 86,00 Formulation 1 84,42 Formulation 2 75,68 Formulation 3 85,88
Graphic 1. Graphic % inhibitor of johar leaves capsule dosage form.
The result of α-glucosidase inhibitory activity by formula 3 at concentration of 25 µg/mL was 36,47%, the concentration of 75 µg/mL was 48,83%, the concentration of 125 µg/mL was 65,44%, the concentration of 175 µg/mL was 72,65% and a concentration of 225 µg/mL was 85,88%. Thus the IC50 of the formula 3 was 76,67 ppm. Based on the evaluation, avicel pH 102 showed the highest α-glucosidase inhibitory activity indicating that the capsule dosage efficacious as an antidiabetic.
CONCLUSION
Examination of specific parameters of quality extract ethanol 70% of (Senna siamea (Lam.) Irwin and Barneby) leaves showed that the extract has the consistency viscous, brown, and distinctive smell. Water soluble extract content of 65,27% and content of ethanol soluble extract of 72,60%. Examination of non- specific quality parameters obtained loss on drying 13,27%, water content of 10,45%, total ash of 0,48%, acid insoluble ash content of 0,05%, residual solvent of 0,10%, Pb 0,0301 mg/kg and Cd levels of 0,003 mg/kg, microbial contamination with total plate count 9,1x103 colonies/g and number of mold and yeasts 3,98x102 colonies/g, and total flavonoids 8.44%. Based on the evaluation results abtained that avicel pH 102 as the optimal formula that showed weight uniformity 0,4234 g and disintegration time 7 minute 2 second with inhibitory activity of α-glucosidase 85,88%.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 170
ISBN : 978-602-72418-2-4
REFERENCES
1. Syamsuhidayat SS, Hutapea JR. Inventaris tanaman obat Indonesia. Edisi I. Jakarta: departemen Kesehatan Republik Indonesia Badan Penelitian dan Pengembangan Kesehatan; 1991. 2. Aulton M. E., 2007, Pharmaceutics; the science of dosage form design, New York; Churchill Livingstone, p. 517-523. 3. Lachman L, Lieberman HA, Kanig JL. Teori dan Praktek Farmasi Industri Edisi II Vol 1 & II. Diterjemahkan oleh Suyatmi S. Jakarta: UI Press; 1989, p. 795-822. 4. Swarbrick J, Boylan JC. Encyclopedia of Pharmaceutical Technology vol.4 Newyork: Marcel Dekker Inc; 1991. p. 37-76.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 171
ISBN : 978-602-72418-2-4
Formulation and Evaluation of Herbal Tablets Containing Voacanga foetida (Bl.) K.Schum Extract
FAHLENI1*, YANDI SYUKRI2, NOVELTA FEMMY RISCHA3, ADRIANI SUSANTY3
1)Faculty of Pharmacy Pancasila University, Jakarta. 2) Islamic University of Indonesia, Yogyakarta. 3) Sekolah Tinggi Ilmu Farmasi Riau.
Email : [email protected]
Abstract : Ethanolic extract of leaves of Voacanga foetida (Bl.) K.Schum has been formulated using wet granulation method. The aim of this study was to obtain the optimal concentration of starch as binder with varying concentrations; F1 (1%), F2 (2%) and F3 (3%). Evaluation of granules including true specific density, tapped density, apparent density, compressibility, Hausner factor, porosity, water content and angle of repose. Tablets were evaluated for weight variation, thickness, hardness, friability, in vitro desintegrating time. The results of angle of repose, Carr’s Index and Hausner ratio of all formulas indicated that the powder mixtures possess good flow properties and good packing ability. The physical properties tablets met the requirements according to Indonesian Pharmacopoeia 3th edition. It can be concluded that F1 was the best formula with the hardness 6,51 ± 0,62 kg/cm2, friability 0,99 ± 0,16%, and disintegration time 9,38 ± 0,28 minutes. The hardness and disintegration time increased with increasing concentration of cassava starch as binder employed.
Keywords : Voacanga foetida (Bl.) K.Schum, cassava starch, herbal tablets, binder
INTRODUCTION
Tampa Badak (Voacanga foetida (Bl.) K.Schum), belongs to the family called Apocynaceae, have traditionally been used by people in Indonesia to cure skin infection, headache and abdominal pain(1). This plant also has hypotensive and sedative effect(2). Its leaves contain alkaloids vobtusin, vobtusina lactone, desoxy vobtusinlakton, voafolin, voafolidin, isovoafolin and isovoafolidin. In traditional medicine, the leaves of Voacanga foetida is usually soaked in water and unspecified quantities of the decoction are ingested. The ethanolic extract of the leaves of plants Voacanga foetida (Bl.) K.Schum at a dose of 300 mg / kg in mice have potential and specifically inhibit cancer cell growth and safe to use with (3) IC50 < 50 µg/mL . In spite of their efficacy, herbal medicinal products have been widely criticized due to lack of standardization and poor-quality presentation. However, to improve patient compliance and acceptance, there is need to formulate the extract of leaves of Voacanga foetida (Bl.) K.Schum into tablet dosage form. Based on the description above, the authors were interested in doing the research to make a tablet of the ethanol extract of the leaves using wet granulation method with various concentrations of cassava starch paste as binder. Binder intended to provide compatibility and durability(4). Starch paste has good binding properties, especially for active ingredients that are insoluble and are in significant amounts.
MATERIALS AND METHODS
The leaves of Voacanga foetida (Bl.) K.Schum were collected from Anai Valley, Padang Panjang, West Sumatra. Extraction of the Powdered leaves The leaves were washed thoroughly in water, chopped and airdried at 35 to 40°C. The dried leaves were milled severally in an electric grinder. 4.6 Kg of the powdered sample was exhaustively extracted three
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 172
ISBN : 978-602-72418-2-4 times with absolute ethanol for 5 days by maceration. The solvent was removed at 30°C under reduced pressure and then evaporated.
Preparation of Granules V.foetida extract was dried with dibasic calsium phospate (1:4) in mixer kneader. Primojel and dibasic calsium phospate were added into the dry-mixed of extract for 15 minutes then moistened with 1, 2 and 3% w/w concentration of binder solution (cassava starch mucilage). The wet masses were granulated by passing them manually through a No. 12 mesh sieve, dried in hot air oven for 18 hours at 500C, and then resieved through a No. 16 mesh size. Evaluation of mixed blends was carried out for all the formulations for angle of repose, bulk density, tapped density, % compresibility and flowability.
Table 1. Formulations of the tablets. Ingredients Formula I Formula II Formula III
Extract of Voacanga foetida 200 mg 200 mg 200 mg (Bl.) K.Schum leaves
Dibasic calcium phospate 800 mg 800 mg 800 mg
Cassava starch (mucilage amyli 1 % 2 % 3 % 10% b/v) Primojel 112,5 mg 112,5 mg 112,5 mg Magnesium stearat 15 mg 15 mg 15 mg Dibasic calcium phospate 357,5 mg 342,5 mg 327,5 mg
Preparation of Tablets Tablets (final weight - 1500 mg) were prepared from the granules by compressing the materials using single punch tablet machine (Korsch type EKO) Friability Tablet friability was measured as the percentage of weight loss of 20 tablets randomly selected from each batch tumbled in friability apparatus (Erweka type T-200). After 4 minutes of rotation at 25 rpm, the dust of tablet was removed and the percentage of weight loss calculated. Tablet Hardness Twenty tablets randomly selected from each batch were used for the test. Erweka automatic hardness tester was employed. Disintegration Test The disintegration times (DT) of the tablets were determined in distilled water at 37±0.50C using an Erweka type ZT-502 disintegration testing apparatus. Six tablets randomly selected from each batch were used for the test.
RESULTS AND DISCUSSION
The recommended dose of dry extract of Voacanga foetida (Bl.) K.Schum leaves according to Susanty (2008) was 300 mg/kg for producing required therapeutic response in mice. When converting this dose into a tablet form, this dosage regimen should not be altered. Thus, a tablet containing as high as 200 mg of the dry extract is formulated, because in order to make dry powder there were large portion of dibasic calcium phospate needed.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 173
ISBN : 978-602-72418-2-4
Table 2. Pre-compression parameters of formulations. Physical properties Formula I Formula II Formula III Tapped Density (g/mL) 0,7431 0,6749 0,6845 Bulk Density (g/mL) 0,6192 0,5647 0,5659 Flow rate (second) 6,17 ± 0,15 5,97 ± 0,06 5,63 ± 0,25 Angle of repose (º) 28,62 ± 0,55 29,41 ± 0,29 28,88 ± 1,32 Compresibility index (%) 16,67 ± 0,58 16,33 ± 0,58 17,33 ± 2,31 Moisture content (%) 2,91 ± 0,40 2,90 ± 0,09 2,64 ± 0,30 Hausner ratio 1,20 1,19 1,21
Figure 1. Pictures of tablets Formula I, II and III (respectively)
Table 3. Tablets properties. Physical properties Formula I Formula II Formula III Weight variations (%) 0,82 1,52 2,39 Thickness (mm) 6,07±0,07 5,90±0,22 6,15±0,03 Diameter (mm) 15,06±0,13 15,15±0,04 15,11±0,03 Hardness (kg/cm2) 6,51 ± 0,62 6,42±0,91 7,26±1,01 Friability(%) 0,99 ± 0,16 0,41 ± 0,01 0,34 ± 0,01 Disintegration time (min) 9,38 ± 0,28 13,31 ± 0,47 14,17 ± 0,17
Results obtained from the micromeritic studies are presented in Table 3. The results showed that granules exhibited good flowability and the values obtained fell within the acceptable range for good powder flow. Values of angle of repose below 35°, which showed that the granules had low interparticle cohesion and hence good flowability. Hausner’s ratio less than or equal to 1.25 indicates good flow, while Hausner’s ration greater than 1.25 indicates poor flow. Therefore, the granules were within the specified limits for good flow. Also, Carr’s index of 5 to 16 indicates good flow, while 18 to 23 shows fair flow(5,6). The results of compressibility index indicate that the prepared granules had good flowability and consolidation properties. When the CI and HR are adequate, the powder flows at minimum bulk density. A high bulk density, that is, a low porosity, will result in a low deformation potential, a lack of space for deformation during compression will cause less intimate contact between the particles within the tablets, resulting in weaker tablets(6). The results showed that the granules had low bulk and tapped densities and hence, exhibited good properties required for the production of good quality tablets. The maximum weight variation of the tablets was ± 2.39%, which fulfilled the acceptable weight variation range of ± 5%, hence the tablets of all batch passed the weight variation test. Hardness for tablets of all batches was in the range of 6.42 to 7.26 kg/cm², which falls above the limit of not less than 3.0 kg/cm². Friability value for parameters observed are given in table 2. None of the tablets of the batches has friability more than 1%. Therefore, the tablets can comfortably withstand handling, packaging and transportation without compromisingthe properties of the tablets. The thickness of the tablets of all the batches was found in the range of 5.90- 6.15 mm2 and 15.06 – 15.15 mm in diameter indicating fairly acceptable tablets. Disintegration time is an important parameter of tablet. An ideal tablet should disintegrate within 15min. The tablets of all the batches disintegrated less than 15 minutes.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 174
ISBN : 978-602-72418-2-4
CONCLUSION
Tablets made from ethanolic extract of Voacanga foetida (Bl.) K.Schum leaves were produced by wet granulation method using cassava starch mucilage as binder. Increase in binder concentration caused an decrease in friablity and increase disintegration time of tablets.
ACKNOWLEDGMENT
The authors thank to Faculty of Pharmacy Islamic University of Indonesia, Yogyakarta for research fasilities.
REFERENCES
1. Valkenburg, V.J.L and Bunyapraphatsara. Medicinal and Poisonous Plants, 2008:584. 2. Rahmanudin. Uji Efek Hipotensif Ekstrak Akar Voacanga foetida (Bl.) K.Schum pada Tikus Putih Jantan.1988. Universitas Andalas.Padang. 3. Susanty, A. Uji Toksisitas dan Daya Antikanker Ekstrak Etanol Daun Tampa Badak (Voacanga foetida (Bl.) K.Schum).2008. Andalas University. Padang. 4. Voigt, R. Buku Pelajaran Teknologi Farmasi, Edisi V, diterjemahkan oleh Dr.Soedani Noerono. Penerbit Gadjah Mada University Press: Yogyakarta, 1994. 5. Aulton ME. Pharmaceutics. The Science of dosage form design, 3rd Ed. Churchill Living Stone, Edinburgh. 2007:197-210. 6. Yüksel N, Türkmen B, Kurdoğlu AH, Basaran B, Erkin J, Baykara T. Lubricant efficiency of magnesium stearate in direct compressible powder mixtures comprising cellactose® 80 and pyridoxine hydrochloride. FABAD. J. Pharm. , 2007, Sci. 32:173-183.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 175
ISBN : 978-602-72418-2-4
Optimization of Patchouli Oil and Tea Tree Oil Emulgel Formulation
YUSLIA NOVIANI1*, TETI INDRAWATI, SHELLY TAURHESIA1,2
1)Faculty of Pharmacy University of Pancasila, Srengseng Sawah Jagakarsa Jakarta. 2)Amway Indonesia, Jakarta.
Abstract : Emulgel preparations is created in order to be easier and convenient used. The objective of the study to obtain an emulgel preparation which has containing natural active ingredients as anti-bacteria that cause acne. There are 3 factors which influence this study, therefore 23 factorial design. The factor are concentration of carbopol 940 (0.5% - 1%), oils (7.5% - 10%), and emulsifying agent (1.5% - 2.5%). Evaluation of physical, chemical, and effectiveness in vitro are conducted to emulgel preparation. Data were analyzed using Minitab 16 to determine the effects of these factors and their interactions to the response and determine the optimum formula.
Keywords : optimization, emulgel, patchouli oil, tea tree oil, patchouli oil and tea tree oil emulgel
INTRODUCTION
Emulgels are emulsion, either of the oil-in-water or water-in-oil type, which are galled by mixing with a gelling agent. They have a high patient acceptability since they possess the previously mentioned advantages of both emulsions and gels. Therefore, they have been recently used ad vehicles to deliver various drugs to the skin(1). The aim of this work was to develop an emulgel formulation of patchouli oil and Tea Tree Oil (TTO) with the oil-in-water type emulsion, washable and has a good spread on the skin. The design of the formula in this work is using a factorial design 23 with 3 factors thought to play an important role on the physical, chemical, and effectiveness of the emulgel preparations, there are carbopol 940 as gelling agent, olive oil as the oil component, and the combination of tween 20 and Span 20 as emulsifying agent. Each material used in high and low concentrations that can be known optimum concentrations of each factor to result the good, effective, and stable emulgel preparations as anti bacteria that cause acne.
MATERIALS AND METHODS
Experimental Design. Eight emulgel formulations were prepared according to a 23 factorial design employing the qualitative factors and levels shown in Table 1.
Table 1. Factors and levels for the 23 factorial design. Factors Low Levels (%) High Levels (%) A = gelling agent concentration 0,5 1 B = oils concentration 7,5 10 C = emulsifying agent concentration 1,5 2,5
Preparation of emulgel formulations. The composition of emulgel formulations is shown in Table 2. The gel formulations was prepared by dispersing carbopol 940 in purified water with constant stirring at a moderate speed, then the pH was adjusted to 6 – 6,5 using TEA. The oil phase of the emulsion was prepared by dissolving span 20 and BHT in olive oil, pathchouli oil and TTO while the aqueous phase
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 176
ISBN : 978-602-72418-2-4 was prepared by dissolving tween 20 in purified water. Methyl and propyl parabens were dissolved in propylene glycol, and both solutions were mixed with the aqueous phase. Both the oily and aqueous phases were separately heated to 70°C, then the oily phase was added to the aqueous phase with continous stirring until cooled to room temperature.
