Mast Cell STAT6 IL-4 Induces the Proteolytic Processing Of

Home , STAT5, STAT6

IL-4 Induces the Proteolytic Processing of Mast Cell STAT6 Melanie A. Sherman, Doris R. Powell and Melissa A. Brown This information is current as J Immunol 2002; 169:3811-3818; ; of September 28, 2021. doi: 10.4049/jimmunol.169.7.3811 http://www.jimmunol.org/content/169/7/3811 Downloaded from References This article cites 74 articles, 47 of which you can access for free at: http://www.jimmunol.org/content/169/7/3811.full#ref-list-1

Why The JI? Submit online.

http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on September 28, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

IL-4 Induces the Proteolytic Processing of Mast Cell STAT61

Melanie A. Sherman, Doris R. Powell, and Melissa A. Brown2

IL-4 is a potent, pleiotropic cytokine that, in general, directs cellular activation, differentiation, and rescue from apoptosis. However, in mast cells, IL-4 induces the down-regulation of activation receptors and promotes cell death. Mast cells have been shown to transduce IL-4 signals through a unique C-terminally truncated isoform of STAT6. In this study, we examine the mechanism through which STAT6 is processed to generate this isoform. We demonstrate that STAT6 processing in mast cells is initiated by IL-4-induced phosphorylation and nuclear translocation of full-length STAT6 and subsequent cleavage by a nuclear serine-family protease. The location of the protease in the nucleus ensures that the truncated STAT6 has preferential access to bind DNA. IL-4-responsive target genes in mast cells are identiﬁed by chromatin immunoprecipitation of STAT6, including the IL-4 gene itself. These results suggest a molecular explanation for the suppressive effects of IL-4 on STAT6-regulated genes in mast cells. The Journal of Immunology, 2002, 169: 3811Ð3818. Downloaded from ignal transducer and activator or transcription 6, a latent protein and thus acts relatively late in the STAT6 signaling cas- cytoplasmic transcription factor, is a member of a family cade to inhibit JAK1 and limit the duration of STAT6 activation S of signaling molecules that mediate responses to cyto- (10). Second, alternate isoforms of STAT proteins have been de- kines. IL-4 (and IL-13) binding to its receptor results in the acti- scribed for several STAT family members (11–15). These ␤ iso- vation of Janus kinase (JAK)3 1 and JAK3, receptor-associated forms (identiﬁed for STATs 1, 3, 5A, and 5B) lack the transacti-

tyrosine kinases (1, 2). JAK1 and 3 directly phosphorylate tyrosine vation domain (TAD) but retain DNA binding ability. Therefore, http://www.jimmunol.org/ residues within STAT6 Src homology (SH)2 domains leading to by competing with the transcriptionally active form of STAT for dimerization and translocation to the nucleus where STAT6 can binding to DNA, they effectively inhibit the early transcription of associate with regulatory elements that control IL-4 (and/or IL-13) cytokine-responsive genes. Ϫ Ϫ responsive genes. Numerous studies using STAT6 / mice have The biological significance of STAT isoforms that act as dom- demonstrated the importance of this molecule in providing immu- inant negative transcription factors is clearly evident from studies nological competence (3–5). For example, the STAT6 signaling of STAT5, a signaling molecule activated in response to IL-2, pathway is of particular significance in the development of Th2 IL-3, IL-5, stem cell factor, and IL-15 (16–18). The truncated Ϫ Ϫ immunity to extracellular pathogens. STAT6 / mice are ex- STAT5␤ isoforms are expressed uniquely in myeloid progenitor tremely vulnerable to these infections, and T cells from these mice cells and are responsible for maintaining an IL-3-refractive state by guest on September 28, 2021 are unable to produce adequate amounts of the Th2 cytokines IL-4, (15). Upon differentiation, these cells lose expression of STAT5␤ IL-13, and IL-5 (3–5). B cell isotype switching, immunity to some and express only full-length STAT5, coincident with a gain of IL-3 tumors (6, 7), and development of contact hypersensitivity (8) are responsiveness (19). The truncated STAT5 proteins are generated Ϫ Ϫ also compromised in STAT6 / mice. through proteolysis of full-length STAT5 by a nuclear protease Because IL-4 plays a central role in the regulation of immune found only in immature myelocytes (20). This protease, termed responses, the magnitude and duration of STAT6-induced re- modulator of STAT activity (MSA) is a 25-kDa member of the sponses must be tightly controlled. At least two mechanisms have serine protease family. Its recognition and cleavage site in STAT5 been described to accomplish this regulation. First, suppressor of has been identified, and mutation of this site results in a STAT5 cytokine signaling (SOCS) proteins are up-regulated by cytokine- protein that resists proteolysis (19). induced STAT activation and either compete with STAT for bind- We previously identified a STAT6 isoform that shares charac- ing to receptors or bind to and inhibit JAK kinase activity (re- teristics with the ␤ forms of the other STAT family members (21). viewed by Chen et al. in Ref. 9). SOCS-1 is an IL-4-inducible In contrast to the 100-kDa full-length STAT6 molecule, STAT6␤ is truncated to ϳ65 kDa. Results from epitope mapping studies demonstrate that STAT6␤ lacks the C-terminal TAD, but it ap- Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA ␤ 30322 pears to retain a high affinity for DNA. STAT6 is expressed in a cell type-specific manner and is present in mast cells, but not in B Received for publication June 17, 2002. Accepted for publication July 31, 2002. or T cells. Interestingly, while IL-4-induced STAT6 is associated The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with an activating phenotype in B cells and T cells, it is often with 18 U.S.C. Section 1734 solely to indicate this fact. suppressive for mast cell gene expression. Mast cell receptors c-kit 1 This work was supported by National Institutes of Health Grants AR02157 (to and Fc⑀RI are down-regulated in response to IL-4 stimulation (22– M.A.S.) and CA47992 (to M.A.B.). 24) and the induction of several cytokines is inhibited upon long- 2 Address correspondence and reprint requests to Dr. Melissa A. Brown, 7311 Wood- term IL-4 exposure (23). ruff Memorial Research Building, Department of Pathology and Laboratory Medicine, Emory University, 1639 Pierce Drive, Atlanta, GA 30322. E-mail address: In this study, we set out to 1) characterize the STAT6 protein in [email protected] mast cells with regard to the mechanism of isoform generation, 3 Abbreviations used in this paper: JAK, Janus kinase; SH, Src homology; SOCS, phosphorylation status, and cellular localization, and 2) identify a suppressor of cytokine signaling; TAD, transactivation domain; MSA, modulator of role of STAT6␤ in mast cell gene transcription. We demonstrate STAT activity; BMMC, bone marrow-derived mast cells; USF, upstream stimulatory ␤ ␤ factor; IP, immunoprecipitation; ChIP, chromatin IP; SHP-1, sulfhydryl-2 domain- that analogous to STAT5 , STAT6 is also generated by proteo- containing tyrosine phosphatase-1. lytic processing. Although distinct from STAT5 MSA, the mast

