USOO7772369B2

(12) United States Patent (10) Patent No.: US 7,772,369 B2 Rupar et al. (45) Date of Patent: Aug. 10, 2010

(54) COLEOPTERAN-TOXIC POLYPEPTIDE 6, 197,312 B1 3/2001 Peak et al. COMPOSITIONS AND INSECTRESISTANT 6,372.480 B1* 4/2002 Narva et al...... 435/2525 TRANSGENC PLANTS (75) Inventors: Mark J. Rupar, Wilmington, DE (US); FOREIGN PATENT DOCUMENTS William P. Donovan, Levittown, PA EP 0454485 A2 10, 1991 (US); Chih-Rei Chu, Exton, PA (US); WO WO 9314205 7, 1993 Elizabeth Pease, Danville, PA (US); WO WO 97/40162 10, 1997 Yuping Tan, Fremont, CA (US); Annette C. Slaney, Burlington, NJ (US); Thomas M. Malvar, Troy, MO (US); OTHER PUBLICATIONS James A. Baum, Webster Groves, MO Ely, S., The Engineering of Plants to Express Bacillus thuringiensis (US) Delta-Endotoxins, Bacillus thuringiensis, An Environmental Biopesticide: Theory and Practice, Edited by P.F. Entwistle et al., (73) Assignee: Monsanto Technology LLC, St. Louis, XP-002054693, pp. 105-124 (1993). MO (US) Donovan, W.P. et al., Characterization of Two Genes Encoding Bacillus thuringiensis Insecticidal Crystal Proteins Toxic to (*) Notice: Subject to any disclaimer, the term of this Coleoptera Species, Applied and Environmental Microbiology, patent is extended or adjusted under 35 XP-000876861, pp. 3921-3927 (1992). U.S.C. 154(b) by 24 days. Fidock et al., “Conservation of the Plasmodium falciparum Sporozoite Surface Protein Gene, STARP in Field Isolates and Dis (21) Appl. No.: 12/256,812 tinct Species of Plasmodium.” Molecular and Biochemical Parasitol ogy, 67:255-267 (1994). (22) Filed: Oct. 23, 2008 Yuan et al., GenBank Accession No. AJO00743 (1998). Salomon et al., GenBank Accession No. S42303 (1993). (65) Prior Publication Data Morio et al., GenBank Accession No. C89791 (1998). US 2009/OO94714 A1 Apr. 9, 2009 * cited by examiner Related U.S. Application Data Primary Examiner Anne Kubelik (62) Division of application No. 1 1/485,079, filed on Jul. (74) Attorney, Agent, or Firm Timothy K. Ball, Esq.; 12, 2006, now Pat. No. 7,442,540, which is a division Howrey LLP of application No. 10/408.692, filed on Apr. 7, 2003, now Pat. No. 7,078,592, which is a division of appli (57) ABSTRACT cation No. 09/563,269, filed on May 3, 2000, now Pat. No. 6,555,655. Disclosed are novel insecticidal polypeptides, and composi tions comprising these polypeptides, peptide fragments (60) Provisional application No. 60/172.240, filed on May thereof, and antibodies specific therefor. Also disclosed are 4, 1999. vectors, transformed host cells, and transgenic plants that contain nucleic acid segments that encode the disclosed Ö-en (51) Int. Cl. dotoxin polypeptides. Also disclosed are methods of identi C07K I4/325 (2006.01) fying related polypeptides and polynucleotides, methods of (52) U.S. Cl...... 530/350 making and using transgenic cells comprising these poly (58) Field of Classification Search ...... None nucleotide sequences, as well as methods for controlling an See application file for complete search history. insect population, Such as Colorado potato beetle, Southern (56) References Cited corn rootworm and western corn rootworm, and for confer ring to a plant resistance to a target insect species. U.S. PATENT DOCUMENTS 6,127,180 A 10, 2000 Narva et al. 10 Claims, 3 Drawing Sheets U.S. Patent Aug. 10, 2010 Sheet 1 of 3 US 7,772,369 B2

