Ventral Hindgut and Bladder Development

Wei CHENG

A thesis submitted in conformity with the requirements

For the degree of PhD

Graduate Department of Institute of Medical Science

University of Toronto

395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A0N4 Canada Canada

Your file Votre reference ISBN: 978-0-494-40009-8 Our file Notre reference ISBN: 978-0-494-40009-8

NOTICE: AVIS: The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library permettant a la Bibliotheque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Plntemet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans loan, distribute and sell theses le monde, a des fins commerciales ou autres, worldwide, for commercial or non sur support microforme, papier, electronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in et des droits moraux qui protege cette these. this thesis. Neither the thesis Ni la these ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent etre imprimes ou autrement may be printed or otherwise reproduits sans son autorisation. reproduced without the author's permission.

In compliance with the Canadian Conformement a la loi canadienne Privacy Act some supporting sur la protection de la vie privee, forms may have been removed quelques formulaires secondaires from this thesis. ont ete enleves de cette these.

While these forms may be included Bien que ces formulaires in the document page count, aient inclus dans la pagination, their removal does not represent il n'y aura aucun contenu manquant. any loss of content from the thesis. Canada Thesis Abstract

VENTRAL HINDGUT AND BLADDER DEVELOPMENT

Wei CHENG

Doctor of Philosophy

Institute of Medical Science

University of Toronto

2008

Developmental anomalies of the bladder pose a great challenge to pediatric urologists. Yet the mechanisms regulating the developmental biology of the bladder remain poorly understood. Bladder development involves epithelial-mesenchymal interaction. p63 is expressed in all stratified epithelia including the bladder urothelium. We have established that the N-terminal truncated isoform of p63, ANp63, is preferentially expressed in the ventral bladder urothelium during early organogenesis. p63~A embryos developed ventral midline defects affecting the ventral bladder and abdominal walls, reminiscent of bladder exstrophy, a congenital anomaly exhibited in human neonates. The p63 deficient ventral urothelium was neither stratified nor differentiated. It had significantly increased apoptotic activity and reduced cell proliferation. This is accompanied by failure to induce mesenchyme. Over-expression of ANp63 in p63'A bladder primary cell cultures rescued the apoptosis. We conclude that ANp63 plays a crucial anti-apoptotic role during bladder development. The absence of ANp63 leads to ventral urothelial apoptosis, failure of mesenchymal development and bladder exstrophy.

ii Shh is a candidate epithelial signal in the bladder epithelial mesenchymal interaction. The

mechanism by which Shh regulates bladder development remains unclear. In the wild-type

developing bladders, Shh was expressed in the epithelium whereas its transcriptional factor

GH2 and its target gene Bmp4 were expressed in the inner mesenchymal zone, which also

contained more proliferating cells. In the outer mesenchymal zone, where GH2 and Bmp4

expressions were not detectable, smooth muscle a-actin expression was detected. In GH2~/~

embryo bladders, normal Bmp4 expression in the inner zone was lost. The normal radial pattern of inner zone of cell proliferation and outer zone of smooth muscle differentiation was replaced by disorganized cell proliferation and ectopic smooth muscle in the inner zone.

Using primary murine bladder mesenchymal cell cultures, we demonstrated that transfection

with ANGH2 adenoviruses up-regulated Bmp4 expression and addition of Bmp4 protein

(lOmg/ml) repressed smooth muscle differentiation. We conclude that Shh transcriptional

factor GH2 regulates the bladder mesenchymal patterning.

iii Acknowledgements

This work would not have been possible without the opportunity to conduct basic science research afforded me by my supervisors, Dr. Peter C.W. Kim and Dr. Chi-Chung Hui. I thank them for their patience and guidance. Although I carried out most of the experimental work presented here, I benefited greatly from the technical assistance and friendship of my colleagues in Dr. Kim's laboratory, namely, Dr. Jennifer Jian-Rong Zhang, Dr. Guo-Dong

Liu, Ms. Michelle Kushida, Dr. Anne Moro, Ms. Jin-hyung Park. My colleagues in Dr.

Hui's laboratory also deserve mention for their advice and technical instruction; Dr.

Pleasantine Mill, Dr. Erica Nuiwenhuis, and Dr. Rong Mo. In addition, I am most grateful to

Dr. Wei Qiu of the Research Institute, Hospital for Sick Children, for his technical support to the key experiment.

I very much enjoyed my collaboration with Dr. W. Bradley Jacobs, Dr. Freda Miller and Dr.

Alea Mills on the study of p63v~ mutant mice, and am grateful to both Professor Jacob

Langer, Department of Surgery, and Dr. Neil Sweezey, Clinician Scientist Program

Coordinator, Hospital for Sick Children, for their advice and encouragement. Invaluable financial support was received from the Division of General Surgery, Department of Surgery,

Research Trainee Competition Fund of the Institute of Research, and a Clinician Scientist

Scholarship from the Hospital for Sick Children, Toronto.

Finally, my loving wife, Karin Moorhouse deserves special mention. I thank her for unwavering support throughout my studies, for sharing the ups and downs, and above all for making her own career sacrifices which enabled me to realize my dream.

IV Table of Contents

Chapter 1 Introduction 1 A clinical problem 2 Bladder Structure and embryology 2 Bladder structure 3 Endoderm, gut, and bladder embryology 4 Gut, Hindgut and Bladder Developmental biology 6 Endodermal genes 6 Hindgut genes 7 Mesenchymal-epithelial interaction in gut and bladder 8 Epithelial signal in bladder development 9 p63 regulates the development of stratified epithelium 10 Sonic hedgehog (Shh) as a urothelial signal 17 Mesenchymal development 22 Bone morphogenetic protein-4 (Bmp4) in mesenchyme development 22 Bladder mesenchymal cells differentiate into smooth muscle cells 25 Working Model 27 Chapter 2 Hypothesis 28 Hypothesis 1 29 Questions 29 Hypothesis 1 29 Test of the hypothesis 29 Hypothesis 2 31 Questions 31 Hypothesis 2 32 Test of the hypothesis 32 Chapter 3 ANp63 plays an anti-apoptotic role in ventral bladder development33 Abstract 34 Introduction 35

v Materials and Methods 37 p63~/~ mutant mice genotyping 37 Histochemistry and immunohistochemistry 38 RNA extraction, qPCR, and RT-PCR 39 Immunoblot 40 Organ culture, primary cell culture, and transfection 41 In-situ hybridization 42 Results 43 P63 deficiency leads to bladder exstrophy 43 p63 is expressed in bladder epithelium throughout its development and the ANp63 is the predominant isoform 45 p63 expression is ventrally restricted during early bladder development 47 p63-deficient bladder epithelium is abnormal along the dorso-ventral axis 48 Apoptosis is increased in p63-deficient bladder epithelium 52 ANp63 is anti-apoptotic during bladder development 55 Apoptosis of bladder cells of El 2.5 p63~/' mutants is associated with an upregulation of p53 and p73 expressions 57 Failure of ventral UGS mesenchymal induction and proliferation in the absence of epithelial ANp63 57 Smooth muscle differentiation is disturbed in p63-deficient bladders 61 Discussion 63 Early ventral p63 expression and ventral midline defects in p63"A mutants 63 Temporospatial restriction of p63 expression determines epithelial commitment to stratification and differentiation 65 ANp63 is prosurvival in ventral bladder development 66 Chapter 4 Shh transcriptional factor GU2 regulates bladder mesenchymal patterning69 Abstract 70 Introduction 71 Methods 74 Mutation Analysis 74 Primary cell cultures and transfection 74

VI Immunoblot 75 Immunohistochemistry and TUNEL 76 RNA extraction and the real time PCR 76 In-situ hybridization 77 Results 77 Shh signaling is active in bladder development 77 GH2 promotes cell proliferation in the inner mesenchymal zone 79 GH2 represses smooth muscle differentiation in the bladder 82 GU2 up-regulates Bmp4 expression in the sub-epithelial bladder mesenchyme 84 Bmp4 Represses Bladder Smooth Muscle Differentiation 85 Epithelial mesenchymal interaction 87 Discussion 88 Shh transcriptional factor GH2 regulates the radial patterning of the bladder mesenchyme 89 GU2 regulates the smooth muscle differentiation via its action on Bmp4 91 Working Model 93 Chapter 5 Conclusions and future directions 95 Conclusions 96 p63 is anti-apoptotic in ventral bladder development 96 Shh transcriptional factor GH2 regulates the patterning of a developing bladder 96 Future Directions 97 Is early p63 expression a marker for epithelial organizer during morphogenesis? 97 p63 screening in bladder exstrophy patients 98 Regulation of p63 expression 99 Shh-Bmp4-Hox regulation of hindgut 102 Radial polarity and hollow organ development 103 Cancer and the bladder developmental genes 104 Hypothetical model of bladder development 105 References 107

vii Table of Figures Figure 1-1. Bladder structure 3 Figure 1-2. Bladder histology (new born mouse bladder) 4 Figure 1-3. The sagittal representation of the cloaca being partitioned into the urogenital sinus and anorectal canal. A: The El 1.5 embryo before the partition. B: The E13.5 embryo after the partition. The four parts of urogenital sinus: 1: urachus (fibrous at El3.5), 2: urinary bladder, 3: membranous urethra and 4: phallic urethra 6 Figure 1-4. Simplified hierarchy of signaling pathway for vertebrate endoderm development. 7 Figure 1-5. E14 wild-type andp63~A embryos 11 Figure 1-6. The general protein structure of p53 family proteins 13 Figure 1-7. Apoptosis cascade in mammals 16 Figure 1-8. Hedgehog signaling. A) In the absence of Hh, Ci is cleaved. The N-terminus of Ci translocates into nucleus and inhibits the target genes. B) In the presence of Hh, the multi-protein complex is dissociated from microtubules and the un-cleaved Ci translocates into the nucleus and activates Hh target genes. Fu: Fused, Su(fu): Suppressor of Fused. Cos2: Costal 20 Figure 1-9. The diagrammatic summary of the current understanding of epithelial- mesenchymal interaction and smooth muscle differentiation in bladder 27 Figure 3-1. Bladder exstrophy (BE) in human mdp63 "A mice. A: BE with separation of pubic bones and genitalia in a female. B: Covered BE in a male. C: The wild-type E18.5 embryo (lOx). D: BE in an E18.5p63 ''' embryo (lOx). E-F: Hematoxylin and eosin staining of sagittal sections of wild-type andp63~A E18.5 embryos (40x). White arrow: umbilical hernia. G-H: Hematoxylin and eosin staining of transverse sections of E18.5 wild-type and p63~'~ embryo pelvises (40x). (photo A and B: Courtesy of Dr. J.L. Salle, Hospital for Sick Children, Toront).... 44 Figure 3-2. Ontogeny of p63 on sagittal sections of wild-type embryos (Fluorescent immunohistochemistry, lOOx). Sagittal sections of El 1.5 embryos transect the epithelium tangentially at the distal UGS, accounting for the wider expression pattern at the distal urogenital sinus (A and E). A-D: p63 (4A4) expression. E-H: ANp63 isoform expression. I -L: TAp63 isoform expression. Blood cells within the mesenchyme are

viii autofluorescent. M: RT-PCR of wild-type El 5.5 bladder, using adenoviruses with ANp63, TAp63, p63a, p63$, andp63y constructs as controls. Arrows in A-J and M represent immuno-reactivity and RT-PCR bands in wild-type bladder samples, b: wild- type bladder cDNA. v: adenoviruses containing AN, TA, a, p, and yp63 constructs.. 47 Figure 3-3.p63 (4A4) expressions in El 1.5 and E14.5 wild-type embryos. A:p63 immunofluorescent staining of a sagittal section of an El 1.5 embryo (20x). B:p63 immunofluorescent staining of transverse sections of an El 1.5 embryo pelvis (40x).(B) C: p63 immunofluorescent staining of an El 1.5 UGS (200x). Arrows in A-C represent the ventral aspects of the specimens. D: Colorimetric immunostaining of a transverse section from an El 4.5 embryo (20x). High-magnification view of ventral (E) and dorsal (F) skin of the E14.5 embryo (600x) 48 Figure 3-4. Sagittal sections of El 8.5 wild-type and p63'A bladders showing the ventral and dorsal epithelia. A-D: Hematoxylin and eosin staining (600x). E-H: Immunofluorescent staining of cytokeratin 18 (K18) (400x, confocal microscopy). I-L: Immunofluorescent staining of uroplakin III (630x, confocal microscopy). (A,C,E,G,I,K) Wild type. (B,D,F,H,J,L) p63~A . Arrows represent the epithelia 51 Figure 3-5. The intestinal epithelial markers in El 8.5 wild-type andp63 "'" bladders. A-B: Immunohistochemical staining of the intestine marker, villin (40x). C-D: Periodic acid- Schiff reaction for large intestine mucin (40x). E-F: Alkaline phosphatase staining for small bowel epithelium 51 Figure 3-6. A-B: Hematoxylin and eosin staining of the sagittal sections of El 1.5 wild-type and p63~/~ embryos. C-D: Fluorescent TUNEL staining (arrows) of wild-type and p63'A UGS (200x). The DAPI staining of nuclei is shown in red to increase color contrast. E- F: The colorimetric immunostaining (arrows) for cleaved caspase-3 in El 1.5 wild-type andp63'A UGS (200x). HG: hindgut (200x). G-H: Fluorescent TUNEL staining (arrow) of sagittal sections through the oral cavity of El 1.5 wild-type and p63'A embryos. I-J: The qPCR relative expressions of Box and Apqfl in E12.5 and E13.5 p63 ~A bladders. (A,C,E,G) Wild type. (B,D,F,H)/>&T\ HG, hindgut 54 Figure 3-7. The El3.5 p63'A bladder primary cell cultures were transfected with adenoviruses expressing green fluorescent protein (GFP), TAp63y, ANp63B and ANp63y. The tensiometry of Box, Apqfl, and (3-actin bands was recorded. The ratios of

ix J3ax/p-actin and ApaflVp-actin of the specimens were compared to that of the GFP- infected controls (assigned to be 100). The relative Bajc/p-actin ratios and Apafl/fi-actin ratios are shown in A and B, respectively (Student's t-test, *: p<0.05, ** : p<0.01). C-D: Immunohistochemical staining of p53 in El 1.5 wild-type andp63'A UGS (200x). Arrows represent the ventral aspects of the UGS. E-F: Immunohistochemical staining of p73 in El 1.5 wild-type andp63'A UGS (lOOx). G-H show the qPCR relative expressions ofp53 and/?73 in E12.5 and E13.5 wild-type (WT) andp63'A bladders... 56 Figure 3-8. Epithelial-mesenchymal interactions. A-B: Msx-1 expressions (immnohistochemistry) in transverse sections of El4.5 wild-type and p63'A bladders (lOOx). C-D: Fgf-8 in-situ hybridization in the sagittal sections of El 1.5 wild-type and p63'A UGS (lOOx). E-F: m-snctil in-situ hybridization of E14.5 wild-type andp63~/~ bladders (sagittal sections) (lOOx). G- H: BrdU incorporation in the sagittal sections of wild-type and p63-/- El 1.5 UGS (lOOx). Arrows represent the ventral aspects of the bladders. I: Histogram of cell proliferation in both epithelium and mesenchyme of El 1.5 wild-type andp53"A UGSs 60 Figure 3-9. Smooth muscle development of bladders. A-B: Smooth muscle heavy chain myosin expressions in the transverse sections of the E14.5 wild-type andp63"A bladders. The intestinal muscular wall serves as an internal control (arrow, lOOx). C-D: Smooth muscle a-actin actin expressions in the sagittal section of El 8.5 wild-type andp63'/" bladders (40x). Larger arrow in C,D represent the ventral bladder wall. Small arrow in D represents dorsal bladder wall. E-F: Hematoxylin and eosin staining of El 8.5 wild- type andp63~A bladders (sagittal sections, 200x) 62 Figure 3-10. In situ-hybridization of Shh in El 1.5 wild-type (A) andp63'A (B) UGS. The arrows represent the ventral aspects of UGS ( n=3) 63 Figure 4-1. Shh signaling pathway gene expressions in sagittal sections of El 2.5 wild-type embryos (200x). A: Hematoxylin and eosin staining showing the structure of ventral urogenital sinus (UGS) and dorsal hindgut (HG). B-F: In-situ hybridization studies of the UGSs. The white arrows represent the expressions of the genes of interest in the developing bladders 78 Figure 4-2. Hematoxylin and eosin staining of the sagittal sections of wild-type and mutant murine bladders. A, C, E and G are the gestational stage-matched wild-type controls. B,

x D, F and H are the E16.5 ShK1', E17.5 GUT^, E18.5 G//2"A;G/?5+/', and E13.5 Gli?'- ;GH3~' mutant bladders respectively. The arrows represent the bladder lumens 79 Figure 4-3. The real time PCR relative expression of cyclin Dl in El3.5 wild-type and GH2~ '' bladders. A: the cyclin Dl expressions in wild-type and GUI''' bladders. B: The relative expressions of cyclin Dl in El 3.5 bladder mesenchymal primary cells cultured for 36 hours with adenoviruses expressing green fluorescent protein (GFP) alone and bicistronic adenovirus expressing both GFP and ANGH2 80 Figure 4-4. PCNA immunostaining of the murine embryonic bladders. A and B: Low magnification of El 3.5 bladders (xlOO). The rectangles represent the inner and outer inner mesenchymal zones magnified in C-F. High magnifications: C and E (x 600), E and F (x 400) of the inner and outer zones of the A and B respectively. G: E14.5 wild- type bladder 82 Figure 4-5. The SM a-actin immunohistochemistry (brown) of sagittal sections of the wild type and Gli2'A bladders. A-B: 200 x, C-F: lOOx, G-H: 400x. The rectangles in E-F represent the areas enlarged in G-H. The white arrows represent ectopic smooth muscle a-actin expression in the lamina propria of the GH2~/~ bladders 83 Figure 4-6. The Bmp4 expressions in wild-type and Gli2'A murine bladders. A and B: Bmp4 expressions (in-situ hybridization) in wild-type and GU2'A El2.5 bladders. The arrows represent the inner mesenchymal zone of the developing bladders where Bmp4 is normally expressed. C: The real time PCR relative expression of Bmp4 in the wild-type and GH2~/~ E13.5 bladders. D: The qPCR relative expression of Bmp4 in E13.5 GH2~/' mesenchymal cell cultures transfected with adenoviruses expressing GFP and AN GU2 respectively 85 Figure 4-7. SM a-actin immunoblots of the primary mesenchymal cell cultures of El 5.5 murine bladders. A: The biphasic effect of Bmp4 dosage on smooth muscle a-actin expressions. B and C: The SM a-actin expressions in cells cultured with Bmp4 (lOng/ml), plus or minus Noggin 86 Figure 4-8. Epithelial markers, alkaline phosphatase, PAS, uroplakin and p63 in wild-type, Shh'A;Gli2-A and G/?TA bladders (E17.5) 88

XI Figure 5-1. p63 immunohistochemistry of a horizontal section of El 1.5 wild-type embryo across the level of cloaca and hind limb buds. The arrows point to the p63 expressions at the apical ectodermal ridge (AER) of the hind limbs 98 Figure 5-2. A: The cloacal epithelial p63 expression in chick embryos transfected with GFP (a and b) and ANGH2 (c and d) (Liu et al., 2007). B: The immunoblots of p63 in cloaca transfected with GFP and ANGH2 respectively 101 Figure 5-3. Hoxa-13, Hoxd-13 and Hoxd-12 expressions (in-situ hybridization) in E12.5 wild-type and GH2'/" urogenital sinuses 103 Figure 5-4. The smooth muscle a-actin expressions (immunohistochemistry) in El 7.5 wild- type (A) and GU2~/~ (B) rectal walls (x400). The double-headed arrows represent the thickness of muscular layers. The single-headed arrow represents ectopic smooth muscle in the sub-mucosal layer, just beneath the mucosal basement membrane 104 Figure 5-5. A hypothetical model of ventral mammalian bladder development 106

xii List of abbreviations Abbreviation Full name AER apical ectodermal ridge BE bladder exstrophy Bmp4 Bone morphogenetic protein 4 BrdU 5-bromo-2-deoxyuridine incorporation study Ci cubitus interruptus Cos2 Costal 2 Dhh Desert hedgehog dpp decapentaplegic FBS fresh bovine serum Fgf fibroblast growth factor Fu fused GFP green fluorescent protein H&E hematoxylin and eosin Hh Hedgehog HSC Hedgehog signaling complex Ihh Indian hedgehog PAS periodic acid-Schiff reaction PCR polymerase chain reaction Ptc Patched qPCR quantitative PCR RT-PCR reverse transcription PCR Shh Sonic hedgehog SM smooth muscle Smo Smoothened Su(fu) suppressor of fused TGF transforming growth factor TUNEL Terminal deoxynucleotidyl Transferase Biotin-dUTP Nick End Labeling UGS urogenital sinus

xiii Chapter 1 Introduction

1 A clinical problem

Urinary bladder is the largest smooth muscle organ and the most distensible organ in the

human body. The bladder serves to collect, store and pass urine in a highly coordinated

fashion. Most of the lower animals, such as birds, amphibians, reptiles and chondrichthyan

fish do not have bladders. The function of urine storage is served by the cloaca, which

collects effluents from both the digestive and urinary tracts. Placental mammals have

bladders. It is developed from the ventral cloaca.