cell STAT6 protease is a member of the serine protease family and ferred to nylon membrane. The blot was blocked in 5% milk/TBST (10 is located in the nucleus. We show that mast cell STAT6 is phos- mM Tris, pH 8.0, 150 mM NaCl, 0.5% Tween) overnight at 4°C. Abs (1 ␮ phorylated in response to IL-4 and binds in vivo to a STAT6 bind- g/ml) were added in 2% milk/TBST (the phospho-STAT6 Ab was diluted in 3% BSA/Tween 20 ϩ TBS) and incubated1hatroom temperature. ing site in the IL-4 promoter in mast cells. Mast cell STAT6 is also HRP-conjugated donkey anti-rabbit secondary Abs (Amersham, Arlington associated with the promoters of apoptosis regulator genes bax and Heights, IL) were added at a 1/5000 dilution in 2% milk/TBST and incu- bcl-2. The restricted expression and binding of this isoform to IL-4 bated1hatroom temperature. Reactive proteins were visualized by ECL responsive genes in mast cells could account for the cell-type spe- (DuPont, Boston, MA) and radiography. cific inhibitory effects of IL-4. Northern blot analysis For analysis of STAT6 expression in cell lines, 10 ␮g of total RNA was Materials and Methods electrophoresed on a 1% formaldehyde gel and transferred to nitrocellu- Cell culture and stimulation lose. The STAT6 DNA probe (bp 1–384 from STAT6 sequence, Accession CFTL-15, a murine IL-3 dependent mast cell line (C15; Ref. 25), WEHI- no. AF481809) was labeled by random hexamer priming. 3B, an immature myeloid cell line (26), and M12.4.1, a transformed B cell RNase protection analysis line (27), were cultured in complete RPMI (10% heat-inactivated FBS, 0.5% penicillin/streptomycin, 2 mM glutamine, 1.0 mM sodium pyruvate, Total RNA samples from C15 and M12 cell lines were isolated using the 50 ␮M 2-ME). C15 culture medium also contained 25% WEHI-3B super- RNA-STAT-60 reagent according to the manufacturer’s instructions (Tel- natant as a source of IL-3, a crucial growth factor for mast cells (26). Test, Friendswood, TX). RNase protection assays were performed using DO11.10 cells (OVA-specific T cells; Ref. 28) were stimulated with four different STAT6 cDNA fragments as templates for the synthesis of 4 ␮ 32 BALB/c spleen cells, IL-2 (10 U/ml), and OVA323–339 peptide (0.5 M) antisense RNA labeled with [ P]UTP (Riboprobe kit; Promega, Madison, every 7–10 days. Bone marrow-derived mast cells (BMMC) were har- WI). The probes correspond to the following sequences of STAT6 cDNA, Downloaded from vested from BALB/c mice (The Jackson Laboratory, Bar Harbor, ME) and GenBank accession no. AF481809: probe 1, bp 1718–2392; probe 2, bp Ϫ Ϫ STAT6 / BALB/c mice (The Jackson Laboratory) (4) and were differ- 2093–2392; probe 3, bp 2422–2887; probe 4, bp 2134–2463. Full-length entiated with 25% WEHI-3B supernatant. BMMC were used after 4 wk in RNA probes were gel-purified and hybridized (5 ϫ 105 cpm) to 10 ␮gof culture at Ͼ90% purity as determined by FACS analysis (FACScan; BD total RNA overnight at 45°C in 40 mM PIPES, pH 6.4, 400 mM NaCl, 1 Biosciences, Mountain View, CA) of c-kit and Fc⑀RI expression. To in- mM EDTA, and 80% formamide in a total volume of 30 ␮l. Samples were duce STAT6 activation, cells were stimulated with rIL-4 (a kind gift of C. incubated for1hat30°C after the addition of 350 ␮l of digestion buffer (10 ␮ Watson and W. E. Paul, National Institutes of Health, Bethesda, MD) at mM Tris, pH 7.5, 5 mM EDTA, 300 mM NaCl, 0.14 g of RNase T1, and http://www.jimmunol.org/ 10,000 U/ml for 15 min at 37°C. 1 ␮g of RNase A). Proteinase K (50 ␮g) and SDS (10 ␮l of 20% solution) were added and incubated for an additional 30 min at 37°C. Samples were Cell extract preparation extracted with phenol/chloroform, precipitated, resuspended in gel loading BMMC whole cell extracts were prepared in the presence of high concen- buffer, and analyzed by 6% denaturing PAGE. trations of protease inhibitors (Roche, Indianapolis, IN) according to the Chromatin immunoprecipitation (ChIP) assays published protocol (29). Briefly, after treatment with IL-4 (15 min at 37°C), cells were pelleted, washed in PBS, resuspended in lysis buffer (50 Formaldehyde cross-linked chromatin was prepared from 4 ϫ 106 cells for mM Tris, pH 8.0, 0.5% Nonidet P-40, 200 mM NaCl, 10% glycerol, 0.1 each sample. Abs (5 ␮g per immunoprecipitation (IP) sample) were pre- mM EDTA, 1.0 mM DTT, 100 ␮M sodium orthovanadate, and protease cleared with 40 ␮g each sonicated salmon sperm DNA and yeast tRNA in ␮ inhibitors), and incubated for 60 min on ice. Following high-speed micro- 900 l IP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, by guest on September 28, 2021 centrifugation at 4°C (13,000 rpm) (model 5522; Forma Scientific, Mari- 16.7 mM Tris-HCl, pH 8.0, 167 mM NaCl) for 15 min at 4°C on a rocking etta, OH), supernatants were collected and protein concentration was de- platform. Chromatin (100 ␮l; one-fifth of the original sample) was added termined by the Bradford procedure (Ref. 30; Bio-Rad, Hercules, CA). to the Ab solution for a further 2-h incubation at 4°C. Protein A/G agarose Nuclear extracts were prepared following the procedure of Fiering et al. beads (Santa Cruz Biotechnology) were simultaneously pretreated with (31). Briefly, cells were harvested and washed once in ice-cold PBS and yeast tRNA (for each sample, 20 ␮l beads and 200 ␮g yeast tRNA). The once in cold buffer A (10 mM HEPES, pH 7.8, 15 mM KCl, 2 mM MgCl2, pretreated beads were added to the Ab/chromatin mixture and incubated for 1 mM DTT, 0.1 mM EDTA, 1ϫ protease inhibitors). Cells were then lysed an additional hour at 4°C. The beads were washed extensively: three times in buffer B (buffer A plus 0.2% Nonidet P-40) on ice for 5 min with with IP dilution buffer, three times with 1ϫ dialysis buffer (2 mM EDTA, vortexing. Nuclei were pelleted by high-speed microcentrifugation and the 50 mM Tris-HCl, pH 8.0, 0.2% Sarkosyl), three times with IP wash buffer supernatant was saved as the “cytosolic fraction.” Pelleted nuclei were (100 mM Tris-HCl, pH 9.0, 500 mM LiCl, 1% Nonidet P-40, 1% deoxy- resuspended in buffer C (50 mM HEPES, pH 7.8, 50 mM KCl, 0.1 mM cholic acid), and once with 10 mM Tris 0.1 mM EDTA. The Ab complexes EDTA, 1 mM DTT, 10% (v/v) glycerol, 1ϫ protease inhibitors; Roche) were eluted with 150 ␮l elution buffer (50 mM NaCO, 1% SDS), rocking and 10% volume of3M(NH4)2SO4, pH 7.9, was added for a final con- the tubes for 5 min at room temperature. The beads were pelleted and the centration of 0.3 M (NH4)2SO4. After a 30-min incubation on a rotating elution was repeated, pooling eluates (300 ␮l total). The cross-links were platform, the sample was centrifuged at 200,000 ϫ g for 15 min. An equal reversed by adding 1 ␮g RNase and 17.6 ␮l 5 M NaCl to each sample and volume of3M(NH4)2SO4 was added to the supernatant, and precipitated heating to 67°C for at least 4 h. The DNA was then precipitated and re- proteins were pelleted at 100,000 ϫ g for 10 min. The proteins were resuspended in 125 ␮l1ϫ proteinase K buffer (50 mM Tris-HCl, pH 7.5, 25 suspended in 100 ␮l buffer B per 108 cell equivalents and used for mixing mM EDTA, 1.25% SDS) with 20 ␮g proteinase K. The DNA was phenol/ experiments with M12 B cells or stored at Ϫ80°C. chloroform extracted and then precipitated with 20 ␮g glycogen as a car- To prepare SDS lysates, cells were pelleted and washed once with cold rier. The DNA was resuspended in 50 ␮l 10 mM Tris 0.1 mM EDTA and PBS. The cell pellet was then suspended directly in 1ϫ SDS-PAGE load- 1 ␮l (or 10-fold dilutions) was used for PCR analysis. Conditions for PCR ing buffer (58 mM Tris-HCl, pH 6.8, 5% (v/v) glycerol, 1.6% SDS, 1.5% were 40 cycles (94°C for 30 s, 50°C for 30 s, 72°C for 1 min) using DTT, 0.002% bromophenol blue) at the ratio of 2500 cells to 1 ␮l buffer. HotStarTaq (Qiagen, Valencia, CA). PCR primers: IL-4 promoter The viscous lysate was then sonicated (4 ϫ 1 s pulses on power setting 3) (forward): GTGGCAACCCTACGCTGATAAG; (reverse): GCTAACA (Sonic Dismembrator Model 100; Fisher Scientific, Pittsburgh, PA) and ATGCAATGCTGGCAG; IL-4 intron (forward): GGATCCTGCAGGA frozen at Ϫ80°C. CATCTCTCTTCCCTTTC; (reverse): CATTCTGCATCAGACTCCTG For each gel lane, 50 ␮g protein (for extracts) or 5 ϫ 103 cell equiva- GAG; bax promoter (forward): GCTAGGCCCTGCTGGTGTG; (reverse): lents (for SDS lysates) were used for Western blot analysis. TTCGTTCATTGCTGGTGGCTCTCA; bcl-x promoter(forward): AGCT GGCTGGTCCTTTCAA; (reverse): GGGCTCAACCAGTCCATT; bcl-2 Western blot analyses promoter (forward): AACCCTCCCCCACCACCTCCTTCT; (reverse): Western blot analyses were performed with rabbit polyclonal anti-STAT6 CCTTCTTCTCGGCAATTTACACTT. Abs raised against the C-terminal domain (M20X; Santa Cruz Biotechnol- ogy, Santa Cruz, CA), the DNA-binding domain (M200X; Santa Cruz Bio- Results technology), or the phosphorylated tyrosine 641 of murine STAT6 (Cell STAT6␤ is induced by IL-4 treatment of mast cells Signaling, Beverly, MA) and rabbit polyclonal anti-JAK3 and anti- upstream stimulatory factor (USF; Santa Cruz Biotechnology). Cell ex- In previous studies we established that mast cells express both a tracts (20 ␮g) were electrophoresed on a 10% SDS-PAGE gel and trans- 100- and a 65-kDa isoform of STAT6, and it is the smaller form The Journal of Immunology 3813 that preferentially binds DNA in vitro (21). Because STAT6 re- quires activation by IL-4 signaling to dimerize, translocate to the nucleus, and bind DNA, we sought to determine the relationship between the 65-kDa isoform (herein referred to as the ␤ form of STAT6) and IL-4 activation of mast cells. BMMCs, as well as B cells and WEHI-3B myeloid cells, were treated with IL-4 for 2 h before cell lysis. To denature any proteases that could result in artifactual proteolysis during the extract procedure, cells were directly lysed in 1ϫ SDS-PAGE sample buffer. The extracts were analyzed by Western blot using M200, an Ab that detects both full-length and ␤ forms of STAT6. As shown in Fig. 1, IL-4 treatment increases the presence of the ␤ form in mast cells, but not in B cells or WEHI-3B.