Hind

g g> D

3 ECOR ECOR s r f

HindIII

FIG. 1 U.S. Patent Aug. 10, 2010 Sheet 2 of 3 US 7,772,369 B2

HindII Cla Ssp ECOR HindIII SSp

Xmn ECOR

HindII

FIG. 2 U.S. Patent Aug. 10, 2010 Sheet 3 of 3 US 7,772,369 B2

O LO N. L. r CN

| | | |

s US 7,772,369 B2 1. 2 COLEOPTERAN-TOXC POLYPEPTOE insect, Solubilization in the insect midgut (a combination COMPOSITIONS AND INSECTRESISTANT stomach and Small intestine), resistance to digestive enzymes TRANSGENC PLANTS Sometimes with partial digestion actually “activating the toxin, binding to the midgut cells, formation of a pore in the This application is a divisional of application Ser. No. 5 insect cells and the disruption of cellular homeostasis (En 1 1/485,079, filed Jul 12, 2006 now U.S. Pat. No. 7,442,540, glish and Slatin, 1992). which is a divisional of application Ser. No. 10/408.692, filed One of the unique features of B. thuringiensis is its pro Apr. 7, 2003, now U.S. Pat. No. 7,078,592, which is a divi duction of crystal proteins during sporulation which are spe sional of application Ser. No. 09/563,269, filed May 3, 2000, cifically toxic to certain orders and species of insects. Many now U.S. Pat. No. 6,555,655, which claims the benefit of U.S. 10 different strains of B. thuringiensis have been shown to pro Provisional Application No. 60/172,240, filed May 4, 1999. duce insecticidal crystal proteins. Compositions including B. 1.O BACKGROUND OF THE INVENTION thuringiensis strains which produce proteins having insecti cidal activity against lepidopteran and dipteran insects have 1.1 Field of the Invention 15 been commercially available and used as environmentally The present invention relates generally to the fields of acceptable insecticides because they are quite toxic to the molecular biology. More particularly, certain embodiments specific target insect, but are harmless to plants and other concern methods and compositions comprising DNA seg non-targeted organisms. ments, and proteins derived from bacterial species. More The mechanism of insecticidal activity of the B. thuring particularly, it concerns novel genes from Bacillus thuring- 20 iensis crystal proteins has been studied extensively in the past iensis encoding coleopteran-toxic crystal proteins. Various decade. It has been shown that the crystal proteins are toxic to methods for making and using these DNA segments, DNA the insect only after ingestion of the protein by the insect. The segments encoding synthetically-modified Ö-endotoxin alkaline pH and proteolytic enzymes in the insect mid-gut polypeptides, and native and synthetic crystal proteins are solubilize the proteins, thereby allowing the release of com disclosed, such as, for example, the use of DNA segments as 25 diagnostic probes and templates for protein production, and ponents which are toxic to the insect. These toxic components the use of proteins, fusion protein carriers and peptides in disrupt the mid-gut cells, cause the insect to cease feeding, various immunological and diagnostic applications. Also dis and, eventually, bring about insect death. For this reason, B. closed are methods of making and using nucleic acid seg thuringiensis has proven to be an effective and environmen ments in the development of transgenic plant cells containing 30 tally safe insecticide in dealing with various insect pests. As noted by Höfte et al., (1989) the majority of insecticidal the polynucleotides disclosed herein. B. thuringiensis strains are active against insects of the order 1.2. Description of the Related Art Lepidoptera, i.e. caterpillar insects. Other B. thuringiensis Because crops of commercial interest are often the target of insect attack, environmentally-sensitive methods for control stains are insecticidally active against insects of the order 35 Diptera, i.e., flies and mosquitoes, or against both lepi ling or eradicating insect infestation are desirable in many dopteran and dipteran insects. In recent years, a few B. thur instances. This is particularly true for farmers, nurserymen, ingiensis strains have been reported as producing crystal pro growers, and commercial and residential areas which seek to control insect populations using eco-friendly compositions. teins that are toxic to insects of the order Coleoptera, i.e., The most widely used environmentally-sensitive insecticidal beetles (Krieg et al., 1983; Sicket al., 1990; Donovan et al., formulations developed in recent years have been composed 40 1992: Lambert et al., 1992a: 1992b). of microbial pesticides derived from the bacterium Bacillus 1.2.2 Genes Encoding Crystal Proteins thuringiensis. B. thuringiensis is a Gram-positive bacterium Many of the 8-endotoxins are related to various degrees by that produces crystal proteins or inclusion bodies which are similarities in their amino acid sequences. Historically, the specifically toxic to certain orders and species of insects. proteins and the genes which encode them were classified Many different strains of B. thuringiensis have been shown to 45 based largely upon their spectrum of insecticidal activity. The produce insecticidal crystal proteins. Compositions including review by Höfte and Whiteley (1989) discusses the genes and B. thuringiensis strains which produce insecticidal proteins proteins that were identified in B. thuringiensis prior to 1990, have been commercially-available and used as environmen and sets forth the nomenclature and classification scheme tally-acceptable insecticides because they are quite toxic to which has traditionally been applied to B. thuringiensis genes the specific target insect, but are harmless to plants and other 50 and proteins. cryI genes encode lepidopteran-toxic Cry I pro non-targeted organisms. teins, and cryII genes encode CryII proteins that are toxic to 1.2.1 Ö-Endotoxins both lepidopterans and dipterans. cry III genes encode Ö-endotoxins are used to controla wide range of leaf-eating coleopteran-toxic CryIII proteins, while cryIV genes encode caterpillars and beetles, as well as mosquitoes. These pro- 55 dipteran-toxic Cry IV proteins. teinaceous parasporal crystals, also referred to as insecticidal Based on the degree of sequence similarity, the proteins crystal proteins, crystal proteins, Bt inclusions, crystalline were further classified into subfamilies; more highly related inclusions, inclusion bodies, and Bt toxins, are a large collec proteins within each family were assigned divisional letters tion of insecticidal proteins produced by B. thuringiensis that such as CryIA, CryIB, CryIC, etc. Even more closely related are toxic upon ingestion by a Susceptible insect host. Over the 60 proteins within each division were given names such as past decade research on the structure and function of B. thu CryIC1, CryIC2, etc. ringiensis toxins has covered all of the major toxin categories, Recently, a new nomenclature was developed which sys and while these toxins differ in specific structure and func tematically classified the Cry proteins based upon amino acid tion, general similarities in the structure and function are sequence homology rather than upon insect target specifici assumed. Based on the accumulated knowledge of B. thur- 65 ties (Crickmore et al., 1998). The classification scheme for ingiensis toxins, a generalized mode of action for B. thuring many known toxins, not including allelic variations in indi iensis toxins has been created and includes: ingestion by the vidual proteins, is Summarized in Section 4.3 US 7,772,369 B2 3 4 1.2.3 Crystal Proteins Toxic to Colfopteran Insects polypeptides, their dissimilarity to the known crystal proteins The cloning and expression of the cry3Bb gene has been indicates the existence of a new class or Sub-class of B. described (Donovanet al., 1992). This gene encodes a 74-kDa thuringiensis crystal proteins, as they share less than 65% protein having insecticidal activity against Coleopterans, amino acid sequence identity with any of the presently known such as Colorado potato beetle (CPB), and southern corn root insecticidal polypeptides. The invention further provides worm (SCRW). novel polypeptides that when in combination, produce insec A B. thuringiensis strain, PS201T6, reported to have activ ticidally-active crystal proteins. Also provided are trans ity against western corn rootworm (WCRW, Diabrotica vir formed host cells, transgenic plants, vectors, and methods for gifera virgifera) was described in U.S. Pat. No. 5,436,002 making and using the novel polypeptides and polynucle (specifically incorporated herein by reference in its entirety). 10 otides. This strain also showed activity against Musca domestica, In a first embodiment, the invention provides an isolated Aedes aegypti, and Liriomyza trifoli. CryET69 polypeptide comprising at least 7 contiguous amino The cloning and expression of the cryET29 gene has also acids from SEQID NO:14. More preferably the polypeptide been described (Intl. Pat. Appl. Publ. Ser. No. WO97/17507, comprises at least 9 or at least 11 contiguous amino acids 1997). This gene encodes a 25-kDa protein that is active 15 from SEQID NO:14. Still more preferably, the polypeptide against Coleopteran insects, particularly the CPB, SCRW. comprises at least 13 or at least 15 contiguous amino acids WCRW, and the cat flea, Ctenocephalides felis. from SEQID NO:14, and more preferably comprises at least The cloning and expression of the cryET33 and cryET34 17 or at least 19 contiguous amino acids from SEQID NO:14. genes has been described (Intl. Pat. Appl. Publ. Ser. No. WO In an exemplary embodiment, the polypeptide comprises the 97/17600, 1997). These genes encode proteins of -30 and sequence of SEQID NO:14. Such a polypeptide is preferably ~15 kDa, respectively, and are active against Coleopteran encoded by a nucleic acid segment that comprises an at least insects, particularly CPB larvae and the Japanese beetle (Pop 45-basepair contiguous nucleotide sequence from SEQ ID illia japonica). NO:13, and more preferably is encoded by a nucleic acid The Vip1A gene, which produces a vegetative, Soluble, segment that comprises an at least 90-basepair contiguous insecticidal protein, has also been cloned and sequenced (Intl. 25 sequence from SEQID NO:13. More preferably still, such a Pat. Appl. Publ. Ser. No. WO 96/10083, 1996). This gene polypeptide is encoded by a nucleic acid segment that com encodes a protein of approximately 80 kDa, that is active prises an at least 150-basepair contiguous sequence from against both WCRW and northern corn rootworm (NCRW). SEQ ID NO:13. Exemplary polynucleotides encoding the Another endotoxin active against coleopteran insects, insecticidal polypeptide comprise an at least 300-basepair including WCRW, is Cry1Ia (Intl. Pat. Appl. Publ. Ser. No. 30 contiguous nucleotide sequence from SEQID NO:13, and in WO 90/13651, 1990). The gene encoding this 81-kDa one embodiment comprises the nucleotide sequence of SEQ polypeptide has been cloned and sequenced. ID NO:13. Additional crystal proteins with toxicity towards the Also disclosed and claimed is an isolated CryET84 WCRW have been described (Intl. Pat. Appl. Publ. Ser. No. polypeptide comprising at least 15 contiguous amino acids WO 97/40162, 1997). These proteins appear to function as 35 from SEQID NO:19. More preferably the polypeptide com binary toxins and show sequence similarity to mosquitocidal prises at least 30 to 45 contiguous amino acids from SEQID proteins isolated from B. sphaericus. NO:19. Still more preferably, the polypeptide comprises at Certain strains of B. sphaericus are highly active against least 45 to 90 contiguous amino acids from SEQID NO:19, mosquito larvae, with many producing, upon sporulation, a and more preferably comprises at least 90 to 150 contiguous crystalline inclusion composed of two protein toxins. The 40 amino acids from SEQID NO:19. In an exemplary embodi analysis of the genes encoding these proteins have been ment, the polypeptide comprises the sequence of SEQ ID described by Baumann et al., (1988). The toxins are desig NO:19. Such a polypeptide is preferably encoded by a nucleic nated P51 and P42 on the basis of their predicted molecular acid segment that comprises an at least 45-basepair contigu masses of 51.4- and 41.9-kDa, respectively. The P42 protein ous nucleotide sequence from SEQ ID NO:18, and more alone is weakly active against mosquito larvae. The P51 pro 45 preferably is encoded by a nucleic acid segment that com tein has no mosquitocidal activity by itself. Both P51 and P42 prises an at least 90-basepair contiguous sequence from SEQ are required for full insecticidal activity. There are no reports ID NO:18. More preferably still, such a polypeptide is of the crystal proteins of B. sphaericus having activity on any encoded by a nucleic acid segment that comprises an at least insects other than mosquitoes (for a recent review see Charles 150-basepair contiguous sequence from SEQ ID NO:18. et al., 1996a, 1996b). 50 Exemplary polynucleotides encoding the insecticidal A second class of mosquitocidal protein toxins are pro polypeptide comprise an at least 300-basepair contiguous duced by some strains of B. sphaericus. These proteins, nucleotide sequence from SEQ ID NO:18, and in one known as MtX toxins, are produced during vegetative growth embodiment comprises the nucleotide sequence of SEQ ID and do not form a crystalline inclusion. The two Mtx toxins NO:18. that have been identified, designated MtX and Mtx2, have 55 Also disclosed and claimed is an isolated CryET75 molecular masses of 100 and 30.8 kDa, respectively. The polypeptide comprising at least 15 contiguous amino acids cloning and sequencing of the genes for these toxins, desig from SEQID NO:16. More preferably the polypeptide com nated mtx and mtx2, has been described (Thanabalu et al., prises at least 30 to 45 contiguous amino acids from SEQID 1991, Thanabalu and Porter, 1995). The MtX and Mtx2 pro NO:16. Still more preferably, the polypeptide comprises at teins do not share sequence similarity to any other known 60 least 45 to 90 contiguous amino acids from SEQID NO:16, insecticidal proteins, including the crystal proteins of B. and more preferably comprises at least 90 to 150 contiguous sphaericus and B. thuringiensis. amino acids from SEQID NO:16. In an exemplary embodi ment, the polypeptide comprises the sequence of SEQ ID 2O SUMMARY OF THE INVENTION NO:16. Such a polypeptide is preferably encoded by a nucleic 65 acid segment that comprises an at least 45-basepair contigu The present invention provides novel insecticidal polypep ous nucleotide sequence from SEQ ID NO:15, and more tides and DNA sequences that encode them. For five of these preferably is encoded by a nucleic acid segment that com US 7,772,369 B2 5 6 prises an at least 90-basepair contiguous sequence from SEQ prises an at least 450-basepair contiguous sequence from ID NO:15. More preferably still, such a polypeptide is SEQID NO:11. More preferably still, such a polypeptide is encoded by a nucleic acid segment that comprises an at least encoded by a nucleic acid segment that comprises at least a 150-basepair contiguous sequence from SEQ ID NO:15. 462-basepair contiguous sequence from SEQ ID NO:11. Exemplary polynucleotides encoding the insecticidal Exemplary polynucleotides encoding the insecticidal polypeptide comprise an at least 300-basepair contiguous polypeptide comprise an at least 510-basepair contiguous nucleotide sequence from SEQ ID NO:15, and in one nucleotide sequence from SEQ ID NO:11, and in one embodiment comprises the nucleotide sequence of SEQ ID embodiment comprises the nucleotide sequence of SEQ ID NO:15. NO:11. In another embodiment, the invention discloses and claims 10 The invention also provides an isolated CryET74 polypep an isolated CryET80 polypeptide comprising at least 17 con tide that comprises the sequence of SEQ ID NO:6. Such a tiguous amino acids from SEQID NO:4. More preferably the polypeptide is preferably encoded by a nucleic acid segment polypeptide comprises at least 20 or at least 23 contiguous that comprises at least 45-basepair contiguous nucleotide amino acids from SEQID NO:4. Still more preferably, the sequence from SEQID NO:5, and more preferably is encoded polypeptide comprises at least 26 or at least 29 contiguous 15 by a nucleic acid segment that comprises an at least 90-base amino acids from SEQID NO:4, and more preferably com pair contiguous sequence from SEQ ID NO:5. More prefer prises at least 32 or at least 35 contiguous amino acids from ably still, such a polypeptide is encoded by a nucleic acid SEQID NO:4. In an exemplary embodiment, the polypeptide segment that comprises an at least 150-basepair contiguous comprises the sequence of SEQID NO:4. Such a polypeptide sequence from SEQ ID NO:5. Exemplary polynucleotides is preferably encoded by a nucleic acid segment that com encoding the insecticidal polypeptide comprise an at least prises an at least 51-basepair contiguous nucleotide sequence 300-basepair contiguous nucleotide sequence from SEQ ID from SEQ ID NO:3, and more preferably is encoded by a NO:5, and in one embodiment comprises the nucleotide nucleic acid segment that comprises an at least 60-basepair sequence of SEQID NO:5. contiguous sequence from SEQ ID NO:3. More preferably Furthermore, the invention provides an isolated CryET39 still. Such a polypeptide is encoded by a nucleic acid segment 25 polypeptide that comprises the sequence of SEQ ID NO:8. that comprises an at least 78-basepair contiguous sequence Such a polypeptide is preferably encoded by a nucleic acid from SEQID NO:3. Exemplary polynucleotides encoding the segment that comprises an at least 45-basepair contiguous insecticidal polypeptide comprise an at least 96-basepair con nucleotide sequence from SEQID NO:7, and more preferably tiguous nucleotide sequence from SEQID NO:3, and in one is encoded by a nucleic acid segment that comprises an at embodiment comprises the nucleotide sequence of SEQ ID 30 least 90-basepair contiguous sequence from SEQID NO:7. NO:3. More preferably still, such a polypeptide is encoded by a In another embodiment, the invention provides an isolated nucleic acid segment that comprises an at least 150-basepair CryET76 polypeptide comprising at least 55 contiguous contiguous sequence from SEQ ID NO:7. Exemplary poly amino acids from SEQ ID NO:2. More preferably the nucleotides encoding the insecticidal polypeptide comprise polypeptide comprises at least 60 or at least 70 contiguous 35 an at least 300-basepair contiguous nucleotide sequence from amino acids from SEQID NO:2. Still more preferably, the SEQID NO:7, and in one embodiment comprises the nucle polypeptide comprises at least 75 or at least 80 contiguous otide sequence of SEQID NO:7. amino acids from SEQID NO:2, and more preferably com Likewise, the invention provides an isolated CryET79 prises at least 85 or at least 90 contiguous amino acids from polypeptide that comprises the sequence of SEQID NO:10. SEQID NO:2. In an exemplary embodiment, the polypeptide 40 Such a polypeptide is preferably encoded by a nucleic acid comprises the sequence of SEQID NO:2. Such a polypeptide segment that comprises an at least 45-basepair contiguous is preferably encoded by a nucleic acid segment that com nucleotide sequence from SEQID NO:9, and more preferably prises an at least 165-basepair contiguous nucleotide is encoded by a nucleic acid segment that comprises an at sequence from SEQID NO:1, and more preferably is encoded least 90-basepair contiguous sequence from SEQID NO:9. by a nucleic acid segment that comprises an at least 180 45 More preferably still, such a polypeptide is encoded by a basepair contiguous sequence from SEQ ID NO:1. More nucleic acid segment that comprises an at least 150-basepair preferably still, Such a polypeptide is encoded by a nucleic contiguous sequence from SEQ ID NO:9. Exemplary poly acid segment that comprises an at least 225-basepair contigu nucleotides encoding the insecticidal polypeptide comprise ous sequence from SEQ ID NO:1. Exemplary polynucle at least 300-basepair contiguous nucleotide sequence from otides encoding the insecticidal polypeptide comprise an at 50 SEQID NO:9, and in one embodiment comprises the nucle least 270-basepair contiguous nucleotide sequence from SEQ otide sequence of SEQID NO:9. ID NO:1, and in one embodiment comprises the nucleotide The invention also discloses compositions and insecticidal sequence of SEQID NO:1. formulations that comprise one or more of the polypeptides In a further embodiment, the invention discloses and disclosed herein. Such composition may be a cell extract, cell claims an isolated CryET71 polypeptide comprising at least 55 Suspension, cell homogenate, cell lysate, cell Supernatant, 146 contiguous amino acids from SEQ ID NO:12. More cell filtrate, or cell pellet of a bacteria cell that comprises preferably the polypeptide comprises at least 150 or at least polynucleotides encoding Such polypeptides. Exemplary 154 contiguous amino acids from SEQID NO:12. Still more bacterial cells that produce such polypeptides include B. thu preferably, the polypeptide comprises at least 158 or at least ringiensis EG4550 (deposited with the NRRL on May 30, 162 contiguous amino acids from SEQID NO:12, and more 60 1997 as NRRL B-21784); EG5899 (deposited with the NRRL preferably comprises at least 166 or at least 170 contiguous on May 30, 1997 as NRRL B-21783); EG11529 (deposited amino acids from SEQID NO:12. In an exemplary embodi with the NRRL on Feb. 12, 1998 as NRRL B-21917); ment, the polypeptide comprises the sequence of SEQ ID EG4100 (deposited with the NRRL on May 30, 1997 as NO:12. Such a polypeptide is preferably encoded by a nucleic NRRL B-21786): EG11647 (deposited with the NRRL on acid segment that comprises an at least 438-basepair contigu 65 May 30, 1997 as NRRL B-21787); EG9444 (deposited with ous nucleotide sequence from SEQ ID NO:11, and more the NRRL on May 30, 1997 as NRRL B-21785); EG11648 preferably is encoded by a nucleic acid segment that com (deposited with the NRRL on May 30, 1997 as NRRL US 7,772,369 B2 7 8 B-21788); EG4851 (deposited with the NRRL on Feb. 12, Preparation of such antibodies may be achieved using the 1998 as NRRL B-21915); and EG11658 (deposited with the disclosed polypeptide as an antigen in an animal as described NRRL on Feb. 12, 1998 as NRRL B-21916). below. Antigenic epitopes, shorter peptides, peptide fusions, The composition as described in detail hereinbelow in this carrier-linked peptide fragments, and the like may also be disclosure may be formulated as a powder, dust, pellet, gran generated from a whole or a portion of the polypeptide ule, spray, emulsion, colloid, Solution, or Such like, and may sequence disclosed herein. be preparable by Such conventional means as desiccation, lyophilization, homogenization, extraction, filtration, cen Another aspect of the invention relates to a biologically trifugation, sedimentation, or concentration of a culture of pure culture of a B. thuringiensis bacterium as shown in Table cells comprising the polypeptide. Preferably Such composi 10 9, deposited with the Agricultural Research Culture Collec tions are obtainable from one or more cultures of the B. tion, Northern Regional Research Laboratory (NRRL). thuringiensis cells described herein. In all Such compositions A further embodiment of the invention relates to a vector that contain at least one such insecticidal polypeptide, the comprising a sequence region that encodes a polypeptide polypeptide may be present in a concentration of from about comprising one or more of the amino acid sequences dis 1% to about 99% by weight. 15 closed herein, a recombinant host cell transformed with such An exemplary insecticidal polypeptide formulation may be a recombinant vector, and biologically-pure cultures of prepared by a process comprising the steps of culturing a recombinant bacteria transformed with a polynucleotide suitable B. thuringiensis cell under conditions effective to sequence that encodes the polypeptide disclosed herein. All produce the insecticidal polypeptide(s); and obtaining the strains deposited with the NRRL were submitted to the Patent insecticidal polypeptide(s) so produced. Culture Collection under the terms of the Budapest Treaty, For example, the invention discloses and claims a method and viability statements pursuant to International Receipt of preparing a 6-endotoxin polypeptide having insecticidal Form BP/4 were obtained. Exemplary vectors, recombinant activity against a coleopteran or lepidopteran insect. The host cells, transgenic cell lines, pluripotent plant cells, and method generally involves isolating from a Suitable culture of transgenic plants comprising at least a first sequence region B. thuringiensis cells that have been grown under appropriate 25 that encodes a polypeptide comprising one or more of the conditions, one or more of the Ö-endotoxin polypeptides pro sequences disclosed herein are described in detail hereinbe duced by the cells. Such polypeptides may be isolated from low. the cell culture or Supernatant or from spore Suspensions In a further embodiment, the invention provides methods derived from the cell culture and used in the native form, or for preparing an insecticidal polypeptide composition. In may be otherwise purified or concentrated as appropriate for 30 exemplary embodiments, such polypeptides may be formu the particular application. lated for use as an insecticidal agent, and may be used to A method of controlling an insect population is also pro control insect populations in an environment, including agri vided by the invention. The method generally involves con cultural environs and the like. The formulations may be used tacting the population with an insecticidally-effective amount to kill an insect, either by topical application, or by ingestion of a polypeptide comprising the amino acid sequence of SEQ 35 of the polypeptide composition by the insect. In certain ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, or 19. Such methods may instances, it may be desirable to formulate the polypeptides of be used to kill or reduce the numbers of target insects in a the present invention for application to the Soil, on or near given area, or may be prophylactically applied to an environ plants, trees, shrubs, and the like, near live plants, livestock, mental area to prevent infestation by a Susceptible insect. domiciles, farm equipment, buildings, and the like. Preferably the insectingests, or is contacted with, an insecti 40 The present invention also provides transformed host cells, cidally-effective amount of the polypeptides. pluripotent plant cell populations, embryonic plant tissue, Additionally, the invention provides a purified antibody plant calli, plantlets, and transgenic plants that comprise a that specifically binds to the insecticidal polypeptides dis selected sequence region that encodes the insecticidal closed herein. Also provided are methods of preparing Such polypeptide. Such cells are preferably prokaryotic or eukary an antibody, and methods for using the antibody to isolate, 45 identify, characterize, and/or purify polypeptides to which otic cells such as bacterial, fungal, or plant cells, with exem Such an antibody specifically binds. Immunological kits and plary bacterial cells including B. thuringiensis, B. subtilis, B. immunodetection methods useful in the identification of such megaterium, B. cereus, Escherichia, Salmonella, Agrobacte polypeptides and peptide fragments and/or epitopes thereof rium or Pseudomonas cells. are provided in detail herein, and also represent important 50 The plants and plant host cells are preferably monocotyle aspects of the present invention. donous or dicotyledonous plant cells Such as corn, wheat, Such antibodies may be used to detect the presence of such Soybean, oat, cotton, rice, rye, Sorghum, Sugarcane, tomato, polypeptides in a sample, or may be used as described herein tobacco, kapok, flax, potato, barley, turfgrass, pasture grass, below in a variety of immunological methods. An exemplary berry, fruit, legume, vegetable, ornamental plant, shrub, cac method for detecting a Ö-endotoxin polypeptide in a biologi 55 tus, succulent, and tree cell. cal sample generally involves obtaining a biological sample Illustrative transgenic plants of the present invention pref Suspected of containing a 6-endotoxin polypeptide; contact erably have incorporated into their genome a selected poly ing the sample with an antibody that specifically binds to the nucleotide (or “transgene'), that comprises at least a first polypeptide, under conditions effective to allow the forma sequence region that encodes one or more of the insecticidal tion of complexes; and detecting the complexes so formed. 60 polypeptides disclosed herein. For Such methods, the invention also provides an immuno Likewise, a progeny (decendant, offspring, etc.) of any detection kit. Such a kit generally contains, in Suitable con generation of Such a transgenic plant also represents an tainer means, an antibody that binds to the Ö-endotoxin important aspect of the invention. Preferably such progeny polypeptide, and at least a first immunodetection reagent. comprise the selected transgene, and inherit the phenotypic Optionally, the kit may provide additional reagents or instruc 65 trait of insect resistance demonstrated by the parental plant A tions for using the antibody in the detection of Ö-endotoxin seed of any generation of all such transgenic insect-resistant polypeptides in a sample. plants is also an important aspect of the invention. Preferably US 7,772,369 B2 9 10 the seed will also comprise the selected transgene and will herein. The polynucleotides encoding these peptides and confer to the plants grown from the seed the phenotypic trait polypeptides may encode active insecticidal proteins, or pep of insect resistance. tide fragments, polypeptide Subunits, functional domains, or Insect resistant, crossed fertile transgenic plants compris the like of one or more of the CryET84, CryET80, CryET76, ing one or more transgenes that encode one or more of the CryET71, CryET69, CryET75, CryET39, CryET79, polypeptides disclosed herein may be prepared by a method CryET74 and related crystal proteins as the polypeptides that generally involves obtaining a fertile transgenic plant that disclosed herein. In addition the invention encompasses contains a chromosomally incorporated transgene encoding nucleic acid segments which may be synthesized entirely in Such an insecticidal polypeptide; operably linked to a pro vitro using methods that are well-known to those of skill in moter active in the plant; crossing the fertile transgenic plant 10 with a second plant lacking the transgene to obtain a third the art which encode the novel polypeptides, peptides, pep plant comprising the transgene; and backcrossing the third tide fragments, Subunits, or functional domains disclosed plant to obtain a backcrossed fertile plant. In Such cases, the herein. transgene may be inherited through a male parent or through As used herein, the term “nucleic acid segment’ or “poly a female parent. The second plant may be an inbred, and the 15 nucleotide' refers to a nucleic acid molecule that has been third plant may be a hybrid. isolated free of the total genomic DNAs of a particular spe Likewise, an insect resistant hybrid, transgenic plant may cies. Therefore, a nucleic acid segment or polynucleotide be prepared by a method that generally involves crossing a encoding an endotoxin polypeptide refers to a nucleic acid first and a secondinbred plant, wherein one or both of the first molecule that comprises at least a first crystal protein-encod and second inbred plants comprises a chromosomally incor ing sequences yet is isolated away from, or purified free from, porated transgene that encodes the selected polypeptide oper total genomic DNA of the species from which the nucleic acid ably linked to a plant expressible promoter that expresses the segment is obtained, which in the instant case is the genome transgene. In illustrative embodiments, the first and second of the Gram-positive bacterial genus, Bacillus, and in particu inbred plants may be monocot plants selected from the group lar, the species of Bacillus known as B. thuringiensis. consisting of corn, wheat, rice, barley, oats, rye, Sorghum, 25 Included within the term “nucleic acid segment, are poly turfgrass and Sugarcane. nucleotide segments and Smaller fragments of such segments, In related embodiment, the invention also provides a and also recombinant vectors, including, for example, plas method of preparing an insect resistant plant. The method mids, cosmids, phagemids, phage, virions, baculoviruses, generally involves contacting a recipient plant cell with a artificial chromosomes, viruses, and the like. Accordingly, DNA composition comprising at least a first transgene that 30 polynucleotide sequences that have between about 70% and encodes an insecticidal polypeptide under conditions permit about 80%, or more preferably between about 81% and about ting the uptake of the DNA composition; selecting a recipient 90%, or even more preferably between about 91% and about cell comprising a chromosomally incorporated transgene that 99% nucleic acid sequence identity or functional equivalence encodes the polypeptide; regenerating a plant from the to the polynucleotide sequence of SEQ ID NO:1, SEQ ID selected cell; and identifying a fertile transgenic plant that has 35 NO:3, SEQID NO:5, SEQID NO:7, SEQID NO:9, SEQID enhanced insect resistance relative to the corresponding non NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:18 transformed plant. will be sequences that are “essentially as set forth in SEQID A method of producing transgenic seed generally involves NO: 1, SEQID NO:3, SEQID NO:5, SEQID NO:7, SEQID obtaining a fertile transgenic plant comprising a chromo NO:9, SEQID NO:11, SEQID NO:13, SEQ ID NO:15, or Somally integrated transgene that encodes a polypeptide com 40 SEQ ID NO:18. Highly preferred sequences, are those prising one or more of the amino acid sequences disclosed which are preferably about 91%, about 92%, about 93%, herein, operably linked to a promoter that expresses the trans about 94%, about 95%, about 96%, about 97%, about 98%, gene in a plant, and growing the plant under appropriate about 99%, or about 100% identical or functionally equiva conditions to produce the transgenic seed. lent to the nucleotide sequence of SEQ ID NO: 1, SEQ ID A method of producing progeny of any generation of an 45 NO:3, SEQID NO:13, SEQID NO:15, or SEQ ID NO:18. insect resistance-enhanced fertile transgenic plant is also pro Other preferred sequences that encode related polypeptide vided by the invention. The method generally involves col sequences are those which are about 81%, 82%, 83%, 84%, lecting transgenic seed from a transgenic plant comprising a 85%. 86%, 87%, 88%. 89%, or 90% identical or functionally chromosomally integrated transgene that encodes such a equivalent to the polynucleotide sequence set forth in one or polypeptide, operably linked to a promoter that expresses the 50 more of these sequence identifiers. Likewise, sequences that transgene in the plant; planting the collected transgenic seed; are about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, and growing the progeny transgenic plants from the seed. or 80% identical or functionally equivalent to the polynucle These methods for creating transgenic plants, progeny and otide sequence set forth in one or more of these sequence seed may involve contacting the plant cell with the DNA identifiers are also contemplated to be useful in the practice of composition using one of the processes well-known for plant 55 the present invention. cell transformation Such as microprojectile bombardment, Similarly, a polynucleotide comprising an isolated, puri electroporation or Agrobacterium-mediated transformation. fied, or selected gene or sequence region refers to a polynucle These and other embodiments of the present invention will be otide which may include in addition to peptide encoding apparent to those of skill in the art from the following sequences, certain other elements such as, regulatory examples and claims, having benefit of the teachings of the 60 sequences, isolated Substantially away from other naturally Specification herein. occurring genes or protein-encoding sequences. In this respect, the term “gene' is used for simplicity to refer to a 2.1 Polynucleotide Segments functional protein-, or polypeptide-encoding unit. As will be The present invention provides nucleic acid segments, that understood by those in the art, this functional term includes can be isolated from virtually any source, that are free from 65 both genomic sequences, operator sequences and Smaller total genomic DNA and that encode the novel insecticidal engineered gene segments that express, or may be adapted to polypeptides and peptide fragments thereofthat are disclosed express, proteins, polypeptides or peptides. In certain US 7,772,369 B2 11 12 embodiments, a nucleic acid segment will comprise at least a about 99%, or about 100% identical or functionally equiva first gene that encodes one or more of the polypeptides dis lent to the amino acid sequence of SEQ ID NO:2, SEQ ID closed herein. NO:4, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:19. To permit expression of the gene, and translation of the Other preferred sequences are those which are about 81%, mRNA into mature polypeptide, the nucleic acid segment 5 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, or 90% iden preferably also comprises at least a first promoter operably tical or functionally equivalent to the amino acid sequence of linked to the gene to express the gene product in a host cell SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:14, SEQ ID transformed with this nucleic acid segment. The promoter NO:16, or SEQID NO:19. Likewise, sequences that are about may be an endogenous promoter, or alternatively, a heterolo 71%, 72%, 73%, 74%/0, 75%, 76%, 77%, 78%, 79%, or 80% gous promoter selected for its ability to promote expression of 10 identical or functionally-equivalent to the polypeptide the gene in one or more particular cell types. For example, in sequence set forth in SEQID NO:2, SEQID NO:4, SEQID the creation of transgenic plants and pluripotent plant cells NO:14, SEQID NO: 16, or SEQID NO: 19 are also contem comprising a selected gene, the heterologous promoter of plated to be useful in the practice of the present invention. choice is one that is plant-expressible, and in many instances, It will also be understood that amino acid and nucleic acid may preferably be a plant-expressible promoter that is tissue 15 sequences may include additional residues, such as additional or cell cycle-specific. The selection of plant-expressible pro N- or C-terminal amino acids or 5' or 3' sequences, and yet moters is well-known to those skilled in the art of plant still be essentially as set forth in one of the sequences dis transformation, and exemplary Suitable promoters are closed herein, so long as the sequence meets the criteria set described herein. In certain embodiments, the plant-express forth above, including the maintenance of biological protein ible promoter may be selected from the group consisting of activity where protein expression is concerned. The addition corn Sucrose synthetase 1, corn alcohol dehydrogenase 1, of terminal sequences particularly applies to nucleic acid corn light harvesting complex, corn heat shock protein, pea sequences that may, for example, include various non-coding small subunit RuBP carboxylase, Tiplasmid mannopine syn sequences flanking either of the 5' or 3' portions of the coding thase, Ti plasmid nopaline synthase, petunia chalcone region or may include various internal sequences, i.e., isomerase, bean glycine rich protein 1, Potato patatin, lectin, 25 introns, which are known to occur within genes. CaMV 35S, and the S-E9 small subunit RuBP carboxylase The nucleic acid segments of the present invention, regard promoter. less of the length of the coding sequence itself, may be com "Isolated Substantially away from other coding sequences bined with other nucleic acid sequences, such as promoters, means that the gene of interest, in this case, a gene encoding polyadenylation signals, additional restriction enzyme sites, a bacterial crystal protein, forms the significant part of the 30 multiple cloning sites, other coding segments, and the like, coding region of the DNA segment, and that the DNA seg such that their overall length may vary considerably. It is ment does not contain large portions of naturally-occurring therefore contemplated that a nucleic acid fragment of almost coding DNA, such as large chromosomal fragments or other any length may be employed, with the total length preferably functional genes or operon coding regions. Of course, this being limited by the ease of preparation and use in the refers to the DNA segment as originally isolated, and does not 35 intended recombinant nucleic acid protocol. For example, exclude genes, recombinant genes, synthetic linkers, or cod nucleic acid fragments may be prepared that include a short ing regions later added to the segment by the hand of man. contiguous stretch encoding the peptide sequence disclosed In particular embodiments, the invention concerns isolated in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID polynucleotides (such as DNAs, RNAs, antisense DNAs, NO:8, SEQID NO:10, SEQID NO:12, SEQID NO:14, SEQ antisense RNAs, ribozymes, and PNAs) and recombinant 40 ID NO:16, or SEQ ID NO:19, or that are identical to or vectors comprising polynucleotide sequences that encode complementary to nucleic acid sequences which encode the one or more of the polypeptides disclosed herein. peptides disclosed in SEQID NO:2, SEQID NO:4, SEQID The term “a sequence essentially as set forth in SEQ ID NO:6, SEQID NO:8, SEQID NO:10, SEQID NO:12, SEQ NO:2, SEQID NO:4, SEQID NO:6, SEQID NO:8, SEQID ID NO: 14, or SEQ ID NO:16, or SEQ ID NO:19, and par NO:10, SEQID NO:12, SEQID NO:14, SEQID NO:16, or 45 ticularly those nucleic acid segments disclosed in SEQ ID SEQ ID NO:19” means that the sequence substantially cor NOS:1, 3, 13, 15, or 18. For example, nucleic acid sequences responds to a portion of the sequence of SEQID NO:2, SEQ such as about 23 nucleotides, and that are up to about 10,000, IDNO:4, SEQID NO:6, SEQID NO:8, SEQIDNO: 10, SEQ about 5,000, about 3,000, about 2,000, about 1,000, about ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID 500, about 200, about 100, about 50, and about 23 or so base NO:19 and has relatively few amino acids that are not iden 50 pairs in length (including all intermediate lengths) that com tical to, or a biologically functional equivalent of the amino prise a contiguous nucleotide sequence from SEQID NO:1, acids of any of these sequences. The term “biologically func SEQID NO:3, SEQID NO:5, SEQID NO:7, SEQID NO:9, tional equivalent” is well understood in the art and is further SEQID NO:11, SEQID NO:13, SEQID NO:15, or SEQ ID defined in detail herein (e.g., see Illustrative Embodiments). NO:18 or those that encode a contiguous amino acid Accordingly, sequences that have between about 70% and 55 sequence from SEQID NO:2, SEQID NO:4, SEQID NO:6, about 80%, or more preferably between about 81% and about SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID 90%, or even more preferably between about 91% and about NO:14, SEQID NO:16, or SEQID NO:19 are contemplated 99% amino acid sequence identity or functional equivalence to be particularly useful. to the amino acid sequence of SEQID NO:2, SEQID NO:4, It will be readily understood that “intermediate lengths, in SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID 60 the context of polynucleotide sequences, or nucleic acid seg NO:12, SEQID NO:14, SEQID NO:16, or SEQID NO:19 ments, or primer or probes specific for the disclosed gene, will be sequences that are “essentially as set forth in SEQID means any length between the quoted ranges, such as from NO:2, SEQID NO:4, SEQID NO:6, SEQID NO:8, SEQID about 24, 25, 26, 27, 28, 29, etc.; 30, 31, 32,33, 34,35,36, 37, NO:10, SEQID NO:12, SEQID NO:14, SEQID NO:16, or 38, 39, etc.; 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, SEQ ID NO:19.” Highly preferred sequences, are those 65 53, 54, 55,56, 57,58, 59, 60, 65, 70, 75, 80, 85,90, 95, etc.; which are preferably about 91%, about 92%, about 93%, 100, 101, 102, 103, 104, etc.; 110, 120, 125, 130, 135, 140, about 94%, about 95%, about 96%, about 97%, about 98%, 145, 150, 155, 160, 165, 170, 180, 190, etc.; including all US 7,772,369 B2 13 14 integers in the ranges of from about 200-500: 500-1,000; The DNA segments of the present invention encompass 1,000-2,000; 2,000-3,000; 3,000-5,000; and up to and includ biologically-functional, equivalent peptides. Such sequences ing sequences of about 10,000 or 12,000 or so nucleotides and may arise as a consequence of codon degeneracy and func the like. tional equivalency that are known to occur naturally within Likewise, it will be readily understood that “intermediate 5 nucleic acid sequences and the proteins thus encoded. Alter lengths, in the context of polypeptides or peptides, means natively, functionally-equivalent proteins or peptides may be any length between the quoted ranges of contiguous amino created via the application of recombinant DNA technology, acids. For example, when considering the disclosed insecti in which changes in the protein structure may be engineered, cidal polypeptides, all lengths between about 7 and about 300 based on considerations of the properties of the amino acids contiguous amino acid sequences are contemplated to be 10 being exchanged. Changes designed by man may be intro useful in particular embodiments disclosed herein. For example, peptides comprising contiguous amino acid duced through the application of site-directed mutagenesis sequences having about 7, about 8, about 9, about 10, about techniques, e.g., to introduce improvements to the antigenic 11, about 12, about 13, about 14, about 15, about 16, about 17, ity of the protein or to test mutants in order to examine activity about 18, about 19, about 20, about 21, about 22, 23, 24, 25, 15 at the molecular level. Alternatively, native, as yet-unknown 26, 27, 28, 29, 30, 31, 32,33, 34, 35,36, 37,38, 39, 40, 41, 42, or as yet unidentified polynucleotides and/or polypeptides 43,44, 45,46, 47, 48,49, 50, 51, 52,53,54, 55,56, 57,58, 59, structurally and/or functionally-related to the sequences dis 60, 65, etc., 70, 75, etc., 80, 85, etc., 90, 95, etc., and even closed herein may also be identified that fall within the scope those peptides comprising at least about 96.97, 98.99, 100, of the present invention. Such polynucleotides are those poly 101, 102, 103, and 104, or more contiguous amino acids from 20 nucleotides that encode a polypeptide structurally and/or SEQID NO:2, SEQID NO:4, SEQID NO:6, SEQID NO:8, functionally similar or identical to, the polypeptide charac SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID terized herein as a crystal protein-encoding polynucleotide. NO:16, or SEQ ID NO:19 are explicitly considered to fall Since the designations “CryET39,” “CryET69.” “CryET71.” within the scope of the present invention. “CryET74, “CryET76, “CryET79. “CryET80. Furthermore, it will also be readily understood by one of 25 “CryET84” and “CryET75” are arbitrary names chosen to skill in the art, that “intermediate lengths, in the context of readily identify polypeptides comprising the amino acid larger insecticidally-active polypeptides, means any length sequences disclosed herein, it is likely that many other between the quoted ranges of contiguous amino acids that polypeptides may be identified that are highly homologous to comprise such a polypeptide. For example, when considering the polypeptides of the present invention, all lengths between 30 (or even identical to) this sequence, but which may have been about 100 and about 1000 contiguous amino acid sequences isolated from different organisms or sources, or alternatively, are contemplated to be useful in particular embodiments dis may even have been synthesized entirely, or partially denovo. closed herein. For example, polypeptides comprising a con AS Such, all polypeptide sequences, whether naturally-occur tiguous amino acid sequence having at least about 100, about ring, or artificially-created, that are structurally homologous 101, about 102, 103, 104, 105,106, 107, 108, 109, 110, 115, 35 to the primary amino acid sequences as described herein and 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, that have similar insecticidal activity against the targetinsects 180, 185, 190, 195, etc., 200, 201, 202, 203, 204, 205, 206, disclosed herein are considered to fall within the scope of this 207, 208, 209, 210, 220, 230, 240, 250, 260, 270, 280, 290, disclosure. Likewise, all polynucleotide sequences, whether etc., 300, 310,320, 330, 340,350, 360, 370, 380,390, 400, naturally-occurring, or artificially-created, that are structur etc., 410, 430,450, 470, 490, etc., 500, 525, 550, 575, 600, 40 ally homologous to the nucleotide sequences disclosed 650, 675, 700, etc., 750, etc., and eventhose polypeptides that herein, or that encodes a polypeptide that is homologous, and comprise at least about 775 or more amino acids are explicitly biologically-functionally equivalent to the amino acid considered to fall within the scope of the present invention. sequence disclosed herein are also considered to fall within Particularly in the case of fusion proteins comprising a whole the scope of this disclosure. or a portion of the amino acid sequence of SEQIDNO:2, SEQ 45 If desired, one may also prepare fusion proteins and pep IDNO:4, SEQIDNO:6, SEQID NO:8, SEQID NO:10, SEQ tides; e.g., where the peptide-coding regions are aligned ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID within the same expression unit with other proteins or pep NO:19 longer polypeptide sequences may be preferred, tides having desired functions, such as for purification or including sequences that comprise about 760, 770, 780, 790, immunodetection purposes (e.g., proteins that may be puri or even about 800 or 900 or greater amino acids in length. 50 fied by affinity chromatography and enzyme label coding It will also be understood that this invention is not limited regions, respectively). to the particular nucleic acid sequences which encode pep Recombinant vectors form further aspects of the present tides of the present invention, or which encode the amino acid invention. Particularly useful vectors are contemplated to be sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, those vectors in which the coding portion of the DNA seg SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID 55 ment, whether encoding a full-length insecticidal protein or NO:14, SEQ ID NO:16, or SEQ ID NO:19 including the Smaller peptide, is positioned under the control of a promoter. DNA sequence which is particularly disclosed in SEQ ID The promoter may be in the form of the promoter that is NO:1, SEQID NO:3, SEQID NO:5, SEQID NO:7, SEQID naturally associated with a gene encoding peptides of the NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or present invention, as may be obtained by isolating the 5' SEQID NO:18. Recombinant vectors and isolated DNA seg- 60 non-coding sequences located upstream of the coding seg ments may therefore variously include the polypeptide-cod ment or exon, for example, using recombinant cloning and/or ing regions themselves, coding regions bearing selected alter PCRTM technology, in connection with the compositions dis ations or modifications in the basic coding region, or they may closed herein. In many cases, the promoter may be a native encode larger polypeptides that nevertheless include these promoter, or alternatively, a heterologous promoter, Such as peptide-coding regions or may encode biologically func- 65 those of bacterial origin (including promoters from other tional equivalent proteins or peptides that have variantamino crystal proteins), fungal origin, viral, phage or phagemid acids sequences. origin (including promoters such as CaMV35, and its deriva US 7,772,369 B2 15 16 tives, T3, T7, W., and (p promoters and the like), or plant origin a given sample. However, other uses are envisioned, includ (including constitutive, inducible, and/or tissue-specific pro ing the use of the sequence information for the preparation of moters and the like). mutant species primers, or primers for use in preparing other genetic constructions. 2.1.1 Characteristics of the CryET76, CryET80 and CryET84 Nucleic acid molecules having sequence regions consist Polypeptides Isolated from EG4851 ing of contiguous nucleotide stretches of about 23 to about 50, The present invention provides a novel polypeptide that or even up to and including sequences of about 100-200 defines a whole or a portion of a B. thuringiensis CryET76, nucleotides or so, identical or complementary to the DNA CryET84 or a CryET80 crystal proteins. sequences herein, are particularly contemplated as hybridiza In a preferred embodiment, the invention discloses and claims an isolated and purified CryET76 protein. The 10 tion probes for use in, e.g., Southern and Northern blotting. CryET76 protein isolated from EG4851 comprises a 387 Intermediate-sized fragments will also generally find use in amino acid sequence, and has a calculated molecular mass of hybridization embodiments, wherein the length of the con approximately 43,800 Da. CryET76 has a calculated isoelec tiguous complementary region may be varied. Such as tric constant (pl) equal to 5.39. between about 25-30, or between about 30 and about 40 or so In a preferred embodiment, the invention discloses and 15 nucleotides, but larger contiguous complementary stretches claims an isolated and purified CryET80 protein. The may be used, such as those from about 200 to about 300, or CryET80 protein isolated from EG4851 comprises a 132 from about 300 to about 400 or 500 or so nucleotides in amino acid sequence, and has a calculated molecular mass of length, according to the length complementary sequences one approximately 14,800 Da. CryET80 has a calculated isoelec wishes to detect. It is even possible that longer contiguous tric constant (pl) equal to 6.03. sequence regions may be utilized including those sequences In a preferred embodiment, the invention discloses and comprising at least about 600, 700, 800, 900, 1000, 1100, claims an isolated and purified CryET84 protein. The 1200, 1300, 1400, 1500, or more contiguous nucleotides from CryET84 protein isolated from EG4851 comprises a 341 one of the sequences disclosed herein. amino acid sequence, and has a calculated molecular mass of Of course, fragments may also be obtained by other tech approximately 37,884 Da. CryET84 has a calculated isoelec 25 niques such as, e.g., by mechanical shearing or by restriction tric constant (pl) equal to 5.5. enzyme digestion. Small nucleic acid segments or fragments In strain EG4851, the cryET80 and cryET76 genes are may be readily prepared by, for example, directly synthesiz preferably located on a single DNA segment and are sepa ing the fragment by chemical means, as is commonly prac rated by about 95 nucleotides. The gene for CryET76 extends ticed using an automated oligonucleotide synthesizer. Also, from nucleotide 514 to nucleotide 1674 of SEQID NO:5, and 30 fragments may be obtained by application of nucleic acid the gene encoding CryET80 extends from nucleotide 23 to reproduction technology, such as the PCRTM technology of nucleotide 418 of SEQID NO:5. In the present invention, the U.S. Pat. Nos. 4,683,195 and 4,683.202 (each incorporated cryET80 and cryET76 genes may be preferably located on a herein by reference), by introducing selected sequences into single DNA segment. recombinant vectors for recombinant production, and by 35 other recombinant DNA techniques generally known to those Instrain EG4851, the cryET84 gene is located immediately of skill in the art of molecular biology. 5' to the cryET80 and cryET76 genes. The nucleotide Accordingly, the nucleotide sequences of the invention sequence of the cryET84 gene is shown in SEQID NO:18 and may be used for their ability to selectively form duplex mol the deduced amino acid sequence of the CryET84 protein is ecules with complementary stretches of DNA fragments. shown in SEQ ID NO:19. In the present invention, the 40 Depending on the application envisioned, one will desire to cryET80, cryET84, and cryET76 genes may be preferably employ varying conditions of hybridization to achieve vary located on a single DNA segment (e.g. SEQID NO:17). ing degrees of selectivity of probe towards target sequence. 2.2 Nucleic Acid Segments as Hybridization Probes and For applications requiring high selectivity, one will typically Primers desire to employ relatively stringent conditions to form the In addition to their use in directing the expression of crystal 45 hybrids. “High Stringency hybridization conditions, e.g., proteins or peptides of the present invention, the nucleic acid typically employ relatively low salt and/or high temperature sequences described herein also have a variety of other uses. conditions, such as provided by about 0.02 M to about 0.15 M For example, they have utility as probes or primers in nucleic NaCl at temperatures of about 50° C. to about 70° C. Such acid hybridization embodiments. The invention provides a selective conditions tolerate little, if any, mismatch between method for detecting a nucleic acid sequence encoding a 50 the probe and the template or target strand, and would be Ö-endotoxin polypeptide. The method generally involves particularly Suitable for isolating crystal protein-encoding obtaining sample nucleic acids Suspected of encoding a 6-en DNA segments. Detection of DNA segments via hybridiza dotoxin polypeptide; contacting the sample nucleic acids tion is well-knownto those of skill in the art, and the teachings with an isolated nucleic acid segment comprising one of the of U.S. Pat. Nos. 4,965,188 and 5,176,995 (each incorporated sequences disclosed herein, under conditions effective to 55 herein by reference) are exemplary of the methods of hybrid allow hybridization of substantially complementary nucleic ization analyses. Teachings Such as those found in the texts of acids; and detecting the hybridized complementary nucleic Maloy et al., 1990; Maloy 1994; Segal, 1976; Prokop and acids thus formed. Bajpai, 1991; and Kuby, 1994, are particularly relevant. Also provided is a nucleic acid detection kit comprising, in Of course, for some applications, for example, where one Suitable container means, at least a first nucleic acid segment 60 desires to prepare mutants employing a mutant primer Strand comprising at least 23 contiguous nucleotides from SEQID hybridized to an underlying template or where one seeks to NO:1, SEQID NO:3, SEQID NO:5; SEQID NO:7, SEQID isolate crystal protein-encoding sequences from related spe NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 or cies, functional equivalents, or the like, less stringent hybrid SEQ ID NO:18, and at least a first detection reagent. The ization conditions will typically be needed in order to allow ability of such nucleic acid probes to specifically hybridize to 65 formation of the heteroduplex. In these circumstances, one crystal protein-encoding sequences will enable them to be of may desire to employ “low stringency” or “reduced strin use in detecting the presence of complementary sequences in gency' hybridization conditions such as those employing US 7,772,369 B2 17 18 from about 0.15 M to about 0.9 M salt, attemperatures rang segment in the cell type, organism, or even animal, chosen for ing from about 20° C. to about 55° C. Cross-hybridizing expression. The use of promoter and cell type combinations species can thereby be readily identified as positively hybrid for protein expression is generally known to those of skill in izing signals with respect to control hybridizations. In any the art of molecular biology, for example, see Sambrook et al., case, it is generally appreciated that conditions can be ren 5 (1989). The promoters employed may be constitutive, or dered more stringent by the addition of increasing amounts of inducible, and can be used under the appropriate conditions to formamide, which serves to destabilize the hybrid duplex in direct high level expression of the introduced DNA segment, the same manner as increased temperature. Thus, hybridiza Such as is advantageous in the large-scale production of tion conditions can be readily manipulated, and thus will recombinant proteins or peptides. Appropriate promoter sys generally be a method of choice depending on the desired 10 tems contemplated for use in high-level expression include, results. Regardless of what particular combination of salts but are not limited to, the Pichia expression vector system (such as NaCl or NaCitrate and the like), organic buffers (Pharmacia LKB Biotechnology). (including e.g. formamide and the like), and incubation or In connection with expression embodiments to prepare washing temperatures are employed, the skilled artisan will recombinant proteins and peptides, it is contemplated that readily be able to employ hybridization conditions that are 15 longer DNA segments will most often be used, with DNA “high.” “medium, or “low” stringency, and will be able to segments encoding the entire peptide sequence being most interpret the results from hybridization analyses using Such preferred. However, it will be appreciated that the use of conditions to determine the relative homology of a target shorter DNA segments to direct the expression of crystal nucleic acid sequence to that of the particular novel poly peptides or epitopic core regions, such as may be used to nucleotide probe sequence employed from SEQ ID NO:1, generate anti-crystal protein antibodies, also falls within the SEQID NO:3, SEQID NO:5, SEQID NO:7, SEQID NO:9, Scope of the invention. DNA segments that encode peptide SEQID NO:11, SEQID NO:13, SEQID NO:15 or SEQ ID antigens from about 8 to about 50 amino acids in length, or NO:18. more preferably, from about 8 to about 30 amino acids in In certain embodiments, it will be advantageous to employ length, or even more preferably, from about 8 to about 20 nucleic acid sequences of the present invention in combina 25 amino acids in length are contemplated to be particularly tion with an appropriate means, such as a label, for determin useful. Such peptide epitopes may be amino acid sequences ing hybridization. A wide variety of appropriate indicator which comprise a contiguous amino acid sequence as dis means are known in the art, including fluorescent, radioac closed herein. tive, enzymatic or other ligands, such as avidin/biotin, which are capable of giving a detectable signal. In preferred embodi 30 2.4 Transgenic Plants Expressing CryET Polypeptides ments, one will likely desire to employ a fluorescent label or In yet another aspect, the present invention provides meth an enzyme tag, such as urease, alkaline phosphatase or per ods for producing a transgenic plant that expresses a selected oxidase, instead of radioactive or other environmentally nucleic acid segment comprising a sequence region that undesirable reagents. In the case of enzyme tags, colorimetric encodes the novel endotoxin polypeptides of the present indicator Substrates are known that can be employed to pro 35 invention. The process of producing transgenic plants is well vide a means visible to the human eye or spectrophotometri known in the art. In general, the method comprises transform cally, to identify specific hybridization with complementary ing a Suitable plant host cell with a DNA segment that con nucleic acid-containing samples. tains a promoter operatively linked to a coding region that In general, it is envisioned that the hybridization probes encodes one or more of the disclosed polypeptides. Such a described herein will be useful both as reagents in solution 40 coding region is generally operatively linked to at least a first hybridization as well as in embodiments employing a solid transcription-terminating region, whereby the promoter is phase. In embodiments involving a solid phase, the test DNA capable of driving the transcription of the coding region in the (or RNA) is adsorbed or otherwise affixed to a selected matrix cell, and hence providing the cell the ability to produce the or Surface. This fixed, single-stranded nucleic acid is then polypeptide in vivo. Alternatively, in instances where it is subjected to specific hybridization with selected probes under 45 desirable to control, regulate, or decrease the amount of a desired conditions. The selected conditions will depend on particular recombinant crystal protein expressed in a particu the particular circumstances based on the particular criteria lar transgenic cell, the invention also provides for the expres required (depending, for example, on the G+C content, type sion of crystal protein antisense mRNA. The use of antisense of target nucleic acid, Source of nucleic acid, size of hybrid mRNA as a means of controlling or decreasing the amount of ization probe, etc.). Following washing of the hybridized 50 a given protein of interest in a cell is well-known in the art. Surface so as to remove nonspecifically bound probe mol Another aspect of the invention comprises transgenic ecules, specific hybridization is detected, or even quantitated, plants which express a gene, gene segment, or sequence by means of the label. region that encodes at least one or more of the novel polypep tide compositions disclosed herein. As used herein, the term 2.3 Vectors and Methods for Recombinant Expression of Cry 55 “transgenic plant' is intended to refer to a plant that has Related Polypeptides incorporated DNA sequences, including but not limited to In other embodiments, it is contemplated that certain genes which are perhaps not normally present, DNA advantages will be gained by positioning the coding DNA sequences not normally transcribed into RNA or translated segment under the control of a recombinant, or heterologous, into a protein (“expressed”), or any other genes or DNA promoter. As used herein, a recombinant or heterologous 60 sequences which one desires to introduce into the non-trans promoter is intended to refer to a promoter that is not nor formed plant. Such as genes which may normally be present in mally associated with a DNA segment encoding a crystal the non-transformed plant but which one desires to either protein or peptide in its natural environment. Such promoters genetically engineer or to have altered expression. may include promoters normally associated with other genes, It is contemplated that in some instances the genome of a and/or promoters isolated from any bacterial, viral, eukary 65 transgenic plant of the present invention will have been aug otic, or plant cell. Naturally, it will be important to employ a mented through the stable introduction of one or more trans promoter that effectively directs the expression of the DNA genes, either native, synthetically modified, or mutated, that US 7,772,369 B2 19 20 encodes an insecticidal polypeptide that is identical to, or known to those of skill in the art, a progeny of a plant is highly homologous to the polypeptide disclosed herein. In understood to mean any offspring or any descendant from Some instances, more than one transgene will be incorporated Such a plant. into the genome of the transformed host plant cell. Such is the 2.5 Crystal Protein Screening and Detection Kits case when more than one crystal protein-encoding DNA seg 5 The present invention contemplates methods and kits for ment is incorporated into the genome of Such a plant. In screening samples Suspected of containing crystal protein certain situations, it may be desirable to have one, two, three, polypeptides or crystal protein-related polypeptides, or cells four, or even more B. thuringiensis crystal proteins (either producing such polypeptides. A kit may contain one or more native or recombinantly-engineered) incorporated and stably antibodies specific for the disclosed amino acid sequences expressed in the transformed transgenic plant. Alternatively, a 10 disclosed, or one or more antibodies specific for a peptide second transgene may be introduced into the plant cell to derived from one of the sequences disclosed, and may also confer additional phenotypic traits to the plant. Such trans contain reagent(s) for detecting an interaction between a genes may confer resistance to one or more insects, bacteria, sample and an antibody of the present invention. The pro fungi, viruses, nematodes, or other pathogens. vided reagent(s) can be radio-, fluorescently- or enzymati A preferred gene which may be introduced includes, for 15 cally-labeled. The kit can contain a known radiolabeled agent example, a crystal protein-encoding DNA sequence from capable of binding or interacting with a nucleic acid or anti bacterial origin, and particularly one or more of those body of the present invention. described herein which are obtained from Bacillus spp. The reagent(s) of the kit can be provided as a liquid solu Highly preferred nucleic acid sequences are those obtained tion, attached to a solid support or as a dried powder. Prefer from B. thuringiensis, or any of those sequences which have ably, when the reagent(s) are provided in a liquid solution, the been genetically engineered to decrease or increase the insec liquid solution is an aqueous solution. Preferably, when the ticidal activity of the crystal protein in such a transformed reagent(s) provided are attached to a solid Support, the Solid host cell. Support can be chromatograph media, a test plate having a Means for transforming a plant cell and the preparation of plurality of wells, or a microscope slide. When the reagent(s) pluripotent plant cells, and regeneration of a transgenic cell 25 provided area dry powder, the powder can be reconstituted by line from a transformed cell, cell culture, embryo, or callus the addition of a suitable solvent, that may be provided. tissue are well-known in the art, and are discussed herein. In still further embodiments, the present invention con Vectors, (including plasmids, cosmids, phage, phagemids, cerns immunodetection methods and associated kits. It is baculovirus, viruses, virions, BACs bacterial artificial chro 30 proposed that the crystal proteins or peptides of the present mosomes.YACs yeast artificial chromosomes) comprising invention may be employed to detect antibodies having reac at least a first nucleic acid segment encoding an insecticidal tivity therewith, or, alternatively, antibodies prepared in polypeptide for use in transforming Such cells will, of course, accordance with the present invention, may be employed to generally comprise either the operons, genes, or gene-derived detect crystal proteins or crystal protein-related epitope-con sequences of the present invention, either native, or syntheti 35 taining peptides. In general, these methods will include first cally-derived, and particularly those encoding the disclosed obtaining a sample Suspected of containing Such a protein, crystal proteins. These nucleic acid constructs can further peptide or antibody, contacting the sample with an antibody include structures such as promoters, enhancers, polylinkers, or peptide in accordance with the present invention, as the introns, terminators, or even gene sequences which have posi case may be, under conditions effective to allow the forma tively- or negatively-regulating activity upon the cloned Ö-en 40 tion of an immunocomplex, and then detecting the presence dotoxin gene as desired. The DNA segment or gene may of the immunocomplex. encode either a native or modified crystal protein, which will In general, the detection of immunocomplex formation is be expressed in the resultant recombinant cells, and/or which quite well known in the art and may be achieved through the will confer to a transgenic plant comprising such a segment, application of numerous approaches. For example, the an improved phenotype (in this case, increased resistance to 45 present invention contemplates the application of ELISA, insect attack, infestation, or colonization). RIA, immunoblot (e.g., dot blot), indirect immunofluores The preparation of a transgenic plant that comprises at least cence techniques and the like. Generally, immunocomplex one polynucleotide sequence encoding an insecticidal formation will be detected through the use of a label, such as polypeptide for the purpose of increasing or enhancing the a radiolabel or an enzyme tag (Such as alkaline phosphatase, resistance of such a plant to attack by a target insect represents 50 horseradish peroxidase, or the like). Of course, one may find an important aspect of the invention. In particular, the inven additional advantages through the use of a secondary binding tors describe herein the preparation of insect-resistant mono ligand Such as a second antibody or a biotin/avidin ligand cotyledonous or dicotyledonous plants, by incorporating into binding arrangement, as is known in the art. Such a plant, a transgenic DNA segment encoding one or For assaying purposes, it is proposed that virtually any more insecticidal polypeptides which are toxic to a 55 sample Suspected of comprising either a crystal protein or coleopteran or lepidopteran insect. peptide or a crystal protein-related peptide orantibody sought In a related aspect, the present invention also encompasses to be detected, as the case may be, may be employed. It is a seed produced by the transformed plant, a progeny from contemplated that such embodiments may have application in Such seed, and a seed produced by the progeny of the original the tittering of antigen orantibody samples, in the selection of transgenic plant, produced in accordance with the above pro 60 hybridomas, and the like. In related embodiments, the present cess. Such progeny and seeds will have a crystal protein invention contemplates the preparation of kits that may be encoding transgene stably incorporated into their genome, employed to detect the presence of crystal proteins or related and such progeny plants will inherit the traits afforded by the peptides and/or antibodies in a sample. Samples may include introduction of a stable transgene in Mendelian fashion. All cells, cell Supernatants, cell Suspensions, cell extracts, Such transgenic plants having incorporated into their genome 65 enzyme fractions, protein extracts, or other cell-free compo transgenic DNA segments encoding one or more crystal pro sitions suspected of containing crystal proteins or peptides. teins or polypeptides are aspects of this invention. As well Generally speaking, kits in accordance with the present US 7,772,369 B2 21 22 invention will include a Suitable crystal protein, peptide oran insecticidal composition with Suitable adjuvants using con antibody directed against Such a protein or peptide, together ventional formulation techniques. with an immunodetection reagent and a means for containing the antibody or antigen and reagent. The immunodetection 2.6.1 Oil Flowable Suspensions reagent will typically comprise a label associated with the 5 In a preferred embodiment, the bioinsecticide composition antibody or antigen, or associated with a secondary binding comprises an oil flowable suspension of bacterial cells which ligand. Exemplary ligands might include a secondary anti expresses the novel crystal protein disclosed herein. Exem body directed against the first antibody or antigen or a biotin plary bacterial species include those such as B. thuringiensis, or avidin (or Streptavidin) ligand having an associated label. B. megaterium, B. subtilis, B. cereus, E. coli Salmonella spp., Of course, as noted above, a number of exemplary labels are 10 Agrobacterium spp., or Pseudomonas spp. known in the art and all Such labels may be employed in 2.6.2 Water-Dispersible Granules connection with the present invention. In another important embodiment, the bioinsecticide com The container will generally include a vial into which the position comprises a water dispersible granule. This granule antibody, antigen or detection reagent may be placed, and comprises bacterial cells which expresses a novel crystal preferably suitably aliquotted. The kits of the present inven- 15 protein disclosed herein. Preferred bacterial cells include tion will also typically include a means for containing the bacteria Such as B. megaterium, B. subtilis, B. cereus, E. coli, antibody, antigen, and reagent containers in close confine Salmonella spp., Agrobacterium spp., or Pseudomonas spp. ment for commercial sale. Such containers may include injec cells transformed with a DNA segment disclosed herein and tion or blow-molded plastic containers into which the desired expressing the crystal protein are also contemplated to be vials are retained. 2O useful. 2.6 Insecticidal Compositions and Methods of Use 2.6.3 Powders, Dusts, and Spore Formulations The inventors contemplate that the polypeptide composi In a third important embodiment, the bioinsecticide com tions disclosed herein will find particular utility as insecti position comprises a wettable powder, dust, spore crystal cides for topical and/or systemic application to field crops, 25 formulation, cell pellet, or colloidal concentrate. This powder grasses, fruits and vegetables, lawns, trees, and/or ornamental comprises bacterial cells which expresses a novel crystal plants. Alternatively, the polypeptides disclosed herein may protein disclosed herein. Preferred bacterial cells include B. be formulated as a spray, dust, powder, or other aqueous, thuringiensis cells, or cells of strains of bacteria Such as B. atomized or aerosol for killing an insect, or controlling an megaterium, B. subtilis, B. cereus, E. coli, Salmonella spp., insect population. The polypeptide compositions disclosed 30 Agrobacterium spp., or Pseudomonas spp. and the like, may herein may be used prophylactically, or alternatively, may be also be transformed with one or more nucleic acid segments administered to an environment once target insects. Such as as disclosed herein. Such dry forms of the insecticidal com WCRW, have been identified in the particular environment to positions may be formulated to dissolve immediately upon be treated. The polypeptide compositions may comprise an wetting, or alternatively, dissolve in a controlled-release, Sus individual Cry polypeptide or may contain various combina- 35 tained-release, or other time-dependent manner. Such com tions of the polypeptides disclosed herein. positions may be applied to, or ingested by, the target insect, Regardless of the method of application, the amount of the and as such, may be used to control the numbers of insects, or active polypeptide component(s) is applied at an insecticid the spread of Such insects in a given environment. ally-effective amount, which will vary depending on Such 2.6.4 Aqueous Suspensions and Bacterial Cell Filtrates or factors as, for example, the specific target insects to be con- 40 Lysates trolled, the specific environment, location, plant, crop, or In a fourth important embodiment, the bioinsecticide com agricultural site to be treated, the environmental conditions, position comprises an aqueous Suspension of bacterial cells and the method, rate, concentration, stability, and quantity of or an aqueous Suspension of parasporal crystals, or an aque application of the insecticidally-active polypeptide composi ous Suspension of bacterial cell lysates or filtrates, etc., Such tion. The formulations may also vary with respect to climatic 45 as those described above which express the crystal protein. conditions, environmental considerations, and/or frequency Such aqueous Suspensions may be provided as a concentrated of application and/or severity of insect infestation. stock solution which is diluted prior to application, or alter The insecticide compositions described may be made by natively, as a diluted solution ready-to-apply. formulating either the bacterial cell, crystal and/or spore sus For these methods involving application of bacterial cells, pension, or isolated protein component with the desired agri- 50 the cellular host containing the crystal protein gene(s) may be culturally-acceptable carrier. The compositions may be for grown in any convenient nutrient medium, where the DNA mulated prior to administration in an appropriate means Such construct provides a selective advantage, providing for a as lyophilized, freeze-dried, desiccated, or in an aqueous selective medium so that substantially all or all of the cells carrier, medium or Suitable diluent, Such as Saline or other retain the B. thuringiensis gene. These cells may then be buffer. The formulated compositions may be in the form of a 55 harvested in accordance with conventional ways. Alterna dust or granular material, or a suspension in oil (vegetable or tively, the cells can be treated prior to harvesting. mineral), or water or oil/water emulsions, or as a wettable When the insecticidal compositions comprise intact B. thu powder, or in combination with any other carrier material ringiensis cells expressing the protein of interest, such bac Suitable for agricultural application. Suitable agricultural car teria may be formulated in a variety of ways. They may be riers can be solid or liquid and are well known in the art. The 60 employed as wettable powders, granules or dusts, by mixing term 'agriculturally-acceptable carrier covers all adjuvants, with various inert materials, such as inorganic minerals (phyl inert components, dispersants, Surfactants, tackifiers, bind losilicates, carbonates, Sulfates, phosphates, and the like) or ers, etc. that are ordinarily used in insecticide formulation botanical materials (powdered corncobs, rice hulls, walnut technology; these are well known to those skilled in insecti shells, and the like). The formulations may include spreader cide formulation. The formulations may be mixed with one or 65 Sticker adjuvants, stabilizing agents, other pesticidal addi more Solidor liquid adjuvants and prepared by various means, tives, or Surfactants. Liquid formulations may be acqueous e.g., by homogeneously mixing, blending and/or grinding the based or non-aqueous and employed as foams, Suspensions, US 7,772,369 B2 23 24 emulsifiable concentrates, or the like. The ingredients may ticular formulation, means of application, environmental include rheological agents, Surfactants, emulsifiers, dispers conditions, and degree of biocidal activity. Typically, the ants, or polymers. bioinsecticidal composition will be present in the applied Alternatively, the novel insecticidal polypeptides may be formulation at a concentration of at least about 1% by weight prepared by native or recombinant bacterial expression sys and may be up to and including about 99% by weight. Dry tems in vitro and isolated for Subsequent field application. formulations of the polypeptide compositions may be from Such protein may be either in crude cell lysates, Suspensions, about 1% to about 99% or more by weight of the protein colloids, etc., or alternatively may be purified, refined, buff composition, while liquid formulations may generally com ered, and/or further processed, before formulating in an active prise from about 1% to about 99% or more of the active biocidal formulation. Likewise, under certain circumstances, 10 ingredient by weight. As such, a variety of formulations are it may be desirable to isolate crystals and/or spores from preparable, including those formulations that comprise from bacterial cultures expressing the crystal protein and apply about 5% to about 95% or more by weight of the insecticidal Solutions, Suspensions, or colloidal preparations of Such crys polypeptide, including those formulations that comprise from tals and/or spores as the active bioinsecticidal composition. about 10% to about 90% or more by weight of the insecticidal 2.6.5 Multifunctional Formulations 15 polypeptide. Naturally, compositions comprising from about In certain embodiments, when the control of multiple 15% to about 85% or more by weight of the insecticidal insect species is desired, the insecticidal formulations polypeptide, and formulations comprising from about 20% to described herein may also further comprise one or more about 80% or more by weight of the insecticidal polypeptide chemical pesticides, (such as chemical pesticides, nemato are also considered to fall within the scope of the present cides, fungicides, Virucides, microbicides, amoebicides, disclosure. insecticides, etc.), and/or one or more Ö-endotoxin polypep In the case of compositions in which intact bacterial cells tides having the same, or different insecticidal activities or that contain the insecticidal polypeptide are included, prepa insecticidal specificities, as the insecticidal polypeptide iden rations will generally contain from about 10 to about 10 tified herein. The insecticidal polypeptides may also be used cells/mg, although in certain embodiments it may be desir in conjunction with other treatments such as fertilizers, weed 25 able to utilize formulations comprising from about 10° to killers, cryoprotectants, Surfactants, detergents, insecticidal about 10" cells/mg, or when more concentrated formulations Soaps, dormant oils, polymers, and/or time-release or biode are desired, compositions comprising from about 10 to about gradable carrier formulations that permit long-term dosing of 10' or 10' cells/mg may also be formulated. Alternatively, a target area following a single application of the formulation. cell pastes, spore concentrates, or crystal protein Suspension Likewise the formulations may be prepared into edible 30 concentrates may be prepared that contain the equivalent of “baits” or fashioned into insect “traps” to permit feeding or from about 10' to 10" cells/mg of the active polypeptide, ingestion by a target insect of the insecticidal formulation. and such concentrates may be diluted prior to application. The insecticidal compositions of the invention may also be The insecticidal formulation described above may be used in consecutive or simultaneous application to an envi administered to a particular plant or target area in one or more ronmental site singly or in combination with one or more 35 applications as needed, with a typical field application rate additional insecticides, pesticides, chemicals, fertilizers, or per hectare ranging on the order of from about 50 g/hectare to other compounds. about 500 g/hectare of active ingredient, or alternatively, from about 500 g/hectare to about 1000 g/hectare may be utilized. 2.6.6 Application Methods and Effective Rates In certain instances, it may even be desirable to apply the The insecticidal compositions of the invention are applied 40 insecticidal formulation to a target area at an application rate to the environment of the target insect, typically onto the of from about 1000 g/hectare to about 5000 g/hectare or more foliage of the plant or crop to be protected, by conventional of active ingredient. In fact, all application rates in the range methods, preferably by spraying. The strength and duration of from about 50 g of active polypeptide per hectare to about of insecticidal application will be set with regard to condi 10,000 g/hectare are contemplated to be useful in the man tions specific to the particular pest(s), crop(s) to be treated and 45 agement, control, and killing, of target insect pests using Such particular environmental conditions. The proportional ratio insecticidal formulations. As such, rates of about 100 g/hect of active ingredient to carrier will naturally depend on the are, about 200 g/hectare, about 300 g/hectare, about 400 chemical nature, solubility, and stability of the insecticidal g/hectare, about 500 g/hectare, about 600 g/hectare, about composition, as well as the particular formulation contem 700 g/hectare, about 800 g/hectare, about 900 g/hectare, plated. 50 about 1 kg/hectare, about 1.1 kg/hectare, about 1.2 kg/hect Other application techniques, including dusting, sprin are, about 1.3 kg/hectare, about 1.4 kg/hectare, about 1.5 kling, Soil soaking, Soil injection, seed coating, seedling coat kg/hectare, about 1.6 kg/hectare, about 1.7 kg/hectare, about ing, foliar spraying, aerating, misting, atomizing, fumigating, 1.8 kg/hectare, about 1.9 kg/hectare, about 2.0 kg/hectare, aerosolizing, and the like, are also feasible and may be about 2.5 kg/hectare, about 3.0 kg/hectare, about 3.5 kg/hect required under certain circumstances such as e.g., insects that 55 are, about 4.0 kg/hectare, about 4.5 kg/hectare, about 6.0 cause root or stalk infestation, or for application to delicate kg/hectare, about 7.0 kg/hectare, about 8.0 kg/hectare, about Vegetation or ornamental plants. These application proce 8.5 kg/hectare, about 9.0 kg/hectare, and even up to and dures are also well-known to those of skill in the art. including about 10.0 kg/hectare or greater of active polypep The insecticidal compositions of the present invention may tide may be utilized in certain agricultural, industrial, and also be formulated for preventative or prophylactic applica 60 domestic applications of the pesticidal formulations tion to an area, and may in certain circumstances be applied to described hereinabove. pets, livestock, animal bedding, or in and around farm equip ment, barns, domiciles, or agricultural or industrial facilities, 2.7 Epitopic Core Sequences and the like. The present invention is also directed to protein or peptide The concentration of insecticidal composition which is 65 compositions, free from total cells and other peptides, which used for environmental, systemic, topical, or foliar applica comprise a purified peptide which incorporates an epitope tion will vary widely depending upon the nature of the par that is immunologically cross-reactive with one or more anti US 7,772,369 B2 25 26 bodies that are specific for the disclosed polypeptide In general, the size of the polypeptide antigen is not sequences. In particular, the invention concerns epitopic core believed to be particularly crucial, so long as it is at least large sequences derived from one or more of the polypeptides enough to carry the identified core sequence or sequences. disclosed herein. The Smallest useful core sequence anticipated by the present As used herein, the term “incorporating an epitope(s) that disclosure would generally be on the order of about 8 amino is immunologically cross-reactive with one or more antibod acids in length, with sequences on the order of 10 to 20 being ies that are specific for the disclosed polypeptide sequence' is more preferred. Thus, this size will generally correspond to intended to refer to a peptide or protein antigen which the Smallest peptide antigens prepared in accordance with the includes a primary, secondary or tertiary structure similar to invention. However, the size of the antigen may be larger an epitope located within the disclosed polypeptide. The level 10 where desired, so long as it contains a basic epitopic core of similarity will generally be to Such a degree that mono Sequence. clonal or polyclonal antibodies directed against the crystal The identification of epitopic core sequences is known to protein or polypeptide will also bind to, react with, or other those of skill in the art, for example, as described in U.S. Pat. wise recognize, the cross-reactive peptide or protein antigen. No. 4,554,101, incorporated herein by reference, which Various immunoassay methods may be employed in conjunc 15 teaches the identification and preparation of epitopes from tion with such antibodies, such as, for example, Western amino acid sequences on the basis of hydrophilicity. More blotting, ELISA, RIA, and the like, all of which are known to over, numerous computer programs are available for use in those of skill in the art. predicting antigenic portions of proteins (see e.g., Jameson The identification of immunodominant epitopes, and/or and Wolf, 1988: Wolf et al., 1988). Computerized peptide their functional equivalents, Suitable for use in vaccines is a sequence analysis programs (e.g., DNAStar R Software, relatively straightforward matter. For example, one may DNAStar, Inc., Madison, Wis.) may also be useful in design employ the methods of Hopp, as taught in U.S. Pat. No. ing synthetic peptides in accordance with the present disclo 4.554,101, incorporated herein by reference, which teaches SUC. the identification and preparation of epitopes from amino acid Syntheses of epitopic sequences, or peptides which include sequences on the basis of hydrophilicity. The methods 25 an antigenic epitope within their sequence, are readily described in several other papers, and software programs achieved using conventional synthetic techniques such as the based thereon, can also be used to identify epitopic core Solid phase method (e.g., through the use of commercially sequences (see, for example, Jameson and Wolf, 1988; Wolf available peptide synthesizer Such as an Applied Biosystems et al., 1988: U.S. Pat. No. 4,554,101). The amino acid Model 430A Peptide Synthesizer). Peptide antigens synthe sequence of these "epitopic core sequences' may then be 30 sized in this manner may then be aliquotted in predetermined readily incorporated into peptides, either through the appli amounts and stored in conventional manners, such as in aque cation of peptide synthesis or recombinant technology. ous solutions or, even more preferably, in a powder or lyo Preferred peptides for use in accordance with the present philized State pending use. invention will generally be on the order of about 8 to about 20 In general, due to the relative stability of peptides, they may amino acids in length, and more preferably about 8 to about 35 be readily stored in aqueous Solutions for fairly long periods 15 amino acids in length. It is proposed that shorter antigenic of time if desired, e.g., up to six months or more, in virtually crystal protein-derived peptides will provide advantages in any aqueous solution without appreciable degradation or loss certain circumstances, for example, in the preparation of of antigenic activity. However, where extended aqueous Stor immunologic detection assays. Exemplary advantages age is contemplated it will generally be desirable to include include the ease of preparation and purification, the relatively 40 agents including buffers such as Tris or phosphate buffers to low cost and improved reproducibility of production, and maintain a pH of about 7.0 to about 7.5. Moreover, it may be advantageous biodistribution. desirable to include agents which will inhibit microbial It is proposed that particular advantages of the present growth, such as sodium azide or Merthiolate. For extended invention may be realized through the preparation of Syn storage in an aqueous state it will be desirable to store the thetic peptides which include modified and/or extended 45 solutions at about 4° C., or more preferably, frozen. Of epitopic/immunogenic core sequences which result in a "uni course, where the peptides are stored in a lyophilized or Versal epitopic peptide directed to crystal proteins and powdered State, they may be stored virtually indefinitely, e.g., related sequences. These epitopic core sequences are identi in metered aliquots that may be rehydrated with a predeter fied herein in particular aspects as hydrophilic regions of the mined amount of water (preferably distilled) or buffer prior to particular polypeptide antigen. It is proposed that these 50 SC. regions represent those which are most likely to promote T-cell or B-cell stimulation, and, hence, elicit specific anti 2.8 Definitions body production. The following words and phrases have the meanings set An epitopic core sequence, as used herein, is a relatively forth below. short stretch of amino acids that is "complementary’ to, and 55 Expression: The combination of intracellular processes, therefore will bind, antigen binding sites on the crystal pro including transcription and translation undergone by a coding tein-directed antibodies disclosed herein. Additionally or DNA molecule Such as a structural gene to produce a alternatively, an epitopic core sequence is one that will elicit polypeptide. antibodies that are cross-reactive with antibodies directed Pluripotent: A term used to describe developmental plas against the peptide compositions of the present invention. It 60 ticity. A pluripotent cell is capable of differentiating into a will be understood that in the context of the present disclo number of different cell types and lineages. For example, a Sure, the term “complementary refers to amino acids or stem cell in the bone marrow may give rise to many different peptides that exhibit an attractive force towards each other. lineages of circulating blood cells. This is in contrast to a Thus, certain epitope core sequences of the present invention differentiated cell, which is generally committed to a particu may be operationally defined in terms of their ability to com 65 lar developmental pathway. pete with or perhaps displace the binding of the desired pro Promoter: A recognition site on a DNA sequence or group tein antigen with the corresponding protein-directed antisera. of DNA sequences that provide an expression control element US 7,772,369 B2 27 28 for a structural gene and to which RNA polymerase specifi described in Example 11. Ten microliters were loaded per cally binds and initiates RNA synthesis (transcription) of that lane on the 15% acrylamide gel. A serial dilution of bovine gene. serum albumin (BSA) was included as a standard. Lanes 1-3, Regeneration: The process of growing a plant from a plant EG1 1658; lanes 4-6, EG12156; lanes 7-8, EG12158. cell (e.g., plant protoplast or explant). M-molecular weight standards (Sigma M-0671) in kilodal Structural gene: A gene that is expressed to produce a tons. The bands corresponding to CryET76, CryET80, and polypeptide. CryET84 are indicated by the arrows. Transformation: A process of introducing an exogenous DNA sequence (e.g., a vector, a recombinant DNA molecule) 4.O DESCRIPTION OF ILLUSTRATIVE into a cell or protoplast in which that exogenous DNA is 10 EMBODIMENTS incorporated into a chromosome or is capable of autonomous replication. 4.1 Some Advantages of the Invention Transformed cell: A cell whose DNA has been altered by The present invention provides novel 8-endotoxins which the introduction of an exogenous DNA molecule into that are highly toxic to insects such as WCRW, SCRW, and CPB. cell. 15 These protein have amino acid sequences which are only Transgenic cell: Any cell derived from or regenerated from distantly related to those of other ö-endotoxins that are toxic a transformed cell or derived from a transgenic cell. Exem to dipteran or coleopteran insects. Based on the guidelines plary transgenic cells include plant calli derived from a trans established for the B. thuringiensis crystal protein nomencla formed plant cell and particular cells such as leaf, root, stem, e.g., Somatic cells, or reproductive (germ) cells obtained from ture (Crickmore et al., 1998), two of these polypeptides, a transgenic plant. designated CryET176 and CryET80, represent a new sub Transgenic plant: A plant or a progeny of any generation of class of coleopteran active insecticidal crystal proteins. the plant that was derived from a transformed plant cell or 4.2 Insect Pests protoplast, wherein the plant nucleic acids contains an exog Almost all field crops, plants, and commercial farming enous selected nucleic acid sequence region not originally 25 areas are susceptible to attack by one or more insect pests. present in a native, non-transgenic plant of the same strain. Particularly problematic are the lepidopteran and coleopteran The terms “transgenic plant” and “transformed plant have pests identified in Table 1. For example, vegetable and cole Sometimes been used in the art as synonymous terms to define crops such as artichokes, kohlrabi, arugula, leeks, asparagus, a plant whose DNA contains an exogenous DNA molecule. lentils, beans, lettuce (e.g., head, leaf, romaine), beets, bok However, it is thought more scientifically correct to refer to a 30 choy, malanga, broccoli, melons (e.g., muskmelon, water regenerated plant or callus obtained from a transformed plant melon, crenshaw, honeydew, cantaloupe), brussels sprouts, cell or protoplast or from transformed pluripotent plant cells cabbage, cardoni, carrots, napa, cauliflower, okra, onions, as being a transgenic plant. Preferably, transgenic plants of celery, parsley, chick peas, parsnips, chicory, peas, Chinese the present invention include those plants that comprise at cabbage, peppers, collards, potatoes, cucumber, pumpkins, least a first selected polynucleotide that encodes an insecti 35 cucurbits, radishes, dry bulb onions, rutabaga, eggplant, Sal cidal polypeptide. This selected polynucleotide is preferably Sify, escarole, shallots, endive, soybean, garlic, spinach, a 6-endotoxin coding region (or gene) operably linked to at green onions, squash, greens, Sugar beets, Sweet potatoes, least a first promoter that expresses the coding region to turnip, Swiss chard, horseradish, tomatoes, kale, turnips, and produce the insecticidal polypeptide in the transgenic plant. a variety of spices are sensitive to infestation by one or more Preferably, the transgenic plants of the present invention that 40 of the following insect pests: alfalfa looper, armyworm, beet produce the encoded polypeptide demonstrate a phenotype of armyworm, artichoke plume moth, cabbage budworm, cab improved resistance to target insect pests. Such transgenic bage looper, cabbage webworm, corn earworm, celery leaf plants, their progeny, descendants, and seed from any Such eater, cross-striped cabbageworm, european corn borer, dia generation are preferably insect resistant plants. mondback moth, green cloverworm, imported cabbageworm, Vector: A nucleic acid molecule capable of replication in a 45 melonworm, omnivorous leafroller, pickleworm, rindworm host-cell and/or to which another nucleic acid segment can be complex, Saltmarsh caterpillar, soybean looper, tobacco bud operatively linked so as to bring about replication of the worm, tomato fruitworm, tomato hornworm, tomato pin attached segment. Plasmids, phage, phagemids, and cosmids worm, Velvetbean caterpillar, and yellowstriped armyworm. are all exemplary vectors. In many embodiments, vectors are Likewise, pasture and hay crops such as alfalfa, pasture used as a vehicle to introduce one or more selected polynucle 50 grasses and Silage are often attacked by Such pests as army otides into a host cell, thereby generating a “transformed’ or worm, beef armyworm, alfalfa caterpillar, European skipper, “recombinant’ host cell. a variety of loopers and webworms, as well as yellowstriped armyworms. 3.O BRIEF DESCRIPTION OF THE DRAWINGS Fruit and vine crops such as apples, apricots, cherries, 55 nectarines, peaches, pears, plums, prunes, quince almonds, The drawings form part of the present specification and are chestnuts, filberts, pecans, pistachios, walnuts, citrus, black included to further demonstrate certain aspects of the present berries, blueberries, boysenberries, cranberries, currants, invention. The invention may be better understood by refer loganberries, raspberries, strawberries, grapes, avocados, ence to one or more of these drawings in combination with the bananas, kiwi, persimmons, pomegranate, pineapple, tropical detailed description of specific embodiments presented 60 fruits are often suseptible to attack and defoliation by achema herein. sphinx moth, amorbia, armyworm, citrus cutworm, banana FIG. 1 Restriction map ofpEG1337 skipper, blackheaded fireworm, blueberry leafroller, canker FIG. 2 Restriction map of pEG1921. worm, cherry fruitworm, citrus cutworm, cranberry girdler, FIG. 3 SDS-PAGE analysis of spore-crystal suspensions eastern tent caterpillar, fall webworm, fall webworm, filbert from C2 cultures of EG1 1658, EG12156, and EG12158. 65 leafroller, filbert webworm, fruit tree leafroller, grape berry Twenty-five microliters (ul) of the suspensions were diluted moth, grape leaffolder, grapeleaf skeletonizer, green frlit with 75ul of sterile water and prepared for electrophoresis as worm, gummoSoS-batrachedra commosae, gypsy moth, US 7,772,369 B2 29 30 hickory shuckworm, homworms, loopers, navel orange caterpillar, Southwestern corn borer, soybean looper, spotted worm, obliquebanded leafroller, omnivorous leafroller. cutworm, Sunflower moth, tobacco budworm, tobacco horn omnivorous looper, orange tortrix, orangedog, oriental fruit worm, velvetbean caterpillar, moth, pandemis leafroller, peach twig borer, pecan nut case Bedding plants, flowers, ornamentals, vegetables and con bearer, redbanded leafroller, redhumped caterpillar, roughs- 5 tainer stock are frequently fed upon by a host of insect pests kinned cutworm, saltmarsh caterpillar, spanworm, tent cater pillar, thecla-thecla basillides,- - - - tobacco budworm, tortrix Such as armyworm, azalea moth, beet armyworm, diamond moth, tufted apple budmoth, variegated leafroller, walnut cat back moth, ello moth (hornworm), Florida fern caterpillar, Io erpillar, western tent caterpillar, and yellowstriped army moth, loopers, oleander moth, omnivorous leafroller, WO. omnivorous looper, and tobacco budworm. Field crops Such as canola/rape seed, evening primrose, Forests, fruit, ornamental, and nut-bearing trees, as well as meadow foam, corn (field, Sweet, popcorn), cotton, hops, shrubs and other nursery stock are often Susceptible to attack jojoba, peanuts, rice, safflower, Small grains (barley, oats, rye, from diverse insects such as bagworm, blackheaded bud wheat, etc.), Sorghum, soybeans, Sunflowers, and tobacco are worm, browntail moth, Califoria oakworm, douglas fir tus often targets for infestation by insects including armyworm, 15 sock moth, elm spanworm, fall webworm, fruittree leafroller, asian and other corn borers, banded sunflower moth, beet greenstriped mapleworm, gypsy moth, jack pine budworm, armyworm, bollworm, cabbage looper, corn rootworm (in- mimosa webworm, pine butterfly, redhumped caterpillar, cluding Southern and western varieties), cotton leaf perfora- saddleback caterpillar, saddle prominent caterpillar, spring tor, diamondback moth, european corn borer, green clover- and fall cankerworm, spruce budworm, tent caterpillar, tor worm, headmoth, headworm, imported cabbageworm, 20 trix, and western tussock moth. Likewise, turf grasses are loopers (including Anacamptodes spp.), obliquebanded lea- often attacked by pests such as armyworm, Sod webworm, froller, omnivorous leaftier, podworm, podworm, Saltmarsh and tropical sod webworm.