Table 2. Quantitative composition of emulgel formulations. % (w/w) Ingredient F1 F2 F3 F4 F5 F6 F7 F8 Patchouli oil 2,5 2,5 2,5 2,5 2,5 2,5 2,5 2,5
TTO 2,5 2,5 2,5 2,5 2,5 2,5 2,5 2,5
Olive oil 2,5 2,5 5 2,5 5 2,5 5 5
Carbopol 940 0,5 1 0,5 0,5 1 1 0,5 1
Tween 20 0,6 0,6 0,6 1 0,6 1 1 1
Span 20 0,9 0,9 0,9 1,5 0,9 1,5 1,5 1,5
Propylene glycol 5 5 5 5 5 5 5 5
Methyl paraben 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01
Prophyl paraben 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03
BHT 0,01 0,01 0,01 0,01 0,01 0,01 0,01 0,01
Purified water 100 100 100 100 100 100 100 100
Physical Examination. The prepared emulgel formulation were inspected visually for their color, homogeneity, emulsion type and spreadability. The pH values of 1% aqueous solutions of the prepared emulgels were measured by a pH meter. Rheological Studies. The viscosity of the different emulgel formulations was determined using Viscometer Brookfield RV with spindel 6. Microbiological Assay. Ditch plate technique was used. Previously prepared Nutrient Agar dried plates were used. Three grams of the emulgel were placed in a ditch cut in the plate. Freshly prepared culture loops were streaked accros the agar at a right angel from the ditch to the edge of the plate. The commercial gel was used for comparison. Control plates containing plain emulgel bases were also prepared. After incubation at 35 - 37°C for 18 – 24 hours (Staphylococcus aureus) and for 24 – 48 hours (Propionibacterium acnes), the bacterial growth was observed and the percentage inhibition was measured as follows: % inhibition = L1/L2 x 100 where L1 = total length of the streaked culture, and L2 = length of inhibition(2).
RESULTS AND DISCUSSION
The result of the emulgel formulations are shown in Table 3.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 177
ISBN : 978-602-72418-2-4
Table 3. Result of the examination of emulgel formulations. Examination F1 F2 F3 F4 F5 F6 F7 F8 C1 C2 Physical - Color white white white white white white white white white white - Homogeneity good good good good good good good good good good - Emulsion type O/W O/W O/W O/W O/W O/W O/W O/W O/W O/W - Spreadability good good good good good good good good good good pH 5,49 5,27 5,84 5,74 5,04 5,06 5,69 5,30 5,82 5,39 Rheological plasti plasti plasti plasti plasti plasti plasti plasti plasti plasti Studies s s s s s s s s s s Microbiological assay 100 100 100 100 100 100 100 100 100 89,29 - S. aureus (%) 78,67 78,14 78,38 78,62 77,90 78,33 79,77 78,52 100 61,67 - P. acne (%)
Where F1 – F8 = formula 1 to 8, C1 = commercial gel 1 that containing clindamycin 1%, C2 = commercial emulgel that containing TTO.
Physical Examination. The prepared emulgel formulation were white viscous creamy preparation with a smooth and homogeneous appearance. There were easily spreadable with acceptable bioadhesion and fair mechanical properties. The pH values of all the prepared formulations range from 5,04 to 5,84, which is considered acceptable to avoid the risk of irritation upon application to the skin.3,4 Rheological Studies. Figure 1 show the entire rheograms (shear stress vs shear rate) of emulgel formulations. As seen in the figures, the emulgel formulations has thixotropy rheological properties and has the yield value of 276,568.6443 dyne/cm2. Thixotropy is a desirable characteristic in pharmaceutical preparations. Thixotropy, or time dependent flow, occurs because the gel requires a finite time to rebuild its original structure that breaks down during continuous shear measurements.5
F
Figure 1. Rheograms of emulgel formulation.
Microbiological Assay. The use of control plates showed that the plain emulgel bases were microbiologically innert toward the tested S. aureus and P. acne. The antibacteria activity of in its different emulgel formulations as well as in its commercially available (C1) for S. aureus. Percentage inhibition was taken as a measure of the antibacteria activity. The greatest activity was observed with formula F7, where the percentage inhibition reached up 79,77%, while the lowest activity was found with F5, where the percentage inhibition was 77,90%.
CONCLUSION
The composition of optimum formula for the emulgel formulation are 0,635% of karbopol 940 concentration, 8,75% oils, and 1,5% of emulsifying agent.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 178
ISBN : 978-602-72418-2-4
ACKNOWLEDGMENT
Faculty of Pharmacy University of Pancasila, Srengseng Sawah Jagakarsa Jakarta.
REFERENCES
1. Magdy IM. Optimization of chlorphenesin emulgel formulation. The AAPS journal. 2004;6(3). 2. Hugo WB, Russell AD. Pharmaceutical Microbiology. Oxford, UK: Blackwell Scientific Publications; 1977:190. 3. Clearly GW. Transdermal controlled release systems. In: Larger RS, Wise DS, eds. Medical Applications of Controlled Release. Vol 1. Boca Raton, FL: CRC Press; 1984:204-251. 4. Lucero MJ, Vigo J, Leon MJ. A Study of shear and compression deformarions on hydrophilic gels of tretionin. Int J Pharm. 1994; 106:125-133. 5. Klich CM. Jels and Jellies. In: Swarbrick J, Boylan JC, eds. Encyclopedia of Pharmaceutical Technology. Vol 6. New York, NY: Marcel Dekker Inc; 1992:415-439.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 179
ISBN : 978-602-72418-2-4
Formulation of Liquorice Root Extract (Glycyrrhiza glabra L.) as Skin Whitening Cream
SITI UMRAH NOOR*, FARIDAH, MICHICO
Faculty of Pharmacy Pancasila University, Jakarta 12640.
Abstract : Liquorice root extract (Glycyrrhiza glabra L.) contains glabridin isoflavane as a tyrosinase inhibitors to inhibit melanin synthesis under the skin so that potentially as a skin whitener. The aim of this research are to determine the tyrosinase inhibition activity in liquorice root extract as skin whitening and formulated into a cream with a variety of 0.1%, 0.5% and 0.9% of emulsifier glyceryl monostearate to determine the effect of emulsifier on the physical quality and effective as a skin whitener. Liquorice root extract made by kinetic maceration using ethanol 96%, invitro tyrosinase inhibition assay was then conducted with kojic acid as positive control using 96-well microtiter plate and microplate reader, sample incubated at temperature 37°C for 20 minutes, and its absorbance measured at 490 nm wavelength. The physical quality parameters of cream were evaluated includes organoleptic, homogeneity, type of emulsion, viscosity, flow properties, spreadability, droplet size, centrifugation, pH and the inhibition activity of the cream. The research results that tyrosinase inhibition activity of liquorice root extract (IC50) was 126.75 µg/mL. Creams of 1.01 % liquorice root extract were yellowish white, aromatics odours, soft textures, homogeneous and segregation did not occur with O/W emulsion type and plastic thixotropic rheological properties, viscosity of (2800±0.00) – (4000±0.00) Ps, spreadability of (3029.72±0.81) – (3531.79±6.15)mm2, droplet size of (60.00±0.00) – (65.12±0.01)μm, pH of (4.55±0.03)–(4.63±0.04) with (10.14 -19.30)% tyrosinase inhibition value of cream. It can be concluded that the formula with concentration of 0.1% of glyceryl monostearate was the best formula that conforms physical quality test and potentially as a skin whitening cream.
Keywords: liquorice root extract, glyceryl monostearate, tyrosinase inhibitor, skin whitening cream
INTRODUCTION
Increased production and accumulation of Melanin locally and unadequately can cause local pigmentation or black spot on certain parts of the face. The production of melanin occurs with the help of biocatalis tyrosinase enzymes and was further accelerated by the UV light. One of the ways to prevent or inhibit the production of melanin is to inhibit the activity of tyrosinase. The concept of "from nature to cosmetic" concept will produce natural cosmetics. Besides more secure, cosmetics made from natural ingredients have been proven to have a better effectiveness which is good for health, beauty and eco-friendly. One of the plants that can inhibit the activity of tyrosinase is liquorice (Glycyrrhiza glabra L.). Licorice contains glycirrhizin (10-25%), liquiritin, liquiritigenin, isoliquiritigenin, isoliquiretin, glizirhizat, glabrene acid and glabridin. Glabridin as a phenolic compounds (isoflavan) contained in the root of liquorice and can act as an antioxidant, neuroprotective agent, anti inflamation agent, cure eczema, pruiritis, other dermatitis symptoms, as well as an effective whitening agent. According to Yokota (1998), inhibitory effects of glabridin against inflammation and melanogenesis in B-16 melanoma cell culture of and guinea pig skin showed that glabridin inhibited the enzyme tyrosinase activity at 0.1 -1,0 μg/ml concentration without affect DNA synthesis. The research of Zheng (2011) also stated that Glabridin has the stronger activity than kojic acid. Depigmentation effect of Glabridin known 15 times better than kojic acid and the wider activity than arbutin which is a natural compound that is widely used in skin whitening cosmetic.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 180
ISBN : 978-602-72418-2-4
Based on journal "Extraction of glycyrrhizic Acid and Glabridin from Licorice", the optimum Glabridin extraction conditions of liquorice obtained by using 96.0% ethanol for 240 minutes at a temperature below 50°C. Viscous extract was formulated into cream preparations. The formulation of the O/W medium- based cream use the concentration of Liquorice Root Ethanol Extract from invitro tyeosinase inhibition activity assay results. The cream is made with nonionic surfactants polysorbate 80 combined with co- emulgator cetyl alcohol, cetearyl alcohol and glyceryl monostearate. The variation of glyceryl monostearate concentration as co-emulgator based on research that had been done before. The addition of 0.5-1% glyceryl monostearate will improve the stability and appearance of creams by making them not easily creaming. Glyceryl monostearate is “emollient lipophilic thickening agent and stabilizer" that commonly used in emulsion and cream, it is included in the fatty alcohol group that can improve the consistency or as the stiffening agent so that increase the stability of the cream.
MATERIALS AND METHODS
Tyrosinase inhibition activity: Liquorice Root Extract (Glycyrrhiza glabra L.) (Simplicia from CV. Herbaltama Yogyakarta), Kojic acid (Thornhill, Canada), L-DOPA and Tyrosinase from Mushroom- lyophilized powder (SIGMA-Aldrich, USA), 0.1 M Phosphate Buffer pH 6.8, Dimethyl Sulfoxide1%.
Liquorice whitening cream: Liquorice Root Extract, triple pressed stearic acid (Shanghai FuXin, RRC), cetyl alcohol (BASF, Germany), cetearyl alcohol (Ecogreen, Singapore), anhydrous lanolin (WuXi, RRC), propylene glycol (Dow Chemical Pacific, Canada), parafin liquid (Sonneborn, Netherland), polysorbate 80 (KAO Indonesia Chemical, Indonesia), glyceryl monostearate (Danisco, RRC), methyl and propyl paraben (UENO Fine Chemical, Germany), butylated hidroxy toluene (Sterlitamak Petrochemical Plant, Russia), perfumes, aquadest. Reagen Sudan III, methylene blue
Equipments and instruments : Microplate reader (BioTek, ELx800), 96-well microtiter plate (Bio-RAD), micropippete (transferpette), kinetic macerator (IKA, RW20), rotary vacuum evaporator (Heidolph, Laborota 4000), water bath (Memmert, WNB400), microbalance (Mettler, MT5), analytical balance (KERN, ABT 120- 5DM), homogenizer (IKA, RW20), oven (Memmert, U-110), viscometer (Brookfield RV type), pH meter (HANNA, HI 2211), microscope (Olympus, CH20), centrifugator (Kokusan, K-103N), incubator (Memmert, IN-55), refrigerator (LG).
Organoleptic Liquorice Root Introduction test: Solvent miscibility Extraction with 96% ethanol pH Incubation time Condensed with vacuum rotavapor Wavelength Tyrosinase inhibition Enzyme concentration Substrate concentration Liquorice extract activity invitro
IC50
Oil Water Mixing speed Mixing time
Cream base Organoleptic (Colour, Odour, Texture) Tyrosinase Inhibition Homogeneity Cream type Activity invitro Licorice Whitening Viscosity & Rheological Cream Properties Spredability Globule size Centrifugation pH test
Figure 1. Methods in scheme.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 181
ISBN : 978-602-72418-2-4
Simplicia manufacture and extraction Part of the root of the liquorice plant is harvested in the form of cylindrical rods with a length of up to 1 m and diameter in 0.5 cm to 3 cm, yellowish brown to dark brown, and wrinkle. All the cleaned simplicia then dried by sunlight indirectly for 1-3 days. Then the simplicia mashed using a blender and sifted with no. 4/18 mesh. 500 g of liquorice powder were macerated kinetically using 5 L of ethanol (96%) for 4 hours. In 10 repeated process, each process using 4 L of solvents. Then the collected filtrate was evaporated in the rotary vacuum evaporator to obtain Liquorice Root Ethanol Extract at a temperature of ± 40°C, 180 mmHg pressure, and speed of 60 rpm up to gained a thick extract of ethanol. It was packed in a seal opaque container and stored in the refrigerator.
Inhibition of tyrosinase activity invitro This assay was performed using methods as described earlier with modification (Zhang, (2011); Batubara, et.al., (2010) ; Juwita, N.K. (2011). Extract were dissolved in DMSO to a final concentration of 20 mg mL-1. This extract stock solution was then diluted to 25-4000µg mL-1 in 100 mM phosphate buffer (pH 6.8). Kojic acid, whick was used as positive control was also tested at concentrations 2,5-50 µg mL-1. In a 96-well plate 80 μL phospate buffer (0,1 M, pH 6.8) was combined with 40 μL L-DOPA (5mM phospate buffer) in triplicate, 40 μL of each sample dilution. After 5 minutes, add 40 μL tyrosinase ( 310 Units mL-1 in phospate buffer) to each well. Incubation commenced for 20 minutes at 37°C. Optical densities of the wells were then determined at 490 nm. Each samples done with blank samples which tyrosinase solution not added. The tyrosinase inhibition activity was calculated according to the following formula:
B : control absorbance – control blank absorbance (B1-B0) S : sample absorbance – sample blank absorbance (S1-S0)
Inhibitory activity of the sample can be determined by calculating the IC50, namely the concentration in which the sample inhibit tyrosinase activity by 50% by using the linear regression equation. Concentration of the sample (in logarithms) as the x-axis and the percent inhibition (% inhibition) as the y-axis.
Liquorice cream formulation Cream made by mixing the oil phase (Stearic acid, Cetyl alcohol, Cetearyl Alcohol, Lanolyn anhydrous, Paraffin Liquid, Glyceryl monostearate, BHT) to the aqueous phase (Aquadest 70°C added Propylene Glycol, Polysorbate 80, Methyl paraben, Propyl paraben) which has been heated at a temperature of 70°-75°C. Liquorice extract certain concentration test results inhibitory activity mixed into a cream base in warm temperature (50°C).
Table.1 Formula of cream. FORMULA (%) b/v Ingridients Blank I Blank II Blank III I II III Liquoorice Root Ethanol Extract - - - 1.01 1.01 1.01 Sodium metabisulfite (to extract) - - - 0,1 0,1 0,1 Stearic acid 2,0 2,0 2,0 2,0 2,0 2,0 Cetyl alcohol 3,0 3,0 3,0 3,0 3,0 3,0 Cetearyl alcohol 6,0 6,0 6,0 6,0 6,0 6,0 Lanolin anhydrous 4,0 4,0 4,0 4,0 4,0 4,0 Paraffin liquid 10,0 10,0 10,0 10,0 10,0 10,0 Glyceryl monostearate 0,1 0,5 0,9 0,1 0,5 0,9 Polysorbate 80 6,0 6,0 6,0 6,0 6,0 6,0 Propylene glycol 15,0 15,0 15,0 15,0 15,0 15,0 Methyl paraben 0,15 0,15 0,15 0,15 0,15 0,15 Propyl paraben 0,05 0,05 0,05 0,05 0,05 0,05 Butyl hydroxy toluene 0,05 0,05 0,05 0,05 0,05 0,05 Perfumes qs qs qs qs qs qs Aquadest ad 100 100 100 100 100 100
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 182
ISBN : 978-602-72418-2-4
Physical quality parameter Evaluation of the physical quality of cream were done, include: organoleptic (colour, odour, and texture); homogeneity by using a glass object; cream emulsion type with microscopic methods; viscosity and rheological properties by using a Brookfield viscometer type RV; spreadability by using a teflon ring; globule size is measured using an optical microscope; centrifugation for 5 hours at a speed of 3800 rpm; cream pH using pHmeter.
Liquorice cream Inhibition of tyrosinase activity invitro Liquorice cream inhibition of Tyrosinase Activity were done with a microplate reader. This assay was performed using methods as described earlier after the cream extracted with a solvent and centrifuged for 15 minutes.