STAT6␤ is phosphorylated on Y641 and translocates to the nucleus in response to IL-4 STAT6 typically resides in the cytoplasm of resting cells, possibly associated with scaffolding proteins (32). IL-4-induced activation leads to phosphorylation of Y641, translocation of STAT6 to the Downloaded from nucleus, and subsequent DNA binding (33–35). Using a commer- cially available Ab speciﬁc for the Y-641 epitope in Western blot analysis, we observed rapid phosphorylation of STAT6␤ upon exposure of the mast cells to IL-4 (Fig. 2A). Phosphorylation per- sisted over a 24-h period (Fig. 2B), similar to the long kinetics observed in B cells (33). Cytoplasmic and nuclear fractions were http://www.jimmunol.org/ also isolated and examined for the presence of STAT6␤. As shown in Fig. 2C, after IL-4 treatment of mast cells, the STAT6 isoform is located primarily in the mast cell nucleus, consistent with its phosphorylated state. These results indicate that STAT6␤ is subject to phosphorylation and can translocate to the nucleus in a manner similar to the full-length protein.

STAT6 is proteolytically processed in mast cells by guest on September 28, 2021 STAT5 isoforms are proteolytically processed in immature my- FIGURE 2. STAT6␤ is phosphorylated and located in the mast cell nu- eloid cells by MSA, a serine family protease that is located in the cleus. A, Mast cells and B cells were left untreated (Ϫ) or treated with IL-4 nucleus (36). Due to the rapid kinetics of STAT6␤ expression, its for 15 min before extract preparation (ϩ). Western blot analysis was performed using an Ab speciﬁc for phosphorylated Y641 of STAT6. B, Mast cells were treated with IL-4 for the indicated times before whole cell lysis with Nonidet P-40 and Western blot analysis with the phospho-STAT6- speciﬁc Ab. C, Mast cells and B cells were treated with IL-4 for 15 min before cell membrane lysis by 0.2% Nonidet P-40. The nuclei were pelleted, washed, and lysed in ammonium sulfate buffer. The cytoplasmic (C) and nuclear (N) fractions were analyzed for STAT6 (using the pan M200 STAT6 Ab), JAK3 (as a marker for the cytoplasmic fraction), and the transcription factor USF (as a marker for the nuclear fraction).

induction by IL-4 treatment, and its nuclear location, we consid- ered the possibility that STAT6␤ could be generated by a similar mechanism in mast cells. To address this possibility, mast cells were cultured for 16 h with a protease inhibitor mixture. After confirming cell viability, whole cell extracts were prepared. As shown in Fig. 3, the addition of protease inhibitors to live cells prevents the generation of the truncated STAT6 protein, indicating that the generation of the truncated STAT6 molecule is an active and specific process that occurs in viable cells. In contrast, simply increasing the concentration of protease inhibitors (up to five times the recommended dose) in the lysis buffer when preparing mast cell extracts does not prevent the appearance of STAT6␤ (37), FIGURE 1. A, IL-4-induced expression of STAT6␤ in mast cells. Rest- because the STAT6 protein is processed in live mast cells before ing (lane 1) or IL-4 treated (lane 2) BMMC were lysed directly in 1ϫ SDS-PAGE sample buffer. Samples (5 ϫ 104 cell equivalents) were analysis. lyzed by Western blot with the Ab M200, which is specific for the central Mast cells also were preincubated with individual protease in- domain of STAT6. B, The STAT6␤ isoform is mast cell-specific. Extracts hibitors before IL-4 treatment and cell lysis to determine the class were prepared from IL-4-treated M12 B cells, WEHI-3B myeloid cells, and of protease that acts on STAT6. Treatment with a mixture of pro- BMMC by direct lysis in 1ϫ SDS-PAGE sample buffer. tease inhibitors or with 1 mM PMSF and 1 mM EDTA, but not 3814 MAST CELL STAT6 PROTEASE Downloaded from

FIGURE 3. Culture of live mast cells with protease inhibitors inhibits STAT6␤ expression. A, BMMC and M12 B cells remained untreated (Ϫ) or were cultured with 1ϫ protease inhibitor mixture for 16 h before whole cell Nonidet P-40 lysis (ϩ). B, BMMC were cultured with either a mixture of all or each individual protease inhibitor using the following concentra-

tions: 1 mM EDTA, 1 mM PMSF, 1 ␮g/ml leupeptin, 3 ␮g/ml aprotinin, http://www.jimmunol.org/ and/or 2 ␮g/ml pepstatin A for 16 h. Whole cell extracts were analyzed for STAT6␤ by Western blot with the pan STAT6 M200 Ab (Santa Cruz Biotechnology).