TABLE 1

TAXONOMY OF COLEOPTER ANPESTS IN THE SUBORDERS ARCHOSTEMATA AND POLYPHAGA Super Infraorder family Family Subfamily Tribe Genus Species Cupedidae (reticulated Priacna P Serraia beetles) Bostrichiformia Dermestidae (skin and AttagentiS A. pellio larder beetles) Chrysomeliformia Cerambycidae (long- Agapanthia Agapanthia sp. horned beetles) Lepturinae Leptura Leptura sp. (flower long-horned beetle) Rhagium Rhagium sp. Megacyllene M. robiniae Prioninae Derobrachus D. geminatius Tetraopes T. tetropthalmus Chrysomelidae (leaf Chlamisinae Exena E. neglecta beetles) Chrysomelinae Chrysomelini Chrysomela C. tremula, Chrysomela sp. Oreina O. cacaiae Doryphorini Chrysoline Chrysolina sp. Leptinotarsa L. decemlineata (Colorado potato beetle) Gonioctenini Goniocietna G. fornicata, G. holdausi, G. intermedia, G. interposita, G. kamikawai, G. innaeana, G. nigroplagiata, G. Occidentalis, G. olivacea, G. pallida, G. quin quieptinctata, G. rubripennis, G. rufipes, G. treaecim-maculata, G. variabilis, G. viiminais Timarchini Timarcha Timarcha sp. Criocerinae Ouiema Outlema sp. Galerucinae Galerucini Monoxia M. inornata, Monoxia sp. Ophraeila O. arctica, O. artemisiae, O. bilineata, O. commiina, O. Conferta, O. cribrata, O. notata, O. notitiata, O. nuda, O. pilosa, O. Sexvittata, O. Siobodkini Luperini Cerotona C. trifurcata Diabiotica D. barberi (northern corn rootworm), D. undecimptinctata, (Southern corn rootworm), D. virgifera US 7,772,369 B2 31 32

TABLE 1-continued

TAXONOMY OF COLEOPTER ANPESTS IN THE SUBORDERS ARCHOSTEMATA AND POLYPHAGA Super Infraorder family Family Subfamily Tribe Genus Species (western corn rootworm) unclassified Lachnaia Lachnaia sp. Chrysomelidae Epitrix E. cucumenis (Harris) (potato flea beetle), E. fiscala (eggplant flea beetle) Curculionidae (weevils) Curculioninae Anthonomis A. grandis (boll weevil) Entiminae Naupactini Aranigits A. Conirostris, A. globocatius, A. intermedius, A. pianioculus, A. tesselaints Otiorhynchus Otiorhynchus sp. Phyllobiini Diaprepes D. abbreviata Phyllobius Phyllobius sp. Galapagantis G. galapagoensis Hyperinae Hypera H. brunneipennis (Egyptian alfalfa weevil), H. postica (alfalfa weevil), H. punctata (clover leaf weevil) Molytinae Pissodes P. afinis, F2 memorensis, PSchwarzi, Pstrobi, P terminais Rhynchophorinae Sitophilini Sitophilus S. granarius (granary weevil), S. zeanais (maize weevil) Nemonychidae Lebanorhinus L. Sticcinits Scolytidae lps I. actiminattis, I. anniiniis, I. cembrae, I. duplicatus, I. mannsfeldi, I. Sexaeniatus, I. typographits Orthotomicus O. erostis Tonicus T. minor Cuculiformia Coccinellidae (ladybird Epilachna E. borealis (squash ladybird beetles) beetle), E. varivstis (Mexican bean beetle) Cuculidae (flat bark Cryptolestes C. ferruginetis beetles) Oryzaephilus O. Surinamensis (saw-toothed (grain grain beetle) beetles) Lagriidae (long-joined Lagria Lagria sp. beetles) Meloidae (blister beetles) Epicalita E. funebris Meioe M. proscarabaeus Rhipiphoridae Rhipiphorus R. fasciatus Tenebrionidae (darkling Alphitobius A. diaperint is ground beetles) (lesser mealworm) Hegeter H. amaroides, H. brevicois, H. CoStipennis, H. fernandezi, H. glaber, H. gomerensis, H. gran canariensis, H. impressus, H. intercedens, H. lateralis, H. plicifions, H. politus, H. Subrotundatus, H. tentii punctatus, H. transversus, H. webbianus Misolampus M. got idoti Paiorus Pficicola, Pratzeburgi (small eyed flour beetle), P subdepressus (depressed flour beetle) Pineia P. baetica, P. canariensis, P. criba, Pelevata, Pestevezi, P. fernan deziopezi, P. grandis, Pgranulicollis, Pintegra, Pinterjecta, P. laevigata, Pilitaria, Pradula, P. sparsa, P. varioiosa Tenebrio T. molitor (yellow mealworm), T. obscurus (dark mealworm) Tentyria T. Schaumi US 7,772,369 B2 33 34

TABLE 1-continued

TAXONOMY OF COLEOPTER ANPESTS IN THE SUBORDERS ARCHOSTEMATA AND POLYPHAGA Super Infraorder family Family Subfamily Tribe Genus Species Triboium T. brevicornis, T. Castaneum (red flour beetle), T. confusum (confused flour beetle), T. freemani, T. madens Zophobas Z. atratus Z. rugipes Elateriformia Elateroidea Octinodes Octinodes sp. Pyrophorus P plagio-phthalamits Scarabaeiformia Lucanidae (Stag beetles) Dorctiis D. paralleio-pipedits Lticantis L. Cervus Scarabaeidae Allomyrina A. dichotoma (lamellicorn beetles) Cetoniinae Pachnoda P marginata (flower beetle) Dynastinae Xvioryctes X. faints Geotrupinae Geotripes G. Stercorostis (earth-boring dung beetles) Melonlonthiinae Costelytra C. zealandica (chafers) Holotrichia H. diomphalia Meioioniha M. melolontha (cockchafer) Odontria O. Striata O. variegata Prodontria P. bicolorata, P. capito, Piewisii, Ptarsis, P. modesta, Pipinguis, P. praeiatella, P. truncata, Prodontria sp. Scythrodes S. squalidus Rutelinae Popiilia Piaponica (Japanese beetle) (shining leaf chafers) Scarabaeinae Copris C. lunaris (black dung beetle) Scarabaeus Scarabaei is sp. (Scarab) Staphyliniformia Hydrophilidae Cercyon Cercyon sp. Silphidae Nicrophorus N. americantis, N. marginiatus, N. orbicois, N. tomentosus Staphyllinidae (rove Carpelimits Carpelimits sp. beetles) Piedits P. mesomeini is Tachyporus Tachyporus sp. Xanthoints Xantholin its sp.

4.3 Nomenclature of B. Thuringiensis 8-Endotoxins Table 2 contains a list of the traditional, and currently TABLE 2-continued recognized nomenclature for the known Ö-endotoxins. Also NOMENCLATURE OF KNOWN B. THURINGIENSIS 8 shown are GenBank accession numbers for the sequenced 50 ENDOTOXINS polypeptides and polynucleotides. New Old GenBank Accession # TABLE 2 Cry1Ab2 Cry (A(b) M12661 Cry1Ab3 Cry (A(b) M15271 NOMENCLATURE OF KNOWN B. THURINGIENSIS 8- 55 Cry1Ab4 Cry (A(b) DOO117 ENDOTOXINS1 Cry1Ab5 Cry (A(b) XO4698 Cry1Ab6 Cry (A(b) M37263 New Old GenBank Accession # Cry1Ab7 Cry (A(b) X13233 Cry1Ab8 Cry (A(b) M16463 Cry1Aa1 CryLA(a) M112SO Cry1Ab9 Cry Cry1Aa2 CryLA(a) M10917 60 (A(b) XS4939 Cry1Aa3 CryLA(a) DOO348 Cry1Ab10 Cry (A(b) A2912S Cry1Aa4 CryLA(a) X13535 Cry1Ab11 I12419 Cry1Aas CryLA(a) D175182 Cry1Ab12 AFO57670 Cry1Aa.6 CryLA(a) U436OS Cry1Ac1 Cry A(c) M11068 Cry1Aa7 AFO81790 Cry1Ac2 Cry A(c) M3SS24 Cry1Aa.8 I261.49 Cry1Ac3 Cry A(c) XS4159 Cry1Aa.9 ABO26261 65 Cry1Ac4 Cry A(c) M73249 Cry1Ab1 CryLA(b) M13898 Cry1Ac5 Cry A(c) M73248

US 7,772,369 B2 37 38 4.4 Probes and Primers Promoters that function in bacteria are well-known in the art. In another aspect, DNA sequence information provided by An exemplary and preferred promoter for the Bacillus-de the invention allows for the preparation of relatively short rived crystal proteins include any of the known crystal protein DNA (or RNA) sequences having the ability to specifically gene promoters, including the cry gene promoters them hybridize to gene sequences of the selected polynucleotides selves. Alternatively, mutagenized or recombinant promoters disclosed herein. In these aspects, nucleic acid probes of an may be engineered by the hand of man and used to promote appropriate length are prepared based on a consideration of a expression of the novel gene segments disclosed herein. Selected crystal protein-encoding gene sequence, e.g., a In an alternate embodiment, the recombinant expression of sequence such as that disclosed herein. The ability of Such DNAs encoding the crystal proteins of the present invention is DNAs and nucleic acid probes to specifically hybridize to a 10 performed using a transformed Gram-negative bacterium crystal protein-encoding gene sequence lends them particular Such as an E. coli or Pseudomonas spp. host cell. Promoters utility in a variety of embodiments. Most importantly, the which function in high-level expression of target polypep probes may be used in a variety of assays for detecting the tides in E. coli and other Gram-negative host cells are also presence of complementary sequences in a given sample. well-known in the art. In certain embodiments, it is advantageous to use oligo 15 Where an expression vector of the present invention is to be nucleotide primers. The sequence of such primers is designed used to transform a plant, a promoter is selected that has the using a polynucleotide of the present invention for use in ability to drive expression in plants. Promoters that function detecting, amplifying or mutating a defined segment of a in plants are also well known in the art. Useful in expressing crystal protein gene from B. thuringiensis using PCRTM tech the polypeptide in plants are promoters that are inducible, nology. Segments of related crystal protein genes from other viral, synthetic, constitutive as described (Poszkowski et al., species may also be amplified by PCRTM using such primers. 1989; Odell et al., 1985), and temporally regulated, spatially To provide certain of the advantages in accordance with the regulated, and spatio-temporally regulated (Chau et al., present invention, a preferred nucleic acid sequence 1989). employed for hybridization studies or assays includes A promoter is also selected for its ability to direct the sequences that are complementary to at least an about 23 to 25 transformed plant cells or transgenic plants transcriptional about 40 or so long nucleotide stretch of a crystal protein activity to the coding region. Structural genes can be driven encoding sequence. Such as that shown herein. A size of at by a variety of promoters in plant tissues. Promoters can be least about 14 or 15 or so nucleotides in length helps to ensure near-constitutive, such as the CaMV 35S promoter, or tissue that the fragment will be of sufficient length to form a duplex specific or developmentally specific promoters affecting molecule that is both stable and selective. Molecules having 30 dicots or monocots. complementary sequences over stretches greater than about Where the promoter is a near-constitutive promoter such as 23 or so bases in length are generally preferred, though, in CaMV 35S, increases in polypeptide expression are found in order to increase stability and selectivity of the hybrid, and a variety of transformed plant tissues (e.g., callus, leaf, seed thereby improve the quality and degree of specific hybrid and root). Alternatively, the effects of transformation can be molecules obtained. One will generally prefer to design 35 directed to specific plant tissues by using plant integrating nucleic acid molecules having gene-complementary stretches vectors containing a tissue-specific promoter. of about 14 to about 20 nucleotides, or even longer where An exemplary tissue-specific promoter is the lectin pro desired. Such fragments may be readily prepared by, for moter, which is specific for seed tissue. The Lectin protein in example, directly synthesizing the fragment by chemical Soybean seeds is encoded by a single gene (Lel) that is only means, by application of nucleic acid reproduction technol 40 expressed during seed maturation and accounts for about 2 to ogy, such as the PCRTM technology of U.S. Pat. Nos. 4,683, about 5% of total seed mRNA. The lectin gene and seed 195, and 4,683.202, specifically incorporated herein by ref specific promoter have been fully characterized and used to erence, or by excising selected DNA fragments from direct seed specific expression in transgenic tobacco plants recombinant plasmids containing appropriate inserts and (Vodkinet al., 1983: Lindstrom et al., 1990.) suitable restriction sites. 45 An expression vector containing a coding region that encodes a polypeptide of interest is engineered to be under 4.5 Expression Vectors control of the lectin promoter and that vector is introduced The present invention contemplates a polynucleotide of the into plants using, for example, a protoplast transformation present invention comprised within one or more expression method (Dhir et al., 1991a). The expression of the polypep vectors. Thus, in one embodiment an expression vector com 50 tide is directed specifically to the seeds of the transgenic prises a nucleic acid segment containing a crystal protein plant. encoding gene operably linked to a promoter which expresses A transgenic plant of the present invention produced from the gene. Additionally, the coding region may also be oper a plant cell transformed with a tissue specific promoter can be ably linked to a transcription-terminating region, whereby the crossed with a second transgenic plant developed from a plant promoter drives the transcription of the coding region, and the 55 cell transformed with a different tissue specific promoter to transcription-terminating region halts transcription at Some produce a hybrid transgenic plant that shows the effects of point 3' of the coding region. transformation in more than one specific tissue. As used herein, the term “operatively linked' means that a Exemplary tissue-specific promoters are corn Sucrose syn promoter is connected to an coding region in Such a way that thetase 1 (Yang et al., 1990), corn alcohol dehydrogenase 1 the transcription of that coding region is controlled and regu 60 (Vogel et al., 1989), corn light harvesting complex (Simpson, lated by that promoter. Means for operatively linking a pro 1986), corn heat shock protein (Odell et al., 1985), pea small moter to a coding region are well known in the art. subunit RuBP carboxylase (Poulsen et al., 1986; Cashmore et In a preferred embodiment, the recombinant expression of al., 1983), Tiplasmid mannopine synthase (Langridge et al., DNAs encoding the crystal proteins of the present invention is 1989), Tiplasmid nopaline syntase (Langridge et al., 1989), preferable in a Bacillus host cell. Preferred host cells include 65 petunia chalcone isomerase (Van Tunen et al., 1988), bean B. thuringiensis, B. megaterium, B. subtilis, and related glycine rich protein 1 (Keller et al., 1989), CaMV 35S tran bacilli, with B. thuringiensis host cells being highly preferred. script (Odell et al., 1985) and Potato patatin (Wenzler et al., US 7,772,369 B2 39 40 1989). Preferred promoters are the cauliflower mosaic virus nomenclature of crystal protein endotoxins will be assigned (CaMV 35S) promoter and the S-E9 small subunit RuBP by a committee on the nomenclature of B. thuringiensis, carboxylase promoter. formed to systematically classify B. thuringiensis crystal pro The choice of which expression vector and ultimately to teins. The inventors contemplate that the arbitrarily assigned which promoter a polypeptide coding region is operatively 5 designations of the present invention will be superseded by linked depends directly on the functional properties desired, the official nomenclature assigned to these sequences. e.g., the location and timing of protein expression, and the host cell to be transformed. These are well known limitations 4.9 Transformed Host Cells and Transgenic Plants inherent in the art of constructing recombinant DNA mol Methods and compositions for transforming a bacterium, a ecules. However, a vector useful in practicing the present 10 yeast cell, a plant cell, or an entire plant with one or more invention is capable of directing the expression of the expression vectors comprising a crystal protein-encoding polypeptide coding region to which it is operatively linked. gene segment are further aspects of this disclosure. A trans Typical vectors useful for expression of genes in higher genic bacterium, yeast cell, plant cell or plant derived from plants are well known in the art and include vectors derived Such a transformation process or the progeny and seeds from from the tumor-inducing (Ti) plasmid of Agrobacterium 15 Such a transgenic plant are also further embodiments of the tumefaciens described (Rogers et al., 1987). However, several invention. other plant integrating vector systems are known to function Means for transforming bacteria and yeast cells are well in plants including pCaMVCN transfer control vector known in the art. Typically, means of transformation are described (Fromm et al., 1985). pCaMVCN (available from similar to those well known means used to transform other Pharmacia, Piscataway, N.J.) includes the cauliflower mosaic 20 bacteria or yeast Such as E. coli or Saccharomyces cerevisiae. virus CaMV 35S promoter. Methods for DNA transformation of plant cells include Agro In preferred embodiments, the vector used to express the bacterium-mediated plant transformation, protoplast trans polypeptide includes a selection marker that is effective in a formation, gene transfer into pollen, injection into reproduc plant cell, preferably a drug resistance selection marker. One tive organs, injection into immature embryos and particle preferred drug resistance marker is the gene whose expres- 25 bombardment. Each of these methods has distinct advantages sion results in kanamycin resistance; i.e., the chimeric gene and disadvantages. Thus, one particular method of introduc containing the nopaline synthase promoter, Tn5 neomycin ing genes into a particular plant strain may not necessarily be phosphotransferase II (nptII) and nopaline synthase 3' non the most effective for another plant strain, but it is well known translated region described (Rogers et al., 1988). which methods are useful for a particular plant Strain. RNA polymerase transcribes a coding DNA sequence 30 There are many methods for introducing transforming through a site where polyadenylation occurs. Typically, DNA DNA segments into cells, but not all are suitable for deliver sequences located a few hundred base pairs downstream of ing DNA to plant cells. Suitable methods are believed to the polyadenylation site serve to terminate transcription. include virtually any method by which DNA can be intro Those DNA sequences are referred to herein as transcription duced into a cell. Such as by Agrobacterium infection, direct termination regions. Those regions are required for efficient 35 delivery of DNA such as, for example, by PEG-mediated polyadenylation of transcribed messenger RNA (mRNA). transformation of protoplasts (Omirulleh et al., 1993), by Means for preparing expression vectors are well known in desiccation/inhibition-mediated DNA uptake, by electropo the art. Expression (transformation vectors) used to transform ration, by agitation with silicon carbide fibers, by acceleration plants and methods of making those vectors are described in of DNA coated particles, etc. In certain embodiments, accel U.S. Pat. Nos. 4,971,908, 4,940,835, 4,769,061 and 4,757, 40 eration methods are preferred and include, for example, 011, the disclosures of which are specifically incorporated microprojectile bombardment and the like. herein by reference in their entirety. Those vectors can be Technology for introduction of DNA into cells is well modified to include a coding sequence in accordance with the known to those of skill in the art. Four general methods for present invention. delivering a gene into cells have been described: (1) chemical A variety of methods has been developed to operatively 45 methods (Graham and van der Eb, 1973; Zatloukal et al., inserta DNA segment into a vector via complementary cohe 1992); (2) physical methods such as microinjection (Capec sive termini or blunt ends. For instance, complementary chi, 1980), electroporation (Wong and Neumann, 1982; homopolymer tracts can be added to the DNA segment to be Fromm et al., 1985; U.S. Pat. No. 5,384.253) and the gene gun inserted and to the vector DNA. The vector and DNA segment (Johnston and Tang, 1994: Fynan et al., 1993); (3) viral vec are then joined by hydrogen bonding between the comple 50 tors (Clapp, 1993: Lu et al., 1993; Eglitis and Anderson, mentary homopolymeric tails to form recombinant DNA 1988a; Eglitis et al., 1988), and (4) receptor-mediated mecha molecules. nisms (Curiel et al., 1991; 1992: Wagner et al., 1992). A coding region that encodes a polypeptide having the ability to confer insecticidal activity to a cell is preferably a B. 4.9.1 Electroporation thuringiensis crystal protein-encoding gene. In preferred 55 The application of brief, high-voltage electric pulses to a embodiments, such a polypeptide has the amino acid residue variety of animal and plant cells leads to the formation of sequence of one of the sequences disclosed herein, or a func nanometer-sized pores in the plasma membrane. DNA is tional equivalent thereof. In accordance with Such embodi taken directly into the cell cytoplasm either through these ments, a coding region comprising the DNA sequence of such pores or as a consequence of the redistribution of membrane a sequence is also preferred 60 components that accompanies closure of the pores. Elec troporation can be extremely efficient and can be used both 4.8 Nomenclature of The Novel Proteins for transient expression of clones genes and forestablishment The inventors have arbitrarily assigned designations to the of cell lines that carry integrated copies of the gene of interest. novel proteins of the invention. Likewise, the arbitrary gene Electroporation, in contrast to calcium phosphate-mediated designations have been assigned to the novel nucleic acid 65 transfection and protoplast fusion, frequently gives rise to cell sequence which encodes these polypeptides. Formal assign lines that carry one, or at most a few, integrated copies of the ment of gene and protein designations based on the revised foreign DNA. US 7,772,369 B2 41 42 The introduction of DNA by means of electroporation, is linearized DNA or intact supercoiled plasmids. It is believed well-known to those of skill in the art. In this method, certain that pre-bombardment manipulations are especially impor cell wall-degrading enzymes, such as pectin-degrading tant for Successful transformation of immature embryos. enzymes, are employed to render the target recipient cells Accordingly, it is contemplated that one may wish to adjust more Susceptible to transformation by electroporation than 5 various of the bombardment parameters in Small scale studies untreated cells. Alternatively, recipient cells are made more to fully optimize the conditions. One may particularly wish to Susceptible to transformation, by mechanical wounding. To adjust physical parameters such as gap distance, flight dis effect transformation by electroporation one may employ tance, tissue distance, and helium pressure. One may also either friable tissues such as a Suspension culture of cells, or minimize the trauma reduction factors (TRFs) by modifying embryogenic callus, or alternatively, one may transform 10 conditions which influence the physiological state of the immature embryos or other organized tissues directly. One recipient cells and which may therefore influence transfor would partially degrade the cell walls of the chosen cells by mation and integration efficiencies. For example, the osmotic exposing them to pectin-degrading enzymes (pectolyases) or state, tissue hydration and the Subculture stage or cell cycle of mechanically wounding in a controlled manner. Such cells the recipient cells may be adjusted for optimum transforma would then be recipient to DNA transfer by electroporation, 15 tion. The execution of other routine adjustments will be which may be carried out at this stage, and transformed cells known to those of skill in the art in light of the present then identified by a Suitable selection or screening protocol disclosure. dependent on the nature of the newly incorporated DNA. 4.9.3 Agrobacterium-Mediated Transfer 4.9.2 Microprojectile Bombardment Agrobacterium-mediated transfer is a widely applicable A further advantageous method for delivering transform system for introducing genes into plant cells because the ing DNA segments to plant cells is microprojectile bombard DNA can be introduced into whole plant tissues, thereby ment. In this method, particles may be coated with nucleic bypassing the need for regeneration of an intact plant from a acids and delivered into cells by a propelling force. Exem protoplast. The use of Agrobacterium-mediated plant inte plary particles include those comprised of tungsten, gold, 25 grating vectors to introduce DNA into plant cells is well platinum, and the like. known in the art. See, for example, the methods described An advantage of microprojectile bombardment, in addition (Fraley et al., 1985; Rogers et al., 1987). Further, the integra to it being an effective means of reproducibly stably trans tion of the Ti-DNA is a relatively precise process resulting in forming monocots, is that neither the isolation of protoplasts few rearrangements. The region of DNA to be transferred is (Cristou et al., 1988) nor the susceptibility to Agrobacterium 30 defined by the border sequences, and intervening DNA is infection is required. An illustrative embodiment of a method usually inserted into the plant genome as described (Spiel for delivering DNA into maize cells by acceleration is a mann et al., 1986; Jorgensen et al., 1987). Biolistics Particle Delivery System, which can be used to Modern Agrobacterium transformation vectors are capable propel particles coated with DNA or cells through a screen, of replication in E. coli as well as Agrobacterium, allowing Such as a stainless Steel or Nytex screen, onto a filter Surface 35 for convenient manipulations as described (Klee et al., 1985). covered with corn cells cultured in Suspension. The screen Moreover, recent technological advances in vectors for Agro disperses the particles so that they are not delivered to the bacterium-mediated gene transfer have improved the recipient cells in large aggregates. It is believed that a screen arrangement of genes and restriction sites in the vectors to intervening between the projectile apparatus and the cells to facilitate construction of vectors capable of expressing vari be bombarded reduces the size of projectiles aggregate and 40 ous polypeptide coding genes. The vectors described (Rogers may contribute to a higher frequency of transformation by et al., 1987), have convenient multi-linker regions flanked by reducing damage inflicted on the recipient cells by projectiles a promoter and a polyadenylation site for direct expression of that are too large. inserted polypeptide coding genes and are suitable for present For the bombardment, cells in suspension are preferably purposes. In addition, Agrobacterium containing both armed concentrated on filters or solid culture medium. Alternatively, 45 and disarmed Tigenes can be used for the transformations. In immature embryos or other target cells may be arranged on those plant strains where Agrobacterium-mediated transfor solid culture medium. The cells to be bombarded are posi mation is efficient, it is the method of choice because of the tioned at an appropriate distance below the macroprojectile facile and defined nature of the gene transfer. stopping plate. If desired, one or more screens are also posi Agrobacterium-mediated transformation of leaf disks and tioned between the acceleration device and the cells to be 50 other tissues such as cotyledons and hypocotyls appears to be bombarded. Through the use of techniques set forth herein limited to plants that Agrobacterium naturally infects. Agro one may obtain up to 1000 or more foci of cells transiently bacterium-mediated transformation is most efficient in expressing a marker gene. The number of cells in a focus dicotyledonous plants. Few monocots appear to be natural which express the exogenous gene product 48 hr post-bom hosts for Agrobacterium, although transgenic plants have bardment often range from 1 to 10 and average 1 to 3. 55 been produced in asparagus using Agrobacterium vectors as In bombardment transformation, one may optimize the described (Bytebier et al., 1987). Therefore, commercially prebombardment culturing conditions and the bombardment important cereal grains such as rice, corn, and wheat must parameters to yield the maximum numbers of stable transfor usually be transformed using alternative methods. However, mants. Both the physical and biological parameters for bom as mentioned above, the transformation of asparagus using bardment are important in this technology. Physical factors 60 Agrobacterium can also be achieved (see, for example, Byte are those that involve manipulating the DNA/microprojectile bier et al., 1987). precipitate or those that affect the flight and velocity of either A transgenic plant formed using Agrobacterium transfor the macro- or microprojectiles. Biological factors include all mation methods typically contains a single gene on one chro steps involved in manipulation of cells before and immedi mosome. Such transgenic plants can be referred to as being ately after bombardment, the osmotic adjustment of target 65 heterozygous for the added gene. However, inasmuch as use cells to help alleviate the trauma associated with bombard of the word “heterozygous' usually implies the presence of a ment, and also the nature of the transforming DNA, such as complementary gene at the same locus of the second chro US 7,772,369 B2 43 44 mosome of a pair of chromosomes, and there is no such gene during transcription. Second, full length RNA may be pro in a plant containing one added gene as here, it is believed that duced in the plant cell, but then processed (splicing, polyA a more accurate name for Such a plant is an independent addition) in the nucleus in a fashion that creates a nonfunc segregant, because the added, exogenous gene segregates tional mRNA. If the RNA is not properly synthesized, termi independently during mitosis and meiosis. nated and polyadenylated, it cannot move to the cytoplasm for More preferred is a transgenic plant that is homozygous for translation. Similarly, in the cytoplasm, if mRNAs have the added structural gene; i.e., a transgenic plant that contains reduced half lives (which are determined by their primary or two added genes, one gene at the same locus on each chro secondary sequence) insufficient protein product will be pro mosome of a chromosome pair. A homozygous transgenic duced. In addition, there is an effect, whose magnitude is plant can be obtained by sexually mating (selfing) an inde 10 uncertain, of translational efficiency on mRNA half-life. In pendent segregant transgenic plant that contains a single addition, every RNA molecule folds into a particular struc added gene, germinating some of the seed produced and ture, or perhaps family of structures, which is determined by analyzing the resulting plants produced for enhanced car its sequence. The particular structure of any RNA might lead boxylase activity relative to a control (native, non-transgenic) to greater or lesser stability in the cytoplasm. Structure perse or an independent segregant transgenic plant. 15 is probably also a determinant of mRNA processing in the It is to be understood that two different transgenic plants nucleus. Unfortunately, it is impossible to predict, and nearly can also be mated to produce offspring that contain two impossible to determine, the structure of any RNA (except for independently segregating added, exogenous genes. Selfing tRNA) in vitro or in vivo. However, it is likely that dramati of appropriate progeny can produce plants that are homozy cally changing the sequence of an RNA will have a large gous for both added, exogenous genes that encode a polypep effect on its folded structure It is likely that structure perse or tide of interest. Back-crossing to a parental plant and out particular structural features also have a role in determining crossing with a non-transgenic plant are also contemplated. RNA stability. 4.9.4 Other Transformation Methods To overcome these limitations in foreign gene expression, Transformation of plant protoplasts can be achieved using researchers have identified particular sequences and signals methods based on calcium phosphate precipitation, polyeth 25 in RNAs that have the potential for having a specific effect on ylene glycol treatment, electroporation, and combinations of RNA stability. In certain embodiments of the invention, there these treatments (see, e.g., Potrykus et al., 1985; Lorz et al., fore, there is a desire to optimize expression of the disclosed 1985; Fromm et al., 1986: Uchimiya et al., 1986; Callis et al., nucleic acid segments in planta. One particular method of 1987; Marcotte et al., 1988). doing so, is by alteration of the bacterial gene to remove Application of these systems to different plant Strains 30 sequences or motifs which decrease expression in a trans depends upon the ability to regenerate that particular plant formed plant cell. The process of engineering a coding strain from protoplasts. Illustrative methods for the regenera sequence for optimal expression in planta is often referred to tion of cereals from protoplasts are described (Fujimura et al., as “plantizing a DNA sequence. 1985; Toriyama et al., 1986:Yamada et al., 1986; Abdullah et Particularly problematic sequences are those which are al., 1986). 35 A+T rich. Unfortunately, since B. thuringiensis has an A+T To transform plant strains that cannot be successfully rich genome, native crystal protein gene sequences must regenerated from protoplasts, other ways to introduce DNA often be modified for optimal expression in a plant. The into intact cells or tissues can be utilized. For example, regen sequence motif ATTTA (or AUUUA as it appears in RNA) has eration of cereals from immature embryos or explants can be been implicated as a destabilizing sequence in mammalian effected as described (Vasil, 1988). In addition, “particle gun’ 40 cell mRNA (Shaw and Kamen, 1986). Many short lived or high-velocity microprojectile technology can be utilized mRNAs have A+T rich 3' untranslated regions, and these (Vasil et al., 1992). regions often have the ATTTA sequence, sometimes present Using that latter technology, DNA is carried through the in multiple copies or as multimers (e.g., ATTTATTTA . . . ). cell wall and into the cytoplasm on the surface of small metal Shaw and Kamen showed that the transfer of the 3' end of an 45 unstable mRNA to a stable RNA (globin or VA1) decreased particles as described (Klein et al., 1987; Klein et al., 1988: the stable RNA's half life dramatically. They further showed McCabe et al., 1988). The metal particles penetrate through that a pentamer of ATTTA had a profound destabilizing effect several layers of cells and thus allow the transformation of on a stable message, and that this signal could exert its effect cells within tissue explants. whether it was located at the 3' end or within the coding 4.9.5 Gene Expression in Plants 50 sequence. However, the number of ATTTA sequences and/or Although great progress has been made in recent years the sequence context in which they occur also appear to be with respect to preparation of transgenic plants which express important in determining whether they function as destabi bacterial proteins such as B. thuringiensis crystal proteins, the lizing sequences. Shaw and Kamen showed that a trimer of results of expressing native bacterial genes in plants are often ATTTA had much less effect than a pentamer on mRNA disappointing. Unlike microbial genetics, little was known by 55 stability and a dimer or a monomer had no effect on stability early plant geneticists about the factors which affected heter (Shaw and Kamen, 1987). Note that multimers of ATTTA ologous expression of foreign genes in plants. In recent years, Such as a pentamer automatically create an A+T rich region. however, several potential factors have been implicated as This was shown to be a cytoplasmic effect, not nuclear. In responsible in varying degrees for the level of protein expres other unstable mRNAs, the ATTTA sequence may be present sion from a particular coding sequence. For example, Scien 60 in only a single copy, but it is often contained in an A+T rich tists now know that maintaining a significant level of a par region. From the animal cell data collected to date, it appears ticular mRNA in the cell is indeed a critical factor. that ATTTA at least in some contexts is important in stability, Unfortunately, the causes for low steady state levels of mRNA but it is not yet possible to predict which occurrences of encoding foreign proteins are many. First, full length RNA ATTTA are destabilizing elements or whether any of these synthesis may not occur at a high frequency. This could, for 65 effects are likely to be seen in plants. example, be caused by the premature termination of RNA Some studies on mRNA degradation in animal cells also during transcription or due to unexpected mRNA processing indicate that RNA degradation may begin in some cases with US 7,772,369 B2 45 46 nucleolytic attack in A+T rich regions. It is not clear if these changes in a normal gene. In a heterologous gene, it is even cleavages occur at ATTTA sequences. There are also harder to predict the consequences. However, it is possible examples of mRNAs that have differential stability depend that the putative sites identified are dysfunctional. That is, ing on the cell type in which they are expressed or on the stage these sites may not act as proper polyA sites, but instead within the cell cycle at which they are expressed. For 5 function as aberrant sites that give rise to unstable mRNAs. example, histone mRNAs are stable during DNA synthesis In animal cell systems, AATAAA is by far the most com but unstable if DNA synthesis is disrupted. The 3' end of some mon signal identified in mRNAs upstream of the polyA, but at histone mRNAs seems to be responsible for this effect (Pan least four variants have also been found (Wickens and dey and Marzluff, 1987). It does not appear to be mediated by Stephenson, 1984). In plants, not nearly so much analysis has ATTTA, nor is it clear what controls the differential stability 10 been done, but it is clear that multiple sequences similar to of this mRNA. Another example is the differential stability of AATAAA can be used. The plant sites in Table 3 called major IgG mRNA in B lymphocytes during B cell maturation (Gen or minor refer only to the study of Dean et al. (1986) which ovese and Milcarek, 1988). These examples all provide evi analyzed only three types of plant gene. The designation of dence that mRNA stability can be mediated by cell type or cell polyadenylation sites as major or minor refers only to the cycle specific factors. Furthermore this type of instability is 15 frequency of their occurrence as functional sites in naturally not yet associated with specific sequences. Given these uncer occurring genes that have been analyzed. In the case of plants tainties, it is not possible to predict which RNAs are likely to this is a very limited database. It is hard to predict with any be unstable in a given cell. In addition, even the ATTTA motif certainty that a site designated major or minor is more or less may act differentially depending on the nature of the cell in likely to function partially or completely when found in a which the RNA is present. Shaw and Kamen (1987) have heterologous gene Such as those encoding the crystal proteins reported that activation of protein kinase C can block degra of the present invention. dation mediated by ATTTA. The addition of a polyadenylate string to the 3' end is TABLE 3 common to most eukaryotic mRNAS, both plant and animal. The currently accepted view of polyA addition is that the 25 POLYADENYLATION SITES IN PLANT GENES nascent transcript extends beyond the mature 3' terminus. Contained within this transcript are signals for polyadenyla PA AATAAA Major consensus site tion and proper 3' end formation. This processing at the 3' end P1A AATAAT Major plant site involves cleavage of the mRNA and addition of polyA to the P2A AACCAA Minor plant site mature 3' end. By searching for consensus sequences near the 30 polyA tract in both plant and animal mRNAs, it has been P3A ATATAA possible to identify consensus sequences that apparently are involved in polyA addition and 3' end cleavage. The same P4A AATCAA consensus sequences seem to be important to both of these PSA ATACTA processes. These signals are typically a variation on the 35 sequence AATAAA. In animal cells, some variants of this P6A. ATAAAA sequence that are functional have been identified; in plant cells there seems to be an extended range of functional PFA ATGAAA sequences (Wickens and Stephenson, 1984; Dean et al., P8A AAGCAT 1986). Because all of these consensus sequences are varia 40 tions on AATAAA, they all are A+T rich sequences. This P9A ATTAAT sequence is typically found 15 to 20 bp before the polyA tract P1OA ATACAT in a mature mRNA. Studies in animal cells indicate that this sequence is involved in both polyA addition and 3' matura P11A AAAATA tion. Site directed mutations in this sequence can disrupt these 45 functions (Conway and Wickens, 1988; Wickens et al., 1987). P12A ATTAAA Minor animal site However, it has also been observed that sequences up to 50 to P13A AATTAA 100 bp 3' to the putative polyA signal are also required; i.e. a gene that has a normal AATAAA but has been replaced or P14A. AATACA disrupted downstream does not get properly polyadenylated 50 P15A CATAAA (Gil and Proudfoot, 1984; Sadofsky and Alwine, 1984; McDevitt et al., 1984). That is, the polyA signal itself is not Sufficient for complete and proper processing. It is not yet The present invention provides a method for preparing known what specific downstream sequences are required in synthetic plant genes which genes express their protein prod addition to the polyA signal, or if there is a specific sequence 55 uct at levels significantly higher than the wild-type genes that has this function. Therefore, sequence analysis can only which were commonly employed in plant transformation identify potential polyA signals. heretofore. In another aspect, the present invention also pro In naturally occurring mRNAS that are normally polyade vides novel synthetic plant genes which encode non-plant nylated, it has been observed that disruption of this process, proteins. either by altering the polyA signal or other sequences in the 60 As described above, the expression of native B. thuring mRNA, profound effects can be obtained in the level of func iensis genes in plants is often problematic. The nature of the tional mRNA. This has been observed in several naturally coding sequences of B. thuringiensis genes distinguishes occurring mRNAS, with results that are gene-specific So far. them from plant genes as well as many other heterologous It has been shown that in natural mRNAs proper polyade genes expressed in plants. In particular, B. thuringiensis nylation is important in mRNA accumulation, an that disrup 65 genes are very rich (~62%) in adenine (A) and thymine (T) tion of this process can effect mRNA levels significantly. while plant genes and most other bacterial genes which have However, insufficient knowledge exists to predict the effect of been expressed in plants are on the order of 45-55% A+T. US 7,772,369 B2 47 48 Due to the degeneracy of the genetic code and the limited It is also preferred that regions comprising many consecu number of codon choices for any amino acid, most of the tive A+T bases or G+C bases are disrupted since these regions “excess' A+T of the structural coding sequences of some are predicted to have a higher likelihood to form hairpin Bacillus species are found in the third position of the codons. structure due to self-complementarity. Therefore, insertion of That is, genes of some Bacillus species have A or T as the third heterogeneous base pairs would reduce the likelihood of self nucleotide in many codons. Thus A+T content in part can complementary secondary structure formation which are determine codon usage bias. In addition, it is clear that genes known to inhibit transcription and/or translation in some organisms. In most cases, the adverse effects may be mini evolve for maximum function in the organism in which they mized by using sequences which do not contain more than evolve. This means that particular nucleotide sequences five consecutive A+T or G+C. found in a gene from one organism, where they may play no 10 role except to code for a particular stretch of amino acids, 4.9.6 Synthetic Oligonucleotides for Mutagenesis have the potential to be recognized as gene control elements When oligonucleotides are used in the mutagenesis, it is in another organism (such as transcriptional promoters or desirable to maintain the proper amino acid sequence and terminators, polyA addition sites, intron splice sites, or spe reading frame, without introducing common restriction sites cific mRNA degradation signals). It is perhaps Surprising that 15 such as BglII, HindIII, SacI, KpnI, EcoRI, Nco, PstI and Sall Such misread signals are not a more common feature of het into the modified gene. These restriction sites are found in erologous gene expression, but this can be explained in part poly-linker insertion sites of many cloning vectors. Ofcourse, by the relatively homogeneous A+T content (-50%) of many the introduction of new polyadenylation signals, ATTTA organisms. This A+T content plus the nature of genetic code sequences or consecutive stretches of more than five A+T or put clear constraints on the likelihood of occurrence of any G+C, should also be avoided. The preferred size for the oli particular oligonucleotide sequence. Thus, a gene from E. gonucleotides is about 40 to about 50 bases, but fragments coli with a 50% A+T content is much less likely to contain any ranging from about 18 to about 100 bases have been utilized. particular A+T rich segment than a gene from B. thuringien In most cases, a minimum of about 5 to about 8 base pairs of SS. homology to the template DNA on both ends of the synthe Typically, to obtain high-level expression of the 8-endot sized fragment are maintained to insure proper hybridization oxin genes in plants, existing structural coding sequence 25 of the primer to the template. The oligonucleotides should (“structural gene') which codes for the 8-endotoxin are modi avoid sequences longer than five base pairs A+T or G+C. fied by removal of ATTTA sequences and putative polyade Codons used in the replacement of wild-type codons should nylation signals by site directed mutagenesis of the DNA preferably avoid the TA or CG doublet wherever possible. comprising the structural gene. It is most preferred that Sub Codons are selected from a plant preferred codon table (such stantially all the polyadenylation signals and ATTTA 30 as Table 4 below) so as to avoid codons which are rarely found sequences are removed although enhanced expression levels in plant genomes, and efforts should be made to select codons are observed with only partial removal of either of the above to preferably adjust the G+C content to about 50%. identified sequences. Alternately if a synthetic gene is pre pared which codes for the expression of the subject protein, TABLE 4 codons are selected to avoid the ATTTA sequence and puta 35 tive polyadenylation signals. For purposes of the present PREFERRED CODON USAGE IN PLANTS invention putative polyadenylation signals include, but are not necessarily limited to, AATAAA, AATAAT. AACCAA, Amino Acid Codon Percent Usage in Plants ATATAAAATCAA, ATACTA, ATAAAA, ATGAAAAAG ARG CGA 7 CAT, ATTAAT, ATACAT. AAAATA, ATTAAA AATTAA, 40 AATACA and CATAAA. In replacing the ATTTA sequences CGC 11 and polyadenylation signals, codons are preferably utilized CGG 5 which avoid the codons which are rarely found in plant genomes. CGU 25 The selected DNA sequence is scanned to identify regions 45 with greater than four consecutive adenine (A) or thymine (I) AGA 29 nucleotides. The A+T regions are scanned for potential plant AGG 23 polyadenylation signals. Although the absence offive or more consecutive A or T nucleotides eliminates most plant poly LEU CUA. 8 adenylation signals, if there are more than one of the minor polyadenylation signals identified within ten nucleotides of 50 CUC 2O each other, then the nucleotide sequence of this region is CUG 1O preferably altered to remove these signals while maintaining the original encoded amino acid sequence. CUU 28 The second step is to consider the about 15 to about 30 or so nucleotide residues Surrounding the A+T rich region iden 55 UUA 5 tified in step one. If the A+T content of the Surrounding region UUG 3O is less than 80%, the region should be examined for polyade nylation signals. Alteration of the region based on polyade SER UCA 14 nylation signals is dependent upon (1) the number of poly UCC 26 adenylation signals present and (2) presence of a major plant 60 polyadenylation signal. UCG 3 The extended region is examined for the presence of plant polyadenylation signals. The polyadenylation signals are UCU 21 removed by site-directed mutagenesis of the DNA sequence. AGC 21 The extended region is also examined for multiple copies of 65 the ATTTA sequence which are also removed by mutagen AGU 15 CS1S. US 7,772,369 B2 49 50

TABL 4- Continued TABLE 4 - continued

PREFERRED CODON USAGE IN PLANTS PREFERRED CODON USAGE IN PLANTS

Amino Acid Codon Percent Usage in Plants Amino Acid Codon Percent Usage in Plants

CYS UGC 78 THR ACA 21 UGU 22 ACC 41 10 PHE UUC 56 ACG UUU 44 ACU 31 MET AUG 1 OO PRO CCA 45 15 TRP UGG 1 OO CCC 19 CCG Regions with many consecutive A+T bases or G+C bases are predicted to have a higher likelihood to form hairpin CCU 26 structures due to self-complementarity. Disruption of these ALA GCA 23 regions by the insertion of heterogeneous base pairs is pre ferred and should reduce the likelihood of the formation of GCC 32 self-complementary secondary structures such as hairpins which are known in Some organisms to inhibit transcription (transcriptional terminators) and translation (attenuators). 41 25 Alternatively, a completely synthetic gene for a given GLY GGA 32 amino acid sequence can be prepared, with regions of five or more consecutive A+T or G+C nucleotides being avoided. GGC Codons are selected avoiding the TA and CG doublets in GGG 11 30 codons whenever possible. Codon usage can be normalized against a plant preferred codon usage table (such as Table 4) GGU 37 and the G+C content preferably adjusted to about 50%. The resulting sequence should be examined to ensure that there ILE AUA. 12 are minimal putative plant polyadenylation signals and AUC 45 35 ATTTA sequences. Restriction sites found in commonly used cloning vectors are also preferably avoided. However, place AUU 43 ment of several unique restriction sites throughout the gene is WAL GUA. useful for analysis of gene expression or construction of gene variants. GUC 40 4.10 Methods for Producing Insect-Resistant Transgenic GUG 28 Plants

GUU 43 By transforming a suitable host cell. Such as a plant cell, with a recombinant cry gene-containing segment, the expres LYS 36 sion of the encoded crystal protein (i.e. a bacterial crystal 45 protein or polypeptide having insecticidal activity against AAG 64 Coleopterans) can result in the formation of insect-resistant ASN AAC 72 plants.