Statistical analysis Data of physical parameter assay were expressed with ANOVA one ways without replication, such as viscocity, spreadability, globule size and pH with p = 0.05 significance level
RESULTS AND DISCUSSION
Liquorice Extract and Kojic Acid Tyrosinase Inhibition Activity Assay
Figure 2. Liquorice extract tyrosinase inhibition activity assay results.
Figure 3. Kojic acid tyrosinase inhibition activity assay results.
Inhibition of tyrosinase enzyme activity in vitro carried out on 96% ethanol extract of the Liquorice root of and kojic acid as a positive control using enzyme concentration of 310 U / mL, pH 6.8, incubation time of 20 minutes, 5 mM substrate concentration and temperature of 37ºC in accordance with preliminary test done. Kojic acid chosen as a positive control because of kojic acid is one of the active substances that are commonly used in skin whitening preparations with a mechanism of tyrosinase inhibitory activity as non-competitive in the oxidation of L-DOPA into the pigment melanin. IC50 value of kojic acid obtained in this study was 20.88 mgmL-1. When compared with the positive control kojic acid, inhibitory activity shown by the liquorice root ethanolic extract lower at 126.76 mgmL-1. In the previous study revealed that Glabridin activity 15 times more potent than kojic acid, but in this study the activity of the liquorice root ethanolic extract showed a lower activity. It caused by the crude extract of liquorice ethanol extract, so there was still many other component which disturb the inhibition activity assay.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 183
ISBN : 978-602-72418-2-4
Physical quality parameter of Cream
Table 2 Physical quality parameter of cream. Formula Parameters Blank I Blank II Blank III I II III Milky Milky Milky Yellowish Yellowish Yellowish white, white, white, white, white, white, Aromatics Organoleptic aromatic aromatic aromatic Aromatics Aromatics odours, less Soft odours, soft odours, soft odours, less odours, Soft odours, Soft textures textures textures soft textures textures textures Homogeneity Homogeneity O/W
Type of cream
Viscosity (Ps) 4000 4400 4600 2800±0,00 3200±100 4000±50 Yield 83817,27-149957,53 value(dyne/cm)
Rheological Properties
Rheological : Tyxotrophy plastic Spreadability 3053.41 2927.69 2885.98 3531,79±6,15 3394,77±24,95 3029,72±0,81 (mm2) Globule size (μm) 60.81 58.21 56.67 65.12±0,01 63.72±0,02 60.00±0,00
Distribution Curve
Centrifugation (-) segregation did not occur pH 4.39 4.38 4.35 4.63 ±0,04 4,55±0,03 4.59±0,03 Activity (%) 19.30 10.14 -17.78
The results of physical quality parameter studies showed Formula I with 0,1% glyceryl monostearate gave soft textures so it is the most convenient in usage and spread easily when applicated, and had the higher activity of tyrosinase inhibitory activity. The variation of Gylceryl monostearate concentration in cream formula related with the softness textures of cream, viscosity spreadbility, globule size, pH and inhibition activity. The higher concentrations of Glyceryl monostearate made the cream less soft, higher visocity, lower spreadability and globule size also lower to acid pH value. This is due to the function of glyceryl monostearate that can improve the cream consistency. The addition of stearyl alcohol also can improve the texture and adds hardness cream that can be softened with cetyl alcohol so cream remained soft. Glyceryl monostearate as co-
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 184
ISBN : 978-602-72418-2-4 emulsifier can reduce the size of the oil globules and can reinforce the coating film that is formed thus increasing the cream consistency. O/W cream emulsion type can be determined by the addition of sudan III, which gained colorless outer phase and inner phase in the form of red globules, while the addition of methylene blue obtained blue outer phase and colorless inner phase in the. The formula viscocity had a lower value than blank formula. This is due to the addition of liquorice extract which tends to be acidic in formula, the interaction between the extract containing polyphenols and saponins compounds with a base of cream, causing a decrease viscosity. The ability to spread decreases with increasing concentration of glyceryl monostearate is used, which is an oil phase of a solid with a large molecular weight, the greater the molecular weight of a substance will be smaller then spreadability, so that the higher the concentration, the lower spreadability. Results of the evaluation showed that the increased concentration of glyceryl monostearate may reduce the ability to spread the cream. Most globules obtained in the range of 31-41 μm and decreases with increasing diameter. Globule size distribution showed normal distribution, if the curve did not meet the normal distribution law can lead to distability of an emulsion system according to Stokes law, which is expected to sedimentation. Globule size can also be influenced by various factors that occur during the manufacturing process such as stirring or mixing. It can be concluded that the concentration of glyceryl monostearate used can affect the liquorice cream globule size distribution. All formulas showed no sedimetation occured after centrifugation for 5 hours at a speed of 3800 rpm, so it can be said cream can be stable during storage year. Cream to be unstable by observing the separation of the dispersed phase that occurs as a result of centrifugation. The principle is that if globules meet the same liquid then tends to form a globule with a larger size. From the evaluation it can be concluded that the concentration of emulsifier in cream enough to form a monomolecular layer on the surface of the oil globules of water so as to prevent coalescence. Liquorice extract containing polyphenols and saponins compounds that big amount of OH- causing the pH of the dosage decreased to acid. The results of the pH approached liquorice extract and also get into the skin's normal pH range is 4.5-6.5. With this pH range, we expected to remain stable and do not irritate the skin because too acidic or alkaline dossage forms can irritate the skin or damage the acid mantle skin can cause skin unprotected against invading microorganisms. However, when compared, % inhibition decreased with the increasing glyceryl monostearate concentrations used in cream. More concentrations of glyceryl monostearate used, then the closer film formed and the closer matrix were available, made it more difficult to extarct the compound dispersed in there. High consistency of cream also produced a complex matrix that currently extracted by the solvent and put in a plate in a certain amount to make the conditions in the plate becomes complex and made the inhibition reaction more difficult for the compound. Based on previous research, liquorice extract contained glycosides, saponins, flavonoids and tannins that had a different stability. The total content of these compounds, especially total polyphenols and total flavonoids affect the activity of the extract in inhibiting the enzyme tyrosinase. Cream formulation using crude extract led to many constituents who might be able to disrupt the activities. Inhibitory activity of formula III result was negative, this is due to the amount of substrate and enzyme were less in favor of the course of the enzymatic reaction. In addition, the compounds Glabridin identified as a whitening agent is a flavonoid. Flavonoids in the plant as a sugar bound to aglycone glycosides and flavonoids that may be in some form of glycosides combination. In order that, the flavonoids are usually better examine the aglycone contained in extracts of plants through the process of hydrolysis before to be its glycon and aglycon. In general, groups of a flavonoid aglycone more active than as a single form of flavonoids.
CONCLUSSION
Liquorice (Glycyrrhiza glabra L.) ethanol extract which contains glabridin is potential to be whitening agent through invitro tyrosinase inhibition activity assay with IC50 value of 126, 75 ppm. Liquorice Ethanol extract 1.01% can be formulated into creams which pass physical quality test and pH as well as effective in inhibiting tyrosinase enzyme. Formula with 0.1% gliceryl monostearate concentration (Formula I) as the best formula.
ACKNOWLEDGEMENT
Special thanks are devote for Directorate General of Higher Education of Indonesia which has given grants in this research. International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 185
ISBN : 978-602-72418-2-4
REFERENCES
1. Aulton”s Pharmaceutics; The Design and Manufacture of Medicines; 3thed; Edinburgh; Churchill Livingstone Elsevier. 2007; p. 42-58; 70-97; 384-405. 2. Lloyd HW, Jenna N, Kammer BA. Treatment of Hyperpigmentation. Semin Cutan Med. Surg.2011;30:171-175. 3. Fais A, Corda M, Era B, et al. Tyrosinase Inhibitor Activity of Coumarin-Resveratrol Hybrids. Molecules.2009;14:2514-2520. 4. Parvez S, Kang M, Chung HS, et al. Survey and Mechanism of Skin Depigmenting and Lightening Agent. Phytother. Res.2006;20(11):921-934. 5. Draelos ZD, Thaman LA. Cosmetic Formulation of Skin Care Products. London: Taylor&Francis; 2006. p.203, 206, 214. 6. Smith N, Vicanova J, Pavel S. The hunt for natural skin whitening agents. Int. J. Mol. Sci. 2009;10:2440-2475 7. Vinayak BR, Mary SR. Natural ingredients for creating food textured cosmetics. USA: Cosmetic Science Technology Journal. 2007. p.33. 8. Qiushi C. Evaluate the effectiveness of the natural cosmetic compared to chemical-based product. International Journal of Chemistry.2009;1:57-59. 9. Yokota T, Nishio H, Kubota, et al. The inhibitory effect of Glabridin from Licorice Extracts on Melanogenesis. Pigment Cell Res. 1998; 11:955-961. 10. Ramsden CA, Patrick AR. Mechanistic Studies of Tyrosinase Inhibitors in Cultures of Pityrosporum. The Journal of Investigative Dermatology. 2010;71:205-208. 11. Jennifer C, Stephie CM. A review on skin whitening property of plant extracts. Bangalore. Int J Pharm Bio Sci. 2012; 3(4):332 – 347. 12. Schrader K, Domsch A. Cosmetology Theory and practice Vol. III. Germany: Cassler Druck and Medien;2005.p.17,28,32,44-53. 13. Ansels HC. Pharmaceutical Dosage Forms and Drug Delivery Systems 8th, Philadelphia; Lippincott Williams & Wilkins; 2005.p.276-297. 14. Wilkinson JB, Moore RJ. Harry’s Cosmeticology. 8th ed. London: George Godwin;2005.p. 226, 707- 726. 15. Batubara I, Darusman LK, Mitsunaga T, et al. Potency of Indonesian medicinal plants as tyrosinase inhibitor and antioxidant agent. J. Bio. Sci., 2010;10(2): 138-144.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 186
ISBN : 978-602-72418-2-4
Accelerated Stability Test of Liquorice (Glycyrrhiza glabra L.) Extract Cream
FARIDAH, SITI UMRAH NOOR, SULIH PROBO SINDI
Faculty of Pharmacy, Pancasila University.
Abstract : The accelerated stability test of Liquorice extract as a whitening agent has been done. The test was conducted for three months at a room temperature and at a temperature of 40°C with 75% RH in climatic chamber for 2 formulas with different concentrations of the co-emulsifier glyceryl monostearate 0.1% and 0.5%. Cream was evaluated include organoleptic test, homogenity, cream type, viscosity and flow properties, the ability to spread, the size of the globules, centrifugation, and the pH test. The results was obtained by these two formulas have cream-colored, flavored green tea, soft textured, homogeneous, O/W type, thixotropy-pseudoplastis,no undergo separation after centrifugation test (3800 rpm for 5 hours), as well as pH which decreased at both room temperature storage at pH formula I (4,56 to 4,30) and formula II (4,54 to 4,33) and at 40˚C / 75% RH storage both of formula I (4,49 to 4,31) and formula II (4,49 to 4,31). The spreadability cream at room temperature storage was reduced in formula I (4416,7 mm2-2237,3 mm2) and the formula II (2734 mm2-1666,9 mm2). In contrast, at 40˚C / 75% RH storage was increased in formula I (4217,6 mm2-5360,9 mm2) and formula II (2886,2 mm2-4287,8 mm2). Viscosity was measured by the speed of 0.5 rpm at room temperature storage has increased in formula I (172000 cPs to 228667 cPs) and formula II (195333 to-269333 cPs), but at 40˚C / 75% RH storage, the viscosity has decreased in formula I (172667 cPs to131333 cPs) and formula II (185333 cPs-158 000 cPs) .The globule sizes of cream at room temperature storage was decreased in formula I (62.26 µm -55.64 µm) and formula II (56,66 µm to 47.81 µm). While at 40˚C / 75% RH storage, was increased in formula I (63,75 µm to 69,03 µm) and formula II (61,55 µm -64,90 µm). It can be concluded that both liquorice cream formula with various glyceryl monostearate concentration was stable for 1 year storage at room temperature.
Key words : accelerated stability test, liquorice, Glycyrrhiza glabra l.
INTRODUCTION
Stability is defined as the ability of a product to keep the specification limits set throughout the period of storage and use to ensure the identity, strength, quality and purity of the product and keep the characteristics product that has been made. There are five types of stability that is generally known are the stability of the chemical, physical, microbiological, therapeutic and toxicology(1). Cream stability test is designed to assess the stability characteristics, appropriate storage conditions and the expired date(1). the cream that has been made must be qualified in general criteria, which is physically and chemically stable. as well as effective and safe when it used. Stability cream is a period in which the cream is stored in a certain period of time will have a constant level, no changes in shape, color, and other changes that can be determined by physical or chemical(2). To obtain the value of the stability of the cream in a short time, can be carried out by accelerated stability test. This test is intended to obtain the desired information in the shortest possible time by keep the sample in designed conditions to accelerate the changes that normally occur in normal conditions. If the test results cream in an accelerated test for 3 months obtained stable results, it shows that the cream is stable at room temperature storage for one year(3). Based on the recommendations of WHO documents, for products
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 187
ISBN : 978-602-72418-2-4 that are marketed globally tested under conditions of climatic zone IV (hot and humid), in which Indonesia is zone IV claim. According to ICH and FDA, a country located in the climatic zones III and IV with the temperature and humidity, is 400 C ± 20C and 75% ± 5% RH. In nature, there are various plantswhich has efficacy as bleaching or whitening agent, such as yam bean, chamomile and liquorice. In the previous studies, the efficacy of liquorice (Glycyrrhiza glabra L.) as an inhibitor of the enzyme tyrosinase has been proved and formulated into a cream dosage forms with varying concentrations of glyceryl monostearate as a co-emulsifier and stiffening agent(4.5). Liquorice extract cream should be required the criteria of stability, so that the formulation is designed to consider some related issues, among physico chemical properties of substances forming such as glabridin which contained in liquorice extracts. . Glabridin is stable at storage temperatures of 2-10˚C in a dry place and protected from light(6). The selected cream base in the formula is a medium cream. This base has a pH of 4.40 to 4.50 so that it has a similarity with the active substance Glabridin, is 4.54. Using the non ionic surfactant as emulgator, such as polysorbat 80 and some co-emulgator as a stiffening agent such as cetyl alcohol, stearyl alcohol, monostearic glyceryl that will enhance the stability of cream.
MATERIALS AND METHODS Ingredients Ethanol extract of liquorice (Glycyrrhiza glabra L.), stearic acid (Wilfarin, China), stearyl alcohol, lanolin anhydrous (Wuxi, China), propylene glycol (Dow Chemical Co., Japan), paraffin Liquidum (Sonneborn, Japan), cetyl alcohol , glyceryl monostearate, polysorbate 80, methyl paraben, propyl paraben, BHT, distilled aqua and green tea perfume. Tools Cup vaporizer, analytical balance, spatula, stir bar, mortar, pestle, stirrer, water bath, viscometer, glass objects, glass cover, pH meter, optical microscope, spreadebility tester, centrifuges and climatic chamber (Memmert). Procedure 1. Extraction Process Liquorice powder macerated with ethanol 96% until perfectly extracted. The filtrate was evaporated with a rotary evaporator to become thick extract. 2. Identification of Flavonoids Extract was boiled with hot water for 5 minutes, then filtered (solution A), to 5 ml of filtrate was added magnesium powder and 1 ml of concentrated HCl, add 2 ml of amyl alcohol, shaked vigorously and allow to separate. The presence of the flavonoid was showed by the formation of red, yellow, or orange in the lining of amyl alcohol. 3. Cream Basic Formulation The cream consist of liquorice extract 0,2% with the medium base : Stearyl alcohol, stearic acid, lanolin, squalene, paraffin liquidum,glyceryl monostearic, polysorbat 80, propylenglycol, methylparaben, propylparaben, BHT, green tea parfume and aquadest. 4. Evaluation of the Cream a. Organoleptic Observed the cream appearance is the color and odor visually. b. Homogenity The cream is applied on the objects glass then clenched with another object glass, and then observed the homogenity, look at the surface. It should be smooth and homogen c. Examination of cream type
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 188
ISBN : 978-602-72418-2-4
Tests carried out using the color method by mixing the cream base with a few drops of a methylene blue solution on the glass object, and then observed with a microscope, if the external phase is blue and the internal phase is transparant drops, so the type of emulsion is oil in water emulsion. On the addition of sudan III, the external phase is red and the internal phase is transparant drops. So, the emulsion type is an oil in water. d. Viscosity and flow properties Determination of the viscosity is carried out by using a Brookfield viscometer RV with a capacity 1- 8000000 Cps. Cream was placed in a container and the appropriate spindle is inserted to the prescribed limit, then rotated at a certain speed until the needle viscometer showed a constant scale. e. Spreadability test The cream is filled on the 15 mm inner diameter of Teflon ring and spread the cream with spatula until there is no bubble. Remove the ring carefully, then covered with a glass plate, then press with a 200 grams load, allow for 3 minutes, then measured the diameter of cream surface then calculated by the following formula : F = π x r2 (mm2) Description: F = Spreadability; π = 3,14; r = radius (mm)
f. Globule size Analysis of globul size was done by measuring the average diameter of globule using microscope. Globul diameter on the object glass was measured using a calibrated micrometer. The amount of calculated globule is about 300 – 500. g. Mechanical tests (centrifugal test) Samples was put into a test tube and then inserted into sentrifugator at a speed of 3800 rpm for 5 hours, then observed the separation of oil and water. h. pH cream pH cream measurement was obtained using a calibrated pH meter.