Congenital urological abnormalities such as bladder exstrophy present a major challenge in pediatric urological practice. Bladder smooth muscle hypertrophy also poses a serious

clinical challenge in conditions such as bladder outlet obstruction and neurogenic bladders.

Currently, the genetic and molecular events regulating mammalian bladder development

and smooth muscle differentiation are still unclear. Therefore, research in bladder

developmental biology will not only demonstrate the principles of hollow organ

organogenesis, it will also have wide clinical implications.

Bladder Structure and embryology

The spherical form of a full bladder provides the most efficient shape for fluid storage. The

epithelium of the bladder serves as a waterproof lining. The smooth muscle layers, with

fibers running perpendicular to one another, are capable of mass contraction, emptying the bladder in a most efficient fashion. This suggests that, a stringent genetic and molecular mechanism is required to regulate the development of these functional structures.

2 Bladder structure

Anatomically, the bladder consists of a dome or fundus and a relatively immobile base. The ureters, carrying urine from each kidney, enter the bladder dorso-laterally at the ureteric orifices on each side. The urine exits the bladder through the urethra which is controlled by a sphincter. The area between the ureteric orifices and the urethra forms the trigone which is incorporated into the bladder from ureters during organogenesis (Last, 1984) (Figure 1-1).

Figure 1-1. Bladder structure.

Histologically, the bladder cavity is lined with stratified transitional epithelium, the urothelium. The basal layer of the urothelium expresses p63 (Yang et al., 1999), a marker for stem/progenitor cells in the stratified epithelium (Figure 1-2). The most superficial layer contains water-proof umbrella cells which express uroplakin; a marker for the terminally differentiated urothelium (Yu et al., 1990) (Figure 1-2). The bladder urothelium contains no

3 gland and is mostly of endodermal origin, except for the trigone area which is of mesodermal origin. Underneath the epithelium is a layer of connective tissue fibroblasts: the lamina propria. The lamina propria is covered by smooth-muscle, the detrusor muscle, which is organized in layers (inner longitudinal, middle transverse and outer longitudinal layers) with fibers of each layer arranged in different directions. Unlike the gut which is capable of peristalsis, the detrusor muscle is tailored for mass contraction, resulting in the bladder emptying. The outermost layer of bladder is the serosa (adventicial layer).

Figure 1-2. Bladder histology (new born mouse bladder).

Endoderm, gut, and bladder embryology

The embryological development of the bladder is closely intertwined with that of the hindgut. During murine embryo gastrulation (E7.5), the embryo is stratified into three

4 layers: the ectoderm, the mesoderm and the endoderm. The gut tube develops mostly as a result of folding and tabularization (formation of a tube from a sheet of tissue) of the endodermal layer. The folding begins at the anterior (anterior intestinal portal, AIP) and posterior (caudal intestinal portal, CIP) ends. The last segment of endoderm fuses at the level of the future umbilicus. Along the anterior-posterior axis, the gut develops into:

1. the foregut (pharynx, esophagus and stomach),

2. the midgut (small intestine) and

3. the hindgut (colon, rectum and bladder) (Moore and Persaud, 2003).

Each of the three germ layers contribute to the formation of the gut; the endoderm to the epithelium, the mesoderm to smooth muscle and ectoderm to the enteric nervous system as well as the most anterior and posterior parts of the gut (oral and anal lumina) respectively.

Along the radial axis, the gut assumes a general plan of the epithelium, sub-mucosal

(lamina propria), smooth muscle layers and the outmost serosa (Dudek and Fix, 1998).

During embryogenesis, allantois from the body stalk and hindgut converge into a cavity, the cloaca, at the posterior end of the embryo. The bladder is developed from the ventral part of the cloaca. Between the 4th and 7th week of development (El 2 in mice), the urorectal septum partitions the cloaca into the urogenital sinus ventrally and anorectal canal dorsally

(Arey, 1965) (Figure 1-3 A). The urogenital sinus is subdivided into four parts (Figure 1-3

B) (Parrott et al., 1994):

1. The most cranial part, the urachus, is continuous with the allantois stalk. It is later

obliterated and becomes a thick fibrous cord: the median umbilical ligament.

2. The part where the ureters join the urogenital sinus becomes the urinary bladder.

5 3. The pelvic part of the urogenital sinus gives rise to the prostate and membranous

urethra.

4. The distal part becomes the phallic urethra.

Figure 1-3. The sagittal representation of the cloaca being partitioned into the urogenital sinus and anorectal canal. A: The E11.5 embryo before the partition. B: The E13.5 embryo after the partition.

The four parts of urogenital sinus: 1: urachus (fibrous at E13.5), 2: urinary bladder, 3: membranous urethra and 4: phallic urethra.

While the embryological process of bladder development is well-described, the molecular regulation of the development is poorly understood.

Gut, Hindgut and Bladder Developmental biology

A conserved cassette of genes is required for the hindgut and bladder development.

Endodermal genes

Endoderm constitutes most of the gastrointestinal epithelium. T-box transcriptional factor family is characterized by a DNA-binding domain of approximately 200 amino acid

(Smith, 1999). In Xenopus, the T-box gene, VegT, is normally expressed in the endoderm.

6 If VegT is ectopically expressed in animal cap explants, it induces endoderm formation

(Horb and Thomsen, 1997). Furthermore, specification of the endoderm by VegT requires

TGFfi (transforming growth factor P) signaling (Chang and Hemmati-Brivanlou, 2000). In

FegT-depleted embryos, Mixer, acting alone or in combination withXGATA5, restores the expression of the endodermal genes. On the other hand GATA5 is expressed in the endoderm in response to TGFp and VegT ligands (Yasuo and Lemaire, 1999).

Sox genes belong to the family of high-mobility group (HMG) transcription factors. At least 5 different Sox genes are expressed in the gut endoderm. Sox 17 ~'~ embryos are deficient in endoderm (Kanai-Azuma et al., 2002). Conversely, ectopic expression of

Casanova, a transcription factor upstream to Sox 17, in presumptive mesoderm leads to transfating mesoderm into the endoderm (Kikuchi et al., 2001), suggesting the crucial role of Sox genes in endoderm specification (Figure 1-4). In summary, a cascade of T-box,

TGFp, GAT A & Mixer, and Sox 17 regulates the formation of the endoderm (Shivdasani,

2002).

T-box -> TGFfi -> GATA& Mixer -> Sox 17

Figure 1-4. Simplified hierarchy of signaling pathway for vertebrate endoderm development.

Hindgut genes

A set of genes is involved in the patterning and maintenance of the hindgut in Drosophila and these genes are well conserved in mammals. They include i) caudal/Cdx, ii) brachyenteron/Brachyury (T-box), iii) fork head/HNF-3, and iv) wingless/Wnt (Lengyel and Iwaki, 2002). In mice, both Cdxl and Cdx 2 are expressed in the hindgut (Silberg et al.,

2000). Cdx2'A mutant mice develop colon polyps (Chawengsaksophak et al., 1997). Mice

7 with heterozygous Brachyury mutation have short tails, whereas homozygous Brachyury mutation leads to severe axial shortening and absence of allantois (Stott et al., 1993).

HNF-3B is involved in initiation of the endoderm lineage in mice (Ang and Rossant, 1994).

Wnt5a and Wnt 7b are expressed in the hindguts of chicks (McBride et al., 2003). In humans, mutation in the Wnt signaling pathway has been implicated in colon cancer

(Taipale and Beachy, 2001).

Mesenchymal-epithelial interaction in gut and bladder

Mesenchymal-epithelial interactions are crucial during gut development. Endoderm differentiation depends on soluble factors from the adjacent mesoderm (Wells and Melton,

2000). The ileal mesenchyme is capable of inducing small intestinal-type enzymatic epithelial differentiation in the colonic endoderm (Kedinger et al., 1998). The mechanism is thought to involve the basement membrane laminin (Kedinger et al., 1988) and Cdx-2 gene which binds the promoters of various enterocyte differentiation genes (Kedinger et al.,

1998). It may also involve retinoic acid, which is capable of inducing the precocious formation of villi and expression of lactase in El 4 fetal gut epithelium (Plateroti et al.,

1997). Interestingly, ingestion of retinoic acid during mid-gestational period also induces anorectal malformation in mice and caudal regression in chick embryos (Griffith and Wiley,

1991; Hirai and Kuwabara, 1990; Yu et al., 2003).

Epithelial-mesenchymal interaction also plays a role in bladder development. In an El4.5 rat embryo bladder epithelium/mesenchyme recombination and transplant study, while recombination of the epithelium and mesenchyme induces smooth muscle formation in the bladder mesenchyme, in the absence of the epithelium, the bladder mesenchyme does not

8 develop into smooth muscle (Baskin et al., 1996a; Baskin et al., 1997). This suggests that an epithelial-derived stimulus is required for bladder mesenchyme differentiation.

Furthermore, it has been demonstrated that a diffusible urothelial substance is capable of inducing smooth muscle differentiation in the bladder mesenchyme culture (Liu et al.,

2000). In summary, bladder mesenchymal development requires a diffusible signal from the bladder epithelium.

Summary 1: • Bladder consists of Inner urothellum and outer smooth muscle layers • Eplthellal-mesenchymal Interaction Is crucial to bladder development • Without epithelial signal to mesenchyme, bladder smooth muscle does not develop

Epithelial signal in bladder development

The nature of the bladder epithelial signal is unclear. Both TGFfi2 and TGFfi3 are expressed in the bladder epithelium. Their expressions are high in early, and low in late, bladder organogenesis. This has led some to surmise that TGF02 and TGFPs may be the epithelial signals inducing smooth muscle differentiation (Baskin et al., 1996d). However, no direct evidence is available to demonstrate that they induce smooth muscle differentiation. Two candidate bladder epithelial genes are considered in this research: p63 and Sonic hedgehog

(Shh). They are both expressed in the epithelium during early bladder organogenesis, yet they serve different functions. p63 is instrumental to epithelial stratification whereas the

Shh is a diffusible morphogen secreted by the epithelium.

9 p63 regulates the development of stratified epithelium

p63 is expressed in the urothelium

p63 is a member of the p53 family which consists of p53, p63 andp73.p63 is expressed in

all stratified epithelia. p63 expression is found in the epithelia of both ectodermal (skin)

and endodermal (esophagus and bladder) origins (Mills et al., 1999; Yang et al., 1997).

The non-stratified epithelia, such as those of small and large bowels, do not express p63.

p63 in development

All members of the p53 family are involved in development. p53"/_ embryos from certain

genetic backgrounds exhibit overgrowth of midbrain neuronal tissue, culminating in

exencephaly (Sah et al., 1995). p73 is highly expressed in the developing central and

sympathetic nerve system (Pozniak et al., 2000). p73'A mice develop hydrocephaly,

hippocampal dysgenesis, chronic rhinitis and otitis (Yang et al., 1997) and have an

increased mortality rate, mostly secondary to massive gastro-intestinal hemorrhage. Male p73"A adult mice also have reduced fertility.

p63 ~'~ embryos develop a plethora of anomalies including truncated limbs, truncated

maxilla and mandible, stunted tails and non-stratified skin with no skin appendages (Mills

et al., 1999; Yang et al., 1997) (Figure 1-5). The mammary glands, salivary glands, prostate

glands (Signoretti et al., 2005), hair follicles, and teeth (Laurikkala et al., 2006), are also

absent. p63'A mice die perinatally, probably as a result of water loss due to an absence of

skin . The failure of limb development in p63'f~ embryo has been attributed to the failure of

10 apical ectodermal ridge (AER) development (Mills et al., 1999). Whetherp63 mutations affect bladder urothelial development and organogenesis in a similar fashion is not known.

Wild-type p63-/-

limb

bifid genitalia

maxilla defect

Figure 1-5. E14 wild-type and p63" embryos.

Tumor suppression and apoptosis

The founding member of the family, p53, is a well-studied tumor repressor gene. p53 is expressed at a very low level in many tissues after early embryogenesis. With DNA damage, thep53 level increases and transactivates/>2i""^. p21 then mediates cell cycle arrest by inhibiting cyclin-dependent kinase (CDK) at the Gl/S checkpoint of the cell cycle

(el-Deiry et al., 1993). With unmitigated DNA damage, p53 induces apoptosis by

11 transactivating Bax and Puma (Miyashita and Reed, 1995). Both cell-cycle arrest and apoptosis contribute to tumor suppression. p53'A mice exhibit a high rate of spontaneous tumor formation by 6 months of age (Donehower et al., 1992). p53 mutation is found in

50% of all human malignancies (Nigro et al., 1989). The p53v~ phenotype is similar to those of Apaf-V', Caspase-9"' and Caspase-3'" mutants, suggesting that p53 possibly triggers the mitochondrial apoptotic cascade. Both p63 and p73 transactivate p53 target genes, such as Bax. Although p63~f~ andp73~A do not appear to have higher risk of cancer development, p63+/';p 73+/~ compound mutants do display an increased risk of spontaneous tumors (Flores et al., 2005).

Protein structure ofp53 family genes

The/?55 family genes contain two separate promoters, PI and P2, (Bourdon et al., 2005;

Scrable et al., 2005; Yang et al., 1997) generating two classes of proteins with different functions:

a) The full-length isoforms containing an acidic N-terminal transactivation domain

(TA) or the TA isoform, and

b) The N-terminally truncated form, the AN isoform, without the TA domain.

All p53 family proteins contain a DNA binding domain for interacting with DNA and an oligomerization domain through which the isoforms are capable of complex formation.

Alternative splicing of the C-terminus of p63 gene generates three isoforms, a, P and y. In combination with the two promoters, at least six p63 can be generated (Little and

Jochemsen, 2002). The C-terminus of p63a contains a sterile a motif (SAM) which exerts intra-molecular inhibition on the TA domain. Hence, TAp63a has little transactivating function (Yang et al., 1998). The SAM in the p63 pathway is thought to be homologous to

12 mdm2 in the down-regulation of p53 (Serber et al., 2002). Likewise, six p73 C-terminal isoforms have been identified (a, p, y, 8, s, Q (Grob et al., 2001) (Figure 1-6). p53 does not have a C-terminus with these variations.

TAor DNA binding OHgomerization C-terminus AN domain domain

Figure 1-6. The general protein structure of p53 family proteins.

TAp63 is pro-apoptotic

The transactivation (TA) domain of p63 (and p73) shares 25% homology with that of p53.

Functionally, TAp63y behaves like full-length p53 and is capable of transactivatingp5J target genes such asp21WAF in Saos-2 cells (human osteosarcoma cells) and inducing apoptosis in BHK (baby hamster kidney) cells (Yang et al., 1998). TAp63y probably inhibits apoptosis by interacting with the p53 target genes. Although TAp63a does not transactivate p53-target genes (Yang et al., 1998), due to the SAM domain at the C- terminus, it is capable of inducing apoptosis (Gressner et al., 2005). TAp63 isoforms are capable of triggering a mitochondrial apoptotic cascade by activating Box in both Hep3b cells and developing neuronal cells (Gressner et al., 2005; Jacobs et al., 2005) \ Ectopic expression of TAp63a also commits the single-layered lung epithelium to the stratification program (Koster et al., 2004), suggesting a specific role for TAp63 during development.

1 TAp73 is also pro-apoptotic. Watson, I. R., Blanch, A., Lin, D. C, Ohh, M. and Irwin, M. S. (2006). Mdm2-mediated NEDD8 modification of TAp73 regulates its transactivation function. J Biol Chem 281, 34096-103..

13 ANp63 is anti-apoptotic

In normal stratified epithelium, ANp63 is expressed in the basal cells whereas TAp63 is expressed in the supra-basal cells, suggesting that ANp63 is a marker of progenitor or stem cells (McKeon, 2004). ANp63 displays certain pro-survival and oncogenic properties. In- vitro data showed that ANp63

(Lee and Kimelman, 2002). The ANp63 isoform is over-expressed or amplified in nasopharyngeal carcinomas (Crook et al., 2000), and squamous cell carcinoma of the lung

(Hibi et al., 2000). In oral carcinomas, ANp63 expression increases with the severity of dysplasia (Nylander et al., 2000).

ANp63 also shows some anti-apoptotic qualities. ANp63a, and to a lesser extent ANp63y, suppress the transactivation ability of p53 and TAp63y in Sao-2 cells in a dose-dependent manner. Possible mechanisms may involve:

1. Competition between ANp63 on one side and TAp63 and p53 on the other for the

p53 target sites (Yang et al., 1998). Electrophoretic mobility shift assays (EMSA)

demonstrate interactions between the p5 3 -binding sites {PG and p21WAF promoter)

and ANp63y (Yang et al., 1998).

2. Formation of the transactivation-incompetent heterocomplex, between the ANp63

and TAp63 isoforms via their oligomerization domains, offers additional means of

inhibition for TAp63. The glutathion S-transferase assay (GST) showed strong

associations between ANp63 (a and y) and TAp63y (Yang et al., 1998). Abrogation

14 of the ANp63a expression by siRNA sensitizes 5637 cells to apoptosis after DNA

damage (Lee et al., 2006), confirming the anti-apoptotic role of ANp63.

On the other hand, ANp63 seems to repress differentiation. It is expressed mainly in the basal cells of stratified epithelium and its expression is lost in more differentiated epithelium (McKeon, 2004). Similarly, in carcinomas, ANp63 is absent in cells undergoing terminal differentiation (Parsa et al., 1999). In fact, over-expression of ANp63a blocks

Ca2+-induced terminal differentiation of mouse primary keratinocytes in culture (Kingsley,

1994). Taken together, ANp63 promotes proliferation, represses cell differentiation and inhibits apoptosis.

Likewise, ANp73 is an essential pro-survival protein for both central and peripheral nerve developments (Pozniak et al., 2002). ANp73 mediates its anti-apoptotic action by blocking p53-mediated transactivation of target genes (Fillippovich et al., 2001) and over-expression of ANp73 renders cultured cells less vulnerable to apoptosis (Walsh et al., 2004).

Apoptosis in Development

Programmed cell death, or apoptosis, has been utilized by many organisms for morphogenesis. In fact, most of the cells produced during mammalian embryonic development undergo physiological cell death before the end of the perinatal period (Vaux and Korsmeyer, 1999). This mechanism of apoptosis is highly conserved from C. Elegans to mammals (Vaux and Korsmeyer, 1999). The process of developmental apoptosis serves to control cell numbers and to sculpture the structure (Glucksmann, 1951).

15 The developmental apoptosis pathway is currently understood to involve mitochondria.

DNA instability results in stabilization of p53 in the cytoplasm. The stabilized p53 then transactivates Box which in turn releases cytochrome-c from the mitochondria.

Cytochrome-c activates Apaf-1 to bind caspase-9 which in turn cleaves caspase-3 (Green,

1998; Vaux and Korsmeyer, 1999) (Figure 1-7). Most of the intermediaries in the apoptotic pathway are so crucial in development that their mutations are either embryologically lethal or lead to developmental abnormalities. Caspase 3_/" mutants develop supernumerary cell masses in central nerve system and die prenatally (Kuida et al., 1996). In caspase 9 ~'~ mutants, caspase 3 was not activated (Kuida et al., 1998) and caspase 9~'~ cells were resistant to y irradiation (Hakem et al., 1998). Apaf-1'1' mutant die prenatally with severe craniofacial malformation and brain overgrowth (Cecconi et al., 1998) whereas Bax'A mutants are viable, but are infertile (Knudson et al., 1995).

Bax cytochrome-e Casp-9 Apoptosis

/\ Apaf-1 Casp-3

Figure 1-7. Apoptosis cascade in mammals.

Summary 2: • p63 is expressed in urothelium • p63 is member of p53 tumor suppressor family • TAp63 is pro-apoptotic • ANp63 is anti-apoptotic and oncogenic

16 Sonic hedgehog (Shh) as a urothelial signal

5/7/7 signaling

Hedgehog (Hh) is a secreted morphogen which regulates the development of a wide range of organs (Ingham and McMahon, 2001). It was originally identified along with other segment polarity genes in the fruit fly, Drosophila. Mutation of Hh disrupts the larval body plan, leading to the duplication of denticles which mark the posterior half of each segment

(Nusslein-Volhard and Wieschaus, 1980). The lawn of denticles in the mutant larvae apparently resembles a hedgehog under a microscope, and hence the nomenclature.