AAU 28 By way of example, one may utilize an expression vector 50 containing a coding region for a B. thuringiensis crystal pro GLN CAA 64 tein and an appropriate selectable marker to transform a sus pension of embryonic plant cells, such as wheat or corn cells CAG 36 using a method Such as particle bombardment (Maddocket HIS CAC 65 al., 1991; Vasil et al., 1992) to deliver the DNA coated on 55 microprojectiles into the recipient cells. Transgenic plants are CAU 35 then regenerated from transformed embryonic calli that GLU GAA 48 express the insecticidal proteins. The formation of transgenic plants may also be accom GAG 52 plished using other methods of cell transformation which are 60 known in the art such as Agrobacterium-mediated DNA ASP GAC 48 transfer (Fraley et al., 1983). Alternatively, DNA can be intro GAU 52 duced into plants by direct DNA transfer into pollen (Zhou et al., 1983; Hess, 1987; Luo et al., 1988), by injection of the TYR UAC 68 DNA into reproductive organs of a plant (Pena et al., 1987), or UAU 32 65 by direct injection of DNA into the cells of immature embryos followed by the rehydration of desiccated embryos (Neuhaus et al., 1987: Benbrook et al., 1986). US 7,772,369 B2 51 52 The regeneration, development, and cultivation of plants or plant-derived components. In such instances, the progeny from single plant protoplast transformants or from various and seed obtained from any generation of the transformed transformed explants is well known in the art (Weissbach and plants will contain the selected chromosomally-integrated Weissbach, 1988). This regeneration and growth process transgene that encodes the Ö-endotoxin of the present inven typically includes the steps of selection of transformed cells, 5 tion. The transgenic plants of the present invention may be culturing those individualized cells through the usual stages crossed to produce hybrid or inbred lines with one or more of embryonic development through the rooted plantlet stage. plants that have desirable properties. In certain circum Transgenic embryos and seeds are similarly regenerated. The stances, it may also be desirable to create transgenic plants, resulting transgenic rooted shoots are thereafter planted in an seed, and progeny that contain one or more additional trans appropriate plant growth medium such as soil. 10 genes incorporated into their genome in addition to the trans The development or regeneration of plants containing the gene encoding the polypeptide of the invention. For example, foreign, exogenous gene that encodes a polypeptide of inter the transgenic plants may contain a second gene encoding the est introduced by Agrobacterium from leaf explants can be same, or a different insect-resistance polypeptide, or alterna achieved by methods well known in the art such as described tively, the plants may comprise one or more additional trans (Horsch et al., 1985). In this procedure, transformants are 15 genes Such as those conferring herbicide resistance, fungal cultured in the presence of a selection agent and in a medium resistance, bacterial resistance, stress, salt, or drought toler that induces the regeneration of shoots in the plant strain ance, improved Stalk or root lodging, increased starch, grain, being transformed as described (Fraley et al., 1983). oil, carbohydrate, amino acid, protein production, and the This procedure typically produces shoots within two to like. four months and those shoots are then transferred to an appro- 20 priate root-inducing medium coldtaining the selective agent 4.11 Isolating Homologous Gene and Gene Fragments and an antibiotic to prevent bacterial growth. Shoots that The genes and Ö-endotoxins according to the Subject inven rooted in the presence of the selective agent ta form plantlets tion include not only the full length sequences disclosed are then transplanted to soil or other media to allow the herein but also fragments of these sequences, or fusion pro production of roots. These procedures vary depending upon 25 teins, which retain the characteristic insecticidal activity of the particular plant strain employed, such variations being the sequences specifically exemplified herein. well known in the art. It should be apparent to a person skill in this art that insec Preferably, the regenerated plants are self-pollinated to ticidal 8-endotoxins can be identified and obtained through provide homozygous transgenic plants, as discussed before. several means. The specific genes, orportions thereof, may be Otherwise, pollen obtained from the regenerated plants is 30 obtained from a culture depository, or constructed syntheti crossed to seed-grown plants of agronomically important, cally, for example, by use of a gene machine. Variations of preferably inbred lines. Conversely, pollen from plants of these genes may be readily constructed using standard tech those importantlines is used to pollinate regenerated plants. A niques for making point mutations. Also, fragments of these transgenic plant of the present invention containing a desired genes can be made using commercially available exonu polypeptide is cultivated using methods well known to one 35 cleases or endonucleases according to standard procedures. skilled in the art. For example, enzymes such as Bal31 or site-directed A transgenic plant of this invention thus has an increased mutagenesis can be used to systematically cut off nucleotides amount of a coding region (e.g., a gene) that encodes a from the ends of these genes. Also, genies which code for polypeptide as disclosed herein. A preferred transgenic plant active fragments may be obtained using a variety of other is an independent segregant and can transmit that gene and its 40 restriction enzymes. Proteases may be used to directly obtain activity to its progeny. A more preferred transgenic plant is active fragments of these Ö-endotoxins. homozygous for that gene, and transmits that gene to all of its Equivalent Ö-endotoxins and/or genes encoding these offspring on sexual mating. Seed from a transgenic plant may equivalent Ö-endotoxins can also be isolated from Bacillus be grown in the field or greenhouse, and resulting sexually strains and/or DNA libraries using the teachings provided mature transgenic plants are self-pollinated to generate true 45 herein. For example, antibodies to the 8-endotoxins disclosed breeding plants. The progeny from these plants become true and claimed herein can be used to identify and isolate other breeding lines that are evaluated for, by way of example, Ö-endotoxins from a mixture of proteins. Specifically, anti increased insecticidal capacity against coleopteran insects, bodies may be raised to the portions of the 8-endotoxins preferably in the field, under a range of environmental con which are most constant and most distinct from other B. ditions. The inventors contemplate that the present invention 50 thuringiensis 8-endotoxins. These antibodies can then be will find particular utility in the creation of transgenic plants used to specifically identify equivalent 8-endotoxins with the of commercial interest including various turf and pasture characteristic insecticidal activity by immunoprecipitation, grasses, rye, wheat, corn, kapok, flax, rice, barley, oats, Sug enzyme linked immunoassay (ELISA), or Western blotting. arcane, cotton, tomato, potato, soybeans and other legumes, A further method for identifying the 8-endotoxins and tobacco, Sorghum, as well as a variety of ornamental plants 55 genes of the Subject invention is through the use of oligo including cacti and Succulents, fruits, berries, vegetables, and nucleotide probes. These probes are nucleotide sequences also a number of nut- and fruit-bearing trees and plants. having a detectable label. As is well known in the art, if the Transgenic plants comprising one or more transgenes that probe molecule and nucleic acid sample hybridize by forming encode a polypeptide as described herein will preferably a strong bond between the two molecules, it can be reason exhibit a phenotype of improved or enhanced insect resis- 60 ably assumed that the probe and sample are essentially iden tance to the target coleopteran and lepidopteran insects as tical. The probe's detectable label provides a means for deter described herein. These plants will preferably provide trans mining in a known manner whether hybridization has genic seeds, which will be used to create lineages of trans occurred. Such a probe analysis provides a rapid method for genic plants (i.e. progeny or advanced generations of the identifying formicidal 6-endotoxin genes of the Subject original transgenic plant) that may be used to produce seed, or 65 invention. used as animal or human foodstuffs, or to produce fibers, oil, The nucleotide segments which are used as probes accord fruit, grains, or other commercially-important plant products ing to the invention can be synthesized by use of DNA syn US 7,772,369 B2 53 54 thesizers using standard procedures. In the use of the nucle tides, of particular interest will be the prokaryotes and the otide segments as probes, the particular probe is labeled with lower eukaryotes, such as fungi. Illustrative prokaryotes, both any suitable label known to those skilled in the art, including Gram-negative and Gram-positive, include Enterobacteri radioactive and non-radioactive labels. Typical radioactive aceae. Such as Escherichia, Erwinia, Shigella, Salmonella, labels include P, 'I, S, or the like. A probe labeled with 5 and Proteus, Bacillaceae, Rhizobiceae, such as Rhizobium, a radioactive isotope can be constructed from a nucleotide Spirillaceae, such as photobacterium, Zymomonas, Serratia, sequence complementary to the DNA sample by a conven Aeromonas, Vibrio, Desulfovibrio, Spirillum, Lactobacil tional nick translation reaction, using a DNase and DNA laceae, Pseudomonadaceae, Such as Pseudomonas and polymerase. The probe and sample can then be combined in a Acetobacter, Azotobacteraceae, Actinomycetales, and Nitro hybridization buffer solution and held at an appropriate tem 10 bacteraceae. Among eukaryotes are fungi, such as Phyco perature until annealing occurs. Thereafter, the membrane is mycetes and Ascomycetes, which includes yeast, such as washed free of extraneous materials, leaving the sample and Saccharomyces and Schizosaccharomyces; and Basidi bound probe molecules typically detected and quantified by omycetes yeast, such as Rhodotorula, Aureobasidium, autoradiography and/or liquid Scintillation counting. Sporobolomyces, and the like. Non-radioactive labels include, for example, ligands such 15 Characteristics of particular interest in selecting a host cell as biotin orthyroxin, as well as enzymes such as hydrolases or for purposes of production include ease of introducing the peroxidases, or the various chemiluminescers such as genetic constructs of the present invention into the host cell, luciferin, or fluorescent compounds like fluorescein and its availability of expression systems, efficiency of expression, derivatives. The probe may also be labeled at both ends with stability of the gene of interest in the host, and the presence of different types of labels for ease of separation, as, for auxiliary genetic capabilities. example, by using an isotopic label at the end mentioned A large number of microorganisms known to inhabit the above and a biotin label at the other end. phylloplane (the surface of the plant leaves) and/or the rhizo Duplex formation and stability depend on substantial sphere (the Soil Surrounding plant roots) of a wide variety of complementarity between the two strands of a hybrid, and, as important crops may also be desirable host cells for manipu noted above, a certain degree of mismatch can be tolerated. 25 lation, propagation, Storage, delivery and/or mutagenesis of Therefore, the probes of the subject invention include muta the disclosed genetic constructs. These microorganisms tions (both single and multiple), deletions, insertions of the include bacteria, algae, and fungi. Of particular interest are described sequences, and combinations thereof, wherein said microorganisms, such as bacteria, e.g., genera Bacillus (in mutations, insertions and deletions permit formation of stable cluding the species and subspecies B. thuringiensis kurstaki hybrids with the target polynucleotide of interest. Mutations, 30 HD-1, B. thuringiensis kurstaki HD-73, B. thuringiensis insertions, and deletions can be produced in a given poly Sotto, B. thuringiensis berliner; B. thuringiensis thuringien nucleotide sequence in many ways, by methods currently sis, B. thuringiensis tolworthi, B. thuringiensis dendrolimus, known to an ordinarily skilled artisan, and perhaps by other B. thuringiensis alesti, B. thuringiensis galleriae, B. thring methods which may become known in the future. iensis aizawai, B. thuringiensis subtoxicus, B. thuringiensis The potential variations in the probes listed is due, in part, 35 entomocidus, B. thuringiensistenebrionis and B. thuringien to the redundancy of the genetic code. Because of the redun sis San diego); Pseudomonas, Erwinia, Serratia, Klebsiella, dancy of the genetic code, i.e. more than one coding nucle Zanthomonas, Streptomyces, Rhizobium, Rhodopseudomo otide triplet (codon) can be used for most of the amino acids nas, Methylophilius, Agrobacterium, Acetobacter; Lactoba used to make proteins. Therefore different nucleotide cillus, Arthrobacter, Azotobacter, Leuconostoc, and Alcali sequences can code for a particular amino acid. Thus, the 40 genes; fungi, particularly yeast, e.g., genera Saccharomyces, amino acid sequences of the B. thuringiensis 6-endotoxins Cryptococcus, Kluyveromyces, Sporobolomyces, Rhodot and peptides can be prepared by equivalent nucleotide orula, and Aureobasidium. Of particular interest are Such sequences encoding the same amino acid sequence of the phytosphere bacterial species as Pseudomonas Syringae, protein or peptide. Accordingly, the Subject invention Pseudomonas fluorescens, Serratia marcescens, Acetobacter includes such equivalent nucleotide sequences. Also, inverse 45 xylinum, Agrobacterium tumefaciens, Rhodobactersphaeroi or complement sequences are an aspect of the Subject inven des, Xanthomonas campestris, Rhizobium melioti, Alcali tion and can be readily used by a person skilled in this art. In genes eutrophus, and Azotobacter vinlandii; and phytosphere addition it has been shown that proteins of identified structure yeast species such as Rhodotorula rubra, R. glutinis, R. and function may be constructed by changing the amino acid marina, K. aurantiaca, Cryptococcus albidus, C. difluens, C. sequence if such changes do not alter the protein secondary 50 laurentii, Saccharomyces rosei, S. pretoriensis, S. cerevisiae, structure (Kaiser and Kezdy, 1984). Thus, the subject inven Sporobolomyces roseus, S. odorus, Kluyveromyces veronae, tion includes mutants of the amino acid sequence depicted and Aureobasidium pollulans. herein which do not alter the protein secondary structure, or if Characteristics of particular interest in selecting a host cell the structure is altered, the biological activity is substantially for purposes of production include ease of introducing a retained. Further, the invention also includes mutants of selected genetic construct into the host, availability of expres organisms hosting all or part of a 6-endotoxin encoding a sion systems, efficiency of expression, stability of the poly gene of the invention. Such mutants can be made by tech nucleotide in the host, and the presence of auxiliary genetic niques well known to persons skilled in the art. For example, capabilities. Other considerations include ease of formulation irradiation can be used to prepare mutants of host organisms. and handling, economics, storage stability, and the like. Likewise, such mutants may include asporogenous host cells 60 which also can be prepared by procedures well known in the 4.14 Polynucleotide Sequences art. DNA compositions encoding the insecticidally-active polypeptides of the present invention are particularly pre 4.13 Recombinant Host Cells ferred for delivery to recipient plant cells, in the generation of The nucleotide sequences of the Subject invention may be 65 pluripotent plant cells, and ultimately in the production of introduced into a wide variety of microbial and eukaryotic insect-resistant transgenic plants. For example, DNA seg hosts. As hosts for recombinant expression of Cry polypep ments in the form of vectors and plasmids, or linear DNA US 7,772,369 B2 55 56 fragments, in Some instances containing only the DNA ele increase, decrease, or otherwise regulate or control these ment to be expressed in the plant cell, and the like, may be constructs in particular host cells and/or transgenic plants. employed. Vectors, plasmids, phagemids, cosmids, viral vectors, 4.16.1 Efficient Initiation of Protein Translation shuttle vectors, baculovirus vectors, BACs (bacterial artificial 5 The 5'-untranslated leader (5'-UTL) sequence of eukary chromosomes), YACs (yeast artificial chromosomes) and otic mRNA plays a major role in translational efficiency. DNA segments for use in transforming cells with a 6-endot Many early chimeric transgenes using a viral promoter used oxin encoding polynucleotide, will, of course, generally com an arbitrary length of viral sequence after the transcription prise at least a first gene that encodes the polypeptide in initiation site and fused this to the AUG of the coding region. accordance with SEQ ID NO:2, SEQ ID NO:4, SEQ ID 10 More recently studies have shown that the 5'-UTL sequence NO:6, SEQID NO:8, SEQID NO:10, SEQID NO:12, SEQ and the sequences directly surrounding the AUG can have a ID NO:14, SEQID NO:16, or SEQID NO:19, or a gene that large effect in translational efficiency in host cells and par encodes a polypeptide that has at least about 80% or 85% or ticularly certain plant species and that this effect can be dif 90% or 95% sequence identity to the amino acid sequence ferent depending on the particular cells or tissues in which the disclosed in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, 15 message is expressed. SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:19. These nucleic In most eukaryotic mRNAs, the point of translational ini acid constructs may comprise one or more genes which one tiation occurs at the AUG codon closest to the 5' cap of the desires to introduce into recipient cells. These DNA con transcript. Comparison of plant mRNA sequences and site structs can include structures such as promoters, enhancers, directed mutagenesis experiments have demonstrated the polylinkers, or regulatory genes as desired. The DNA seg existence of a consensus sequence Surrounding the initiation ment or gene chosen for cellular introduction will often codon in plants, 5'-UAAACAAUGGCU-3' (SEQID NO:35) (Joshi, 1987; Lutcke et al., 1987). However, consensus encode a polypeptide which will be expressed in the resultant sequences will be apparent amongst individual plant species. recombinant cells, such as will resultina Screenable or select For example, a compilation of sequences Surrounding the able trait and/or which will impart an improved phenotype to 25 the transformed host cell. Alternatively, the nucleic acid con initiation codon from 85 maize genes yields a consensus of 5'-(C/G)AUGGCG-3 (Luehrsenet al., 1994). In tobacco pro structs may contain antisense constructs, or ribozyme-encod toplasts, transgenes encoding B-glucuronidase (GUS) and ing regions when delivery or introduction of such nucleic acid bacterial chitinase showed a 4-fold and an 8-fold increase in constructs are desirable. expression, respectively, when the native sequences of these 4.15 Methods for Preparing Mutagenized Polynucleotides 30 genes were changed to encode 5'-ACCAUGG-3 (Gallie et al., In certain circumstances, it may be desirable to modify or 1987b; Jones et al., 1988). alter one or more nucleotides in one or more of the polynucle When producing chimeric transgenes (i.e. transgenes com otide sequences disclosed herein for the purpose of altering or prising DNA segments from different sources operably changing the insecticidal activity or insecticidal specificity of linked together), often the 5'-UTL of plant viruses are used. the encoded polypeptide. The mutant sequence is then Sub The alfalfa mosaic virus (AMV) coat protein and brome sequently amplified. Methods for mutagenizing and amplify mosaic virus (BMV) coat protein 5'-UTLs have been shown ing a DNA segment are well-known to those of skill in the art. to enhance mRNA translation 8-fold in electroporated Mutagenesis of the DNA segments may be made by random or site-specific mutagenesis procedures. The polynucleotides tobacco protoplasts (Gallie et al., 1987a; 1987b). A 67-nucle 40 otide derivative (S2) of the 5'-UTL of tobacco mosaic virus may be modified by the addition, deletion, or substitution of RNA (TMV) fused to the chloramphenicol acetyltransferase one or more nucleotides from the sequence encoding the (CAT) gene and GUS gene has been shown to enhance trans insecticidally-active polypeptide. lation of reporter genes in vitro (Gallie et al., 1987a; 1987b; Particular mutagenesis and amplification methods which Sleat et al., 1987; Sleat et al., 1988). Electroporation of may be useful in the practice of the present invention are 45 tobacco mesophyll protoplasts with transcripts containing the described by Tomic et al., Michael, et al., Upender et al., TMV leader fused to reporter genes CAT, GUS, and LUC Kwoh et al., Frohman, et al., Ohara et al., Wu, et al., Walkeret produced a 33-, 21-, and 36-fold level of enhancement, al.; U.S. Pat. Nos. 4,683,195, 4,683,202, 4,800,159, 4,883, respectively (Gallie et al., 1987a; 1987b; Gallie et al., 1991) 750, and EP320,308 EP329,822; GB 2202328; PCT/US87/ Also in tobacco, an 83-nt 5'-UTL of potato virus X RNA was 00880; PCT/US89/01025; WO 88/10315, WO 89/06700, shown to enhance expression of the neomycin phosphotrans each of which is incorporated herein by reference in its 50 entirety. ferese II (NptII) 4-fold (Poogin and Skryabin, 1992). The effect of a 5'-UTL may be different depending on the 4.16 Post-Transcriptional Events Affecting Expression of plant, particularly between dicots and monocots. The TMV Transgenes in Plants 5'-UTL has been shown to be more effective in tobacco pro In many instances, the level of transcription of a particular 55 toplasts (Gallie et al., 1989) than in maize protoplasts (Gallie transgene in a given host cell is not always indicative of the and Young, 1994) Also, the 5'-UTLs from TMV-2 (Gallie et amount of protein being produced in the transformed host al., 1988), AMV-coat (Gehrke et al., 1983; Jobling and cell. This is often due to post-transcriptional processes, such Gehrke, 1987), TMV-coat (Goelet et al., 1982), and BMV as splicing, polyadenylation, appropriate translation initia coat (French et al., 1986) worked poorly in maize and inhib tion, and RNA stability, that affect the ability of a transcript to 60 ited expression of a luciferase gene in maize relative to its produce protein. Such factors may also affect the stability and native leader (Koziel et al., 1996). However, the 5'-UTLs amount of mRNA produced from the given transgene. As from the cauliflower mosaic virus (CaMV)35S transcript and such, it is often desirable to alter the post-translational events the maize genes glutelin (Boronatet al., 1986), PEP carboxy through particular molecular biology techniques. The inven lase (Hudspeth and Grula, 1989) and ribulose biphosphate tors contemplate that in certain instances it may be desirable 65 carboxylase showed a considerable increase in expression of to alter the transcription and/or expression of the polypeptide the luciferase gene in maize relative to its native leader (Ko encoding nucleic acid constructs of the present invention to Ziel et al., 1996). US 7,772,369 B2 57 58 These 5'-UTLs had different effects in tobacco. In contrast circumstances be altered to increase the expression of these to maize, the TMV S2 5'-UTL and the AMV coat protein prokaryotic-derived genes in particular eukaryotic host cells 5'-UTL enhanced expression in tobacco, whereas the glutelin, and/or transgenic plants which comprise Such constructs. maize PEP-carboxylase and maizeribulose-1,5-bisphosphate Using molecular biology techniques which are well-knownto carboxylase 5'-UTLs did not show enhancement relative to those of skill in the art, one may alter the coding or noncoding the native luciferase 5'-UTL (Koziel et al., 1996). Only the sequences of the particular Cry-encoding gene sequences to CaMV 35S 5'-UTL enhanced luciferase expression in both optimize or facilitate its expression in transformed plant cells maize and tobacco (Koziel et al., 1996). Furthermore, the at levels Suitable for preventing or reducing insect infestation TMV and BMV coat protein 5'-UTLs were inhibitory in both or attack in Such transgenic plants. maize and tobacco protoplasts (Koziel et al., 1996). 10 4.162 USE OF INTRONS TO INCREASE EXPRESSION 4.16.4 Chloroplast Sequestering and Targeting Including one or more introns in the transcribed portion of Another approach for increasing expression of A+T rich a gene has been found to increase heterologous gene expres genes in plants has been demonstrated in tobacco chloroplast sion in a variety of plant systems (Callis et al., 1987; Maas et transformation. High levels of expression of an unmodified B. al., 1991; Mascerenhas et al., 1990; McElroy et al., 1990; 15 thuringiensis crystal protein-encoding genes in tobacco has Vasil et al., 1989), although not all introns produce a stimu been reported by McBride et al., (1995). latory effect and the degree of stimulation varies. The enhanc Additionally, methods of targeting proteins to the chloro ing effect of introns appears to be more apparent in monocots plast have been developed. This technique, utilizing the pea than indicots. Tanaka et al., (1990) has shown that use of the chloroplast transit peptide, has been used to target the catalase intron 1 isolated from castor beans increases gene enzymes of the polyhydroxybutyrate synthesis pathway to expression in rice. Likewise, the first intron of the alcohol dehydrogenase 1 (Adh1) has been shown to increase expres the chloroplast (Nawrath et al., 1994). Also, this technique sion of a genomic clone of Adh1 comprising the endogenous negated the necessity of modification of the coding region promoter in transformed maize cells (Callis et al., 1987: Den other than to add an appropriate targeting sequence. nis et al., 1984). Other introns that are also able to increase 25 U.S. Pat. No. 5,576,198 (specifically incorporated herein expression of transgenes which contain them include the by reference) discloses compositions and methods useful for introns 2 and 6 of Adh1 (Luehrsen and Walbot, 1991), the genetic engineering of plant cells to provide a method of catalase intron (Tanaka et al., 1990), intron 1 of the maize controlling the timing or tissue pattern of expression of for bronze 1 gene (Callis et al., 1987), the maize sucrose synthase eign DNA sequences inserted into the plant plastid genome. intron 1 (Vasil et al., 1989), intron 3 of the rice actin gene 30 Constructs include those for nuclear transformation which (Luehrsen and Walbot, 1991), rice actin intron 1 (McElroy et provide for expression of a viral single subunit RNA poly al., 1990), and the maize ubiquitin exon 1 (Christensen et al., merase in plant tissues, and targeting of the expressed poly 1992). merase protein into plant cell plastids. Also included are Generally, to achieve optimal expression, the selected plastid expression constructs comprising a promoter region intron(s) should be present in the 5' transcriptional unit in the 35 which is specific to the RNA polymerase expressed from the correct orientation with respect to the splice junction nuclear expression constructs described above and a heter sequences (Callis et al., 1987: Maas et al., 1991; Mascerenhas ologous gene of interest to be expressed in the transformed et al., 1990; Oard et al., 1989: Tanaka et al., 1990; Vasil et al., plastid cells. Alternatively, the gene can be transformed/lo 1989). Intron 9 of Adh1 has been shown to increase expres calized to chloroplast/plastid genome and expressed from sion of a heterologous gene when placed 3' (or downstream 40 there using promoters well known in the art (see Maliga, et of) the gene of interest (Callis et al., 1987). al.) 4.16.3 Use of Synthetic Genes to Increase Expression of 4.16.5 Effects of 3' Regions on Transgene Expression Heterologous Genes in Plants The 3'-end regions of transgenes have been found to have a When introducing a prokaryotic gene into a eukaryotic 45 large effect on transgene expression in plants Ingelbrecht et host, or when expressing a eukaryotic gene in a non-native al., 1989). In this study, different 3' ends were operably linked host, the sequence of the gene must often be altered or modi to the neomycin phosphotransferase II (NptII) reporter gene fied to allow efficient translation of the transcript(s) derived and expressed in transgenic tobacco. The different 3' ends form the gene. Significant experience in using synthetic genes used were obtained from the octopine synthase gene, the 2S to increase expression of a desired protein has been achieved 50 seed protein from Arabidopsis, the small subunit of rbcS from in the expression of B. thuringiensis in plants. Native B. Arabidopsis, extension form carrot, and chalcone synthase thuringiensis genes are often expressed only at low levels in from Antirrhinum. In stable tobacco transformants, there was dicots and sometimes not at all in many species of monocots about a. 60-fold difference between the best-expressing con (Koziel et al., 1996). Codon usage in the native genes is struct (small subunit rbcS 3' end) and the lowest expressing considerably different from that found in typical plant genes, 55 construct (shalcone synthase 3' end). which have a higher G+C content. Strategies to increase expression of these genes in plants generally alter the overall TABLE 5 G+C content of the genes. For example, synthetic B. thuring iensis crystal-protein encoding genes have resulted in signifi PLANT PROMOTERS cant improvements in expression of these endotoxins in vari 60 ous crops including cotton (Perlak et al., 1990; Wilson et al., Promoter Reference 1992), tomato (Perlak et al., 1991), potato (Perlak et al., Viral 1993), rice (Cheng et al., 1998), and maize (Koziel et al., Figwort Mosaic Virus (FMV) U.S. Pat. No. 5,378,619 1993). Cauliflower Mosaic Virus (CaMV) U.S. Pat. No. 5,530,196 In a similar fashion the inventors contemplate that the 65 U.S. Pat. No. 5,097,025 genetic constructs of the present invention, because they con U.S. Pat. No. 5,110,732 tain one or more genes of bacterial origin, may in certain US 7,772,369 B2 59 60 method of producing plants with female genetic sterility. The TABLE 5-continued method comprises the use of style-cell, Stigma-cell, or style and Stigma-cell specific promoters that express polypeptides PLANT PROMOTERS that, when produced in the cells of the plant, kills or signifi Promoter Reference 5 cantly disturbs the metabolism, functioning or development of the cells. Plant TABLE 7 Elongation Factor U.S. Pat. No. 5,177,011 Tomato Polygalacturonase U.S. Pat. No. 5,442,052 INDUCIBLE PLANT PROMOTERS Arabidopsis Histone H4 U.S. Pat. No. 5,491,288 10 Phaseolin U.S. Pat. No. 5,504,200 Promoter Reference? Group 2 U.S. Pat. No. 5,608,144 Ubiquitin U.S. Pat. No. 5,614,399 heat shock promoter U.S. Pat. No. 5,447,858 P119 U.S. Pat. No. 5,633,440 Em U.S. Pat. No. 5,139,954 C-amylase U.S. Pat. No. 5,712,112 Adh1 Kyozoka et al., 1991 Viral enhancer/Plant promoter 15 HMG2 U.S. Pat. No. 5,689,056 cinnamyl alcohol dehydrogenase U.S. Pat. No. 5,633,439 CaMV 35Senhancertmannopine U.S. Pat. No. 5,106,739 asparagine synthase U.S. Pat. No. 5,595,896 synthase promoter GST-II-27 U.S. Pat. No. 5,589,614 Each reference is specifically incorporated herein by reference in its entirety, Each reference is specifically incorporated herein by reference in its entirety,

TABLE 6

TISSUE SPECIFICPLANT PROMOTERS Tissue Specific Promoter Tissue(s) Reference Blec epidermis U.S. Pat. No. 5,646,333 malate synthase seeds; seedlings U.S. Pat. No. 5,689,040 isocitrate lyase seeds; seedlings U.S. Pat. No. 5,689,040 patatin tuber U.S. Pat. No. 5,436,393 ZRP2 root U.S. Pat. No. 5,633,363 ZRP2(2.0) root U.S. Pat. No. 5,633,363 ZRP2(1.0) root U.S. Pat. No. 5,633,363 RB7 root U.S. Pat. No. 5,459.252 root U.S. Pat. No. 5,401,836 fruit U.S. Pat. No. 4,943,674 meristem U.S. Pat. No. 5,589,583 guard cell U.S. Pat. No. 5,538,879 Stannen U.S. Pat. No. 5,589,610 SodA1 pollen; middle layer; stomium of Van Camp et al., 1996 anthers SodA2 vasular bundles; stomata: Van Camp et al., 1996 axillary buds; pericycle; stomium; pollen CHS15 flowers; root tips Faktor et al., 1996 Psam-1 phloem tissue; cortex; Vander et al., 1996 root tips ACT11 elongating tissues and Huang et al., 1997 organs; pollen; ovules ZnOBS pollen; endosperm Russell and Fromm, 1997 Zn227 endosperm Russell and Fromm, 1997 OSAGP endosperm Russell and Fromm, 1997 OSGT1 endosperm Russell and Fromm, 1997 RolC phloem tissue; bundle Graham et al., 1997 sheath; vascular parenchyma. Sh phloem tissue Graham et al., 1997 CMd endosperm Grosset et al., 1997 Bnm1 pollen Treacy et al., 1997 rice tungro bacilliform virus phloem Yin et al., 1997a: 1997b S2-RNase pollen Ficker et al., 1998 LeB4 seeds Baumlein et al., 1991 gf-2.8 seeds; seedlings Berna and Bernier, 1997 Each reference is specifically incorporated herein by reference in its entirety,

The ability to express genes in a tissue specific manner in 60 4.18 Antibody Compositions and Methods of Making plants has led to the production of male and female sterile In particular embodiments, the inventors contemplate the plants. Generally, the production of male Sterile plants use of antibodies, either monoclonal or polyclonal which bind involves the use of anther-specific promoters operably linked to one or more of the polypeptides disclosed herein. Means to heterologous genes that disrupt pollen formation (U.S. Pat. for preparing and characterizing antibodies are well known in Nos. 5,689,051; 5.689,049; 5,659,124, each specifically 65 the art (See, e.g., Harlow and Lane, 1988; incorporated herein incorporated herein by reference). U.S. Pat. No. 5,633,441 by reference). The methods for generating monoclonal anti (specifically incorporated herein by reference) discloses a bodies (mAbs) generally begin along the same lines as those US 7,772,369 B2 61 62 for preparing polyclonal antibodies. Briefly, a polyclonal antibody is prepared by immunizing an animal with an immu TABLE 8 nogenic composition in accordance with the present inven tion and collecting antisera from that immunized animal. A Amino Acids Codons wide range of animal species can be used for the production of 5 Alanine Ala A GCA GCC GCG GCU antisera. Typically the animal used for production of anti antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig or Cysteine Cys C UGC UGU a goat. Because of the relatively large blood volume of rab Aspartic acid Asp D GAC GAU bits, a rabbit is a preferred choice for production of polyclonal antibodies. 10 Glutamic acid Glu E GAA. GAG mAbs may be readily prepared through use of well-known Phenylalanine Phe F UUC UUU techniques, such as those exemplified in U.S. Pat. No. 4,196, 265, incorporated herein by reference. Typically, this tech Glycine Gly G. GGA. GGC GGG GGU nique involves immunizing a suitable animal with a selected 15 Histidine His H CAC CAU immunogen composition, e.g., a purified or partially purified crystal protein, polypeptide or peptide. The immunizing com Isoleucine Ile I AUA AUC AUU position is administered in a manner effective to stimulate Lysine Lys K AAA AAG antibody producing cells. Rodents such as mice and rats are preferred animals, however, the use of rabbit, sheep, or frog Leucine Lell L UUA UUG CUA CUC CUG. CUU cells is also possible. The use of rats may provide certain Methionine Met M AUG advantages (Goding, 1986, pp. 60-61), but mice are preferred, with the BALB/c mouse being most preferred as this is most Asparagine Asn N AAC AAU routinely used and generally gives a higher percentage of Proline Pro P CCA CCC CCG CCU stable fusions. 25 Glutamine Glin Q CAA CAG 4.19 Elisas and Immunoprecipitation ELISAs may be used in conjunction with the invention. Arginine Arg R AGA AGG CGA CGC CGG CGU The production and use of ELISAs or kits employing such Serine Ser S AGC AGU UCA, UCC UCG UCU ELISAs are well know to those of skill in the art. 30 Threonine Thir T ACA ACC ACG ACU 4.20 Western Blots The compositions of the present invention will find great Waline Wall W GUA GUC GUG GUU use in immunoblot or western blot analysis. The anti-peptide Tryptophan Trp W. UGG antibodies may be used as high-affinity primary reagents for 35 the identification of proteins immobilized onto a solid support Tyrosine Tyr Y UAC UAU matrix. Such as nitrocellulose, nylon or combinations thereof. In conjunction with immunoprecipitation, followed by gel For example, certain amino acids may be substituted for electrophoresis, these may be used as a single step reagent for other amino acids in a protein structure without appreciable use in detecting antigens against which secondary reagents 40 loss of interactive binding capacity with structures such as, used in the detection of the antigen cause an adverse back for example, antigen-binding regions of antibodies orbinding ground. This is especially useful when the antigens Studied sites on Substrate molecules. Since it is the interactive capac are immunoglobulins (precluding the use of immunoglobu ity and nature of a protein that defines that protein's biological lins binding bacterial cell wall components), the antigens functional activity, certain amino acid sequence Substitutions studied cross-react with the detecting agent, or they migrate at 45 can be made in a protein sequence, and, of course, its under the same relative molecular weight as a cross-reacting signal. lying DNA coding sequence, and nevertheless obtain a pro Immunologically-based detection methods for use in con tein with like properties. It is thus contemplated by the inven junction with Western blotting include enzymatically-, radio tors that various changes may be made in the peptide label-, or fluorescently-tagged secondary antibodies against sequences of the disclosed compositions, or corresponding the toxin moiety are considered to be of particular use in this 50 DNA sequences which encode said peptides without appre regard. ciable loss of their biological utility or activity. In making Such changes, the hydropathic index of amino 4.21 Biological Functional Equivalents acids may be considered. The importance of the hydropathic Modification and changes may be made in the structure of amino acid index in conferring interactive biologic function the peptides of the present invention and DNA segments 55 on a protein is generally understood in the art (Kyte and which encode them and still obtain a functional molecule that Doolittle, 1982, incorporate herein by reference). It is encodes a protein or peptide with desirable characteristics. accepted that the relative hydropathic character of the amino The following is a discussion based upon changing the amino acid contributes to the secondary structure of the resultant acids of a protein to create an equivalent, or even an improved, protein, which in turn defines the interaction of the protein second-generation molecule. In particular embodiments of 60 with other molecules, for example, enzymes, Substrates, the invention, mutated crystal proteins are contemplated to be receptors, DNA, antibodies, antigens, and the like. useful for increasing the insecticidal activity of the protein, Each amino acid has been assigned a hydropathic index on and consequently increasing the insecticidal activity and/or the basis of their hydrophobicity and charge characteristics expression of the recombinant transgene in a plant cell. The byte and Doolittle, 1982), these are: isoleucine (+4.5); valine amino acid changes may be achieved by changing the codons 65 (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine of the DNA sequence, according to the codons given in Table (+2.5), menthionine (+1.9); anine (+1.8); glycine (-0.4): 8. threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine US 7,772,369 B2 63 64 (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); examples which follow represent techniques discovered by glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine the inventor to function well in the practice of the invention, (-3.9); and arginine (-4.5). and thus can be considered to constitute preferred modes for It is known in the art that certain amino acids may be its practice. However, those of skill in the art should, in light Substituted by otheramino acids having a similar hydropathic of the present disclosure, appreciate that many changes can be index or score and still result in a protein with similar bio made in the specific embodiments which are disclosed and logical activity, i.e., still obtain a biological functionally still obtain a like or similar result without departing from the equivalent protein. In making Such changes, the Substitution spirit and scope of the invention. of amino acids whose hydropathic indices are within t2 is preferred, those which are within +1 are particularly pre 10 5.1 Example 1 ferred, and those within +0.5 are even more particularly pre ferred. Isolation of B. Thuringiensis Strains EG4550 and It is also understood in the art that the substitution of like EG5899 amino acids can be made effectively on the basis of hydro philicity. U.S. Pat. No. 4,554,101, incorporated herein by 15 Crop dust samples were obtained from various sources reference, States that the greatest local average hydrophilicity throughout the United States and abroad, typically from of a protein, as governed by the hydrophilicity of its adjacent grain-storage facilities. The crop dust samples were treated amino acids, correlates with a biological property of the pro and spread on agar plates to isolate individual Bacillus-type tein. colonies, e.g., B. thuringiensis, as described in U.S. Pat. No. As detailed in U.S. Pat. No. 4,554,101, the following 5,187,091, specifically incorporated herein by reference in its hydrophilicity values have been assigned to amino acid resi entirety. Phase-contrast microscopy was used to visually dues: arginine (+3.0); lysine (+3.0); aspartate (+3.0+1): identify cells with crystalline inclusions in the colonies that glutamate (+3.0t1); serine (+0.3); asparagine (+0.2): grew after this treatment. Crystal-producing strains were then glutamine (+0.2); glycine (O); threonine (-0.4); proline characterized by modified Eckhardtagarose gel electrophore (-0.5+1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); sis as described by Gonzalez et al., (1982). This procedure methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine 25 allows the visualization of the array of native plasmids in a B. (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan thuringiensis strain. The plasmid arrays can be compared to (-3.4). It is understood that an amino acid can be substituted for those of known serovars of B. thuringiensis to facilitate the another having a similar hydrophilicity value and still obtain identification of wild-type strains (Carlton and Gonzalez, a biologically equivalent, and in particular, an immunologi 1985). cally equivalent protein. In Such changes, the Substitution of 30 Strain EG4550 is a crystal-producing B. thuringiensis amino acids whose hydrophilicity values are within t2 is strain isolated from a New York crop dust sample. The crys preferred, those which are within +1 are particularly pre talline inclusions of sporulated EG4550 have a distinct mor ferred, and those within +0.5 are even more particularly pre phology and resemble tiny rods. The plasmid array of ferred. EG4550 does not resemble the array of any of the known As outlined above, amino acid substitutions are generally 35 serovars of B. thuringiensis. therefore based on the relative similarity of the amino acid Strain EG5899 is a crystal-producing B. thuringiensis side-chain Substituents, for example, their hydrophobicity, strain isolated from a California crop dust sample. The crys hydrophilicity, charge, size, and the like. Exemplary Substi talline inclusions of sporulated EG5899 are unusual in that tutions which take various of the foregoing characteristics they appear to be multiple attached crystals with an irregular into consideration are well known to those of skill in the art 40 morphology. The plasmid array of EG5899 does not resemble and include: arginine and lysine; glutamate and aspartate; the array of any of the known serovars of B. thuringiensis. serine and threonine, glutamine and asparagine; and valine, Insect bioassay of the B. thuringiensis strains EG4550 and leucine and isoleucine. EG5899 indicated that these strains are toxic to larvae of coleopteran insects, including SCRW, Suggesting that the 5.0 EXAMPLES 45 crystals in these strains contained novel insecticidal proteins. EG4550 and EG5899 were deposited with the ARS Patent The following examples are included to demonstrate pre Culture Collection and been assigned NRRL numbers ferred embodiments of the invention. It should be appreciated B-21784 and B-21783, respectively. These strains and other by those of skill in the art that the techniques disclosed in the strains of the present invention are listed in Table 9:

TABLE 9

WILD-TYPE AND RECOMBINANT BACTERIAL STRAINS

Plasmid NRRL NRRL Deposit cry Gene(s) Antibiotic Strain Accession # Date Organism Plasmid Cloned Insert Vector Present Marker EG4SSO B-21784 May 30, 1997 B. thuringiensis cryET39, 74, 75 - EGS899 B-21783 May 30, 1997 B. thuringiensis cryET39, 74, 75 - EG11582 E. coi pEG1337 8.4-kb HindIII plJC18 cryET39, 74, 75 Amp EG11525 E. coi pEG1321 8.4-kb HindIII pEG597 cryET39, 74, 75 Amp EG11529 B-21917 Feb. 12, 1998 B. thuringiensis pEG1321 8.4-kb HindIII pEG597 cryET39, 74, 75 Cm EG11521 - E. coi pEG 1319 8.4-kb HindIII pBluescript cryET39, 74, 75 Amp EG11934 - B. thuringiensis pEG1918 4.5-kb HindIII pHT315 cryET75 Eryth EG11935 B. thuringiensis pEG1919 3.2-kb HindIII- pHT315 cryET74 Eryth EcoRI EG11936 - B. thuringiensis pEG1920 3.7-kb HindIII pHT315 cryET39, 74 Eryth EG11937 B. thuringiensis pEG1921 1.4-kb HindIII pEG1915 cryET39 Eryth US 7,772,369 B2

TABLE 9-continued

WILD-TYPE AND RECOMBINANT BACTERIAL STRAINS

Plasmid NRRL NRRL Deposit cry Gene(s) Antibiotic Strain Accession # Date' Organism Plasmid Cloned Insert Vector Present Marker EG41OO B-21786 May 30, 1997 B. thuringiensis — cryET69 EG11647 B-21787 May 30, 1997 B. thuringiensis pEG1820 MboI partial pHT315 cryET69 Eryth EG94.44 B-21785 May 30, 1997 B. thuringiensis — cryET71, 79 EG11648 B-21788 May 30, 1997 B. thuringiensis pEG1821 MboI partial pHT315 cryET71, 79 Eryth EG4851 B-21915 Feb. 12, 1998 B. thuringiensis cryET76, 80, 84 – EG11658 B-21916 Feb. 12, 1998 B. thuringiensis pEG1823 MboI partial pHT315 cryET76, 80, 84 Eryth The details of the construction of the strains listed above are included in the following Examples. The subject cultures have been deposited under conditions that assure that access to the cultures will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R. S.1.14 and 35 U.S.C. S 122. The deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action. The subject culture deposits will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., they will be stored with all the care necessary to keep them viable and uncontaminated for a period of at least five years after the most recent request for the finishing of a sample of the deposit, and in any case, for a period of at least 30 (thirty) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the cultures. The depositor acknowledges the duty to replace the deposits should the depository be unable to furnish a sample when requested, due to the condition of the deposits. All restrictions on the availability to the public of the subject culture deposits will be irrevocably removed upon the granting of a patent disclosing them, Cultures shown in Table 3 were deposited in the permanent collection of the Agricultural Research Service Culture Collection, Northern Regional Research Laboratory (NRRL), located at 1815 N. University Street, Peoria, IL 61604, under the terms of the Budapest Treaty,

