City University of New York (CUNY) CUNY Academic Works

School of Arts & Sciences Theses Hunter College

Fall 1-5-2018

Combatting the Illegal Pet Trade: Using Molecular Techniques to Determine the Provenience of Illegal Ring-Tailed Lemur (Lemur catta) Pets

Jessica Knierim CUNY Hunter College

How does access to this work benefit ou?y Let us know!

More information about this work at: https://academicworks.cuny.edu/hc_sas_etds/271 Discover additional works at: https://academicworks.cuny.edu

This work is made publicly available by the City University of New York (CUNY). Contact: [email protected]

Combatting the Illegal Pet Trade: Using Molecular Techniques to Determine the Provenience of Illegal Ring-Tailed Lemur (Lemur catta) Pets

by

Jessica Knierim

Submitted in partial fulfillment of the requirements for the degree of Master of Arts in Animal Behavior and Conservation, Hunter College The City University of New York

2017

Thesis Sponsor:

December 18, 2017 Dr. Andrea Baden Date Signature

December 18, 2017 Dr. Tara Clarke Date Signature of Second Reader

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA ii

Table of Contents Acknowledgements ...... iii List of Figures ...... iv List of Tables ...... v Abstract ...... 1 INTRODUCTION ...... 2 Ecology and Conservation Status of Lemur Catta ...... 4 The Problem: Lemurs in the Pet Trade ...... 6 Wildlife Forensic Genetics ...... 11 SPECIFIC AIMS ...... 14 METHODS ...... 14 Study Sites and Sample Collection ...... 14 Study Sites...... 14 Sample Collection...... 18 DNA Extraction and Microsatellite Genotyping ...... 18 DNA extraction...... 18 Microsatellite genotyping ...... 18 Population Genetic Analysis ...... 19 Genetic diversity ...... 19 Population genetic structure ...... 20 RESULTS ...... 21 Genetic Diversity ...... 21 Population Genetic Structure and Assignments ...... 24 DISCUSSION ...... 27 Genetic Differentiation and Diversity of Wild Populations ...... 27 Genetic Differentiation ...... 27 Genetic Diversity ...... 28 Assignment of Captive Lemurs ...... 29 Future Study and Conservation Implications ...... 30 REFERENCES ...... 35 APPENDIX ...... 43

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA iii

Acknowledgements

I would like to sincerely thank my wonderful advisor, Dr. Andrea Baden, for her unending support and guidance throughout this project. She has been instrumental in guiding me through my research. I would also like the thank the ladies at Lemur Love, Dr. Tara Clarke and

Dr. Marni LaFleur for developing the idea of this project that I have been lucky to work on. I would like to especially thank Tara, my second reader, for contributing her comments and revisions. I would like to thank my lab buddies, who helped me for get through countless hours in the lab with a smile on my face. Lastly, I’d like to express my gratitude towards my amazing family who have been my biggest supporters. Laboratory support was provided by Dr. Andrea

Baden at the Primate Molecular Ecology Laboratory at Hunter College (City University of New

York) and the DNA Analysis Facility at Yale University on Science Hill. Funding for this research was provided by the ABC Thesis Research Grant.

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA iv

List of Figures

Figure I. Map of sampling localities ...... 17 Figure II. STRUCTURE analysis ...... 24 Figure III. Discriminant Analysis of Principle Components (DAPC) ...... 25 Figure IV. Principal Coordinates Analysis (PCoA) ...... 26

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA v

List of Tables

Table I. Sampling localities, GPS coordinates and sample size ...... 17 Table II. Characteristics of 7 microsatellite loci ...... 23 Table III. Population genetic parameters at sampling localities ...... 23 Table IV. Genetic differentiation between sampling sites ...... 23

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 1

Abstract

The ring-tailed lemur (Lemur catta) was once widespread across southern Madagascar.

However, anthropogenic activities such as habitat loss, hunting for bushmeat, and live capture for the illegal pet trade have caused L. catta populations to plummet in the past decade. Here I compare genotypes of illegal wild-caught pet and confiscated ex-pet L. catta to those from wild populations to determine their source localities. Fecal samples were collected from 20 wild- caught pet L. catta and 5 wild individuals from Isalo National Park. DNA was extracted and amplified at seven polymorphic loci following Parga et al. (2012, 2015). To determine the geographic origin of captive and confiscated lemurs, their genotypes were matched to a geographically-referenced allele frequency database generated from a reference library of 30 adults sampled from three wild L. catta populations in south-central Madagascar (Anja,

Sakaviro, Tsinjoriake). Evidence for two genetic clusters was provided by both a Bayesian cluster analysis and a multivariate clustering method (Discriminate Analysis of Principle

Components), suggesting genetic clustering based on geographic location. Mean number of alleles per locus of the wild populations ranged from 4.29-6.00. Observed and expected heterozygosity ranged from 0.690-0.857 and 0.727-0.739, respectively. These populations maintained moderate levels of genetic diversity but lower levels of allelic richness as compared to other populations of L. catta. Additionally, most captive individuals could not be assigned to a source population, likely because sampling does not represent the species’ entire geographic range. This is a pilot study and additional sampling of both captive and wild populations of L. catta will be needed to accurately pinpoint provenience of L. catta in the pet trade. Ultimately, results of this study can be used to help determine geographic “hot spots” of wildlife trafficking COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 2 for which targeted conservation initiatives – including heightened security and increased conservation outreach – can be developed.

INTRODUCTION

Madagascar’s endemic lemurs represent more than 20% of the world’s primate species and 30% of family-level diversity, and yet, they are the world’s most endangered group of mammals (Schwitzer et al., 2014). The island’s vast levels of endemic biodiversity are unparalleled by any other country and set it apart as a biodiversity hotspot (Ganzhorn et al.,

2001; Myers et al., 2000; Schwitzer et al., 2014). Despite the need to preserve the country’s endemic and biodiverse species, lemurs are facing extinction due to human driven disturbances including habitat loss and fragmentation and hunting for the bushmeat (Borgerson, McKean,

Sutherland, & Godfrey, 2016; Golden, 2009) and illegal pet trades (Estrada et al., 2017; Reuter,

Gilles, et al., 2016).

The Endangered (Andriaholinirina et al., 2014) ring-tailed lemur (Lemur catta), a flagship species (Mittermeier et al., 1992), represents one of over 100 lemur species and is perhaps Madagascar’s most widely recognized and well-studied species of lemur (Sauther et al.,

2015). Historically, this species has been widespread and abundant throughout the southern regions of Madagascar (Goodman, Rakotoarisoa, & Wilme, 2006; Gould, 2007; Gould,

Sussman, & Sauther, 2003; Sauther et al., 2015; Sauther, Sussman, & Gould, 1999; Sussman et al., 2006), but loss of habitat and overexploitation via poaching for the illegal bushmeat and pet trade over the past decade have caused extirpations and severe population reductions throughout their geographic range (Gould & Sauther, 2016; LaFleur & Gould, 2009). Despite the species’ historic ability to cope in degraded habitats, the stark loss of nearly half of their habitat in just the past 40 years may prove too much for this traditionally abundant species to overcome COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 3

(Brinkmann et al., 2014; LaFleur, Clarke, Ratzimbazafy, et al., 2017). This severe habitat loss, coupled with their disappearance from extant forests due to hunting and live capture for the illegal pet trade have caused this species to be included in the list of “The World’s 25 Most

Endangered Primates” (LaFleur, Clarke, Ratzimbazafy, et al., 2017).

L. catta are just one of the many primate species threatened by live capture for the pet trade. The global exotic pet trade affects thousands of primates every year, with some estimates suggesting ~40,000 live captured primates are traded annually on international markets (Karesh et al., 2005). The demand for primate pets contributes to declining populations of many endangered species, including the Critically Endangered Central American Spider Monkey

(Ateles geoffroyi; Smith, 2005). Live capture for the pet trade is the greatest threat facing the

Critically Endangered Javan slow loris (Nycticebus javanicus) and is one of the main threats to the entire Nycticebus genus (Nekaris et al., 2010). Additionally, adult Critically Endangered

Bornean orangutans (Pongo pygmaeus) are killed in order to capture infants for the pet trade

(Husson et al., 2017; Rijksen & Meijaard, 1999). While the wildlife trade is a major threat to many primate species, the number of live primates exported annually has been steadily increasing since 1995, with 3,500 more live primates being exported every year (Nijman et al.,

2011).

Thousands of lemurs are affected by Madagascar’s illegal pet trade every year and L. catta is the most common lemur species kept in captivity in the country (Reuter 2015; Reuter,

Gilles, Wills, & Sewall, 2016). As of yet, there is no data on which wild populations L. catta are being taken from in order to fuel the demands of the pet trade. In this thesis, I employ forensic genetic techniques to identify the source populations from which wild-caught current and ex-pet

L. catta were captured and inform conservation actions. COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 4

Ecology and Conservation Status of Lemur Catta

L. catta is an exceptionally flexible species, in terms of both its habitat and diet (Gould,

2007). It occupies a diverse range of habitats across southern, southwestern, and south-central

Madagascar, including gallery, littoral, and dry deciduous forests, brush and scrub, spiny bush, high-altitude ericoid bush, rocky-outcrop mixed vegetation, and mangroves (Cameron & Gould,

2013; Goodman et al., 2006; Gould, 2007; Sauther et al., 1999). Some of these habitats also experience the island’s most extreme climate conditions, from the hottest and driest climates to the coldest (Cameron & Gould, 2013). Lemur catta live in female philopatric multi-male/multi- female groups averaging 11 to 17 individuals but these group sizes vary widely across sites

(Cawthon Lang, 2005; Jolly, 2003; Sauther et al., 1999; Sussman, 1991). Males disperse from their natal group once they reach sexual maturity (3-4 years) and will again disperse on average every 3.5 years throughout their lifetime (Sauther et al., 1999; Sussman, 1992).

L. catta, a medium-sized strepsirrhine (average 2.2 kg) (Gould et al., 2003; Sussman,

1991), is considered an “opportunistic omnivore” and has a remarkably flexible diet (Gould,

2007; LaFleur & Gould, 2009; Sauther et al., 1999). Its diet can consist of both ripe and unripe fruit, young and mature leaves, leaf and flower stems, flowers, soil, dead wood, cactus, insect larvae, spiders, spider webs, caterpillars, cicadas, locusts, and occasionally small birds and chameleons (Gould, 2007; Jolly, 1966; Kelley, 2011; Oda, 1996; Rasamimanana & Rafidinarivo,

1993; Sauther, 1992, 1998; Sauther et al., 1999; Simmen et al., 2006; Simmen, Hladik, &

Ramasiarisoa, 2003; Sussman, 1972; Yamashita, 2002). In addition to their diet, their social behavior and activity budgets also vary with changing environmental conditions (Sauther et al.,

1999). For example, L. catta live in denser populations with smaller home ranges in gallery COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 5 forests which typically have an abundance of resources versus populations that live in drier forests (O’Conner, 1987; Sussman, 1991).