leupeptin, aprotinin or pepstatin A, inhibits the generation of ␤ FIGURE 4. Evaluation of mast cell RNA for alternative STAT6 tran- STAT6 (Fig. 3B). Thus, the STAT6 protease (like STAT5 MSA) scripts. A, Total RNA (10 ␮g) from resting or PMA/ionomycin-stimulated appears to be a member of the serine protease family. Of note, C15 mast cells and DO11.10 T cells was used in Northern blot analysis by guest on September 28, 2021 STAT6 does not contain the MSA recognition and cleavage se- with a STAT6 probe (bp 257–642 of STAT6 cDNA). B, Total RNA (10 ␮g) quence (ATY*MDQA) (20). In addition, MSA does not appear to from resting M12 B cells (B) and C15 mast cells (M) was incubated with cleave STAT6 (38), and STAT5 remains intact in mast cells (21, four different riboprobes from the 3Ј STAT6 sequence. Only one major 37). Taken together, these data indicate that the mast cell STAT6 product was detected in the samples for each probe used. protease and STAT5 MSA are distinct proteins. STAT1␤ and STAT3␤ are generated by alternative RNA splic- teolytic activity. Incubation with the insoluble (uncleared) nuclear ing (11–13) and STAT5 RNA can be processed to yield a truncated fraction and the whole cell extract, but not the cytoplasmic frac- ␤ form as well (14). To address the possibility that RNA process- tion, leads to the generation of STAT6␤ (Fig. 5B). Freeze-thawing ing may also contribute to the generation of STAT6 isoforms, we the extracts or including PMSF/EDTA in the lysis buffer inhibits analyzed mast cell STAT6 transcripts by Northern blot analysis the STAT6 protease (Fig. 5A and data not shown). The results (Fig. 4A). RNase protection assays were also performed using four demonstrate that the proteolytic activity is localized in the nucleus distinct probes (Fig. 4B). Only a single STAT6 mRNA species was of mast cells. Furthermore, STAT6 does not have to be activated detected in mast cells using both analyses. These results support (phosphorylated) to be processed by the STAT6 protease. This the idea that the generation of the STAT6␤ protein is solely due to conclusion is based on the fact that STAT6 derived from resting B nuclear proteolytic processing in mast cells. cells can be cleaved. The compartmentalization of the STAT6␤ isoform in the nucleus explains why both full-length and truncated ␤ STAT6 and the STAT6 protease colocalize in the mast cell STAT6 are observed in whole mast cell extracts (Fig. 3B and Refs. nucleus 21 and 37). We demonstrate that STAT6␤ is enriched in nuclear fractions and ␤ previous studies show that STAT5 MSA resides in the nucleus of STAT6 binds to the mast cell IL-4 promoter in vivo myeloid progenitors (20). To determine whether the STAT6 pro- We have previously postulated that STAT6␤ is involved in neg- tease is also a nuclear protein, we examined the ability of isolated atively regulating mast cell IL-4 production. A STAT6 binding site mast cell fractions to generate the truncated STAT6␤ using B cell is present in the IL-4 proximal promoter, and mutational studies STAT6 as a source of the full-length protein. STAT6-deficient have demonstrated that it confers transcriptional repression (39). BMMC were used in these experiments to avoid contributions STAT6 binding to this element could act to limit IL-4 transcription from mast cell-derived STAT6 isoforms. Intact mast cells and B by interfering with positive transcriptional activators such as cells were mixed together in a 1:1 ratio in the absence of protease NFAT (40, 41). Alternatively, preferential binding of STAT6␤, inhibitors during extract preparation. Extracts were analyzed by which presumably lacks the ability to transactivate because of the Western blot using the M200 Ab. As shown in Fig. 5A, full-length truncation of the parent protein, may directly interfere with tran- STAT6 is cleaved by a mast cell protease. Mast cell extracts were scription. EMSA analysis has demonstrated that STAT6␤ prefer- then fractionated before mixing with B cells to localize the pro- entially associates with the IL-4 promoter STAT6 site in vitro (21). The Journal of Immunology 3815 Downloaded from FIGURE 5. The STAT6 protease is located in the mast cell nucleus. A, Resting M12 B cells were lysed in the absence or presence (1:1 ratio) of STAT6Ϫ/Ϫ BMMC extracts. One mixture sample contains protease inhibitors, which block STAT6 processing. IL-4-treated wild-type BMMC are included for size comparison. B, Resting M12 B cells were lysed in the presence of fractionated STAT6Ϫ/Ϫ BMMC extracts (whole cell, cytoplasmic, or nuclear fractions). Mixed extracts were analyzed for STAT6 pro- http://www.jimmunol.org/ tein by Western blot with the pan-STAT6 Ab M200. FIGURE 6. Specific in vivo binding of STAT6 to IL-4-responsive genes in mast cells. A, In vivo binding of STAT6 to the IL-4 promoter in resting BMMC, M12 B cells, and DO11.10 Th1 and Th2 cells was assessed by To test the ability of STAT6 to bind to the IL-4 promoter in vivo, ChIP. Formaldehyde cross-linked DNA-protein complexes were immuno- ChIP experiments were performed with mast cell chromatin and precipitated with control rabbit IgG (Ϫ) or the STAT6-specific antisera ϩ Ϫ ϩ STAT6 antisera. Mast cell chromatin precipitated with anti- M200 ( ). IL-4 PCR primers amplify the 291 to 11 region of the STAT6 but not normal rabbit IgG yields PCR-amplified IL-4 pro- proximal IL-4 promoter (upper panels) and 353 bp of a BglII fragment of the intron between exons 1 and 2 (44). As a control to show that the moter fragments (Fig. 6A, upper panels). This finding indicates