5.2 Example 2 then rinsed in 3 changes of distilled HO. The portion of the filter containing the approximately 45-kDa CryET39 band Evaluation of the Crystal Proteins of EG4550 and 25 was excised with a razor blade. This procedure resulted in a EG5899 pure form of CryET39 being obtained as a protein band blotted onto a PVDF membrane (BioRad, Hercules, Calif.). Strains EG4550 and EG5899 were grown in C2 sporula The determination of the NH-terminal amino acid tion medium (Donovan, et al., J. Biol. Chem., 263:561-567, sequence of the purified CryET39 protein immobilized on the 1988) for three days at 30°C. during which the cultures grew 30 membrane was performed in the Department of Physiology at to stationary phase, sporulated and lysed, releasing the pro the Tufts Medical School, Boston, Mass. using standard tein inclusions into the medium. The cultures were centri Edman degradation procedures. The NH2-terminal sequence fuged to harvest cell pellets containing the spores and crys was determined to be: tals. The pellets were washed by suspension in a solution of 0.005% Triton X-100R and centrifuged. The washed pellets 35 were resuspended at one-tenth the original volume in 0.005% (SEQ ID NO: 2O) Triton X-1009. 1. 2 3 4. 5 6 7 8 9 1O 11 12 Crystal proteins were solubilized from the spores-crystals Met Lieu. Asp Thr Asn Llys Val Tyr Glu Ile Ser Asn suspensions by incubating in solubilization buffer 0.14 M 13 14 15 Tris-HCl pH 8.0, 2% (wt.?vol.) sodium dodecyl sulfate 40 His Ala Asn (SDS), 5% (vol./vol.) 2-mercaptoethanol, 10% (vol./vol.) Computer algorithms (Komand Queen, 1984) were used to glycerol, and 1% bromphenol blue at 100° C. for 5 min. The compare the NH2-terminal sequence of the CryET39 protein solubilized crystal proteins were size-fractionated by SDS with the amino acid sequences of all B. thuringiensis crystal PAGE using a gel with an acrylamide concentration of 12.5%. proteins of which the inventors were aware including the After size fractionation the proteins were visualized by 45 sequences of all B. thuringiensis crystal proteins which had staining with Coomassie Brilliant Blue R-250. Strain been published in scientific literature, international patent EG4550 displayed proteins with approximate molecular applications, or issued patents. A list of the crystal proteins weights of 45 and 15 kDa. Strain EG5899 displayed proteins whose sequences have been published and assigned a gene/ of approximate molecular weights of 160 kDa, 45 kDa, 35 protein designation is shown in Table 2. kDa, and 15 kDa. 50 5.3 Example 3 5.4 Example 4 Isolation of a DNA Fragment Comprising the Characterization of the CryET39 Crystal Protein of CryET39 Gene EG4550 55 In order to identify the gene encoding CryET39, an oligo The NH2-terminal sequence of the approximately 45-kDa nucleotide probe specific for the NH2-terminal amino acid protein of EG4550, designated CryET39, was determined. A sequence of the protein was designed. Using codons typically sporulated culture of EG4550 was washed and resuspended. found in B. thuringiensis toxin genes an oligonucleotide of 41 The crystal proteins in the suspension were solubilized and 60 nucleotides was synthesized by Integrated DNA Technolo run on a 10% acrylamide gel following the procedures for gies, Inc. (Coralville, Iowa) and designated wa271. The SDS-PAGE analysis. After electrophoresis the proteins were sequence of wa271 is: transferred to a BioRad PVDF membrane using standard western blotting procedures. Following transfer the mem brane was rinsed 3x in distilled HO and stained for 1 min 65 (SEQ ID NO: 21) using Amido Black 1013 (Sigma Chemical Co., St. Louis, 5 - ATGTTAGATACAAATAAAGTATATGAAATTTCAAATCATGC-3 Mo.). The filter was destained for 1 min in 5% acetic acid and US 7,772,369 B2 67 68 Radioactively labeled wa271 was then used as a probe in cating that the 2.5-kb EcoRI fragment does not contain a Southern hybridization experiments, as described below, to complete and functional cryET39 gene. This result also indi identify a restriction fragment containing the cryET39 gene. cated that the genes for the 15-kDa crystal protein and Total DNA was extracted from Strains EG4550 and EG5899 CryET39 were, however, in close proximity. The recombi by the following procedure. Vegetative cells were resus nant B. thuringiensis strain expressing the 15-kDa protein, pended in a lysis buffer containing 50 mM glucose, 25 mM designated EG11467, was not toxic to larvae of SCRW. Tris-HCl (pH 8.0), 10 mM EDTA, and 4 mg/ml lysozyme. The approximately 8.4 kb HindIII restriction fragment The suspension was incubated at 37°C. for one hour. Follow containing the cryET39 gene from EG5899 was isolated from ing incubation, the Suspension was extracted once with an total genomic DNA as described in Section 5.4. The DNA equal Volume of phenol, then once with an equal Volume of 10 was digested with HindIII and electrophoresed through a phenol:chloroform:isoamyl alcohol (25:24:1), and once with 0.8% agarose, 1xTBE gel, overnight at 2 volts/cm of gel an equal volume of chloroform:isoamyl alcohol (24:1). The length. The gel was stained with ethidium bromide so that the DNA was precipitated from the aqueous phase by the addition digested DNA could be visualized when exposed to long of one-tenth volume 3 M sodium acetate then two volumes wave UV light. Gel slices containing DNA fragments of 100% ethanol. The precipitated DNA was collected by cen 15 approximately 8.0-9.0 kb were excised from the gel with a trifugation, washed with 70% ethanol and resuspended in razor blade. The DNA fragments were then purified from the dH.O. gel slice using the GenecleanR procedure (Bio 101, Vista, The extracted DNA was then digested, in separate reac Calif.). tions, with various restriction endonucleases, including The isolated DNA fragments were ligated into the EcoRI and HindIII using conditions recommended by the phagemid p3luescript(R) II SK+ (Stratagene, LaJolla, Calif.) manufacturer (Promega Corp., Madison, Wis.). The digested to create a library in E. coli of size—selected HindIII restric DNA was size-fractionated by electrophoresis through a tion fragments. The phagemid DNA vector pBluescript(R) II 0.8% agarose gel in 1XTBE (0.089 M Tris-borate, 0.089 M SK+ can replicate at a high copy number in E. coli and carries boric acid, 0.002 M EDTA) overnight at 2 volts/cm of gel the gene for resistance to the antibiotic amplicillin, which can length The fractionated DNA fragments were then transferred 25 be used as a selectable marker. The fragments were mixed to a Millipore Immobilon-NCR) nitrocellulose filter (Milli with HindIII-digested pBluescript(R) II SK-- that had been pore Corp., Bedford, Mass.) according to the method of treated with bacterial alkaline phosphatase (GibcoBRL, Southern (1975). The DNA fragments were fixed to the nitro Gaithersburg, Md.) to remove the 5' phosphates from the cellulose by baking the filter at 80°C. in a vacuum oven. digested plasmid to prevent re-ligation of the vector to itself. Identification of the DNA fragment(s) containing the 30 T4 ligase and a ligation buffer (Promega Corp.) were added to sequence encoding the NH2-terminus of the CryET39 protein the reaction containing the digested phagemid and the size (see Example 3) was accomplished by using the oligonucle selected HindIII fragments. These were incubated at room otide wa271 as a hybridization probe. To radioactively label temperature for 1 hour to allow the insertion and ligation of the probe, 1 to 5 pmoles wa271 was added to a reaction the HindII fragments into the pBluescript(R) II SK-- vector. containing Y-PATP (3 ul of 3,000 Ci/mmole at 10 mCi/ml 35 The ligation mixture was introduced into transformation in a 20-ul reaction volume), a 10x reaction buffer (700 mM competent E. coli DH5OTM cells (GibcoBRL) following pro Tris-HCl (pH 7.8), 100 mM MgCl, 50 mM DTT), and 10 cedures described by the manufacturer. The transformed E. units T4 polynucleotide kinase (Promega Corp.). The reac coli cells were plated on LB agar plates containing 50 ug/ml tion was incubated 20minat37°C. to allow the transfer of the ampicillin and incubated overnight at 37°C. The growth of radioactive phosphate to the 5'-end of the oligonucleotide, 40 several hundred ampicillin-resistant colonies on each plate thus making it useful as a hybridization probe. indicated the presence of the recombinant plasmid in the cells The labeled probe was then incubated with the nitrocellu of each of those colonies. lose filter overnight at 45° C. in 3xSSC, 0.1% SDS, 10xDen To isolate the colonies harboring the cloned 8.4-kb HindIII hardt’s reagent (0.2% BSA, 0.2% polyvinylpyrrolidone, fragment containing the cryET39 gene, colonies were first 0.2% Ficollr), 0.2 mg/ml heparin. Following incubation the 45 transferred to nitrocellulose filters. This was accomplished by filter was washed in several changes of 3xSSC, 0.1% SDS at placing a circular filter (Millipore HATF 08525, Millipore 45° C. The filter was blotted dry and exposed to Kodak Corp., Bedford, Mass.) directly on top of the LB-ampicillin X-OMAT ARX-ray film (Eastman Kodak Company, Roch agar plates containing the transformed colonies. When the ester, N.Y.) overnight at -70° C. with a DuPont Cronex Light filter was slowly peeled off of the plate the colonies stuck to ning Plus screen to obtain an autoradiogram. 50 the filter giving an exact replica of the pattern of colonies from Examination of the autoradiogram identified an approxi the original plate. Enough cells from each colony were left on mately 2.5-kb wa271-hybridizing EcoRI fragment in DNA the plate that 5 to 6 hours of growth at 37° C. restored the from strain EG4550. Strain EG5899 had an approximately colonies. The plates were then stored at 4°C. until needed. 8.4-kb HindIII restriction fragment that specifically hybrid The nitrocellulose filters with the transferred colonies were ized to the labeled wid271. This result indicated that both 55 then placed, colony-side up, on fresh LB-amplicillin agar EG4550 and EG5899 contained related, or perhaps identical, plates and allowed to grow at 37°C. until the colonies reached copies of the cryET39 gene. an approximate diameter of 1 mm. To release the DNA from the recombinant E. coli cells the 5.5 Example 5 nitrocellulose filters were placed colony-side up on 2 sheets 60 of Whatman 3mM Chromatography paper (Whatman Inter Cloning of the cryET39 Gene national Ltd., Maidstone, England) soaked with 0.5 NNaOH, 1.5 M NaCl for 15 min. This treatment lysed the cells and The first cloning study included the isolation of the 2.5-kb denatured the released DNA allowing it to stick to the nitro EcoRI fragment of EG4550 in order to express and charac cellulose filter. The filters were then neutralized by placing terize the CryET39 protein of EG4550. When this fragment 65 the filters, colony-side up, on 2 sheets of Whatman paper was cloned and expressed in a B. thuringiensis recombinant soaked with 1 Mammonium acetate, 0.02 MNaOH for 10 strain, however, only the 15 kDa protein was produced, indi min. The filters were then rinsed in 3xSSC, air dried, and US 7,772,369 B2 69 70 baked for 1 hour at 80°C. in a vacuum oven to prepare them 8.4-kb HindIII fragment inserted into the pG597 vector was for hybridization The NH-terminal oligonucleotide specific designated pEG1321. The E. coli strain harboring plG1321 for the cryET39 gene, wa271, was labeled at the 5' end with was designated EG11525. Y-p and T4 polynucleotide kinase as described above. The pEG1321 was introduced into a Cry B. thuringiensis labeled probe was added to the filters in 3xSSC, 0.1% SDS, strain, EG10368, by electroporation (Macaluso and Mettus, 10xDenhardt’s reagent (0.2% BSA, 0.2% polyvinylpyrroli 1991). Cells transformed to chloramphenicol resistance were done, 0.2% Ficollr), 0.2 mg/ml heparin and incubated over selected by incubation overnighton LBagarplates containing night at 40°C. These conditions were chosen to allow hybrid 3 g/ml chloramphenicol. Plasmid DNA was isolated from ization of the labeled oligonucleotide to related sequences several of the B. thuringiensis transformants. The isolated 10 plasmid was digested with HindIII and electrophoresed present on the nitocellulose blots of the transformed E. coli through an agarose gel. All of the transformants had restric colonies. Following incubation the filters were washed in tion fragments corresponding to the 8.4 kb cryET39 fragment several changes of 3xSSC, 0.1% SDS at 45° C. The filters and the pG597 vector. To verify the correct plasmid con were blotted dry and exposed to Kodak X-OMAT ARX-ray struction the restriction fragments were blotted to a nitrocel film (Eastman Kodak) overnight at -70° C. with a DuPont 15 lulose filter which was then hybridized with the cryET39 Cronex Lightning Plus screen. specific oligo wa271, as described above. The wa271 probe Several colonies from this transformation hybridized to hybridized to the cloned 8.4 kb HindIII fragments confirming wd271. These colonies were identified by lining up the sig that pEG1321 contains the cryET39 gene and that it had been nals on the autoradiogram with the colonies on the original successfully introduced into B. thuringiensis. The B. thuring transformation plates. The isolated colonies were then grown iensis recombinant strain containing pEG1321 was desig in LB-ampicillin liquid medium from which the cells could nated EG11529. EG11529 was deposited with the NRRL and be harvested and recombinant plasmid prepared by the stan given the accession number B-21917. dard alkaline-lysis miniprep procedure (Maniatis et al., EG11529 was grown in DSM-glucose sporulation 1982). The isolated plasmids were digested with the restric medium containing 5 ug/ml chloramphenicol 0.8% (wt./ tion enzyme HindIII which indicated that the cloned frag 25 vol.) Difco nutrient broth, 0.5% (wt.?vol.) glucose, 10 mM ments of EG5899 DNA were of the expected size, i.e. 8.4-kb. K-1PO, 110 mM. KHPO, 1 mM Ca(NO), 0.5 mM HindIII-digested plasmid DNA from six of the hybridizing MgSO 10 uMMnCl, 10uM FeSO for three days at 30° C. colonies was electrophoresed through an agarose gel and during which the culture grew to stationary phase, sporulated transferred to nitrocellulose as described above. The blot was and lysed, thus releasing the protein inclusions into the then hybridized with the oligonucleotidewd271 that had been 30 medium. The cultures were harvested by centrifugation. The radioactively labeled at the 5' end with Y-P and T4 poly pellet consisting of spores and protein crystals was washed in nucleotide kinase. The approximately 8.4-kb insert fragments a solution of 0.005% Triton X-100R, 2 mM EDTA and cen from all six of the digested plasmids hybridized with wa271 trifuged. The washed pellet was suspended at one-tenth the confirming the presence of the cryET39 gene. One of the original volume in 0.005% Triton X-100R, 2 mM EDTA. plasmids with the 8.4 kb insert containing the cryET39 gene 35 Crystal proteins were solubilized from the spores-crystal was designated pEG 1319. The E. coli strain containing Suspension by incubating the Suspension in solubilization pEG1319 has been designated EG11521. buffer 0.14 M Tris-HCl pH 8.0, 2% (wt.?vol.) sodium dode cyl sulfate (SDS), 5% (vol./vol.) 2-mercaptoethanol, 10% 5.6 Example 6 (vol./vol.)glycerol, and 0.1% bromphenol blue at 100°C. for 40 5 min. The solubilized crystal proteins were size-fractionated Expression of Recombinant Proteins from EG11529 by SDS-PAGE. After size fractionation the proteins were visualized by staining with Coomassie Brilliant Blue R-250. This analysis showed that three distinct crystal proteins were To characterize the properties of the CryET39 protein it produced in strain EG11529. In addition to the 44-kDa was necessary to express the cloned cryET39 gene in B. 45 thuringiensis cells that do not produce any crystal proteins CryET39 toxin, approximately 15- and 35-kDa polypeptides (Cry). To accomplish this, the cloned 8.4-kb HindIII frag were also produced. ment from pEG 1319 was inserted into a plasmid capable of The 35-kDa crystal protein expressed in B. thuringiensis replicating in B. thuringiensis, thus allowing the expression EG11529 could be separated from the 44-kDa (CryET39) and of the cryET39 gene and production of the encoded protein. 15-kDa proteins by centrifugation through a Sucrose step 50 gradient (steps: 55%, 68%, 72%, 79%) as described in Sec pEG 1319 was digested with HindIII to excise the cloned tion 5.12. Determination of the NH-terminal amino acid 8A4-kb fragment. The digested plasmid was resolved on an sequence of the isolated 35-kDa protein was accomplished agarose gel and a slice of the gel containing the 8.4-kb frag using procedures described in Section 5.3. The NH-terminal ment was excised. The 8.4-kb HindIII fragment was purified amino acid sequence of the 35-kDa protein was shown to be: from the gel slice using the GeneClean procedure (Biol O1). 55 The fragment was ligated into a B. thuringiensis/E. coli shuttle vector that had been digested with HindIII and treated SILNLODLSOKYMTAALNKI (SEQ ID NO: 22) with bacterial alkaline phosphatase. This shuttle vector, des ignated pBG597, was described by Baum et al., (1990). Comparison of the NH2-terminus of the 35-kDa protein pEG597 is capable of replication in both E. coli and B. thur 60 with the deduced amino acid sequence of CryET39 confirmed ingiensis, conferring amplicillin resistance to E. coli and that it was not a processed form of the CryET39 protein. The chloramphenicol resistance to B. thuringiensis. The ligation approximately 35kDa protein was designated CryET75, and mixture was introduced into E. coli DH5CTM cells using the gene encoding it (which resides on the 8.4-kb fragment transformation procedures described by the manufacturer from EG5899) was designated cryET75. (GibcoBRL). Plasmid DNA was prepared from AmP trans 65 The sucrose gradient fraction containing CryET39 also formants and restriction enzyme analysis was performed to contained the approximately 15-kDa protein, designated confirm the proper construction. A plasmid containing the CryET74. The NH2-terminal amino acid sequence of US 7,772,369 B2 71 72 CryET74 was determined as described for CryET39 in Sec Studies in which the 8.4-kb HindIII fragment from tion 5.3. The NH-terminal amino acid sequence of the iso EG11529 was further digested and the fragments sub-cloned lated CryET74 protein was determined to be: to express the crystal protein genes individually, or in com bination, are described in Section 5.11. The expression of the CryET39 protein was dependent on cloning the cryET74 SAROWHIOINNKTRH (SEQ ID NO:23) gene on the same restriction fragment. This suggested that the Comparison of this sequence with that of CryET39 and cryET74 gene was located upstream of the cryET39 gene and CryET75 showed that CryET74 was a unique protein that the promoter for cryET74 also directs the expression of encoded by a third gene, designated cryET74, that was con cryET39. Oligonucleotides specific for the DNA sequence 5' 10 to the beginning of the cryET39 gene were designed for use as tained on the 8.4-kb HindIII fragment cloned from EG5899. primers for automated sequencing. Successive primers were 5.7 Example 7 designed based on the data derived from each set of sequenc ing reactions. In this way the region upstream of cryET39 was Sequencing of the Cry GENES and Determination of sequenced in a step-wise fashion. A translation of the DNA the Amino Acids Sequences of the Encoded 15 sequence revealed an open reading frame encoding the Polypeptides CryET74 protein. Examination of the derived amino acid sequence found a region identical to the determined NH To facilitate the sequencing of the cryET39, cryET74, and terminal amino acid sequence of CryET74, identifying the cryET75 genes, the 8.4-kb HindIII fragment of pEG 1319 was open reading frame as the cryET74 gene. subcloned into HindIII-digested puC18 (Yanisch-Perronet 5.7.1 CryET39 al., 1985). This plasmid was designated pBG1337, and is The DNA sequence of the CryET39 gene is represented by shown in FIG. 1. SEQID NO:7, and encodes the amino acid sequence of the Preparation of plG1337 double-stranded plasmid tem CryET39 polypeptide, represented by SEQID NO:8. plate DNA was accomplished using either a standard alkaline lysis procedure or a Qiagen Plasmid Kit (Qiagen Inc., Chat 25 5.7.1.3 Characteristics of the CryET39 Polypeptide Isolated worth, Calif.) following the manufacturer's procedures. The from EG5899 sequencing reactions were performed using the SequenaseTM The CryET39 polypeptide comprises a 385-amino acid Version 2.0 DNA Sequencing Kit (United States Biochemi sequence, has a calculated molecular mass of 44.246 Da, and cal/Amersham Life Science Inc., Cleveland, Ohio) following has a calculated isoelectric constant (p) equal to 5.47. The the manufacturer's procedures and using 5-dATP as the 30 amino acid composition of the CryET39 polypeptide is given labeling isotope (DuPont NEN Research Products, Boston, in Table 11. Mass.). Denaturing gel electrophoresis of the reactions was performed on a 6% (wt./vol.) acrylamide, 42% (wt/vol.) urea TABLE 11 sequencing gel. The dried gel was exposed to Kodak X-OMAT ARX-ray film (Eastman Kodak) overnight at room 35 AMINOACID COMPOSITION OF CRYET39 temperature. The NH-terminal specific oligonucleotide wid271 was Amino Acid # Residues % Total used as the initial sequencing primer. The entire sequence for Ala 6 1.5 Arg 3 0.7 the cryET39 gene was determined using the procedures 40 ASn 31 8.0 described above. Successive oligonucleotides to be used for Asp 23 5.9 priming sequencing reactions were designed from the Cys 2 O.S sequencing data of the previous set of reactions. In this way Gln 17 4.4 Glu 27 7.0 the DNA sequencing progressed along both the top and bot Gly 19 4.9 tom strand of the cryET39 gene in a step-wise fashion. 45 His 8 2.0 An oligonucleotide primer based on the NH2-terminal Ile 32 8.3 amino acid sequence of the CryET75 protein was designed Leu 33 8.5 Lys 39 10.1 for use in sequencing the cryET75 gene. The oligonucleotide Met 8 2.0 was designated MR51 and had the sequence: Phe 6 1.5 Pro 16 4.1 50 Ser 30 7.7 5-TCACAAAAATATATGAACAGC-3' (SEQ ID NO:24) Thr 36 9.3 Trp 7 1.8 Using the DNA sequencing procedures described above, a Tyr 24 6.2 Wall 18 4.6 partial nucleotide sequence of the cryET75 gene was deter Acidic (Asp + Glu) 50 mined, with the completion of the sequence being achieved 55 Basic (Arg + Lys) 42 using automated sequencing. DNA samples were sequenced Aromatic (Phe + Trp + Tyr) 37 using the ABI PRISM(R) DyeDeoxy sequencing chemistry Hydrophobic (Aromatic + Ile + Leu + Met + Val) 126 (Applied Biosystems, Inc., CA) according to the manufactur er's protocol. The completed reactions were run on an ABI 377 automated DNA sequencer. DNA sequence data were 60 5.7.2 CryET74 analyzed using Sequencher v3.0 DNA analysis software The DNA sequence of the CryET74 gene is represented by (Gene Codes Corporation, Ann Arbor, Mich.). The amino SEQID NO:5, and encodes the amino acid sequence of the acid sequence of the CryET75 protein was then derived by CryET74 polypeptide, represented by SEQID NO:6. translating the open reading frame of cryET75. The deter mined NH2-terminal sequence of CryET75 was identical 65 5.7.2.3 Characteristics of the CryET74 Polypeptide with the NH2-terminal amino acid sequence derived from the The CryET74 polypeptide comprises a 1 19-amino acid nucleotide sequence. sequence, has a calculated molecular mass of 13,221 Da, and US 7,772,369 B2 73 74 has a calculated pequal to 6.21. The amino acid composition 5.8 Example 8 of the CryET74 polypeptide is given in Table 12. Homology Analyses for CryET39 TABLE 12 5 The deduced amino acid sequence of the CryET39 protein AMINOACID COMPOSITION OF CRYET74 was used to query electronic sequence databases for related protein homologies. The SWISS-PROT ALL (swall) data Amino Acid # Residues % Total base was queried using FASTA version 3.15 (Pearson and Ala 4 3.3 Lipman, 1988) on the FASTA server at the European Bioin Arg 6 S.O 10 ASn 6 S.O formatics Institute under the following parameters Asp 7 5.8 (matrix pam150, ktup–2, gapcost -12, gapXcost-2). The Cys 1 O.8 results of the database search showed that CryET39 exhibited Gln 3 2.5 ~25% amino acid sequence identity over a 322-amino acid Glu 8 6.7 Gly 10 8.4 region of the 42-kDa mosquitocidal crystal protein from B. His 5 4.2 15 sphaericus. CryET39 also showed ~20% sequence identity Ile 9 7.5 over a 343 amino acid region of the 51-kDa crystal protein Leu 6 S.O from B. sphaericus. No other protein sequences in the data Lys 7 5.8 Met 2 1.6 base showed any significant sequence similarity with the Phe 4 3.3 CryET39 sequence. The amino acid sequence of CryET39 Pro 3 2.5 was also used to query the non-redundant (nr) database of the Ser 13 10.9 National Center Biotechnology Information (NCBI) using Thr 12 1O.O Trp 1 O.8 BLASTP version 2.0 (Altschulet al., 1997) using the follow Tyr 4 3.3 ing parameters: matrix blosumó2, gapped alignment, other Wall 8 6.7 parameters default settings. The nr database comprises Acidic (Asp + Glu) 15 25 sequence entries from PDB, SWISS-PROT, PIRK and CDS Basic (Arg + Lys) 13 translations of GenBank. The results of this search were in Aromatic (Phe + Trp + Tyr) 9 Hydrophobic (Aromatic + Ile + Leu + Met + Val) 34 agreement with those obtained using the FASTA search. 5.9 Example 9 30 5.7.3 CryET75 Database Searches for CryET74-Related Proteins The DNA sequence of the CryET75 gene is represented by SEQID NO:15, and encodes the amino acid sequence of the The deduced amino acid sequence for CryET74 was also CryET75 polypeptide, represented by SEQID NO:16. used to query the SWISS-PROT ALL and nr databases using 35 FASTA and BLASTPas described in Section 5.8. No proteins 5.7.3.3 Characteristics of the CryET75 Polypeptide were found showing any significant sequence similarity to The CryET75 polypeptide comprises a 310-amino acid CryET74. sequence, has a calculated molecular mass of 34.259 Da, and has a calculated pequal to 5.67. The amino acid composition 5.10 Example 10 of the CryET75 polypeptide is given in Table 13. 40 Database Searches for CryET75-Related Proteins TABLE 13 The deduced amino acid sequence for CryET75 was also AMINOACID COMPOSITION OF CRYET75 used to query the SWISS-PROT ALL and nr databases using Amino Acid # Residues % Total 45 FASTA and BLASTPas described in Section 5.8. The FASTA search revealed that CryET75 showed a 28.1% sequence Ala 15 4.8 Arg 5 1.6 identity with Cry15Aa (Genbank Accession Number ASn 15 4.8 M76442) over a 121-amino acid region. The BLASTP analy Asp 17 5.4 sis revealed 23% sequence identity over a 231-amino acid Cys 2 O6 50 region. Gln 11 3.5 Glu 22 7.0 Gly 17 5.4 5.11 Example 11 His 6 1.9 Ile 22 7.0 Subcloning and Expression of the CryET39 and Leu 24 7.7 55 CryET74 Genes Lys 29 9.3 Met 7 2.2 Phe 11 3.5 The Sucrose gradient fraction of parasporal crystals Pro 9 2.9 obtained from lysed cultures of strain EG11529 contained Ser 34 10.9 both CryET39 and CryET74 polypeptides. Bioassay evalua Thr 33 10.6 Trp 1 O.3 60 tion of the CryET39 and CryET74 preparation demonstrated Tyr 11 3.5 that this preparation was as toxic to WCRW larvae as total Wall 19 6.1 crystal protein prepared from EG11529. To determine the Acidic (Asp + Glu) 39 Basic (Arg + Lys) 34 insecticidal activity of the CryET39 protein alone it was nec Aromatic (Phe + Trp + Tyr) 23 essary to clone the cryET39 gene downstream from another Hydrophobic (Aromatic + Ile + Leu + Met + Val) 95 65 promoter. As described below, this was accomplished by using the PCRTM to amplify the promoter region for the B. thuringiensis crystal protein, Cry2Ac (Wu et al., 1991) and US 7,772,369 B2 75 76 placing it upstream of a PCRTM-amplified cryET39 gene in a confers ampiclliin resistance to recombinant cells into which shuttle vector, thus allowing for the expression of only the it has been successfully introduced. Plasmid DNA was pre CryET39 protein in a recombinant B. thuringiensis strain. pared from several amplicillin-resistant clones and digested Oligonucleotides were designed for use as primers in the with EcoRI and HindIII to confirm the presence of the 2-kb PCRTM amplification and subsequent cloning of the regula insert. One of these plasmids, designated plG1915, was used tory region of the cry2Ac gene; including the open reading for the cloning and expression of the cryET39 gene. frames ORF1 and ORF2, the ribosome binding site, and the PCRTM was used to amplify cryET39 from the cloned start codon for Cry2Ac. Oligo mr17 includes the EcoRI 8.4-kb HindIII fragment in pRG1337. Oligonucleotide prim restriction site 2124 base pairs upstream from the start codon ers were designed to facilitate the insertion of cryET39 into of the cry2Ac coding region. The sequence of mra7 is: 10 pEG1915 so that the gene could be expressed from the cry2Ac promoter. The cryET39-specific oligonucleotide, mrá4, includes the start codon (Met) for cryET39 with a (SEQ ID NO:25) HindIII site engineered 5' to the start codon. The sequence of s' - ATATCTATAGAATTCGCAATTCGTCCATGTG-3' EcoRI mr14 is: 15 The complementary oligonucleotide primer, mr13, con (SEO ID NO: 27) sists of the inverted complementary sequence for the ribo 5'-AAGGTGAAGCTTTTATGTTAGATACTAATAAAGTTTATG-3 Some binding site and start codon (Met) for the cry2Ac gene. HindIII Met A HindIII site has been incorporated between the RBS and the Met codon to allow for an in frame insertion of the sequence A second primer, designated mra-5, was designed to be of the cryET39 gene. The sequence of mrá3 is: complementary to a sequence 212 base pairs 3' to the end of the cryET39 coding region. A HindIII site was incorporated into the sequence of mr15. s' - CAGTATTCATATAAGCTTCCTCCTTTAATA-3' (SEQ ID NO: 26) Met HindIII, RBS 25 5 - CCGGAATAGAAGCTTTGCATATGG-3 (SEQ ID NO:28) The PCRTM reaction to amplify the cryET39 gene con HindIII sisted of the following: four deoxynucleosidetriphosphates dATP, dTTP, dCTP, dGTP at a final concentration of 200 The cryET39 PCRTM product generated using mrá4 and uM; 5 Jul 10xTaq. ExtenderTM Buffer (Stratagene Cloning mrá5 as a primers was cut with HindIII and inserted into the Systems) for a final concentration of 1x; 10 ng plG1273, 30 HindIII site specified by mr13 in the plasmid plG1915. This which consisted of pUC18 into which the cry2Ac gene has places the Met codon of the cryET39 gene 7-base pairs down been cloned; the oligonucleotide primers mra7 and mra-3 at a stream from the ribosome binding site of the cloned cry2Ac final concentration of 2.5 LM each; 2.5 units Taq. ExtenderTM promoter. Such a configuration was expected to allow the (Stratagene Cloning Systems); 2.5 units Taq Polymerase efficient expression of the recombinant CryET39 protein. The (Promega Corp.); and dHO to a final reaction volume of 50 35 ligation reaction that was performed to insert the cryET39 ul. The reaction was performed in a PowerBlockTM EasyCy gene into pEG1915 was used to transform E. coli DH5CTM to clerTM Series temperature cycler (Ericomp, Inc., San Diego, ampicillin resistance. Plasmid DNA was prepared and sub Calif.). Cycling conditions consisted of a 2-min denaturation jected to restriction enzyme analysis to identify a clone in step at 94° C., followed by 30 cycles of 94° C. for 1 min, 40 which the cryET39 gene had inserted into pEG1915 in the annealing at 50° C. for 1 min, and extension at 72°C. for 2 proper orientation. It was necessary for the sense Strand of min. Following the cycling 5 ul of the reaction was electro cryET39 to be oriented in the same direction as that of the phoresed through a 0.8% agarose gel to verify that an approxi cry2Ac regulatory region for efficient transcription to occur. mately 2-kb product band was produced by the PCRTM. The Restriction digests using the enzymes shown in FIG. 2 iden remainder of the reaction product was purified using a tified a plasmid containing cryET39 in the proper orientation. QIAquickTM spin column following the manufacturers 45 This plasmid was designated pEG1921. instructions (QIAGEN, Inc.). A Cry strain of B. thuringiensis was transformed to eryth The PCRTM-amplified cry2Ac promoter was then cloned romycin resistance by the introduction of plG1921. This into the E. coli/B. thuringiensis shuttle vector pHT315 recombinant strain, designated EG1 1937, was grown in C2 (Arantes and Lereclus, 1991). This was accomplished by 50 sporulation medium until sporulation and crystal formation digesting both pHT315 and the PCRTM product, in separate had occurred. Phase contrast microscopy clearly identified reactions, with the restriction enzymes EcoRI and HindIII. crystalline inclusions in the shape of elongated rectangles, or These enzymes cut within the multiple cloning region of needles, in the culture. The spores, crystals, and unlysed pHT315 and near the ends of the PCRTM product, within the sporangia were harvested by centrifugation. The material in sequences specified by the oligonucleotides mra7 and mr13. 55 the pellet was washed twice in a solution of 0.005% Triton The digested PCRTM product was isolated by running the X-100R, 10 mM Tris-HCl pH7.5 and suspended at one-half reaction through an agarose gel, followed by purification of the original Volume in the wash solution. the approximately 2-kb fragment using the GenecleanR pro SDS-PAGE was used to visualize the protein in the crystal. cedure (Bio 101). Digested pHT315 was purified in a similar 25ul of 0.5 N NaOH was added to 100 ul of the sample to manner. The fragment was then ligated into the digested 60 inhibit proteolytic activity which can destroy the protein as pHT315 in a reaction containing T4DNAligase and aligation the crystal is solubilized. After 2.5 min at room temperature buffer (Promega Corp.). 65 ul of 3xLaemmli sample buffer (30% glycerol, 15% The ligation mixture was introduced into transformation 2-mercaptoethanol, 3% SDS, 0.1875 M Tris, 0.01% bro competent E. coli DH5OTM cells (GibcoBRL) following pro mphenol blue) was added to the sample. The sample was cedures described by the manufacturer. The E. coli cells were 65 heated to 100° C. for 5 min, centrifuged briefly to remove plated on LB agar plates containing 50 ug/ml ampicillin and insoluble material, and loaded onto an acrylamide gel. The incubated overnight at 37° C. pHT315 contains a gene that protein bands were visualized by staining with Coomassie US 7,772,369 B2 77 78 Brilliant Blue R-250. This analysis demonstrated that expressing the coleopteran-toxic protein Cry3B2 (Donovan EG1 1937 expressed the 44-kDa CryET39 protein and not the et al., 1992) was grown and harvested in the same manner. 13-kDa (CryET74) or 34-kDa (CryET75) proteins produced SDS-PAGE was used to visualize the proteins. The proteins by recombinant strain, EG11529. The PCRTM-generated were quantified by comparison with standard loading of a copy of the cryET39 gene in pRG1921 was sequenced to 5 known amount of bovine serum albumin (Sigma Chemical confirm that it was identical to the wild-type copy from Co., St. Louis, Mo.) using a Computing Densitometer, Model pEG1337. Strain EG1 1937 was grown and prepared for bio 300A, (Molecular Dynamics, Sunnyvale, Calif.), following assays on WCRW larvae. Unexpectedly the crystal protein the manufacturer's procedures. from EG1 1937 had no activity on the insects. This result SCRW larvae were bioassayed via surface contamination suggested that either the CryET39 protein requires the pres 10 of an artificial diet similar to Marrone et al., (1992), but ence of the CryET74 to be toxic, or that CryET74 is the active without formalin. Each bioassay consisted of eight serial toxin protein. aqueous dilutions with aliquots applied to the Surface of the pEG1337 was digested with the restriction enzymes Hin diet. After the diluent (an aqueous 0.005% Triton X-100R dIII and EcoRI to release an approximately 3.2-kb fragment solution) had dried, first instar larvae were placed on the diet containing the cryET74 gene and only a small piece of the 15 and incubated at 28°C. Thirty-two larvae were tested per cryET39 gene. This fragment was isolated on an agarose gel. dose. Mortality was scored after 7 days. Data from replicated purified, and cloned into the shuttle vector pHT315, digested bioassays were pooled for probit analysis (Daum, 1970) with with HindIII and EcoRI, using procedures described above. mortality being corrected for control death, the control being This plasmid, designated pBG1919, was introduced into the diluent only (Abbot, 1925). Results were reported as the Cry B. thuringiensis strain, EG10650, by electroporation, amount of crystal protein per well (175 mm of diet surface) transforming the recombinant cells to erythromycin resis resulting in an LCso, the concentration killing 50% of the test tance. One transformant, designated EG1 1935, was grown in insects. 95% confidence intervals were also reported. C2 sporulation medium to determine if the cloned cryET74 gene could direct the expression of the crystal protein. The TABLE 1.4 culture was harvested and the crystal protein analyzed by 25 SDS-PAGE as described above. EG11935 produced only INSECTICIDALACTIVITY OF EG11529 PROTEINS ON CryET74 and had no activity on larvae of the WCRW. SCRW LARVAE The observations that CryET39 and CryET74, individu LCso ally, have no activity on WCRW larvae indicates that the two Sample (ug protein? well) 95% C.I. 30 proteins interact to form a toxic protein composition. PCRTM EG11529 34.1 28–41 was used to generate a DNA fragment containing the genes EG11535 (Cry3B2) 49.5 33-83 for CryET39 and CryET74, but not the gene for CryET75 also present on the 8.4-kb fragment of p.G1337 (see map of pEG1337). The m13/pUC forward sequencing primer, (Gib The results shown in the above table demonstrated that the coBRL), and mra5 were used to amplify an approximately 35 crystal proteins of EG11529 had significant activity on larvae 3.7-kb product containing both cryET74 and cryET39. of the SCRW. The LCs value for EG11529 was lower than PCRTM was performed using conditions described above that seen for the Cry3B2 control protein, although the 95% using pEG1337 as the template. The PCRTM product was gel confidence intervals did overlap, indicating the difference purified, digested with HindIII, and cloned into pHT315 that may not have been significant. had been cut with HindIII and treated with bacterial alkaline 40 5.12.2 Toxicity of CryET39 and CryET74 to WCRW Larvae phosphatase. The resulting plasmid, designated pEG1920, The toxicity to WCRW larvae (Diabrotica virgifera vir was used to transform the Cry B thuringiensis strain, gifera) was determined for EG11529, as well as the recom EG10650, to erythromycin resistance. One recombinant, des binant strains constructed to produce the individual crystal ignated EG1 1936, was grown to assess crystal protein pro proteins of EG11529. The recombinant strains and the crystal duction. EGi 1936 produced both the 44-kDa CryET39 and 45 proteins they produced are shown in Table 15. the approximately 13-kDa CryET74 polypeptides. Crystal proteins produced by EG11936 had activity on WCRW larvae TABLE 1.5 comparable to the activity seen with the recombinant strain, EG11529. Bt Recombinant Strain Crystal Protein Expressed MW (kDa)* 50 EG11529 CryET39 44 kDa 5.12 Example 12 CryET74 13 kDa CryET75 34 kDa EG11934 CryET75 34 kDa Toxicity of Crystal Proteins to Insects EG11935 CryET74 13 kDa EG11936 CryET39 + CryET74 44 kDa + 13 kDa 55 5.12.1 Toxicity of EG11529 Crystal Proteins to SCRW Lar EG11937 CryET39 44 kDa Wa *Molecular weights are estimated by migration of the protein on an SDS-PAGE gel and The toxicity to SCRW larvae (Diabrotica undecimpunc comparison with standards of known molecular weight, tata howardi) was determined for the recombinant strain A series of bioassays to determine the activity of the crystal EG11529, that expressed CryET39, CryET74, and CryET75 60 proteins was performed essentially as described for the polypeptides. SCRW assays, with the exception that neonate larvae were EG11529 was grown in C2 medium at 30° C. for 3 days used instead of first instar larvae. Purified crystal proteins until sporulation and lysis had occurred. The cultures were were prepared for the first assay using Sucrose step gradients. harvested by centrifugation, washed twice in 1x original Vol EG11529 was grown for three days at 30° C. in C2 sporula ume 0.005% Triton X-100R, and suspended in /10 the origi 65 tion medium. The sporulated and lysed cultures were har nal culture volume of 0.005% Triton X-100R). For compari Vested by centrifugation and washed, twice, in equal Volumes son EG11535, a recombinant B. thuringiensis strain of wash buffer (10 mM Tris-HCl, pH 7.5, 0.005% Triton US 7,772,369 B2 79 X-100R), and suspended at Mo' the original volume in the wash solution. Sucrose step gradients were prepared by lay TABLE 17 ering solutions of decreasing concentrations of Sucrose, in the INSECTICIDAL ACTIVITY OF B. thuringiensis PROTEINS wash solution, in 25x89 mm Ultra-Clear centrifuge tubes ONWCRW LARVAE (Beckman Instruments, Inc., Palo Alto, Calif.). The steps consisted of 7.5 ml each of the following concentrations of Sample LCso (ugwell) 95% C.I. sucrose (bottom to top): 79%-72%-68%-55%. 5 ml of the EG11935 No Activity at 80 ugwell EG11529 9.78 6.9-12.5 spore/crystal Suspension were layered on top of the gradient. EG11936 14.5 9.7-19.5 The gradients were centrifuged at 18,000 rpm at 4°C. in an 10 L8-70M ultracentrifuge (Beckman Instruments) overnight. The CryET74 protein produced by EG11935 had no activ The crystal proteins of EG11529 separated into two distinct ity on WCRW larvae, suggesting that the CryET39 protein, bands. One band, at the 68%-72% interface, contained only either alone or in combination with CryET74, was respon the CryET75 protein. The second band, at the 72%-79% sible for the insecticidal activity seen in EG11529 and interface, contained both CryET39 and CryET74. The bands 15 EG1, 1936. were pulled off with a pipet and washed, twice, in the wash An assay comparing a spore/crystal Suspension of buffer. The protein sample was then run over a second gradi EG1 1937, which produces only the CryET39 crystal protein, ent to assure a complete separation of CryET75 from with suspensions of EG1 1936 and EG1 1937 was performed. CryET39 and CryET74. The protein samples were run on an Also included in this assay were 50:50 mixtures of SDS-PAGE gel to verify the sample integrity. The samples EG1 1935+EG11937 to see if a mixture of CryET39 and were then quantified using a standard protein assay (Bio-Rad CryET74 had activity similar to that of EG1 1936. The data (Table 18) are expressed as percent control, which is mortality Laboratories, Hercules, Calif.), following manufacturers at a given dose corrected for control mortality in the diluent procedures. control. Two identical samples of EG 11937 were prepared for An assay was performed comparing the toxicity to WCRW 25 the purposes of repetition. larvae of the CryET39+CryET74 and the CryET75 purified crystal protein samples with the toxicity of EG11529. TABLE 1.8 EG11529 was prepared as a spore/crystal suspension and the amount of protein was determined by SDS-PAGE and densi Sample Dose (Igwell) Percent Control tometry. Data from the assay were pooled for probit analysis 30 EG11935 8O O (Daum, 1970) with mortality being corrected for control EG11935 160 O EG11936 8O 1OO death, the control being diluent only (Abbot, 1925). Results EG11936 160 100 are reported as the amount of crystal protein per well (175 EG11937 (1) 8O 1O.S mm of diet surface) resulting in an LCso, the concentration EG11937 (1) 160 6.7 35 EG11937 (2) 8O 13.3 killing 50% of the test insects. 95% confidence intervals were EG11937 (2) 160 O also reported in Table 16. EG11935+ EG11937 (1) 8O 100 EG11935+ EG11937 (1) 160 100 TABLE 16 EG11935+ EG11937 (2) 8O 100 EG11935+ EG11937 (2) 160 93.3 INSECTICIDAL ACTIVITY OF EG11529 PROTEINS 40 ONWCRW LARVAE The results of this assay clearly demonstrated that Sample LCso (ugwell) 95% C.I. CryET39 protein alone, as expressed in EG1 1937, does not account for the activity seen in EG11936 or EG11529. The CryET75 No Activity* addition of CryET74 to the CryET39 protein, however, EG11529 8.6 6.6-10.6 45 resulted in a composition toxic to larvae of the WCRW. These CryET39 + CryET74 9.7 7.2-12.7 data suggest that CryET39 and CryET74 interact to form the *6% mortality at a dose of 45 lugwell toxic component of EG11529 and EG1 1936. 5.12.3 Toxicity of the Crystal Proteins of EG11529 to CPB This assay clearly demonstrated that the purified CryET75 Larvae protein was not toxic towards the larvae of the WCRW. The 50 A sporulated culture of EG11529 was harvested, washed sample containing the mixture of CryET39 and CryET74 had and suspended as described above, to determine if the crystal activity similar to that of EG11529, indicating that the proteins produced by EG11529 are toxic to the larvae of the Colorado potato beetle (CPB). The assay on CPB larvae was CryET75 played no synergistic role in the toxicity of performed using techniques similar to those in the SCRW EG11529 to WCRW larvae. assay, except for the substitution of BioServe's #9380 insect To determine if the CryET74 is the toxic component of the 55 diet (with potato flakes added) for the artificial diet. Mortality EG11529 strain a spore/crystal suspension of EG1 1935, was scored at three days instead of seven days. For this assay which produces only CryET74, was compared in bioassay to 16 insects were used at a single dose of 140 ug/well. At this spore/crystal suspensions of EG11529 and EG1 1936, which dose 100% of the larvae were killed demonstrating that produces both CryET39 and CryET74. Data from replicated EG11529 is toxic to CPB larvae. bioassays were pooled for probit analysis (Daum, 1970) with 60 mortality being corrected for control death, the control being 5.13 Example 13 diluent only (Abbot, 1925). Results are reported as the Identification of Genes Encoding Related amount of crystal protein per well (175 mm of diet surface) Ö-Endotoxin Polypeptides resulting in an LCso, the concentration killing 50% of the test 65 insects. 95% confidence intervals are also reported in Table B. thuringiensis strains producing crystal proteins of 40-50 17 below. kDa were identified by SDS-PAGE analysis of parasporal US 7,772,369 B2 81 82 crystals produced by sporulating cultures. Total DNA was A cloned fragment isolated from the EG9444 library as extracted from these strains following procedures described described above encoded an approximately 45-kDa crystal above, digested with the restriction endonuclease HindIII, protein, designated CryET71, that was related to CryET39, and the restriction fragments resolved by agarose gel electro and an approximately 14-kDa crystal protein, designated phoresis and blotted to nitrocellulose filters for Southern blot analysis. PCRTM was used to amplify a segment of the CryET79, that was related to CryET74. DNA sequence analy cryET39 gene for use as a hybridization probe to identify and sis revealed that the cryET71 gene (SEQID NO:11) encodes clone related toxin genes from these B. thuringiensis strains. a protein of 397 amino acids and that the cryET79 gene (SEQ The PCRTM fragment extended from nucleotide 176 of the IDNO:9) encodes a protein of 123 amino acids. The CryET71 cryET39 coding sequence to approximately 200-bp 3' to the protein (SEQ ID NO:12) showed 78% sequence identity to end of the gene and was generated using the opposing primers 10 CryET39 while the CryET79 protein (SEQ ID NO:10) mr13 and mr24 and plasmid pEG1337 as a template. showed 80% sequence identity to CryET74. The recombinant B. thuringiensis strain expressing CryET71 and CryET79 was designated EG 11648 and the recombinant plasmid con mir13 : 5'-TGACACAGCTATGGAGC-3' (SEQ ID NO:33) 15 taining the cryET71 and cryET79 genes was designated mir24 : 5-ATGATTGCCGGAATAGAAGC-3' (SEQ ID NO:34) pEG1821 (Table 9). EG11648 was toxic to larvae of the WCRW. By analogy to the related CryET39 and CryET74 The amplified DNA fragment was radioactively labeled proteins, it was presumed that both CryET71 and CryET79 using O-P-dATP and a random primer labeling kit (Prine were required for full WCRW toxicity. EG9444 and a-GeneR Labeling System; Promega Corporation, Madison, EG11648 have been deposited with the ARS Patent Culture Wis.). Following incubation with the cryET39-specific Collection and given the NRRL accession numbers B-21785 hybridization probe, the filters were washed under moder and B-21788, respectively. ately stringent conditions (e.g., in 0.1x-1.0xSSC at 55C), and exposed to X-ray film to obtain an autoradiogram identifying A cloned fragment isolated from the EG4851 library as DNA fragments containing cryET39-related sequences. Sev described above encoded an approximately 44-kDa crystal 25 protein, designated CryET76, that was related to CryET39, eral strains yielded hybridization patterns that differed from and an approximately 15-kDa protein, designated CryET80, that of EG5899. Three strains, designated EG4100, EG4851, that was related to CryET74. DNA sequence analysis and EG9444 respectively, were selected for further charac revealed that the cryET76 gene (SEQ ID NO: 1) encoded a terization. protein of 387 amino acids and that the cryET80 gene (SEQ The cloning and expression of the cry genes from Strains 30 ID NO:3) encoded a protein of 132 amino acids. The EG4100, EG4851, and EG9444 was accomplished using pro CryET76 protein (SEQ ID NO:2) showed 61% sequence cedures described in Section 5.4, Section 5.5 and Section 5.6. identity to CryET39 while the CryET80 protein SEQ ID DNA was prepared from the strains and partially digested NO:4) showed 52% sequence identity to CryET74. The with the restriction enzyme MboI, resulting in an assortment recombinant B. thuringiensis strain expressing CryET76 and of essentially random DNA fragments. The MboI fragments 35 CryET80 was designated EG1 1658, and the recombinant were resolved on an agarose gel and fragments in the 6-10-kb plasmid containing the cryET76 and cryET80 genes has been size range were purified. The purified Mbol fragments were designated pEG1823 (Table 9). EG1 1658 was toxic to larvae then ligated into a B. thuringiensis/E. coli shuttle vector, of the WCRW. By analogy to the related CryET39 and pHT315, previously digested with BamHI and treated with CryET74 proteins, it was presumed that both CryET76 and alkaline phosphatase. The ligation mixture was then used to 40 CryET80 were required for full WCRW toxicity. EG4851 and transform E. coli to amplicillin resistance, thus constructing a EG11658 were deposited with the ARS Patent Culture Col library of cloned fragments representing the genome of each lection and given the NRRL accession numbers B-21915 and respective B. thuringiensis strain. The E. coli libraries were B-21916, respectively. plated on LB agar containing 50 ug/ml amplicillin and the Based on these results, the inventors contemplate that the colonies transferred to nitrocellulose filters. To identify 45 utilization of procedures similar to those described herein cryET39-related sequences the filters were probed with either will lead to the discovery and isolation of additional B. thur the radiolabeled oligonucleotide wa271 (EG9444 library), as ingiensis crystal protein toxins. DNA probes, based on the described in Section5.4 and Section 5.5, or with the cryET39 novel sequences disclosed herein may be prepared from oli specific hybridization probe described above (EG4100 and gonucleotides, PCRTM products, or restriction fragments and EG4851 libraries). Plasmid DNA was isolated from hybrid 50 used to identify additional genes related to those described izing E. coli colonies and used to transform an acrystallifer herein. These new genes may also be cloned, characterized by ous B. thuringiensis host strain to erythromycin resistance. DNA sequencing, and their encoded proteins evaluated in Recombinant B. thuringiensis clones were grown to sporula bioassay on a variety of insect pests using the methods tion in C2 medium and crystal proteins were analyzed by described herein. Novel genes, in turn, may therefore result in SDS-PAGE as described in Section 5.6. 55 the identification of new families of related genes, as seen in A cloned fragment identified in the manner described the above Examples. above from the EG4100 library encoded an approximately 60-kDa crystal protein, designated CryET69 (SEQ ID 5.14 Example 14 NO:14). DNA sequence analysis revealed that the cryET69 gene (SEQID NO:13) encoded a protein of 520 amino acid 60 Sequencing of Related Cry Genes residues. The CryET69 protein showed -23% sequence iden tity to CryET39. The recombinant B. thuringiensis strain expressing CryET69 was designated EG 11647 and the 5.14.1 CryET71 recombinant plasmid containing the cryET69 gene was des An initial nucleotide sequence for the cryET71 gene was ignated pEG1820. EG4100 and EG11647 were deposited 65 obtained using the oligonucleotide wid271 as a sequencing with the ARS Patent Culture Collection and given the NRRL primer and procedures described in Section 5.7. Successive accession numbers B-21786 and B-21787, respectively. oligonucleotides to be used for priming sequencing reactions US 7,772,369 B2 83 84 were designed from the sequencing data of the previous set of reactions to obtain the complete the sequence of the cryET71 TABLE 20-continued gene. The DNA sequence of the CryET71 gene is represented by AMINOACID COMPOSITION OF CRYET79 SEQID NO:11, and encodes the amino acid sequence of the CryET71 polypeptide, represented by SEQID NO:12. Amino Acid # Residues % Total Asp 5 4.0 5.14.14 Characteristics of the CryET71 Polypeptide Cys O O The CryET71 polypeptide comprises a 397-amino acid Gln 6 4.8 Glu 7 S.6 sequence, has a calculated molecular mass of 45,576 Da, and 10 has a calculated pequal to 4.75. The amino acid composition Gly 13 1O.S of the CryET71 polypeptide is given in Table 19. His 6 4.8 Ile 6 4.8 Leu 4 3.2 TABLE 19 Lys 6 4.8 AMINOACID COMPOSITION OF CRYET71 15 Met 2 1.6 Phe 3 2.4 Amino Acid # Residues % Total Pro 3 2.4 Ser 13 1O.S Ala 11 2.7 Thr 13 1O.S Arg 8 2.0 Trp 1 O.8 ASn 38 9.5 Tyr 8 6.5 Asp 28 7.0 Cys 2 O.S Wall 6 4.8 Gln 25 6.2 Acidic (Asp + Glu) 12 Glu 22 5.5 Basic (Arg + Lys) 10 Gly 19 4.7 Aromatic (Phe + Trp + Tyr) 12 His 5 1.2 25 Hydrophobic (Aromatic + Ile + Leu + Met + Val) 30 Ile 41 10.3 Leu 31 7.8 Lys 30 7.5 Met 8 2.0 5.14.3 CryET69 Phe 6 1.5 Pro 16 4.0 30 The NH-terminal amino acid sequence of the isolated Ser 29 7.3 CryET69 protein was determined using procedures described Thr 33 8.3 Trp 7 1.7 in Section 5.3. The NH2-terminal sequence of the isolated Tyr 24 6.O protein was: Wall 14 3.5 Acidic (Asp + Glu) 50 35 Basic (Arg + Lys) 38 (SEQ ID NO: 29) Aromatic (Phe + Trp + Tyr) 37 1. 2 3 4. 5 6 7 8 9 10 11 Hydrophobic (Aromatic + Ile + Leu + Met + Val) 131 Met Asin Val Asn His Gly Met Ser Cys Gly Cys An oligonucleotide primer based on the NH2-terminal 5.14.2 CryET79 40 amino acid sequence of the CryET69 protein was designed An initial sequence for the upstream cryET79 gene was for use in sequencing cryET69. This oligonucleotide, desig obtained using an oligonucleotide primer designed from the completed cryET71 sequence. DNA samples were sequenced nated cre 12, has the following sequence: using the ABIPRISMTM DyeDeoxy sequencing chemistry kit (Applied Biosystems) according to the manufacturer's pro 45 5-ATGAATGTAAATCATGGGATGWSNTGT-3' (SEQ ID NO:30) tocol. The completed reactions were run on as ABI 377 auto mated DNA sequencer. DNA sequence data were analyzed using Sequencher v3.0 DNA analysis software (Gene Codes where W=A and T and S=C and G. An initial nucleotide Corp.). Successive oligonucleotides to be used for priming sequence was obtained using cre 12 as a sequencing primer sequencing reactions were designed from the sequencing data 50 and procedures described in Section 5.7. Successive oligo of the previous set of reactions to obtain the complete nucleotides to be used for priming sequencing reactions were cryET79 gene sequence. designed from the sequencing data of the previous set of 5.14.2.3 Characteristics of the CryET79 Polypeptide reactions. The completion of the sequence was achieved The CryET79 polypeptide comprises a 123-amino acid using automated sequencing. DNA samples were sequenced sequence, has a calculated molecular mass of 13,609 Da, and 55 using the ABI PRISM DyeDeoxy sequencing chemistry kit has a calculated pequal to 6.32. The amino acid composition (Applied Biosystems) according to the manufacturer's pro of the CryET79 polypeptide is given in Table 20. tocol. The completed reactions were run on as ABI 377 auto mated DNA sequencer. DNA sequence data were analyzed TABLE 20 using Sequencher v3.0 DNA analysis software (Gene Codes 60 Corp.). AMINOACID COMPOSITION OF CRYET79