As a result of L. catta’s behavioral plasticity, they are able to survive in highly fragmented habitats. Unfortunately, this ability has become requisite for their survival due to the severe forest loss throughout the species’ geographic range. In just the past 40 years, L. catta have lost over 45% of their habitat (Brinkmann, Noromiarilanto, Ratovonamana, & Buerkert,

2014; LaFleur et al., 2017) and are projected to lose 68% by 2080 from climate change alone

(Brown & Yoder, 2015). Despite L. catta’s flexibility and ability to survive in degraded landscapes (Gould & Gabriel, 2015), they are dependent on key resources and reach a threshold beyond which they are unable to survive in deforested areas (LaFleur, Clarke, Ratzimbazafy, et al., 2017; Sauther et al., 1999). Because L. catta is the most terrestrial of all extant lemurs, they are usually able to disperse across non-forested areas (Goodman et al., 2006). However, fragmentation throughout their geographic range is too severe in many areas to allow for male dispersal (Gould & Sauther, 2016). Because of this, L. catta populations are declining in accordance with their shrinking forest habitats (LaFleur, Clarke, Ratzimbazafy, et al., 2017;

LaFleur, Clarke, Reuter, et al., 2017).

Today, many L. catta populations live in small, isolated forest remnants which impedes their ability to disperse and results in reduced gene flow, decreased genetic variability and increased inbreeding (Craul et al., 2009; Holmes et al., 2013; Olivieri et al., 2008; Parga et al.,

2012; Radespiel, Rakotondravony, & Chikhi, 2008). Lemur catta’s restriction to isolated fragments of forest throughout their historic range has been a major driver of population declines which has caused the species to be reclassified from ‘Near Threatened’ to ‘Endangered’

(Andriaholinirina et al., 2014; Bodin et al., 2006; Cameron & Gould, 2013; Sussman et al., COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 6

2003). The ongoing fragmentation of forests in Madagascar has already driven local extinctions and is leaving other populations with low densities while also threatening the genetic diversity of the remaining populations (Bodin et al., 2006; Ganzhorn et al., 2001; Gould & Gabriel, 2015;

Sussman et al., 2003).

Following a coup d'état in 2009, Madagascar has experienced political unrest and financial instability, which has only exacerbated the threats facing L. catta and the country’s other endemic primates (Schwitzer et al., 2014). Since 2009, law enforcement has relaxed and there has been a marked increase in illegal logging, slash and burn agriculture, mining, and bushmeat hunting (Barrett et al., 2010; Cameron & Gould, 2013; Innes, 2010; Jenkins et al.,

2011; Schwitzer et al., 2014). Although it is traditionally considered fady (taboo) to hunt and consume L. catta, the instability in the country has led to changing cultural norms and people have begun poaching these lemurs for food (LaFleur, 2013; Sauther et al., 2013). There has also been an uptick in commercial hunting of lemurs, a practice which was not previously seen in the country (Reuter, Randell, et al., 2016; Schwitzer et al., 2014). Because bushmeat hunting and live-capture for the pet trade are often inextricably linked, the latter has also increased (LaFleur,

Clarke, Reuter, et al., 2017; Reuter, Gilles, et al., 2016; Sauther et al., 2013). As a result of being subjected to living in small isolated fragments, L. catta are more severely affected by hunting and live capture, which has already resulted in local extinctions in regions where they were formerly abundant and very low densities in the remaining populations (Gould & Sauther, 2016).

The Problem: Lemurs in the Pet Trade

Given the Endangered status of L. catta, the live capture of these animals for the pet trade poses a serious threat to the species’ survival. Lemur catta were recently added to the list of the

‘World’s 25 Most Endangered Primates,’ which cites the illegal pet trade as one of the leading COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 7 causes of the species rapid population decline (LaFleur, Clarke, Ratzimbazafy, et al., 2017).

Humans have a long history of overexploiting wildlife to the point of extinction and it continues to pose a serious threat to globally threatened animals (Baillie, Hilton-Taylor, & Stuart, 2004).

As the human population continues to grow, so does the wildlife trade industry, including the bushmeat and wildlife trade (Corlett, 2007). Research tends to focus on the extent and implications of the bushmeat trade rather than the live capture of wildlife, but live animals are often caught as byproducts of hunting in order to be sold in markets or kept as pets (Corlett,

2007; Duarte-Quiroga & Estrada, 2003; Fa et al., 1995; Reuter, Gilles, et al., 2016). The widespread and increasing presence of the bushmeat trade in Madagascar could positively correlate to the live capture of lemurs. Until recently, traditional taboos had prevented many people from hunting L. catta and other mammals, but rapidly changing social norms after the political coup and the well-established trade routes of the radiated tortoise (Astrochelys radiata) pet trade have resulted in people actively poaching L. catta (Sauther et al., 2013). Adult L. catta are targeted for the growing demand of luxury bushmeat and the infant and juveniles are taken to cities to be sold as pets (Sauther et al., 2013).

It is difficult to assess the numbers of primates in the wildlife trade, especially in domestic trades, but some estimates suggest that 40,000 live primates are traded globally each year (Karesh et al., 2005) and, with domestic trades, this number could be in the hundreds of thousands (Nijman et al., 2011). The extent of the international wildlife trade is better understood than domestic trades due to the Convention of the International Trade in Endangered Species of

Wild Fauna and Flora (CITES), an international agreement which was designed to protect endangered species from overexploitation by monitoring, regulating, and outlawing the international trade of endangered species. All primate species are protected by CITES and are COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 8 listed in either of the two highest levels of protection, Appendix I or Appendix II. Lemur catta is classified under Appendix I, granting it the highest level of protection in the international trade because it is threatened with extinction. The trade of the L. catta is only permitted in exceptional cases. While there have been some discrepancies in the numbers of species traded internationally by CITES (Blundell & Mascia, 2005), the scope of the international trade of primates and other endangered species, is much better monitored than domestic trades (Nijman et al., 2011).

It can be difficult to monitor domestic trades of wildlife because laws preventing wildlife trade are often not enforced. It is, however, becoming increasingly clear that domestic demands in countries throughout the tropics are a large driver in the primate trade (Ceballos-Mago &

Chivers, 2010; Ceballos-Mago, González, & Chivers, 2010; Duarte-Quiroga & Estrada, 2003;

Nijman, Martinez, & Shepherd, 2009; Shepherd, 2010). In Madagascar, the wildlife trade had previously been much less formal and organized than the markets in Asia and Africa, but recent studies have found that specialized sellers are selling large quantities of wildlife products that rival the markets in other sub-Saharan African countries (Reuter, Gilles, et al., 2016; Reuter,

Randell, et al., 2016). Much of the research on the illegal wildlife trade in Madagascar focuses on bushmeat (Golden et al., 2014; Randrianandrianina, Racey, & Jenkins, 2010; Razafimanahaka et al., 2012), but it is becoming increasingly apparent that live capture is widespread.

Amphibians and reptiles in the country are being taken from the wild to supply the international pet and medicinal markets at unsustainable rates, which is driving some species to extinction

(Andreone, Mercurio, & Mattioli, 2006; Reuter et al., 2016). It is harder to get accurate estimates of mammals in the pet trade than birds and reptiles because the majority of birds and reptiles are sold in open markets while mammals are mostly sold in smaller quantities and by request, making it harder for scientists and law enforcement to find them easily (Bush, Baker, & COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 9

Macdonald, 2014). It was, however, found that between 2010 and mid-2013 an estimated 28,000 lemurs were illegally kept in captivity (Reuter et al., 2016). Surveys indicated that the most common lemur observed in captivity were L. catta, accounting for 28% of observed sightings, while no other lemur accounted for even 10% of captive lemur sightings (Reuter, 2015). Lemur catta are the most terrestrial of all strepsirhines species (Cameron & Gould, 2013; Jolly, 1966;

Sussman, 1972), which may make them easier to capture than the more arboreal species and may partially account for their high rates in the pet trade.

The practice of live capturing lemurs to keep them as pets is illegal both internationally and domestically (Ordonnance No. 60-128, 1962) and can domestically result in confiscation and a fine. Despite this, a quarter of Malagasy people have seen a lemur being kept as a pet and nearly 30,000 lemurs were kept illegally over the course of three years (Reuter & Schaefer,

2017). These lemurs are kept by both individuals as pets and by hotels to make money from tourists (Reuter & Schaefer, 2017). The ownership of lemurs may have adverse effects on both the captive animal’s well-being and on the fitness of the wild populations or sub-populations

(Ceballos-Mago et al., 2010; Reuter & Schaefer, 2016). Although Madagascar does not, many other countries regulate the ownership of primates and mandate minimum requirements for the captive conditions (Reuter & Schaefer, 2016). These baseline regulations usually require the primate is provided with food akin to what they would eat in the wild; the animal is given adequate space to exhibit natural behaviors, such as climbing and jumping; the primate is given species appropriate enrichment; and they are housed socially, unless the species is naturally solitary (Reuter & Schaefer, 2016). In Madagascar, these minimum standards for animal-welfare are often not met for captive lemurs. Reuter and Schaefer (2016) found that the majority of pet lemurs were restrained by a rope or chain or were kept in a cage. These cages did not provide COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 10 adequate space for the lemurs to exhibit their natural behaviors, such as jumping and climbing.

In hotels, however, nearly all lemurs appeared to be free roaming and habituated in order to attract tourists. Captive lemurs were also fed human food instead of their natural diet and the majority of lemurs were reported to be in “poor health.” Assessments of pet lemurs being in

“poor health” included lemurs that were underweight, having lacerations from restraints, and/or exhibiting stereotypical behavior (repetitive pacing, indicating poor mental health). Many captive lemurs were also aggressive, which often led to them being further restrained (Reuter &

Schaefer, 2016).

In addition to the welfare issues of keeping lemurs as pets, the live capture of these animals may also have a negative effect on the long-term viability of wild populations. The effects of live capture and hunting on wild populations has not yet been studied in L. catta, but we can make inferences based on research done on other primates. In a study of the effects of hunting and the pet trade on yellow-breasted capuchin monkey (Sapajus xanthosternos), da Silva et al. (2016) found that the live capture of infant females had a greater negative impact on population viability than did the capture of infant males. This is likely due to the reproductive habits of the species because the loss of a female has a direct effect on the number of offspring.