The 45-kDa precursor of Hh undergoes intramolecular autocleavage and yields a 19-kDa hydrophillic N-terminal fragment (Hh-N) which is responsible for all the inductive activities, and a 25-kDa C-terminal fragment that has no known function (Porter et al.,

1996). Cholesterol is added to the C terminus of Hh-N fragment and form Hh-Np, resulting in membrane retention of Hh proteins. A second lipid modification, palmitoylation of the

N-terminus of Hh-Np (Cys residue), probably increases the hydrophobicity of Hh

(Pepinsky et al., 1998). The lipid modifications of Hh may tether Hh to lipid rafts (Rietveld et al., 1999) which are important in exocytosis, secretion of Hh molecules (Chen et al.,

2004a). A 12 transmembrane protein, Dispatched (Disp), which bears structural homology with Patched (Ptc), is required to release cholesterol modified Hh (Burke et al., 1999). The multimeric protein complex of Shh thus formed is freely diffusible and is responsible for long-range signalling (Zeng et al., 2001). There are three known mammalian hedgehog homologues, Sonic hedgehog (Shh), Indian hedgehog (Ihh) and Desert hedgehog (Dhh).

17 Sonic hedgehog (Shh) is the most important mammalian homologue (Echelard et al., 1993;

Riddle etal., 1993).

A membrane-bound glycoprotein, Hh-interacting protein (Hip), has high affinity for Shh,

Ihh and Dhh and serves to attenuate Hh signaling(Chuang and McMahon, 1999). Two transmembrane receptors, Patched (Ptc) and Smoothened (Smo) are involved in Hh signal reception. A cytoplasmic Hedgehog Signaling Complex (HSC), consisted of Fused (Fu),

Suppressor of fused (Su(fu)), CostaH (Cos2) and Cubitus interruptus (Ci), is also involved in Hh signal transduction (Figure 1-8). In the absence of Hh, Ptc constitutively inhibits a second membrane receptor, Smo. Cos2 tethers the Hedgehog Signaling Complex to microtubules and facilitates cleavage of Cubitus interruptus (Ci) (Robbins et al., 1997). The cleaved N-terminus of Ci translocates into the nucleus, repressing the Hh target genes.

When Hh binds Ptc, the repression of Smo is relieved. HSC is dissociated from the microtubules and the activated Smo binds to Cos2 of the HSC, inhibiting cleavage Ci cleavage. The un-cleaved Ci translocates into the nucleus, activating the Shh target genes.

Short-range signalling is exemplified in Drosophila marginal disc. Hh secreted by a row of cells {engrailed expressing cells) in the posterior compartment at the boundary. Cells anterior to Hh domain respond by maintaining Wg transcription whereas cells posterior to

Hh domain respond by repressing Ser expression. Wg also represses Ser expression.

Following cell division, Wg represses denticles formation in anterior cells. Hh induces Rho in the row of cells posteriorly. Rho is also induced by and Ser domain anteriorly.

18 respectively and thus specifying denticles formation in the anterior compartment (Ingham and McMahon, 2001). Denticles form in Ser and Rho expressing cells.

Hh long-range signalling is exemplified by patterning of Drosophila imaginal discs, floor plate, notochord (Echelard et al., 1993) and vertebrate limb buds (Riddle et al., 1993).

Relay and diffusible multimer could account for the long-range signalling (Zeng et al.,

2001). Hh is expressed in the posterior compartment. At high gradient of Hh, Ci/Gli are expressed, at intermediate gradient, dpp/Bmp4 are expressed (Teleman and Cohen, 2000) whereas in area of low gradient, the repressor form of Ci/Gli are expressed (Ingham and

McMahon, 2001). Shh is expressed in the floor plate of neural tube and notochord. Shh gradient over the ventral half specifies the cell fates of various neurons. Ectopic expression of Shh in mouse central nerve system led to activation of floor-plate expressed genes

(Echelard et al., 1993). In vertebrate limb buds, Shh is expressed in the zone of polarizing activity situated posteriorly, specifying the identity of posterior digits Ectopic expression of

Shh to the anterior margin of a limb bud produced mirror image duplication of in chick embryo, indicating that Shh functions as the signal from the zone of polarizing activity

(Riddle et al., 1993) (Riddle et al., 1993). Reduction of Shh in ZPA results in a loss of the most posterior digits.

There are three Ci homologues in vertebrates, the Zinc-finger transcriptional factors GUI

(Park et al., 2000), GU2 (Mo et al., 1997) and GU3 (Hui et al., 1994). The N-termini of Gli2 and GH3 contain repression domain whereas the C-termini contain activation domain

19 (Sasaki et al., 1999). Like Ci, un-cleaved Gli2 and Gli3 function as activators but are converted into repressors through cleavage of their C-termini (Mo et al., 1997). GH2 is predominantly an activator2 whereas GH3, more prone to cleavage, is predominantly a repressor (Hui and Joyner, 1993; Persson et al., 2002). Glil does not undergo cleavage and is a secondary transducer regulated by GH2 and GH3 (Park et al., 2000). Glil and Bmp4 are the well established target genes of Shh signalling. Cyclopamine, a plant-derived teratogen, inhibits Smo function and hence blocks the Shh signaling (Cooper et al., 1998).

In absence of hedgehog signalling In presence o f H edgeho g Si gnalling

Figure 1-8. Hedgehog signaling. A) In the absence of Hh, Ci is cleaved. The N-terminus of Ci translocates into nucleus and inhibits the target genes. B) In the presence of Hh, the multi-protein complex is dissociated from microtubules and the un-cleaved Ci translocates into the nucleus and activates Hh target genes. Fu: Fused, Su(fu): Suppressor of Fused. Cos2: Costal.

" GH2 may play a minor role as repressor (Nieuwenhuis, E. and Hui, C. C. (2005). Hedgehog signaling and congenital malformations. Clin Genet 67, 193-208.)

20 5/7/7 in development

The role of Hh signalling during development is exemplified by patterning of Drosophila imaginal discs, vertebrae neural tubes and limb buds. Hh is expressed in the posterior compartment of Drosophila segment. At high level of Hh, Ci/GH are expressed, at intermediate gradient, decapentaplegic (dpp)/Bmp4 are expressed (Teleman and Cohen,

2000) whereas in area of low gradient, the repressor form of Ci/GH (i.e. GH3) are expressed

(Ingham and McMahon, 2001). In neural tube, the Shh gradient over the ventral half specifies the cell fates of various neurons (Echelard et al., 1993). In limb buds, Shh is expressed in the zone of polarizing activity situated posteriorly, specifying the identity of posterior digits (Kaghad et al., 1997). Reduction of Shh in the zone of polarizing activity

(ZPA) results in a loss of the most posterior digits (Niswander et al., 1994).

Shh is expressed in the endoderm during early gastrulation. It is expressed in the anterior intestinal portal (AIP) and the caudal intestinal portal (CIP) during the foregut and hindgut invaginations respectively. Shh is expressed predominantly in the epithelia at many sites of epithelial-mesenchymal interactions, including the intestine and the bladder (Bitgood and

McMahon, 1995; Sasaki et al., 2004). Recently, Haraguchi et al. have demonstrated that

Shh is required for bladder development as Shhv' bladders are hypoplastic. By genetically labeling the cells, they also showed that bladder smooth muscle cells are derived from Shh- responsive cloacal mesenchymal cells (Haraguchi et al., 2007). Indeed, blocking of Shh signaling with cyclopamine has been shown to affect smooth muscle a-actin induction in bladder (Shiroyanagi et al., 2007). Involvement of Shh signaling has further been reported in human fetal bladders (Jenkins et al., 2007).

21 While Shh promotes mesenchymal cell proliferation in many organs (Ramalho-Santos et al.,

2000; Weaver et al., 2003; Yu et al., 2002), Shh represses smooth muscle differentiation in both the chick gizzard mesenchyme (Sukegawa et al., 2000) and the mammalian ureteric mesenchyme (Yu et al., 2002).

Summary 3: • Shh is expressed in epithelia, including bladder urothelium • Shh is involved in epithelial-mesenchymal interaction • Shh promotes mesenchymal cell proliferation and represses differentiation

Mesenchymal development

Epithelial-mesenchymal interaction plays a crucial role in mesenchymal development

(Headington, 1970; Kedinger et al., 1998). Mesenchymal development at many sites relies on epithelial signals (Baskin et al., 1996a; Mill et al., 2003).

Bone morphogenetic protein-4 (Bmp4) in mesenchyme development

Bone morphogenetic proteins (BMPs) belong to a subgroup of the transforming growth factor superfamily (TGF-p) (Kingsley, 1994)3. Bmp4 is normally expressed in the posterior ventral mesoderm in wild-type E7.5 murine embryos. Most of the Bmp-4''" embryos die between E6.5 and E9.5. The Bmp-4"'' embryos do not express mesodermal marker T

3 Based on a highly conserved seven-cysteine domain at C-terminal

22 (Brachyury) and demonstrate no mesodermal differentiation. A few embryos, which

survived beyond the gastrulation stage, have truncated posterior structures and showed

failure of ventral body wall closure (Winnier et al., 1995). This suggests that Bmp4 is

crucial to mesenchymal development.

Bmp4 is expressed in many organs in which reciprocal interactions between epithelial and

mesenchymal cells are important for morphogenesis and differentiation (Bitgood and

McMahon, 1995; Hogan, 1996). Like its Drosophila counterpart decapentaplegic (dpp),

Bmp4 is induced by Shh in vertebrate hindgut (Roberts et al., 1995; Roberts et al., 1998).

Bmp4 therefore functions as a mesenchymal intermediary transducting the epithelial Shh

signal.

Bmp is an extracellular signal; its binding induces the type I and type II Bmp receptors to

associate and phosphorylate the R-Smads (Receptor-regulated Smad, Smads 1, -2, 3, -5 and

-8). Co-Smads (common partner Smad, Smad-4) forms a complex with R-Smads and the

complex translocates into the nucleus to activate the Bmp target genes (Attisano and Wrana,

2002). Noggin binds Bmp4 with high affinity and antagonizes its function (Zimmerman et

al., 1996). In Xenopus, Noggin is expressed in Spemann organizer, which specifies dorsal

mesoderm. Over-expression of Noggin in zebra fish strongly dorsalizes the embryo.

Noggin knockout mice lose caudal vertebra with reduced size of the somites and neural tube (Brunet et al., 1998). Hence, Bmp 4 and Noggin regulate the embryo development along the dorso-ventral axis.

23 Hox

Hox genes encode transcriptional factors which are expressed principally in the mesenchyme during gut development (Kmita and Duboule, 2003). The Hoxa-13 and Hoxd-

13 genes, the 5' Hox genes, are expressed in both the mesoderm and endoderm of the hindgut. There are some evidences that Hox may be a target gene of Bmp. In limb bud,

Bmp regulates Hox expression (Li and Cao, 2003; Li et al., 2006; Shi et al., 1999) and over-expression of Bmp4 in Xenopus up-regulates mesodermal Xhox-3 (Dale et al., 1992).

Hox-13 genes play an important role in the hindgut development (Table 1-1). Hoxd-13 is crucial for dorsal ano-rectal development (Kondo et al., 1996; Roberts et al., 1998) whereas

Hoxa-13 is critical for ventral bladder development (de Santa Barbara and Roberts, 2002;

Warot et al., 1997). In teratogenic (ETU) model of ano-rectal malformation, the expressions of both Shh and its down-stream genes, Bmp4 and Hox are down-regulated

(Quan et al., 2007).

Table 1-1. Summary of Hoxa-13 and Hold 13 phenotypic study.

Mutation Phenotypes

Hoxd-13 •'-: Hoxd-13-'', Poor anal sphincter

Abnormal anorectum Hoxd-13';Hoxa-13w- Rectal dilatation, rectal agenesis

Hoxa-13 *%• Hoxa-13'- Bladder agenesis

Abnormal bladder Hoxa-13-'-;Hoxd-13+/- Rudimentary bladder

Hoxd-13^'; Hoxa-13'- Hoxa-13-'-;Hoxdl3-'- Cloaca

Bladder & rectal anomaly

24 Bladder mesenchymal cells differentiate into smooth muscle cells

Regulation smooth muscle myogenesis

Bladder smooth muscle cells are derived from the mesenchymal cells (Baskin et al., 1996b).

The majority of smooth muscle genes are controlled by serum response factor (SRF), a widely expressed transcription factor that also regulates genes involved in cell proliferation.

SRF binds CArG box (i.e. CC(A+T ricfr^GG motif) of promoters of smooth muscle genes and induces smooth muscle differentiation. A co-activator of SRF, Myocardin, is necessary and sufficient to initiate smooth muscle differentiation (Wang and Olson, 2004).

Myocardin is expressed in myocardium and visceral smooth muscles, including that of bladder (Wang et al., 2001). Various markers of smooth muscle (SM) differentiation are expressed at different stages of differentiation. SM a-actin, SM22, calponin, and SM- myosin heavy chain are expressed in a chronological order during the vertebrate vascular smooth muscle development (Owens, 1995).

Controversial role ofBmp4 in smooth muscle differentiation

Contradictory reports on the role of Bmp4 in smooth muscle differentiation are found in the literature. In ureter, Bmp4 expands smooth muscle a-actin expression (Raatikainen-Ahokas et al., 2000). In lung development, Bmp4 inhibits fibroblast proliferation and promotes smooth muscle differentiation (Jeffery et al., 2005). The Bmp-induced Smadl binds myocardin, the co-factor of smooth muscle differentiation (Callis et al., 2005). Smadl expression also co-localizes with that of the SM a-actin (Chen et al., 2005). These results suggest that Bmp4 promotes smooth muscle differentiation.

25 Yet, during avian somite development, Bmp4 inhibits skeletal myogenesis and prevents its premature differentiation whereas Noggin antagonizes the action of Bmp4 on skeletal muscle (Hirsinger et al., 1997). In chick gizzard mesenchyme (Sukegawa et al., 2000), smooth muscle differentiation has been detected in the area devoid of Bmp4 expression, suggesting the opposite scenario, i.e. Bmp4 represses smooth muscle differentiation. The exact role of Bmp4 in regulating smooth muscle differentiation is not known and may be context-dependent.

Msx may be a target gene ofBmp4 in smooth muscle differentiation regulation

Msx genes (related to muscle-segment homeobox genes in Drosophila) belong to a sub family of homeobox genes. Vertebrate have three Msx genes {Msx-1, Msx-2 and Msx-J).

During development, Msx family proteins are required for patterning and morphogenesis.

Msx is expressed in the highly proliferative region (Bendall and Abate-Shen, 2000).

Conversely, Msx also inhibits cellular differentiation probably by upregulating cyclin Dl

(Hu et al., 2001). Msx genes have been shown to be involved in epithelial mesenchymal interaction in both tooth development and placenta (Jowett et al., 1993; Quinn et al., 2000).

Msx-1 expression depends on ectodermal signal whereas Msx-2 expression does not (Wang and Sassoon, 1995). Hence, Msx-1 has been used as a marker of mesenchymal induction

(Mills et al., 1999). Msx-1 mutation leads to central midline defect, cleft palate in mouse

(Satokata and Maas, 1994). Bmp4 has been shown to induces mesenchymal expression of

Msx-1 and Msx-2 in vertebral development (Monsoro-Burq et al., 1996; Ovchinnikov et al.,

2006). Recently, Bmp4-induced Msx has been shown to form a ternary complex with SRF and myocardin, preventing their binding to CArG box motif, hence inhibiting transcription

26 of smooth muscle genes (Hayashi et al., 2006a). These data suggest that Bmp4 may repress the smooth muscle differentiation via its action on Msx.

Summary 4: • Bmp4 is a mesenchymal target gene of Shh • Bmp4 is crucial in mesenchymal development • Msx is a candidate target gene of Bmp4 • The role of Bmp4 in regulating smooth muscle differentiation is unclear

Working Model

Based on the literature, we propose the following working model where p63 maintains the integrity of the stratified urothelium. The urothelium secrets Shh, which regulates the bladder mesenchymal development via its effect on Bmp4 (Figure 1-9).

Bladder lumen

Epithelium p63 maintains stratified epithelium Shh is secreted from epithelial cells

Lamina Shh up-regulates Bmp4 in lamina propria propria Bmp4 Shh represses smooth muscle differentiation fibroblasts

Smooth- Bmp4 level peters out at the periphery muscle Smooth muscle differentiation begins Serosa in the sub-serosal mesenchyme

Figure 1-9. The diagrammatic summary of the current understanding of epithelial-mesenchymal interaction and smooth muscle differentiation in bladder.

27 Chapter 2 Hypothesis

28 Hypothesis 1 Questions p63 is required for stratification of stratified epithelia (Koster et al., 2004), (Kurita and

Cunha, 2001; Kurita et al., 2004a; Kurita et al., 2004b). The transitional urothelium of the

bladder is stratified and expresses p63. The two p63 isoform groups, TAp63 and ANp63,

have the opposite effect on apoptosis (McKeon, 2004). The p63 isoform expressed in

bladder urothelium is unknown and yet the nature of the isoform expressed is pivotal to its

function. It is well-established that bladder epithelial signaling is critical to the

development of bladder mesenchyme (Baskin et al., 1996a; Baskin et al., 1996b). If p63 is

plays a role in the development of bladder urothelium, then p63 may also affect bladder

mesenchymal development through the epithelial-mesenchymal interaction.

Hypothesis 1

We hypothesize that:

1.1 p63 plays a crucial role in the bladder urothelial development

1.2 The pro-survival ANp63 is the dominant isoform expressed in the developing bladder

urothelium

1.3 Through epithelial-mesenchymal interaction, p63 affects bladder mesenchymal

development

Test of the hypothesis

To verify each section of the hypothesis we will

29 1.1. First, establish when p63 is expressed during bladder development by

immunohistochemistry on wild-type embryos of gestational age ranging from

El 1.5 to E17.5. We will then assess thep63'/' bladder epithelial development with

histology, and the markers for stratification commitment (K18), urothelial

differentiation (uroplakin III), apoptosis (TUNEL and cleaved caspase-3 Ab) and

cell proliferation (BrdU incorporation study).

1.2. Determine the predominant isoform of p63 expressed in the developing bladder

by immunohistochemistry with specific antibodies against the TAp63 and ANp63

isoforms. We will then confirm the findings with RT-PCR.

1.3. Evaluate the mesenchymal induction with the mesenchymal markers Msx-1 and

Fg/8, mesenchymal proliferation with BrdU incorporation study, apoptosis with

TUNEL and differentiation with smooth muscle a-actin and smooth muscle heavy-

chain myosin immunohistochemistry.

30 Hypothesis 2 Questions

Bladder mesenchymal development requires a bladder epithelial signal(s) (Baskin et al.,

1996a) and this signal is diffusible (Liu et al., 2000). Shh is a secreted morphogen crucial to development of many organs (Ingham and McMahon, 2001). Shh is expressed in many epithelia including bladder urothelium (Bitgood and McMahon, 1995). Its function often involves regulation of the segmental polarity during development (Nusslein-Volhard and

Wieschaus, 1980). In the development of hollow visceral organs, Shh may play a role in maintaining the radial polarity of these structures.

A Hedgehog/Bmp interaction is a well-conserved process throughout evolution and is crucial for embryological development. In Drosophila limbs, hedgehog induces the expression of decapentaplegic, the Bmp4 homologue (Basler and Struhl, 1994). Similarly,

Shh induces the expression of Bmp4 in the vertebrate hindgut (Roberts et al., 1995). In mammalian bladders, Shh is expressed in the urothelium and Bmp4 is expressed in the adjacent mesenchyme (Bitgood and McMahon, 1995). The role of Bmp4 in smooth muscle differentiation of visceral organs is controversial (Raatikainen-Ahokas et al., 2000;

Sukegawa et al., 2000). Unlike ureter where smooth muscle is adjacent to the epithelium

(Yu et al., 2002), the bladder smooth muscle differentiation starts at the periphery of the mesenchyme (Baskin et al., 1996c), away from the sub-epithelial expression of Bmp4

(Bitgood and McMahon, 1995). The function of Bmp4 in the development of the urinary bladder, the largest smooth muscle organ, has not been studied before.

31 Hypothesis 2

2.1 Shh signaling pathway regulates the patterning of the bladder mesenchyme during

its development

2.2 Shh regulates the bladder smooth muscle differentiation via its action on Bmp4

Test of the hypothesis

To test the 2nd hypothesis, we will

2.1 Establish the patterns of cell proliferation and smooth muscle differentiation in both

wild-type and GU2'/' murine bladders by PCNA immunostaining and the smooth

muscle a-actin immunohistochemistry.

2.2 Add Bmp4 protein with and without additional Noggin protein to the wild-type El 5.5

bladder mesenchymal primary cell cultures and quantify smooth muscle a-actin

expressions with immunoblots.

32 Chapter 3 ANp63 plays an anti-apoptotic role in

ventral bladder development

Published in:

Development. 2006 Dec;133(23):4783-92. Epub 2006 Nov 1.