Amino Acid # Residues % Total 5.14.33 Characteristics of the CryET69 Polypeptide The CryET69 polypeptide comprises a 520-amino acid Ala 5 4.0 Arg 4 3.2 65 sequence, has a calculated molecular mass of 58,609 Da, and ASn 12 9.7 has a calculated pequal to 5.84. The amino acid composition of the CryET69 polypeptide is given in Table 21. US 7,772,369 B2 85 86 was accomplished using a Wizard R. SV Miniprep Kit TABLE 21 (Promega Corp.) following the manufacturer's procedures or a Qiagen Plasmid Kit (Qiagen Inc.) following the manufac AMINOACID COMPOSITION OF CRYET69 turer's procedures, followed by a phenol: chlorofomm: Amino Acid # Residues % Total isoamyl alcohol (50:48:2) extraction and then a chlorform: isoamyl alcohol (24:1) extraction. The sequencing reactions Ala 24 4.6 were performed using the SequenaseTM Version 2.0 DNA Arg 30 5.7 ASn 60 11.5 Sequencing Kit (United States Biochemical/Amersham Life Asp 27 S.1 Science Inc.) following the manufacturer's procedures and Cys 9 1.7 10 using S-IdATP as the labeling isotope (DuPont NENR) Gln 32 6.1 Research Products). Denaturing gel electrophoresis of the Glu 24 4.6 Gly 32 6.1 reactions was performed on a 6% (wt.?vol.) acrylamide, 42% His 9 1.7 (wt./vol.) urea sequencing gel or on a CastAway TM Precast Ile 24 4.6 6% acrylamide sequencing gel (Stratagene). The dried gel Leu 31 5.9 15 Lys 15 2.8 was exposed to Kodak X-OMAT AR X-ray film (Eastman Met 10 1.9 Kodak) overnight at room temperature to obtain an autorad Phe 2O 3.8 iogram. Pro 24 4.6 A partial DNA sequence for the cryET76 and cryET80 Ser 39 7.5 genes on pEG1823 was obtained by using the procedures Thr 48 9.2 Trp 6 1.1 described above. The cryET39-specific oligonucleotide mr18 Tyr 22 4.2 was used as the initial sequencing primer. The sequence of Wall 34 6.5 mr18 is: Acidic (Asp + Glu) 51 Basic (Arg + Lys) 45 Aromatic (Phe + Trp + Tyr) 48 Hydrophobic (Aromatic + Ile + Leu + Met + Val) 147 25 5 " - GTACCAGAAGTAGGAGG-3' (SEQ ID NO. 31) Successive oligonucleotides to be used for priming sequencing reactions were designed from the sequencing data 5.16 Example 16 of the previous set of reactions. The completion of the sequence was achieved using automated sequencing. DNA Database Searches for CryET69-Related Proteins 30 samples were sequenced using the ABI PRISM Dye Deoxy sequencing chemistry kit (Applied Biosystems) according to The deduced amino acid sequence for CryET69 was used the manufacturer's Suggested protocol. The completed reac tions were run on as ABI 377 automated DNA sequencer. to query the SWISS-PROT ALL and nr databases using DNA sequence data were analyzed using Sequencher v3.0 FASTA and BLASTP as described for CryET39 in Section 35 5.8 except that the blosum.50 comparison matrix was used for DNA analysis software (Gene Codes Corp.). The DNA the FASTA search. The results of the FASTA search indicated sequence of cryET76 (SEQID NO:1) and cryET80 (SEQID that CryET69 showed -32% sequence identity over a 338 NO:3) is shown below. The deduced amino acid sequence of amino acid region with the 42-kDa mosquitocidal crystal the CryET76 protein (SEQID NO:2) and the CryET80 pro protein of B. sphaericus and -30% sequence identity over a 40 tein (SEQ ID NO:4) is also shown below. The entire 440-amino acid region with the 51-kDa crystal protein of B. sequenced region is shown in (SEQID NO: 17). sphaericus. 5.18.1 CryET76 The DNA sequence of the CryET76 gene is represented by 5.17 Example 17 SEQID NO:1, and encodes the amino acid sequence of the 45 CryET76 polypeptide, represented by SEQID NO:2. Database Searches for CryET71- and CryET79-Related Proteins 5.18.1.3 Characteristics of the CryET76 Polypeptide The CryET76 polypeptide comprises a 387-amino acid sequence, has a calculated molecular mass of 43,812 Da, and The deduced amino acid sequences for CryET71 and has a calculated pequal to 5.39. The amino acid composition CryET79 were used to query the SWISS-PROT ALL and nr 50 databases using FASTA and BLASTP as described for of the CryET76 polypeptide is given in Table 22. CryET39 in Section 5.8. The results of the FASTA search indicated that CryET71 showed ~25% sequence identity over TABLE 22 a 323-amino acid region with the 42-kDa mosquitocidal crys AMINOACID COMPOSITION OF CRYET76 tal protein of B. sphaericus and ~25% sequence identity over 55 a 388-amino acid region with the 51-kDa crystal protein of B. Amino Acid # Residues % Total sphaericus. The FASTA and BLASTP searches did not iden Ala 14 3.6 tify proteins with significant sequence identity to CryET79. Arg 7 1.8 ASn 39 1O.O Asp 17 4.3 5.18 Example 18 60 Cys 1 O.2 Gln 17 4.3 Sequencing of the CryET76 and CryET80 Genes Glu 22 S.6 Gly 22 S.6 His 4 1.O A partial DNA sequence of the genes cloned on pEG1823 Ile 31 8.O was determined following established dideoxy chain-termi 65 Leu 34 8.7 nation DNA sequencing procedures (Sanger et al., 1977). Lys 27 6.9 Preparation of the double stranded plasmid template DNA US 7,772,369 B2 87 88 cryET80 gene begins at nucleotide 1773 and ends at nucle TABLE 22-continued otide 2168. The cryET76 gene begins at nucleotide 2264 and ends at nucleotide 3424. AMINOACID COMPOSITION OF CRYET76 5.19 Example 19 Amino Acid # Residues % Total