Data analysis Stability test results data were analyzed by 2-way ANOVA to find out the effect of temperature and self life to the response.
RESULTS AND DISCUSSION
A. Extract Characteristics Test Result Extract Characteristic - A thick , blackish brown color , aromatic odor and a sweet taste - Yield = 8,99 % - DER – Native = 11,13 % - Flavonoids = + - pH = 4,54 B. Stability Test Result Organoleptic Test Organoleptic observation until the first month either at room temperature or at 40 ° C / 75% RH, do not change the color, odor and texture cream. Yellowish white to cream color due to the addition of liquorice extract. The Color changes can occur due to high temperature might accelerate chemical reactions, because each 10˚C rise could accelerate chemical reactions 2 to 3 times. The cream uses green tea
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 189
ISBN : 978-602-72418-2-4
perfume so the odor produced is the scent of green tea. Cream texture changes started in the second month. This is caused by the differences in the concentration of glyceryl monostearate which act as a stiffening agent, where the presence of temperature changes, it will cause changes in the globules size of the cream, so that at room temperature, cream texture tends to be more coarse and at 40˚C creams tend to be softer. Besides of the texture, the odor of the cream is also change in 40˚C storage temperature, this is because the perfume evaporates at high temperatures. The odor changes often referred to rancidity can be caused by oxydation of the oil or fat. The effect of light is a catalyst for the onset of rancidity, that is the combination of these two factors can cause accelerated fat oxidation.
Viscocity of cream
Rheology of cream
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 190
ISBN : 978-602-72418-2-4
Spreadibility of cream
Globule size
pH of cream
The results was obtained by these two formulas have cream-colored, flavored green tea, soft textured, homogeneous, O/W type, thixotropy-pseudoplastis,no undergo separation after centrifugation test (3800 rpm
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 191
ISBN : 978-602-72418-2-4
for 5 hours), as well as pH which decreased at both room temperature storage at pH formula I (4,56 to 4,30) and formula II (4,54 to 4,33) and at 40˚C / 75% RH storage both of formula I (4,49 to 4,31) and formula II (4,49 to 4,31). The spreadability cream at room temperature storage was reduced in formula I (4416,7 mm2- 2237,3 mm2) and the formula II (2734 mm2-1666,9 mm2). In contrast, at 40˚C / 75% RH storage was increased in formula I (4217,6 mm2-5360,9 mm2) and formula II (2886,2 mm2-4287,8 mm2). Viscosity was measured by the speed of 0.5 rpm at room temperature storage has increased in formula I (172000 cPs to 228667 cPs) and formula II (195333 to-269333 cPs), but at 40˚C / 75% RH storage, the viscosity has decreased in formula I (172667 cPs to131333 cPs) and formula II (185333 cPs-158 000 cPs) .The globule sizes of cream at room temperature storage was decreased in formula I (62.26 µm -55.64 µm) and formula II (56,66 µm to 47.81 µm). While at 40˚C / 75% RH storage, was increased in formula I (63,75 µm to 69,03 µm) and formula II (61,55 µm -64,90 µm). Cream-type examination is performed to determine the suitability of the composition of the proportion of each phase, the dispersed phase and the dispersing phase associated with comfort during use. Results of the evaluation of the type of cream made from moon-0 until the 3rd month, either at room temperature or a temperature of 40 C showed that the cream has type O/W.. Cream Type O/W more consumer demand for more convenient to use and have better penetration capability compared to type W/O.
CONCLUSION
Both formulations liquorice cream type O/W with the variation of glyceryl monostearate stable in storage at temperatures of 400C / 75% RH for 3 months or at room temperature (20˚C-25˚C) for a year.
REFERENCES
1. Joshita D. Cosmetic stability. Departemen Farmasi Fakultas Matematika dan Ilmu Pengetahuan Alam Universitas Indonesia. Depok: 2004 2. United State Pharmacopea. Volume 2. United State: 2009 3. Departemen Kesehatan Republik Indonesia. Farmakope Indonesia. Edisi IV. Jakarta: 1995 4. Jens T. Cartensen, C.T. Rhodes. Drug Stability principles and practices, 3rd ed. New York: 1990 5. Connors K.A, Gordon LA, Valentino JS, Stabilitas kimiawi sediaan farmasi. Edisi II, New York: 1986 6. Tim Padfield. A climate chamber for simulating a temperature and humidity gradient across a wall of roof. Technical University of Denmark: 2000 7. Mitsui T. New cosmetic science Edisi I. Amsterdam: 1997 8. B. Eckmann. Prediction of emulsion properties from binder/ emulsifier characteristic. Barcelona: 2000 9. Chang TS, An update review of tyrosinase inhibitors. Taiwan: 2009 10. Yokota T, Nishio N, Kubata Y, Mizoguchi M. The inhibitory effect of glabridin from licorice extract on melanogenesis and inflamatory [abstract]. Pigmen cell research, 2008 11. Raymon CR, Paul JS, Marian EQ. Handbook of pharmaceutical excipients. 7th edition. London: 2009
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 192
Powered by TCPDF (www.tcpdf.org) ISBN : 978-602-72418-2-4
The Variation of Tofu’s Wastewater Concentrations as Culture Medium to the Protein, Lipid and Chlorophyl Contents from Microalgae Nannochloropsis sp.
RIAN NURUL HIDAYAT1)*, SUDJASWADI WIRYOWIDAGDO1), NI WAYAN SRI AGUSTINI2)
1)Faculty of Pharmacy-University of Pancasila. 2)Research Center for Biotechnology LIPI-Cibinong.
Abstract : Nannochlororpsis sp. is one of many microalgae species which has potential to be improved as source of nutrient and pigment that may be very useful in food, cosmetic and pharmacy industry. The growth of microalgae is influenced by environmental and nutritional factors. Tofu’s wastewater (TW) is one of agroindustry wastewater which still contains nutritions (e.g. nitrogen and phosphor) so it can be used as a culture medium for microalgae. This research is purposed to get the optimum concentration of tofu’s wastewater in term of producing the highest protein, lipid and chlorophyl-a content. Nannochloropsis sp. was cultivated in Johnson medium (JM), tofu’s wastewater with concentrations (25%-100%)+JM and TW 100%. Sample testing of microalgae was analyzed its protein, lipid and chlorophyl contents at logarithmic phase and stationary phase. The analysis of protein content was used Biuret method, the analysis of lipid content was used Bligh and Dryer method, the analysis of chlorophyl-a content was used aceton 80%. During 17 days cultivation, the protein content was around 11.48-16.77 g/L at logarithmic phase and 3.72-12.54 g/L at stationary phase. The lipid content was around 0.37- 1.58 g/L at logarithmic phase and 0.55-2.63 g/L at stationary phase. While the chlorophyl-a content was around 4.2-7.7 ppm at logarithmic phase and 5.33-12.04 ppm at stationary phase. The highest protein content was 16.77 ppm which was cultivated in TW 50%+JM medium at logarithmic phase. The highest lipid content was 2.63 g/L which was cultivated in TW 100% medium at stationary phase. While, the highest chlorophyl-a content was 12.04 ppm which was cultivated in TW 50%+JM medium at stationary phase. According to the results that the variation of tofu’s wastewater concentrationts can influence Nannochloropsis sp. cell contents.
Keywords: Nannochloropsis sp., tofu’s wastewater, protein, lipid, chlorophyl-a
INTRODUCTION
Microalgae is a micro-size algae that has diameter around 3-30µm, both unicellular and multicellular forms, and can live in sea water or fresh water habitat. The microalgae has potential to be improved as a new resource for bioenergy, medicine and chemical substances, etc. Nannochlororpsis sp. is one of many microalgae species which has potential to be improved as source of nutrient and pigment that may be very useful in food, cosmetic and pharmaceutical industry(1). The most important nutrient that can be produce by Nannochloropsis sp. is protein which has reach 52.11%. On medicine field, this protein can be used as a natural antioksidan after enzymatic reaction process. Beside that, Nannochloropsis sp. has lipid which reach 27.64%. The bigger of lipid content is a potential for fatty acid contents such as docosahexaenoat acid and eicosapentaenoic acid which is useful to prevent coronary heart disease, ischemic stroke, rheumatoid arthritis, dementia and depression(2). Nannochloropsis sp. also has a pigment called
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 193 ISBN : 978-602-72418-2-4 chlorophyl which reach 0.89% and has an important role in photosintetic process. The chlorophyl has many kinds such as chlorophyl a, b, c, d and f. Nannochloropsis sp. has only one type of chlorophyl that is chlorophyl-a. On medicine field, the chlorophyl is useful to prevent anemia, detoxification of liver and has an antioksidan activity(3). The growth of Nannochloropsis sp. needs a culture medium containing macro-nutrition and micro- nutrition. Tofu’s wastewater is one of agroindustry wastewater which has potential to be used as culture medium due to its contents including macro-nutrition substances such as nitrogen and phosfor and micro- nutrition substances such as calcium, magnesium, iron and sodium which are used for the growth of microalgae(4). This research is purposed to get the optimum concentration of tofu’s wastewater in term of producing the highest protein, lipid and chlorophyl-a content.
MATERIALS AND METHODS
Strain and culture conditions Nannochloropsis sp. was obtained from Fresh-water Microalgae Laboratory, Research Center for Biotechnology LIPI-Cibinong. The strain was cultivated in Johnson medium (JM), tofu’s wastewater (TW) medium with the following concentrations: TW 25%+JM, TW 50%+JM, TW 75%+JM, TW 100%+JM and TW 100%. The johnson medium contained with the following substances (per litre): 27g NaCl, 0.5g MgSO4, 1.5g MgCl2, 0.2g CaCl2, 1g KNO3, 0.035g KH2PO4, 0.043g NaHCO3, 0.2g KCl, 10ml Fe-Solution and 10ml Trace-elements. Fe-Solution:189mg Na2EDTA and 244mg FeCl3.6H2O. The cultures were set up in six 2L-bottles placed in room temperature (25oC) and aerated by bubbling with a mixture of 1% CO2 in air. Continuous illumination was provided by TL lamps with light intensity 2500 lux. Before the cultivation, different tofu’s wastewater concentrations was aerated until pH 7 which was optimum pH for the growth of microalgae. Experiment design Absorbency was used to represent the growth of Nannochlororpsis sp.. Absorbency was measured at 680nm by spectrophotometer uv-vis (Hitachi 3950H). Sample testing of Nannochloropsis sp. was done at logarithmic phase and stationary phase to analyze its protein, lipid and chlorophyl contents. Protein content was measured using Biuret method(5). Biuret reagent and combined with sonicator (Branson) were used to extract the protein from each sample at room temperature. The extracted matter was centrifuged and measured the absorbency at λ550nm using spectrophotometer vis (Hitachi 3950H). Concentrations of protein were determined according to the regression curve equation of Bovine Serum Albumin (BSA): Y = a+bx, while : y=absorbency, x=concentration of protein
Total lipid content was analyzed using Bligh and Dryer method. The mixture solvent chloroform- methanol-water (2:1:0,8) and combined with sonicator (Branson) were used to extract the total lipid from each sample at room temperature. The chlroform phase was collected and poured into the tubes which were weighted before. Then, the tubes (containing chloroform phase) were dryed in an oven (Heraus) with temperature 500C and then weighted again. Total lipid contents were determined gravimetrically according to the formulas below:
Total lipid weight (g/L) = ((tube+ lipid) weight – whole tube weight) x 100
Chlorophyl-a content was measured using the spectrophotometric method. Aceton (80%) and combained with sonicator (Branson) were used to extract the chlorophyl-a from each sample at room temperature. The extracted matter was centrifuged (4000rpm,10min) and then the 600-700nm absoption spectrum was used to measure the pigments by spetrophotometer vis (Hitachi 3950H). Concentrations of chlorophyl-a were determined according to the formulas of Becker (1994)(5):
Chlorophyl-a (mg/l) = (12,7 x A663) – (2,69 x A645)
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 194 ISBN : 978-602-72418-2-4
RESULTS AND DISCUSSION
Fig.1 The growth curve of Nannochloropsis sp. Fig. 2 Standard curve of BSA.
Fig.3 Protein content. Fig. 4 Total lipid content.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 195 ISBN : 978-602-72418-2-4
Fig. 5 Chlorophyl-a Fig. 6 pH medium
Growth of Nannochloropsis sp. The growth of cell was measured according to the number of cell per volume. The growth of Nannochloropsis sp. under various concentrations of tofu’s wastewater (TW) experienced adaptation phase for 3 days (in TW 25%+JM, TW 50%+JM and TW 75%+JM mediums), while the others were for 4 days (in TW 100%+JM and TW 100% mediums). Adaptation phase occured due to the substitution of TW as part of culture medium influenced the environment of medium. In the opposite side, there was not adaptation phase on Nannochloropsis sp. cultivated in JM (Fig.1). The maximum number of cell Nannochloropsis sp. was 117.08 x 106 cells mL-1 in TW 50%+JM medium. The growth of Nannochloropsis sp. showed the lowest number of cell when cultivated in JM and TW 100%+JM medium with the value of 81.23x106 cells mL-1 and 81.35x106 cells mL-1, respectively (Fig.1). the different of the number of cell under various medium conditions were correlated to amount of nutrition in the culture medium. At the end of the experiment, the growth of Nannochloropsis sp. was at pH 10 (pH culture medium) (Fig.6). Even though on alkali condition, the pH could be tolerated that Nannochloropsis sp. could live at pH 7-10(6).
Protein content The Biuret method is one of the most accurate methods for quantifying protein. In principle, the Biuret method was based on reactions between peptide bond with Cu2+ ion to form a colouring complex substance. The more peptide bond is there, the more intensity of the colour of complex substance. The absorbance would be determined at a wavelength of 550 nm to a calibration curve of standard solutions of a protein. Bovine serum albumin (BSA) is the commonly used standard. Using BSA as a standard, the calibration curve was linear in the absorbance range of 0.2-0.7 corresponding to a protein concentration range from 6000-16000 mgL-1. Within this range, the correlation coefficient was >0.976 (Fig.2). Overall, the protein content was higher at logarithmic phase than stationary phase (Fig.3). According to Davies’s statement in Tadros et al. (1995)(7), this was occuring due to the degradation of protein as the increasing of protease enzyme activity at stationary phase. The protein content of Nannochloropsis sp. at logarithmic phase was different in each culture medium due to the content of its nutrition. According to the result (Fig.3), the highest of protein content was 16,77 gL-1 which was cultivated in TW 50%+JM
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 196 ISBN : 978-602-72418-2-4 medium. This result was correlated to the nutrition content of medium. The optimum amount of nitrogen in medium has influenced to form intracellular protein(5). In contrast, the lowest of protein content was 11.48 gL-1 which was cultivated in TW 100%. Based on statistical test Kruskal-wallis, there was not significanly different on the protein content between the culture medium (p>0.05), but there was significanly different between the growth phase (p<0.05).