samples from each cell type contain equivalent amounts of target DNA, by guest on September 28, 2021 that STAT6 binds to the IL-4 proximal promoter sequences in vivo PCR was also performed on the immunoprecipitation supernatants (“total in mast cells. STAT6 was not associated with this site in B cells, input chromatin”). B, ChIP analysis of BMMC stimulated for 2 h with IL-4 Th1, or Th2 cells, a result consistent with our previous observa- alone (lanes 1 and 2) or IL-4 plus the calcium ionophore ionomycin, which tions that IL-4 transcription in mast cells uses cell-specific regu- induces IL-4 transcription (lanes 3 and 4). Immunoprecipitated DNA and latory mechanisms (39, 42, 43). As a control, PCR was also per- the IP supernatants (“total input chromatin”) were amplified using IL-4 formed using primers for the IL-4 second intron, which contains a promoter-specific primers. C, ChIP analysis of IL-4-treated BMMC with binding site for STAT5 (44). This region was not amplified from primers specific for the promoters of apoptosis regulator proteins bcl-2, bax STAT6-associated chromatin (Fig. 6A, lower panels), suggesting and bcl-x. that STAT6 is specifically associated with the promoter element of the IL-4 gene. In addition, stimulation of the mast cells with iono- proposed by others (45, 46) that STAT6 can regulate apoptosis in mycin (which activates IL-4 transcription) appears to result in de- mast cells. creased STAT6 binding to the IL-4 promoter (Fig. 6B, lanes 3 and The STAT6-specific antisera used in these ChIP experiments 4), a finding that supports the hypothesis that the STAT6 isoform can associate with both full-length and truncated STAT6, and a acts as a negative repressor. STAT6 isoform-specific Ab does not yet exist. Therefore, we can- Finally, we also examined STAT6 involvement in apoptosis not definitively demonstrate that the STAT6␤ isoform (rather than gene regulation in mast cells. Recently, STAT6 has been impli- full-length STAT6) is associated with mast cell chromatin. How- cated in induction of mast cell apoptosis through IL-4/IL-10 co- ever, the STAT6 isoform is the predominant species in the mast signaling (45) and protection of mast cell apoptosis through IL-15 cell nucleus (Fig. 2), and the isoform preferentially binds DNA in signaling (46). The ratio of anti-apoptotic proteins (such as bcl-2 vitro despite the presence of full-length STAT6 (21). To provide and bcl-x) to proapoptotic proteins (such as bax and bad) can de- further evidence for the idea that STAT6␤ preferentially binds termine the probability of a cell’s survival (reviewed by Zornig et STAT6-regulated genes in mast cells in vivo, parallel immunopre- al. in Ref. 47). Three of these genes (bcl-2, bcl-x, and bax) have cipitations were performed using two STAT6 Abs: M200X, which been shown to regulate mast cell apoptosis (45, 46, 48). Thus, binds both full-length and truncated STAT6␤, and M20X, which ChIP was performed on chromatin from IL-4-stimulated mast cells associates with full-length STAT6 only (21). As shown in Fig. 7, using the STAT6 Ab M200 and primers specific for the apoptosis both samples resulted in amplification of the IL-4 promoter se- genes bcl-2, bcl-x, and bax. As shown in Fig. 6C, we observed no quence, suggesting that both full-length and truncated STAT6␤ are detectable STAT6 binding to the bcl-x promoter, a region that does present in the mast cell nucleus. However, dilutions of the immu- contain one consensus STAT6 site and can bind STAT6 in vitro noprecipitated chromatin material demonstrated that the M200- (46). However, we did observe STAT6 binding to the proapoptotic associated sample contains at least 10-fold more template, consis- gene bax, and to the prosurvival gene bcl-2. The demonstration of tent with our Western blot analysis (Fig. 2C) showing that most of in vivo binding of STAT6 to these genes supports the hypothesis the STAT6 protein in the nucleus is processed to the ␤ isoform. 3816 MAST CELL STAT6 PROTEASE