In comparison, the loss of a male does not affect the number offspring because he would be replaced by another reproductive male who copulates with multiple females (da Silva et al.,

2016). Unlike the S. xanthosternos who have an interbirth interval of two years, which exacerbates the problem (Canale, 2010; da Silva et al., 2016; Fedigan, 1993; Fragaszy,

Visalberghi, & Fedigan, 2004), 75-80% of L. catta give birth every year, which may help offset the population viability deficits that are associated with live capture (Gould et al., 2003; Jolly et al., 2002; Koyama et al., 2001). These high rates of the reproduction help L. catta recover from COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 11 years with especially high infant mortality (Cawthon Lang, 2005; Sauther et al., 1999), but because the surviving infants are targeted for the pet trade, the practice is likely still unsustainable. Additionally, the recent severe fragmentation of L. catta habitat has led to small, isolated populations (Gould & Sauther, 2016), which will likely exacerbate ecological effects of live capture on these small populations. Only three sites (Berenty Reserve, Bezà Mahafaly

Reserve, and Anja Private Reserve) are known to have L. catta populations over 200 and many other sited have been extirpated of the species or have fewer than 30 individuals left, such as

Kirindy-Mitea National Park, the Makay Massif, and the Mikea forest (Gould & Sauther, 2016;

LaFleur, Clarke, Reuter, et al., 2017).

Wildlife Forensic Genetics

In order to combat the illegal pet lemur trade, we must first understand where wild individuals are being captured. Using molecular wildlife forensic methods, one can determine the source population of an individual pet of unknown origin by comparing its genetic signature to conspecifics in the wild. More specifically, by employing multilocus genotypes and statistical assignment methods, an individual can be assigned or matched to a population or geographic region while being excluded from others (Manel, Berthier, & Luikart, 2002). Determining geographic origin of illegal pets or illegal wildlife products (e.g., elephant ivory) can lead to the identification of geographic poaching ‘hotspots’, insight into wildlife trade networks, and potentially aid in the reintroduction of live captured animals back into the wild (Ogden &

Linacre, 2015).

These wildlife forensic techniques have been applied to multiple species that are severely affected by the wildlife trade, including African elephants, leopards in India, and slow lorises in

Vietnam (Blair et al., 2017; Mondol et al., 2015; Wasser et al., 2008). It was previously believed COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 12 that shipments of ivory confiscated in Asia was sourced broadly from across Africa. However,

Wasser et al. (2008) found that most of the ivory from the two of the largest poaching rings sourced their ivory from a poaching hotspot in central Africa. Mondol et al.’s (2015) study on determining provenience of leopard skins invalidated the commonly held assumption that pelts sized in small quantities were from local leopards. This research indicated that leopard poaching is widespread throughout the Indian subcontinent and there are poaching hotspots in central India

(Mondol et al., 2015). Additionally, preliminary findings on pygmy slow lorises (Nycticebus pygmaeus) in Vietnam have corroborated the trend that wildlife is trafficked from the south of the country to the north (Blair et al., 2017). The findings of these three studies will provide invaluable information for developing targeted conservation plans.

To accurately identify the geographic origin of an individual using assignment methods, the source population (or birthplace) needs to be genetically distinct from other potential source populations (i.e., reference populations) (Ogden & Linacre, 2015). If the origin is unknown, reference populations must represent the species’ entire geographic range in order to ensure all possible populations are considered for accurate assignment. Because the L. catta has a wide and diverse range across southern Madagascar, we need a broad sampling to effectively assign captive pets to their geographic origin. As of yet, there has not been a comprehensive study on the genetics of the entire population of L. catta. To date, two studies have investigated the genetics of wild populations in southwestern Madagascar (Parga et al., 2012) and in south- central Madagascar (Anja Community Reserve, Tsaranoro Valley Forest, and Sakaviro) (Clarke,

2015; Clarke et al., 2015).

Parga et al (2012) primarily investigated the presence of a population genetic bottleneck of two populations of L. catta in southwestern Madagascar: Beza Mahafaly Special Reserve COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 13

(BMSR) and Tsimanampetsotsa National Park (TNP). While they found evidence of a recent population genetic bottleneck of these lemurs due to climate events and human disturbances, they also reported observed and expected heterozygosity. These statistics are useful in determining the genetic diversity and health of the populations. L. catta in both BSMR (600 ha) and TNP (48,000 ha) showed high levels of heterozygosity (BMSR HO=0.80, MNA=8.62; TNP

HO=0.80, MNA=9.13) (Parga et al., 2012) that were consistent with or higher than other studies using the same microsatellite markers (Jekielek & Strobeck, 1999; Pastorini et al., 2005;

Zaonarivelo et al., 2007).

Comparatively, three populations in south-central Madagascar had similar levels of heterozygosity but lower levels of the mean number of alleles across all loci. Clarke’s (2015, et. al 2015) study sites were smaller and had small population sizes: Anja (34 ha), Sakaviro (14 ha), and Tsaranoro (46 ha). Despite the sites being severely fragmented and having small populations of L. catta, they still maintained moderate genetic diversity (Anja HO=0.88, MNA=5.17;

Sakaviro HO=0.79, MNA=4.83; Tsaranoro HO=0.72, MNA=5.83) when compared to the larger populations in the southwest. Clarke et al. (2015) also found that there was little genetic difference between the populations, but the differences increased as a product of increasing geographic distance. While these populations are not currently revealing a loss in genetic diversity, it is likely because they are exhibiting a lag response due to the recent intense fragmentation. Should this be the case, genetic diversity will markedly decrease as the effects of fragmentation catch up to the L. catta’s uncanny ability to be immune to environmental stressors

(Clarke et al., 2015).

If we are to effectively determine the origins of L. catta being kept as pets, we will need to include these populations as potential source populations as well as other wild L. catta COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 14 populations across their range. Population genetic data will need to be collected from other extant populations throughout southwestern Madagascar as well as southern Madagascar.

SPECIFIC AIMS

This research serves as a pilot study to assess the plausibility of determining the provenience of individual wild-caught rescued and current pet L. catta based on a sampling of four wild populations (i.e., source populations). The specific aims of this study are to 1) assess the genetic diversity and structure of the four source populations, and 2) assign individual wild- caught rescued and current pets to their wild population of origin, thereby identifying provenience of capture for these animals. To do this, I performed microsatellite genotyping for a total of n=55 wild and captive L. catta. I genotyped samples from 5 wild individuals from Isalo

National Park in southwestern Madagascar, and 20 captive individuals – those that are currently or were rescued from being kept as pets – at seven polymorphic loci. I will also include the genotypes of the three previously genotyped populations in south-central Madagascar: Anja

(n=10), Sakaviro (n=10), and Tsaranoro (n=10) (Clarke, 2015; Clarke et al., 2015). All individuals were assessed at the same seven polymorphic loci. This study will serve as a foundation for future research into the origin of L. catta pets when more potential source populations are included.

METHODS

Study Sites and Sample Collection

Study Sites. Noninvasive fecal samples were opportunistically collected from wild L. catta individuals in Isalo National Park and from captive L. catta around southern Madagascar by Tara A. Clarke (TAC) and Marni LaFleur (ML). Isalo National Park (22°29.26' S, 45°22.73' COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 15

E) is located in southwestern Madagascar and has several dense but isolated populations of L. catta, but their population size estimates are unknown (Gould & Sauther, 2016; LaFleur, Clarke,

Reuter, et al., 2017; Sussman et al., 2003). The 81,500 ha park’s landscape is characterized by large rock massifs of sandstone and intrusive igneous rock formations (Sussman et al., 2003).

The majority of the park consists of exposed rock or grass savannah (Hawkins, 1999). There is tree savannah interspersed between the grass savannah and in the valleys of the rock formations are dense, closed-canopy forests where rainwater collects (Hawkins, 1999; Sussman et al., 2003).

Fecal samples were also collected from captive L. catta at the Lemur Rescue Center

(LRC; 23°07′19′′S 43°37′17′′E) and from individuals being kept as pets. The LRC is located within the Reniala Botanical Reserve and currently houses 26 L. catta that were rescued from the illegal pet and bush meat trade (LaFleur et al., 2015). The center has been taking in L. catta since

2011, when Malagasy officials began confiscating illegally owned L. catta pets (Gould &

Andrianomena, 2015; LaFleur et al., 2015). Samples were also collected from ring-tailed lemurs being kept as personal pets in Toliara (23°21′22′′S 43°41′28′′E) and at a hotel in Tsinjoriake

(23°32′08′′S 43°44′43′′E) in southwestern Madagascar. These individuals were discovered by citizen reports to the Pet Lemur Survey Project.

For a reference of potential source populations, I used the genotypes of 30 adult L. catta from three wild populations: Anja, Sakaviro, Tsaranoro (Clarke, 2015; Clarke et al., 2015)

(Table 1). These populations are in the central highland region of Madagascar and are all comprised of mixed xerophytic, deciduous vegetation, and large granite outcrops (Cameron &

Gould, 2013; Clarke, 2015; Clarke et al., 2015; Gabriel, 2013). This region of Madagascar has been almost completely deforested over the last 50 years and has just a few small forest fragments scattered throughout (Gould & Gabriel, 2015). The Anja Reserve (21º51′12′′S COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 16

46º50′40′′E; 34 ha) has a population of ~220 L. catta (Cameron & Gould, 2013); Sakaviro

(21º47′03′′S 46º52′02′′E ; 14 ha) has a population of ~27 L. catta (Gould & Andrianomena,

2015); and Tsaranoro Valley (22º05′11′′S 46º46′14′′E ; 46 ha) has a population of ~80 L. catta

(Gould & Andrianomena, 2015). The Anja and Sakaviro fragments are ~12 km apart and are both isolated from other forest fragments due to highways and anthropogenic savannah, making dispersal unlikely (Clarke, 2015; Clarke et al., 2015; Gould & Andrianomena, 2015; Gould &

Gabriel, 2015). The Tsaranoro fragment is 27 km southwest of Anja and is <5 km away from two other forest fragments in the Tsaranoro valley (Gould & Andrianomena, 2015). These three fragments may comprise a single breeding population of L. catta (Clarke, 2015).

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 17

Figure I. Map of sampling localities. Wild populations are marked blue (Isalo National Park, Sakaviro, Anja Community Reserve, and Tsaranoro Valley Forrest) and captive individuals are marked green (Lemur Rescue Center, Hotel in Tsinjoriake, and personal pets in Toliara). The historical geographic distribution of L. catta in yellow is based on Goodman et al. (2006).