Total lipid content The analysis of total lipid was used Bligh and Dryer method. This methode was one of most popular and standar model to analyze the lipid content. The benefit of this method was not required much biomass, simple method and cheap. Commonly, the lipid content was higher at stationary phase than logarithmic phase (Fig.4). this was occuring due to decreasing of cells fission and starting to save the product into lipid form(8). The highest of lipid content was 2,63 g/L which was cultivated in TW 100%. The TW 100% medium (without JM nutrition) was including of a little nutrition of nitrogen. The accumulation of total lipid occured when the content of nitrogen nutrition was limited(1). This result was similar to Leyla uslu’s research (2011) that the deficiency of nitrogen nutrition in medium caused the accumulation of total lipid on Spirulina platensis. Comparing to the lipid content in JM, TW 25%+JM, TW 50%+JM, TW 75%+JM, TW 100%+JM were 2.55 gL-1, 1.56 gL-1, 1.37 gL-1, 0.78 gL-1 dan 0.55 gL-1, respectively. The lipid content was decreasing as the increasing of TW concentration which caused the increasing of nitrogen content in culture medium. The increasing of total lipid was occuring at stationary phase which the pH of culture mediums were more than 7, it means that the accumulation of total lipid was also occuring when the culture mediums were on alkali condition. This interpretation was supported by Ben amotz’s research (1985) that the accumulation of total lipid may occured on alkali condition. Based on statistical test Kruskal-wallis, there was significanly different on the total lipid content between the culture medium (p<0.05) and between the growth phase (p<0.05).
Chlorophyl-a content Genus Nannochloropsis was firstly descripted by Hibbered (1981) which removed it from class Chlorophyceae into class Eustigmatophyceae due to have only chlorophyl-a(9). The analysis of chlorophyl-a content was used aceton 80% to avoid the forming of artifacts that may occured when used wether methanol or ethanol. The artifacts were a change form from real chlorophyl-a. The artifacts of chlorophyl-a had a different characteristic in spectrum. The highest of chlorophyl-a content was 12,04 mgL-1 which was cultivated in TW 50%+JM medium. While in TW 75%+JM and TW 100%+JM medium were 7,48 mgL-1 and 6,14 mgL-1, that was lower than in TW 50%+JM medium. This result could be occured because microalgae was only using nutrition in certain number. The amount of nitrogen in higher concentration could be toxic for itself(5). In contrast, the lowest of chlorophyl-a content was 5,33 mgL-1 which was cultivated in TW 100% medium. this result may occured because 100% medium was enough muddy so it influenced the light intensity which entered the culture medium (the light was used microalga to photosyntesis process). Based on Pal et. al.’s research (2011)(10) that the different amount of light intensity would influence the chlorophyl content on Nannochloropsis. Overall, the chlorophyl-a content was higher at stationary phase than logarithmic phase (Fig.5). There was correlation between the number of cell and its chlorophyl-a content as to the higher amount of cells caused to the higher chlorophyl-a content at stationary phase. This research appropriated with Wilson and Walter’s reasearch (1989) that the chlorophyl-a content from unicellular algae as a function from its growth. Based on statistical test Kruskal-wallis, there was significanly different on the chlorophyl-a content between the culture medium (p<0.05) and between the growth phase (p<0.05).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 197 ISBN : 978-602-72418-2-4
CONCLUSION
The growth models of Nannochloropsis sp. in the variation of tofu’s wastewater concentrations were logarithmic phase on 1st-14th day with the cell number (7.85-114.15)x106 cells ml-1 and stationary phase on 14th-16th day with the cell number (81.23-117,08)x106 cells ml-1. In the 50%+JM medium has been produced the highest of protein and chlorophyl-a content, (16.77 gL-1) and (12.04 ppm),respectively, while the highest of total lipid content (2.63 gL-1 ) has been in the TW 100% medium.
ACKNOWLEDGMENTS
The authors would like to thank Research Center for Biotechnology LIPI-Cibinong which has facilitated this research project.
REFERENCES
1. Borowitzka MA, Borowitzka LJ. Mikroalgal biotechnology. Cambridge: Cambridge University Press; 1988. p. 3-18, 257-61, 270-77, 305-15, 460. 2. Russell FD, Corinna S. Distinguishing health benefits of Eicosapentaenoic and Docosahexaenoic Acids. J Marine Drugs. 2012; 10 (10): 1-25. 3. Inanc AL. Chlorophyll: Structural properties, health benefits and its occurrence in virgin olive oils. Academic Food Journal. Departemen of Food Engineering-Imam University Turkey. 2011; 9(2): 1- 10. 4. Husin A. Tofu’s wastewater process using an anaerob biofiltration in reactor fixed-bed. (tesis). Medan: Postgraduate School USU; 2008. h. 12-5. 5. Becker EW. Microalgae biotechnology and microbiology. 1st ed. Cambridge: Cambridge University Press; 1994. p. 11-27, 57-60, 177-95, 225-6. 6. Briassoulis D, et. al. An Experimental helical-tubular photobioreactor for continuous production of Nannochloropsis sp.. J. Bioresouce Technology. Vol. 101 (17). 2010. p. 6768-6777. 7. Tadros et MG, Smith W, Joseph B. Yield and quality of cyanobacteria Spirulina maxima in continuous culture in response to sodium chloride. J.App. Biochem. And Biotech. 1995. p. 275-281 8. Guzman HM, Valido AJ, Duarte LC, Presmanes KF. Estimate by means of flow cytometry of variation in composition of fatty acids from Tetraselmis suecica in response to culture conditions. Aquacult.Int .2010. 18: 189-199. 9. Sukenik A. Production of eicosapentaenoic acid by the marine eustigmatophyte Nannochloropsis. In: Chemicals from microalgae. Editor Zvi Cohen. London: Taylor & Francis Ltd; 1999. p. 42-43. 10. Pal D, Inna KG, Cohen Z. The effect of light, salinity and nitrogen availability on lipid production by Nannochloropsis sp. J.Appl Microbiol Biotechnol . 2011. 90: 1429-144.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 198 ISBN : 978-602-72418-2-4
Utilization of Corn Husk Waste to Produce Cellulase Enzymes by Trichoderma viride FNCC 6013
MIRA ANDAM DEWI*, RIRIN PUSPADEWI, SYLVIA HERYANTI
Faculty of Pharmacy, Jenderal Achmad Yani University, Cimahi.
Abstract : Corn husk waste is one of the waste that is abundant and contains components cellulose, lignin and hemicellulose can be used as raw materials or substrates used for the manufacture of cellulase enzymes, so it has indigo economic and environmentally friendly. Before the corn husk waste is used as the substrate concentration levels need to be minimized its lignin with process delignification using 4 % NaOH. It used mold that is Trichoderma viride FNCC 6013 is a producer of cellulose serve to be glucose. Test performed include glucose qualitative test and test cellulase enzyme activity. Qualitative glucose test result showed positive result begin from day 1 of fermentation while the highest cellulase enzyme activity test was obtained at day 8 is 0,0047 U/mL.
Keywords: corn husk waste, Trichoderma viride FNCC 6013, cellulase enzymes, delignification
INTRODUCTION
Waste is an issue that is still difficult to be solved by the community. One of that is agricultural waste. Increased agricultural products followed by increased agricultural waste. In Indonesia, one of the commodities that are a staple of most is corn. According to data from the department of agriculture (2005) maize production in Indonesia began to rise sharply after 2002 at a rate of 9.14% per year. In 2005, maize production reached 12.5 million tons. Prior to 1990, the use of corn in Indonesia more (86%) for the direct consumption, only about 6% for the feed industry. However, abundant maize production can be maximized seems not well. The use of corn is now over to consumption of seeds only. It is obviously an impact on the amount of waste produced, such as stems, tubers, until his skin. The use of this corn wastes merely as fodder or craft. The potential of corn could be used more optimally. Corn husk into one part that is rich in cellulose content of 42%. Cellulose contained in the waste corn husk can be used to help produce the enzyme cellulase.(1) Trichoderma viride 6013 FNCC produce cellulase enzymes. Cellulase enzymes produced by Trichoderma viride FNCC 6013 has the ability to break down cellulose into glucose. Selobiohidrolase break down cellulose through hydrogen bonding causes the cellulose chains easily hydrolyzed further. Hydrolysis takes place in order to obtain cellobiose and glucose eventually carried out by the enzyme β- glukonase and β-glucosidase.(2) Trichoderma viride FNCC 6013 one type of mold that is cellulolitic because it can produce cellulase. Many molds that are cellulolitic but not many that produce cellulase enzymes enough to be used directly.(3) Cellulolytic mold a good enough enzyme-producing cellulolytic is Trichoderma viride.(4) Gains these mold as a source of cellulose is to produce cellulase complete with all the components necessary for total hydrolysis of crystalline cellulose.(4) Cellulase enzyme is an enzyme complex that consists of several enzymes that work gradually or together outlines of cellulose into glucose.(5) Cellulase enzymes is the name for all enzymes that break β- 1,4 glycosidic bonds in cellulose, selodekstrin, cellobiose and other cellulose derivatives.(6) Cellulase is not possessed by humans, because humans can not decipher the cellulose. But this can be done by some animals such as goats, cows, and insects such as termites because the digestive systems
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 199 ISBN : 978-602-72418-2-4 contain bacteria and protozoa that produce cellulase enzymes that will hydrolyze beta-1,4 glycosidic bonds. Cellulase enzyme plays an important role in a variety of industries, including industry with the use of cellulase quite large as the textile, pulp & paper, detergents, food and pharmaceuticals. Potential cellulase enzymes to hydrolyze lignocellulose into bioethanol production expectations. The production of bioethanol currently developed can be made from a substrate containing glucose which is then hydrolysed to ethanol by fermentation. A source of glucose that can be used can be derived from foods containing glucose but in the process is considered less effective because it would create competition for food needs of everyday people. One of the other alternatives that can provide is to utilize the glucose in the form of cellulosic biomass which are found mainly in agricultural waste such as straw, corn and sugarcane. Cellulose can be hydrolyzed to glucose using cellulase enzyme biocatalyst form. New constraints that arise is the high price of cellulase enzymes in the market, so it is considered less effective for large scale production. Based on the above, it is necessary to do research in the use of corn husk waste to produce cellulase enzymes by using Trichoderma viride FNCC 6013. Selection of Trichoderma viride FNCC 6013 as the starter based on the consideration of the ease to breed, ease in it, and of course because of its ability to produce cellulase enzymes. Selection of corn husk as substrate to assist in producing cellulase enzymes with the primary consideration is in addition to corn husk status as well as waste containing cellulose in high enough quantities. Cellulose this is required by Trichoderma viride FNCC 6013 as a starter to produce cellulase enzymes that can break down cellulose into glucose. Testing was conducted on the qualitative test glucose and cellulase enzyme activity test.
MATERIALS AND METHODS
Corn husk waste is expected to support the growth of Trichoderma viride FNCC 6013 as a starter in producing cellulase enzymes are enzymes that can hydrolyze cellulose to glucose. The study begins with the rejuvenation of Trichoderma viride FNCC 6013 in PDA (Potato Dextrose Agar) for 7 days to get mold in the productive age. 7 days old mold culture and then suspended in media PDB (Potato Dextrose Broth). The growth curve of Trichoderma viride FNCC 6013 in the media PDB carried out for 14 days in bottles and incubated in a rotary shaker incubator with a stirring speed of 150 rpm at a temperature of 25- 28 ° C. Observations were made every 24 hours for 14 days by weighing the dry cell weight. The measurement results obtained over time will result in mold growth curve. The next stage is to prepare the corn husk substrate that will be used include the cutting process, delignification, sterilization, screening, washing and drying. Observation of cellulase enzyme fermentation results in early lag phase to late stationary phase of growth of mold starter. Fermented centrifuged at 14,000 rpm for 5 min at 4 ° C. Fermented then testing glucose content qualitatively and cellulase enzyme activity tests carried out by hydrolyzing the substrate CMC 1% and Whatman filter paper No. 1. reducing sugar produced is calculated by the method of Somogyi Nelson on Uv-Vis spectrophotometry λ 752.2 nm. Corn husk waste is expected to support the growth of Trichoderma viride FNCC 6013 as a starter in producing cellulase enzymes are enzymes that can hydrolyze cellulose to glucose. The study begins with the rejuvenation of Trichoderma viride FNCC 6013 in PDA for 7 days to get mold in the productive age. 7 days old mold culture and then suspended in media PDB. The growth curve of Trichoderma viride FNCC 6013 GDP in the media carried out for 14 days in bottles and incubated in a rotary shaker incubator with a stirring speed of 150 rpm at a temperature of 25- 28 ° C. Observations were made every 24 hours for 14 days by weighing the dry cell weight. The measurement results obtained over time will result in mold growth curve. The next stage is to prepare the corn husk substrate that will be used include the cutting process, delignification, sterilization, screening, washing and drying. Observation of cellulase enzyme fermentation results in early lag phase to late stationary phase of growth of mold starter. Fermented centrifuged at 14,000 rpm for 5 min at 4 ° C. Fermented then testing
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 200 ISBN : 978-602-72418-2-4 glucose content qualitatively and cellulase enzyme activity tests carried out by hydrolyzing the substrate CMC 1% and Whatman filter paper No. 1. reducing sugar produced is calculated by the method of Somogyi Nelson on Uv-Vis spectrophotometry λ 752.2 nm.
RESULTS AND DISCUSSION
Making the growth curve of Trichoderma viride FNCC 6013 A total of 5 mL starter Trichoderma viride FNCC 6013 in sterile water was aseptically inoculated into 15 bottles containing 45 mL media total PDB that has been sterilized in an autoclave at 121 ° C for 15 minutes. Bottle is closed using a cotton plug and covered with aluminum foil. Bottles were incubated in a rotary shaker incubator with a stirring speed of 150 rpm at a temperature of 25-28 ° C. Observations were made every 24 hours for 14 days by weighing the dry cell weight. Dry cell weight data and the sampling time is described as mold growth curve is the weight versus time curve. Dry cell weight data which weighed a picture of a population of cells in each phase of mold growth. Data growth curve Trichoderma viride FNCC 6013 in media PDB describe the phases of cell growth of mold that is the initial phase lag day 1, the end of the phase lag day 2, the early log phase to 3, the end of the log phase day 7 and early stationary phase today 8 th and final day stationary phase.
Figure 1. Growth curve of Trichoderma viride FNCC 6013.
Substrate Preparation Corn Leather Waste(7) Leather waste corn used is waste that is still fresh corn husk green to yellowish green. Corn husk waste is then cleaned of dirt and then chopped up to ± 2cm size and smoothed by using a blender. Furthermore, corn husks soaked in a solution of NaOH 4% with a ratio of 1: 5 (w / v) for 2 hours, the mixture is put into a tool autoclaving at 121 ° C for 15 minutes. Corn husk is then filtered to separated and washed repeatedly with distilled water until pH neutral. Otherwise neutral pH conditions when the pH of the washing water pH corn husks together with distilled water. Skin samples of corn is dried in an oven at 105 ° C for 10 hours, the sample weighed 2.5 g and stored at room temperature for the substrate will then be used as a growth medium of Trichoderma viride FNCC 6013.
Figure 2. Substrate Corn Husk Waste
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 201 ISBN : 978-602-72418-2-4
Cellulase enzyme fermentation(7) A total of 25 mL of Trichoderma viride FNCC 6013 in sterile water was aseptically inoculated into Erlenmeyer flask containing corn husk substrate and zinc sulfat.7H2O (ZnSO4.7H2O) 5 mg in 225 ml of distilled water and 98% acetic acid added to pH 5, which had been sterilized in an autoclave at 121 ° C for 15 minutes. The mixture was incubated in a rotary shaker incubator with a stirring speed of 150 rpm at 25-28 ° C and fermented start from the beginning until the end of the lag phase stationary phase of the growth curve. Expected fermented liquid containing the enzyme cellulase then centrifuged at a speed of 14,000 rpm for 5 minutes. The supernatant is separated, further testing glucose content qualitatively and testing of cellulase enzyme activity.
Figure 3. Fermented
Qualitative testing Glucose and Cellulase Enzyme Activity Determination(7) (8) Glucose content qualitative testing was performed using reagents Benedict and reagent Fehling which indicated a positive reaction to the onset of red sludge.