Cheng W. Jacobs WB, Zhang JJ. Moro A, Park JH, Kushida M, Oiu W. Mills AA, Kim PC.

33 p63 is expressed in all stratified epithelia, including bladder urothelium. Epithelial- mesenchymal interaction has also been shown to take place in bladder development. At what developmental stage p63 expresses in bladder and what isoform of p63 is expressed in bladder urothelium are not known. How p63 regulates bladder urothelial development has not been studied. In the absence of p63, how bladder mesenchyme and smooth muscle develop is not clear. In this chapter, we set out to answer these questions.

Abstract

The bladder, the largest smooth muscle organ in the human body, is responsible for urine storage and micturition. P63, a homologue of the p53 tumor suppressor gene, is essential for development of all stratified epithelia, including the bladder urothelium. The N-terminal truncated isoform of p63, ANp63, is known to have anti-apoptotic characteristics. We have established that ANp63 is not only the predominant isoform expressed throughout the bladder but is also preferentially expressed in the ventral bladder urothelium during early development. We observed a host of ventral defects in the p63'A embryos, including the absence of the ventral bladder and abdominal walls. This complex of ventral defects is identical to bladder exstrophy (BE), a congenital anomaly exhibited in human neonates. In the absence ofp63, the ventral urothelium was neither committed nor differentiated, whereas the dorsal urothelium was both committed and differentiated. Furthermore, in p63~

'" bladders, apoptosis in the ventral urothelium was significantly increased. This was accompanied by upregulation of mitochondrial apoptotic mediators Box and Apafl, and concurrent upregulation of p53. Overexpression of ANp63y and ANp63j3 in p63'A bladder primary cell cultures resulted in a rescue, evidenced by significantly reduced expressions of

34 Bax and Apaf 1. We conclude that ANp63 plays a crucial anti-apoptotic role in normal bladder development.

Introduction

Bladder exstrophy (BE) is a serious congenital anomaly affecting one in 36,000 live births

(Martinez-Frias et al., 2001). In cases of BE, the ventral abdominal and bladder walls are either absent, leaving the bladder cavity exposed, or covered only by an amniotic sac; the pubic bones, external genitalia, and rectus abdominis muscles are separated along the midline, while the anus is displaced ventrally, often with an associated narrowing or atresia.

Treatment of BE is complicated and involves major reconstructive surgical procedures.

Although advanced parental age (Boyadjiev et al., 2004), familial links, and racial predilection (Shapiro et al., 1984) imply a genetic cause, the molecular mechanisms underlying the formation of BE remain unknown. As such, our understanding of the pathogenesis of BE remains limited to that provided by a previous descriptive study

(Muecke, 1964).

During embryogenesis, the cloacal cavity at the posterior end of the embryo is partitioned by the uro-rectal septum into the ventral urogenital sinus (UGS) and the dorsal hindgut.

The UGS subsequently develops into the urethra, bladder, and urachus. The UGS epithelium differentiates into a stratified transitional epithelium, known as the urothelium, while the mesenchyme of the UGS differentiates into the lamina propria and the smooth muscle of the bladder, known as the detrusor muscle. Interaction between the UGS epithelium and its mesenchyme is crucial to proper development of the detrusor muscle, as previous studies have shown that the UGS epithelium provides key signaling input that

35 promotes differentiation of the UGS mesenchyme into smooth muscle (Baskin et al.,

1996b).

Homologs p53, p63, andp73 comprise ihep53 gene family (Levine, 1997; Murray-

Zmijewski et al., 2006). p63 is highly expressed in all stratified epithelia and its expression can be detected in the urothelium starting at El 1.5 and persisting thereafter (Kurita and

Cunha, 2001; Kurita et al., 2004a; Kurita et al., 2004b). We therefore hypothesize ihatp63 plays a role in bladder urothelium development, which, in turn, affects bladder development. p63 ~'~ mice exhibit severe developmental anomalies, including failure of morphogenesis of the skin, truncation of limbs, and craniofacial abnormalities (Mills et al.,

1999; Yang et al., 1999). The specific mechanism underlying the regulation of epithelial stratification and development by p63 is not fully delineated and remains controversial.

Some investigators suggest that failure of epithelial stratification in the absence of p63 is related to a lack of commitment (Koster et al., 2004; Mills et al., 1999), while others suggest that it results from a defect in epithelial cell proliferation (McKeon, 2004; Yang et al., 1999).

P63 expresses multiple N-terminal isoforms, known as TAp63 and ANp63, due to the presence of an alternative promoter located in intron 3. The full-length isoform, TAp63, contains a transactivation (TA) domain similar to the TA domain of p53. TAp63 is capable of activating numerous p53 target genes, promoting cell cycle arrest (Yang et al., 1999) and inducing apoptosis (Jacobs et al., 2005). Conversely, the truncated isoform, ANp63, acts in a dominant-negative manner toward the TA isoforms of p63 and p53 (Yang et al., 1998).

36 ANp63 has been shown to inhibit apoptosis (Jacobs et al., 2005) and promote stem cell

proliferation in vitro (Moll and Slade, 2004). In addition to these N-terminal isoforms,

alternative splicing atp63's C-terminus generates three isoforms: a, p, and y. In

combination with the N-terminal isoforms, sixp63 isoforms can be generated (Yang et al.,

1998).

In the current study, we find the ANp63 isoform is the predominant isoform in the ventral bladder throughout development. In the absence of p63, the ventral bladder and abdominal walls are absent; these defects epitomize the BE complex in humans. In addition, the ventral epithelium of the p63'A bladder is neither committed to stratification nor differentiated, and exhibits significantly increased apoptotic activity. Pro-apoptotic mediators Box and Apafl are upregulated in the p63'A bladder. Restoration of ANp63p or

ANp63y protein levels inp63'A bladders partially rescues expression of Bax and Apafl.

Furthermore, absence of p63 in the bladder epithelium leads to failure of induction of the adjacent UGS mesenchyme, resulting in a significant reduction of mesenchymal proliferation. Taken together, these observations lead us to conclude that ANp63 plays a crucial anti-apoptotic role in development of the ventral bladder epithelium.

Materials and Methods p6S/m mutant mice genotyping

P63'/' mutant mice were bred on a C57B16 background (Mills et al., 1999). Homozygous embryos were identified by phenotype. Heterozygous embryos were genotyped by PCR

37 (primers 5'GTGTTGGCAAGGATTCTGAGACC3' and

5'GGAAGACAATAGCAGGCATG CTG3').

Histochemistry and immunohistochemistry

Specimen sections (7 urn) were stained with 50% hematoxylin and 0.5% eosin in 70% ethanol. Carbohydrates were stained with periodic acid and Schiff reaction (PAS,

Surgipath). Alkaline phosphatase (AP) reaction was studied by treating slides with 0.1 M

Tris-buffered solution (pH = 9.5), followed by addition of BM purple AP substrate (Roche).

Immunochemistry was performed as follows: After quenching the endogenous peroxidases with 3% H2O2 in 10% methanol, the antigens were retrieved by boiling the slides in an antigen unmasking solution (H-3300, Vector Laboratories). The sections were blocked with blocking reagent (Roche). Primary antibodies at the following dilutions were applied: cytokeratin 18 (CK18) (1:100, Santa Cruz Biotechnology), p63 {AAA, 1:100, Santa Cruz

Biotechnology), TAp63 (1:20, Santa Cruz Biotechnology), ANp63 (1:100, gift from Dr. K

Nylander) (Nylander et al., 2002), p53 ( Abeam, ab26, 1:250), p73 (Abeam, abl7230,

1:200), villin (1:100, Santa Cruz Biotechnology), uroplakin III (undiluted, Santa Cruz

Biotechnology), smooth muscle a-actin (undiluted, Sigma Chemicals), cleaved caspase-3

(1:100, Sigma Chemicals), Msx-1 (1:500, Covance Research Products), and smooth muscle heavy chain myosin (1: 2000, Santa Cruz Biotechnology). Appropriate secondary antibodies were applied at 1:200 dilutions. Avidin-biotin-peroxidase complex (ABC) buffer washing was followed by substrate diaminobenzidine (DAB) staining. Cell proliferation was assayed by 5-bromo-2'deoxyuridine (BrdU) incorporation (animals were injected with

100 um BrdU/gram of animal's weight). Apoptosis was studied using the terminal

38 deoxynucleotidyl transferase biotin-dUTP nick end-labeling (TUNEL) assay and FragEL™

DNA Fragmentation Detection Kit (Calbiochem). p63 Ab (4A4) specificity was first assessed with wild-type and/763"7" El8.5 embryo bladders. The cellular (histological) specificity of ANp63 and TAp63 antibodies were characterized by comparing the expression patterns with that of p63 (4A4), in bladder, skin (positive controls) and colon epithelium (negative control). The isoform specificities of ANp63 and TAp63 Abs were then confirmed with RT-PCR on El5.5 murine fetal bladders.

RNA extraction, qPCR, and RT-PCR

Total RNA was extracted utilizing the RNeasy Mini Kit (Qiagen). cDNA was synthesized utilizing the Superscript™ II First-Strand Synthesis Kit (Invitrogen), then purified utilizing a QIAquick PCR Purification Kit (Qiagen). Quantitative polymerase chain reactions

(qPCRs) were performed using SYBR Green real time PCR Kit (Qiagen, 204141, with premixed Taq enzyme and nucleotides). The cDNA, primers, Taq enzyme, SYBR Green, nucleotides, MgCl2, PCR buffer and water were added to PCR tubes (triplets) (20 ul) and loaded on Chromo4 Cycler (Bio-Rad™). PCR process consists of 30-40 cycles of denaturing (1 minute), annealing (45 seconds) and externsion (2 minutes). The primers were designed such that the PCR products were relatively short, 100-200 bp. Optimal anaeling temperature was first estimated by assessing the primer content and established by running PCR across a gradient of temperature. We used the commercially available p53 primers (SuperArray Bioscience, PPM02931A-24) and self-designed primers :p53

(5'CACCTCACTGCATGGA CGATC3', 5'GTCTGCCTGTCTTCCAGATACTCG3', T:

59.1°C ),p73 (5'CAAG AAGG CAGA GCAT GTGA3', 5'TCAT ACGG CACA ACCA

39 CACT3', T: 50.1°C), fi-actin (internal control, 5'CCTTTTCCAGCCTTCCTTC3\

5'TACTCCTGCT TGCTGATCC3', T: 55.0 °C), Box (5'CGAG CTGA TCAG AACC

ATCA3', 5'CTCA GCCC ATCT TCTT CCAG3', T: 50.1° C), and Apafl (5'

GAGAAAACCC TGAGGCACAA3', 5' TAATTAAAGCGGCTGCTCGT3', T: 50.4°C).

The relative expressions, e.g. the ratio of the interested gene to that of house-keeping gene.

The cycle difference required to reach certain level is an indicator of the quatitive of the initial DNA load. The data were analyzed according to Pfaffl's methods (Pfaffl, 2001).

Reverse transcriptase-polymerase chain reactions (RT-PCRs) were performed using the following primers: ANp63 (5'CAAT GCCC AGAC TCAA TTTA GTGA3', 5'GGCC

CGGG TAAT CTGT GTTG G3', 221bp, T: 51.4°C), TAp63 (5'AACC CCAG CTCA

TTTC TCTG3', 5'GGCC CGGG TAAT CTGT GTTG G3' 449 bp, T: 57.0°C),p63a

(5'ACGG GGTG GAAA AGAG ATGG TC3', 5'AAGA GACC GGAA GGCA GATG

AAG3', 919 bp, T: 59.5°C),p63fi (5'GACT TGCC AAAT CCTG ACA3', 5'AAGA

GACC GGAA GGCA GATG AAG3', 619 bp, 55.1°C), andp63y (5'CTCC CCGG GGCT

CCAC AAG3', 5'AAGA GACC GGAA GGCA GATG AAG3', 338 bp, T: 56.2°C).

Immunoblot

Immunoblot was performed as previously described (Qiu et al., 2004). Briefly, the cultured cells were washed twice with lx PBS and lysed using a solubilizing buffer (lx PBS containing 1% Nonidet P-40, 1% deoxycholate, 5 mM EDTA, ImM EGTA, 2 mM PMSF,

0.1 mM leupeptin, 100 KIU/mL Trasylol, and 0.5 uM ALLN), and an equal amount of cell lysates were resolved on 8% SDS-PAGE mini gels. Following SDS-PAGE, the protein was transferred electrophoretically for 18 hours at 4°C onto PVDF. The membranes were

40 blocked with a 4% solution of fat-free dry milk powder, incubated with the primary antibodies (anti-Bax Ab, Upstate Cell Signaling, Cat# 06-499, 1:500; anti-Apafl, Chemicon,

Cat# MAB3504, 1:500; and anti-0-actin Ab, Sigma Chemicals, Cat# A 5441, 1:1000), washed, and incubated with a secondary antibody conjugated to horseradish peroxidase.

Membranes were then incubated in an enhanced chemiluminescence detection reagent

(Amersham Pharmacia Biotech) and exposed to Kodak Hyperfilm (Eastman Kodak). Films were developed and quantitative analysis was performed using an imaging densitometer.

Organ culture, primary cell culture, and transfection

The El3.5 pregnant mice were anaesthetized with intra-peritoneal phenobartitol injection

(0.12mg/gm). The surgical instruments were autoclaved prior to dissection. The operating field was sterilized with 70% ethanol. Laparotomy and hysterotomy were performed on the pregnant mice. The fetuses were removed, decapitated and bladder was removed under in sterile PBS solution. The dissected bladders were cultured in 50% BGJb medium

(Invitrogen), plus 50% A10 (Wisent) culture medium with supplements of transferrin (20 ng/ml), insulin (10 ng/ml), and epithelial growth factor (10 ng/ml). For primary cell culture, the bladder was incised into smaller pieces, digested with collagenase for 2 hours at 37 C, plated on 6 cm culture plates. Primary cells were cultured with Eagle's minimum essential medium (EMEM; Wisent) and 20% fresh bovine serum (FBS). They were cultured in humidified incubator with 5% CO2 at 37 C°. Green fluorescent protein (GFP)-tagged recombinant bicistronic adenoviruses with ANp63y, ANp63fi, and TAp63y constructs were generated, purified, and titered as previously reported (Jacobs et al., 2005). The adenoviruses were added to the culture media at the ratio of 5-10 pfu per cell.

41 In-situ hybridization

In-situ hybridization of paraffin section with DIG-labeled RNA probe was performed as previously described (Hui and Joyner, 1993). Briefly, the dewaxed slides were pre-fixed with 4% paraformaldehyde, permeabilized with proteinase K (0.02 mg/ml), treated with 0.2

M HC1 solution and 0.1 M triethanolamine solution (TEA), plus 0.025 ml acetic anhydride/liter of TEA. The slides were then hybridized with 4.0 ug/ml of DIG-labeled

RNA probes (DIG labeling mix; Roche) in formamide/sodium citrate-sodium chloride

(SSC) buffer in a 55°C oven overnight. The slides were then washed with a 5x

SSC/formamide solution and treated with RNAse-A, 2x SSC, and 0.2x SSC before being blocked with blocking reagent (Roche). Anti-DIG alkaline phosphatase antibody (Roche) was then applied followed, by BM purple AP substrate (Roche).

42 Results

P63 deficiency leads to bladder exstrophy

In humans, BE complex is evidenced by a cluster of ventral midline defects, including 1) ventral abdominal- and ventral bladder-wall defects, 2) bifid external genitalia, and 3) separation of the pubic bones (Figure 3-1A-B). Three litters were examined. The 1-2 p63'A mutant p63 embryos were identified by their limp phenotype. All p63 "'"embryos examined

(n = 12) developed bladder abnormalities. Four embryos developed BE with ventral bladder- and abdominal- wall defects (with and without membrane cover), bifid external genitalia (Figure 3-1C-D) and umbilical hernia. The remaining eight embryos developed dilated bladders with both thin lamina propria and thin muscle layers. The sagittal sections of El 8.5 p63 "'" mutant embryos demonstrated the full complement of BE (Figure 3-1E-F), evidenced by 1) ventral abdominal wall defect, 2) ventral bladder wall defect covered with a thin membrane, 3) absence of pubic symphysis at the midline (i.e., separation of pubic bones), 4) absence of external genitalia at the midline (i.e., bifid genitalia), 4) umbilical hernia, and 5) ventral translocation of the anus. Sections of even younger embryos demonstrated that the separation of external genitalia was evident at El 1.5 (Figure 3-6A-

B) . Transverse sections through the p63 ~'~ embryo pelvis confirmed BE (ruptured membrane and separation of pubic bones (Figure 3-1G-H). In summary, ihep63 ~'~ mutant mouse phenotype recapitulates the full spectrum of human BE complex.

43 bladder exstrophy

human bladder exstrophy -bifid clitoris

pubic bones

wild-type

umbilical external hernia E18.5 genitalia murine bladder embryo exstrophy

bifid genitalia

E18.5 murine sagittal

Figure 3-1. Bladder exstrophy (BE) in human and p63 mice. A: BE with separation of pubic bones and genitalia in a female. B: Covered BE in a male. C: The wild-type E18.5 embryo (lOx). D: BE in an

E18.5/>6J "'" embryo (lOx). E-F: Hematoxylin and eosin staining of sagittal sections of wild-type and p63'/' E18.5 embryos (40x). White arrow: umbilical hernia. G-H: Hematoxylin and eosin staining of transverse sections of E18.5 wild-type and p63~'~ embryo pelvises (40x). (photo A and B: Courtesy of Dr.

J.L. Salle, Hospital for Sick Children, Toronto).

44 p63 is expressed in bladder epithelium throughout its development and the ANp63 is the predominant isoform

To define the role of p63 in bladder development, the ontogeny of p63 expression in the bladder was examined by immunohistochemistry from gestational days El 1.5 to El7.5, using a 4A4 pm-p63 antibody (Figure 3-2A-D). p63 was initially expressed in the distal- ventral UGS epithelium, hindgut, and skin overlying the genital tubercle ofE11.5-E12.5 embryos (Figure 3-2A-B). p63 expression then extended to the epithelium over the body and dome of the bladder, at El 5.5 and El 7.5, respectively (Figure 3-2C-D). Next, the expression pattern of the different N-terminal isoforms was studied using antibodies specific to either TAp63 or ANp63 (Nylander et al., 2002). Expression of the ANp63 isoform (detected by anti-ANp63 Ab) was found to be similar to that of the pan-p63 antibody (detected by 4A4), suggesting that ANp63 represents the predominant isoform during bladder development. ANp63 expression started in the ventral UGS epithelium on

El 1.5 and extended to the rest of the epithelium later in development (Figure 3-2E-H).

ANp63 was also expressed in the epithelium overlying the urogenital tubercle (Figure

3-2E-F). In contrast, TAp63 (detected by anti-TAp63) was expressed only transiently from

El 1.5 to E12.5 in the distal hindgut's epithelium and in its communication with the UGS

(Figure 3-21-J). TAp63 expression decreased markedly in the distal hindgut after E14.5

(Figure 3-2K-L and data not shown) and was not expressed in the skin overlying the urogenital tubercle.

To verify the dominant p63 N-terminal isoform expressed in wild-type bladders, RT-PCR was performed on RNA extracted from El5.5 wild-type bladders using primers specific to

45 ANp63 and TAp63 respectively. This analysis confirmed that the predominant N-terminal isoform ofp63 during early bladder development was ANp63 (Figure 3-2M). Unlike in the skin, wherep63a is the predominant C-terminal isoform (Westfall et al., 2003; Yang et al.,

1998), RT-PCR detected onlyp63y andp63\S in the bladder epithelium (Figure 3-2M).

Thus, we concluded that ANp63y and ANp63§ are the predominant isoforms of p63 expressed in bladder epithelium during development.

E11.5 E12.5 E14.5 E17.5

ANp63

TAp63

46 Figure 3-2. Ontogeny of p63 on sagittal sections of wild-type embryos (Fluorescent

immunohistochemistry, lOOx). Sagittal sections of El 1.5 embryos transect the epithelium tangentially

at the distal UGS, accounting for the wider expression pattern at the distal urogenital sinus (A and £).

A-D: p63 (4A4) expression. E-H: JNp63 isoform expression. I -L: TAp63 isoform expression. Blood

cells within the mesenchyme are autofluorescent. M: RT-PCR of wild-type E15.5 bladder, using

adenoviruses with ANp63, TAp63,p63a,p63fi, andp63y constructs as controls. Arrows in A-J and M

represent immuno-reactivity and RT-PCR bands in wild-type bladder samples, b: wild-type bladder cDNA. v: adenoviruses containing AN, TA, a, p, and yp63 constructs. p63 expression is ventrally restricted during early bladder

development

To better understand why p63 ~'~ embryos develop ventral midline defects, the p63 expression pattern during early bladder development was studied using immunohistochemistry. Although there was widespread p63 expression throughout the skin and urothelium in El 8.5 embryos, sagittal sections of El 1.5 embryos showed that p63 expression was restricted to the ventral epithelia of the urogenital tubercle and UGS, the tail bud, the oral epithelium (Figure 3-3A, arrows), and the apical ectodermal ridge (Mills et al., 1999). Horizontal pelvic sections of El 1.5 embryos confirmed thsAp63 expression was present in the skin overlying the urogenital tubercle (Figure 3-3B) and ventral UGS epithelium (Figure 3-3C). In later gestational-stage embryos, p63 expression was stronger and epithelial stratification more advanced in the ventral skin compared to that of the dorsal skin (Figure 3-3D-F). In summary, p63 expression in early bladder and skin epithelial development is ventrally restricted.