Met 5 1.2 Analysis of Sequence Homologies Phe 8 2.0 Pro 10 2.5 5.19.1 Database Searches for CryET76- and CryET80-Re Ser 30 7.7 10 lated Proteins Thr 47 12.1 Trp 8 2.0 The amino acid sequences of the CryET76 and CryET80 Tyr 24 6.2 proteins, deduced by translation of the nucleotide sequence, Wall 2O S.1 were used to query sequence databases for related protein Acidic (Asp + Glu) 39 15 sequences. The SWISS-PROT ALL database was queried Basic (Arg + Lys) 34 using FASTA version 3.15 (Pearson and Lipman, 1988) pro vided by the FASTA server at European Biotechnology Insti Aromatic (Phe + Trp + Tyr) 40 tute using the following parameters (library-Swall, Hydrophobic (Aromatic + Ile + Leu + Met + Val) 130 matrix pam150, ktup–2, gapcost-12, gapXcost-2). The amino acid sequences of CryET76 and CryET80 were also used to query the non-redundant (nr) database of the National 5.18.2 CryET80 Center Biotechnology Information (NCBI) using BLASTP The DNA sequence of the CryET80 gene is represented by version 2.0 (Altschulet al., 1997) with the following param SEQID NO:3, and encodes the amino acid sequence of the eters: matrix-blosumó2, gapped alignment, other CryET80 polypeptide, represented by SEQID NO:4. parameters default settings. 25 The results of the FASTA analysis revealed that CryET76 5.18.2.3 Characteristics of the CryET80 Polypeptide showed ~27% sequence identity over a 320-amino acid The CryET80 polypeptide comprises a 132-amino acid region with the 42-kDa mosquitocidal crystal protein from B. sequence, has a calculated molecular mass of 14,839 Da, and sphaericus while CryET80 showed no significant sequence has a calculated pequal to 6.03. The amino acid composition 30 similarity to sequences in SWISS-PROT ALL. The results of the BLASTP search were in general agreement with those of of the CryET80 polypeptide is given in Table 23. the FASTA search. No proteins with significant sequence TABLE 23 similarity to CryET80 were identified. 5.19.2 Additional Sequence Comparisons with Cry Proteins AMINOACID COMPOSITION OF CRYET8O 35 Sequence alignments were performed to compare the Amino Acid # Residues % Total CryET39, CryET74, CryET75, CryET71, CryET79, CryET76, CryET80 and CryET69 sequences with sequences Ala 7 5.3 Arg 8 6.O from recently published patent applications. The alignments ASn 13 9.8 were performed using PALIGN in the PC/GENEversion 6.85 Asp 8 6.O 40 sequence analysis package (Intelligenetics Corp. Mountain Cys 1 0.7 View, Calif.). The pairwise alignments were performed using Gln 3 2.2 Glu 8 6.O the following parameters; comparison matrix unitary, open Gly 9 6.8 gap cost 3, unit gap cost-1. His 8 6.O Ile 13 9.8 45 5.19.2.1 CryET39 Leu 6 4.5 Sequence alignment comparing the CryET39 sequence Lys 4 3.0 with sequences from recently published patent applications Met 2 1.5 revealed sequence similarity between CryET39 and proteins Phe 2 1.5 Pro 3 2.2 identified by sequence identifiers 11, 38 and 43 of Intl. Pat. Ser 11 8.3 50 Appl. Publ. No. WO 97/40162. CryET39 showed a 99.2% Thr 11 8.3 sequence identity to sequence number 11, 78.6% sequence Trp 1 0.7 Tyr 6 4.5 identity to sequence number 38, and 79.9% sequence identity Wall 8 6.O to sequence number 43. Acidic (Asp + Glu) 16 Basic (Arg + Lys) 12 5.19.2.2 CryET74 Aromatic (Phe + Trp + Tyr) 9 55 Sequence alignment comparing the CryET74 sequence Hydrophobic (Aromatic + Ile + Leu + Met + Val) 38 with sequences from recently published patent applications revealed sequence similarity between CryET74 and sequence identifier numbers 32, 36, and 41 of the Intl. Pat. Appl. Publ. 5.18.3 Characteristics of the CryET76, CryET80 and No. WO 97/40162. CryET74 shows 100% sequence identity CryET84 Genes Isolated from EG4851 (SEQID NO:17) 60 with sequence identifier number 32, 80.7% sequence identity The DNA sequence of the entire three gene operon con with sequence identifier number 36, and 77.3% sequence taining the CryET76, CryET80, and CryET84 coding regions identity with sequence identifier number 41 of that applica is represented by SEQID NO: 17. tion. Instrain EG4851, the cryET84 gene is located immediately 65 5.19.2.3 CryET75 5' to the cryET80 and cryET76 genes. The cryET84 gene Sequence alignment comparing CryET75 with sequences begins at nucleotide 656 and ends at nucleotide 1681. The from recently published patent applications revealed approxi US 7,772,369 B2 89 90 mately 26% sequence identity between CryET75 and cryET76 and cryET80 genes in a B. thuringiensis strain that CryET33, a coleoptera-toxic protein, disclosed in Intl. Pat. did not produce other crystal proteins (i.e. a Cry strain). The Appl. Publ. No. WO97/17600. plasmid containing the cloned cryET76 and cryET80 genes, 5.19.2.4 CryET71 pEG1823, contains a B. thuringiensis origin of replication as Sequence alignment comparing the CryET71 sequence well as an origin that directs replication in E. coli, as with sequences from recently published patent applications described above. pEG1823 was used to transform the Cry B. revealed sequence similarity between CryET71 and sequence thuringiensis strain EG10650 to erythromycin resistance identifier numbers 11, 38, and 43 of the Intl. Pat. Appl. Publ. (Em') by electroporation (Macaluso and Mettus, 1991). Cells No. WO 97/40162. CryET71 showed 78.4% sequence iden 10 transformed to Em' were selected by incubation overnighton tity with sequence identifier number 11; 91.9% sequence LB agar plates containing 25ug/ml erythromycin. One Em' identity with sequence identifier number 38; and 97.4% colony from each transformation was selected for further sequence identity with sequence identifier number 43. analysis. One isolate was designated EG1 1658. 5.19.2.5 CryET79 EG1 1658 was grown in C2 sporulation medium containing Sequence alignment comparing the CryET79 sequence 15 with sequences from recently published patent applications 25ug/ml erythromycin for four days at 25°C., at which point revealed sequence similarity between CryET79 and the sporulation and cell lysis had occurred. Microscopic exami sequences identifier numbers 32, 36, and 41 of the Intl. Pat. nation of the sporulated cultures demonstrated that the Appl. Publ. No. WO 97/40162. CryET79 showed 79.8% recombinant strain was producing parasporal inclusions. The sequence identity with sequence identifier number 32; 95.9% sporulated culture of EG1 1658 was harvested by centrifuga sequence identity with sequence identifier number 36; and tion, washed, and resuspended at one-tenth the original Vol 91% sequence identity with sequence identifier number 41. ume in H2O. The crystal protein in the Suspension was char 5.19.2.6 CryET76 acterized by SDS-PAGE analysis which revealed the Sequence alignment comparing the CryET76 sequence production of approximately 44- and 15-kDa proteins. with sequences from recently published patent applications 25 revealed sequence similarity between CryET76 and sequence 5.21 Example 21 identifier numbers 11, 38, and 43 of the Intl. Pat. Appl. Publ. No. WO 97/40162. CryET76 showed 60.8% sequence iden Toxicity of CryET76 and CryET80 to Insects tity to sequence identifier number 11; 61.6% sequence iden 30 tity to sequence identifier number 38; and 61.9% sequence The toxicity of CryET76 and CryET80 protein towards identity to sequence identifier number 43. WCRW was determined. 5.19.2.7 CryET80 EG1 1658 was grown in C2 medium at 25°C. for four days Sequence alignment comparing the CryET80 sequence until sporulation and cell lysis had occurred. The culture was with sequences from recently published patent applications 35 harvested by centrifugation, washed in approximately 2.5 revealed sequence similarity between CryET80 and sequence times the original volume with distilled HO, and resus identifier numbers 32, 36, and 41 of the Intl. Pat. Appl. Publ pended in 0.005% Triton X-1002) at one-tenth the original No. WO 97/40162. CryET80 showed 52.1% sequence iden volume. For comparison with EG1 1658, the recombinant B. tity to sequence identifier number 32; 56.1% sequence iden thuringiensis strains, EG11529, producing the WCRW-toxic tity to sequence identifier number 36; and 54.5% sequence 40 proteins CryET39 and CryET74, and EG11648, producing identity to sequence identifier number 41. the WCRW-toxic proteins CryET71 and CryET79, were 5.19.2.8 CryET69 grown and harvested in the same manner. Toxin proteins from Sequence alignment comparing the CryET69 sequence the samples were quantified by SDS-PAGE as described revealed only 23-25% sequence identity between CryET69 45 (Brussock and Currier, 1990. The procedure was modified to and sequence identifier numbers 11,38, and 43 of the Intl. Pat. eliminate the neutralization step with 3M HEPES. Appl. Publ. No. WO 97/40162. This crystal protein showed a higher degree of homology to the mosquitocidal crystal pro WCRW larvae were bioassayed via surface contamination teins of B. sphaericus than to the crystal proteins of B. thur of an artificial diet (20g agar, 50 g wheatgerm, 39 g Sucrose, ingiensis. 32 g casein, 14 g fiber, 9 g Wesson salts mix, 1 g methyl 50 paraben, 0.5 g sorbic acid, 0.06 g cholesterol, 9 g Vander 5.19.3 Summary Zant's vitamin mix, 0.5 ml linseed oil, 2.5 ml phosphoric/ These analyses demonstrated that the amino acid propionic acid per 1 liter). Each bioassay of EG11658 sequences of CryET69, CryET75, CryET76 and CryET80 are (CryET76 and CryET80), EG11529 (CryET39 and markedly different from the sequences of previously CryET74), and EG11648 (CryET71 and CryET79) consisted described insecticidal crystal proteins. Employing the 55 nomenclature established for B. thuringiensis crystal proteins of eight serial aqueous dilutions with aliquots applied to the (Crickmore et al., 1998), CryET76 and CryET80 would be surface of the diet. After the diluent (an aqueous 0.005% assigned a new secondary rank and CryET69 and CryET75 Triton X—OOR) solution) had dried, neonate larvae were would be assigned a new primary rank. placed on the diet and incubated at 28°C. Thirty-two larvae 60 were tested per dose. Mortality was scored after seven days. 5.20 Example 20 Data from replicated bioassays were pooled for probit analy sis (Daum, 1970) with mortality being corrected for control Expression of Recombinant CryET76 and CryET80 death, the control being diluent only (Abboff, 1925). Results Polypeptides are reported as the amount of crystal protein per well (175 m 65 of diet surface) resulting in an LCso, the concentration killing To characterize the properties of the CryET76 and 50% of the test insects. 95% confidence intervals are also CryET80 proteins, it was necessary to express the cloned reported for the LCs values (Table 24). US 7,772,369 B2 92 Age site on pEG1823. The recombinant plasmid from one TABLE 24 such clone was designated plG2206. pEG2206 was subse quently used to transform, via electroporation, the acrystal INSECTICIDALACTIVITY OF CRY PROTEINS TO liferous B. thuringiensis strain EG10650 to erythromycin WCRW LARVAE 5 resistance. The recombinant Bt strain containing plG2206 Crystal LCso LC95 was designated EG12156. Sample Protein (ug protein well) 95% C.I. (g protein? well) A deletion mutation was introduced into the cryET80 cod EG11658 CryET76 10.7 22-18.9 46 ing sequence on pEG1823 to generate a recombinant plasmid CryET80 capable of directing the production of CryET76 alone. A EG11648 CryET71 5.3 O.9-10.1 27 10 unique DraIII restriction site within the cryET80 coding CryET79 sequence was identified by computer analysis of the deter EG11936 CryET39 12.3 125-143 32 CryET74 mined cryET80 nucleotide sequence. Subsequent digestion of plG1823 with DraIII confirmed that this restriction site was unique to the plasmid. To generate a mutation at this site, The results shown in Table 24 demonstrated that the 15 pEG1823 was digested with DraIII and the DNA ends blunt CryET76 and CryET80 proteins had significant activity on ended with T4 polymerase in the presence of dNTPs. The WCRW larvae. linear DNA fragment was subsequently resolved by electro phoresis on a 1% agarose gel, the DNA band excised with a 5.22 Example 22 razor blade, and the DNA purified using the Qiagen gel 2O extraction kit. The purified DNA was self-ligated using T4 Toxicity of CryET69 to Insects ligase and used to transform the E. coli strain DH5C. to ampi cillin resistance. Restriction enzyme analysis of DNA recov The toxicity of CryET69 towards WCRW was determined ered from several ampicillin-resistant clones confirmed the using procedures described in Section 5.21. Results are disruption of the DraHI site on pEG1823. The recombinant reported as the amount of crystal protein per well (175 m of 2s plasmid from one such clone was designated pBG2207. diet Surface) resulting in an LCso, the concentration killing pEG2207 was subsequently used to transform, via electropo 50% of the test insects. 95% confidence intervals are also ration, the acrystalliferous B thuringiensis strain EG10650 to reported for the LCs values (Table 25). erythromycin resistance. The recombinant strain containing pEG2207 was designated EG12158. TABLE 25 30 Strains EG1 1658, EG12156, and EG12158 were used to inoculate 100 ml C2 broth cultures containing 10 g/mleryth INSECTICIDALACTIVITY OF CRYET69 TO WCRW LARVAE romycin. The broth cultures were grown with shaking in 500 Crystal LCso LC9s ml baffled flasks at 28-30°C. for 3 days at which time the Sample Protein (ug protein well) 95% C.I. (g protein? well) cultures were fully sporulated and the sporangia lysed. The EG11204 Cry3B2 13.8 3.2-3.0.1 502 35 spores and crystals were pelleted by centrifugation at 8,000 EG11647 CryET69 147.3 73-1292 61.90 rpm (-9800xg) in a JA14 rotor for 20 min at 4°C. The pellets were suspended in 50 ml of 10 mM Tris-HCl, 50 mM. NaCl, Control mortality = 22% 1 mM EDTA, 0.005% Triton R. X-100 (pH 7.0). The spores and crystals were pelleted again by centrifugation at 3,750 These results demonstrated that CryET69 was significantly 40 rpm (-3200xg) in a Beckman GPR centrifuge for 1 hour at 4 less active than Cry3B2 against WCRW. Nevertheless, this C. The pellets were resuspended in 10 ml of 10 mM Tris-HCl, crystal protein apparently represents a new class of 50 mM. NaCl, 1 mM EDTA, 0.005% Triton RX-100 (pH 7.0) coleopteran-toxic Ö-endotoxins. and stored at 4-8°C. Crystal proteins produced by these cultures were detected 5.23 Example 23 45 by SDS-PAGE and subsequent staining of the SDS gels with Coomassie Brilliant Blue R-250 as described in Section 5.11. Construction of Strains EG12156 and EG12158 The results of this analysis confirmed that strain EG12156 produced CryET80, but not CryET76, while strain EG12158 Recombinant B. thuringiensis strains were constructed that produced CryET76, but not CryET80 (FIG. 3). Thus, each produce either CryET76 or CryET80. A frameshift mutation 50 crystal protein could be produced independently of the other was introduced into the cryET76 coding sequence on crystal protein. The role of each crystal protein in effecting pEG1823 to generate a recombinant plasmid capable of toxicity towards WCRW larvae may now be studied in even directing the production of CryET80 alone. A unique AgeI greater detail. restriction site within the cryET76 coding sequence was iden The SDS-PAGE analysis described in FIG.3 also revealed tified by computer analysis of the determined cryET76 nucle 55 the presence of an additional protein present in both the otide sequence. Subsequent digestion of p.G1823 with AgeI EG12156 and EG12158 crystal preparations. This protein confirmed that this restriction site was unique to the plasmid. exhibited an apparent molecular mass of approximately 35 To generate a frameshift mutation at this site, pFG 1823 was kDa and was designated CryET84. digested with AgeI and the DNA ends blunt-ended with T4 Additional DNA sequence analysis of the cloned insert in polymerase in the presence of dNTPs. The linear DNA frag 60 pEG1823 revealed a third open reading frame sufficient to ment was subsequently resolved by electrophoresis on a 1% code for a 38-kDa protein (SEQ ID NO:19). This coding agarose gel, the DNA band excised with a razorblade, and the region is located immediately 5' to the cryET80 gene. Thus, DNA purified using the Qiagen gel extraction kit. The puri cryET84, cryET80, and cryET76 may comprise an operon. fied DNA was self-ligated using T4 ligase and used to trans The CryET84 protein isolated from EG4851 comprises a form the E. coli strain DH5C. to ampicillin resistance. Restric 65 341-amino acid sequence, and has a calculated molecular tion enzyme analysis of DNA recovered from several mass of approximately 37.884 Da. CryET84 has a calculated ampicillin-resistant clones confirmed the disruption of the isoelectric constant (pl) equal to 5.5. US 7,772,369 B2 93 94 SDS-PAGE analysis of the EG11658 crystal proteins used promoter, e.g., promoters derived by means of ligation with for the WCRW bioassays described in Section 5.21 did not operator regions, random or controlled mutagenesis, etc. Fur detect the CryET84 protein band. Apparently, subtle differ thermore, the promoters may be altered to contain multiple ences in the cultivation of the strain or in the harvesting and "enhancer sequences to assist in elevating gene expression. washing of the spore-crystal Suspension can result in the loss 5 The RNA produced by a DNA construct of the present of CryET84. invention also contains a 5' non-translated leader sequence. Sequence comparisons using Blast 2.0 and FASTA3, as This sequence can be derived from the promoter selected to described in Example 8, revealed no significant sequence express the gene, and can be specifically modified so as to similarity between CryET84 and all known B. thuringiensis increase translation of the mRNA. The 5' non-translated crystal proteins. 10 regions can also be obtained from viral RNAS, from suitable eucaryotic genes, or from a synthetic gene sequence. The 5.24 Example 24 present invention is not limited to constructs wherein the non-translated region is derived from the 5' non-translated Preparation of Insect-Resistant Transgenic Plants sequence that accompanies the promoter sequence. 15 For optimized expression in monocotyledenous plants Such as maize, an intron may also be included in the DNA 5.24.1 Plant Transgene Construction expression construct. This intron would typically be placed The expression of a plant transgene which exists in double near the 5' end of the mRNA in untranslated sequence. This stranded DNA form involves transcription of messenger intron could be obtained from, but not limited to, a set of RNA (mRNA) from one strand of the DNA by RNA poly introns consisting of the maize hsp70 intron (U.S. Pat. No. merase enzyme, and the Subsequent processing of the mRNA 5,424.412; specifically incorporated herein by reference) or primary transcript inside the nucleus. This processing the rice Act 1 intron (mcElroy et al., 1990). involves a 3' non-translated region which adds polyadenylate As noted above, the 3' non-translated region of the chi nucleotides to the 3' end of the RNA. Transcription of DNA meric plant genes of the present invention contains a poly into mRNA is regulated by a region of DNA usually referred 25 adenylation signal which functions in plants to cause the to as the “promoter'. The promoter region contains a addition of adenylate nucleotides to the 3' end of the RNA. sequence of bases that signals RNA polymerase to associate Examples of preferred 3' regions are (1) the 3' transcribed, with the DNA and to initiate the transcription of mRNA using non-translated regions containing the polyadenylate signal of one of the DNA strands as a template to make a corresponding Agrobacterium tumor-inducing (Ti) plasmid genes, such as Strand of RNA. 30 the nopaline synthase (NOS) gene and (2) plant genes such as A number of promoters which are active in plant cells have the pea ssRUBISCO E9 gene (Wong et al., 1992). been described in the literature. Such promoters may be obtained from plants or plant viruses and include, but are not 5.24.2 Plant Transformation and Expression limited to, the nopaline synthase (NOS) and octopine syn A transgene containing a 5-endotoxin coding sequence of thase (OCS) promoters (which are carried on tumor-inducing 35 the present invention can be inserted into the genome of a plasmids of Agrobacterium tumefaciens), the cauliflower plant by any suitable method such as those detailed herein. mosaic virus (CaMV) 19S and S promoters, the light-in Suitable plant transformation vectors include those derived ducible promoter from the small subunit of ribulose 1.5- from a Ti plasmid of A. tumefaciens, as well as those dis bisphosphate carboxylase (ssERUBISCO, a very abundant closed, e.g., by Herrera-Estrella (1983), Bevan et al. (1983), plant polypeptide), and the Figwort Mosaic Virus (FMV)35S 40 Klee (1985) and Eur. Pat. Appl. Publ. No. EP0120516. In promoter. All of these promoters have been used to create addition to plant transformation vectors derived from the Tior various types of DNA constructs which have been expressed root-inducing (R1) plasmids of A. tumefaciens, alternative in plants (see e.g., U.S. Pat. No. 5,463,175, specifically incor methods can be used to insert the DNA constructs of this porated herein by reference). invention into plant cells. Such methods may involve, for example, the use of liposomes, electroporation, chemicals The particular promoter selected should be capable of 45 causing sufficient expression of the enzyme coding sequence that increase free DNA uptake, free DNA delivery via micro to result in the production of an effective amount of protein. projectile bombardment, and transformation using viruses or One set of preferred promoters are constitutive promoters pollen (Fromm et al., 1986; Fromm et al., 1990). Such meth such as the CaMV35S or FMV35S promoters that yield high ods are described in detail in Section 4.0. levels of expression in most plant organs (U.S. Pat. No. 5,378, 50 5.24.3 Construction of Plant Expression Vectors 619, specifically incorporated herein by reference). Another For efficient expression of the polynucleotides disclosed set of preferred promoters are root enhanced or specific pro herein in transgenic plants, the selected sequence region(s) moters such as the CaMV derived 4 as-1 promoter or the encoding the insecticidal polypeptide(s) must have a suitable wheat POX1 promoter (U.S. Pat. No. 5,023,179, specifically sequence composition (Diehn et al., 1996). incorporated herein by reference: Hertig et al., 1991). The 55 For example, to place one or more of cry genes described root enhanced or specific promoters would be particularly herein in a vector Suitable for expression in monocotyledon preferred for the control of corn rootworm (Diabroticus spp.) ous plants (e.g., under control of the enhanced Cauliflower in transgenic corn plants. Mosaic Virus 35S promoter and link to the hsp70 intron The promoters used in the DNA constructs of the present followed by a nopaline synthase polyadenylation site as in invention may be modified, if desired, to affect their control 60 U.S. Pat. No. 5,424,412, specifically incorporated herein by characteristics. For example, the CaMV35S promoter may be reference), the vector may be digested with appropriate ligated to the portion of the ssRUBISCO gene that represses enzymes such as NcoI and EcoRI. The larger vector band of the expression of ssRUBISCO in the absence of light, to approximately 4.6 kb is then electrophoresed, purified, and create a promoter which is active in leaves but not in roots. ligated with T4 DNA ligase to the appropriate restriction The resulting chimeric promoter may be used as described 65 fragment containing the plantized cry gene. The ligation mix herein. For purposes of this description, the phrase is then transformed into E. coli, carbenicillin resistant colo “CaMV35S' promoter thus includes variations of CaMV35S nies recovered and plasmid DNA recovered by DNA mini US 7,772,369 B2 95 96 prep procedures. The DNA may then be subjected to restric tion endonuclease analysis with enzymes such as Nicol and TABLE 26 - continued EcoRI (together). NotI, and PstI to identify clones containing the cry gene coding sequence fused to the hsp70 intron under LIST OF SEQUENCES OF POTENTIAL POLYADENYLATION control of the enhanced CaMV35S promoter). SIGNALS To place the 8-endotoxin gene in a vector suitable for recovery of stably transformed and insect resistant plants, the AATCAA ATTAAAikik restriction fragment from pMON33708 containing the lysine ATACTA AATTAAikik oxidase coding sequence fused to the hsp70 intron under control of the enhanced CaMV35S promoter may be isolated 10 ATAAAA AATACAkk by gel electrophoresis and purification. This fragment can then be ligated with a vector such as pMON30460 treated ATGAAA CATAAAkk with NotI and calf intestinal alkaline phosphatase *indicates a potential major plant polyadenylation site. (pMON30460 contains the neomycin phosphotransferase ** indicates a potential minor animal polyadenylation site. coding sequence under control of the CaMV35S promoter). 15 All others are potential minor plant polyadenylation sites. Kanamycin resistant colonies may then be obtained by trans The regions for mutagenesis may be selected in the follow formation of this ligation mix into E. Coli and colonies con ing manner. All regions of the DNA sequence of the cry gene taining the resulting plasmid can be identified by restriction are identified which contained five or more consecutive base endonuclease digestion of plasmid miniprep DNAS. Restric pairs which were A or T. These were ranked in terms of length tion enzymes such as NotI, EcoRV. HindIII, Ncol, EcoRI, and and highest percentage of A+T in the Surrounding sequence BglII can be used to identify the appropriate clones contain over a 20-30 base pair region. The DNA is analysed for ing the restriction fragment properly inserted in the corre regions which might contain polyadenylation sites or ATTTA sponding site of pMON30460, in the orientation such that sequences. Oligonucleotides are then designed which maxi both genes are in tandem (i.e. the 3' end of the cry gene mize the elimination of A+T consecutive regions which con expression cassette is linked to the 5' end of the nptII expres 25 tained one or more polyadenylation sites or ATTTA sion cassette). Expression of the Cry proteins by the resulting sequences. Two potential plant polyadenylation sites have vector is then confirmed in plant protoplasts by electropora been shown to be more critical based on published reports. tion of the vector into protoplasts followed by protein blot and Codons are selected which increase G+C content, but do not ELISA analysis. This vector can be introduced into the generate restriction sites for enzymes useful for cloning and genomic DNA of plant embryos Such as maize by particle gun 30 assembly of the modified gene (e.g., BamHI, BgIII, SacI. bombardment followed by paromomycin selection to obtain NcoI, EcoRV, etc.). Likewise condons are avoided which corn plants expressing the cry gene essentially as described in contain the doublets TA or GC which have been reported to be U.S. Pat. No. 5,424,412, specifically incorporated herein by infrequently-found codons in plants. reference. In this example, the vector was introduced via Although the CaMV35S promoter is generally a high level cobombardment with a hygromycin resistance conferring 35 constitutive promoter in most plant tissues, the expression plasmid into immature embryo scutella (IES) of maize, fol level of genes driven the CaMV35S promoter is low in floral lowed by hygromycin selection, and regeneration. Trans tissue relative to the levels seen in leaf tissue. Because the genic plant lines expressing the selected cry protein are then economically important targets damaged by some insects are identified by ELISA analysis. Progeny seed from these events the floral parts or derived from floral parts (e.g., cotton may then Subsequently tested for protection from Susceptible 40 squares and bolls, tobacco buds, tomato buds and fruit), it is insect feeding. often advantageous to increase the expression of crystal pro teins in these tissues over that obtained with the CaMV35S 5.25 Example 25 promoter. The 35S promoter of Figwort Mosaic Virus (FMV) is Modification of Bacterial Genes for Expression in 45 analogous to the CaMV35S promoter. This promoter has Plants been isolated and engineered into a plant transformation vec tor. Relative to the CaMV promoter, the FMV 35S promoter Many wild-type genes encoding bacterial crystal proteins is highly expressed in the floral tissue, while still providing are known to be expressed poorly in plants as a full-length similar high levels of gene expression in other tissues such as gene or as a truncated gene. Typically, the G+C content of a 50 leaf. A plant transformation vector, may be constructed in cry gene is low (37%) and often contains many A+T rich which one or more full-length native or plantized Ö-endot regions, potential polyadenylation sites and numerous oxin-encoding genes is driven by the FMV 35S promoter. For ATTTA sequences. Table 26 shows a list of potential poly example, tobacco plants may be transformed with Such a adenylation sequences which should be avoided when pre vector and compared for expression of the crystal protein(s) paring the “plantized' gene construct. 55 by Western blot or ELISA immunoassay in leaf and/or floral tissue. The FMV promoter has been used to produce rela TABLE 26 tively high levels of crystal protein in floral tissue compared to the CaMV promoter. LIST OF SEQUENCES OF POTENTIAL POLYADENYLATION SIGNALS 60 5.26 Example 26 AATAAA* AAGCAT Expression of Native or Plantized Cry Genes with AATAATk ATTAAT ssRUBISCO Promoters and Chloroplast Transit AACCAA ATACAT Peptides 65 ATATAA AAAATA The genes in plants encoding the Small subunit of RUBISCO (SSU) are often highly expressed, light regulated US 7,772,369 B2 97 98 and sometimes show tissue specificity. These expression plant cell function, then localization to a noncytoplasmic properties are largely due to the promoter sequences of these compartment could protect these cells from the toxicity of the genes. It has been possible to use SSU promoters to express protein. heterologous genes in transformed plants. Typically a plant In plants as well as other eukaryotes, proteins that are will contain multiple SSU genes, and the expression levels destined to be localized either extracellularly or in several and tissue specificity of different SSU genes will be different. specific compartments are typically synthesized with an The SSU proteins are encoded in the nucleus and synthesized in the cytoplasm as precursors that contain an NH-terminal NH2-terminal amino acid extension known as the signal pep extension known as the chloroplast transit peptide (CTP).The tide. This signal peptide directs the protein to enter the com CTP directs the precursor to the chloroplast and promotes the 10 partmentalization pathway, and it is typically cleaved from uptake of the SSU protein into the chloroplast. In this process, the mature protein as an early step in compartmentalization. the CTP is cleaved from the SSU protein. These CTP For an extracellular protein, the secretory pathway typically sequences have been used to direct heterologous proteins into involves cotranslational insertion into the endoplasmic chloroplasts of transformed plants. reticulum with cleavage of the signal peptide occurring at this The SSU promoters might have several advantages for 15 stage. The mature protein then passes through the Golgi body expression of heterologous genes in plants. Some SSU pro into vesicles that fuse with the plasma membrane thus releas moters are very highly expressed and could give rise to ing the protein into the extracellular space. Proteins destined expression levels as high or higher than those observed with for other compartments follow a similar pathway. For the CaMV35S promoter. The tissue distribution of expression example, proteins that are destined for the endoplasmic from SSU promoters is different from that of the CaMV35S promoter, so for control of some insect pests, it may be reticulum or the Golgi body follow this scheme, but they are advantageous to direct the expression of crystal proteins to specifically retained in the appropriate compartment. In those cells in which SSU is most highly expressed. For plants, some proteins are also targeted to the vacuole, another example, although relatively constitutive, in the leaf the membrane bound compartment in the cytoplasm of many CaMV35S promoter is more highly expressed in vascular 25 plant cells. Vacuole targeted proteins diverge from the above tissue than in some other parts of the leaf, while most SSU pathway at the Golgi body where they enter vesicles that fuse promoters are most highly expressed in the mesophyll cells of with the vacuole. the leaf. Some SSU promoters also are more highly tissue specific, so it could be possible to utilize a specific SSU A common feature of this protein targeting is the signal promoter to express the protein of the present invention in peptide that initiates the compartmentalization process. Fus only a subset of plant tissues, if for example expression of ing a signal peptide to a protein will in many cases lead to the such a protein in certain cells was found to be deleterious to targeting of that protein to the endoplasmic reticulum. The those cells. For example, for control of Colorado potato beetle efficiency of this step may depend on the sequence of the in potato, it may be advantageous to use SSU promoters to mature protein itself as well. The signals that direct a protein direct crystal protein expression to the leaves but not to the 35 to a specific compartment rather than to the extracellular edible tubers. space are not as clearly defined. It appears that many of the Utilizing SSU CTP sequences to localize crystal proteins signals that direct the protein to specific compartments are to the chloroplast might also be advantageous. Localization contained within the amino acid sequence of the mature pro of the B. thuringiensis crystal proteins to the chloroplast tein. This has been shown for some vacuole targeted proteins, could protect these from proteases found in the cytoplasm. 40 but it is not yet possible to define these sequences precisely. It This could stabilize the proteins and lead to higher levels of appears that secretion into the extracellular space is the accumulation of active toxin. cry genes containing the CTP “default” pathway for a protein that contains a signal may be used in combination with the SSU promoter or with sequence but no other compartmentalization signals. Thus, a other promoters such as CaMV35S. 45 strategy to direct B. thuringiensis proteins out of the cyto plasm is to fuse the genes for synthetic B. thuringiensis genes 5.27 Example 27 to DNA sequences encoding known plant signal peptides. These fusion genes will give rise to B. thuringiensis proteins Targeting of 8-Endotoxin Polypeptides to the that enter the secretory pathway, and lead to extracellular Extracellular Space or Vacuole Using Signal 50 secretion or targeting to the vacuole or other compartments. Peptides Signal sequences for several plant genes have been described. One such sequence is for the tobacco pathogenesis The B. thuringiensis 8-endotoxin polypeptides described related protein PR1b has been previously described (Corne herein may primarily be localized to the cytoplasm of trans lissen et al., 1986). The PR1b protein is normally localized to formed plant cell, and this cytoplasmic localization may 55 result in plants that are insecticidally-resistant. However, in the extracellular space. Another type of signal peptide is certain embodiments, it may be advantageous to direct the contained on seed storage proteins of legumes. These proteins localization or production of the B. thuringiensis are localized to the protein body of seeds, which is a vacuole polypeptide(s) to one or more compartments of a plant, or to like compartment found in seeds. A signal peptide DNA particular types of plant cells. Localizing B. thuringiensis 60 sequence for the B-subunit of the 7S storage protein of com proteins in compartments other than the cytoplasm may result mon bean (Phaseolus vulgaris), PvuB has been described in less exposure of the B. thuringiensis proteins to cytoplas (Doyle et al., 1986). Based on the published these published mic proteases leading to greater accumulation of the protein sequences, genes may be synthesized chemically using oli yielding enhanced insecticidal activity. Extracellular local gonucleotides that encode the signal peptides for PR1b and ization could lead to more efficient exposure of certain insects 65 PvuB. In some cases to achieve secretion or compartmental to the B. thuringiensis proteins leading to greater efficacy. If ization of heterologous proteins, it may be necessary to a B. thuringiensis protein were found to be deleterious to include some amino acid sequence beyond the normal cleav US 7,772,369 B2 99 100 age site of the signal peptide. This may be necessary to insure Int. Pat. Appl. Pub1 N PCT/US87/OO880. proper cleavage of the signal peptide. Int. Pat. Appl. Pub1 N PCT/US89/O1025. Int. Pat. Appl. Pub1 N WO 88/103.15. 6.O REFERENCES Int. Pat. Appl. Pub1 N WO 89/06700. 5 Int. Pat. Appl. Pub1 N WO90713651. The following references, to the extent that they provide Int. Pat. Appl. Pub1 N WO 91 FO3162. exemplary procedural or other details Supplementary to those Int. Pat. Appl. Pub1 N WO92/07065. set forth herein, are specifically incorporated herein by refer Int. Pat. Appl. Pub1 N WO 93/15187. CCC. Int. Pat. Appl. Pub1 N WO 93A23569. U.S Pat. No. 4,196,265, issued Apr. 1, 1980. 10 U.S. Pat. No. 4,237,224, issued Dec. 2, 1980. Int. Pat. Appl. Pub1 N WO 94/O2595. U.S. Pat. No. 4,554,101, issued Nov. 19, 1985. Int. Pat. Appl. Pub1 N WO94f13688. U.S. Pat. No. 4,683,195, issued Jul. 28, 1987. Int. Pat. Appl. Pub1 N WO 96/10O83. U.S. Pat. No. 4,683,202, issued Jul. 28, 1987. Int. Pat. Appl. Pub1 N WO 97/17507. Int. U.S. Pat. No. 4,757,011, issued Jul. 12, 1988. 15 Pat. Appl. Publ. No. WO97/17600. U.S. Pat. No. 4,766,203, issued Aug. 23, 1988. Int. Pat. Appl. Publ. No. WO 97/40162. U.S. Pat. No. 4,769,061, issued Sep. 6, 1988. Eur. Pat. Appl. Publ. No. EP0120516. U.S. Pat. No. 4,800,159, issued Jan. 24, 1989. Eur. Pat. Appl. Publ. No. EP0360257. U.S. Pat. No. 4,883,750, issued Nov. 28, 1989. Eur. Pat. Appl. Publ. No. EP 320,308. U.S. Pat. No. 4,940,835, issued Feb. 23, 1990. Eur. Pat. Appl. Publ. No. EP 329,822. U.S. Pat. No. 4,943,674, issued Jul. 24, 1990. Eur. Pat. Appl. Publ. No. 921 10298.4 U.S. Pat. No. 4,965,188, issued Oct. 23, 1990. Great Britain Pat. Appl. Publ. No. GB 2.202,328. U.S. Pat. No. 4,971,908, issued Nov. 20, 1990. Abdullah et al., Biotechnology, 4:1087, 1986. U.S. Pat. No. 4,987,071, issued Jan. 22, 1991. Abbott, “A method for computing the effectiveness of an U.S. Pat. No. 5,023,179, issued Jun. 11, 1991. 25 insecticide. J. Econ. Entomol, 18:265-267, 1925. U.S. Pat. No. 5,097,025, issued Mar. 17, 1992. Altschul, Stephen F. et al., “Gapped BLAST and PSI U.S. Pat. No. 5,106,739, issued Apr. 21, 1992. BLAST: a new generation of protein database search pro U.S. Pat. No. 5,110.732, issued May 5, 1992. grams”, Nucl. Acids Res. 25:3389-3402, 1997. U.S. Pat. No. 5,139.954, issued Aug. 19, 1992. Arantes and Lereclus, Gene, 108:115-119, 1991. U.S. Pat. No. 5,176,995, issued Oct. 15, 1991. 30 Armitage et al., Proc. Natl. Acad. Sci. USA, 94(23): 12320 U.S. Pat. No. 5,177,011, issued Jan. 5, 1993. 12325, 1997. U.S. Pat. No. 5,187,091, issued Oct. 15, 1991. Baumlein, Boerjan, Nagy, Panitz, Inze, Wobus, "Upstream U.S. Pat. No. 5,334,711, issued Aug. 2, 1994. sequences regulating legumin gene expression in heterolo U.S. Pat. No. 5,378,619, issued Jan. 3, 1995. gous transgenic plants. Mol. Gen. Genet., 225(1): 121 U.S. Pat. No. 5,384,253, issued Jan. 24, 1995. 35 128, 1991. U.S. Pat. No. 5,401,836, issued Mar. 28, 1995. Baum, et al., Appl. Envior. Biol. 56:3420-3428, 1990. U.S. Pat. No. 5,424,412, issued Jun. 13, 1995. Baumann et al., J. Bacteriol., 170:2045-2050, 1988. U.S. Pat. No. 5,436,002, issued Jul. 25, 1995. Benbrooketal. In: Proceedings Bio Expo 1986, Butterworth, U.S. Pat. No. 5,436,393, issued Jul 25, 1995. Stoneham, MA, pp. 27-54, 1986. U.S. Pat. No. 5,442,052, issued Aug. 15, 1995. 40 U.S. Pat. No. 5,447,858, issued Sep. 5, 1995. Berna and Bernier, “Regulated expression of a wheat germin U.S. Pat. No. 5,459,252, issued Oct. 17, 1995. gene in tobacco: Oxalate oxidase activity and apoplastic U.S. Pat. No. 5,463,175, issued Oct. 31, 1995. localization of the heterologous protein. Plant Mol. Biol., U.S. Pat. No. 5,491,288, issued Feb. 13, 1996. 33(3):417-429, 1997. U.S. Pat. No. 5,504.200, issued Apr. 2, 1996. 45 Bevan et al., Nucleic Acids Res., 11(2):369-85, 1983. U.S. Pat. No. 5,530,196, issued Jun. 25, 1996. Boffa, Carpaneto, Alfrey, Proc. Natl. Acad. Sci. USA, U.S. Pat. No. 5,538,879, issued Jul 23, 1996. 92:1901-1905, 1995. U.S. Pat. No. 5,576,198, issued Nov. 19, 1996. Boffa, Morris, Carpaneto, Louissaint, Alfrey, J. Biol. Chem., U.S. Pat. No. 5,589,583, issued Dec. 31, 1996. 271:13228-13233, 1996. U.S. Pat. No. 5,589,610, issued Dec. 31, 1996. 50 Boronat, Martinez, Reina, Puigdomenech, Palau, “Isolation U.S. Pat. No. 5,589,614, issued Dec. 31, 1996 and sequencmg of a 28 kd gluteline-2 gene from maize: U.S. Pat. No. 5,595,896, issued Jan. 21, 1997. Common elements in the 5' flanking regions among Zein U.S. Pat. No. 5,608,144, issued Mar. 4, 1997. and glutelin genes. Plant Sci., 47:95-102, 1986. U.S. Pat. No. 5,614,399, issued Mar. 25, 1997. Brussock and Currier. “Use of sodium dodecyl sulfate-po U.S. Pat. No. 5,631,359, issued May 20, 1997. 55 lacryamide gel electrophoresis to quantify Bacillus thur U.S. Pat. No. 5,633,363, issued May 27, 1997. ingiensis 8-endotoxins. In: Analytical Chemistry of Bacil U.S. Pat. No. 5,633,439, issued May 27, 1997. lus thuringiensis, L. A. Hickle and W. L. Fitch, (Eds), U.S. Pat. No. 5,633,440, issued May 27, 1997. American Chemical Society, Washington D.C., pp. 78-87, U.S. Pat. No. 5,633,441, issued May 27, 1997. 1990. U.S. Pat. No. 5,646,333, issued Jul. 8, 1997. 60 Bytebier et al., Proc. Natl. Acad. Sci. USA, 84:5345, 1987. U.S. Pat. No. 5,659,124, issued Aug. 19, 1997. Callis et al., Genes and Development, 1:1183, 1987. U.S. Pat. No. 5,689,040, issued Nov. 18, 1997. Callis, Fromm, Walbot, “Introns increase gene expression in U.S. Pat. No. 5,689,049, issued Nov. 18, 1997. cultured maize cells. Genes Devel, 1:1 183-1200, 1987. U.S. Pat. No. 5,689,051, issued Nov. 18, 1997. Campbell, “Monoclonal Antibody Technology, Laboratory U.S. Pat. No. 5,689,056, issued Nov. 18, 1997. 65 Techniques in Biochemistry and Molecular Biology. Vol. U.S. Pat. No. 5,700,922, issued Dec. 23, 1997. 13, Burden and Von Knippenberg, Eds. pp. 75-83, Elsevier, U.S. Pat. No. 5,712,112, issued Jan. 27, 1998. Amsterdam, 1984. US 7,772,369 B2 101 102 Capecchi, “High efficiency transformation by direct micro Eglitis, Kantoff, Kohn, Karson, Moen, Lotbrop, Blaese, injection of DNA into cultured mammalian cells. Cell, Anderson, “Retroviral-mediated gene transfer into 22(2):479-488, 1980. hemopoietic cells. Avd Exp. Med. Biol., 241:19-27, 1988. Carlsson et al., Nature, 380:207, 1996. Elroy-Stein and Moss, Proc. Natl. Acad. Sci. USA, 87:6743-7, Carlton and Gonzalez, Molecular Biology of Microbial Dif 1990. fernetiation, Ninth International Spore Conference, Asilo English and Slatin, Insect Biochem. Mol. Biol., 22:1-7, 1992. mar, Calif., USA Sep. 3-6, 1984. IX+280P. American Soci Faktor, Kooter, Dixon, Lamb, "Functional dissection of a ety for Microbiology, 246-252, 1985. bean chalcone synthase gene promoter in transgenic Cashmore et al., Gen. Eng. of Plants, Plenum Press, New tobacco plants reveals sequence motifs essential for floral York, 29-38, 1983. 10 expression.” Plant Mol. Biol., 32(5):849-859, 1996. Charles et al., Zent. Bakteriol. Suppl. 28(0):99-100, 1996a. Ficker, Kirch, Eijlander, Jacobsen, Thompson, “Multiple ele Charles et al., Annual Review of Entomology, 41:451-472, ments of the S2-RNase promoter from potato (Solanum 1996b. tuberosum L.) are required for cell type-specific expression Chau et al., Science, 244:174-181, 1989. in transgenic potato and tobacco. Mol. Gen. Genet., 257 Chen et al., Nucl. Acids Res., 20:4581-9, 1992. 15 (2):132-142, 1998. Cheng, Sardana, Kaplan, Altosaar, "Agrobacterium-trans Footer, Engholm, Kron, Coull, Matsudaira, Biochemistry, formed rice plants expressing synthetic cryIA(b) and cryIA 35:10673-10679, 1996. (c) genes are highly toxic to striped stem borer and yellow Fraley et al., Biotechnology, 3:629, 1985. stem borer.” Proc. Natl. Acad. Sci. USA, 95(6):2767-2772, Fraley et al., Proc. Natl. Acad. Sci. USA, 80:4803, 1983. 1998. French, Janda, Ahlquist, "Bacterial gene inserted in an engi Chowrira and Burke, Nucl. Acids Res., 20:2835-2840, 1992. neered RNA virus: efficient expression in monocotyledon Christensen et al., J. Pept. Sci., 1(3):175-183, 1995. ous plant cells,” Science, 231:1294-1297, 1986. Christensen, Sharrock, Quail, "Maize polyubiquitin genes: Frohman, In: PCRTM Protocols: A Guide to Methods and Structure, thermal perturbation of expression and tran Applications, Academic Press, New York, 1990. Script splicing, and promoter activity following transfer to 25 Fromm et al., Biotechnology (N.Y), 8(9):833-9, 1990. protoplasts by electroporation. Plant Mol. Biol., 18:675 Fromm, Taylor, Walbot, “Expression of genes transferred into 689, 1992. monocot and dicot plant cells by electroporation. Proc. Clapp, “Somatic gene therapy into hematopoietic cells. Cur Natl. Acad. Sci. USA, 82(17):5824-5828, 1985. rent status and future implications. Clin. Perinatol, 2001)- Fromm et al., Nature, 319:791-793, 1986. 155-168, 1993. 30 Fujimura et al., Plant Tiss. Cult. Lett., 2:74, 1985. Collins and Olive, Biochem, 32:2795-2799, 1993. Fynan, Webster, Fuller, Haynes, Santoro, Robinson, “DNA Conway and Wickens, In: RNA Processing, p. 40, Cold vaccines: protective immunizations by parenteral, Spring Harbor Laboratory, Cold Spring Harbor, N.Y., mucosal, and gene gun inoculations. Proc. Natl. Acad. 1988. Sci. USA, 90(24): 11478-1 1482, 1993. Corey, Trends Biotechnol., 15(6):224-229, 1997. 35 Gallie and Young, “The regulation of expression in trans Cornelissen et al., Nature, 321 (6069):531-2, 1986. formed maize aleurone and endosperm protoplasts. Plant Crickmore et al., “Revision of thenomenclature for the Bacil Physiol., 106:929-939, 1994. lus thuringiensis pesticidal crystal proteins.” Proc. Natl. Gallie, Feder, Schimke, Walbot, “Post-transcriptional regula Acad. Sci. USA 62:807-813, 1998 tion in higher eukaryotes: the role of the reporter gene in Cristou et al., Plant Physiol., 87:671-674, 1988. 40 controlling expression.” Mol. Gen. Genet., 228:258-264, Curiel, Agarwal, Wagner, Cotten, Adenovirus enhancement 1991. of transferrin-polylysine-mediated gene delivery.” Proc. Gallie, Lucas, Walbot, “Visualizing mRNA expression in Natl. Acad. Sci. USA, 88(19):8850-8854, 1991. plant protoplasts: factors influencing efficient mRNA Curiel, Wagner, Cotten, Birnstiel, Agarwal, Li, Loechel, and uptake and translation.” Plant Cell, 1:301-311, 1989. Hu, “High-efficiency gene transfer mediated by adenovi 45 Gallie, Sleat, Turner, Wilson, “Mutational analysis of the rus coupled to DNA-polylysine complexes. Hum. Gen. tobacco mosaic virus 5'-leader for altered ability to Then, 3(2): 147-154, 1992. enhance translation. Nucl. Acids Res., 16:883-893, 1988. Daum, “Revision of two computer programs for probitanaly Gallie, Sleat, Watts, Turner, Wilson, “A comparison of sis.” Bull. Entomol. Soc. Amer:, 16:10-15, 1970. eukaryotic viral 5'-leader sequences as enhancers of Dean et al., Nucl. Acids Res., 14(5):2229, 1986. 50 mRNA expression in vivo. Nucl. Acids Res., 15:8693 Dennis, Gerlach, Pryor, Bennetzen, Inglis, Llewellyn, Sachs, 8711, 1987b. Ferl, Peackocock, “Molecular analysis of the alcoholdehy Gallie, Sleat, Watts, Turner, Wilson, “The 5'-leader sequence drogenase (Adh1) gene of maize. Nucl. Acids Res., of tobacco mosaic virus RNA enhances the expression of 12:3983-4000, 1984. foreign gene transcripts in vitro and in vivo. Nucl. Acids Diehn et al., Genet. Eng. (N.Y.) 18:83-99, 1996. 55 Res., 15:3257-3273, 1987a Dhir, Dhir, HepbuTM, Widholm, “Factors affecting transient Gambacorti-Passerini et al., Blood, 88:141 1-1417, 1996. gene expression in electroporated Glycine-max proto Gao and Huang, Nucl. Acids Res., 21:2867-72, 1993. plasts.” Plant Cell Rep., 10(2):106-110, 1991 a Gefter et al., Somat. Cell Genet., 3:231-236, 1977. Donovan et al., Appl. Environ. Microbiol., 58:3921-3927, Gehrke, Auron, Quigley, Rich, Sonenberg, “5'-Conformation 1992. 60 of capped alfalfa mosaic virus ribonucleic acid 4 may Doyle et al., J. Biol. Chem., 261 (20): 9228-38, 1986. reflect its independence of the cap structure or of cap Dropulic et al., J. Virol., 66:1432-41, 1992. binding protein for efficient translation. Biochemistry, Dueholm et al., J. Org. Chem., 59:5767-5773, 1994. 22:5157-5164, 1983. Egholn et al., Nature, 365:566-568, 1993. Genovese and Milcarek, In: RNA Processing, p. 62, Cold Eglitis and Anderson, “Retroviral vectors for introduction of 65 Spring Harbor Laboratory, Cold Spring Harbor, N.Y., genes into mammalian cells. Biotechniques, 1988. 6(7):608-614, 1988. Gil and Proudfoot, Nature, 312:473, 1984. US 7,772,369 B2 103 104 Goding, “Monoclonal Antibodies: Principles and Practice.” Jorgensen et al., Mol. Gen. Genet., 207:471, 1987. Joshi, An pp. 60-74. 2nd Edition, Academic Press, Orlando, Fla., inspection of the domain between putative TATA box and 1986. translation start site in 79 plant genes. Nucl. Acids Res., Goelet, Lomonossoff, Butler, Akam, Gait, Karn, "Nucleotide 15:6643-6653, 1987. sequence of tobacco mosaic virus RNA. Proc. Natl. Acad 5 Kaiser and Kezdy, Science, 223:249-255, 1984. Sci., USA, 79:5818-5822, 1982. Kashani-Sabet et al., Antisense Res. Dev, 2:3-15, 1992. Gonzalez Jr. et al., Proc. Natl. AcadSci USA, 79:6951-6955, Keller et al., EMBO.J., 8:1309-14, 1989. 1982. Klee, Yanofsky, Nester, “Vectors for transformation of higher Good and Nielsen, Antisense Nucleic Acid Drug Dev., 7(4): plants.” Bio-Technology, 3(7):637-642, 1985. 431–437, 1997. 10 Klein et al., Nature, 327:70, 1987. Graham, Craig, Waterhouse, “Expression patterns of vascu Klein et al., Proc. Natl. Acad. Sci. USA, 85:8502-8505, 1988. lar-specific promoters RO1C and Shin transgenic potatoes Koch et al., Tetrahedron Lett., 36:6933-6936, 1995. and their use in engineering PLRV-resistant plants. Plant Kohler and Milstein, Eur: J. Immunol. 6:511-519, 1976. Mol. Biol. 33(4):729-735, 1997. Kohler and Milstein, Nature, 256:495-497, 1975. Koppelhus, Graham, F. L., and van der Eb, A. J., “Transformation of rat 15 Nucleic Acids Res., 25(11):2167-2173, 1997. cells by DNA of human adenovirus 5,' Virology, 54(2): Korn and Queen, DNA, 3:421-436, 1984. 536-539, 1973. Koziel, Beland, Bowman, Carozzi, Crenshaw, Crossland, Griffith et al., J. Am. Chem. Soc., 117:831-832, 1995. Dawson, Desai, Hill, Kadwell, Launis, Lewis, Maddox, Grosset, Alary, Gautier, Menossi, Martinez-Izquierdo, McPherson, Meghji, Merlin, Rhodes, Warren, Wright, Joudrier, “Characterization of a barley gene coding for an Evola, “Field performance of elite transgenic maize plants alpha-amylase inhibitor Subunit (Cmd protein) and analy expressing an insecticidal protein derived from Bacillus sis of its promoter intransgenic tobacco plants and in maize thuringiensis, Bio/technology, 11:194-200, 1993. kernels by microprojectile bombardment. Plant Mol. Koziel, Carozzi, Desai, "Optimizing expression of transgenes Biol. 34(2):331-338, 1997. with an emphasis on post-transcriptional events. Plant Guerrier-Takada et al., Cell, 35:849, 1983. 25 Mol. Biol., 32(102):393-405, 1996. Haaima, Lohse, Buchardt, Nielsen, Angew. Chem., Int. Ed. Kremsky et al., Tetrahedron Lett., 37:4313-4316, 1996. Engl., 35:1939-1942, 1996. Krieg et al., In: Zangew. Ent., 96:500-508, 1983. Hampel and Tritz, Biochem., 28:4929, 1989. Kuby. “Immunology’ 2nd Edition. W. H. Freeman & Com Hampel et al., Nucl. Acids Res., 18:299, 1990. pany, New York, 1994. Hanvey et al., Science, 258: 1481-1485, 1992. 30 Kunkel, Roberts, Zakour, “Rapid and efficient site-specific Harlow and Lane, Antibodies: A Laboratory Manual.” Cold mutagenesis without phenotypic selection.” Methods Spring Harbor Laboratory, Cold Spring Harbor, N.Y., Enzymol., 154:367-382, 1987. 1988. Kwoh, Davis, Whitfield, Chappelle, DiMichele, Gingeras, Herrera-Estrella et al., Embo. J. 2(6):987-996, 1983. “Transcription-based amplification system and detection Hertig et al., Plant Mol. Biol., 16(1): 1714, 1991. 35 of amplified human immunodeficiency virus type 1 with a Hess, Intern Rev. Cytol., 107:367, 1987. bead-based sandwich hybridization format.” Proc. Natl. Höfte and Whiteley, Microbiol. Rev., 53:242-255, 1989. Acad. Sci. USA, 86(4): 1173-1177, 1989. Horsch, Fry, Hoffmann, Eichholtz, Rogers, Fraley, “A simple KyoZuka, Fujimoto, Izawa, Shimamoto, "Anaerobic induc and general method for transferring genes into plants.” tion and tissue-specific expression of maize Adh1 pro Science, 227(4691): 1229-1231, 1985. 40 moter in transgenic rice plants and their progeny. Mol. Huang, An, McDowell, McKinney, Meagher, “The Arabi Gen. Genet., 228(1-2):40-48, 1991. dopsis ACT11 action gene is strongly expressed in tissues Kyte and Doolittle. A simple method for displaying the of the emerging inflorescence, pollen and developing hydropathic character of a protein.” J. Mol. Biol., 157(1): ovules. Plant Mol. Biol., 33(1):125-139, 1997. 105-132, 1982. Hudspeth and Grula, “Structure and expression of the maize 45 L'Huillier et al., EMBO.J., 11:4411-8, 1992. gene encoding the phosphoenolpyruvate carboxylase Lambert et al., Appl. Environ. Microbiol., 58:2536-2642, isozyme involved in C4 photosynthesis. Plant Mol. Biol., 1992b. 12:579-589, 1989. Lambert et al., Gene, 1.10: 131-132, 1992a. Hyrup and Nielsen, Bioorg. Med. Chem., 1996. Landsdorp et al., Hum. Mol. Genet., 5:685-691, 1996. Ingelbrecht, Herman, Dekeyser, Van Montagu, Depicker, 50 Langridge et al., Proc. Natl. Acad. Sci. USA, 86:3219-3223, “Different 3' end regions strongly influence the level of 1989. gene expression in plant cells. Plant Cell, 1:671-680, Lieber et al., Methods Enzymol., 217:47-66, 1993. 1989. Lindstrom et al., Developmental Genetics, 11: 160, 1990. Jameson and Wolf, “The Antigenic Index: A Novel Algorithm Lisziewicz et al., Proc. Natl. Acad. Sci. U.S., 90:8000-4, for Predicting Antigenic Determinants. Compu. Appl. 55 1993. Biosci., 4(1): 181-6, 1988. Lorz et al., Mol. Gen. Genet., 199: 178, 1985. Jensen et al., Biochemistry, 36(16):5072-5077, 1997. Lu, Xiao, Clapp, Li, Broxmeyer, “High efficiency retroviral Jobling and Gehrke, “Enhanced translation of chimeric mes mediated gene transduction into single isolated immature senger RNAS containing a plant viral untranslated leader and replatable CD34(3+) hematopoietic stem/progenitor sequence.” Nature, 325:622-625, 1987. 60 cells from human umbilical cord blood. J. Exp. Med., Johnston and Tang, "Gene gun transfection of animal cells 178(6):2089-2096, 1993. and genetic immunization.” Methods Cell. Biol., 43(A): Luehrsen et al., Prog. Nucleic Acid Res. Mol Biol, 47:149-93, 353–365, 1994. 1994. Jones, Dean, Gidoni, Gilbert, Bond-Nutter, Lee, Bedbrook, Luehrsen and Walbot, “Intron enhancement of gene expres Dunsmuir, “Expression of bacterial chitinase protein in 65 sion and the splicing efficiency of introns in maize cells.” tobacco leaves using two photosynthetic gene promoters.” Mol. Gen. Genet., 225:81-93, 1991. Mol. Gen. Genet., 212:536-542, 1988. Luo et al., Plant Mol. Biol. Reporter; 6:165, 1988. US 7,772,369 B2 105 106 Lutcke. Chow, Mickel, Moss, Kern, Scheele, “Selection of Pandey and Marzluff. In “RNA Processing.” p. 133, Cold AUG initiation codons differs in plants and animals.” Spring Harbor Laboratory, Cold Spring Harbor, N.Y., EMBOJ, 6:43-48, 1987. 1987. Maas, Laufs, Grant, Korfhage, Werr, “The combination of a Pardridge, Boado, Kang, Proc. Natl. Acad. Sci. USA, novel stimulatory element in the first exon of the maize 92:5592-5596, 1995. shrunken-1 gene with the following intron enhances Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85 (8):2444 reporter gene expression 1000-fold. Plant Mol. Biol., 8, 1988. 16:199-207, 1991. Pena et al., Nature, 325:274, 1987. Macaluso and Mettus, J. Bacteriol., 173:1353-1356, 1991. Perlak, Deaton, Armstrong, Fuchs, Sims, Greenplate, Fis Maddock et al. Third International Congress of Plant 10 chhoff, “Insect resistant cotton plants. Bio/Technology, Molecular Biology, Abstract 372, 1991. 8:939-943, 1990. Maloy, “Experimental Techniques in Bacterial Genetics' Perlak, Fuchs, Dean, McPherson, Fischhoff, “Modification Jones and Bartlett Publishers, Boston, Mass., 1990. of the coding sequence enhances plant expression of insect Maloy et al., “Microbial Genetics' 2nd Edition. Jones and control protein genes.” Proc. Natl. Acad. Sci. USA, Barlett Publishers, Boston, Mass., 1994. 15 88:3324-3328, 1991. Maniatis et al., “Molecular Cloning: a Laboratory Manual.” Perlak, Stone, Muskopf, Peterson, Parker, McPherson, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., Wyman, Love, Reed, Biever, Fischhoff, “Genetically 1982. improved potatoes: protection from damage by Colorado Marcotte et al., Nature, 335:454, 1988. potato beetles.” Plant Mol. Biol., 22:313-321, 1993. Mairone, “Influence of artificial diet on southern corn root Perrault et al., Nature, 344:565, 1990. worm life history and susceptibility to insecticidal com Perrotta and Been, Biochem., 31:16, 1992. pounds. Westview Studies in Insect Biology, Advances in Perry-O'Keefe, Yao, Coull, Fuchs, Egholm, Proc. Natl. Acad. insect rearing for research andpest management, 229-235, Sci. USA, 93:14670-14675, 1996. 1992. Petersen, Jensen, Egholm, Nielsen, Buchardt, Bioorg. Med. Mascerenhas, Mettler, Pierce, Lowe, “Intron mediated 25 Chem. Lett., 5:1119-1124, 1995. enhancement of heterologous gene expression in maize.” Pieken et al., Science, 253:314, 1991. Plant Mol. Biol. 15:913-920, 1990. Poogin and Skryabin, “The 5' untranslated leader sequence of McBride, Svab, Schaaf, Hogan, Stalker, Maliga, Amplifica potato virus X RNA enhances the expression of the heter tion of a chimeric Bacillus gene in chloroplasts leads to an ologous gene in vivo. Mol. Gen. Genet., 234:329-331, extraordinary level of an insecticidal protein in tobacco.” 30 1992. Bio/technology, 13:362-365, 1995. Poszkowski et al., EMBO.J., 3:2719, 1989. McCabe et al., Biotechnology, 6:923, 1988. Potrykus et al., Mol. Gen. Genet., 199:183, 1985. McDevitt et al., Cell, 37:993-999, 1984. Poulsen et al., Mol Gen. Genet., 205:193-200, 1986. McElroy, Zhang, Wu, “Isolation of an efficient promoter for Prokop and Bajpai, Ann. N.Y. Acad. Sci., 646, 1991. use in rice transformation. Plant Cell, 2:163–171, 1990. 35 Rogers et al., In: Methods For Plant Molecular Biology, Michael, Biotechniques, 16:410-412, 1994. Weissbach and Weissbach, eds., Academic Press Inc., San Mollegaard, Buchardt, Egholm, Nielsen, Proc. Natl. Acad. Diego, Calif. 1988. Sci., USA, 91:3892-3895, 1994. Rogers et al., Methods Enzymol., 153:253-277, 1987. Nawrath, Poirier. Somerville, “Targeting of the polyhydroxy Rose, Anal. Chem., 65(24):3545-3549, 1993. butyrate biosynthetic pathway to the plastids of Arabidop 40 Rossi et al., Aids Res. Hum. Retrovir., 8:183, 1992. sis thaliana results in high levels of polymer accumula Ruskowski et al., Cancer, 80(12 Suppl):2699-2705, 1997. tion. Proc. Natl. Acad. Sci. USA, 91: 12760-12764, 1994. Russell and Fromm, "Tissue-specific expression in trans Neilsen, In: Perspectives in Drug Discovery and Design 4. genic maize for four endosperm promoters from maize and Escom Science Publishers, pp. 76-84, 1996. rice.” Transgenic Res., 6(2): 157-168, 1997. 45 Sadofsky and Alwine, Mol. Cell. Biol., 4(8): 1460-1468, Nielsen et al., Anticancer Drug Des., 8(1):53-63, 1993b. 1984. Nielsen, Egholm, Berg, Buchardt, Science, 254: 1497-1500, Sambrook et al., “Antibodies: A Laboratory Manual.” Cold 1991. Spring Harbor Laboratory, Cold spring Harbor, N.Y., Norton, Piatyszek, Wright, Shay, Corey, Nat. Biotechnol., 1989a. 14:615-620, 1996. 50 Sambrook et al., “Molecular Cloning: A Laboratory Manual.” Norton, Waggenspack, Varnum, Corey, Bioorg. Med. Chem., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 3:437-445, 1995. 1989b. Oard, Paige, Dvorak, "Chimeric gene expression using maize Sanger et al., “DNA sequencing with chain-terminating intron in cultured cells of breadwheat. Plant Cell. Rep., inhibitors.” Proc. Natl. Acad. Sci. USA, 74(12):5463-5467, 8:156-160, 1989. 55 1977. Odell et al., Nature, 313:810, 1985. Sarver et al., Science, 247(4947): 1222-5, 1990. Ohara et al., Proc. Natl. Acad. Sci. U.S.A., 86(15):5673-7, Saville and Collins, Cell, 61:685-696, 1990. 1989. Saville and Collins, Proc. Natl. Acad. Sci. USA, 88:8826 Ohkawa, Yuyama, Taira, “Activities of HIV-RNA targeted 8830, 1991. ribozymes transcribed from a shot-gun type ribozyme 60 Scanlon et al., Proc. Natl. Acad. Sci. USA, 88:10591-5, 1991. trimming plasmid. Nucl. Acids Symp. Ser, 27:15-6, 1992. Scaringe et al., Nucl. Acids Res., 18:5433-5441, 1990. Ojwang et al., Proc. Natl. Acad. Sci. USA, 89:10802-6, 1992. Seeger et al., Biotechniques, 23(3):512-517, 1997. Omirulleh et al., Plant Mol. Biol., 21:415-428, 1993. Segal, “Biochemical Calculations' 2nd Edition. John Wiley Orum, Nielsen, Egholm, Berg, Buchardt, Stanley, Nucl. Acids & Sons, New York, 1976. Res., 21:5332-5336, 1993. 65 Shaw and Kamen, Cell, 46:659-667, 1986. Orum, Nielsen, Jorgensen, Larsson, Stanley, Koch, BioTech Shaw and Karnen, In: “RNA Processing, p. 220, Cold Spring niques, 19:472-480, 1995. Harbor Laboratory, Cold Spring Harbor, N.Y., 1987. US 7,772,369 B2 107 108 Simpson, Science, 233:34, 1986. Vogel, Dawe, Freeling, “Regulation of the cell type-specific Sleat, Gallie, Jefferson Bevan, Turner, Wilson, "Character expression of maize Adh1 and Sh1 electroporation-di ization of the 5'-leader sequence of tobacco mosaic virus rected gene transfer into protoplasts of several maize tis RNA as a general enhancer of translation in vitro. Gene, sues.” J. Cell. Biochem. (Suppl. 0) 13:Part D, 1989. 217:217-225, 1987. 5 Wagner et al., “Coupling of adenovirus to transferrin-polyl Sleat, Hull, Turner, Wilson, “Studies on the mechanism of ysine?DNA complexes greatly enhances receptor-medi translational enhancement by the 5'-leader sequence of ated gene delivery and expression of transfected genes.” tobacco mosaic virus RNA, Eur: J. Biochem., 175:75-86, Proc. Natl. Acad. Sci. USA, 89(13):6099-6103, 1992. 1988. Walker, Little, Nadeau, Shank, “Isothermal in vitro amplifi Southern, J. Mol. Biol. 98:503-5 17, 1975. 10 cation of DNA by a restriction enzyme/DNA polymerase Spielmann et al., Mol. Gen. Genet., 205:34, 1986. system.” Proc. Natl. Acad. Sci. USA, 89(1):392–396, 1992. Stetsenko, Lubyako, Potapov, Azhikina, Sverdlov, Tetrahe Wang et al., J. Am. Chem. Soc., 118:7667-7670, 1996. dron Lett. 37:3571-3574, 1996. Watson, “Fluid and electrolyte disorders in cardiovascular Taira et al., Nucl. Acids Res, 19:51 25-30, 1991. patients.” Nurs. Clin. North Am. 22(4):797-803, 1987. Tanaka, Mita, Ohta, KyoZuka, Shimamoto, Nakamura, 15 Webb and Hurskainen, J. Biomol Screen. 1:119-121, 1996. "Enhancement of foreign gene expression by a dicot intron Weerasinghe et al., J. Virol, 65:5531-4, 1991. in rice but not in tobacco is correlated with an increased Weissbach and Weissbach, Methods for Plant Molecular level of mRNA and an efficient splicing of the intron.” Biology, (eds.), Academic Press, Inc., San Diego, Calif., Nucl. Acids Res., 18:6767-6770, 1990. 1988. Thanabalu et al., Appl. Environ. Microbiol., 61 (11):4031-6, Wenzler et al., Plant Mol. Biol., 12:41-50, 1989. 1995. Wickens and Stephenson, Science, 226:1045, 1984. Thanabalu et al., J. Bacteriol, 173(9):2776-85, 1991. Wickens et al., In: “RNA Processing...’ p. 9, Cold Spring Thiede, Bayerdorffer, Blasczyk, Wittig, Neubauer, Nucleic Harbor Laboratory, Cold Spring Harbor, N.Y., 1987. Acids Res., 24:983-984, 1996. Wilson, Flint, Deaton, Fischhoff, Perlak, Armstrong, Fuchs, Thisted, Just, Petersen, Hyldig-Nielsen, Godtfredsen, Cell 25 Berberich, Parks, Stapp, “Resistance of cotton lines con Vision, 3:358-363, 1996. taining a Bacillus thuringiensis toxin to pink bollworm Thomson et al., Tetrahedron, 51:6179-61.94, 1995. (Lepidopteran: Gelechiidae) and other insects.J. Econ. Tomic, Sunjevaric, Savtchenko, Blumenberg, "A rapid and Entom., 4:1516-1521, 1992. simple method for introducing specific mutations into any Wolfetal. Compu. Appl. Biosci., 4(1): 187-91 1988. position of DNA leaving all other positions unaltered.” 30 Wong et al., Plant Mol. Biol. 20(1):81-93, 1992. Nucl. Acids Res., 18(6): 1656, 1990. Wong and Neumann, “Electric field mediated gene transfer.” Toriyama et al., Theor Appl. Genet., 73:16, 1986. Biochim. Biophys. Res. Commun., 107(2):584-587, 1982. Treacy, Hattori, Prud’homme, Barbour, Boutilier, Baszczyn Woolfetal. Proc. Natl. Acad. Sci. USA, 89:7305-7309, 1992. ski, Huang, Johnson, Miki, "Brmm1, a Brassica pollen Wu et al., FEMS Microbiol. Lett., 81,31-36, 1991. specific gene.” Plant Mol. Biol., 34(4):603–61 1, 1997. 35 Wu and Dean, “Functional significance of loops in the recep Uchimiya et al., Mol. Gen. Genet., 204:204, 1986. tor binding domain of Bacillus thuringiensis Cry IIIA Ulmann, Will, Breipohl, Langner, Ryte, Angew. Chem., Int. delta-endotoxin.” J. Mol. Biol., 255(4):628-640, 1996. Ed. Engl., 35:2632-2635, 1996. Yamada et al., Plant Cell Rep., 4:85, 1986. Upender, Raj, Weir, “Megaprimer method for in vitro 40 Yang et al., Proc. Natl. Acad. Sci. USA, 87:4144-48, 1990. mutagenesis using parallel templates. Biotechniques, Yanisch-Perronet al., Gene, 33(1): 103-19, 1985. 18:29-31, 1995. Yin, Chen, Beachy, “Promoter elements required for phloem Usman et al., J. Am. Chem. Soc., 109:7845-7854, 1987. specific gene expression from the RTBV promoter in rice.” Usman and Cedergren, TIBS, 17:34, 1992. Plant J., 12(5):1179-1188, 1997b. Van Camp, Herouart, Willekens, Takahashi, Saito, Van Mon 45 Yin, Zhu, Dai, Lamb, Beachy, “RF2a, a bZIP transcriptional tagu, Inze, “Tissue-specific activity of two manganese activator of the phloem-specific rice tungro bacilliform Superoxide dismutase promoters in transgenic tobacco. virus promoter, functions in vascular development.” Plant Physiol, 112(2):525-535, 1996. EMBO.J. 16(17):5247-5259, 1997a. Van Tunen et al., EMBO.J., 7:1257, 1988. Yu et al., Proc. Natl. Acad Sci. USA, 90:6340-4, 1993. Vander, Van Montagu, Inze, Boerjan, “Tissue-specific 50 Zatloukal, Wagner, Cotten, Phillips, Plank, Steinlein, Curiel, expression conferred by the S-adenosyl-L-methionine Birnstiel, “Transferrinfection: a highly efficient way to synthetase promoter of Arabidopsis thaliana in transgenic express gene constructs in eukaryotic cells. Ann. N.Y. poplar.” Plant Cell Physiol., 37(8): 1108-1115, 1996. Acad. Sci., 660:136-153, 1992. Vasil et al., “Herbicide-resistant fertile transgenic wheat Zhou et al., Methods Enzymol., 101:433, 1983. plants obtained by microprojectile bombardment of regen 55 Zhou et al., Mol. Cell. Biol., 10:4529-37, 1990. erable embryogenic callus. Biotechnology, 10:667-674, All of the compositions and methods disclosed and 1992. claimed herein can be made and executed without undue Vasil, Biotechnology, 6:397, 1988. experimentation in light of the present disclosure. While the Vasil, Clancy, Ferl, Vasil, Hannah, “Increased gene expres compositions and methods of this invention have been sion by the first intron of maize shrunken-1 locus in grass 60 described interms of preferred embodiments, it will be appar species. Plant Physiol., 91: 1575-1579, 1989. ent to those of skill in the art that variations may be applied to Ventura et al., Nucl. Acids Res., 21:3249-55, 1993. the composition, methods and in the steps or in the sequence Veselkov, Demidov, Nielsen, Frank-Kamenetskii, NuclAcids of steps of the method described herein without departing Res., 24:2483-2487, 1996. from the concept, spirit and scope of the invention. More Vickers, Griffith, Ramasamy, Risen, Freier, Nucl. Acids Res., 65 specifically, it will be apparent that certain agents which are 23:3003-3008, 1995. both chemically and physiologically related may be substi Vodkin et al., Cell, 34:1023, 1983. tuted for the agents described herein while the same or similar US 7,772,369 B2 109 110 results would be achieved. All such similar substitutes and defined by the appended claims. Accordingly, the exclusive modifications apparent to those skilled in the art are deemed rights sought to be patented are as described in the claims to be within the spirit, scope and concept of the invention as below.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 35

<21 Os SEQ ID NO 1 &211s LENGTH: 1161. &212s. TYPE: DNA <213> ORGANISM: Bacillus thuringiensis

<4 OOs SEQUENCE: 1 atgatagaaa ctaataagat atatgaaata agcaataaag ctaatggatt atatgcaact 60

act tatttaa gttittgataa tt caggtgtt agttt attaa ataaaaatga atctgatatt 12O aatgattata atttgaaatg gtttittattt cotattgata ataatcagta tatt attaca 18O

agittatggag taaataaaaa talaggtttgg actgctaatg gtaataaaat aaatgttaca 24 O

acatatt cog cagaaaattic agcacaacaa tdgcaaataa gaaacagttc ttctggatat 3 OO ataatagaaa at aataatgg gaaaattitta acggcaggaa caggccaatc attaggittta 360

ttatatttaa citgatgaaat acctgaagat tctaatcaac aatggaattit aact tcaata 42O caaacaattt cact tcc titc acaac caata attgatacaa cattagtaga ttaccctaaa 48O tatt caacga ccgg tagtat aaattataat gg tacagcac ttcaattaat gggatggaca 54 O

ct cataccat gtatt atggit atacgataaa acgatagctt ctacacacac toaaattaca 6 OO

acaac cc citt attatattitt gaaaaaatat caacgttggg tacttgcaac aggaagtggit 660 citatctgtac ct gcacatgt caaat caact titcgaatacg aatggggaac agacacagat 72O

caaaaaacca gtgtaataaa tacattaggit tttcaaatta atacagatac aaaattaaaa 78O gct actgtac Cagaagtagg toggaggtaca acagatataa galacacaaat cactgaagaa 84 O

cittaaagtag aatatagtag tdaaaataaa gaaatgcgaa aatataaaca aagctittgac 9 OO gtagacaact taaattatga tigaag cacta aatgctgtag gatttattgt tdaaactt.ca 96.O

titcgaattat atcqaatgaa tdgaaatgtc. cittataacaa gtataaaaac tacaaataaa 102O gacaccitata at acagttac titatic caaat cataaagaag ttitt attact tcttacaaat 108O cattctitatg aagaagtaac agcactaact ggcattt coa aagaaagact tcaaaatctt 114 O

aaaaacaatt ggaaaaaaag a 1161.