suppresses STAT6 activation in B cells but does not affect mast cell STAT6 (55), possibly due to the loss of a SHP-1 recognition site in the truncated STAT6␤ molecule. These features of the STAT6␤ isoform and its differential regulation are consistent with the known effects of IL-4 signaling in mast cells. In cell types where the full-length STAT6 protein is expressed, IL-4 exerts positive effects on differentiation and effector function. For example, in B cells, IL-4 induces expression of class II MHC Ags, Ig isotope switching, and proliferation. Endothelial cells induce VCAM-1 expression (56) when exposed to IL-4. The differentiation of CD4ϩ T cells to Th2 cells, a pathway essential for effective immune responses to extracellular pathogens, is also dependent on IL-4 (reviewed by Nelms et al. in Ref. 57). However, IL-4 acts to sup- press the expression of several mast cell genes. Long-term expo- FIGURE 7. Comparison of chromatin associated with full-length sure to IL-4 induces the down-regulation of Fc⑀RI and c-kit ex- STAT6 (M20 Ab immunoprecipitation) and full-length STAT6 plus pression and significantly reduces the activation-dependent STAT6␤ (“pan” M200 Ab immunoprecipitation). Chromatin from IL-4- expression of IL-4, IL-5, IL-13, and IL-6. (22–24). The dominant- treated BMMC was immunoprecipitated with M20, M200, and control rab- negative STAT6 isoform may play a direct role in this process. bit antiserum and analyzed by PCR with IL-4 promoter-specific primers. We have postulated that mast cell IL-4 expression is regulated Downloaded from Template material was serially diluted 10-fold before PCR analysis. through a negative feedback mechanism (37). Previous data from our laboratory confirms that the STAT6 binding site in the IL-4 promoter acts as a negative regulatory element (39), and work by Discussion others has shown that IL-4 signaling induces a down-regulation of In this study, we demonstrate that a C-terminally-truncated iso- further IL-4 expression by activated mast cells (23). Our demon- form of STAT6, termed STAT6␤, is generated by posttranslational stration that STAT6 binds to the IL-4 promoter in mast cells in http://www.jimmunol.org/ processing in mast cells and is associated with the promoter of the vivo provides further data to support this hypothesis. We did not IL-4, bax, and bcl-2 genes in vivo. Although both STAT6 isoforms detect STAT6 binding to the IL-4 promoter in B cells or Th1 cells, exist in mast cells, it is the full-length STAT6 that predominates in consistent with the “closed” conformation of the IL-4 gene in these resting cells. We propose that IL-4 interaction with its receptor non-IL-4-producing cell types (58). We also did not detect STAT6 activates the conventional JAK-STAT signaling pathway in mast binding to the IL-4 promoter in Th2 cells, however, a recent report cells. The full-length molecule is phosphorylated on tyrosine 641, using ChIP analysis demonstrated that STAT6 does bind to the dimerizes, and translocates to the nucleus where it is subject to IL-4 promoter in Th2 cells after IL-4 stimulation (59). The differ- proteolysis by a protease sequestered in the nucleus giving rise to ence in our results may reflect the fact that our chromatin was STAT6␤. Thus, the generation of STAT6␤ is dependent on IL-4- derived from resting Th2 cells and Avni et al. (59) used IL-4 by guest on September 28, 2021 induced nuclear translocation. treated Th2 cells, which would induce STAT6 binding to DNA. This model can account for the apparently conflicting data pre- Of particular interest is our finding that STAT6 associates with viously reported by other groups. Suzuki et al. (49) observed that the proximal IL-4 promoter in resting, but not activated, mast cells. the 65-kDa STAT6 isoform is phosphorylated by IL-4 treatment of As mentioned above, mast cells continuously produce and release mast cells. Conversely, Masuda et al. (50) did not detect the small amounts of IL-4 that may result in a low level of STAT6␤ STAT6 isoform in resting MC/9 mast cells or BMMC and proin the nucleus. Powerful cell stimulation (such as the ionophore posed that the use of a different lot of M200 Ab in Western blot used in our studies) may recruit strong transactivators of IL-4, such analysis may be responsible for failure to detect STAT6␤. How- as NFAT, which could displace STAT6␤ on the IL-4 promoter. ever, without exposure to IL-4, MC/9 mast cells and BMMC We propose that the binding of STAT6␤ to the promoter limits would not express appreciable amounts of STAT6␤. Notably, active transcription in resting cells and may regulate the duration small amounts of STAT6␤ are sometimes detected in our resting of IL-4 production after cell activation. Thus, STAT6 could facil- mast cell lysates. This may be a result of a procedural artifact that itate a negative feedback response in mast cells. This response may allows the protease access to STAT6 during cell lysis. Alterna- be important physiologically during the generation of Th cell re- tively, resting mast cells can express and release small amounts of sponses where early sources of IL-4, such as those from mast cells, IL-4 (51), thus activating STAT6 in a subset of cells. Regardless, can drive Th2 cell differentiation. Timely suppression of mast cell our results clearly show that mast cell exposure to IL-4 is neces- IL-4 may regulate the magnitude of the Th2 response. Consistent sary for optimal STAT6␤ generation. Interestingly, in vivo admin- with this idea, Morris et al. (60) recently showed that treatment of istration of IL-4 induces the appearance of activated STAT6␤ in mice with IL-4 before Ag challenge induces a rapid increase in murine lymph nodes (52). Although the cellular source of this IFN-␥ and a suppression of Th2 cytokines. This finding is sup- STAT6 was not identified in this study, mast cells have been dem- portive evidence that a negative IL-4 feedback loop does exist onstrated to be present in lymph nodes after immunologic stimu- in vivo. lation (53). Given the predominance of STAT6␤ in IL-4-activated mast The C terminus of STAT6, a region containing a defined TAD cells, it is not clear how STAT6 can positively affect gene expres- (54), is absent in STAT6␤. Yet DNA binding activity is retained, sion in these cells. Some insight into this question may be gleaned suggesting that this molecule may act as a dominant-negative reg- from studies of the effect of IL-4 on mast cell apoptosis. The mech- ulator of transcriptional activity by binding to the regulatory ele- anisms that regulate mast cell programmed cell death are distinct ments of STAT6-regulated genes and blocking the binding and/or from those that control lymphocyte apoptosis in several ways: 1) action of positive-acting transcription factors. The regulation of IL-4 alone does not protect mast cells from apoptosis (61, 62) as STAT6 by the phosphatase sulfhydryl-2 domain-containing ty- it does in B and T cells (63–70); 2) a combination of signals re- rosine phosphatase-1 (SHP-1) is also unique in mast cells: SHP-1 sulting from exposure to both IL-4 and IL-10 induces genes that The Journal of Immunology 3817 promote apoptosis, events that are STAT6-dependent (45), and 3) 5. Shimoda, K., J. van Deursen, M. Y. Sangster, S. R. Sarawar, R. T. Carson, IL-15 (which in most cell types activates STAT5) protects mast R. A. Tripp, C. Chu, F. W. Quelle, T. Nosaka, D. A. Vignali, et al. 1996. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted cells from apoptosis through STAT6 induction of the bcl-x gene Stat6 gene. Nature 380:630. (46). These data indicate that mast cell STAT6 does play a positive 6. Ostrand-Rosenberg, S., M. J. Grusby, and V. K. Clements. 2000. Cutting edge: STAT6-deficient mice have enhanced tumor immunity to primary and metastatic role in apoptosis gene regulation, but only if STAT6 is activated mammary carcinoma. J. Immunol. 165:6015. through another receptor (IL-15) or if STAT6 is induced coinci- 7. Kacha, A. K., F. Fallarino, M. A. Markiewicz, and T. F. Gajewski. 2000. Cutting dent with other cytokine signals. Other studies have also revealed edge: spontaneous rejection of poorly immunogenic P1.HTR tumors by Stat6- deficient mice. J. Immunol. 165:6024. instances where the negative effects of IL-4 on mast cell gene 8. Yokozeki, H., M. Ghoreishi, S. Takagawa, K. Takayama, T. Satoh, I. Katayama, transcription are abrogated if other cytokine signaling pathways K. Takeda, S. Akira, and K. Nishioka. 2000. Signal transducer and activator of are activated simultaneously. For example, if mast cells are ex- transcription 6 is essential in the induction of contact hypersensitivity. J. Exp. Med. 191:995. posed to both IL-4 and IL-6 or stem cell factor, the cells proliferate 9. Chen, X. P., J. A. Losman, and P. Rothman. 2000. SOCS proteins, regulators of and express Th2 cytokines (71). Thus, the mast cell-specific intracellular signaling. Immunity 13:287. STAT6 protease may act to render mast cells insensitive to IL-4- 10. Losman, J. A., X. P. Chen, D. Hilton, and P. Rothman. 1999. Cutting edge: SOCS-1 is a potent inhibitor of IL-4 signal transduction. J. Immunol. 162:3770. induced gene activation alone. Only through costimulation of mast 11. Caldenhoven, E., T. B. van Dijk, R. Solari, J. Armstrong, J. A. Raaijmakers, cells or alternative pathways of STAT6 activation will STAT6 J. W. Lammers, L. Koenderman, and R. P. de Groot. 1996. STAT3␤, a splice mediate gene activation in mast cells. Our preliminary experiments variant of transcription factor STAT3, is a dominant negative regulator of transcription. J. Biol. Chem. 271:13221. show in vivo binding of mast cell STAT6 to the promoter of the 12. Schindler, C., X. Y. Fu, T. Improta, R. Aebersold, and J. E. Darnell, Jr. 1992. apoptotic genes bax and bcl-2 after IL-4 treatment alone. It will be Proteins of transcription factor ISGF-3: one gene encodes the 91- and 84-kDa interesting to determine whether STAT6 can be induced to bind to ISGF-3 proteins that are activated by interferon ␣. Proc. Natl. Acad. Sci. USA Downloaded from 89:7836. other promoters, such as bcl-x, upon IL-15 treatment. Also, the 13. Shuai, K., G. R. Stark, I. M. Kerr, and J. E. Darnell, Jr. 1993. A single phos- long-term effects of cytokine signaling (such as IL-10 treatment) photyrosine residue of Stat91 required for gene activation by interferon-␥. Sci- on the activity of the STAT6 protease may also reveal clues as to ence 261:1744. 14. Wang, D., D. Stravopodis, S. Teglund, J. Kitazawa, and J. N. Ihle. 1996. Natu- the mechanism of STAT6 gene activation and repression in mast rally occurring dominant negative variants of Stat5. Mol. Cell. Biol. 16:6141. cells. 15. Azam, M., C. Lee, I. Strehlow, and C. Schindler. 1997. Functionally distinct isoforms of STAT5 are generated by protein processing. Immunity 6:691. There are several parallels that can be drawn between the http://www.jimmunol.org/ 16. Azam, M., H. Erdjument-Bromage, B. L. Kreider, M. Xia, F. Quelle, R. Basu, STAT5 and STAT6 ␤ isoforms. Both are expressed in a cell-spe- C. Saris, P. Tempst, J. N. Ihle, and C. Schindler. 1995. Interleukin-3 signals cific manner, and both are generated by a serine-family nuclear through multiple isoforms of Stat5. EMBO J. 14:1402. protease. Recently, it was shown that differentiation of myeloid 17. Mui, A. L., H. Wakao, A. M. O’Farrell, N. Harada, and A. Miyajima. 1995. Interleukin-3, granulocyte-macrophage colony stimulating factor and interleu- precursors with GM-CSF causes the loss of STAT5 protease ex- kin-5 transduce signals through two STAT5 homologs. EMBO J. 14:1166. pression and recovery of their ability to respond to IL-3 (19). Ec- 18. Johnston, J. A., C. M. Bacon, D. S. Finbloom, R. C. Rees, D. Kaplan, K. Shibuya, J. R. Ortaldo, S. Gupta, Y. Q. Chen, J. D. Giri, et al. 1995. Tyrosine phosphor- topic expression of STAT5 cleavage site mutant proteins prevent ylation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and the maturation of myelocytes, indicating that MSA and STAT5␤ 15. Proc. Natl. Acad. Sci. USA 92:8705. are crucial for regulating differentiation in these cells (20). There 19. Piazza, F., J. Valens, E. Lagasse, and C. Schindler. 2000. Myeloid differentiation