47 Figure 3-3. p63 (4A4) expressions in E11.5 and E14.5 wild-type embryos. A:p63 immunofluorescent staining of a sagittal section of an £11.5 embryo (20x). B: p63 immunofluorescent staining of transverse sections of an E11.5 embryo pelvis (40x).(B) C: p63 immunofluorescent staining of an E11.5 UGS

(200x). Arrows in A-C represent the ventral aspects of the specimens. D: Colorimetric immunostaining of a transverse section from an E14.5 embryo (20x). High-magnification view of ventral (E) and dorsal

(F) skin of the E14.5 embryo (600x).

p63-deficient bladder epithelium is abnormal along the dorso-ventral axis

To determine whether the stratification of the endoderm-derived urothelium is affected similarly to that of the ectoderm-derived epithelium in the absence ofp63, EIS.5 p63 ~'~ bladders were stained with hematoxylin and eosin. This analysis revealed that, while wild- type bladder epithelium differentiates into stratified transitional urothelium (Figure 3-4A and C), the bladder epithelium of p63 ~'~ mutants fails to stratify and remains as a single layer (Figure 3-4B and D). Differences in epithelial morphology were also noted along the dorso-ventral axis. The dorsal epithelium of p63 A bladder consisted mainly of simple

48 cuboidal cells (Figure 3-4D), whereas the ventral epithelial cells were primarily simple squamous cells (Figure 3-4B, arrow).

Since p63 has been previously shown to be essential in ectodermal epithelial commitment and/or differentiation (Mills et al., 1999), the role of p63 in bladder development was examined using well-established markers for epithelial differentiation in El8.5 embryos.

K18, a marker of the endoderm or uncommitted epithelium, is not expressed in stratified or differentiated epithelia (Koster et al., 2004). We noted that, in mature wild-type bladder urothelium, K18 expression was absent (Figure 3-4E and G). In thep63 ~'~ bladder, while the dorsal epithelium did not express K18 (Figure 3-4H), the ventral epithelium retained

K18 expression, indicating that it was uncommitted to stratification (Figure 3-4F). To further determine the status of epithelial differentiation in bladder tissue, the expression of uroplakin III, a marker for terminally differentiated urothelium, was studied (Wu et al.,

1999). Uroplakin III was strongly expressed in mature wild-type bladder urothelium

(Figure 3-41 and K). In the p63 ~'~ bladder, uroplakin expression was reduced in the dorsal epithelium (Figure 3-4L) and undetectable in the ventral epithelium (Figure 3-4J). This suggests that, while the p63'A ventral bladder epithelium is undifferentiated, the dorsal epithelium is capable of differentiation, even in the absence of p63 (Figure 3-4K-L). As null mutation of p63 has been reported to be associated with intestinal metaplasia

(Signoretti et al., 2005; Yang et al., 1999), intestinal markers were also examined in the p63'A bladder epithelium. This analysis revealed that intestinal transformation does not occur in thep63"/" bladder epithelium (Figure 3-5). In summary, null mutation of p63 was

49 noted to affect the development of bladder epithelium differentially along the dorso-ventral axis, ultimately resulting in uncommitted and undifferentiated ventral bladder epithelium. wild-type p63-A

50 Figure 3-4. Sagittal sections of E18.5 wild-type and p63~' bladders showing the ventral and dorsal epithelia. A-D: Hematoxylin and eosin staining (600x). E-H: Immunofluorescent staining of cytokeratin 18 (K18) (400x, confocal microscopy). I-L: Immunofluorescent staining of uroplakin III

(630x, confocal microscopy). (A,C,E,G,I,K) Wild type. (B,D,F,H,J,L) p63T/'. Arrows represent the epithelia.

Wild-type p63 *

Figure 3-5. The intestinal epithelial markers in E18.5 wild-type and p63 " bladders. A-B:

Immunohistochemical staining of the intestine marker, villin (40x). C-D: Periodic acid-Schiff reaction for large intestine mucin (40x). E-F: Alkaline phosphatase staining for small bowel epithelium.

51 Apoptosis is increased in p63-deficient bladder epithelium

ANp63 is known to act as a naturally occurring dominant negative. It has been shown to counteract the pro-apoptotic actions of TAp63 and p53 in vitro (Yang et al., 1998). We have shown that ANp63 is the major isoform of p63 expressed in the developing ventral bladder and that both the mesenchyme and epithelium of the ventral UGS develop abnormally in the absence of ANp63 (Figure 3-6A-B). As such, we hypothesized that/?65 acts as a prosurvival protein in the developing bladder, thus preventing the apoptosis of ventral UGS epithelium during development. To directly test this hypothesis, we examined the amount of apoptosis in p63';~ bladders by TUNEL assay and cleaved caspase-3 expression. The number of TUNEL-positive cells in the ventral UGS epithelium of El 1.5 p63'A mutants was significantly higher than that of wild-type controls (Figure 3-6 C-D)

(44% vs. 9%, Student's t-test, p<0.05). This increase in apoptosis was further corroborated by an observed increase in cleaved caspase-3 expression in p63'A ventral UGS epithelium

(35% vs. 5%, Student's t-test, p<0.05) (Figure 3-6 E-F). In comparison, we noted minimal apoptotic activity in the dorsal epithelia of both wild-type andp63~A bladders, as determined by TUNEL assay and cleaved caspase-3 expression (Figure 3-6 C-F). We also compared the apoptotic activities (percentage of cleaved caspase-3 positive cells) of skin overlying ihep63'/' and wild-type urogenital tubercles (12.8 +1-2.1 % and 2.1+1-1.1 %) and found the difference between them was statistically significant (Student's t-test, p<0.01).

This phenomenon of increased apoptosis in the absence of p63 does not appear to be restricted to the ventral UGS. Oral cavity epithelium, which also expresses high levels of p63 during early development (Figure 3-3 A), was noted to have a statistically significant

52 increase in apoptosis in the p63~' embryo (Figure 3-6G-H, 49.0 +/-1.0% vs. 9.0+/-1.0%,

Student's t-test, p<0.05). In summary, our data show that apoptosis is increased mp63~/~ mice in the epithelia of the ventral UGS, as well as in other epithelial structures where p63 expression is normally high during early development.

Developmental apoptosis, important in normal organogenesis, is understood to involve the mitochondrial apoptotic pathway (Vaux and Korsmeyer, 1999). As such, we analyzed the expression of mitochondrial apoptotic mediators Bax and Apafl in El 2.5 and El 3.5 wild- type andp&T7" bladders by qPCR. In the/?<55-deficient bladders, the relative expressions of

Bax and Apafl were increased on both El2.5 and El3.5 (Figure 3-6 I-J). Taken together, our data showed that, in the absence of ANp63, there was increased mitochondrial apoptotic activity in the developing bladder.

53 Wild-type p63-/- Hard palate Hard palate

Tongue Tongue

Figure 3-6. A-B: Hematoxylin and eosin staining of the sagittal sections of E11.5 wild-type andp63" embryos. C-D: Fluorescent TUNEL staining (arrows) of wild-type and p63'A UGS (200x). The DAPI staining of nuclei is shown in red to increase color contrast. E-F: The colorimetric immunostaining

54 (arrows) for cleaved caspase-3 in El 1.5 wild-type smdp63~A UGS (200x). HG: hindgut (200x). G-H:

Fluorescent TUNEL staining (arrow) of sagittal sections through the oral cavity of El 1.5 wild-type and p63~/~ embryos. I-J: The qPCR relative expressions of Box and Apafl in E12.5 and E13.5 p63 v" bladders. (A,C,E,G) Wild type. {B,D,F,H)p63A. HG, hindgut.

ANp63 is anti-apoptotic during bladder development

To confirm the anti-apoptotic role of ANp63 during bladder development, El3.5 p63"A bladder primary cell cultures were infected with bicistronic adenoviruses expressing

TAp63y, ANp63$, ANp63y and green fluorescent protein (GFP) or GFP alone for 24 hours.

The cells were then harvested and the expressions of Box and Apafl were quantified with immunoblots. Their gel tensiometry readings were compared. Compared to the GFP transfected control, transfection with ANp63$ or ANp63y adenoviruses significantly reduced the expressions of both Box (p<0.05) and Apafl(p<0.01), whereas transfection with TAp63y adenovirus led to an increase in the expressions of Box and Apafl (p<0.05)

(Figure 3-7A-B). To confirm the anti-apoptotic role of ANp63, organ cultures of E13.5p63

"A bladders were infected with bicistronic adenoviruses expressing ANp63y and GFP or

GFP alone for 24 hours. Box expression was examined by qPCR. We observed more than a

50% reduction of the Box relative expression in the ANp63y-infected p63~/~ bladder. These data suggest that ANp63, the predominant isoform of p63 in the bladder, plays an anti- apoptotic role during bladder development.

55 Figure 3-7. The E13.5 p63 bladder primary cell cultures were transfected with adenoviruses expressing green fluorescent protein (GFP), TAp63y, ANp63p and ANp63y. The tensiometry of Box,

Apafl, and p-actin bands was recorded. The ratios of fiaac/p-actin and Apafl/p-actin of the specimens were compared to that of the GFP-infected controls (assigned to be 100). The relative Bax/p-actin ratios and Apa/7/fi-actm ratios are shown in A and B, respectively (Student's t-test, *: p<0.05, ** : p<0.01). C-

D: Immunohistochemical staining of p53 in E11.5 wild-type andp&T7" UGS (200x). Arrows represent the ventral aspects of the UGS. E-F: Immunohistochemical staining of p73 in E11.5 wild-type and p63~/~

UGS (lOOx). G-H show the qPCR relative expressions of pS3 andp73 in E12.5 and E13.5 wild-type

(WT) andpoT7" bladders.

56 Apoptosis of bladder cells of E12.5 p6T~ mutants is associated with an

upregulation of p53 and p73 expressions

We then examined whether the expressions of p53 andp73 were affected in p63'A bladders.

Immunohistochemical staining showed an upregulation of p53 expression in the ventral aspect of El 1.5 p63'A UGS (Figure 3-7C-D). There appeared to be an upregulation of p73 expression inp63'A UGS as well (Figure 3-7 E-F). We proceeded to quantify the p53 and p73 mRNA expressions in El2.5 and El3.5 wild-type andp63'A bladders using real-time

PCR. There was a compensatory upregulation of the relative expressions of both p53 and p73 in E12.5 p63'A bladders, compared to those of the wild-type controls (p<0.05,

Student's t-test). Interestingly, in E13.5 p63'A bladders, the expressions of bothp53 and p73 were downregulated (Figure 3-7G-H, p<0.01, Student's t-tests). The transient upregulation ofp53 and/?73 expressions inp63'A bladders coincides temporally with increased apoptosis (Figure 3-6C-F).

Failure of ventral UGS mesenchymal induction and proliferation in the absence of epithelial ANp63

Appropriate epithelial-mesenchymal interaction is essential for normal bladder development; in the absence of bladder epithelium, bladder smooth muscle does not develop normally (Baskin et al., 1996a). To examine how thep65-null epithelium affects the adjacent mesenchyme, we studied the expression of Msx-1, a homeobox gene that is induced in the mesenchyme by an epithelium-derived signal. In the wild-type control embryos, Msx-1 was expressed in the ventral sub-epithelial mesenchyme of El 3.5 bladders, suggesting induction of Msx-1 in the mesenchyme by the ventral UGS epithelium (Figure

57 3-8A, arrow). In contrast, the expression of Msx-1 is greatly reduced or absent in the sub epithelial mesenchyme of El 3.5 p63'A bladders (Figure 3-8B). To assess whether thep63- positive epithelium release mediator(s) critical for homeostasis of the mesenchyme, we studied the expression of Fgf-8, another marker normally induced in the apical ectodermal ridge by p63, by mRNA in-situ hybridization (Mills et al., 1999; Yang et al., 1999). Fgf-8 is normally expressed in the mesenchyme of El 1.5 wild-type UGS (Maruoka et al., 1998)

(Figure 3-8C). We found that the expression of Fgf-8 was downregulated in the p63'/' ventral UGS (Figure 3-8D). These results suggest that p63 deficiency in UGS epithelium is associated with failure of induction in the adjacent UGS mesenchyme, especially ventrally.

Epithelial-mesenchymal transition (EMT) is a cellular mechanism during which certain cells switch from an epithelial to mesenchymal status. During development, EMT is involved in neural crest migration, heart morphogenesis, and formation of palate mesenchymal cells from the oral epithelium on El3.5 in mice (Larue and Bellacosa, 2005).

We questioned whether bladder epithelial cells undergo EMT, as this might explain why the failure of epithelial development is associated with failure of mesenchymal development. We studied the expression of Snail {Snail), which induces the epithelial- mesenchymal transition (Barrallo-Gimeno and Nieto, 2005; Cano et al., 2000). We could not detect any Snail (Snail) expression in either the wild-type orp63'A El4.5 bladders by in-situ hybridization (Figure 3-8E-F). These results failed to demonstrate the role of EMT at this stage of bladder development.

To explain the paucity of smooth muscle in the ventral bladder wall, mesenchymal cell proliferation was studied with the incorporation of BrdU. Msx-1 is commonly expressed in

58 regions of rapid proliferation (Bendall and Abate-Shen, 2000) and Fgf-8 regulates survival and proliferation in the anterior heart field (Park et al., 2006). In the absence of epithelial

ANp63 expression, mesenchymal expressions of both Msx-1 and Fgf-8 were decreased.

This was accompanied by a reduction in cell proliferation in both the epithelium and mesenchyme, especially ventrally (Figure 3-8 G-H). The difference in cell proliferation between p63"A and the wild-type control was statistically significant (ANOVA, dorsal epithelium and mesenchyme: p<0.01, ventral epithelium and ventral mesenchyme: pO.OOOl) (Figure 3-8 I). Taken together, in the absence of ANp63, the ventral bladder epithelium fails to induce Msx-1 and Fgf-8 in the adjacent mesenchyme. This is associated with a decreased mesenchymal cell proliferation.

59 p63-/-

^sj^r-?^:-^,*:;^ :A Bar -»•*-^ "v.—*- ti •*•;'«• j?m y iff* •**• '-J*'- i • - ^

' *..?4 C Ventral : j^W^'%\ - • V flk£f Fgf-8 E11.5

M-snail E14.5

BrdU ^fc*" E11.5

ventral ventral dorsal dorsal epithelium mesenchyme epttheHum mesenchyme

Figure 3-8. Epithelial-mesenchymal interactions. A-B: Msx-1 expressions (immnohistochemistry) in transverse sections of E14.5 wild-type smdp63v~ bladders (lOOx). C-D: Fgf-8 in-situ hybridization in the

60 sagittal sections of El 1.5 wild-type and p63 UGS (lOOx). E-F: m-snail in-situ hybridization of E14.5 wild-type rnidp63v~ bladders (sagittal sections) (lOOx). G- H: BrdU incorporation in the sagittal sections of wild-type and p63-/- E11.5 UGS (lOOx). Arrows represent the ventral aspects of the bladders. I:

Histogram of cell proliferation in both epithelium and mesenchyme of El 1.5 wild-type and/765"" UGSs.

Smooth muscle differentiation is disturbed in p63-deficient bladders

Msx-l is known to repress terminal differentiation (Bendall and Abate-Shen, 2000). To determine the effect of Msx-l down-regulation on smooth muscle differentiation, the expression of smooth muscle heavy chain myosin, which is present only in mature smooth muscle cells (Owens, 1995), was studied immunohistochemically. In El4.5 wild-type bladders, smooth muscle heavy chain myosin expression was absent or very weak, whereas, in the p63'/" bladder, its expression was strong in the thin ventral bladder wall (Figure

3-9A-B). This suggests the absence of Msx-l in the ventral mesenchyme allowed premature smooth muscle differentiation in the adjacent mesenchyme. Despite premature smooth muscle differentiation, the El8.5p63 ~!~ bladder contained little or no smooth muscle ventrally, but did retain a thin layer of smooth muscle dorsally (smooth muscle cc- actin). Moreover, the lamina propria was either greatly reduced or absent in the p63'A bladder (Figure 3-9 C-D). In addition, unlike the wild-type bladder detrusor muscle, which displayed well-organized smooth muscle stratification, the dorsal smooth muscle in the p63

~'~ bladder was disorganized and non-stratified (Figure 3-9E-F). To assess what epithelial signal to mesenchyme may be affected in p63~/~ bladder, in-situ hybridization of Shh was performed. The Shh expression in the ventral UGS epithelium was reduced or absent in p63~A bladder (Figure 3-10).

61 Wild-type

• ,.•« SM heavy ,*;.;•' =.?^ -:^,i$f'" bladder chain V.\--;-.Vv ,iiaddio> -'-ifc*': HBb •-. • •' ' .J < , y V , myosin *•»>?!, * -f ">? * .* T-'-V'>'

SM alpha actin

H&E It'. ^SHEs

Figure 3-9. Smooth muscle development of bladders. A-B: Smooth muscle heavy chain myosin expressions in the transverse sections of the E14.5 wild-type and p63^~ bladders. The intestinal muscular wall serves as an internal control (arrow, lOOx). C-D: Smooth muscle a-actin actin expressions in the sagittal section of E18.5 wild-type and p63'A bladders (40x). Larger arrow in C,D

62 represent the ventral bladder wall. Small arrow in D represents dorsal bladder wall. E-F: Hematoxylin and eosin staining of E18.5 wild-type and/>6J" bladders (sagittal sections, 200x).

Figure 3-10. In situ-hybridization of Shh in E11.5 wild-type (A) and/KiJ A (B) UGS. The arrows

represent the ventral aspects of UGS ( n=3).

Discussion

Our experimental findings support a number of conclusions. First, ANp63 is preferentially expressed in the ventral UGS during early bladder development. Second, in the absence of

ANp63, ventral bladder epithelial development is abnormal due to an increase in ventral bladder epithelial apoptosis. Third, ANp63 prevents this ventral bladder epithelial apoptosis by, at least partially, downregulating the mitochondrial apoptotic pathway. Finally, in the absence of ANp63, there is decreased cell proliferation in the UGS mesenchyme. The increased epithelial apoptosis and decreased cell proliferation in both epithelium and mesenchyme ultimately results in bladder exstrophy in p63~' embryos.

Early ventral p63 expression and ventral midline defects in p63"'" mutants

In the current study, we demonstrated that, during early development, p63 is preferentially expressed in the epithelia of ventral structures, including the genital tubercle (Figure 3-3B),

63 oral cavity (Yang et al., 1999), and ventral UGS (Figure 3-3C) (Kurita et al., 2004a). In the absence of p63, development of these ventral structures is defective, and is manifested as a truncated maxilla, cleft palate, ventral pelvic wall defect (Ince et al., 2002), bifid genitalia, and bladder exstrophy. We have established that ANp63 is the predominant/?^ isoform throughout bladder development. In a zebra fish model, ANp63 has been noted to be required for ventral specification, with loss of ANp63 resulting in a reduction of ventral

(non-neural) ectoderm, whereas overexpression of ANp63 expands the ventral ectoderm

(Bakkers et al., 2002). ANp63 is also a direct target of Bmp4 (Bakkers et al., 2002), a morphogen vital for correct ventral patterning (Lemaire and Yasuo, 1998). In light of these findings, our results suggest that ANp63 may be a ventralizing protein in mammalian development and absence of ANp63 may account for the ventral midline defects seen in p63'A embryos.

Msx-1 is a mesenchymal marker, the expression of which is induced by adjacent epithelial tissue (Jowett et al., 1993). Inp63'A embryos, where limb buds are absent or vestigial, Msx-

1 expression in the progress zone beneath the apical ectodermal ridge of the limb bud is greatly reduced or absent (Mills et al., 1999; Yang et al., 1999). Our findings further suggest that epithelial-mesenchymal interaction also plays an important role in ventral bladder development. Msx-1 expression in the ventral mesenchyme is deficient in thep63'A bladder, suggesting thatp<55-deficient epithelium fails to appropriately induce the adjacent mesenchyme (Figure 3-7A-B). This decreased Msx-1 expression is associated with a reduction in UGS mesenchymal proliferation and premature terminal differentiation of the smooth muscle. Interestingly, Msx-1 is also a ventralizing signal responsible for mesoderm

64 patterning under the regulation of Bmp4 in xenopus (Takeda et al., 2000). In summary, a failure of mesenchymal induction may be responsible for the changes seen mp63~/~ ventral

UGS mesenchyme.