Figure 4. Results + with Fehling reagent Figure 5. Results + with reagent Benedict
Cellulolytic activity of the crude enzyme cellulase obtained is determined by its ability to catalyze the hydrolysis of two kinds of cellulosic substrates. The substrate used in these experiments are: CMC 1% and Filter Paper Units (Whatman filter paper No. 1).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 202 ISBN : 978-602-72418-2-4
Table 1. Composition and filtrate Enzyme Substrate for Activity Test Filtrat Paper Unit (FPU) CMC 1 % Substrate 50 mg 1 ml
Asetat buffer pH 5 1 ml 0,9 ml
Enzyme 0,5 ml 0,1 ml
The mixture was incubated at 30 ° C and incubated for 0 and 30 minutes. Enzyme activity was stopped by soaking in boiling water for ± 5 minutes. Further reducing sugars formed were tested by the method of Somogy Nelson. The formula used to calculate the enzyme activity:
Description : AE = Enzyme Activity (U / mL) pt = concentration of glucose in the incubation time t minute (mol / mL) q0 = concentration of glucose in the incubation time o minute (mol / mL) t = incubation time (minutes) One unit of enzyme activity is defined as 1 mol of glucose produced per minute at 30 ° C.
Testing Sugar Reducers (Somogyi Nelson)(7) Reducing sugar formed from the hydrolysis of the substrate by a subsequent cellulase enzyme rough determined using the Somogyi Nelson. Reagents used consisting of alkaline copper reagent made by mixing reagent A Nelson and Nelson B 4: 1 when used. Nelson A: 1.5 g K-Na Tartrate, 3 g Na2CO3, 18 g of Na2SO4 dissolved in distilled water to 100 mL. Nelson B: 2 g CuSO4,5H2O dissolved in a little distilled water, plus 18 g Na2SO4 and 2 drops of concentrated H2SO4 and then added to 100 mL of distilled water. Arsenmolibdat reagent prepared from 5 g of ammonium molybdate were dissolved in 90 mL aqudest plus 5 mL concentrated H2SO4 (a), then added 0.6 g Na-arsenate dissolved in 5 mL of distilled water (b). B solution mixed with a solvent to form a clear yellow solution. The solution was incubated at 37 ° C for 1 day. (9) One (1) mililitre liquid hydrolysis proceeds, coupled with alkaline copper reagent 1 ml and the mixture is heated for 20 minutes in a water bath. Mix when cool, add 1 ml of reagent arsenmolibdat, and diluted with 7 ml of distilled water, stirred until homogeneous and measured absorbance at a wavelength of 752.2 nm. Results absorbance reading is then converted to glucose standard linear equations. This study refers to a fermentation process producing cellulase enzyme where the enzyme is able to degrade cellulose to glucose. This study uses a Trichoderma viride FNCC 6013 as a starter and waste corn husks as substrate. SelectedTrichoderma viride FNCC 6013 as a starter because it can produce cellulase enzymes complete with all the components necessary for total hydrolysis of crystalline cellulose and cellulose protein produced quite high. (4) This research is expectejd to be able to provide an alternative to the utilization of waste corn husk corn husk so that waste can be made into something more useful. At the beginning of the study conducted rejuvenation Trichoderma viride FNCC 6013 in order to obtain the amount of mold that much and can produce the enzyme at its optimum. The medium used for rejuvenation is the PDA (Potato Dextrose Agar) because the media is a nutritionally dense media carbohydrate (dextrose) is good for the growth of mold. The next process is the manufacture of a growth curve Trichoderma viride FNCC 6013 the aim is to find out when the mold is able to produce cellulase enzymes so it will be easier to determine the sampling for qualitative testing and testing glucose enzyme activity. The medium used for the manufacture of the growth curve is PDB (Potato Dextrose Broth) because the media is able to provide nutrients such as carbohydrate (dextrose) that can support the growth of Trichoderma viride FNCC 6013. A total of 5 mL of Trichoderma viride FNCC 6013 in sterile water was aseptically inoculated into 15 bottles containing 45 mL media total PDB that has been sterilized in an
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 203 ISBN : 978-602-72418-2-4 autoclave at 121 ° C for 15 minutes. Bottle is closed using a cotton plug and covered with aluminum foil. Bottles were incubated in a rotary shaker incubator with a stirring speed of 150 rpm at 25-28 ° C. The purpose of using a rotary shaker incubator is to provide aeration so oxygen availability remain guaranteed, because the fermentation process should take place in aerobic conditions. In addition, the stirring also aims to agitation so as to keep the cells of mold remain in all parts of the substrate (not settle). Observations were made every 24 hours for 14 days by weighing the dry cell weight. Data growth curve Trichoderma viride FNCC 6013 in a medium PDB illustrates the expected phases of cell growth of mold that is the initial phase lag day 1, the end of the phase lag day 2, the early log phase to 3, the end of the log phase day 7 and early stationary phase day 8 and the end of the stationary phase to 12. But the visible data that fluctuate on day 4 to 7, it can be caused by a lack of agitation and aeration during the fermentation process. So that the cells produced by molds that should optimally in log phase hampered due to the intake of oxygen which is a necessity to decrease mold growth.(2) Before fermentation, corn husk waste substrate is prepared first. The corn husk waste used is still fresh corn husk green to yellowish green. Corn husk waste is then cleaned of dirt and then chopped up and blended measuring ± 2 cm to minimize the size of the corn husk waste so that the surface area in contact with NaOH while delignification process becomes larger. Further more, corn husks soaked in a solution of NaOH 4% with a ratio of 1: 5 (w / v) for 2 hours, the process is a process of delignification in which the delignification with NaOH solution can attack and damage the structure of lignin, part crystalline and amorphous, separating most of the lignin and hemicellulose and cellulose that causes swelling of cellulose structure becomes more open and easier to interact with the enzyme, so the hydrolysis of cellulose to glucose will be easier.(10) The mixture is put into an autoclave apparatus for 15 minutes, at a temperature of 121 ° C. Corn husk is then filtered to separated and washed repeatedly with distilled water until pH neutral. Otherwise neutral pH conditions when the pH of the washing water pH corn husks together with distilled water. Skin samples of corn is dried in an oven at 105 ° C for 10 hours, the sample weighed 2.5 g and stored at room temperature for the substrate will then be used as a growth medium Trichoderma viride FNCC 6013. The fermentation process is done with the addition of nutrients such as trace element that can increase the activity of cellulase enzyme is a zinc sulfat.7H2O which is a cofactor for the enzyme. Trace element is a nutrient essential, lack of trace elements can extend the phase lag (adaptation) and can lower the growth rate, but the addition of trace element overload can inhibit microbial growth.(7) From the tests it is known that the enzyme cellulase ranging generated from the first day of fermentation where the results will contain glucose fermentation that is the result of decomposition of cellulose to glucose performed by cellulase enzymes. After testing the qualitative glucose on day 1 positive containing glucose were shown with sediment red brick that can describe the cellulase enzymes in fermentation results were compared with day 0 of fermentation which showed negative results which have not been the formation of cellulase enzymes so that glucose is not contained within the fermentation days to 0.(8) Testing conducted cellulase enzyme activity at the beginning of the lag phase to late stationary phase is from day 1 to day 12 to determine the phase Which highest activity of cellulase enzyme is produced. A cellulase enzyme complex consisting of several enzymes that work in stages or together outlines of cellulose to glucose by means of hydrolyzing the glycoside bond β (1 → 4) on cellulose. There are four groups of cellulase enzymes, which are distinguished based on their substrate specificity, ie endo- β- 1,4 glucanase, β-1,4-D-glucan selobiohidrolase, β-1,4-D-glucans and β-1,4 glukohidrolase -glukosidase. Endo- enzyme β-1,4 glucanase has a high specificity for substrates that are amorphous, such as CMC. This enzyme menghidirolisis glycoside bond β (1 → 4) randomly. Endo- β-1,4 glucanase working on the chain CMC produce oligosaccharides or cellulose chains shorter. Cellulose (CMC) has a higher solubility than cellulose, thus easily hydrolyzed. One unit of activity (U) is defined 1 mol of glucose produced from the degradation of CMC per minute at pH 5 and the temperature of the test is 30 ° C.(7) FPU activity test with (Filter Paper Units) is used to indicate total cellulase activity. One unit of enzyme is defined as 1 mol glucose formed during 1 min at pH 5 and 30 ° C. Activity test using Whatman filter paper No. 1 with the size of the strips 1x6 cm weighing 50 mg as a substrate commonly done because the substrate of the test are easy to obtain and inexpensive.(11) Test of activity with this method has some drawbacks, such as inconsistency in size, shape, and the method of folding the substrate test can cause errors in the determination of the activity.(12)
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 204 ISBN : 978-602-72418-2-4
The test results cellulase enzyme activity was measured by the method of Somogyi Nelson on UV- vis spectrophotometer at a wavelength of 752.2 nm. Reducing sugar measured absorbance plotted on a standard curve of glucose. Endoglucanase enzyme and enzyme activity of the enzyme cellulase total ranging generated from day 1 during the lag phase and achieved the highest enzyme activity at day 9 for endoglucanase and day 8 for a total enzyme then continued to decline until day 12. This may be due to delays glucose production by the enzyme it produces. This is referred to as the effect of glucose in which glucose can inhibit the formation of catabolic enzymes.(6) The enzyme activity endoglucanase and enzyme activity total began to look at the one that is in phase lag which in this phase is the phase adjustment of the cells with the environment formation of enzymes for parse the substrate. Highest endoglucanase enzyme activity obtained on day 9 when the stationary phase with enzyme activity as much as 0.0031 U / mL while the highest total enzyme activity obtained by day 8 at the beginning of the stationary phase with the enzyme activity of 0.0047 U / mL.
Table 2. Data endoglucanase Enzyme Activity and Total Enzyme Activity Total Enzym Fermentation Endoglucanase Activity Activity 1 0,0017 0,0018 2 0,0014 0,0022 3 0,0014 0,0031 4 0,0019 0,0037 5 0,0016 0,0027 6 0,0021 0,0032 7 0,002 0,0024 8 0,0023 0,0047 9 0,0031 0,0024 10 0,0017 0,002 11 0,0019 0,0024 12 0,001 0,0016
Figure 6. The cellulase enzyme activity
CONCLUSION
Based on observations conducted on the research that has been done, it can be deduced that corn husk waste can be used as a natural substrate to produced cellulase enzymes by Trichoderma viride FNCC 6013. Based on qualitative testing glucose, the enzyme cellulase ranging generated from day 1. The highest cellulase enzyme activity is obtained by testing the enzyme activity using the substrate FPU total is 0.0047 U / mL.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 205 ISBN : 978-602-72418-2-4
REFERENCES
1. Wahyudi, M.P, Achmad, F., Firna, S., Saraswati,s S.A, Setia B. 2012. Pemanfaatan Limbah Kulit Jagung (Zea mays) Sebagai Komposit Pembuatan Sumpit Makan. Universitas Indonesia. Depok. 2. Pratiwi, H. 2014. Pemanfaatan Limbah Kulit Nanas Untuk Biosintesis Asam Sitrat Menggunakan Trichoderma viride FNCC 6013. (skripsi) : Cimahi (ID) UNJANI CIMAHI. 3. Judoamidjojo, M., A. Darwis, E. Gumbira. 1990. Teknologi Fermentasi. Pusat Antar Universitas Bioteknologi. Institut Pertanian Bogor. Bogor. 4. Pelczar, M. J., and E.C.S Chan. 1986. Dasar-dasar Mikrobiologi. UI Press. Jakarta. 5. Enari, T.M, 1983. Microbial Cellulase. Di dalam W.M. Forgarty.1985. Microbial Enzymes and Biotechnology. Appl. Sci. Publishing, New York. 6. Gong C.S. dan G.T. Tsao. 1979. Cellulase and Biosynthetis Regulation. Di dalam D. Pearlman (ed). Annual Report on Fermentation Process. Academic Press, New York. 7. Nenci. 2012.Isolasi dan Karakterisasi Selulase dari Trichoderma viride Strain T051 dengan Substrat Jerami. (skripsi). Universitas Indonesia. 8. Poedjadi, Anna. 2005. Dasar – dasar Biokimia. Jakarta: Penerbit Universitas Indonesia. 9. Magfiroh L, Agustini R. (2013). Pengaruh Konsentrasi Onggok Industri Tapioka dan Urea Pada Produksi Biohidrogen Melalui Fermentasi Gelap. UNESA Journal of Chemistry Vol. 2 No. 3. 10. Marsden, W.L and P.P. Gray. (1986). Enzimatic Hydrolisis of Cellulases in Lignocellulosic Material. CRC. Critical Rev. In Biotechnol. 3: 235-276. 11. Shuler Michael L., Fikret Kargi. (1992). Bioprocess Engineering Basic Concepts, Prentile-Hall International Inc., New Jersey. 12. Zhang Y-HP, Hong J, Ye X. (2009). Cellulase assays. Methods Mol Biol 581 213-231.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 206 ISBN : 978-602-72418-2-4
Clinical Trials Efficacy of Hyperglycemia Herbs Formula
AGUS TRIYONO*, ZURAIDA ZULKARNAIN
Medicinal Plants and Traditional Medicine Research and Development Center, Tawangmangu. Lawu Street no 11 Tawangmangu Karanganyar Central Java.
Email : [email protected]
Abstract : In herbs scientification, to find out the scientific proof of formula herbs efficacy as a lowering blood glucose, clinical research was conducted to find out herbs formula safety and efficacy as a lowering blood glucose. The formula is empirically proved safe in use as the results of preclinical tests. Clinical study were conducted by the study of parallel design. It was involving 80 subjects who have met the inclusion and exclusion criteria. Study protocol was approved by the research ethics of the Ethics Committee for Health Research, National Institut of Health Researh and Development, Ministry of Health. The subjects who had signed informed consent, the D-0 (pre-intervention) performed anamnesis subject's identity, medical history, clinical symptoms, physical examination diagnostic, laboratory tests of blood glucose, liver function, kiney function and blood routin. The subjects of first group were given by the test materials research in an amount to use for seven days, then controlled it once a week to eight weeks (56 days), each control was given by test materials to use for one week. On the first day (D-1), the subject boiled formula simplisia, formula of lowering blood glucose, according to the instructions how to drink boiled water and then presenting the formula herbal medicine three times a day one cup every day for 56 days. The subjects of second group were given metformin 500 mg, to use for seven days, then controlled it once a week to eight weeks (56 days), each control was given metformin to use for one week. On the first day (D-1), the subject taking metformin once aday for 56 days. Research subject was control once a week to do anamnesis complaint, the development of clinical symptoms the possibility of side effects and performed a physical examination diagnostic. Subjects examined blood glucose and SF-36 every four weeks. The results of anamsesis and physical examination on the subject during intervention and after intervention was not found significant side effects. Results of analysis of unpaired t test showed, there was no significant difference levels of blood glucose (t = -0.93, p = 0.534 (p> 0.05)) after intervention hyperglycemia herbs formula and metformin in the 28th day, and no significant difference levels of blood glucose (t = 0.96, p = 0.342 (p> 0.05)) after intervention hyperglycemia herbs formula and metformin in the 56th day. From these results it can be concluded that intervention hyperglycemia herbs formula comparable to metformin lowers blood glucose.
Keywords: Clinical trials, efficacy of hyperglycemia herbs formula
INTRODUCTION
Diabetes mellitus (DM) is a chronic and progressive disease . DM is characterized by blood glucose more than normal value . DM is caused by a deficiency of the insulin, either absolute (insulin levels actually decrease ) and relative (enough insulin levels but decreased function). Insulin is produced by the pancreas organ(1). According to the WHO report , in 2010 there were an estimated 5 million people with DM and 2030 is estimated about 21.3 million people in Indonesia suffer from DM(2).Clinical symptoms diabetus mellitus are polyuria , polidipsi and polifagi . Diabetes mellitus is caused by a metabolic disorder of
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 207 ISBN : 978-602-72418-2-4 carbohydrate , fat and protein . Diabetes mellitus cause acute or chronic complications(3). DM need long- term therapy . Most patients with diabetes mellitus bored with conventional treatment and chose alternative treatments including herbs formula(4). In herbs scientification, to find out the scientific proof of formula herbs efficacy as a lowering blood glucose, clinical research was conducted to find out herbs formula efficacy as lowering blood glucose.