of FdCP1 cells is dependent on Stat5 processing. Blood 96:1358. by guest on September 28, 2021 is a correlation between expression of the truncated STAT5 and 20. Lee, C., F. Piazza, S. Brutsaert, J. Valens, I. Strehlow, M. Jarosinski, C. Saris, and resistance to apoptosis (72) and relapse of acute myeloid leukemia C. Schindler. 1999. Characterization of the Stat5 protease. J. Biol. Chem. 274: (38, 73), suggesting that the MSA protease is important in myeloid 26767. 21. Sherman, M. A., V. H. Secor, and M. A. Brown. 1999. IL-4 preferentially acti- homeostasis. Mast cells are known for their ability to adapt their vates a novel STAT6 isoform in mast cells. J. Immunol. 162:2703. phenotype to their surroundings, so it will be important to deter- 22. Mirmonsef, P., C. P. Shelburne, C. Fitzhugh Yeatman II, H. J. Chong, and mine whether mast cells can similarly be induced to lose STAT6 J. J. Ryan. 1999. Inhibition of kit expression by IL-4 and IL-10 in murine mast cells: role of STAT6 and phosphatidylinositol 3Ј-kinase. J. Immunol. 163:2530. protease activity under growth conditions with select cytokines, 23. Ryan, J. J., S. DeSimone, G. Klisch, C. Shelburne, L. J. McReynolds, K. Han, leading to a unique IL-4-responsive phenotype in different tissue R. Kovacs, P. Mirmonsef, and T. F. Huff. 1998. IL-4 inhibits mouse mast cell sites. Fc⑀RI expression through a STAT6-dependent mechanism. J. Immunol. 161: 6915. Note added in proof. While this manuscript was in submission, 24. Nilsson, G., U. Miettinen, T. Ishizaka, L. K. Ashman, A. M. Irani, and Suzuki et al. (74) published similar results showing that mast cells L. B. Schwartz. 1994. Interleukin-4 inhibits the expression of kit and tryptase express a nuclear serine protease that cleaves STAT6. This group during stem cell factor-dependent development of human mast cells from fetal liver cells. Blood 84:1519. also demonstrated that the cleavage site is at aa 685 (aspartic acid) 25. Pierce, J. H., P. P. Di Fiore, S. A. Aaronson, M. Potter, J. Pumphrey, A. Scott, of the STAT6 protein sequence and a cleavage-resistant STAT6 and J. N. Ihle. 1985. Neoplastic transformation of mast cells by Abelson-MuLV: mutant confers hypersensitivity to IL-4 in mast cells as measured abrogation of IL-3 dependence by a nonautocrine mechanism. Cell 41:685. 26. Yung, Y. P., R. Eger, G. Tertian, and M. A. Moore. 1981. Long-term in vitro by Fc⑀R1 down-regulation and apoptosis. culture of murine mast cells. II. Puriﬁcation of a mast cell growth factor and its dissociation from TCGF. J. Immunol. 127:794. 27. Alt, F. W., N. Rosenberg, R. J. Casanova, E. Thomas, and D. Baltimore. 1982. Acknowledgments Immunoglobulin heavy-chain expression and class switching in a murine leukae- We thank Shveta Shah for technical assistance and Drs. Jeremy Boss and mia cell line. Nature 296:325. 28. Murphy, K. M., A. B. Heimberger, and D. Y. Loh. 1990. Induction by antigen of S. Wright Caughman for helpful discussions and critical review of the ϩ ϩ intrathymic apoptosis of CD4 CD8 TCRlo thymocytes in vivo. Science 250: manuscript. 1720. 29. Lu, B., M. Reichel, D. A. Fisher, J. F. Smith, and P. Rothman. 1997. Identiﬁ- cation of a STAT6 domain required for IL-4-induced activation of transcription. References J. Immunol. 159:1255. 1. Takeda, K., T. Kishimoto, and S. Akira. 1997. STAT6: its role in interleukin 30. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of 4-mediated biological functions. J. Mol. Med. 75:317. microgram quantities of protein utilizing the principle of protein-dye binding. 2. Wurster, A. L., T. Tanaka, and M. J. Grusby. 2000. The biology of Stat4 and Anal. Biochem. 72:248. Stat6. Oncogene 19:2577. 31. Fiering, S., J. P. Northrop, G. P. Nolan, P. S. Mattila, G. R. Crabtree, and 3. Takeda, K., T. Tanaka, W. Shi, M. Matsumoto, M. Minami, S. Kashiwamura, L. A. Herzenberg. 1990. Single cell assay of a transcription factor reveals a K. Nakanishi, N. Yoshida, T. Kishimoto, and S. Akira. 1996. Essential role of threshold in transcription activated by signals emanating from the T-cell antigen Stat6 in IL-4 signalling. Nature 380:627. receptor. Genes Dev. 4:1823. 4. Kaplan, M. H., U. Schindler, S. T. Smiley, and M. J. Grusby. 1996. Stat6 is 32. Ndubuisi, M. I., G. G. Guo, V. A. Fried, J. D. Etlinger, and P. B. Sehgal. 1999. required for mediating responses to IL-4 and for development of Th2 cells. Im- Cellular physiology of STAT3: where’s the cytoplasmic monomer? J. Biol. munity 4:313. Chem. 274:25499. 3818 MAST CELL STAT6 PROTEASE