Notably, the specific epithelial signal to the UGS mesenchyme remains undefined. A possible candidate protein for this role is the secreted diffusible morphogen, Sonic hedgehog (Shh). Shh is known to participate in numerous developmental processes involving epithelial-mesenchymal interaction (Ingham and McMahon, 2001). Shh also promotes proliferation and inhibits differentiation in renal mesenchymal cell development

(Yu et al., 2002). Furthermore, Shh is expressed in the UGS epithelium during early bladder organogensis (Bitgood and McMahon, 1995; Mo et al., 2001). We found that the expression of Shh was reduced in the ventral p63'A UGS (Figure 3-10), where the epithelium is squamous and uncommitted. The reduction of Shh signaling may contribute to the reduction in cell proliferation and premature terminal differentiation in ventral bladder mesenchymal development. This remains to be determined.

Temporospatial restriction of p63 expression determines epithelial commitment to stratification and differentiation

The exact role of p63 during epithelial development is controversial (McKeon, 2004). p63 either commits the epithelium to stratification (Mills et al., 1999) or maintains epithelial proliferation (Yang et al., 1999). Koster et al suggested that TAp63 initiates epithelial commitment and that ANp63 is responsible for epithelial differentiation (Koster et al.,

2004). Our study shows that, during the developmental period examined (El 1.5 - 17.5),

ANp63 expression started in the ventral UGS and progressively extended to the remaining

65 bladder urothelium. In the p63"" bladder, a clear phenotypic difference is noted in the epithelium along the dorso-ventral axis of the bladder. The ventral epithelium is squamous, with almost no adjacent smooth muscle, whereas the dorsal epithelium is cuboidal, with a thin layer of disorganized muscle. The distal ventral UGS epithelium, which is destined to become the urethra, transforms into an intestine-like epithelium (Signoretti et al., 2005).

The ventral epithelium remains both uncommitted (positive for Kl 8) and undifferentiated

(negative for uroplakin III). The dorsal epithelium, however, is both committed (negative for K18) and differentiated (positive for uroplakin III). These results suggest that the timing of p63 expression in normal bladder development determines the extent of developmental delay. Thus, the absence of p63 during early ventral bladder development affects both epithelial commitment and differentiation, whereas in dorsal epithelium, where p63 is normally expressed later, p63 deletion does not seem to affect either commitment or differentiation.

ANp63 is prosurvival in ventral bladder development

This study provides in vivo evidence that ANp63 is anti-apoptotic during bladder development. In vitro study showed that ANp63 can compete for the apoptotic target gene site or form a transactivation-incompetent heterocomplex with p53 or TAp73, thus inhibiting apoptosis (Yang et al., 2002). In our study, apoptotic activity was increased in the ventral UGS epithelium in the absence of ANp63 (Figure 3-6D and F). Expression of mitochondrial apoptotic mediators Box and Apafl was also elevated in p63~/~ bladders; elevated Box and Apafl expressions in p63'A bladders were rescued by overexpression of either ANp63$ or ANp63y. This rescue is corroborated by a previous study, where ectopic

66 ANp63a expression in the epidermis reduces epidermal susceptibility to ultraviolet light-

induced apoptosis (Liefer et al., 2000). In the developing sympathetic neurons, where

ANp73 is the predominant isoform, ap73 knockout leads to increased apoptosis in a

fashion similar top63~/~ mutation in the ventral bladder. Overexpression of ANp73 rescues

the sympathetic neurons from apoptosis induced by withdrawal of the nerve growth factor

(Pozniak et al., 2000). Our results not only confirm the functional consistency of AN

isoform proteins of the p53 family, but also demonstrate the anti-apoptotic role of the

ANp63 isoform during normal mammalian development.

ANp63 is also detected in oral carcinoma and the intensity of its expression increases with the severity of dysplasia (Nylander et al., 2002), suggesting an oncogenic role or stem cell pluripotency factor for the ANp63 isoform. The possible mechanism may involve &p53 target gene, p21, as ANp63a binds thep21 promoter, represses its transcription, and permits cell cycle progression (Westfall et al., 2003). The scenario is similar to ANp53, which is tumorigenic (Mowat et al., 1985). Overexpression of a C-terminal dominant-negative fragment of p53 (ANp53) (Shaulian et al., 1992) in human urothelial cells has been reported to increase the cell proliferation rate (Shaw et al., 2005). In this study, p63~/~ mutation has been shown to be associated with a significant reduction of cell proliferation in the ventral bladder epithelium. This suggests that ANp63 also promotes epithelial proliferation in mammalian bladder development. Autocrine regulation of urothelial cell proliferation via the EGFR signaling loop seen in urothelial regenerative response could also play a role in urothelial development (Varley et al., 2005).

67 Our data showed that deletion of p63 is associated with compensatory upregulation ofp53 expression in the bladders of younger embryos (El 1.5-E12.5). This p53 upregulation may further contribute to the apoptosis seen in the ventral p63'A bladder, in addition to the protein-protein and protein-target gene interactions. Although the expression ofp 73 mp63"

A bladders is also upregulated, its role in inducing apoptosis is uncertain, as the predominant isoform of p73 expressed in bladder has not been studied.

In conclusion, we have established ap63'A murine model for BE. We have found that

ANp63 is expressed initially in the ventral bladder urothelium, and possesses a ventralizing property. Although the complete bladder urothelium fails to stratify in the absence of p63, ventral urothelial development is more delayed than the dorsal epithelium, being both uncommitted and undifferentiated. We found that ANp63 is the predominant isoform in the bladder. Without ANp63, urothelial apoptosis is increased and cell proliferation is reduced.

We also noted a concurrent upregulation of p53 expression. Overexpressions of ANp63y and ANp63fi rescue the expression levels of mitochondrial apoptotic mediators Box and

Apafl in p63'A bladders. We conclude that ANp63 plays a crucial anti-apoptotic role during ventral bladder development.

68 Chapter 4 Shh transcriptional factor GU2 regulates

bladder mesenchymal patterning In the previous chapter, we have demonstrated that p63 is crucial for bladder epithelial survival mdp63 deficient urothelium fails to induce bladder mesenchyme, resulting in bladder exstrophy phenotype. This is likely to be due to an interruption of the epithelial signaling to the adjacent mesenchyme. p63 maintains the survival of urothelium which synthesizes and secretes Shh. The diffusible morphogen Shh is expressed in the bladder urothelium and therefore is a candidate epithelial signal. Yet how Shh regulates the bladder mesenchymal cell proliferation and smooth muscle differentiation is not known. Bmp4 is a

Shh mesenchymal target gene in many organs. Whether and how Bmp4 transduces the Shh regulation signal during bladder mesenchymal development have not been studied. In this chapter, we set out to answer these questions.

Abstract

Developmental and congenital bladder anomalies are a major challenge in pediatric urological practice. Understanding the mechanism of bladder development is clinically important. The epithelial-mesenchymal interaction has been shown to be crucial in bladder development. Current evidence suggests that Sonic hedgehog (Shh) is a candidate epithelial signal for bladder development. Yet the mechanism by which Shh patterns bladder development is still unknown. In this study we have confirmed that Shh is an epithelial signal in mammalian bladder. In a wild-type bladder, Shh transcriptional factor GH2 and the putative Shh target gene Bmp4 were expressed in the inner mesenchymal zone where active cell proliferation was observed. In an El5.5 primary GH2"A bladder mesenchymal cell cultures, transfection with adenoviruses expressing ANGU2, a constitutionally active form of GU2, upregulated the Bmp4 expression and promoted cell proliferation. In the outer

70 mesenchymal zone, where GU2 and Bmp4 expressions were not detectable, smooth muscle ct-actin was expressed and there were less proliferating cells. In the GU2'A embryo bladders, the Bmp4 expression was lost and ectopic smooth muscle was detected in the inner mesenchymal zone. In addition, the pattern of the cell proliferation was disorganized.

Furthermore, exogenous Bmp4 (lOng/ml) repressed smooth muscle differentiation. The repression was partially rescued by Noggin (300ng/ml), a Bmp4 antagonist. We conclude that Shh transcriptional factor Gli2 regulates the bladder mesenchymal patterning.

Introduction

The bladder is responsible for storing and passing urine. It consists of an urothelium layer, a lamina propria layer, and the smooth muscle (SM) layer (detrusor muscle). The bladder is derived from the urogenital sinus (UGS). The UGS epithelium differentiates into the urothelium. The inner zone mesenchymal cells differentiate into the fibroblasts of lamina propria whereas the outer zone mesenchymal cells differentiate into the smooth muscle cells. Epithelial-mesenchymal interactions, which are crucial to gut development (Kedinger et al., 1988), are also instrumental in bladder development. In a recombination and transplant study, Baskin et al. showed that without an epithelial signal, the smooth muscle of the bladder fails to develop (Baskin et al., 1996a; Baskin et al., 1996b). Furthermore, the

UGS epithelial signal has been demonstrated to be diffusible (Liu et al., 2000). Recently, there is evidence that Sonic hedgehog (Shh) may be a urothelial signal, as Shh, GUI, Pet J are expressed in the epithelium and mesenchyme of developing bladders respectively. In addition, Shh''' and GH2'A bladders are hypoplastic (Haraguchi et al., 2007). The differentiation of the bladder smooth muscle cells, which are derived from Shh-responsive

71 mesenchymal cells (Haraguchi et al., 2007), may be regulated by Shh (Shiroyanagi et al.,

2007).

Shh is a secreted epithelial morphogen and is involved in many epithelial-mesenchymal interactions during development (Bitgood and McMahon, 1995; Ingham and McMahon,

2001). Ptcl and Smo are the membrane receptors of Shh. Gli2 and Gli3 are respectively principally the activator and repressor transcriptional factors of Shh signaling (Ingham,

1998; Ingham and McMahon, 2001), whereas Glil is a secondary transducer (Park et al.,

2000) that is regulated by Gli2 and GH3 (Ding et al., 1999). In vertebrate hindgut development, Shh is an endodermal (epithelial) signal to the adjacent mesenchyme

(Ramalho-Santos et al., 2000; Roberts et al., 1995). Shh is also expressed in the UGS epithelium (Bitgood and McMahon, 1995; Haraguchi et al., 2007; Shiroyanagi et al., 2007).

Although Shh promotes mesenchymal cell proliferation in many organs during development (Freestone et al., 2003), it represses SM differentiation in chick gizzard mesenchyme (Sukegawa et al., 2000), mammalian ureteric mesenchyme (Yu et al., 2002), and gut villi (Madison et al., 2005). The mechanism by which Shh signaling pathway regulates bladder smooth muscle differentiation remains unclear.

Shh is known to induce bone morphogenetic protein-4 (Bmp4) expression in vertebrate hindgut mesenchyme (Roberts et al., 1995) and mammalian ureteric mesenchyme (Yu et al.,

2002). Bone morphogenetic proteins (BMPs) belong to the secreted transforming growth factor-P superfamily (TGF-P), and are expressed in many organs where epithelial- mesenchymal interaction takes place (Hogan, 1996; Winnier et al., 1995). Bmp4 has

72 recently been shown to be a candidate Shh target gene in the mesenchyme during bladder

development (Shiroyanagi et al., 2007). In El 1 mice ureters, over-expression of Bmp4

expands the SM a-actin-positive cell population (Raatikainen-Ahokas et al., 2000), presumably due to increased differentiation. In post-natal vascular SM culture, over-

expression of Bmp4 also up-regulates the SM markers (King et al., 2003). These data

suggest that Bmp4 promotes SM differentiation. However, it is puzzling that in chick gizzard, Bmp4 is expressed in the inner non-muscle mesenchyme, whereas SM forms in the outer zone mesenchyme (Sukegawa et al., 2000). In another words, Bmp4 and SM do not co-localize. In murine bladders, SM differentiation also begins at the peripheral mesenchyme (Baskin et al., 1996c). This suggests a contradictory role for Bmp4: in that it may repress smooth muscle differentiation. In summary, Bmp4 is a target gene of Shh in the bladder mesenchyme, but its role in bladder SM differentiation is still controversial.

In the current study, we report that the bladder mesenchyme can be divided into inner and outer zones. GH2 is expressed in the inner mesenchymal zone where cell proliferation is more active. Bmp4 is also expressed in the inner mesenchymal zone. Transfection of the bladder mesenchymal cells with adenoviruses expressing ANGU2 promotes cell proliferation and upregulates Bmp4 expression. In the outer zone where the expressions of

GU2 and Bmp4 are not detectable, SM a-actin is expressed. In the GH2'/' bladders, the pattern of mesenchymal cell proliferation is disorganized. Furthermore, the normal expression of Bmp4 is lost and ectopic smooth muscle differentiation can be detected.

Addition of Bmp4 protein (lOng/ml) repressed smooth muscle differentiation and the

73 repression was rescued by Noggin. We conclude that the Shh transcriptional factor Gli2

maintains the radial patterning of the developing bladder.

Methods

Mutation Analysis

All animal protocols were reviewed by the ethic committees prior to conducting the

experiments (Health Department of Hong Kong, China and Animal Ethic Committee,

Hospital for Sick Children, Toronto, Canada). Heterozygous mutant mice were inbred and

cross bred to generate Shh'^, GH2'/\ GH2"/';GH3+/', and GU2'A;GU3~/~ mutant embryos. The

embryos were genotyped as previously described (Mo et al., 2001), fixed, embedded in

paraffin, sectioned and stained with hematoxylin and eosin for microscopic examination.

Primary cell cultures and transfection

Time-pregnant Sprag-Dawley rats and Gli2"/~ mice were sacrificed. The fetuses were first

removed. The fetal bladder was then dissected out under dissecting microscope. The bladders were incubated at 37 °C in collagenase type II (0.2 mg/ml ) for 20 minutes.

Epithelium was then dissected off the bladder mesenchyme under dissecting microscope.

The bladder epithelium and mesenchyme were then separated under microscope. The mesenchyme was cut into smaller pieces with micro-scissors and dissociated with collagenase Type II (Invitrogen, Carlsbad, CA, USA, 0.2mg/ml of EMEM medium) for 2 hours at 37°C. The mesenchymal cells were centrifuged and cultured on laminin-coated plates (Gibco, Invitrogen, Carlsbad, CA, USA, 0.2mg laminin/ml of PBS) in EMEM culture medium (Wisent, St. Bruno, Quebec, Canada) plus 20% fresh bovine serum and antibiotic/antimycotic (Invitrogen, Carlsbad, CA, USA) (Cheng et al., 2006). The culture

74 medium (control), Shh (0.4 mg/ml, R&D system, Minneapolis, MN, USA), Bmp4 (10-50 ng/ml, R&D system, Minneapolis, MN, USA) and Noggin (300 ng/ml, R&D system,

Minneapolis, MN, USA) proteins were added to the cells and cultured for a further 36 hours. Adenoviruses expressing green fluorescent protein (GFP) alone and expressing both

GFP and ANGU2 (a gift from Professor CM Fan, Department of Embryology, Carnegie

Institute of Washington, Baltimore, USA) were used to transfect the cultured cells for 36 hours (10 pfu/cell).

Immunoblot

As previously described (Liu et al., 2007), the cultured cells were lysed with lx PBS containing 1% P-40, 1% sodium deoxycholate, 5 mM EDTA, ImM EGTA, 2 mM PMSF,

0.1 mM leupeptin, 100 KIU/mL Trasylol, and 0.5 uM ALLN, and the cell lysates were resolved on 15% SDS-PAGE gels. After SDS-PAGE, the proteins were transferred on to nitrocellulose membranes. The membranes were blocked with a TBST containing 4% non fat milk powder, incubated overnight at 4 °C with the primary antibodies, i.e. SM a-actin

(1:2000, Sigma-Aldrich St. Louis, MO, USA), GAPDH (1:2000, Abeam Cambridge, UK),

Bmp4 (1:1000, Abeam, Cambridge, UK). They were then washed, and incubated with horseradish peroxidase conjugated secondary antibodies (1:8000, Invitrogen, Carlsbad, CA,

USA). The signals on the membranes were developed by chemiluminescence (Western

Lightning Chemilumines, Perkin Elmer, Waltham, MA, USA) and exposed to BioMax

Light films (Kodak, New Haven, CT, USA). The band intensities of the immunoblots were quantified by densitometry.

75 Immunohistochemistry and TUNEL

The embryos were removed from the euthanized mice, fixed in 4% paraformaldehyde, embedded into paraffin and sectioned (7um). The slides were then de-waxed and re- hydrated. After quenching with 3% H2O2 in 10% methanol, retrieving antigens with antigen unmasking solution (Vector Laboratories) and blocking with Blocking Reagent (Roche), the anti-PCNA antibody (1:2000, Sigma-Aldrich St. Louis, MO, USA) was applied and the slides were incubated overnight at 4°C. After further washing, secondary antibodies were applied for 30 minutes. After treating with Avidin-biotin-peroxidase complex buffer, the slides were developed with DAB (Cheng et al., 1997; Cheng et al., 1999). TUNEL staining was performed as previously described (Cheng and Tarn, 2000).

RNA extraction and the real time PCR

The RNA was extracted from the mesenchymal tissue with the RNeasy Kit (Qiagen) and purified with the QIAquick PCR Purification Kit (Qiagen). The first strand cDNA were then synthesized (SuperScript™II First-strand Synthesis Kit, Invitrogen). qPCRs were performed using SYBR™. The relative expressions were analyzed according to Pfaffl's methods (Pfaffl, 2001), using p-actin as the endogenous control. The sequences of the qPCRprimers were: i) Bmp4: forward: TTCCTGGACACCTCATCACA, reverse: AACGATCGGCTGATTCTGAC, annealing temperature: 50.0 °C, 182 bp, ii)

Cyclin Dl: forward: ATGCTGGTTTTTGCCTGAAG, reverse:

TCCCCATCCATTCCATTAGA, annealing temperature: 45.0 °C, 177 bp, and iii) myocardin: forward: ATGCAGTGAAGCAGCAAATG, reverse:

AAGATGCCTGCTCAAAGGAA, 55.°C, 200 bp.

76 In-situ hybridization

The El2.5 wild-type mice embryos were fixed in 4% paraformaldehyde, dehydrated, paraffin embedded and sectioned (7um). The dewaxed slides were pre-fixed with 4% paraformaldehyde, permeabilized with proteinase K (0.02mg/ml), and treated with 0.2 M

HC1 solution and 0.1 M triethanolamine solution (TEA) plus 0.025ml acetic anhydride/liter of TEA. The slides were then hybridized with 4.0 ug/ml of DIG-labeled RNA probes

(Roche, DIG labeling mix) in formamide/sodium citrate-sodium chloride (SSC) buffer overnight at 55°C. The slides were then washed with 5 x SSC (sodium chloride and sodium citrate) solution, SSC/formamide solution and treated with RNase-A, 2 x SSC and 0.2 x

SSC before being blocked with the Blocking Reagent (Roche). The anti-DIG-alkaline phosphatase antibody (Roche) was then applied, followed by the alkaline phosphatase substrate BM Purple (Roche).

Results

Shh signaling is active in bladder development

To ascertain whether Shh is involved in bladder development, the expressions of Shh, Ptcl

(Shh receptor), GUI, GU2 and GU3 (Shh transcriptional factors) were determined by in-situ hybridization in developing (El2.5) wild-type murine bladders. We found that Shh was expressed in the UGS epithelium (Figure 4-IB) whereas its receptor Ptcl and (Figure 4-1

C). GUI, GU2 and GU3, were also expressed in the sub-epithelial mesenchyme (Figure 4-1

D-F). The results confirmed that Shh signaling pathway is activated during early bladder development.

77 Figure 4-1. Shh signaling pathway gene expressions in sagittal sections of E12.5 wild-type embryos

(200x). A: Hematoxylin and eosin staining showing the structure of ventral urogenital sinus (UGS) and dorsal hindgut (HG). B-F: In-situ hybridization studies of the UGSs. The white arrows represent the expressions of the genes of interest in the developing bladders.

To further assess the role of this signaling pathway in bladder development we performed mutation analysis on knock-out murine embryos. Compared to wild-type (WT) bladders, both Shh'1' and GH2~/~ bladders were contracted and hypoplastic, with a shorter bladder height and smaller luminal diameters (Figure 4-2 A-D). GH2~A mutants also developed imperforate anus and recto-urethral fistula (Figure 4-2 D). Further loss of the Gli gene dosage in GU2'/';GU3+/' and GH2'/~;GH3~/~ compound mutant bladders led to progressively more malformed bladders. The long axis of the GU2r/-;Gli3+/- bladder (Figure 4-2 F) was more contracted than that of the GU2'/' (Figure 4-2 D) bladder, whereas GU2~/~;GH3~/~ mutation resulted in a vestigial bladder (Figure 4-2 H). Our data confirmed that mutation of the Shh signaling pathway genes led to bladder anomalies in a gene-dose dependent fashion.