MATERIALS AND METHODS
Clinical trials conducted with the open-label study, randomized clinical trial and parallel design. The study involved 80 subjects who have met the inclusion and exclusion criteria. subject randomization so divided in the herbal formula group and the metformin group. Inclusion criteria : subjects blood glucose 200-300 mg/dl , age 20-65 years ,male or female, willing to follow the research, signed informed consent. Exclusion criteria :pregnant or breastfeeding women , subjects taking medications that affect blood sugar levels , subjects with severe complications of the disease. Subjects who had signed informed consent, the D-0 (pre-intervention) performed anamnesis subject's identity, medical history, physical examination, assessment of quality of life scores (SF – 36), laboratory examination : blood glucose, liver function, kidney function, blood routine. The herbs formula group subjects were given by the test materials research in an amount to use for one week, then controlled every week to 8 weeks, each control was given by test materials to use for one week. On the first day (D-1), the subject boiled formula simplisia, according to the instructions how to drink boiled water and then presenting the herbs formula three times a cup every day for 8 weeks. Metformin group subjects taking metformin 1 x 500 mg every morning for eight weeks. Subject was control every week to do anamnesis complaint, the possibility of side effects and performed a physical examination diagnostic. Subjects examined blood glucose every two weeks. This study has received an ethical clearance from the Ethics Committee of National Institute of Health Research and Development, Ministry of Health Jakarta
RESULTS AND DISCUSSION
Chi Square analysis of the demographic characteristics of subjects the herbs formula group and the metformin group showed no significant difference, by age ( X ² = 1.45 , p = 0.229 ( p > 0.05 ) ) , sex ( X ² = 0.47 , p = 0.491 ( p > 0.05 ) ) , employment ( X ² = 9.27 , p = 0.098 ( p > 0.05 ) ) , and BMI ( X ² = 0.55, p = 0.906 ( p > 0.05 ) ) . This shows that the demographics of the sample is homogenous or equivalent. Characteristics of blood glicose and quality of life scores (SF - 36 ) the subject of the two groups are shown in Table-1.
Table 1 . Characteristics of blood glucose and quality of life scores (SF - 36) subjects before treatment.
Herbs Metformin Group Formula Group t p
mean SD mean D Blood glucose 256.47 41.30 268.20 55.72 -1.04 0.153 (mg/dL)
QOL Score 74.57 15.87 73.04 17.67 0.39 0.693
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 208 ISBN : 978-602-72418-2-4
Table 1 shows the unpaired t test analysis, no significant difference in blood glucose (t = -1.04 , p = 0.300 ( p > 0.05 ) ) and the quality of life scores ( t = 0.39 , p = 0.693 ( p > 0.05 ) ) in two groups. Blood glucose and quality of life scores, two groups, equal or homogeneous . Unpaired t test analyzes blood glucose of two groups after treatment ( H28 and H56 ) are shown in the Table-2.
Table 2. Unpaired t test Analysis blood glucose after treatment (H28 and H56 ) two groups.
Herbs Formula Group Metformin Group t p
mean SD mean SD
H28 (mg/dL) 255.17 68.52 271.29 77.98 -0.93 0.354
H56 (mg/dL) 244.62 59.23 229.36 50.10 0.96 0.342
Table 2. showed that the herbs formula group and the metformin group, there were no significant differences in blood glucose on H28 ( t = -0.93 , p = 0.354 ( p > 0.05 ) ) ; and H56 ( t = 0.96 , p = 0.342 (p > 0.05 )). The results showed hyperglycemia herbs formula have the same efficacy with metformin 500 mg. Unpaired t test analyzes quality of life scores of two groups after treatment ( H28 and H56 ) are shown in the Table 3.
Table 3. Unpaired t test Analyzis quality of life after treatment (H28 and H56 ) two groups.
Herbs Formula Metformin Group Group t p
mean SD mean SD
H28 75.19 16.23 77.59 14.45 -0.62 0.533
H56 78.87 15.25 79.20 14.77 -0.57 0.568
Table 3 showed that the herbs formula group and the metformin group there were no significant difference in quality of life score (SF-36) on H28 ( t = -0.62 , p = 0.533 ( p > 0.05 ) ) ; and H56 ( t = - 0.57, p = 0.568 ( p > 0.05 ) ). The results showed a score improvement of quality of life after treatment in the herbs formula group and metformin groups did not differ significantly.Preparation of the paper
CONCLUSION
Giving herbs hyperglycemia herbs formula for 56 days efficacious lowering blood glucose on par with metformin. Giving hyperglycemia herbs formula for 56 days to raise the quality of life scores (SF-36 ) is equivalent to the increase in quality of life scores (SF-36) due to the metformin intervention
REFERENCES
1. Noer Sjaifoellah. Ajar Ilmu Penyakit Dalam, edisi V.,2009 2. Horrison. Principles of Internal Medicine, 2001.15 th edition, Mc Grow Hill, New York
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 209 ISBN : 978-602-72418-2-4
3. Mosterd Arend, D’ Agostino Ralph B, Silbershatz Halit, et.al. Trends in the Prevalens of Hypertension, Antihypertensive terapy, and left Ventricular Hypertrophy from 1950 to 1989. 1999; 1221-1222.December 18,2006 4. Ross C. Brownson, Patrick L. Remington, James R. davis, High Blood Pressure in Chronic Disease Epidemiology and Control. Second Edition, American Public Health Assosiation: 262-264 5. Menteri Kesehatan RI. Permenkes Nomor: 003/MENKES/PER /I/ 2010 tentang Saintifikasi Jamu dalam Penelitian Berbasis Pelayanan Kesehatan. Jakarta. 2010. 6. Badan Litbang Kesehatan. Laporan Riskesdas 2010 7. Menteri Kesehatan. Kepmenkes. RI Nomor 1076/Menkes/SK/VII/2003 tentang Penyelenggaraan Pengobatan Tradisional. Jakarta. 2003 8. Badan Litbang Kesehatan. Pedoman Observasi Klinik Obat Tradisional Berbasis Masyarakat. 2009 9. Vogel.H.G. Drug Discovery and Evaluation Pharmacilogical Assay, 2rd Edition, Springer Verlag, Berlin Heidelberg Jerman.2002.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 210 ISBN : 978-602-72418-2-4
Antihiperkolesterolemia Jamu Formula Effect on Plasma Cholesterol Levels in Patients with Mild Hypercholesterolemia in Rumah Riset Jamu 'Hortus Medicus' Tawangmangu
ZURAIDA ZULKARNAIN*, AGUS TRIYONO
Medicinal Plant and Traditional Medicine Research and Development Office National Institute of Health Research and development, Ministry of Health Republic of Indonesia. Jl. Raya Lawu No. 11 Tawangmangu Karanganyar Jawa Tengah.
email : [email protected]
Abstract : Hypercholesterolemia is a medical condition characterized by elevated levels of cholesterol in the blood exceeds normal limits which can increase the risk of coronary heart disease, cardiovascular disease, and stroke. Hypercholesterolemia is a degenerative disease that often require lifelong treatment. These conditions often make patients get bored with conventional treatment and chose herbal medicine. Antihypercholesterolemia Jamu formula consisting of jati belanda leaves (Guazuma ulmifolia L), jati cina leaves (Cassia Sennae L), tempuyung leaves (Sonchus arvensis L), teh hijau leaves (Camillia sinensis L), temulawak (C. xanthorrhiza), kunyit (C. Longa) and meniran (Philanthus niruri) has the potential to be investigated. The aim of this research is to evaluate the efficacy of the jamu formula mention above to lowering cholesterol plasma level in order of Saintifikasi Jamu program. This study is quasi-experimental with pre and post test design. Total samples were 50 patients with mild hypercholesterolemia who meet the inclusion criteria. The research took place at Rumah Riset jamu 'Hortus Medicus' B2P2TO2T Tawangmangu during September to December 2014. The data were processed using a paired t-test with SPSS 16. Results showed jamu formula which is taken every day for 28 days lowered the mean of cholesterol plasma level of 212.42 mg / dl to 196.6 mg / dl. Paired t test at 95% confidence level acquired p value <0.05, which means that there are significant differences in the mean cholesterol level subjects before and after the study.
Keywords: hypercholesterolemia, Jamu, Rumah Riset Jamu
INTRODUCTION
Hypercholesterolemia is a medical condition characterized by increased of cholesterol level in the blood exceeds the normal limit .(1) Cholesterol has a soft structure, such as a candle, consisting of fat that can be produced by the body or derived from food.(2) Cholesterol in the body is produced in the liver, and has a function to build cell walls and a precursor of steroid hormones.(3,4) normally cholesterol plasma level is below 200 mg / dL, while the level is more than or equal to 200 mg / dL indicates hiperkolesterolemia.(1)
Table 1. Classification of Plasma Cholesterol Levels(1) Total Cholesterol (mg/dl) Classification <200 Normal 200-239 Borderline high > 240 High
Hypercholesterolemia increases the risk of coronary heart disease, cardiovascular disease, and stroke.(1,2,3,5) Coronary heart disease is the number one killer in the world especially in developing
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 211 ISBN : 978-602-72418-2-4 country.(5) Along with technology and changes in modern lifestyles, an estimated number of patients with hypercholesterolemia will increase.(5) Hypercholesterolemia treatment becomes very important in order to reduce the risk of complications.(5) Mild / borderline high of hypercholesterolemia (cholesterol values 200-239 mg / dl), priority treatment is the lifestyle changes such as regular exercise, reduce your intake of fatty foods, and last step of treatment is using drugs / herbs that can lower cholesterol plasma level.(1,2,3,4,5) Hypercholesterolemia is a degenerative disease that often require lifelong treatment. These conditions often make patients get bored with conventional treatment and chose herbs treatment.(6) Data from Rumah Riset Jamu ‘Hortus Medicus’ there are about 500 new cases of hypercholesterolemia during 2013. Indonesia have some Jamu formulas that have empirically been used to lower blood cholesterol level. Antihypercholesterolemia Jamu formula consisting of jati belanda leaves (Guazuma ulmifolia L), jati cina leaves (Cassia Sennae L), tempuyung leaves (Sonchus arvensis L), teh hijau leaves (Camillia sinensis L), temulawak (C. xanthorrhiza), kunyit (C. Longa) and meniran (Philanthus niruri) has the potential to be investigated. The aim of this research is to evaluate the efficacy of the antihiperkolesterolemia jamu formula mention above to lowering cholesterol plasma level in order of Saintifikasi Jamu program.
MATERIALS AND METHODS
This study is quasi-experimental with pre and post test design. Total samples were 50 patients with mild hypercholesterolemia who meet the criteria.7 The research took place at Rumah Riset jamu 'Hortus Medicus' B2P2TO2T Tawangmangu during September to December 2014. Inclusion criteria : a. women or men age 25-60 years b. old or new patients with hypercholesterolemia diagnosis of mild / borderline (total cholesterol 200- 239mg / dl) c. the patient's condition is stable evidenced by clinical examination, laboratory and ECG d. willing to follow the research / schedule follow-up by signing the informed consent Exclusion criteria: a. pregnant or breastfeeding women (based recognition) b. patients taking the drug or other herbal ingredients in addition to the test material which has an indication for lowering cholesterol, and blood-thinning medications such as warfarin, a heart drug digoxin. c. patients with severe disease complications (eg advanced cancer / terminal, 2,3,4 NYHA heart failure, severe diabetes, severe hypertension) b. patients who have an allergy / hypersensitivity to any component of test material c. patients with gastrointestinal diseases, such as gastritis, ulcer pepticum, Crohn's disease and colitis.
Each subject was given formula which consists of jati belanda leaves (Guazuma ulmifolia L), jati cina leaves (Cassia Sennae L), tempuyung leaves (Sonchus arvensis L), teh hijau leaves (Camillia sinensis L), temulawak (C. xanthorrhiza), kunyit (C. Longa) and meniran (Philanthus niruri) boiled in 4 cups of water into 2 glasses and drunk early in the afternoon every day for 4 weeks. Patients are required to came to RRJ every 1 weeks. Total cholesterol level in blood plasma respectively measured at baseline (day -0) and the end of the study (day 28). This study has been approved by Ethics Committee for Health Research, Ministry of Health Republik Indonesia with number LB 02.01/5.2/KE 364/2014.
RESULTS AND DISCUSSION
The average of plasma cholesterol level before and after study are presented in the table below.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 212 ISBN : 978-602-72418-2-4
Table 2. Averages of Plasma Cholesterol Levels Variable D-0 D-28 P Average of plasma cholesterol level 212,42 196,6 0,000* (mg/dl) *: paired t test with the level of confidence 95%
There are significant differences in mean reduction in subjects plasma cholesterol level before and after the study (p <0.05). A total of 35 study subjects experienced a decrease in plasma cholesterol level, 13 subjects experienced an increase in plasma cholesterol level, and 2 subjects of study plasma cholesterol level remain. The increase in the level of cholesterol at the end of the study can be caused by several factors: heredity, high-fat diet and lack of exercise. Hereditary factors play an important role in the occurrence of hypercholesterolemia as well as the management. Hereditary hypercholesterolemia who are more difficult to treat than with hypercholesterolemia due to lifestyle. In this study there were no restrictions on diet in the study subjects, only the suggestion to limit fatty foods so that the increase in the level of cholesterol in 13 research subjects may occur due to excessive intake of fatty foods.(8) In addition, lack of exercise and physical activity can also lead to increased cholesterol level the 13 subjects.(9) Cholesterol plasma level 28 research subjects at the end of the 4th week became normal (<200 mg / dl), while 22 subjects still had cholesterol values above 200 mg / dl. There are 9 subjects that although experience decrease in cholesterol level but still above the normal level. Considerable research brief time of 28 days is one of the factors that could be causing it. Antihypercholesterolemia Jamu formula consisting of Jati belanda leaves, Jati cina leaves, tempuyung leaves, green tea leaves, temulawak, kunyit and meniran. Each of these plants has been clinically proven safe and efficacious for lowering blood cholesterol levels. Jati belanda Leaves (Guazuma ulmifolia L) Aqueous extract of Jati belanda leaves contains tannin, flavonoids and saponin.(10) Aqueous extract at a dose of 50 mg / kg bw can lower total cholesterol and Low Density Lipid level significantly compared control.(11) Mucilage in Jati belanda can swell in the stomach so that pressing appetite.(6) Alkaloids in Jati belanda has the activity in inhibiting pancreatic lipase enzyme that hydrolyze fat.(6) Dried extract of Jati belanda leaves doses of 2, 4, and 8 g / kg bw that administered in male mice once a day for 3 months did not increase the level of creatine and plasma urea and an average diameter size of the rat kidney glomerulus. (10,11) This suggests that long-term administration Jati belanda leaves does not disturb the function of kidney.(12,13) Jati cina leaves (Cassia sennae L) Cassia sennae is a medicinal plant that has been known throughout the world. Society of India and the middle east since long ago use Cassia sennae to treat hemorrhoids, as a laxative, colon cleansing, helps get rid of all the toxins in the body, and to reduce body weight.(14) In Indonesia Cassia sennae leaves commercially sold in the form of tea bags or dried leaves with claims of efficacy to reduce body weight , laxative and lowering plasma cholesterol.(15.16,17_ Cassia sennae leaves contain hydroxyanthracene glycosides, with the derivate are sennosides (BO-linked glycosides) has the effect of laxative.18 Sennosides not absorbed in the upper intestine, and will be changed by bacteria in the large intestine becomes metabolically active rheinanthrone.(18 ) Rheinanthrone would increase the motility of the colon, so shortening the transit time of food in the colon.(18) Cassia sennae leaves also contain flavonoids that can inhibit pancreatic lipase enzyme.(14) Dose of sennosides up to 500mg / kg bw given to dogs for 4 weeks showed no toxic effects, as well as the dose to 100 mg / kg in rats during administration of 6 months.(18) Daun Teh Hijau (Camillia sinensis L) Green tea leaves contains polyphenols (catechins and flavonoids), alkaloids, volatile oil, polysaccharides and amino acid.(19, 20) Catechins in tea can lowering total cholesterol and Low Density Lipid level in blood plasma. This is associated with the increased of body metabolism. Epigallocathecin-3-gallate (EGCG) in green tea stimulate thermogenesis and fat oxidation which has implications for body weight
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 213 ISBN : 978-602-72418-2-4 loss. EGCG inhibits the activity of acetyl CoA carboxylase in fatty acid biosynthesis cycle, so as to reduce the accumulation of triacylglycerol (triglycerides) in fat tissue.(20,21,22) Daun tempuyung (Sonchus arvensis L) Tempuyung leaves contain kaempferol, quercetin, orientin, rutin, catechin and miristisin.(23) Indonesia community since long ago use tempuyung to treat kidney stones and lowering plasma cholesterol.(24) Tempuyung rich in polyphenols which have antioksidan activity.23 Empirically tempuyung leaf infusion has used to lower plasma cholesterol level.(12) Studies in mice, showed the ethanol extract of tempuyung leaves with doses up to 1000mg / kg proved to be safe and efficacious to lowering plasma cholesterol.(25) Temulawak (Curcuma xanthorrhiza), Kunyit (Curcuma longa) and Meniran (Philanthus niruri) Temulawak, kunyit and meniran is the basic formula of Jamu that can increase fitness.(26)
CONCLUSSION
Antihiperkolesterolemia Jamu formula administration for 28 days significantly lowered plasma cholesterol levels in subjects with mild hypercholesterolemia.