<21 Os SEQ ID NO 2 &211s LENGTH: 387 212s. TYPE: PRT <213> ORGANISM: Bacillus thuringiensis <4 OOs SEQUENCE: 2 Met Ile Glu Thir Asn Lys Ile Tyr Glu Ile Ser Asn Lys Ala Asn Gly 1. 5 1O 15 Leu Tyr Ala Thr Thr Tyr Lieu Ser Phe Asp Asn Ser Gly Val Ser Lieu. 2O 25 3 O

Lieu. Asn Lys Asn. Glu Ser Asp Ile Asn Asp Tyr Asn Lieu Lys Trp Phe 35 4 O 45

Leu Phe Pro Ile Asp Asn Asn Glin Tyr Ile Ile Thr Ser Tyr Gly Val SO 55 60

Asn Lys Asn Llys Val Trp Thr Ala Asn Gly Asn Lys Ile Asn Val Thr 65 70 7s 8O US 7,772,369 B2 111 112

- Continued

Thir Ser Ala Glu Asn. Ser Ala Gln Glin Trp Glin Ile Arg Asn. Ser 85 90 95

Ser Ser Gly Tyr Ile Ile Glu Asn Asn Asn Gly Ile Luell Thir Ala 105 11 O

Gly Thir Gly Glin Ser Lieu. Gly Lieu. Lieu. Tyr Lieu. Thir Asp Glu Ile Pro 115 12 O 125

Glu Asp Ser Asin Glin Gln Trp Asn Lieu. Thir Ser Ile Glin Thir Ile Ser 13 O 135 14 O

Lell Pro Ser Glin Pro Ile Ile Asp Thir Thir Lieu. Wall Asp Pro Llys 145 150 155 160

Ser Thir Thr Gly Ser Ile Asn yr Asn Gly Thir Ala Luell Gln Lieu. 1.65 17O 17s

Met Gly Trp Thr Lieu. Ile Pro Cys le Met Wall Asp Lys Thir Ile 18O 85 19 O

Ala Ser Thir His Thr Glin Ile Thr Thir Thr Pro Tyr Ile Lieu Lys 195

Tyr Glin Arg Trp Val Lieu Ala Thr Gly Ser Gly Lell Ser Wall Pro 21 O 215 22O

Ala His Wall Lys Ser Thr Phe Glu yr Glu Trp Gly Thir Asp Thir Asp 225 23 O 235 24 O

Glin Thir Ser Wall Ile Asn. Thir Leu Gly Phe Glin Ile Asn Thir Asp 245 250 255

Thir Luell Lys Ala Thr Val Pro Glu Val Gly Gly Gly Thir Thir Asp 26 O 265 27 O

Ile Arg Thir Glin Ile Thr Glu Glu Lieu Lys Val Glu Tyr Ser Ser Glu 27s 28O 285

Asn Lys Glu Met Arg Llys Tyr Lys Glin Ser Phe Asp Wall Asp Asn Luell 29 O 295 3 OO

Asn Tyr Asp Glu Ala Lieu. Asn Ala Val Gly Phe Ile Wall Glu Thir Ser 3. OS 310 315 32O

Phe Glu Luell Tyr Arg Met Asn Gly Asn. Wall Lieu. Ile Thir Ser Ile Llys 3.25 330 335

Thir Thir Asn Lys Asp Thr Tyr Asn Thir Wall. Thir Pro Asn His Lys 34 O 345 35. O

Glu Wall Luell Lieu Lleu Lieu. Thir Asn His Ser Tyr Glu Glu Wall Thir Ala 355 360 365

Lell Thir Gly Ile Ser Lys Glu Arg Lieu. Glin Asn Lell Asn Asn Trp 37 O 375 38O Lys Arg 385

<210s, SEQ ID NO 3 &211s LENGTH: 396 &212s. TYPE: DNA <213> ORGANISM: Bacillus thuringiensis <4 OOs, SEQUENCE: 3 atgtcagcac gitgaagtaca cattgaaata ataaatcata caggt catac cittacaaatg 6 O gataaaagaa ctagacittgc acatggtgaa tggattatta Caccc.gtgaa tgttccaaat 12 O aattcttctg atttattt Ca agcaggttct gatggagttt tgacaggagt agaaggaata 18O ataatttata ctataaatgg agaaatagaa attacct tac attittgacaa tcc titatgca 24 O ggttctaata aat attctgg acgttctagt gatgatgatt ataaagttat aactgaagca 3OO US 7,772,369 B2 113 114

- Continued agagcagaac atagagctaa taat catgat catgtaa.cat atacagttca aagaalacata 360 t cacgatata ccaataaatt atgttctaat aacticc 396

SEQ ID NO 4 LENGTH: 132 TYPE : PRT ORGANISM: Bacillus thuringiensis

< 4 OOs SEQUENCE: 4

Met Ser Ala Arg Glu Val His Ile Glu Ile Ile Asn His Thir Gly His 1. 5 1O 15

Thir Luell Glin Met Asp Lys Arg Thr Arg Lieu Ala His Gly Glu Trp Ile 25

Ile Thir Pro Wall Asn. Wall Pro Asn Asn. Ser Ser Asp Lell Phe Glin Ala 35 4 O 45

Gly Ser Asp Gly Val Lieu. Thr Gly Val Glu Gly Ile Ile Ile Tyr Thr SO 55 6 O

Ile Asn Gly Glu Ile Glu Ile Thr Lieu. His Phe Asp Asn Pro 65 70 7s

Gly Ser Asn Llys Tyr Ser Gly Arg Ser Ser Asp Asp Asp Llys Val 85 90 95

Ile Thir Glu Ala Arg Ala Glu. His Arg Ala Asn Asn His Asp His Wall 105 11 O

Thir Thir Val Glin Arg Asn. Ile Ser Arg Tyr Thir Asn Lieu. Cys 115 12 O 125

Ser Asn Asn Ser 13 O

SEO ID NO 5 LENGTH: 4 O2 TYPE: DNA ORGANISM: Bacillus thuringiensis

< 4 OOs SEQUENCE: 5 aaggaacata catataaaaa ggggaalacct accaaaaat attat cattt ttittaagtta 6 O aataCataca ttaatttagt atctgtaaaa acattaattit tatggaggitt gatatt tatg 12 O t cagct cqcg aagtacacat tgaaataaac aataaaaCaC gtcatacatt acaattagag 18O gataaaacta aacttagcgg agg tagatgg cgaacat cac ctacaaatgt tgctcgtgat 24 O acaattaaaa. catttgtagc agaat cacat ggttt tatga Caggagtaga agg tattata 3OO tattittagtg taaacggaga cgcagaaatt agtttacatt ttgacaatcc ttatatagitt 360 ctaataaatg tdatggttct tctgatagac ctgaatatga ag

<210s, SEQ ID NO 6 &211s LENGTH: 119 212. TYPE : PRT <213> ORGANISM: Bacillus thuringiensis <4 OOs, SEQUENCE: 6

Met Ser Ala Arg Glu Val His Ile Glu Ile ASn Asn Lys Thir Arg His 1. 5 1O 15

Thir Lieu. Glin Lieu. Glu Asp Llys Thr Llys Lieu. Ser Gly Gly Arg Trp Arg 25

Thir Ser Pro Thr Asn Val Ala Arg Asp Thir Ile Thir Phe Wall Ala 35 4 O 45

Glu Ser His Gly Phe Met Thr Gly Val Glu Gly Ile Ile Phe Ser US 7,772,369 B2 115 116

- Continued

SO 55 6 O Val Asn Gly Asp Ala Glu Ile Ser Lieu. His Phe Asp Asn. Pro Tyr Ile 65 70 8O

Gly Ser Asn Lys Cys Asp Gly Ser Ser Asp Llys Pro Glu Tyr Glu Wall 85 90 95

Ile Thr Glin Ser Gly Ser Gly Asp Llys Ser His Val Thr Tyr Thir Ile 105 11 O

Glin. Thir Wall Ser Lieu. Arg Lieu. 115

<210s, SEQ I D NO 7 &211s LENGT H: 1155 212. TYPE : DNA <213> ORGANISM: Bacillus thuringiensis <4 OO > SEQUENCE: 7 atgttagata ctaataaagt titatgaaata agcaatc.ttg ctaatggatt atata catca 6 O act tatttala gtc.ttgatga ttcaggtgtt agtttaatga gtaaaaagga tgaagatatt 12 O gatgattaca atttaaaatg gtttittattt cct attgata ataat Calata tatt attaca 18O agctatggag ctaataattg taaagtttgg aatgttaaaa atgataaaat aaatgtttca 24 O act tattott Caacaaactic tgtacaaaaa tggcaaataa aagctaaaga t tott catat 3OO ataatacaaa. gtgataatgg aaaggtotta acagcaggag taggtgaatc t cittggaata 360 gtacgc.ctaa citgatgaatt tccagagaat totalaccaac aatggaattit aactic ct gta caaacaattic aactcCCaCa aaaac Ctaaa. atagatgaaa aattaaaaga t catcctgaa tatt cagaaa ccggaaat at aaatcCtaaa. acaactic Ctc. aattaatggg atgga catta 54 O gtaccttgta titatgg taaa tgatt Cagga atagataaaa acact Calaat taaaact act

Coat attata tttittaaaaa. atataaatac tggaatctag caaaaggaag taatgitat ct 660 t tact tccac atcaaaaaag at catatgat tatgaatggg gtacagaaaa aaatcaaaaa. 72 O acat Ct atta ttaatacagt aggattgcaa. attaatatag att caggaat gaaatttgaa gtaccagaag taggaggagg tacagaagac ataaaaaCaC aattaactga agaattaaaa 84 O gttgaatata gCactgaaac caaaataatg acgaaat atc aagaacactic agagatagat 9 OO aatcCalacta at Calaccalat gaattictata ggactitctta titt at act to tittagaatta 96.O tat cqatata acggtacaga aattaagata atgga catag aaact tcaga t catgatact tacact Ctta citt cittat co aaatcatalaa. gaagcattat tact t ct cac aaaccattcg 108 O tatgaagaag tagaagaaat aacaaaaata cctaa.gcata CaCttataaa. attgaaaaaa 114 O

Cattattitta aaaaa. 1155

<210s, SEQ I D NO 8 &211s LENGT H: 385 212. TYPE : PRT <213> ORGANISM: Bacillus thuringiensis

<4 OOs, SEQUENCE: 8 Met Lieu. Asp Thr Asn Llys Val Tyr Glu Ile Ser Asn Lieu Ala Asn Gly 1. 5 15 Lieu. Tyr Thr Ser Thr Tyr Lieu. Ser Lieu. Asp Asp Ser Gly Val Ser Lieu. 25

Met Ser Lys Lys Asp Glu Asp Ile Asp Asp Tyr Asn Lieu Lys Trp Phe 35 4 O 45 US 7,772,369 B2 117 118

- Continued Lell Phe Pro Ile Asp Asn Asn Glin Tyr Ile Ile Thir Ser Tyr Gly Ala SO 55 6 O

Asn Asn Wall Trp Asn Wall Lys Asn Asp Lys Ile Asn Wall Ser 65 70

Thir Ser Ser Thir Asn Ser Wall Glin Lys Trp Glin Ile Ala Lys 85 90 95

Asp Ser Ser Tyr Ile Ile Glin Ser Asp Asn Gly Wall Luell Thir Ala 1OO 105 11 O

Gly Wall Gly Glu Ser Lell Gly Ile Wall Arg Luell Thir Asp Glu Phe Pro 115 12 O 125

Glu Asn Ser Asn Glin Glin Trp Asn Luell Thir Pro Wall Glin Thir Ile Glin 13 O 135 14 O

Lell Pro Glin Pro Lys Ile Asp Glu Luell Asp His Pro Glu 145 150 155 160

Ser Glu Thir Gly Asn Ile Asn Pro Lys Thir Thir Pro Glin Luell Met 1.65 17O 17s

Trp Thir Luell Wall Pro Ile Met Wall ASn Asp Ser Gly Ile Asp 18O 185 19 O

Asn Thir Glin Ile Thir Thir Pro Tyr Ile Phe Tyr 195

Tyr Trp Asn Lell Ala Lys Gly Ser Asn Wall Ser Lell Luell Pro His 21 O 215 22O

Glin Arg Ser Tyr Asp Glu Trp Thir Glu Asn Glin Lys 225 23 O 235 24 O

Thir Ser Ile Ile Asn Thir Wall Gly Luell Ile Asn Ile Asp Ser Gly 245 255

Met Phe Glu Wall Pro Glu Wall Gly Gly Thir Glu Asp Ile 26 O 265 27 O

Thir Glin Luell Thir Glu Glu Lell Lys Wall Ser Thir Glu Thir 28O 285

Ile Met Thir Tyr Glin Glu His Ser Ile Asp Asn Pro Thir Asn 29 O 295 3 OO

Glin Pro Met Asn Ser Ile Gly Luell Luell Tyr Thir Ser Luell Glu Luell 3. OS 310 315

Arg Asn Gly Thir Glu Ile Met Asp Ile Glu Thir Ser 3.25 335

Asp His Asp Thir Tyr Thir Lell Thir Ser Tyr Pro Asn His Lys Glu Ala 34 O 345 35. O

Lell Luell Luell Luell Thir Asn His Ser Glu Glu Wall Glu Glu Ile Thir 355 360 365

Ile Pro His Thir Lell Ile Luell Lys Lys His Phe 37 O 375 38O Lys 385

<210s, SEQ ID NO 9 &211s LENGTH: 372 &212s. TYPE: DNA <213> ORGANISM: Bacillus thuringiensis

<4 OOs, SEQUENCE: atgtcagdac gitgaagtaca cattaatgta aataataaga caggit catac attacaatta gaagataaaa caaaacttga tiggtggtaga tiggcgaacat Cacct acaaa tittgctaat 12 O gatcaaatta aaa catttgt agcagaatca catggittitta tdacagg tac agaaggt cat 18O US 7,772,369 B2 119 120

- Continued at at attata gtataaatgg agaagicagaa attagttitat attittgataa toctitatt ca 24 O ggttctaata aatatgatgg gcatt coaat aaacct caat atgaagttac tacccaagga 3OO ggat Caggaa atcaatctica tottacgitat act attcaaa citgcatc.ttic acgatatggg 360 aataact cat a.a. 372

<210s, SEQ I D NO 10 &211s LENGT H: 123 212. TYPE : PRT <213> ORGANISM: Bacillus thuringiensis

<4 OOs, SEQUENCE: 10 Met Ser Ala Arg Glu Wa l His Ile Asn. Wall Asn Asn Llys Thr Gly His 1. 5 1O 15

Thir Lieu. Glin Lieu. Glu. As p Llys Thr Llys Lieu. Asp Gly Gly Arg Trp Arg 2O 25 3O

Thir Ser Pro Thir Asn. Wa l Ala Asn Asp Glin Ile Lys Thr Phe Wall Ala 35 4 O 45

Glu Ser His Gly Phe Me t Thr Gly Thr Glu Gly His Ile Tyr Tyr Ser SO 55 6 O

Ile Asin Gly Glu Ala Gl u Ile Ser Leu Tyr Phe Asp Asn Pro Tyr Ser 65 70 7s

Gly Ser Asn Llys Tyr As p Gly His Ser Asn Lys Pro Glin Tyr Glu Wall 85 90 95

Thir Thr Gin Gly Gly Se r Gly ASn Glin Ser His Val Thr Tyr Thir Ile 1OO 105 11 O

Glin. Thir Ala Ser Ser Air g Tyr Gly Asn. Asn. Ser 115 12 O

<210s, SEQ I D NO 11 &211s LENGT H: 1152 212. TYPE : DNA <213> ORGANISM: Bacillus thuringiensis <4 OOs, SEQUENCE: 11 atgttagata ctaataaagt titatgaaata agtaatcatg ctaatgg act atatgcagca 6 O act tatttala gtttagatga ttcaggtgtt agtttaatga ataaaaatga tgatgatatt 12 O gatgattata acttaaaatg gtttittattt cct attgatg atgat caata tatt attaca 18O agctatgcag caaataattg taaagtttgg aatgttaata atgataaaat aaatgtttcg 24 O act tattott Caacaaattic aatacaaaaa. tggcaaataa aagctaatgg t tott catat 3OO gtaatacaaa gtgataatgg aaaagt citta acagcaggaa ccggit Caagc tcttggattg 360 atacgtttaa citgatgaatc Ctcaaataat CCCaatcaac aatggaattit aacttctgta caaacaattic aact tccaca aaaac Citata atagatacaa aattaaaaga ttatcCCaaa. tatt Caccala ctggaaat at agataatgga aCatcto Ctc. aattaatggg atgga catta 54 O gtaccttgta titatgg taaa tgatccaaat atagataaaa a tact Calaat taaaact act

Coat attata ttittaaaaaa. at atcaat at tggcaacgag Cagtaggaag taatgtagct 660 ttacgt.ccac atgaaaaaaa at Catatact tatgaatggg gaacagalaat agatcaaaaa 72 O acaacaat Ca taalata Catt aggatttcaa atcaatatag att caggaat gaaatttgat ataccagaag taggtggagg tacagatgaa ataaaaaCaC aactaaatga agaattaaaa 84 O atagaatata gtcgtgaaac taaaataatg gaaaaat atc aagaacaatc tgaaatagat 9 OO US 7,772,369 B2 121 122

- Continued aatccaactg at Calaccalat gaattictata ggatttctta ctatt acttic tittagaatta 96.O tatagatata atggct Caga aatticgtata atgcaaattic aaacct caga taatgatact tataatgtta citt cittat co agat catcaa caa.gcttitat tactt Cttac aaatcattca 108 O tatgaagaag tagaagaaat aacaaatatt cctaaaagta Cactaaaaaa attaaaaaaa. 114 O tatt atttitt a.a. 1152

SEQ ID NO 12 LENGTH: 383 TYPE : PRT ORGANISM: Bacillus thuringiensis

< 4 OOs SEQUENCE: 12 Met Lieu. Asp Thr Asn Llys Val Tyr Glu Ile Ser Asn His Ala Asn Gly 1. 5 1O 15

Lell Tyr Ala Ala Thr Tyr Lieu Ser Lieu. Asp Asp Ser Gly Val Ser Leu 25 3O

Met Asn Lys Asn Asp Asp Asp Ile Asp Asp Tyr Asn Lieu Lys Trp Phe 35 4 O 45

Lell Phe Pro Ile Asp Asp Asp Glin Tyr Ile Ile Thir Ser Tyr Ala Ala SO 55 6 O

Asn Asn Llys Val Trp Asn. Wall Asn Asn Asp Lys Ile Asin Val Ser 65 70 7s 8O

Thir Ser Ser Thir Asn. Ser Ile Gln Lys Trp Glin Ile Lys Ala Asn 85 90 95

Gly Ser Ser Tyr Val Ile Glin Ser Asp Asn Gly Llys Val Lieu. Thir Ala 105 11 O

Gly Thir Gly Glin Ala Lieu. Gly Lieu. Ile Arg Lieu. Thr Asp Glu Ser Ser 115 12 O 125

Asn Asn Pro Asin Glin Gln Trp Asn Lieu. Thir Ser Wall Glin. Thir Ile Glin 13 O 135 14 O

Lell Pro Glin Llys Pro Ile Ile Asp Thir Lys Lieu. Lys Asp Tyr Pro Llys 145 150 155 160

Ser Pro Thr Gly Asn. Ile Asp Asin Gly Thr Ser Pro Glin Lieu Met 1.65 17O 17s

Trp Thir Leu Val Pro Cys Ile Met Wall Asn Asp Pro Asn. Ile Asp 18O 185 19 O

Asn Thir Glin Ile Llys Thr Thr Pro Tyr Tyr Ile Lieu Lys Llys Tyr 195 2O5

Glin Tyr Trp Glin Arg Ala Val Gly Ser Asn. Wall Ala Lieu. Arg Pro His 21 O 215 22O

Glu Ser Tyr Thr Tyr Glu Trp Gly Thr Glu Ile Asp Glin Lys 225 23 O 235 24 O

Thir Thir Ile Ile Asn. Thir Lieu. Gly Phe Glin Ile Asn. Ile Asp Ser Gly 245 250 255

Met Phe Asp Ile Pro Glu Val Gly Gly Gly Thir Asp Glu Ile Llys 26 O 265 27 O

Thir Glin Luell Asin Glu Glu Lieu Lys Ile Glu Tyr Ser Arg Glu Thir Lys 285

Ile Met Glu Llys Tyr Glin Glu Glin Ser Glu Ile Asp Asn Pro Thr Asp 29 O 295 3 OO

Glin Pro Met Asn Ser Ile Gly Phe Lieu. Thir Ile Thir Ser Lieu. Glu Lieu. 3. OS 310 315 32O

Arg Asin Gly Ser Glu Ile Arg Ile Met Glin Ile Glin. Thir Ser US 7,772,369 B2 123 124

- Continued

3.25 330 335 Asp Asn Asp Thr Tyr Asn Val Thr Ser Tyr Pro Asp His Glin Glin Ala 34 O 345 35. O Lieu. Lieu. Lieu. Lieu. Thir Asn His Ser Tyr Glu Glu Val Glu Glu Ile Thr 355 360 365 Asn. Ile Pro Llys Ser Thr Lieu Lys Llys Lieu Lys Llys Tyr Tyr Phe 37 O 375

SEQ ID NO 13 LENGTH: 1952 TYPE: DNA ORGANISM: Bacillus thuringiensis FEATURE: NAMEAKEY: misc feature LOCATION: (1903) . . (1903) OTHER INFORMATION: N= any A, C, T, or G FEATURE: NAMEAKEY: misc feature LOCATION: (1932) ... (1932) OTHER INFORMATION: N= any A, C, T, or G SEQUENCE: 13 aaaatc.ttitt acatatattt gttaggaagc atgaaaataa aaatagatta tatagaagga 6 O gtgaaataga tigaatgtaaa t cacgg tatgtcttgttggat gtggttgcca gcaaggtaaa 12 O gaagaatata acgattat cattgtcaaat gaatataggg acgaaaatcc tag tacaact 18O tgtaattctic aacaaggtaa titatgagtac gaacaaagta aagaaacata taacaatgat 24 O tat caatcat atgaatacaa toaacaaaat tataatactt gcggalaggala totalaggaacg 3OO atggaacagg agt catgca aaaggatagg aattgggaga atgcaaatta tagtggatat 360 gatggatgta gtccaaatca gttgaatgca ctaaatttac Cagatgaaag tact aggttt caaaaaataa ctaatgtaaa tact.cgtgat agt catcgtg ttittaga cat gatggacgtt cctagtggaa citaggcttga tact.cgtgta cct cotattt gtagt caaac cqaatttaca 54 O aatacggitta gtaatgaatt agttt coacg aat catgata Cacaatttitt aatttitt tat caaacagatg at agttcatt tatt attggg aatcgaggaa atggit cagt tittagatgtt 660 titt.cct agta atagaaatgg ttatacaata gtttcaaatg tgtatagtgg ttcaaggaat 72 O aatcagcgtt titcg tatgaa taaag catct aataatcaat ttagtttaca aaccatttitt aaggacagag taaatatatg toggtoatatt cacaattitta acgcgataat tacagotact 84 O actittaggtg agaatgatag taatgctitta tittcaagtac aat CttcCaic aaatataa.ca 9 OO ctacct acat taccacctag gacaa.catta gaaccaccaa gag cattaac aaatataaat 96.O gatacaggtg attct c cagc gcaa.gcacct cagcgg tag aaggaagtgt tottatc.ccc gcaatagcgg taaatgatgt catt.ccggta gcgcaaagaa tgcaagaaag to cqt attat gtgttaa.cat ataatacata ttggcataga gttattt cag Caatact acc agg tagtggg 14 O caaact acaa gottcgatgt aaacttacca ggit cotaatc aaagtacaat ggtagatgta 2OO ttagatacag caattactgc agattittaga ttacaatttg ttggaagtgg acgaacaaat 26 O gtatttcaac aacaaattag aaatggatta aatat attaa attctacaac git ct catcgt. 32O ttaggagatgaaacacgtaa ttgggattitt acaaatagag gtgct Caagg aagattagcg tttitttgtaa aag cacatga gtttgtatta acacgtgcga atggalacacg agtaagtgat 44 O c catgggtgg cattagat co gaatgttaca gctgctcaaa catttggagg agtattactt SOO acattagaaa aagaaaaaat agtatgtgca agtaatagitt ataattitatic agtatggaaa 560 US 7,772,369 B2 125 126

- Continued acaccalatgg aaataaagaa tggaaaaatt tatacaaaaa. atgaatggaa tacaaaacca 162O alactacaaat aaacaaaatg attctgttga caagtttgaa aaaaaaaaa. ttggitttgca 168O aaatatggitt ccggtgcaaa aattic Caaaa. tgattgaaaa ggattitatica aacttgtc.ca 1740 tactgg tact act act taala aaaggtgttgt gattagt atg ggaccagaaa atttatttala 18OO gtggaalacat tat caaccag at attattitt atcaa.cagta cgttggit acc tacgg tacaa 1860 cittaagttitt cgtgatttgg tagaaatgat ggaggaacga ggntitat citt tggct catac 1920 aaccattatg Cngttgggtt catcaatatg gt 1952

<210s, SEQ I D NO 14 &211s LENGT 212. TYPE : <213> ORGANISM: Bacillus thuringiensis <4 OOs, SEQUENCE: 14 Met Asn. Wall Asn His Gly Met Ser Gly Glin Gln Gly 1. 5 1O 15

Lys Glu Glu Tyr Asn Asp Tyr His Wal Ser Asn Glu Arg Asp Glu 25

Asn. Pro Ser Thir Thr Cys Asn Ser Gln Glin Gly Asn Glu Tyr Glu 35 4 O

Glin Ser Lys Glu Thir Tyr Asn Asn Asp Tyr Glin Ser Glu Tyr Asn SO 55 6 O

Glin Glin Asn Tyr Asn Thr Cys Gly Arg Asn Glin Gly Thir Met Glu Glin 65 70 8O

Glu Ser Met Gln Lys Asp Arg Asn Trp Glu Asn Ala Asn Ser Gly 85 90 95

Cys Ser Pro Asn Glin Lieu. Asn Ala Lell Asn Luell Pro Asp 105 11 O

Glu Ser Thr Arg Phe Gln Lys Ile Thir Asn. Wall Asn Thir Arg Asp Ser 115 12 O 125

His Arg Val Lieu. Asp Met Met Asp Wall Pro Ser Gly Thir Arg Lieu. Asp 13 O 135 14 O

Thr Arg Val Pro Pro Ile Cys Ser Glin. Thir Glu Phe Thir Asn Thir Wall 145 150 155 160

Ser Asn. Glu Lieu Wal Ser Thir Asn His Asp Thr Glin Phe Luell Ile Phe 1.65 17O 17s

Tyr Glin Thr Asp Asp Ser Ser Phe Ile Ile Gly Asn Arg Gly Asin Gly 18O 185 19 O

Arg Val Lieu. Asp Val Phe Pro Ser Asn Arg Asn Gly Tyr Thir Ile Wall 195

Ser Asn. Wall Tyr Ser Gly Ser Arg Asn Asn. Glin Arg Phe Arg Met Asn 21 O 215

Lys Ala Ser Asn. Asn. Glin Phe Ser Leul Glin. Thir Ile Phe Asp Arg 225 23 O 235 24 O

Wall Asn. Ile Cys Gly His Ile His Asn Phe Asn Ala Ile Ile Thir Ala 245 250 255

Thir Thir Lieu. Gly Glu Asn Asp Ser Asn Ala Lieu. Phe Glin Wall Glin Ser 26 O 265 27 O

Ser Thir Asn Ile Thir Lieu Pro Thr Leul Pro Pro Arg Thir Thir Lieu. Glu 27s 28O 285

Pro Pro Arg Ala Lieu. Thir Asn. Ile Asn Asp Thr Gly Asp Ser Pro Ala 29 O 295 3 OO US 7,772,369 B2 127 128

- Continued Glin Ala Pro Arg Ala Val Glu Gly Ser Wall Lieu Ile Pro Ala Ile Ala 3. OS 310 315 32O

Wall Asn Asp Val Ile Pro Val Ala Glin Arg Met Glin Glu Ser Pro Tyr 3.25 330 335

Wall Lieu. Thir Tyr Asn Thr Tyr Trp His Arg Wall Ile Ser Ala Ile 34 O 345 35. O

Lell Pro Gly Ser Gly Glin Thr Thr Arg Phe Asp Wall Asn Lieu. Pro Gly 355 360 365

Pro Asn Glin Ser Thr Met Val Asp Val Lieu. Asp Thir Ala Ile Thir Ala 37 O 375 38O

Asp Phe Arg Lieu. Glin Phe Val Gly Ser Gly Arg Thir Asn. Wall Phe Glin 385 390 395 4 OO

Glin Glin Ile Arg Asn Gly Lieu. Asn Ile Lieu. Asn Ser Thir Thr Ser His 4 OS 41O 415

Arg Luell Gly Asp Glu Thir Arg Asn Trp Asp Phe Thir Asn Arg Gly Ala 425 43 O

Glin Gly Arg Lieu Ala Phe Phe Val Lys Ala His Glu Phe Wall Lieu. Thir 435 44 O 445

Arg Ala Asin Gly Thr Arg Val Ser Asp Pro Trp Wall Ala Lieu. Asp Pro 450 45.5 460

Asn Wall Thir Ala Ala Glin. Thir Phe Gly Gly Val Lieu. Lieu. Thr Lieu. Glu 465 470

Glu Lys Ile Val Cys Ala Ser Asn Ser Tyr ASn Luell Ser Val Trp 485 490 495

Thir Pro Met Glu Ile Lys Asn Gly Lys Ile Tyr Thr Lys Asn. Glu SOO 505 51O

Trp Asn Thr Llys Pro Asn Tyr Lys 515

<210s, SEQ ID NO 15 &211s LENGTH: 1024 &212s. TYPE: DNA <213> ORGANISM: Bacillus thuringiensis <4 OOs, SEQUENCE: 15 agtgcgagca ttt attaata caatagaaat gct cacatat gtaacaacct ttagtatatt 6 O taaatataag gagttgtata actitgagtat Cttaa at Ctt caagactitat Cacaaaaata 12 O tatgactgca gctittaaata agataaatcc aaaaaaagta gg tactitt.cc attittgagga 18O accalatagta ctitt cagaat cit to tact co cacacgttct gaaattgatg CCCCt Cttaa. 24 O tgttatgttt cacgctt cac aagat cittga taatagaagg ggCactagtg atttaaaa.ca 3OO aactgtttct ttittct caaa Ctcaaataaa. tactgttgaa accalaalacta Ctgatggtgt 360 taaaacaact aaagaacata catttagtgg tacattagaa ctaaagatta aatatgcaat gtttgattta gggggagtgt Caggcacata toalatataaa. aaaagtactg aaaacgatat tagttcagaa aagagtaaat cgaagttcaga ttctoaaact tggtcaatat Caagtgaata 54 O tacagttaaa cct ggagtaa aagaaact ct t catttitt at attgtaggaa taaaaaacco aagtgc ctitt taaatattitt tgctgaattit Caagg tacta aaact attga taatgitaticc 660 aatgttatgg cittatcaaga gtttataagt Caagatgatg aacatataag agcatgitatg 72 O aaagcaagta aattggctaa tcc tigatcat ctitt caggat atacagotcc aaaggaatta aaagcaaata caagtaaagg atcagtagaa tittagaggta cagctatagc taaaataaat 84 O acaggagtaa aatgtcttgt tgtagttaat ggaaaaaatt Caataactgg aaaaactitat 9 OO US 7,772,369 B2 129 130

- Continued t cittatatac atcctaaaac aatgttagct gatggaacca ttgaatattt agaaagtgag 96.O atagat ctitt tagaaagtga gatagat citt ttalactacaa gtag tattitt agtttaalaca atta 1024

<210s, SEQ ID NO 16 &211s LENGTH: 310 212. TYPE : PRT &213s ORGANISM: Bacillus thuringiensis

<4 OOs, SEQUENCE: 16

Met Ser Ile Lieu. Asn Lell Glin Asp Luell Ser Glin Met Thir Ala 1. 5 15

Ala Luell Asn Lys Ile Asn Pro Lys Wall Gly Thir Phe His Phe Glu 25

Glu Pro Ile Wall Lell Ser Glu Ser Ser Thir Pro Thir Arg Ser Glu Ile 35 4 O 45

Asp Ala Pro Luell Asn Wall Met Phe His Ala Ser Glin Asp Luell Asp Asn SO 55 6 O

Arg Arg Gly Thir Ser Asp Lell Glin Thir Wall Ser Phe Ser Glin Thir 65 70

Glin Ile Asn Thir Wall Glu Thir Thir Thir Asp Gly Wall Thir Thir 85 90 95

Glu His Thir Phe Ser Gly Thir Luell Glu Luell Ile Lys Ala 105 11 O

Met Phe Asp Luell Gly Gly Wall Ser Gly Thir Tyr Glin Tyr Ser 115 12 O 125

Thir Glu Asn Asp Ile Ser Ser Glu Ser Lys Ser Ser Asp Ser 13 O 135 14 O

Glin Thir Trp Ser Ile Ser Ser Glu Thir Wall Pro Gly Wall Lys 145 150 155 160

Glu Thir Luell Asp Phe Wall Gly Ile Lys Thir Glu Wall Pro Luell 1.65 17O 17s

Asn Ile Phe Ala Glu Phe Gly Thir Thir Ile Asp Asn Wall Ser 18O 185 19 O

Asn Wall Met Ala Tyr Glin Phe Ile Ser Glin Asp Asp Glu His Ile 195

Arg Ala Met Lys Ala Luell Ala ASn Pro Asp His Luell Ser 21 O 2 5 22O

Gly Tyr Thir Ala Pro Lys Luell Ala ASn Thir Ser Gly Ser 225 23 O 235 24 O

Wall Glu Phe Arg Gly Thir Ile Ala Lys Ile Asn Thir Gly Wall Lys 245 250 255

Luell Wall Wall Wall Asn Asn Ser Ile Thir Gly Lys Thir Tyr 26 O 265 27 O

Ser Ile His Pro Thir Met Luell Ala Asp Gly Thir Ile Glu Tyr 28O 285

Lell Glu Ser Glu Ile Asp Lell Luell Glu Ser Glu Ile Asp Luell Luell Thir 29 O 295 3 OO

Thir Ser Ser Ile Lell Wall 3. OS 310

<210s, SEQ ID NO 17 &211s LENGTH: &212s. TYPE: DNA US 7,772,369 B2 131 132

- Continued <213> ORGANISM: Bacillus thuringiensis <4 OOs, SEQUENCE: 17 gaattcttaa aaaaaataag gtttitt tatg gaaaattgtc. gigaaagctgt atgttttgttg 6 O aatagataag tatatttittt aaaattaatt tatataaaat atataatatic aacgagtgaa 12 O tatatago at tdtctaatta tagataaaag agct tattitt titt cacatat aaact actta 18O ttacgtatag tacagtgaga caatttittaa cagttgtttc atata accct c catt cattt 24 O tataagagca aaaaaacaaa cacgct tatgaaaaggaata tttgtttitt c atttattatt 3OO tatttcaaga aaattgaaat gtgtatatat gattaa.gcaa catttggagt tdtttittgat 360 tctic ct citta ttcaaattgc cqgagtttaa aattcaaata aatttattga tigt at attac 42O tottctgaag atgataatct taaat attac caattgataa aagttgaatc. tcattttgta 48O caaactacct ttagcaaaca gttgatgaaa gag cqtggaa aaattaalaca at agtttagt 54 O catttcaaag ataaagggct ggaacago.ca cqttgatatg gttaaaatcg citat citattg 6OO catatatatt tttagtaaat aactttitt at tattaaaaat ataattittat aaaggatgtg 660 tittaagtttg act at cataa at at attaga t tatgcagat t cittatttaa gagctgctat 72 O taaaaaatat ggaggatacc caagttctag taaagctaga ttctitat ct a citccaaaaat 78O ttcagaacca gag togg tatt accctgctaa agaatctgtt aatgcatatgaaattgg taa 84 O acaatctggit togtat cota at cattctitc tacat ct caa aattittaatg taccalatticg 9 OO titat cotgtt to cact act a gttcaacaaa alactataaat gigttittaaaa cagataaaag 96.O tatttctaaa aatttaaatc tta acttagg gataaatgca aaaataccta atataaatat O2O t cctggtggc tittgaaattg aagttaalacc tigagctgag gtttcaagaa atgttaaaac O8O gaatcaaaca gtag actitta gtag tact tc tdaaaaaa.ca caaaatacaa atgacacticc 14 O atctgacaca act caatct t t ct cittgtcc ticcitaacaca aaa.gcaa.cat atatagittat 2OO ttattt cqgg ggagaaccta aagtagaagt tacagctgta acagatataa taggaaatgg 26 O atctggaata ggalacagatc Ctact actgg toaagaaaaa ticgcaaagaa atgttittagc 32O aactittagat tacagtaaag aaggt caa.gc tigg taaaaaa tatac tatga tigg taactgc 38O agat caatta gcaactaaaa tacctggata taatcct coa ccaagagtc.g. aacaagat.cg 44 O tagt cataat gcattalacta t t catagtga ccttatagta aatttaaaag aagattittgc SOO atatgaaata attgtaaaat ttgaaaattt at cittatt cq acactttitta atgaagatct 560 ctittatttat agatt.cgaca aaaat cataa tottcttata gaaaaaacag ttggat catt 62O atttgaaact aatctacatg cagatattitt titatgaacat attgaaagtgaattagaata 68O aaaatattitt tittaaatatgata acticcac ttatttaaaa toacaaaagt tittaaacaaa 74 O attaacaaaa aaattaaatg gaggttgaaa atatgtcago acgtgaagta cacattgaaa 8OO taataaatca tacagg to at acct tacaaa tdgataaaag aactagacitt gcacatggtg 86 O aatggattat tacaccc.gtgaatgttccaa ataattic titc tdatttattt caa.gcaggitt 92 O

Ctgatggagt tttgacagga gtagaaggaa taataattta tactataaat ggagaaatag 98 O aaattacctt acattttgac aatcc titatg caggttctaa taaat attct ggacgttcta 2O4. O gtgatgatga ttataaagtt ataactgaag Caagagcaga acatagagct aataat catg 21OO at catgtaac atatacagtt caaagaaaca tat cacgata taccaataaa titatgttcta 216 O ataact cota aaatttattt taattattaa aaacaaagtt citataaattt gaataaagaa 222 O Ctttgtttitt atttgaaaaa at cacaaaaa gotgttgttgaa attatgatag aaactaataa 228O US 7,772,369 B2 133 134

- Continued gatatatgaa ataagcaata aagctaatgg attatatgca act acttatt taagttittga 234 O taatticaggt gttagttt at taaataaaaa tdaatctgat attaatgatt ataatttgaa 24 OO atggitttitta titt cot attgataataatca gtatattatt acaagttatg gagtaaataa 246 O aaataaggitt toggactgcta atggtaataa aataaatgtt acaacatatt cogcagaaaa 252O ttcago acaa caatggcaaa taagaaacag ttcttctgga tatataatag aaaataataa 2580 tgggaaaatt ttaacggcag gaacaggcca at cattaggit ttattatatt taact gatga 264 O aatacctgaa gattictaatc aacaatggaa tittaact tca atacaaacaa titt cact tcc 27 OO ttcacaacca ataattgata caa.cattagt agattaccct aaatatt caa cqaccgg tag 276 O tataaattat aatggtacag cacttcaatt aatgggatgg acact catac catgt attat 282O ggtatacgat aaaacgatag cittctacaca cactcaaatt acaacaa.ccc citt attatat 288O tittgaaaaaa tat caacgtt ggg tacttgc aac aggaagt gigt ct atctg tacctgcaca 294 O tgtcaaatca actitt.cgaat acgaatgggg aacagacaca gatcaaaaaa ccagtgtaat 3 OOO aaatacatta ggittittcaaa ttaatacaga tacaaaatta aaag.c tact g taccagaagt 3 O 6 O aggtggaggit acaacagata taagaacaca aat cactgaa gaact taaag tagaatatag 312 O tagtgaaaat aaagaaatgc gaaaatataa acaaagctitt gacgtagaca acttaaatta 318O tgatgaagica ctaaatgctg. taggattitat tdttgaaact t catt cqaat tatat cqaat 324 O gaatggaaat gtc.cttataa caagtataaa alactacaaat aaaga cacct ataatacagt 33 OO tacttatcca aat cataaag aagttittatt acttcttaca aatcattctt atgaagaagt 3360 aacago acta actggcattt coaaagaaag acttcaaaat cittaaaaa.ca attggaaaaa 342O aagataaaat atatatagag ttaaaagttc cqtaaggaac ggggagtgtt tttgaga aga 3480 acactaaaaa agt cqgttitt ttaattitt ca cctaaaggca aagacaatcc ct cagaag.cg 354 O tctagaagct ttatagagc gtttaaaagt atgtttagat aaaatactag ggaaaagtag 36OO tgaattic 36O7

<210s, SEQ ID NO 18 &211s LENGTH: 1026 &212s. TYPE: DNA <213> ORGANISM: Bacillus thuringiensis

<4 OOs, SEQUENCE: 18 atgtgtttaa gtttgacitat cataaatata ttagattatg cagatt citta tittaa.gagct 6 O gct attaaaa aatatggagg at acccaagt totagtaaag ctagatt citt atc tact coa 12 O aaaattitcag aaccagagtg g tatt accct gctaaagaat citgttaatgc atatgaaatt 18O ggtaaacaat citggttcgta t cotaatcat t cittctacat citcaaaattt taatgtacca 24 O attcqttatc ctdttt coac tact agttca acaaaaacta taaatggittt taaaacagat 3OO aaaagtattt ctaaaaattit aaatc.ttaac ttagggataa atgcaaaaat acctaatata 360 aatatt Cotg gtggctttga aattgaagtt aaacctggag Ctgaggttt C aagaaatgtt 42O aaaacgaatc aaa.cagtaga ctittagtagt acttctgaaa aaacacaaaa tacaaatgac 48O actic catctg acacaactica atc.tttct ct tdtcc to cta acacaaaagc aacatatata 54 O gttatt tatt t cqggggaga acctaaagta gaagttacag Ctgta acaga tataatagga 6OO aatggatctg gaataggaac agatcc tact actggtcaag aaaaatcgca aagaaatgtt 660 ttagcaactt tagattacag taaagaaggt caa.gctggta aaaaatatac tatgatggta 72 O US 7,772,369 B2 135 136

- Continued actgcagatc aattagcaac taaaatacct ggatataatc citccaccaag agt cqaacaa gatcgtagt c ataatgcatt alactattoat agtgaccitta tag taaattit aaaagaagat 84 O tittgcatatg aaataattgt aaaatttgaa aattitat Ctt att coacact ttittaatgaa 9 OO gatctottta tittatagatt cgacaaaaat Cataatctitc. ttatagaaaa alacagttgga 96.O t cattatttg aalactaat Ct acatgcagat atttitt tatg aac at attga aagtgaatta gaataa 1026

SEQ ID NO 19 LENGTH: 341 TYPE : PRT ORGANISM: Bacillus thuringiensis

< 4 OOs SEQUENCE: 19 Met Cys Lieu Ser Lieu. Thir Ile Ile ASn Ile Lieu. Asp Ala Asp Ser 1. 5 1O 15

Luell Arg Ala Ala Ile Llys Llys Tyr Gly Gly Tyr Pro Ser Ser Ser 25 3O

Ala Arg Phe Leu Ser Thr Pro Lys Ile Ser Glu Pro Glu Trp Tyr 35 4 O 45

Pro Ala Lys Glu Ser Val Asn Ala Tyr Glu Ile Gly Glin Ser SO 55 6 O

Gly Ser Pro Asn His Ser Ser Thir Ser Glin Asn Phe Asn Wall Pro 65 70 7s 8O

Ile Arg Pro Wall Ser Thir Thr Ser Ser Thr Thir Ile ASn Gly 85 90 95

Phe Thir Asp Llys Ser Ile Ser Lys Asn Lieu. Asn Lell Asn Lieu. Gly 105 11 O

Ile Asn Ala Lys Ile Pro Asn. Ile Asn. Ile Pro Gly Gly Phe Glu Ile 115 12 O 125

Glu Wall Pro Gly Ala Glu Val Ser Arg Asn Wall Thir ASn Glin 13 O 135 14 O

Thir Wall Asp Phe Ser Ser Thir Ser Glu Lys Thr Glin Asn Thir Asn Asp 145 150 155 160

Thir Pro Ser Asp Thr Thr Glin Ser Phe Ser Cys Pro Pro Asn Thr Lys 1.65 17O 17s

Ala Thir Ile Val Ile Tyr Phe Gly Gly Glu Pro Wall Glu Wall 18O 185 19 O

Thir Ala Wall Thr Asp Ile Ile Gly Asin Gly Ser Gly Ile Gly Thir Asp 195 2O5

Pro Thir Thir Gly Glin Glu Lys Ser Glin Arg Asn Wall Lell Ala Thir Lieu. 21 O 215 22O

Asp Ser Lys Glu Gly Glin Ala Gly Lys Llys Thir Met Met Wall 225 23 O 235 24 O

Thir Ala Asp Glin Lieu Ala Thr Lys Ile Pro Gly Tyr Asn Pro Pro Pro 245 250 255

Arg Wall Glu Glin Asp Arg Ser His Asn Ala Lieu. Thir Ile His Ser Asp 26 O 265 27 O

Lell Ile Wall Asn Lieu Lys Glu Asp Phe Ala Tyr Glu Ile Ile Val Lys 285

Phe Glu Asn Leu Ser Tyr Ser Thr Lieu. Phe Asn Glu Asp Luell Phe Ile 29 O 295 3 OO

Tyr Arg Phe Asp Lys Asn His Asn Lieu. Lieu. Ile Glu Thir Val Gly 3. OS 310 315 32O US 7,772,369 B2 137 138

- Continued

Ser Leu Phe Glu Thr Asn Lieu. His Ala Asp Ile Phe Tyr Glu. His Ile 3.25 330 335

Glu Ser Glu Lieu. Glu 34 O

<210s, SEQ ID NO 2 O &211s LENGTH: 15 212. TYPE: PRT <213> ORGANISM: Bacillus thuringiensis <4 OOs, SEQUENCE: 2O Met Lieu. Asp Thr Asn Llys Val Tyr Glu Ile Ser Asn His Ala Asn 1. 5 1O 15

<210s, SEQ ID NO 21 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide

<4 OOs, SEQUENCE: 21 atgttagata caaataaagt atatgaaatt toaaatcatg c 41

<210s, SEQ ID NO 22 &211s LENGTH: 2O 212. TYPE: PRT <213> ORGANISM: Bacillus thuringiensis

<4 OOs, SEQUENCE: 22 Ser Ile Lieu. Asn Lieu. Glin Asp Lieu. Ser Glin Llys Tyr Met Thir Ala Ala 1. 5 1O 15 Lieu. Asn Lys Ile 2O

<210s, SEQ ID NO 23 &211s LENGTH: 15 212. TYPE: PRT <213> ORGANISM: Bacillus thuringiensis

<4 OOs, SEQUENCE: 23 Ser Ala Arg Glin Val His Ile Glin Ile Asn. Asn Llys Thr Arg His 1. 5 1O 15

<210s, SEQ ID NO 24 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide

<4 OOs, SEQUENCE: 24 t cacaaaaat atatgaacag c 21

<210s, SEQ ID NO 25 &211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide

<4 OOs, SEQUENCE: 25 atatictatag aatticgcaat t cqtc catgt g 31 US 7,772,369 B2 139 140

- Continued

<210s, SEQ ID NO 26 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide

<4 OOs, SEQUENCE: 26 cagtatt cat ataagcttico toctittaata 3 O

<210s, SEQ ID NO 27 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide

<4 OOs, SEQUENCE: 27 aaggtgaagc titt tatgtta gatactaata aagtt tatg 39

<210s, SEQ ID NO 28 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide

<4 OOs, SEQUENCE: 28 ccggaataga agctttgcat atgg 24

<210s, SEQ ID NO 29 &211s LENGTH: 11 212. TYPE: PRT <213> ORGANISM: Bacillus thuringiensis

<4 OOs, SEQUENCE: 29 Met Asin Val Asn His Gly Met Ser Cys Gly Cys 1. 5 1O

<210s, SEQ ID NO 3 O &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (22) ... (22) 223 OTHER INFORMATION: W = A or T 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (23) . . (23) 223 OTHER INFORMATION: S = G or C 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (24) . . (24) <223> OTHER INFORMATION: N = A, C G or T

<4 OOs, SEQUENCE: 30 atgaatgtaa at catgggat gWSntgt 27

<210s, SEQ ID NO 31 &211s LENGTH: 12 212. TYPE : RNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide US 7,772,369 B2 142

- Continued <4 OOs, SEQUENCE: 31 ulaaacaaugg cul 12

<210s, SEQ ID NO 32 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic Oligonucleotide

<4 OOs, SEQUENCE: 32 gtaccagaag taggagg 17

SEQ ID NO 33 LENGTH: 17 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Oligonucleotide

<4 OOs, SEQUENCE: 33 tgacacagct atggagc 17

SEQ ID NO 34 LENGTH: 2O TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Oligonucleotide

<4 OOs, SEQUENCE: 34 atgattgc.cg gaatagaa.gc

SEO ID NO 35 LENGTH: 12 TYPE : RNA ORGANISM: plants

<4 OOs, SEQUENCE: 35 ulaaacaaugg cul 12

What is claimed is: 45 6. The composition of claim 5, wherein said composition 1. An isolated polypeptide comprising SEQID NO:4. comprises three or more polypeptides, and one of the 2. A polypeptide prepared by a process comprising the polypeptides is SEQID NO:4. steps of: 7. The composition of claim 4, comprising a cell extract, (a) culturing cells of Bacillus thuringiensis strain EG4851, cell Suspension, cell homogenate, cell lysate, cell Superna a representative sample of which has been deposited 50 tant, cell filtrate, or cell pellet of cells of Bacillus thuringien under NRRL Accession No. B-21915, or B. thuringien sis strain EG4851, a representative sample of which has been sis strain EG1 1658, a representative sample of which deposited under NRRL Accession No. B-21915, or B. thur has been deposited under NRRL Accession No.B- ingiensis strain EG1 1658, a representative sample of which 21916, under conditions effective to produce a polypep has been deposited under NRRL Accession No. B-21916. tide comprising the amino acid sequence of SEQ ID 55 8. The composition of claim 7, wherein said composition is NO:4; and a powder, dust, pellet, granule, spray, emulsion, colloid, or (b) obtaining from said cells the polypeptide so produced. Solution. 3. The polypeptide of claim 2, wherein said polypeptide is 9. The composition of claim 7, wherein said composition is SEQID NO:4. prepared by desiccation, lyophilization, homogenization, 4. A composition containing at least one polypeptide, 60 extraction, filtration, centrifugation, sedimentation, or con wherein said polypeptide comprises SEQID NO:4. centration of a culture of Bacillus thuringiensis cells. 5. The composition of claim 4, wherein said composition 10. The composition of claim 4, comprising from about 1% comprises two or more polypeptides, and one of the polypep to about 99% by weight of said polypeptide. tides is SEQID NO:4. k k k k k