Furthermore, GH3 may play a role of an activator in bladder development.

78 Figure 4-2. Hematoxylin and eosin staining of the sagittal sections of wild-type and mutant murine bladders. A, C, E and G are the gestational stage-matched wild-type controls. B, D, F and H are the

E16.5 Shh'-, E17.5 GUI'', E18.5 GU2^;Gli3+/~, and E13.5 G/i2"";GW.J"" mutant bladders respectively.

The arrows represent the bladder lumens.

GH2 promotes cell proliferation in the inner mesenchymal zone

To assess of the effect of GU2 on bladder mesenchymal cell proliferation, we studied the expression of Cyclin Dl, marker of cell proliferation, with qPCR in E13.5 wild-type and

GH2A and primary mesenchymal cells. Our real time PCR results showed that the relative expression of Cyclin Dl was down-regulated in the El3.5 Gli2~' bladders (Figure 4-3 A,

Student-t test, p<0.05). The GH2'A primary cells but it was rescued by transfection for 24 hours with adenovirus that expressed ANGH2, a constitutionally active form of GU2 (Figure

4-3 B, Student-t test, p<0.05).

79 Figure 4-3. The real time PCR relative expression of cyclin Dl in E13.5 wild-type and GHZ bladders.

A: the cyclin Dl expressions in wild-type and GUT'' bladders. B: The relative expressions of cyclin Dl in E13.5 bladder mesenchymal primary cells cultured for 36 hours with adenoviruses expressing green fluorescent protein (GFP) alone and bicistronic adenovirus expressing both GFP and JNGU2.

To establish the relationship between Shh signaling and mesenchymal cell proliferation we studied the pattern of cell proliferation the wild-type and Gli2-/- bladders. In the wild-type bladders, Shh was expressed in the bladder urothelium (Figure 4-1 B) and Gli2 was expressed in the sub-epithelial mesenchyme (Figure 4-1 E). We found that in the E13.5 wild-type bladders, the inner mesenchymal zone contained significantly more PCNA positive cells (59%) than the outer zone (42%) (Student-t test, two-tailed, p<0.05) (Figure

4-4 C and E). On E14.5, the difference in the proliferative activity between the inner zone

(61%) and the outer zone (31%) was more significant (Student-t test, two-tailed, p<0.01)

(Figure 4-4 G). This inner zone of cell proliferation colocalizes with the Gli2 expression

(Figure 4-1 E). However, in the E13.5 GH2-/- bladders, there was no statistically significant difference in cell proliferation between the inner (48%) and the outer (53%) zones

(Student-t test, two-tailed, p>0.05) (Figure 4-4 D and F). The pattern of mesenchymal cell

80 proliferation was disorganized (Figure 4-4B, D and F). Hence, GH2 regulates the pattern of mesenchymal cell proliferation in bladder.

wild-type GU2-/-

inner zone

outer zone

81 Figure 4-4. PCNA immunostaining of the murine embryonic bladders. A and B: Low magnification of

E13.5 bladders (xlOO). The rectangles represent the inner and outer inner mesenchymal zones

magnified in C-F. High magnifications: C and £ (x 600), E and F (x 400) of the inner and outer zones of

the A and B respectively. G: E14.5 wild-type bladder.

GU2 represses smooth muscle differentiation in the bladder

To assess the effect of GH2 on smooth muscle differentiation, we examined the expression

of myocardin, a transduction co-factor in smooth muscle differentiation by real time PCR.

Compared with the wild-type bladder, the myocardin/fi-actin ratio in El5.5 GH2~/~ bladders

was up-regulated (increased by 2.7 times, Student-t test, p<0.05, data not shown),

suggesting GU2 represses SM differentiation.

We then assessed the SM a-actin expression in the embryo bladders with immunohistochemistry. In the wild-type bladders, the smooth muscle a-actin expression began at the periphery of the bladder mesenchyme at El 3.5 (Figure 4-5 A). It then expanded centripetally on El5.5 (Figure 4-5 C) and El7.5 (Figure 4-5 E, G). In the Gli2~A

El3.5 bladder, the mesenchymal SM a-actin expression was more diffuse (Figure 4-5 B, the white arrow). In the E15.5 and E17.5 GU2'f' bladders, ectopic SM a-actin expressions were detected in the lamina propria adjacent to the epithelium, and the pattern of the expression was disorganized (Figure 4-5 D, F and H, the white arrows). The results suggest that GH2 represses smooth muscle differentiation.

82 Wild-type GH2-/-

E13.5

E15.5

E17.5

Figure 4-5. The SM a-actin immunohistochemistry (brown) of sagittal sections of the wild type and

GHTA bladders. A-B: 200 x, C-F: lOOx, G-H: 400x. The rectangles in E-F represent the areas enlarged in G-H. The white arrows represent ectopic smooth muscle a-actin expression in the lamina propria of

the GUT' bladders.

83 GU2 up-regulates Bmp4 expression in the sub-epithelial bladder mesenchyme

To establish whether GU2 regulates Bmp4 expression in mammalian bladders, we first studied the Bmp4 expression in El2.5 bladders by in-situ hybridization. In the wild-type bladders, Bmp4 was expressed in the inner mesenchymal zone adjacent to the Shh- expressing epithelium (Figure 4-6 A, arrow). GU2 is normally expressed in the inner mesenchymal zone as well (Figure 4-1 E). In the GU2'A bladder, the Bmp4 expression was not detectable (Figure 4-6 B, arrow), suggesting that Bmp4 is a bladder mesenchymal target gene of GH2. To confirm the finding, the relative expression of Bmp4 was assessed with qPCR. We found that, the expression of Bmp4 was down-regulated in the GH2'A bladder mesenchyme (Figure 4-6 C, ANOVA, p<0.05) but this was rescued by transfection with

ANGH2, a constitutionally active form of GH2 (Relative expression = 3.2, ANOVA, p<0.05)

(Figure 4-6 D). Taken together, these results suggest that GH2 up-regulates Bmp4 expression in the sub-epithelial mesenchyme of the bladder.

84 C 17 D G//2V- mesenchymal cell culture

c 1 I 0.8 J2 a. 0.4 m 0.2 ° 0.5 0 wild-type Gli2-/- C3FP deltaN Gli2

Figure 4-6. The Bmp4 expressions in wild-type and GUI'' murine bladders. A and B: Bmp4 expressions

(in-situ hybridization) in wild-type and GUI'' E12.5 bladders. The arrows represent the inner mesenchymal zone of the developing bladders where Bmp4 is normally expressed. C: The real time

PCR relative expression of Bmp4 in the wild-type and GUI'' E13.5 bladders. D: The qPCR relative expression of Bmp4 in E13.5 GU2~/~ mesenchymal cell cultures transfected with adenoviruses expressing

GFP and AN GU2 respectively.

Bmp4 Represses Bladder Smooth Muscle Differentiation

To examine the effect of Bmp4 on SM differentiation in the bladder, El5.5 wild-type murine bladder mesenchymal cells were cultured with an increasing concentration of Bmp4 protein (10, 30 and 50 ng/ml of medium). The results showed that the Bmp4 effect on

smooth muscle a-actin expression behaved in a biphasic fashion: at a low level (10 ng/ml),

85 it repressed and at a high level (50 ng/ml) it up-regulated the a-actin expression (Figure 4-7

A). Addition of Noggin protein (300ng/ml), a Bmp4 antagonist, into the wild-type El 5.5 bladder mesenchymal cells cultured with Bmp4 (lOng/ml) rescued the expression of SM a- actin (Figure 4-7 B and C, ANOVA, p<0.05). In summary, Bmp4 (lOng/ml) represses smooth muscle differentiation in the bladder mesenchyme at low concentration.

Medium +Bmp4 +Bmp4 B +Noggin

actin

Figure 4-7. SM a-actin immunoblots of the primary mesenchymal cell cultures of E15.5 murine bladders. A: The biphasic effect of Bmp4 dosage on smooth muscle a-actin expressions. B and C: The

SM a-actin expressions in cells cultured with Bmp4 (lOng/ml), plus or minus Noggin.

86 Epithelial mesenchymal interaction

The Shh-Gli2 signaling cascade may represent the epithelial signal regulating the mesenchyme development. We then examined the mesenchyme signal regulating epithelial development with two gut epithelial markers and two bladder epithelial markers. Alkaline phosphatase is a marker for small bowel epithelium where as PAS (periodic Acid Schiff) stain is a marker for the large bowel epithelium (mucin). The uroplakin is a marker for terminally differentiated transitional epithelium whereas p63 marker the basal layer of the stratified transitional epithelium. We found that Shh~/~ bladder epithelium does not differ significantly from that of normal bladder control, suggesting that the Shh, secreted by urothelium, does not have autocrine effect on urothelium. We have shown that GH2 and

GU3 are expressed mainly in bladder mesenchyme (Figure 4-1). GH2"/' bladder epithelium showed weaker p63 expression and a stronger uroplakin expression. In addition, it also stained positive for alkaline phosphatase and PAS, suggesting an aberrant epithelial differentiation (Figure 4-8 I-L). On the other hand, GH3'A bladders retained p63 expression but had no detectable uroplakin expression, suggesting that GH3 positive mesenchyme signaling is crucial for the terminal differentiation of the bladder urothelium (Figure 4-8 P).

Alternatively, low levels of GU2 and GU3 expressions may exist, directly influencing the bladder urothelium development.

87 Alkaline PAS Uroplakin p63 phosphatase

wild- type

Shh-/-

GU2-/-

GU3-/-

Figure 4-8. Epithelial markers, alkaline phosphatase, PAS, uroplakin and p63 in wild-type, Shh^',Gli2TA and Gli3r' bladders (E17.5).

Discussion

In this study, we report that Shh transcriptional factor GU2 promotes cell proliferation and represses smooth muscle differentiation. GH2~' bladders had disorganized pattern of mesenchymal cell proliferation and ectopic expression of SM a-actin in the sub-epithelial mesenchyme. In addition, GU2 up-regulates the expression of Bmp4 and Bmp4 (10 ng/ml) represses smooth muscle differentiation in the bladder mesenchyme. We conclude that GU2 maintains the radial patterning of the developing bladder.

88 Shh transcriptional factor GH2 regulates the radial patterning of the bladder mesenchyme

Hedgehog was originally discovered to function as a segment polarity gene, governing the anterior-posterior patterning of Drosophila laval segments (Nusslein-Volhard and

Wieschaus, 1980). In the mammalian and vertebrate limb buds, Shh in the zone of polarizing activity regulates the anterior-posterior polarity of digit formation (Niswander et al., 1994; Riddle et al., 1993; Tarchini et al., 2006). Similarly, Shh is implicated in maintaining the central nervous system polarity (Echelard et al., 1993). During the genital tubercle development, the Shh polarizing activity in the urethral epithelium orchestrates its patterning (Perriton et al., 2002). In the current study, we found that, Shh via its transcriptional factor Gli2 regulates the radial pattern of mammalian bladders.

Shh has been shown to control both the proliferation and survival of progenitor cells in the neural tube through Gli transcriptional factors (Cayuso et al., 2006). In bladders, while Shh is synthesized in the urothelium (Figure 4-1 B), the transcriptional factors GU2 is expressed in the inner mesenchyme

(Figure 4-1 E). The recently reported difference otPtcl expressions in sub-epithelial and sub-serosal mesenchymal cells suggests a Shh gradient along the radial axis of mesenchyme (Shiroyanagi et al.,

2007). Furthermore, our results show that GU2 is expressed in the inner mesenchymal zone where there the cell proliferation is more active (Figure 4-4 Figure 4-4 A and G). Transfection of Gli2'A mesenchymal cells with ANGH2 adenovirus promotes cell proliferation (Figure 4-3 B). The pro-proliferation property of GU2 may account for the hypoplasia seen in GU2'/" and Shh'A bladders (Haraguchi et al., 2007). The inner zone mesenchyme contains smooth muscle progenitor cells that are responsive to Shh signaling (Haraguchi et al., 2007) and Shh promotes smooth muscle progenitor cell

89 progenitor cells that are responsive to Shh signaling (Haraguchi et al., 2007) and Shh promotes smooth muscle progenitor cell proliferation in ureteric mesenchyme (Yu et al.,

2002). Deletion of Shh results in reduction of smooth muscle in the gut (Ramalho-Santos et al., 2000) and pelvic organs (Yucel et al., 2004). Addition of cyclopamine into the bladder organ culture leads to reduction of SM a-actin expression (Shiroyanagi et al., 2007), probably secondary to repression of the Shh-responsive smooth muscle progenitor cells.

The Shh gradient, via GU2 (Figure 4-1 E), establishes the pattern of active proliferation in the inner mesenchymal zone (Figure 4-4 C). In the GU2-/- bladders, the polarized pattern of the inner zone of cell proliferation and the outer zone of mesenchymal differentiation is lost

(Figure 4-4). The Shh gradient from the epithelium to the peripheral mesenchyme may also regulate the fates of mesenchymal cells. In chick neural-plate tissue, the level of Shh and the duration of exposure to Shh specify multiple cell identities, as a twofold or threefold increase in Shh concentration is sufficient to determine cell size, shape and type (Agarwala et al., 2001). In addition, the bladder expressions of Shh ,GH1, Ptcl and Bmp4 decrease while those of SM a-actin, SM-y actin, SM-heavy chain myosin and calponinl increase from E12.5 to E15.5 (Shiroyanagi et al., 2007). The temporal down-regulation of Shh signaling during bladder development hence provides additional control of bladder smooth muscle differentiation. Nevertheless, cell proliferation does take place in the absence of

Shh signaling (Figure 4-2 B).

We also found that in the inner mesenchymal zone where GU2 was expressed, there was no

SM a-actin expression. On the other hand, deletion of GU2 led to up-regulation of

90 myocardin, a co-factor of smooth muscle differentiation and ectopic SM a-actin expression in the inner zone epithelial mesenchyme (Figure 4-5). We conclude that GU2 represses SM differentiation. Taken together, the GH2 regulates the radial pattern of mesenchymal cell proliferation and SM differentiation in developing bladders.

GH2 regulates the smooth muscle differentiation via its action on Bmp4

GH2 up-regulates Bmp4 expression in bladder mesenchyme

In Drosophila, the Bmp4 homologue decapentaplegic (dpp) is a target gene of Shh (Basler and Struhl, 1994). In the vertebrate hindgut(Roberts et al., 1995) and bladder, Bmp4 may be a target gene of Shh, since Shh induces (Haraguchi et al., 2007) and cyclopamine (Shh antagonist) represses (Shiroyanagi et al., 2007) the Bmp4 expression in murine bladder mesenchyme. In the current study, we have demonstrated that Bmp4 expression colocalizes with that of GH2. GH2'A mutation leads to the loss of bladder mesenchymal Bmp4 expression. Moreover, transfection of GH2'A mesenchymal cell culture with adenovirus expressing ANGH2 up-regulates the Bmp4 expression. These data suggest that Shh, via its transcriptional factor GH2, upregulates Bmp4 expression in the inner zone of the bladder mesenchyme.

Bmp4 represses smooth muscle differentiation

Bmp4 is required for mesenchyme formation and patterning (Winnier et al., 1995). The role of Bmp4 in smooth muscle differentiation has been controversial. We think that the role of

Bmp4 in smooth muscle differentiation may be both context-dependent and dose-

91 dependent. Our results show that Bmp4 has a biphasic effect on bladder smooth muscle

differentiation. At a low level (lOng/ml), Bmp4 represses smooth muscle differentiation.

The repression is partially alleviated by the Bmp4 antagonist, Noggin. The Bmp4 level in

the sub-epithelial mesenchyme of the developing bladder has not been measured. However

we found that in the wild-type bladder, Bmp4 was expressed in the inner zone mesenchyme

(Figure 4-6 A), where no SM a-actin expression was detectable. SM a-actin was detected

at the periphery of bladder mesenchyme (Figure 4-5 A, C and E) where there was no

detectable Bmp4 expression. Conversely, in Gli2v~ bladders, the inner zone Bmp4

expression was lost and ectopic SM a-actin expression was detected. These results suggest that Bmp4 may repress smooth muscle differentiation. The gradient of Bmp4 mirrors that of Shh and may be part of the Shh signaling cascade regulating the smooth muscle differentiation. GU2 and Bmp4 may not be the the only players tranducing the Shh signaling in smooth muscle differentiation. Admittedly, the repression of smooth muscle differentiation by Bmp4 was modest. So was the rescue by Noggin. This may be due to the late harvesting of bladder at El 5.5, when the smooth muscle differentiation has already begun. Smooth muscle differentiation normally begins at El 3.5 at the periphery of the bladder (Figure 4-5 A). Yet harvesting bladders at E13.5 may not yield adequate tissue for immunoblot and it is also physically difficult to avoid including the non-bladder urogenital sinus tissue and urogenital tubercle during micro-dissection. Furthermore, additional differentiation may also have taken place while the primary mesenchymal cells were allowed to grow confluent in the culture plates. These factors complicated the Bmp4 -

Noggin effect on primary cell culture.

92 The exact mechanism by which Bmp4 represses smooth muscle differentiation is not clear.

We have previously demonstrated that Msxl, a transcriptional factor, is expressed in the sub-epithelial mesenchyme of the bladder (Cheng et al., 2006) where Bmp4 is normally expressed (Figure 4-6 A). In the vascular smooth muscle cells, Bmp4 has been shown to induce Msxl expression. During normal smooth muscle differentiation, myocardin and serum response factor (SRF) form a complex and bind to the CArG-box motif at the promoters of the smooth muscle genes such as SM22a and caldesmin, triggering their transcription. Msxl is capable of forming a ternary complex with myocardin and SRF, preventing the transactivation of smooth muscle genes (Hayashi et al., 2006b). Hence,

Bmp4 may inhibit smooth muscle differentiation by inducing Msx-1.

Working Model

Based on our results and the current literature, we propose the following working model for the regulation of bladder development. Shh is a bladder epithelial signal. Shh, via its transcriptional factor GH2, promotes the proliferation of inner zone mesenchymal cells which contain the smooth muscle progenitor cells. GU2 induces Bmp4 which, in turn, induces Msx-1. Msx-1 inhibits myocardin-dependent smooth muscle gene transcription in the inner mesenchymal zone. In the outer zone of the mesenchyme where the Shh level declines, GU2, Bmp4 and Msxl expressions decrease accordingly, thus permitting smooth muscle differentiation to take place. The temporal decline of Shh expression during bladder development also contributes to the smooth muscle differentiation. In summary GH2 regulates the radial patterning of the bladder mesenchyme.

93 Understanding the mechanisms that regulate bladder development has a significant clinical

bearing. We have previously demonstrated that GU2~A and Shh"A mutant mice developed

ano-rectal malformation, a condition frequently encountered in pediatric surgical practice

(Mo et al., 2001). Urodynamic studies have demonstrated that the smooth muscle functions

of the bladder are abnormal in many children with anorectal malformation even before any

surgical intervention (Warne et al., 2004). Shh signaling is involved in both the hindgut and

bladder developments and this could explain the abnormal bladder function that is seen in

these patients with ano-rectal malformation. Bladder detrusor muscle hypertrophy is

common in patients with neurogenic bladder and bladder outlet obstructions. Clinically,

there may be a grossly thickened bladder wall, reduced bladder capacity and low bladder

compliance. The phenotypical switch from fibroblast to smooth muscle cells that is seen in

these clinical conditions may be subjected to the similar regulation mechanism seen in the

bladder development. The knowledge gained from the current study could thus be extrapolated to a better understanding and management of these clinical conditions.

94 Chapter 5 Conclusions and future directions

95 Conclusions

p63 is anti-apoptotic in ventral bladder development

Firstly, we have demonstrated that the development of the ventral and the dorsal aspects of hollow organ, such as bladder requires different regulation mechanisms. In case of urinary bladder, it depends on tempero-spatial restriction of p63 expression. Secondly, we showed that the anti-apoptotic ANp63 is just as important as apoptosis in mammalian embryo morphogenesis. Finally, like apical ectodermal ridge in limb bud development, the ventral

UGS endoderm behaves as an organizer in inducing the adjacent bladder mesenchymal development.

Shh transcriptional factor GM2 regulates the patterning of a developing bladder

We have demonstrated that urothelial Shh, via its transcriptional factor GH2, regulates both the proliferation and smooth muscle differentiation patterns of the bladder mesenchyme.

Furthermore, there is some evidence that Bmp4 in bladder acts as a secondary messenger of the Shh/Gli2 signaling cascade.

96 Future Directions

Is early p63 expression a marker for epithelial organizer during morphogenesis?