REFERENCES
1. Phoebe A. Stapleton, Adam G Goodwill, Milinda E James, Robert W Bock and Jefferson C Frisbee. Hypercholesterolemia and Microvascular dysfunction: Interventional Strategies. Journal of Inflammation 2010, 7:54. 2. Steven D. Ehrlich. 2013. Hypercholesterolemia http://umm.edu/health/medical/altmed/ condition/hypercholesterolemia. 3. John Hopkins Medicine. High Cholesterol (Hypercholesterolemia. 4. http://www.hopkinsmedicine.org/heart_vascular_institute/conditions_treatments/conditions/high_ch olesterol.html 5. Noer Sjaifoellah. 1996. Buku Ajar Ilmu Penyakit Dalam jilid 1. Balai Penerbit FK UI Jakarta. Jilid 3 6. Peraturan Menteri Kesehatan RI Nomor 1109/Menkes/Per/IX/2007 tentang Penyelenggaraan Pengobatan Komplementer Alternatif di Fasilitas Pelayanan Kesehatan. Jakarta. 2007. 7. Siswoyo Hadi. Studi Observasi Klinik Penggunaan Djamoe pada Hiperglikemia, Hipertensi, Hiperkolesterolemia, dan Hiperurisemia di Klinik Dokter Saintifikasi Djamoe Alumni Diklat 50 Jam. Badan Litbang Kesehatan Kemenkes RI, 2011. 8. The Association of the British Pharmaceutical Industry. 2007. Guidelines for phase 1 clinial trials. 9. Ruth GA, Aurika S, Carolina H N. Peran Konseling Berkelanjutan pada Penanganan Pasien Hiperkolesterolemia. J Indon Med Assoc No. 5 Vol 62 Mei 2012, pp: 194-201 . 10. Tunggul W, Rimbawan, Nuri A. Hubungan antara Konsumsi Pangan dan Aktivitas Fisik dengan Kadar Kolesterol Darah Pria dan Wanita Dewasa di Bogor. Jurnal Gizi dan Pangan No 8 Vol 1, Maret 2013, pp : 9-16. 11. Dyah I, Rhoito F S, Elizabeth M A, Latifah K D. Zingiber cassumunar, Guazuma ulmifolia, and Murraya paniculata Extracts as Antiobesity: In Vitro Inhibitory Effect on Pancreatic Lipase Activity. Hayati Journal of Biosciences Vol. 18 No. 1, 2011 p : 6-10. http://journal.ipb.ac.id/index.php/hayati 12. Sukandar, E.Y.. Elfahmi, Nurdewi. Influence of Administration of Jati Belanda (Guazuma ulmifolia Lamk) Leaves on Blood Lipid Level of Male Rats. Med. J. Maranatha, 8, 2009: 102-112. 13. Kementerian Kesehatan RI. 2012. Vademekum Tanaman Obat untuk Saintifikasi Jamu. Jilid I (Edisi Revisi). Kemeterian Kesehatan RI 14. Widiyaningrum I, Y Harahap, and D Kusuma, 2005. Effect of dry extract granulae from jati blanda leaves (Guazuma ulmifolia L.) on male rat renal function and on renal histology, The 5th Asian conference on clinical pharmacy.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 214 ISBN : 978-602-72418-2-4
15. Balasankar D, Vanilarasu K, Selva Preetha P, Rajeswari S M.U, Debjit B. Senna – A Medical Miracle Plant. Journal of Medicinal Plants Studies Vol. 1 Issue. 3, 2013. www.plantsjournal.com Page | 41 16. .http://obatsakit2011.blogspot.com/2013/03/7-manfaat-medis-daun senna.html#.U6kHa3ZsuFo 17. http://www.tribunnews.com/tribunners/2012/01/07/manfaat-teh-daun-jati-china-untuk- melangsingkan-tubuh 18. http://www.nutrisibali.com/article/1/31/tanaman_untuk_menurunkan_kolesterol_tinggi.php 19. Evaluation of Medicines for Human Use Community. 2006. Herbal Monograph on Senna Leaf (Sennae Folium). Draft EMEA. http://www.emea.eu.int 20. Naniek Widyaningrum.. Epigallocatechin-3-Gallate (Egcg) Pada Daun Teh Hijau Sebagai Anti Jerawat. Majalah Farmasi Dan Farmakologi, Vol. 17, No.3 2013 Hlm. 95 - 98 (Issn : 1410-7031) 21. Kartika Dewi. Pengaruh Ekstrak Teh Hijau (Camellia Sinensis var. Assamica) terhadap Penurunan Berat Badan, Nilai Trigliserida dan Kolesterol Total pada Tikus Jantan Galur Wistar. JKM. Vol.7 No.2 Februari, 2008. 22. Zheng G, Sayama K, Okubo T, Juneja LR, Oguni I. Antiobesity Effects of Three Major Components of Green Tea, Catechins, Caffeine and Theanine, in Mice. in vivo, 2004 ; 18 : 55 – 62 23. Sayama K, Lin S, Zheng G, Oguni I.. Effects of Green Tea on Growth, Food Utilization and Lipid Metabolism in Mice. in vivo ; 14 , 2000: 481 – 484. 24. Rahmat Ali Khan. Evaluation of flavonoids and diverse antioxidant activities of Sonchus arvensis. Chemistry Central Journal, 2012, 6:126 25. http://www.solopos.com/2012/04/20/trio-herbal-redam-kolesterol-179537 26. Yelvia Nurianti, Rini Hendriani, Elin Yulinah Sukandar, Kusnandar Anggadiredja.. Acute And Subchronic Oral Toxicity Studies Of Ethyl Acetate Extract Of Sonchus arvensis L. Leaves. International Journal Of Pharmacy And Pharmaceutical Sciences Issn- 0975-1491 Vol 6, Issue 5, 2014.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 215 ISBN : 978-602-72418-2-4 LINEAGE GROUP IDENTIFICATION OF LM 25722248, Listeria monocytogenes ISOLATE
Moordiani*, Cath Rees**, Phil Richards**
*Faculty of Pharmacy, Pancasila University **School of Biosciences, The University of Nottingham
Listeria monocytogenes is a serious food-borne pathogen that has been the leading cause of food recalls due to microbiological concerns in recent years. The sample used in this study was taken from a food factory in a city in United Kingdom (UK) which was suspected to have bacterial contamination. From previous investigation, the isolate had been identified and confirmed as Listeria monocytogenes. Further, in order to identify this particular L. monocytogenes lineage, a research was performed using an allelespecific oligonucleotide PCR (ASO-PCR) multiplex. Amplifications were performed in 10 l volumes with 1X flexi buffer, 2 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.5 U of GoTaq polymerase, 0.5 M of each primer, 100 ng of genomic DNA and distilled water up to the volume of 10 l. The amplification reactions consisted of 25 cycles of 15 s at 94°C, 10 s at 56°C and 10 s at 72°C and carried out using a PCR thermal cycler. Amplification products were resolved on 1% (w/v) agarose gel and scored relative to 100 bp DNA size ladder. The result showed that isolate LM 25722248 belongs to lineage II of at least three evolutionary lineages of Listeria monocytogenes. Keywords and phrases: Listeria monocytogenes, identification, lineage, ASO-PCR.
INTRODUCTION
Listeria monocytogenes is a Gram positive bacteria that can cause serious invasive disease (listeriosis) in humans and animals, resulting in severe clinical features, including meningitis, septicemia, and abortion(1). However, it has been reported that a noninvasive form of listeriosis may cause febrile gastroenteritis which results in in milder food poisoninglike symptoms such as fever, headache and diarrhoea(2, 3). L. monocytogenes is a non-spore forming bacteria and able to live in the food-processing environment, grow at refrigeration temperatures, and has pathogenic potential. These features contribute the uniqueness of L. monocytogenes thus its contamination in food has been the leading cause of food recalls due to microbiological concerns in recent years(1). The public health concern of L. monocytogenes is raising and identification of pathogenic bacteria in contaminated food is of the first importance step. Sample excerpt from food factory (from pepper) in a city in United Kingdom (UK) designated as LM 25722248 had been identified as Listeria monocytogenes(4). Previous study had reported that LM 25722248 grew in Brilliance Listeria Agar as a blue/green colonies which is specific for L. monocytogenes (Figure 1).
Figure 1. L. monocytogenes colonies on Brilliance Listeria Agar. The “a” arrow shows the blue/green colony while the “b” arrow shows the white halo resulted from lecithin hydrolization of the medium(4).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 216 ISBN : 978-602-72418-2-4
Further detection of LM 25722248 was done by PCR-based approach for lineage identification. Expectantly, the data can be used to predict the pathogenicity lineage to which its belong.
METHODS
Lineage identification of LM 25722248 was performed using protocol adapted from Ward et al.(1). Amplifications were performed in 10 l volumes with 1X flexi buffer, 2 mM of MgCl2, 0.2 mM of each deoxynucleoside triphosphate, 0.5 U of GoTaq polymerase, 0.5 M of each primer (actA1-F, actA1-R, plcB2-F, plcB2-R, actA3-F and plcB3-R; Eurofins MWG Operon, Ebersberg, Germany), 100 ng of genomic DNA and distilled water up to the volume of 10 l. The amplification reactions consisted of 25 cycles of 15 s at 94°C, 10 s at 56°C and 10 s at 72°C and carried out using a PCR thermal cycler (Techne TC-312, UK). Amplification products were resolved on 1% (w/v) agarose gel and scored relative to 100 bp DNA size ladder. Shown in Table 1 is the primers used and the lineages.
Table 1. Primer sequences used in ASO-PCR multiplex amplification(1). Primers Primer Sequence (5’ 3’) Descriptions PCR product size (bp) actA1-F AATAACAACAGTGAACAAAGC Lineage I 373 actA1-R TATCACGTACCCATTTACC plcB2-F TTGTGATGAATACTTACAAAC Lineage II 564 plcB2-R TTTGCTACCATGTCTTCC actA3-F CGGCGAACCATACAACAT Lineage III 277 plcB3-R TGTGGTAATTTGCTGTCG
Three sets of primers were designed from pVGC sequences for the specific identification of isolates from each of the three L. monocytogenes lineage groups via an allelespecific oligonucleotide PCR (ASO-PCR) multiplex(1).
RESULTS
In an attempt to identify contamination possibility by L. monocytogenes strains within the industrial flow process, a PCR-based approach for lineage identification had been performed on sample isolated from peppers (designated as LM 25722248) which was confirmed as L. monocytogenes. The ASO PCR produced a single amplicon of the correct size for each isolate, which are 373 bp for lineage I, 564 bp for lineage II and 277 bp for lineage III. After being electrophoresed, the result showed as seen on Figure 2.
Figure 2. The 1% agarose gel electrophoresis of ASO-PCR products of LM 25722248 isolate (lane 1) and negative control (lane 2) with 100 bp DNA size ladder (lane M). The lineage of L. monocytogenes isolate is lineage II as the ASO-PCR multiplex produced a single amplicon of the predicted result for lineage II (564 bp).
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 217 ISBN : 978-602-72418-2-4
DISCUSSION
Listeria monocytogenes is categorised into four major phylogenetic lineages that is lineage I, lineage II, lineage III, and lineage IV(5). Based on multilocus enzyme electrophoresis, pulsed-field gel electrophoresis (PFGE), ribotyping, and amplified fragment length polymorphism studies, it has been identified the two primary evolutionary divisions, or lineages, within L. monocytogenes. Further, ribotype and virulence gene polymorphism data were used to describe the existence of a third lineage(1). Using ASO PCR multiplex amplification, it was revealed that sample designated as LM 25722248 belongs to lineage II. However, if the electrophoresis result is refered to that proposed by Ward et al(1) (Figure 3), there is slight difference on the band position in which band of LM 25722248 was not at the exact 564 bp. This might happened since the band is too bright may be because of the size of amplicon. Nevertheless, single amplicon is only produced at around 564 bp which shows that it belongs to lineage II. Result of this study is in line with fact that L. monocytogenes isolates from lineage II are common contaminants of ready to eat and other food products(5). Moreover, L. monocytogenes isolates from lineage II also contribute significantly to sporadic listeriosis in humans(5, 6). Below is Figure 4 which represents summary of L. monocytogenes lineages.
Figure 3. ASO-PCR multiplex amplification results for representative L. monocytogenes strains from lineage I, NRRL 33176 (lane 1); lineage II, NRRL 33180 (lane 2); and lineage III, NRRL 33185 (lane 3). Amplification products were scored relative to a 100-bp DNA size ladder (lane M)(1).
Figure 4. Summary of L. monocytogenes lineages(7).
The ASO-PCR multiplex test is used for specific identification of evolutionary lineage for individual L. monocytogenes isolates. It was proven to be sensitive and specific in accurately assessing the lineage for 112 L. monocytogenes isolates for which lineage identity had been confirmed phylogenetically. The PCR assay is based on prfA virulence gene cluster (pVGC) which is stably integrated in the same chromosomal location in these three Listeria species, L. monocytogenes, L. seeligeri, and L. ivanovii(1). The pVGC of each species contains homologs of six virulence genes: a transcriptional regulator (prfA), two phospholipases (plcA and plcB) and a hemolysin (hly) required for lysis of host phagosomes, a
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 218 ISBN : 978-602-72418-2-4 metalloprotease (mpl) involved in extracellular activation of plcB, and a surface protein (actA) responsible for actin-based motility and cell-to-cell spread(8).
CONCLUSION
Sample entitled as LM 25722248 belongs to lineage II.
ACKNOWLEDGMENTS
The financial support of the research, Directorate General of Higher Education of Indonesia, is gratefully acknowledged. Microbiology Laboratory at School of Biosciences, The University of Nottingham, is also appreciated for providing laboratory facilities to carry out this research work.
REFERENCES
1. Ward TJ, Gorski L, Borucki MK, Mandrell RE, Hutchins J, Pupedis K. Intraspecific Phylogeny and Lineage Group Identification Based on the prfA Virulence Gene Cluster of Listeria monocytogenes†. Journal of Bacteriology. 2004 August 1, 2004;186(15):4994-5002. 2. Franciosa G, Tartaro S, Wedell-Neergaard C, Aureli P. Characterization of Listeria monocytogenes Strains Involved in Invasive and Noninvasive Listeriosis Outbreaks by PCR-Based Fingerprinting Techniques. Applied and Environmental Microbiology. 2001 April 1, 2001;67(4):1793-9. 3. Jadhav S, Bhave M, Palombo EA. Methods used for the detection and subtyping of Listeria monocytogenes. Journal of Microbiological Methods. 2012;88(3):327-41. 4. Moordiani, Rees C, Richards P. Characterization of Listeria monocytogenes Isolated from A Fresh Food Factory. Jurnal Ilmu Kefarmasian Indonesia. 2014;12(2):261-6. 5. Ward TJ, Ducey TF, Usgaard T, Dunn KA, Bielawski JP. Multilocus Genotyping Assays for Single Nucleotide Polymorphism-Based Subtyping of Listeria monocytogenes Isolates. Applied and Environmental Microbiology. 2008 December 15, 2008;74(24):7629-42. 6. Jeffers GT, Bruce JL, McDonough PL, Scarlett J, Boor KJ, Wiedmann M. Comparative genetic characterization of Listeria monocytogenes isolates from human and animal listeriosis cases. Microbiology. 2001;147:1095-104. 7. Orsi RH, Bakker HCd, Wiedmann M. Listeria monocytogenes lineages: Genomics, evolution, ecology, and phenotypic characteristics. International Journal of Medical Microbiology. 2011;301(2):79-96. 8. Vázquez-Boland JA, Domínguez-Bernal G, González-Zorn B, Kreft J, Goebel W. Pathogenicity islands and virulence evolution in Listeria. Microbes and Infection. 2001;3(7):571-84.
International Seminar Pokjanas TOI Faculty of Pharmacy Pancasila University 219