Table I. Sampling localities, geographic coordinates, and sample sizes of wild populations and the sampling size of the captive L. catta used in this study. Site Name Latitute Longitude n Reference Anja 21º51′12′′ S 46º50′40′′ E 10 Clarke et al., 2015 Isalo National Park 5 Canyon of Maki 22°29′16′′ S 45°22′44′′ E 2 Campsite 22°32′31′′ S 45°22′44′′ E 3 Sakaviro 21º47′03′′ S 46º52′02′′ E 10 Clarke et al., 2015 Tsaranoro 22º05′11′′ S 46º46′14′′ E 10 Clarke et al., 2015 Captive Individuals 20 Lemur Rescue Center 23°07′19′′ S 43°37′17′′ E 15 Hotel in Tsinjoriake 23°32′08′′ S 43°44′43′′ E 2 Illegal pet in Toliara 23°21′22′′ S 43°41′28′′ E 3

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 18

Sample Collection. Fecal samples were collected by TAC and ML from Isalo in July

2016 and from captive L. catta in July and August 2016. At Isalo, samples were randomly collected from individuals (n=3) that came through a tourist campsite (22°32′31′′S 45°22′44′′E) and from individuals (n=2) in the Canyon of Maki (22°29′16′′S 45°22′44′′E). Samples were collected from ex-pet lemurs at the LRC and were opportunistically collected from pet lemurs the field researchers encountered in their travels. All samples were immediately stored in

RNAlater reagent (Ambion, Austin, Tex., USA) solution to prevent DNA degradation. Samples were transported to the Primate Molecular Ecology Lab (PMEL; Hunter College of the City

University of New York, New York, NY) where they were stored at -80°C.

DNA Extraction and Microsatellite Genotyping

DNA extraction. Genomic DNA was extracted from samples genotyped in this study using QIAamp DNA Stool Mini Kits (QIAGEN, Valencia, CA). Extraction followed the manufacturer’s protocol with one modification: starting material was increased to 300mg to account for the weight of the RNAlater solution.

Microsatellite genotyping. Samples were amplified at seven highly polymorphic microsatellite markers that have been shown to reliably amplify fecal DNA: L-2 (Merenlender,

1993), Efr09 (Jekielek & Strobeck, 1999), Lc5, Lc6, Lc7 (Pastorini et al., 2005), 69HDZ267,

69HDZ299 (Zaonarivelo et al., 2007) (Appendix). Extraction products were amplified via PCR in a 13 µL reaction volume using HotStarTaq DNA polymerase Master Mix, BSA, primer pairs, and 3 µL gDNA using annealing temperatures specified in the literature (Appendix). PCR products were run at the Yale DNA Analysis Facility on Science Hill on a ABI 3730xl Genetic

Analyzer (Applied Biosystems) and an internal size standard, Rox-500, was added. Allele calls COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 19 were made using GeneMarker Software v.2.6.7 (SoftGenetics) and were checked for consistency across plates by including positive controls. Genotype assignment was based on multiple independent reactions. Heterozygous genotypes were confirmed with at least two independent reactions and homozygous individuals were confirmed with five independent reactions (Morin et al., 2001; Taberlet et al., 1996).

Population Genetic Analysis

Genetic diversity. All loci were tested for the presence of null alleles using the program

MICRO-CHECKER (van Oosterhout et al., 2004). Loci were tested for deviations from Hardy-

Weinberg equilibrium using the program GENEPOP v.4.2 and were evaluated using a 10,000 iteration dememorization phase, followed by 100 batches of 10,000 iterations (Raymond &

Rousset, 1995). Measures of genetic diversity, including number of alleles per locus (nA), mean number of alleles per locus (MNA), allelic richness (AR), and observed (HO) and expected (HS) heterozygosities for each sampling location were calculated using GENODIVE (Meirmans & Van

Tienderen, 2004). Allelic richness (AR) was standardized to the smallest sample size in the dataset to account for uneven sampling between populations using HP-RARE 1.1 (Kalinowski,

2005). Wright’s FIS was then calculated to measure deviations from Hardy–Weinberg equilibrium with 10,000 permutations (Weir & Cockerham, 1984).

It should be noted that for all analyses of the Anja, Sakaviro and Tsaranoro populations

(Clarke, 2015; Clarke et al., 2015), only the seven microsatellite markers that I used for my genotyping of the captive individuals and the Isalo population were used in the analysis

(Appendix). COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 20

Population genetic structure. To assess the genetic distances between the sampling localities, I calculated Wright’s FST (Weir & Cockerham, 1984) using GENODIVE (Meirmans &

Van Tienderen, 2004). FST is a measure of genetic differentiation and uses pairwise comparisons to illustrate whether and to what extent two populations are considered genetically distinct populations.

To infer population genetic structure from my sample of 55 L. catta, I first used a model- based Bayesian clustering method in STRUCTURE v2.3.4 (Pritchard, Stephens, & Donnelly, 2000).

This method uses the Markov Chain Monte Carlo (MCMC) approach to infer the optimal number of genetic populations (K) and groups individuals into those groups based on their multilocus genotypes. No a priori information regarding the individuals’ geographic sampling locations was provided so clusters were formed solely on genetic information. I evaluated the hypothesis K=1-7, three more than the number of wild populations (Evanno, Regnaut, & Goudet,

2005), using 100,000 iterations of MCMC following a burn-in of 50,000 iterations (Baden et al.,

2014; Holmes et al., 2013). I implemented 20 runs for each value of K, assuming admixture and correlated allele frequencies. The admixture model lets us estimate the of the number of natural genetic clusters and detect of historical population admixture (Falush, Stephens, & Pritchard,

2003; Ostrowski et al., 2006). The most likely number of genetic populations (K) was assessed using the highest value of ∆K (Evanno et al., 2005) using the program STRUCTURE HARVESTER v0.6.94 (Earl & vonHoldt, 2012). STRUCTURE HARVESTER calculates the second order rate of change of the likelihood distribution (ΔK), which indicates the most pronounced subdivision within the data and the optimal number of genetic clusters.

To corroborate my STRUCTURE analysis, I used a Discriminant Analysis of Principle

Components (DAPC) (Jombart, Devillard, & Balloux, 2010) in R Studio, using the adegenet COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 21 package (Jombart, 2008; RStudio Team, 2015). This multivariate method identifies clusters of genetically related individuals that maximize between-group variability and minimize within- group variability by using a set of retained principle components (determined by the user to optimize variance explained). The optimal number of clusters is determined by the number of clusters with the smallest Bayesian Information Criterion (BIC) value. Because the DAPC is not a model-based analysis and cannot be driven by an underlying population genetic model, it is more flexible than Bayesian clustering methods.

To further substantiate both the STRUCTURE and DAPC results, I performed a principal coordinates analysis (PCoA) with a standard genetic distance matrix (Nei, 1978) using

GENALEX v.6.5 (Peakall & Smouse, 2012).

Lastly, I executed an exclusion test (Cornuet et al., 1999) in GeneClass2 (Piry et al.,

2004). This type of assignment test calculates the likelihood that an individual in question belongs to each candidate population by comparing its genotypes to 10,000 simulated genotypes of each reference population. The likelihood of the individual belonging to each reference population can be used to rule out one or more of the source populations as the population of origin. Unlike the STRUCTURE analysis, this assignment test does not assume the true population of origin was sampled from. I used the partial Baysean method (Rannala & Mountain, 1997) and performed Monte-Carlo resampling simulations following Paetkau et al. (2003).

RESULTS

Genetic Diversity

All seven loci (described in Table II) were polymorphic with 10-16 alleles. Individuals were pooled across sampling localities and there was no evidence of linkage disequilibrium COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 22 across markers. Two loci were found to significantly deviate from Hardy-Weinberg equilibrium

(L-2 and Lc7; Table II), although they did not deviate at any one site specifically and were therefore used in further analysis. Allelic richness varied from 3.12-3.24 across the sampling localities of wild L. catta and was higher among the captive individuals (3.84 ± 0.23). The mean allelic richness was 3.30 ± 0.487 when pooled across sampling sites (Table III). The mean observed heterozygosity across sampling sites was 0.794 ± 0.074, while the mean expected heterozygosity was 0.762 ± 0.057. Overall FIS was -0.042 (95% confidence interval of -0.127 to

0.050). FIS values ranged from -0.183 at Sakaviro to 0.054 at the captive group, with all populations significantly deviating from 0 except for Anja. Mean FST over all sampling localities was 0.108 ± 0.037. Nearly all pairwise comparisons between sampling localities had significant

FST values except Isalo-Anja (Table IV). This suggests that nearly all sampling locations were genetically distinct.

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 23

Table II. Characteristics of 7 microsatellite markers amplified in 55 L. catta samples, including the number of alleles per locus (nA), observed (Ho) and expected (He) heterozygosity, and deviations from Hardy-Weinberg Equilibrium (HWE). Significant p values (p<0.05) are shown in bold. Size Annealing Marker n H H HWE GenBank Range Temp A o e L-2 179-203 48 11 0.816 0.785 0.0160 ---- Efr09 92-126 54 13 0.688 0.799 0.1072 AF104091 Lc5 127-151 60 10 0.629 0.717 0.5160 AY366441 Lc6 248-270 60 10 0.811 0.761 0.2706 AY366442 Lc7 172-198 60 12 0.745 0.688 0.0396 AY366443 69HDZ267 156-178 55 16 0.907 0.758 0.8883 EF093488 69HDZ299 238-262 58 12 0.963 0.828 0.7803 EF093489

Table III. Allelic diversity within each of 4 sampling localities and of the captive L. catta, including mean number of alleles per locus (MNA), allelic richness (AR), observed (HO) and expected (HS) Heterozygosity, inbreeding coefficient (FIS), and significant deviations from Hardy-Weinberg Equilibrium (HWE) calculated using 10,000 iterations. Significant values (p < 0.05) are shown in bold.

Site N MNA AR (SE) HO HS FIS HWE Captive 20 9.57 3.84 (0.231) 0.816 0.863 0.054 0.4108 Isalo 5 4.29 3.17 (0.731) 0.857 0.736 -0.165 0.8076 Anja 10 5.00 3.13 (0.440) 0.747 0.739 -0.011 0.0940 Sakaviro 10 4.86 3.12 (0.375) 0.860 0.727 -0.183 0.0032 Tsaranoro 10 6.00 3.24 (0.659) 0.690 0.738 0.064 0.6422 Overall 55 5.94 3.30 (0.487) 0.794 0.762 -0.042 -

Table IV. Pairwise FST values (above diagonal) and indication of significance FST values (below diagonal) among sampling localities of L. catta. Significant values indicated with * (P < 0.005 after Bonferroni corrections) Captive Isalo Anja Sakaviro Tsaranoro Captive - 0.076 0.067 0.093 0.089 Isalo * - 0.114 0.174 0.169 Anja * NS - 0.087 0.087 Sakaviro * * * - 0.126 Tsaranoro * * * * - COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 24

Population Genetic Structure and Assignments

A STRUCTURE analysis (Fig. I) identified two genetic clusters, as indicated by the highest value of ∆K. Sampling localities appeared to primarily cluster geographically, with the western most sampling location, Isalo, primarily clustering into cluster 2 and the more eastern populations (Anja, Sakaviro, and Tsaranoro) primarily clustering into cluster 1. The majority of captive individuals (18 of 20), clustered together with the Isalo population. Although Isalo had a small sample size (n=5), this could potentially suggest the captive L. catta are from more westerly populations, including those in or around Isalo.