33. Schindler, C., H. Kashleva, A. Pernis, R. Pine, and P. Rothman. 1994. STF-IL-4: 55. White, E. D., R. P. Andrews, and G. K. Hershey. 2001. Sulfhydryl-2 domain- a novel IL-4-induced signal transducing factor. EMBO J. 13:1350. containing protein tyrosine phosphatase-1 is not a negative regulator of interleu- 34. Hou, J., U. Schindler, W. J. Henzel, T. C. Ho, M. Brasseur, and S. L. McKnight. kin-4 signaling in murine mast cells. J. Leukocyte Biol. 69:825. 1994. An interleukin-4-induced transcription factor: IL-4 Stat. Science 265:1701. 56. Schleimer, R. P., S. A. Sterbinsky, J. Kaiser, C. A. Bickel, D. A. Klunk, K. Tomioka, 35. Kotanides, H., and N. C. Reich. 1993. Requirement of tyrosine phosphorylation W. Newman, F. W. Luscinskas, M. A. Gimbrone Jr., B. W. McIntyre, et al. 1992. for rapid activation of a DNA binding factor by IL-4. Science 262:1265. IL-4 induces adherence of human eosinophils and basophils but not neutrophils to 36. Meyer, J., M. Jucker, W. Ostertag, and C. Stocking. 1998. Carboxyl-truncated endothelium: association with expression of VCAM-1. J. Immunol. 148:1086. ␤ STAT5 is generated by a nucleus-associated serine protease in early hemato- 57. Nelms, K., A. D. Keegan, J. Zamorano, J. J. Ryan, and W. E. Paul. 1999. The poietic progenitors. Blood 91:1901. IL-4 receptor: signaling mechanisms and biologic functions. Annu. Rev. Immunol. 37. Sherman, M. A. 2001. The role of STAT6 in mast cell IL-4 production. Immunol. 17:701. Rev. 179:48. 58. Agarwal, S., and A. Rao. 1998. Modulation of chromatin structure regulates 38. Xia, Z., R. R. Salzler, D. P. Kunz, M. R. Baer, L. Kazim, H. Baumann, and cytokine gene expression during T cell differentiation. Immunity 9:765. M. Wetzler. 2001. A novel serine-dependent proteolytic activity is responsible for truncated signal transducer and activator of transcription proteins in acute my- 59. Avni, O., D. Lee, F. Macian, S. Szabo, L. Glimcher, and A. Rao. 2002. Th cell eloid leukemia blasts. Cancer Res. 61:1747. differentiation is accompanied by dynamic changes in histone acetylation of cy- 39. Sherman, M. A., V. H. Secor, S. K. Lee, R. D. Lopez, and M. A. Brown. 1999. tokine genes. Nat. Immunol. 3:643. STAT6-independent production of IL-4 by mast cells. Eur. J. Immunol. 29:1235. 60. Morris, S. C., W. C. Gause, and F. D. Finkelman. 2000. IL-4 suppression of in 40. Tara, D., D. L. Weiss, and M. A. Brown. 1995. Characterization of the consti- vivo T cell activation and antibody production. J. Immunol. 164:1734. tutive and inducible components of a T cell IL-4 activation responsive element. 61. Oskeritzian, C. A., Z. Wang, J. P. Kochan, M. Grimes, Z. Du, H. W. Chang, J. Immunol. 154:4592. S. Grant, and L. B. Schwartz. 1999. Recombinant human (rh)IL-4-mediated apo- 41. Weiss, D. L., J. Hural, D. Tara, L. A. Timmerman, G. Henkel, and M. A. Brown. ptosis and recombinant human IL-6-mediated protection of recombinant human 1996. Nuclear factor of activated T cells is associated with a mast cell interleukin stem cell factor-dependent human mast cells derived from cord blood mononu- 4 transcription complex. Mol. Cell. Biol. 16:228. clear cell progenitors. J. Immunol. 163:5105. 42. Sherman, M. A., D. R. Powell, D. L. Weiss, and M. A. Brown. 1999. NF-ATc 62. Bischoff, S. C., G. Sellge, A. Lorentz, W. Sebald, R. Raab, and M. P. Manns. isoforms are differentially expressed and regulated in murine T and mast cells. 1999. IL-4 enhances proliferation and mediator release in mature human mast Downloaded from J. Immunol. 162:2820. cells. Proc. Natl. Acad. Sci. USA 96:8080. 43. Sherman, M. A., T. Y. Nachman, and M. A. Brown. 1999. Cutting edge: IL-4 63. Vella, A., T. K. Teague, J. Ihle, J. Kappler, and P. Marrack. 1997. Interleukin 4 production by mast cells does not require c-maf. J. Immunol. 163:1733. (IL-4) or IL-7 prevents the death of resting T cells: Stat6 is probably not required 44. Hural, J. A., M. Kwan, G. Henkel, M. B. Hock, and M. A. Brown. 2000. An for the effect of IL-4. J. Exp. Med. 186:325. intron transcriptional enhancer element regulates IL-4 gene locus accessibility in 64. Zamorano, J., A. L. Mora, M. Boothby, and A. D. Keegan. 2001. NF-␬B acti- mast cells. J. Immunol. 165:3239. vation plays an important role in the IL-4-induced protection from apoptosis. Int. 45. Yeatman, C. F., II, S. M. Jacobs-Helber, P. Mirmonsef, S. R. Gillespie, Immunol. 13:1479. L. A. Bouton, H. A. Collins, S. T. Sawyer, C. P. Shelburne, and J. J. Ryan. 2000. 65. Foote, L. C., R. G. Howard, A. Marshak-Rothstein, and T. L. Rothstein. 1996. Combined stimulation with the T helper cell type 2 cytokines interleukin (IL)-4 http://www.jimmunol.org/ and IL-10 induces mouse mast cell apoptosis. J. Exp. Med. 192:1093. IL-4 induces Fas resistance in B cells. J. Immunol. 157:2749. 46. Masuda, A., T. Matsuguchi, K. Yamaki, T. Hayakawa, and Y. Yoshikai. 2001. 66. Brunetti, M., N. Martelli, A. Colasante, M. Piantelli, P. Musiani, and F. B. Aiello. Interleukin-15 prevents mouse mast cell apoptosis through STAT6- mediated 1995. Spontaneous and glucocorticoid-induced apoptosis in human mature T lymphocytes. Blood 86:4199. Bcl-xL expression. J. Biol. Chem. 276:26107. 47. Zornig, M., A. Hueber, W. Baum, and G. Evan. 2001. Apoptosis regulators and 67. Illera, V. A., C. E. Perandones, L. L. Stunz, D. A. Mower Jr., and R. F. Ashman. their role in tumorigenesis. Biochim. Biophys. Acta 1551:F1. 1993. Apoptosis in splenic B lymphocytes. Regulation by protein kinase C and 48. Freeman, J. G., J. J. Ryan, C. P. Shelburne, D. P. Bailey, L. A. Bouton, IL-4. J. Immunol. 151:2965. N. Narasimhachari, J. Domen, N. Simeon, F. Couderc, and J. K. Stewart. 2001. 68. Parry, S. L., J. Hasbold, M. Holman, and G. G. Klaus. 1994. Hypercross-linking Catecholamines in murine bone marrow derived mast cells. J. Neuroimmunol. surface IgM or IgD receptors on mature B cells induces apoptosis that is reversed 119:231. by costimulation with IL-4 and anti-CD40. J. Immunol. 152:2821. 49. Suzuki, K., H. Nakajima, N. Watanabe, S. Kagami, A. Suto, Y. Saito, T. Saito, 69. Zamorano, J., H. Y. Wang, L. M. Wang, J. H. Pierce, and A. D. Keegan. 1996. and I. Iwamoto. 2000. Role of common cytokine receptor ␥ chain (␥c)- and IL-4 protects cells from apoptosis via the insulin receptor substrate pathway and by guest on September 28, 2021 Jak3-dependent signaling in the proliferation and survival of murine mast cells. a second independent signaling pathway. J. Immunol. 157:4926. Blood 96:2172. 70. Wurster, A. L., D. J. Withers, T. Uchida, M. F. White, and M. J. Grusby. 2002. 50. Masuda, A., T. Matsuguchi, K. Yamaki, T. Hayakawa, M. Kubo, W. J. LaRochelle, Stat6 and IRS-2 cooperate in interleukin 4 (IL-4)-induced proliferation and dif- and Y. Yoshikai. 2000. Interleukin-15 induces rapid tyrosine phosphorylation of ferentiation but are dispensable for IL-4-dependent rescue from apoptosis. Mol. STAT6 and the expression of interleukin-4 in mouse mast cells. J. Biol. Chem. 275: Cell. Biol. 22:117. 29331. 71. Bischoff, S. C., G. Sellge, M. P. Manns, and A. Lorentz. 2001. Interleukin-4 51. Brown, M. A., J. H. Pierce, C. J. Watson, J. Falco, J. N. Ihle, and W. E. Paul. induces a switch of human intestinal mast cells from proinﬂammatory cells to 1987. B cell stimulatory factor-1/interleukin-4 mRNA is expressed by normal and Th2-type cells. Int. Arch. Allergy Immunol. 124:151. transformed mast cells. Cell 50:809. 52. Garren, H., P. J. Ruiz, T. A. Watkins, P. Fontoura, L. T. Nguyen, E. R. Estline, 72. Bovolenta, C., L. Testolin, L. Benussi, P. M. Lievens, and E. Liboi. 1998. Pos- D. L. Hirschberg, and L. Steinman. 2001. Combination of gene delivery and itive selection of apoptosis-resistant cells correlates with activation of dominant- DNA vaccination to protect from and reverse Th1 autoimmune disease via de- negative STAT5. J. Biol. Chem. 273:20779. viation to the Th2 pathway. Immunity 15:15. 73. Xia, Z., S. N. Sait, M. R. Baer, M. Barcos, K. A. Donohue, D. Lawrence, 53. Wang, H. W., N. Tedla, A. R. Lloyd, D. Wakeﬁeld, and P. H. McNeil. 1998. Mast L. A. Ford, A. M. Block, H. Baumann, and M. Wetzler. 2001. Truncated STAT cell activation and migration to lymph nodes during induction of an immune proteins are prevalent at relapse of acute myeloid leukemia. Leuk. Res. 25:473. response in mice. J. Clin. Invest. 102:1617. 74. Suzuki, K., H. Nakajima, S. Kagami, A. Suto, K. Ikeda, K. Hirose, T. Hiwasa, 54. Mikita, T., D. Campbell, P. Wu, K. Williamson, and U. Schindler. 1996. Re- K. Takeda, Y. Saito, S. Akira, and I. Iwamoto. 2002. Proteolytic processing of quirements for interleukin-4-induced gene expression and functional character- Stat6 signaling in mast cells as a negative regulatory mechanism. J. Exp. Med. ization of Stat6. Mol. Cell. Biol. 16:5811. 196:27.