Figure II. STRUCTURE analysis. Each bar represents the of proportional membership (Q) of an individual lemur belonging to two clusters.

Results from the Discriminant Analysis of Principle Components (DAPC) also suggest that two genetic clusters are present in the data. Like the STRUCTURE analysis, the captive individuals mainly formed one cluster and the Anja, Sakaviro, and Tsaranoro populations formed another. However, there was only weak evidence for classifying the data in two versus one clusters, as indicated by the difference in the Bayesian Information Criterion (ΔBIC) between the

K = 1 and K = 2 was ΔBIC = 1.5.

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 25

Figure III. Discriminant Analysis of Principle Components (DAPC). Bar plots show the proportional membership probability of individuals in two clusters.

A principal component analysis (PCoA; Fig. III) supported the results of the STRUCTURE and

DAPC analyses, in that there was loose clustering of the Isalo population along axis 2. The majority of the captive L. catta also clustered along axis 2 with the western Isalo population.

However, clusters were not well defined. The first axis accounted for 11.51% of the total molecular variance while another 8.22% of the variance was explained by Axis 2, which separated Isalo from the more eastern populations in the central highlands.

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 26

Principal Coordinates (PCoA)

Captive %) Isalo 8.22 (

2 Anja

PCoA Sakaviro Tsaranoro

PCoA1 (11.51%)

Figure IV. Principal Coordinates Analysis (PCoA). Wild populations are represented as dots and the captive pet lemurs are represented with an x.

Population assignment tests of the four wild populations in GeneClass resulted in individuals being accurately assigned 97.14% of the time to their respective population.

However, these individuals were excluded from all other populations in only 20.5% of these assignments. One individual from Sakaviro was incorrectly assigned to Anja (99.9% Anja,

98.6% Sakaviro). When captive individuals were assigned to the four wild populations, 3 individuals (15%) could be assigned to a population while being excluded from all other populations. One individual was excluded from Isalo but not from the other three populations.

However, 16 captive individuals (80%) of the 20 were excluded from all populations and could not be assigned to any of the sites in this study.

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 27

DISCUSSION

Genetic Differentiation and Diversity of Wild Populations

Genetic Differentiation. My analyses suggest that the three populations of ring-tailed lemurs in the central highlands (Anja, Sakaviro, and Tsaranoro) represent one genetic cluster and the lemurs in Isalo National Park may be a genetically distinct population. The results of both my

STRUCTURE analysis and Discriminant Analysis of Principal Components (DAPC) when comparing all four wild populations and the captive individuals clustered the Anja, Sakaviro, and

Tsaranoro populations together. The STRUCTURE analysis, however, grouped 26.67% of the central highland lemurs (3 Anja, 2 Sakaviro, and 3 Tsaranoro) with the Isalo and captive cluster and the

DAPC grouped 10% of these lemurs (1 Anja and 2 Sakaviro) into the captive and Isalo cluster.

Only one individual from Sakaviro was placed in the other group in both the STRUCTURE analysis and DAPC, while the other individuals were only grouped in the other cluster in one of the two analyses. The STRUCTURE analysis clustered all the Isalo individuals together along with the majority of the captive individuals, while the DAPC only clustered 40% with the captive individuals. Although the clustering was not identical across both analyses, they both showed general trends of genetic clustering based on geographic location and that the captive individuals were clustering with the more southwestern population, Isalo, rather than the three populations in the central highlands. The principal component analysis also supported these data as it demonstrated loose clustering based on geographic location, with the captive ring-tailed lemurs grouping more closely with the Isalo population, rather than the other three populations. The small number of samples (n=5) from Isalo could be interfering with the results, which may become clearer as more individuals are genotyped from that population. COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 28

Pairwise FST comparisons also supports the evidence that genetic differences in populations increases as a product of geographic distance because three of the four highest FST values were between Isalo and the other three wild populations with only the Sakaviro-Tsaranoro comparison being more closely related than the Isalo-Anja comparison (the only nonsignificant result). Yet, Sakaviro and Tsaranoro are the farthest apart (34 km) among the highland populations, supporting the evidence that the populations are more significantly different the farther away they are due to the severe habitat fragmentation in Madagascar. These results are similar to those found in Microcebus ravelobensis (FST = 0.01-1.15) which showed evidence of isolation-by-distance, although the populations were still exhibiting levels of genetic differentiation during a time when their forest fragments may have been connected (Olivieri et al., 2008). This indicates that fragmentation did not occur too long ago and that they are still exhibiting historic, rather than current, structuring due to a time lag.

Genetic Diversity. Levels of observed heterozygosity were similar to those found in the

Beza Mahafaly Special Reserve (BMSR) and Tsimanampetsotsa National Park (TNP), though

MNA was lower (BSMR Ho=0.79, MNA=8.29; TNP Ho=0.79, MNA=8.43) (Parga et al., 2012).

Parga et al. (2012) used eight microsatellite markers, but for this analysis and comparison I used seven microsatellite markers. To compare our populations, I only used the seven microsatellite markers that were identical to those utilized in my analysis. Although Isalo National Park is the largest fragment in this analysis (81,500 ha), it showed the lowest levels of allelic diversity

(MNA=4.29) yet some of the highest levels of heterozygosity (HO=0.86). The genetic diversity in Isalo were similar to the smallest fragment, Sakaviro (MNA=4.86, HO=0.86). At the time of this analysis, only five individuals were genotyped from this populations, which could skew the COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 29 results. More individuals will need to be genotyped from Isalo before we can conclude that Isalo is exhibiting significant losses of allelic diversity.

Additionally, levels of genetic variability within L. catta in south-central and southwestern Madagascar were similar to those found in other strepsirrhines, including

Propithecus tattersalli (MNA=6.3, HO=0.69) and Microcebus spp. (MNA=4.38–6.50, HO=0.47–

0.69) (Olivieri et al., 2008; Quéméré et al., 2010).

Assignment of Captive Lemurs

The cumulative results of my assignment tests indicate that the vast majority of the pet lemurs sampled did not originate from any of the four wild populations used in this study. When the origin population of sampled individuals are not known, it is recommended that both

Bayesian assignment tests (STRUCTURE; Pritchard et al., 2000) and Bayesian exclusion tests

(Cornuet et al., 1999) are used to avoid assignment errors (Manel et al., 2002; Manel, Gaggiotti,

& Waples, 2005). Using the results of both tests, just one individual can be assigned to

Tsaranoro. This individual had not been confiscated by Malagasy authorities and taken to the

Lemur Rescue Center (LRC), but was instead being kept at a hotel Tsinjoriake on the southwestern coast of Madagascar, ~350km southwest of Tsaranoro. This suggests that the hotel did not capture this lemur from the populations in the nearby forests, but instead may have bought the lemur from a wildlife trader. Another individual from the LRC was narrowed down to coming from Anja, Sakaviro, or Tsaranoro, but the exact population is unknown. The other two individuals that were assigned to a population in the exclusion test were not assigned to those populations in the STRUCTURE analysis, so they cannot be definitively assigned to a population. COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 30

The results of all three assignment tests indicate that the majority of the captive individuals came from populations that were not included in this analysis. Thus, 80% of the captive individuals were excluded from all four populations. In both the STRUCTURE and DAPC analyses, most of the captive individuals formed one cluster, while the Anja, Sakaviro, and

Tsaranoro populations formed another. While Isalo clustered with the captive individuals in the

STRUCTURE analysis and was split between the two clusters in the DAPC, the principal coordinates analysis indicated it was loosely separated from the other populations due to its geographic distance. More individuals are currently being genotyped from this population, which will help strengthen these results.

The wild populations in this study are geographically isolated, but they are exhibiting a time lag in their loss of genetic diversity due to the sites being fragmented relatively recently. As time goes on, these populations will likely become more genetically distinct and assigning individuals to a source population will become more well-defined. As this happens, effective population sizes will decrease, gene flow will be reduced, genetic variability will decrease, and inbreeding will increase (Craul et al., 2009; Holmes et al., 2013; Olivieri et al., 2008; Parga et al., 2012; Radespiel et al., 2008).

Future Study and Conservation Implications

While this pilot study did show evidence of genetic clustering of L. catta, the results made it clear that sampling needs to be greatly broadened in order to reflect the full range of L. catta geographic range. Additional genotyping is underway, including samples from Berenty

Private Reserve in southern Madagascar, populations near Tolaria, southwestern Madagascar, and additional samples from Isalo National Park. Additional reference genotypes will be COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 31 included from Beza Mahafaly Special Reserve (BMSR) and Tsimanampetsotsa National Park

(TNP) (Parga et al., 2012). The inclusion of these sites will more closely represent the entire population of L. catta and I expect that genetic clustering based on geographic distance will become more evident and there may be more than two genetic clusters. These data will allow for more accurate assignment of pet lemurs to their wild population of origin. Because most of the captive samples collected for this study were located near the southwestern coast of Madagascar and L. catta are known to be sold in the southwestern city, Toliara (Sauther et al., 2013), it is likely that many of these pet lemurs came from sites in this region of the country. However, recent studies have found that several populations in this area near the western coast have recently been extirpated due to mining, hunting, and live capture (e.g. Ranobe, Reniala Private

Reserve, Ifaty forest) while other populations are nearly locally extinct (e.g. Tsinjoriake) (Gould

& Sauther, 2016; LaFleur, Clarke, Reuter, et al., 2017). These local extinctions may be the reason that the hotel in this region did not get their lemur from a local population, but instead from Tsaranoro, which is ~350km away but has larger L. catta populations remaining. When sites with extant populations from this region are included (populations near Toliara, BSMR, and

TNP), I expect that provenience for many of the pet L. catta will be from this region. If it is found that majority of pet lemurs were sourced from more distant populations, it will allow us to better understand trade routes.

When sampling is broadened in the future, this project will represent the first comprehensive analysis of the genetic health of ring-tailed lemurs throughout their entire range and will provide critical guidance for conservation management. There have been surprisingly few studies on the genetic diversity of ring-tailed lemurs and given their recent population declines, it is imperative to obtain information that can help preserve the species long-term COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 32 viability in the wild. Future genetic analyses will allow for the identification of populations that maintain healthy levels of genetic diversity and gene flow which will inform potential release sites for the possible future reintroduction of wild caught pet ring-tailed lemurs.

This study, when completed, will represent one of the first reference genetic databases with the intent of identifying poaching hotspots in non-human primates, and will be the first time these techniques are used to track the pet trade exclusively, rather than wildlife products. A similar study is currently being conducted to identify trade networks and provenience of pygmy slow lorises (Nycticebus pygmaeus) in Vietnam (Blair et al., 2017). This type of genetic database has also been successfully developed for tracing confiscated elephant ivory to its origin in Africa

(Wasser et al., 2015) and to identify the origin of confiscated leopard skins in India (Manel et al.,

2002; Mondol et al., 2015). This relatively new application of these forensic techniques has directly impacted the conservation of these species. For example, prior to Wasser et al.’s (2008) study on ivory poaching, it was widely believed that ivory dealers were sourcing products from across Africa as stock became available. However, the study revealed that two of the largest ivory poaching syndicates both sourced all of their ivory from similar locations in and around

Zambia (Wasser et al., 2008). This information was only revealed after performing genetic assignment techniques because ivory was moved to many different intermediary countries before being shipped to its destination in Asia as a means of reducing risk by distancing the syndicates from the source. Previous techniques of tracing ivory only began at the shipping origin location which could be very far from where the animals were poached (Wasser et al., 2008).

Only recently have studies in Madagascar shown that the country’s wildlife trade is becoming formalized and that wildlife products are being transported large distances (Reuter,

Randell, et al., 2016). It was previously believed that wild caught lemurs and bushmeat were COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 33 sourced locally, but this project could potentially reveal more formalized trade routes. The one confidently assigned individual in this study was sourced ~350 km away from the hotel where it was kept, which could be early evidence of trade routes. As broader data is added to this research, trade routes could become more evident, or it may reveal that the majority of pet lemurs are sourced locally. Knowing this information will allow for more targeted and effective conservation measures to be developed. If most trades are happening locally, targeted education and community outreach may be an effective conservation strategy. However, if this study finds that the trade of pet L. catta is organized and trade routes are discovered, education efforts may not be sufficient to combat the trade. Instead, stricter law enforcement may be necessary.

Although Madagascar’s laws prohibit the buying, selling, and owning of lemurs they are not strictly enforced; thus, this study could provide crucial insight into trade networks and mitigate much of the investigative efforts that would otherwise be needed to identify and crack down on trade networks. Potential poaching hotspots and trade routes identified by this study could help law enforcement more efficiently and effectively stop the trade of live lemurs at the source.

This novel approach to understanding the primate pet trade will give us critical insight into the growing conservation issue that is the wildlife trade. By identifying poaching hotspots where lemurs are being captured, conservationists will be able to implement targeted actions that will be more effective than broad outreach campaigns. By combining forensic methods with conservation genetics, it is possible to directly apply scientific research into investigative processes. As such, this emerging and growing field is gaining enthusiasm from government agencies, nonprofit organizations and the scientific research communities alike as a promising tool for combatting the growing illegal wildlife trade industry (Alacs et al., 2010; Ogden,

Dawnay, & McEwing, 2009). If applied to other species, these methods could help the estimated COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 34 hundreds of thousands of primates affected by the wildlife trade every year (Nijman et al., 2011) as well as any species that is threatened by the wildlife trade.

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 35

References

Alacs, E. A., Georges, A., FitzSimmons, N. N., & Robertson, J. (2010). DNA detective: A review of molecular approaches to wildlife forensics. Forensic Science, Medicine, and Pathology, 6(3), 180–194. Andreone, F., Mercurio, V., & Mattioli, F. (2006). Between environmental degradation and international pet trade: conservation strategies for the threatened amphibians of Madagascar. Natura, 95(2), 81–96. Andriaholinirina, N., Baden, A. L., Blanco, M., Chikhi, L., Cooke, A., Davies, N., … Mi, A. (2014). Lemur catta. The IUCN Red List of Threatened Species 2014: e.T11496A62260437 Baden, A. L., Holmes, S. M., Johnson, S. E., Engberg, S. E., Louis, E. E., & Bradley, B. J. (2014). Species-level view of population structure and gene flow for a critically endangered primate (Varecia variegata). Ecology and Evolution, 4(13), 2675–2692. Baillie, J., Hilton-Taylor, C., & Stuart, S. N. (2004). 2004 IUCN red list of threatened species: a global species assessment. Earth. Barrett, M. A., Brown, J. L., Morikawa, M. K., Labat, J.-N., & Yoder, A. D. (2010). CITES Designation for Endangered Rosewood in Madagascar. Science, 328(5982), 1109-1110. Blair, M. E., Le, M. D., Sethi, G., Thach, H. M., Nguyen, V. T. H., Amato, G., … Sterling, E. J. (2017). The Importance of an Interdisciplinary Research Approach to Inform Wildlife Trade Management in Southeast Asia. BioScience, 67(11), 995–1003. Blundell, A. G., & Mascia, M. B. (2005). Discrepancies in reported levels of international wildlife trade. Conservation Biology, 19(6), 2020–2025. Bodin, Ö., Tengö, M., Norman, A., Lundberg, J., & Elmqvist, T. (2006). The Value of Small Size: Loss Of Forest Patches And Ecological Thresholds In Southern Madagascar. Ecological Applications, 16(2), 440–451. Borgerson, C., McKean, M. A., Sutherland, M. R., & Godfrey, L. R. (2016). Who hunts lemurs and why they hunt them. Biological Conservation, 197, 124–130. Brinkmann, K., Noromiarilanto, F., Ratovonamana, R. Y., & Buerkert, A. (2014). Deforestation processes in south-western Madagascar over the past 40 years: What can we learn from settlement characteristics? Agriculture, Ecosystems and Environment, 195, 231–243. Brown, J. L., & Yoder, A. D. (2015). Shifting ranges and conservation challenges for lemurs in the face of climate change. Ecology and Evolution, 5(6), 1131–1142. Bush, E. R., Baker, S. E., & Macdonald, D. W. (2014). Global trade in exotic pets 2006-2012. Conservation Biology, 28(3), 663–676. Cameron, A., & Gould, L. (2013). Fragment-Adaptive Behavioural Strategies and Intersite Variation in the Ring-Tailed Lemur (Lemur catta) in South-Central Madagascar. In L. K. Marsh & C. A. Chapman (Eds.), Primates in Fragments: Complexity and Resilience (pp. 227–243). New York, NY: Springer New York. Canale, G. R. (2010). Ecology and behaviour of the yellowbreasted capuchin monkey (Cebus xanthosternos) in the northern Atlantic Forest (Doctoral dissertation). University of Cambridge. Cawthon Lang, K. (2005). Primate Factsheets: Ring-tailed lemur (Lemur catta) Behavior. Ceballos-Mago, N., & Chivers, D. J. (2010). Local knowledge and perceptions of pet primates and wild Margarita capuchins on Isla de Margarita and Isla de Coche in Venezuela. Endangered Species Research, 13(1), 63–72. COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 36

Ceballos-Mago, N., González, C. E., & Chivers, D. J. (2010). Impact of the pet trade on the Margarita capuchin monkey (Cebus apella margaritae). Endangered Species Research, 12(1), 57–68. Clarke, T. A. (2015). Genetic consequences of occupying a highly fragmented landscape among ring-tailed lemurs (Lemur catta) in south-central Madagascar (Doctoral dissertation). University of Victoria. Clarke, T. A., Gray, O., Gould, L., & Burrell, A. S. (2015). Genetic diversity of the ring-tailed lemur (Lemur catta) in South-Central Madagascar. Folia Primatologica, 86(1–2), 76–84. Corlett, R. T. (2007). The impact of hunting on the mammalian fauna of tropical Asian forests. Biotropica. Cornuet, J. M., Piry, S., Luikart, G., Estoup, A., & Solignac, M. (1999). New methods employing multilocus genotypes to select or exclude populations as origins of individuals. Genetics, 153(4), 1989–2000. Craul, M., Chikhi, L., Sousa, V., Olivieri, G. L., Rabesandratana, A., Zimmermann, E., & Radespiel, U. (2009). Influence of forest fragmentation on an endangered large-bodied lemur in northwestern Madagascar. Biological Conservation, 142(12), 2862–2871. da Silva, F. A., Canale, G. R., Kierulff, M. C. M., Duarte, G. T., Paglia, A. P., & Bernardo, C. S. S. (2016). Hunting, pet trade, and forest size effects on population viability of a critically endangered Neotropical primate, Sapajus xanthosternos (Wied-Neuwied, 1826). American Journal of Primatology, 78(9), 950–960. Duarte-Quiroga, A., & Estrada, A. (2003). Primates as Pets in Mexico City: An Assessment of the Species Involved, Source of Origin, and General Aspects of Treatment. American Journal of Primatology, 61(2), 53–60. Earl, D. A., & vonHoldt, B. M. (2012). STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetics Resources, 4(2), 359–361. Estrada, A., Garber, P. A., Rylands, A. B., Roos, C., Fernandez-duque, E., Fiore, A. Di, … Arregoitia, L. V. (2017). Impending extinction crisis of the world’s primates: Why primates matter. Advance Science, 3(229), 1–16. Evanno, G., Regnaut, S., & Goudet, J. (2005). Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Molecular Ecology, 14(8), 2611–2620. Fa, J. E., Juste, J., Delval, J. P., & Castroviejo, J. (1995). Impact of Market Hunting on Mammal Species in Equatorial-Guinea. Conservation Biology, 9(5), 1107–1115. Falush, D., Stephens, M., & Pritchard, J. K. (2003). Inference of population structure using multilocus genotype data: Linked loci and correlated allele frequencies. Genetics, 164(4), 1567–1587. Fedigan, L. M. (1993). Sex differences and intersexual relations in adult white-faced capuchins (Cebus capucinus). International Journal of Primatology, 14(6), 853–877. Fragaszy, D. M., Visalberghi, E., & Fedigan, L. M. (2004). The Complete Capuchin: The Biology of the Genus Cebus. Reading. Gabriel, D. N. (2013). Habitat Use and Activity Patterns as an Indication of Fragment Quality in a Strepsirrhine Primate. International Journal of Primatology, 34(2), 388–406. Ganzhorn, J. U., Lowry, P. P., Schatz, G. E., & Sommer, S. (2001). The biodiversity of Madagascar: one of the world’s hottest hotspots on its way out. Oryx, 35(4), 346–348. Golden, C. D. (2009). Bushmeat hunting and use in the Makira Forest, north-eastern Madagascar: a conservation and livelihoods issue. Oryx, 43(3), 386–392. COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 37

Golden, C. D., Bonds, M. H., Brashares, J. S., Rodolph Rasolofoniaina, B. J., & Kremen, C. (2014). Economic Valuation of Subsistence Harvest of Wildlife in Madagascar. Conservation Biology, 28(1), 234–243. Goodman, S. M., Rakotoarisoa, S. V., & Wilme, L. (2006). The Distribution and Biogeography of the Ringtailed Lemur (Lemur catta) in Madagascar. In Ringtailed Lemur Biology (pp. 3– 15). Gould, L. (2007). Lemur catta Ecology: What We Know and What We Need to Know. In L. Gould & M. Sauther (Eds.), Lemurs - Ecology and Adaptation (pp. 255–274). Springer, New York. Gould, L., & Andrianomena, P. (2015). Ring-tailed Lemurs (Lemur catta), Forest Fragments, and Community-level Conservation in South-central Madagascar. Primate Conservation, 29(29), 67–73. Gould, L., & Gabriel, D. N. (2015). Wet and dry season diets of the Endangered Lemur catta (ring-tailed lemur) in two mountainous rocky outcrop forest fragments in south-central Madagascar. African Journal of Ecology, 53(3), 320–330. Gould, L., & Sauther, M. L. (2016). Going, Going, Gone… Is the Iconic Ring-tailed Lemur (Lemur catta) Headed for Imminent Extirpation? Primate Conservation, 2016(30), 89–101. Gould, L., Sussman, R. W., & Sauther, M. L. (2003). Demographic and life-history patterns in a population of ring-tailed lemurs (Lemur catta) at Beza Mahafaly Reserve, Madagascar: A 15- year perspective. American Journal of Physical Anthropology, 120(2), 182–194. Hawkins, A. F. A. (1999). The Primates of Isalo National Park, Madagascar. Lemur News, 4, 10– 14. Holmes, S. M., Baden, A. L., Brenneman, R. A., Engberg, S. E., Louis, E. E., & Johnson, S. E. (2013). Patch size and isolation influence genetic patterns in black-and-white ruffed lemur (Varecia variegata) populations. Conservation Genetics, 14(3), 615–624. Husson, S. J., Ancrenaz, M., Macfie, E. J., Utami-Atmoko, S. S., & Wich, S. A. (2017). Pongo pygmaeus (Linnaeus, 1760). In C. Schwitzer, R. A. Mittermeier, A. B. Rylands, F. Chiozza, E. A. Williamson, E. J. Macfie, … A. Cotton (Eds.), Primates in Peril: The World’s 25 Most Endangered Primates 2016–2018 (pp. 75–78). Arlington, VA: IUCN SSC Primate Specialist Group (PSG), International Primatological Society (IPS), Conservation International (CI), and Bristol Zoological Society. Innes, J. (2010). Madagascar rosewood, illegal logging and the tropical timber trade. Madagascar Conservation & Development, 5(1), 5–10. Jekielek, J., & Strobeck, C. (1999). Characterization of polymorphic brown lemur (Eulemur fulvus) microsatellite loci and their amplification in the family Lemuridae. Molecular Ecology, 8(5), 901. Jenkins, R. K. B., Keane, A., Rakotoarivelo, A. R., Rakotomboavonjy, V., Randrianandrianina, F. H., Razafimanahaka, J. H., … Jones, J. P. G. (2011). Analysis of patterns of bushmeat consumption reveals extensive exploitation of protected species in eastern madagascar. PLoS ONE, 6(12). Jolly, A. (1966). Lemur Behavior. Chicago: Chicago University Press. Jolly, A. (2003). Mammals: Lemur catta, ring-tailed lemur, Maky. In S. M. Goodman & J. P. Benstead (Eds.), The natural history of Madagascar (pp. 1329–31). Chicago: University of Chicago Press. COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 38

Jolly, A., Dobson, A., Rasamimanana, H. R., Walker, J., O’Connor, S., Solberg, M., & Perel, V. (2002). Demography of Lemur catta at Berenty Reserve, Madagascar: Effects of troop size, habitat and rainfall. International Journal of Primatology, 23(2), 327–353. Jombart, T. (2008). adegenet: a R package for the multivariate analysis of genetic markers. Bioinformatics, 24(11), 1403–5. Jombart, T., Devillard, S., & Balloux, F. (2010). Discriminant analysis of principal components: a new method for the analysis of genetically structured populations. BMC Genetics, 11(1), 94. Kalinowski, S. T. (2005). HP-RARE 1.0: A computer program for performing rarefaction on measures of allelic richness. Molecular Ecology Notes, 5(1), 187–189. Karesh, W. B., Cook, R. A., Bennett, E. L., & Newcomb, J. (2005). Wildlife trade and global disease emergence. Emerging Infectious Diseases, 11(7), 1000–1002. Kelley, E. (2011). Lemur catta in the region of Cap Sainte-Marie, Madagascar: Introduced cacti, xerophytic didiereaceae-euphorbia bush, and tombs (Doctoral dissertation). Washington University, St. Louis. Koyama, N., Nakamichi, M., Oda, R., & Miyamoto, N. (2001). A Ten-year Summary of Reproductive Parameters for Ring-tailed Lemurs at Berenty, Madagascar. Primates, 42(January), 1–14. LaFleur, M. (2013). Madagascar’s most famous lemur facing big threats. LaFleur, M., Clarke, T. A., Giraud, L., Youssouf Jacky, I., Gould, L., & Adiba, M. (2015). Reniala Lemur Rescue Center for Ringtailed Lemurs in Madagascar. Lemur News, 19, 11– 16. LaFleur, M., Clarke, T. A., Ratzimbazafy, J., & Reuter, K. E. (2017). Lemur catta (Linnaeus, 1758). In C. Schwitzer, R. A. Mittermeier, A. B. Rylands, F. Chiozza, E. A. Williamson, E. J. Macfie, … A. Cotton (Eds.), Primates in Peril: The World’s 25 Most Endangered Primates 2016–2018 (pp. 35–37). Arlington, VA: IUCN SSC Primate Specialist Group (PSG), International Primatological Society (IPS), Conservation International (CI), and Bristol Zoological Society. LaFleur, M., Clarke, T. A., Reuter, K. E., & Schaeffer, T. (2017). Rapid decrease in populations of wild ring-tailed lemurs (Lemur catta) in Madagascar. Folia Primatologica, 87(5), 320– 330. LaFleur, M., & Gould, L. (2009). Feeding outside the Forest: The Importance of Crop Raiding and an Invasive Weed in the Diet of Gallery Forest Ring-Tailed Lemurs (Lemur catta) following a Cyclone at the Beza Mahafaly Special Reserve, Madagascar. Folia Primatologica, 80(3), 233–246. Manel, S., Berthier, P., & Luikart, G. (2002). Detecting Wildlife Poaching: Identifying the Origin of Individuals with Bayesian Assignment Tests and Multilocus Genotypes. Conservation Biology, 16(3), 650–659. Manel, S., Gaggiotti, O. E., & Waples, R. S. (2005). Assignment methods: Matching biological questions with appropriate techniques. Trends in Ecology and Evolution, 20(3), 136–142. Meirmans, P. G., & Van Tienderen, P. H. (2004). GENOTYPE and GENODIVE: Two programs for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes, 4(4), 792–794. Merenlender, A. (1993). The Effects of Sociality on the Demography and Genetic Structure of Lemur fulvus rufus (Polygamous) and Lemur rubriventer (Monogamous) and the Conservation Implications (Doctoral dissertation). University of Rochester. COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 39

Mittermeier, R. A., Konstant, W. R., Nicoll, M. E., & Langrand, O. (1992). Lemurs of Madagascar: An Action Plan for their Conservation. 1993-1999. Gland, Switzerland.: IUCN/SSC Primate Specialist Group. Mondol, S., Sridhar, V., Yadav, P., Gubbi, S., & Ramakrishnan, U. (2015). Tracing the geographic origin of traded leopard body parts in the Indian subcontinent with DNA-based assignment tests. Conservation Biology, 29(2), 556–564. Morin, P. A., Chambers, K. E., Boesch, C., & Vigilant, L. (2001). Quantitative polymerase chain reaction analysis of DNA from noninvasive samples for accurate microsatellite genotyping of wild chimpanzees (Pan troglodytes verus). Molecular Ecology, 10(7), 1835–1844. Myers, N., Mittermeier, R. A., Mittermeier, C. G., da Fonseca, G. a, & Kent, J. (2000). Biodiversity hotspots for conservation priorities. Nature, 403(6772), 853–858. Nei, M. (1978). Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics. Nekaris, K. A. I., Shepherd, C. R., Starr, C. R., & Nijman, V. (2010). Exploring cultural drivers for wildlife trade via an ethnoprimatological approach: a case study of slender and slow lorises (Loris and Nycticebus) in South and Southeast Asia. American Journal of Primatology, 72(10), 877–886. Nijman, V., Martinez, C. Y., & Shepherd, C. R. (2009). Saved from trade: Donated and confiscated gibbons in zoos and rescue centres in Indonesia. Endangered Species Research, 9(2), 151–157. Nijman, V., Nekaris, K. A.-I., Donati, G., Bruford, M., & Fa, J. E. (2011). Primate conservation: Measuring and mitigating trade in primates. Endangered Species Research, 13(2), 159–161. O’Conner, S. M. (1987). The effect of human impact on vegetation and the consequences of primates on two riverine forests, Southern Madagascar (Doctoral dissertation). University of Cambridge. Oda, R. (1996). Predation on a Chameleon by a Ring-Tailed Lemur (Lemur catta) in the Berenty Reserve, Madagascar. Folia Primatologica, 67(1), 40–43. Ogden, R., Dawnay, N., & McEwing, R. (2009). Wildlife DNA forensics - Bridging the gap between conservation genetics and law enforcement. Endangered Species Research, 9(3), 179–195. Ogden, R., & Linacre, A. (2015). Wildlife forensic science: A review of genetic geographic origin assignment. Forensic Science International: Genetics, 18, 152–159. Olivieri, G. L., Sousa, V., Chikhi, L., & Radespiel, U. (2008). From genetic diversity and structure to conservation: Genetic signature of recent population declines in three mouse lemur species (Microcebus spp.). Biological Conservation, 141(5), 1257–1271. Ostrowski, M.-F., David, J., Santoni, S., McKhann, H., Reboud, X., Le Corre, V., … Bataillon, T. (2006). Evidence for a large-scale population structure among accessions of Arabidopsis thaliana: possible causes and consequences for the distribution of linkage disequilibrium. Molecular Ecology, 15(6), 1507–17. Paetkau, D., Slade, R., Burden, M., & Estoup, A. (2004). Genetic assignment methods for the direct, real-time estimation of migration rate: A simulation-based exploration of accuracy and power. Molecular Ecology, 13(1), 55–65. Parga, J. A., Sauther, M. L., Cuozzo, F. P., Jacky, I. A. Y., & Lawler, R. R. (2012). Evaluating ring-tailed lemurs (Lemur catta) from southwestern Madagascar for a genetic population bottleneck. American Journal of Physical Anthropology, 147(1), 21–29. COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 40

Pastorini, J., Fernando, P., Forstner, M. R. J., & Melnick, D. J. (2005). Characterization of new microsatellite loci for the ring-tailed lemur (Lemur catta). Molecular Ecology Notes, 5(1), 149–151. Peakall, R., & Smouse, P. E. (2012). GenALEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics, 28(19), 2537–2539. Piry, S., Alapetite, A., Cornuet, J. M., Paetkau, D., Baudouin, L., & Estoup, A. (2004). GeneClass2: A software for genetic assignment and first-generation migrant detection. Journal of Heredity, 95(6), 536–539. Pritchard, J. K., Stephens, M., & Donnelly, P. (2000). Inference of population structure using multilocus genotype data. Genetics, 155, 945–959. Quéméré, E., Louis, E. E., Ribéron, A., Chikhi, L., & Crouau-Roy, B. (2010). Non-invasive conservation genetics of the critically endangered golden-crowned sifaka (Propithecus tattersalli): High diversity and significant genetic differentiation over a small range. Conservation Genetics, 11(3), 675–687. Radespiel, U., Rakotondravony, R., & Chikhi, L. (2008). Natural and anthropogenic determinants of genetic structure in the largest remaining population of the endangered golden-brown mouse lemur (Microcebus ravelobensis). American Journal of Primatology, 70(9), 860–870. Randrianandrianina, F. H., Racey, P. A., & Jenkins, R. K. B. (2010). Hunting and consumption of mammals and birds by people in urban areas of western Madagascar. Oryx, 44(3), 411– 415. Rannala, B., & Mountain, J. L. (1997). Detecting immigration by using multilocus genotypes. Proceedings of the National Academy of Sciences, 94(17), 9197–9201. Rasamimanana, H. R., & Rafidinarivo, E. (1993). Feeding Behavior of Lemur catta Females in Relation to Their Physiological State. In P. M. Kappeler & J. U. Ganzhorn (Eds.), Lemur Social Systems and Their Ecological Basis (pp. 123–133). Boston, MA: Springer US. Raymond, M., & Rousset, F. (1995). GENEPOP (Version 1.2): Population Genetics Software for Exact Tests and Ecumenicism. Journal of Heredity, 86(3), 248–249. Razafimanahaka, J. H., Jenkins, R. K. B., Andriafidison, D., Randrianandrianina, F. H., Rakotomboavonjy, V., Keane, A., & Jones, J. P. G. (2012). Novel approach for quantifying illegal bushmeat consumption reveals high consumption of protected species in Madagascar. Oryx, 46(4), 584–592. Reuter, K. E., Gilles, H., Wills, A. R., & Sewall, B. J. (2016). Live capture and ownership of lemurs in Madagascar: extent and conservation implications. Oryx, 50(2), 344–354. Reuter, K. E., Randell, H., Wills, A. R., Janvier, T. E., Belalahy, T. R., & Sewall, B. J. (2016). Capture, movement, trade, and consumption of mammals in Madagascar. PLoS ONE, 11(2), 1–25. Reuter, K. E., & Schaefer, M. S. (2016). Captive Conditions of Pet Lemurs in Madagascar. Folia Primatologica, 87(1), 48–63. Reuter, K. E., & Schaefer, M. S. (2017). Motivations for the Ownership of Captive Lemurs in Madagascar. Anthrozoos, 30(1), 33–46. Rijksen, H. D., & Meijaard, E. (1999). Our Vanishing Relative. The Status of Wild Orang-utans at the Close of the Twentieth Century. Dordrecht, The Netherlands: Kluwer Academic Publishers. RStudio Team. (2015). RStudio: Integrated development for R. Boston, MA: RStudio, Inc. COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 41

Sauther, M. L. (1992). The effects of reproductive state, social rank, and group size on resource use among free-ranging ringtailed lemurs (Lemur catta) of Madagascar (Doctoral dissertation). Washington University, St. Louis. Sauther, M. L. (1998). Interplay of Phenology and Reproduction in Ring-Tailed Lemurs: Implications for Ring-Tailed Lemur Conservation. Folia Primatologica, 69(Suppl. 1), 309– 320. Sauther, M. L., Cuozzo, F. P., Youssouf Jacky, I., Fish, K., LaFleur, M., Ravelohasindrazana, L., & Ravoavy, J. (2013). Limestone cliff - face and cave use by wild ring-tailed lemurs (Lemur catta) in southwestern Madagascar. Madagascar Conservation & Development, 8(2). Sauther, M. L., Gould, L., Cuozzo, F. P., & O’Mara, M. T. (2015). Ring-Tailed Lemurs: A Species Re-Imagined. Folia Primatologica, 86(1–2), 5–13. Sauther, M. L., Sussman, R. W., & Gould, L. (1999). The socioecology of the ringtailed lemur: thirty-five years of research. Evolutionary Anthropology, 8, 120–132. Schwitzer, C., Mittermeier, R. A., Johnson, S. E., Donati, G., Irwin, M., Peacock, H., … Wright, P. C. (2014). Averting Lemur Extinctions amid Madagascar’s Political Crisis. Science, 343(6173), 842–843. Shepherd, C. R. (2010). Illegal primate trade in Indonesia exemplified by surveys carried out over a decade in North Sumatra. Endangered Species Research, 11(3), 201–205. Simmen, B., Hladik, A., & Ramasiarisoa, P. (2003). Food Intake and Dietary Overlap in Native Lemur catta and Propithecus verreauxi and Introduced Eulemur fulvus at Berenty, Southern Madagascar. International Journal of Primatology, 24(5), 949–968. Simmen, B., Sauther, M. L., Soma, T., Rasamimanana, H. R., Sussman, R. W., Jolly, A., … Hladik, A. (2006). Plant Species Fed on by Lemur catta in Gallery Forests of the Southern Domain of Madagascar. In Ringtailed Lemur Biology Lemur Catta in Madagascar (pp. 55– 68). New York: Springer. Smith, D. A. (2005). Garden Game: Shifting Cultivation, Indigenous Hunting and Wildlife Ecology in Western Panama. Human Ecology, 33(4), 505–537. Sussman, R. W. (1972). An ecological study of two Madagascan primates: Lemur fulvus rufus Audebert and Lemur catta Linnaeus (Doctoral dissertation). Duke University. Sussman, R. W. (1991). Demography and social organization of free-ranging Lemur catta in the Beza Mahafaly Reserve, Madgascar. American Journal of Physical Anthropology, 58, 43–58. Sussman, R. W. (1992). Male life history and intergroup mobility among ringtailed lemurs (Lemur catta). International Journal of Primatology, 13(4), 395–413. Sussman, R. W., Green, G. M., Porton, I., Andrianasolondraibe, O., & Ratsirarson, J. (2003). A Survey of the Habitat of Lemur catta in Southwestern and Southern Madagascar. Primate Conservation, 19(19), 32–57. Sussman, R. W., Sweeney, S., Green, G. M., Porton, I., Andrianasolondraibe, O. L., & Ratsirarson, J. (2006). A Preliminary Estimate of Lemur catta Population Density Using Satellite Imagery. In A. Jolly, R. W. Sussman, N. Koyama, & H. R. Rasamimanana (Eds.), Ringtailed Lemur Biology: Lemur Catta in Madagascar (pp. 16–31). Taberlet, P., Griffin, S., Goossens, B., Questiau, S., Manceau, V., Escaravage, N., … Bouvet, J. (1996). Reliable genotyping of samples with very low DNA quantities using PCR. Nucleic Acids Research, 24(16), 3189–3194. van Oosterhout, C., Hutchinson, W., Wills, D., & Shipley, P. (2004). Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes, 4(3), 535–538. COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 42

Wasser, S. K., Brown, L., Mailand, C., Mondol, S., Clark, W., Laurie, C., & Weir, B. S. (2015). Genetic assignment of large seizures of elephant ivory reveals Africa’s major poaching hotspots. Science, 349(6243), 84–87. Wasser, S. K., Joseph Clark, W., Drori, O., Stephen Kisamo, E., Mailand, C., Mutayoba, B., & Stephens, M. (2008). Combating the illegal trade in African elephant ivory with DNA forensics. Conservation Biology, 22(4), 1065–1071. Weir, B. S., & Cockerham, C. C. (1984). Estimating F-Statistics for the Analysis of Population Structure. Evolution, 38(6), 1358. Yamashita, N. (2002). Diets of Two Lemur Species in Different Microhabitats in Beza Mahafaly Special Reserve, Madagascar. International Journal of Primatology, 23(5), 1025–1051. Zaonarivelo, J. R., Andriantompohavana, R., Shore, G. E., Engberg, S. E., McGuire, S. M., Louis, E. E., & Brenneman, R. A. (2007). Characterization of 21 microsatellite marker loci in the ring-tailed lemur (Lemur catta). Conservation Genetics, 8(5), 1209–1212.

COMBATTING THE ILLEGAL PET TRADE IN L. CATTA 43

1 2 3 3 3 4 4 Reference

----

GenBank GenBank EF093488 EF093489 AF104091 AY366441 AY366442 AY366443 accession no. accession

C) °

48 54 60 60 60 55 58 Annealing Annealing Temp (

6 TG(TC) 4

4 TG(TC) 11 6

(GT) 3 AC(TC)

TT(TC) (AG) 14 21 19 16 9 15 15 ng temperatures, and GenBank accession number of seven accession temperatures,GenBank the ng and Repeat Motif Repeat (GT) (GT) (TC) (TC) (CA) (CA) (CA)

attattgc

tggggcaagttgaatag gtt tagcattgtgattttctgttacatta

Sequence F: atagacatccagagataagg R: ggcacctctagactctgtta F: aatttcaggtatgcgtgt R: F: tgggacaccttttgttatcag R: gatttctcaggacatccatag F: ctttcctgttcttccactcag R: ccacagcctgcg F: acctcccagcctattcacag R: ggagtggggacttgaatagc F: acctccataacataagcacacg R: agccagaataaagtcagggg F: tgtctatgggtgggttttgtc R:

203 151 270 198 178 262 ------126 - Primer size range, sequence, repeat motifs, repeat Primer sequence, range, size anneali Size Size (bp)Range 179 92 127 248 172 156 238

.

2 -

APPENDIX microsatellite markers used. Locus L Efr09 Lc5 Lc6 Lc7 69HDZ267 69HDZ299 et Zaonarivelo (1) al., (3) References: Strobeck;Pastorini 2007 al., (4) 2005; Merenlender,and et (2) Jekielek 1993;