In addition to bladder exstrophy, p63 deficient embryos also develop a spectrum of deformities ranging from absence of limbs, stunted tail to cleft palate (Mills et al., 1999;

Yang et al., 1999). A feature common to these malformed organs is that p63 is expressed in them during the early development (El 1.5) (Figure 5-1, Figure 3-3 A, Figure 3-2 A and B).

In the absence of p63, the apical ectodermal ridge (AER) as well as ventral bladder epithelium fail to induce the adjacent mesenchyme, evidenced by the loss of Msx-1 and

Fgf8 expressions (Mills et al., 1999) (Figure 3-8 A-D). If p63 in the AER of limb bud designates is as a marker of an organizer (Figure 5-1), then p63 expression in the ventral bladder urothelium also designates it as an organizer (Figure 3-3 A). Furthermore, it is the pro-survival ANp63 isoform which is expressed at these sites (Bakkers et al., 2002) (Figure

3-2 E and F). Coincidentally, p63 is also strongly expressed in the tail bud in the El 1.5 embryos (Figure 3-3 A) and/>65v" embryos have stunted tails. Whether p63 expression is located in ventral ectodermal ridge of the tail bud, the tail bud organizer (Liu et al., 2004), requires further investigation. In summary, early ANp63 epithelial expression appears to be a marker for the epithelial organizer. Further study is required to verify this conjecture.

97 Figure 5-1. p63 immunohistochemistry of a horizontal section of El 1.5 wild-type embryo across the

level of cloaca and hind limb buds. The arrows point to the p63 expressions at the apical ectodermal

ridge (AER) of the hind limbs. p63 screening in bladder exstrophy patients

The etiology of BE is unclear. BE is significantly more prevalent in the children of mothers of older age (Boyadjiev et al., 2004) and in the white population (Nelson et al., 2005).

Although majority of the BE occurs sporadically, familial BE and autosomal dominant BE have been reported (Froster et al., 2004; Messelink et al., 1994; Reutter et al., 2003). The risks of BE increase dramatically to 1 in 100 and 1 in 70 amongst the siblings and the offspring of the BE patients respectively, a 500-fold greater incidence than in the general population (Shapiro et al., 1984). These data suggest that a genetic component may play a role in the BE pathogenesis. Although chromosomal anomalies (t(8;9)(pl 1.2; ql3), 47XYY, deletion of 9q(34.1-qter), del(3)(ql2.2ql3.2) (Kosaki et al., 2005; Nelson et al., 2005;

Thauvin-Robinet et al., 2004) have been reported in the literature, only MYH9 gene

98 mutation has been reported in a girl with both BE and Epstein syndrome, which is an unusual presentation (Ludwig et al., 2005; Reutter et al., 2006; Utsch et al., 2006). Our murine p63~A BE model suggests that p63 may be involved in the pathogenesis of BE in human.

EEC syndrome: Heterozygous missense mutation ofp63 (3q27) in human is associated with autosomal dominant ectrodactyly (claw-hands), ectodermal dysplasia (thin skin) and cleft lip (EEC) syndrome (Celli et al., 1999). The limb and skin anomalies resemble that of the p63'A mice. A good proportion of EEC patients (8.3% to 61%) also have genitourinary anomalies (Kuster, 1986; Nardi et al., 1992; Rollnick and Hoo, 1988). In one report where bladder biopsies were taken in an EEC patient with urethral stenosis, the epithelium was found to be atrophic (Maas et al., 1996), reminiscent of the non-stratified bladder epithelium inp63'/" murine bladder(Cheng et al., 2006). In addition, one large EEC family was also shown to have chromosome 19 defects (O'Quinn et al., 1998), a site which contains TGFpi gene. Interestingly, recently TGF pi has been shown to induce the expression of ANp63alpha in vitro (Murata et al., 2007). In summary, mutation of bothp63 and its putative upstream gene TGF pi, is associated with EEC syndrome. BE and EEC share some common congenital anomalies and hence, p63 may be a candidate gene for genetic screening in BE patients.

Regulation of p63 expression

In the hindgut development, cloaca is partitioned into ventral urogenital sinus and dorsal ano-rectum. We have demonstrated that p63 is preferentially expressed in the ventral

99 cloacal epithelium during early development (Figure 3-3 C). The ventral cloacal epithelium retains p63 expression and develops into stratified urothelium whereas the ano-rectum epithelium, which also expresses p63 at El 1.5, loses p63 expression at E14.5 and becomes simple epithelium with a single layer of columnar cells (Kurita et al., 2004a). What determines the switching on/off of p63 expression is unknown. In foregut development, lung bud develops as a diverticulum from the foregut. The lung buds eventually develop into the trachea, bronchi and the lung ventrally. The remaining of the foregut develops into larynx and esophagus. The tracheo-bronchial epithelium does not express p63 and differentiates into ciliated columnar epithelium (Koster et al., 2004) whereas the esophageal epithelium expresses p63 and develops into stratified epithelium. What regulates the p63 expression and determines the cell fate of the endoderm-derived epithelia remains unclear. The regulation of p63 expression in foregut appears to differ from that of the hindgut. In zebra-fish, p63 is induced by Bmp4 which is expressed ventrally (Bakkers et al., 2002). In mammals, Bmp4 is also expresses ventrally during early development

(Winnier et al., 1995). Do the ventral Bmp4 and the dorsal Noggin from the notochord regulate p63 expression and play a role in determining the epithelial cell fate of the cloaca?

We have recently shown that over-expression of ANGU2, a constitutionally active form of

GH2, up-regulates p63 expression in chick embryo cloacal epithelium (Liu et al., 2007)

(Figure 5-2 A - B). The data suggest that Shh regulates the p63 expression in bladder/cloacal epithelium. Further study is needed to confirm the regulatory mechanism.

100 Figure 5-2. A: The cloacal epithelial p63 expression in chick embryos transfected with GFP (a and b) and ANGH2 (c and d) (Liu et al., 2007). B: The immunoblots of p63 in cloaca transfected with GFP and

ANGH2 respectively.

There appears to be a positive feed-back loop between p63 and Shh. While Shh signaling up-regulates p63 expression (Figure 5-2), p63 also affects Shh expression. We have shown that inp63 deficient urothelium, the Shh expression is weak (Figure 3-10). This may be due to down-regulation of Shh or simply due to hypoplasia of the bladder epithelium. On the other hand, over-expression of p63y and p (both AN and TA isoforms) has been shown to induce Shh expression (Caserta et al., 2006). Apoptosis can is another way where the Shh expressing organizer cells can be regulated. In Xenopus, Bar-like homeobox gene (Barhl2) promotes apoptosis in neuroectoderm and mesoderm, limiting the number of Xshh expressing cells (Offner et al., 2005). It is important to bear in mind that in the absence of

Shh signaling (as in Shh''' and GU2~' bladders), bladders were hypoplastic but not completely absent whereas mp63'/~ mutant embryo, the entire ventral bladder wall may be absent. This implies that Shh may be only one of many epithelial signals involved in bladder organogenesis.

101 Shh-Bmp4-Hox regulation of hindgut

There is some evidence in the limb buds that Bmp regulates Hox expression (Li and Cao,

2003; Li et al., 2006; Shi et al., 1999). In Xenopus, over-expression of Bmp4 also up- regulates mesodermal Xhox-3 (Dale et al., 1992). In vertebrate hindgut, over-expression of

Shh up-regulates both Bmp4 and Hoxd-13 expressions (Roberts et al., 1995; Roberts et al.,

1998). Hox genes are involved in cell proliferation (Dolle et al., 1993). It is possible that in mammalian hindgut and bladder development, Shh regulates Hox expressions via its action on Bmp4. Our data demonstrated that in mammalian urogenital sinus, Gli2'/" mutation affected the Hoxa-13, Hoxd-13 and Hoxd-12 expressions in a region-specific manner, i.e. there was either a reduction of Hox expressing tissue or a down-regulation of Hox expressions in the dorso-posterior region of the Gli2'A urogenital sinus (Figure 5-3, arrows).

Further study would clarify whether Shh, Bmp4 and Hox form a signaling cascade in the hindgut development.

102 Wild-type G//2-A

Figure 5-3. Hoxa-13, Hoxd-13 and Hoxd-12 expressions (in-situ hybridization) in E12.5 wild-type and

GU2~' urogenital sinuses.

Radial polarity and hollow organ development

We have shown, in Chapter 4, that epithelial Shh signal regulates the patterning of bladder mesenchyme during development. The concept of radial polarity may be extrapolated to the development of other endoderm-derived hollow organs, such as hindgut. In GU2~' murine embryo rectum, we observed muscular hypertrophy (Figure 5-4 B, double-headed arrow) and ectopic smooth muscle a-actin expression (Figure 5-4 B, single-headed arrow). This suggests that Gli2 also represses smooth muscle differentiation in the rectal development.

103 Figure 5-4. The smooth muscle a-actin expressions (immunohistochemistry) in E17.5 wild-type (A) and

GH2'' (B) rectal walls (x400). The double-headed arrows represent the thickness of muscular layers.

The single-headed arrow represents ectopic smooth muscle in the sub-mucosal layer, just beneath the mucosal basement membrane.

Cancer and the bladder developmental genes

The discovery of p63, a homolog of p53, generated much excitement in the oncology research field. Yet, evidence of p63 mutation in cancer is lacking. However, there is evidence that impaired ANp63 expression is associated with more aggressive urothelial cancer of bladder, suggesting that the anti-apoptotic property of ANp63 is required in preventing cancer invasion (Koga et al., 2003). Similarly, in esophageal cancer, impaired

ANp63 reflects tumor progression (Hu et al., 2002; Morita et al., 2005). There is some evidence that TAp63 expression is down-regulated in well differentiated oral cancer (Chen et al., 2004b). In mice, p63~f~ mice do not live long enough to develop tumor. Yet, p63+/~

;p73+/~ mice do have increased chance of developing cancer.

104 Shh is also involved in tumor development. Shh signaling pathway is activated by ligand expression in common gastrointestinal tumor (Berman et al., 2003). In urothelial carcinoma cell line, the activation of Shh signaling was not certain (Thievessen et al., 2005). Strong evidence comes from a mouse model where mice with Shh misexpressed in pancreas endoderm develop markers of early pancreatic cancer. Shh expression is also up-regulated in human pancreatic cancer (Thayer et al., 2003). In other cancers of epithelial origin (skin and airway epithelium), Shh signaling has been shown to be involved in tumorogenesis

(Dahmane et al., 1997; Watkins et al., 2003; Xie et al., 1998). Hence, both Shh and ANp63 are similarly involved in development and cancer. In summary, p63 and Shh genes are involved in both development and cancer.

Hypothetical model of bladder development

We hypothesize that the mesenchymal GH2, probably via its action on Bmp4, regulates epithelial p63 expression at early stage of development. ANp63 expressing ventral bladder urothelium acts as an organizer and maintains the urothelial cell survival. The urothelium secrets Shh, which through its action on GH2, regulates the bladder mesenchymal cell proliferation. Mesenchymal Gli2 also regulates Bmp4 and Bmp4 in turn represses smooth muscle differentiation, probably via induction of Msx-1.

105 lumen

Epithelium p63 *pro-surviv;

inner zone of proliferation

•outer .zone of .differentiation Serosa•

Figure 5-5. A hypothetical model of ventral mammalian bladder development.

106 References Agarwala, S., Sanders, T. A. and Ragsdale, C. W. (2001). Sonic hedgehog control of size and shape in midbrain pattern formation. Science 291, 2147-50. Ang, S. L. and Rossant, J. (1994). HNF-3 beta is essential for node and notochord formation in mouse development. Cell 78, 561-74. Arey, L. (1965). Developmental anatomy. Philadelphia: WB Saunders. Attisano, L. and Wrana, J. L. (2002). Signal transduction by the TGF-beta superfamily. Science 296, 1646-7. Bakkers, J., Hild, M., Kramer, C, Furutani-Seiki, M. and Hammerschmidt, M. (2002). Zebrafish DeltaNp63 is a direct target of Bmp signaling and encodes a transcriptional repressor blocking neural specification in the ventral ectoderm. Dev Cell 2, 617-27. Barrallo-Gimeno, A. and Nieto, M. A. (2005). The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development 132, 3151- 61. Baskin, L. S., Hayward, S. W., Sutherland, R. A., DiSandro, M. J., Thomson, A. A., Goodman, J. and Cunha, G. R. (1996a). Mesenchymal-epithelial interactions in the bladder. World J Urol 14, 301-9. Baskin, L. S., Hayward, S. W., Sutherland, R. A., DiSandro, M. S., Thomson, A. A. and Cunha, G. R. (1997). Cellular signaling in the bladder. Front Biosci 2, d592-5. Baskin, L. S., Hayward, S. W., Young, P. and Cunha, G. R. (1996b). Role of mesenchymal-epithelial interactions in normal bladder development. J Urol 156, 1820-7. Baskin, L. S., Hayward, S. W., Young, P. F. and Cunha, G. R. (1996c). Ontogeny of the rat bladder: smooth muscle and epithelial differentiation. ActaAnat (Basel) 155, 163-71. Baskin, L. S., Sutherland, R. S., Thomson, A. A., Hayward, S. W. and Cunha, G. R. (1996d). Growth factors and receptors in bladder development and obstruction. Lab Invest 75, 157-66. Basler, K. and Struhl, G. (1994). Compartment boundaries and the control of Drosophila limb pattern by hedgehog protein. Nature 368, 208-14. Bendall, A. J. and Abate-Shen, C. (2000). Roles for Msx and Dlx homeoproteins in vertebrate development. Gene 247, 17-31. Berman, D. M., Karhadkar, S. S., Maitra, A., Montes De Oca, R., Gerstenblith, M. R., Briggs, K., Parker, A. R., Shimada, Y., Eshleman, J. R., Watkins, D. N. et al. (2003). Widespread requirement for Hedgehog ligand stimulation in growth of digestive tract tumours. Nature 425, 846-51. Bitgood, M. J. and McMahon, A. P. (1995). Hedgehog and Bmp genes are coexpressed at many diverse sites of cell-cell interaction in the mouse embryo. Dev Biol 172, 126-38. Bourdon, J. C, Fernandes, K., Murray-Zmijewski, F., Liu, G., Diot, A., Xirodimas, D. P., Saville, M. K. and Lane, D. P. (2005). p53 isoforms can regulate p53 transcriptional activity. Genes Dev 19, 2122-37. Boyadjiev, S. A., Dodson, J. L., Radford, C. L., Ashrafi, G. H., Beaty, T. H., Mathews, R. I., Broman, K. W. and Gearhart, J. P. (2004). Clinical and molecular characterization of the bladder exstrophy-epispadias complex: analysis of 232 families. BJUInt 94, 1337-43.

107 Brunet, L. J., McMahon, J. A., McMahon, A. P. and Harland, R. M. (1998). Noggin, cartilage morphogenesis, and joint formation in the mammalian skeleton. Science 280, 1455-7. Burke, R., Nellen, D., Bellotto, M., Hafen, E., Senti, K. A., Dickson, B. J. and Basler, K. (1999). Dispatched, a novel sterol-sensing domain protein dedicated to the release of cholesterol-modified hedgehog from signaling cells. Cell 99, 803-15. Callis, T. E., Cao, D. and Wang, D. Z. (2005). Bone morphogenetic protein signaling modulates myocardin transactivation of cardiac genes. Circ Res 97, 992-1000. Cano, A., Perez-Moreno, M., Rodrigo, I., Locascio, A., Blanco, M., de Barrio, M., Portillo, F. and Nieto, A. (2000). The transciption factor snail controls epithelial- mesenchynmal transitions by repressing E-cadherin expression. Nature Cell Biology 2:, 76- 83. Caserta, T. M., Kommagani, R., Yuan, Z., Robbins, D. J., Mercer, C. A. and Kadakia, M. P. (2006). p63 overexpression induces the expression of Sonic Hedgehog. Mol Cancer Res 4, 759-68. Cayuso, J., Ulloa, F., Cox, B., Briscoe, J. and Marti, E. (2006). The Sonic hedgehog pathway independently controls the patterning, proliferation and survival of neuroepithelial cells by regulating Gli activity. Development 133, 517-28. Cecconi, F., Alvarez-Bolado, G., Meyer, B. I., Roth, K. A. and Gruss, P. (1998). Apafl (CED-4 homolog) regulates programmed cell death in mammalian development. Cell 94, 727-37. Celli, J., Duijf, P., Hamel, B. C, Bamshad, M., Kramer, B., Smits, A. P., Newbury- Ecob, R., Hennekam, R. C, Van Buggenhout, G., van Haeringen, A. et al. (1999). Heterozygous germline mutations in the p53 homolog p63 are the cause of EEC syndrome. Cell 99, 143-53. Chang, C. and Hemmati-Brivanlou, A. (2000). A post-mid-blastula transition requirement for TGFbeta signaling in early endodermal specification. Mech Dev 90, 227-35. Chawengsaksophak, K., James, R., Hammond, V. E., Kontgen, F. and Beck, F. (1997). Homeosis and intestinal tumours in Cdx2 mutant mice. Nature 386, 84-7. Chen, C, Chen, H., Sun, J., Bringas, P., Jr., Chen, Y., Warburton, D. and Shi, W. (2005). Smadl expression and function during mouse embryonic lung branching morphogenesis. Am J Physiol Lung Cell Mol Physiol 288, LI 033-9. Chen, M. H., Li, Y. J., Kawakami, T., Xu, S. M. and Chuang, P. T. (2004a). Palmitoylation is required for the production of a soluble multimeric Hedgehog protein complex and long-range signaling in vertebrates. Genes Dev 18, 641-59. Chen, Y. K., Hsue, S. S. and Lin, L. M. (2004b). Expression of p63 (TA and deltaN isoforms) in human primary well differentiated buccal carcinomas. Int J Oral Maxillofac Surg 33, 493-7. Cheng, W., Bishop, A. E., Spitz, L. and Polak, J. M. (1997). Abnormalities of neuropeptides and neural markers in the esophagus of fetal rats with adriamycin-induced esophageal atresia. J Pediatr Surg 32, 1420-3. Cheng, W., Bishop, A. E., Spitz, L. and Polak, J. M. (1999). Abnormal enteric nerve morphology in atretic esophagus of fetal rats with adriamycin-induced esophageal atresia. Pediatr Surg Int 15, 8-10.

108 Cheng, W., Jacobs, W. B., Zhang, J. J., Moro, A., Park, J. H., Kushida, M., Qiu, W., Mills, A. A. and Kim, P. C. (2006). {Delta} Np63 plays an anti-apoptotic role in ventral bladder development. Development 133, 4783-92. Cheng, W. and Tam, P. K. (2000). Apoptosis in murine duodenum during embryonic development. Pediatr Surg Int 16, 485-7. Chuang, P. T. and McMahon, A. P. (1999). Vertebrate Hedgehog signalling modulated by induction of a Hedgehog-binding protein. Nature 397, 617-21. Cooper, M. K., Porter, J. A., Young, K. E. and Beachy, P. A. (1998). Teratogen- mediated inhibition of target tissue response to Shh signaling. Science 280, 1603-7. Crook, T., Nicholls, J. M., Brooks, L., O'Nions, J. and Allday, M. J. (2000). High level expression of deltaN-p63: a mechanism for the inactivation of p53 in undifferentiated nasopharyngeal carcinoma (NPC)? Oncogene 19, 3439-44. Dahmane, N., Lee, J., Robins, P., Heller, P. and Ruiz i Altaba, A. (1997). Activation of the transcription factor Glil and the Sonic hedgehog signalling pathway in skin tumours. Nature 389, 876-81. Dale, L., Howes, G., Price, B. M. and Smith, J. C. (1992). Bone morphogenetic protein 4: a ventralizing factor in early Xenopus development. Development 115, 573-85. de Santa Barbara, P. and Roberts, D. J. (2002). Tail gut endoderm and gut/genitourinary/tail development: a new tissue-specific role for Hoxal3. Development 129,551-61. Ding, Q., Fukami, S., Meng, X., Nishizaki, Y., Zhang, X., Sasaki, H., Dlugosz, A., Nakafuku, M. and Hui, C. (1999). Mouse suppressor of fused is a negative regulator of sonic hedgehog signaling and alters the subcellular distribution of Glil. Curr Biol 9,1119- 22. Dolle, P., Dierich, A., LeMeur, M., Schimmang, T., Schuhbaur, B., Chambon, P. and Duboule, D. (1993). Disruption of the Hoxd-13 gene induces localized heterochrony leading to mice with neotenic limbs. Cell 75, 431-41. Donehower, L. A., Harvey, M., Slagle, B. L., McArthur, M. J., Montgomery, C. A., Jr., Butel, J. S. and Bradley, A. (1992). Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356, 215-21. Dudek, W. R. and Fix, D. J. (1998). Embryology. Philadelphia. Baltimore. New York. London. Buenos Aires. Hong Kong. Sydney. Tokyo: Lippincott Williams & Wilkins. Echelard, Y., Epstein, D. J., St-Jacques, B., Shen, L., Mohler, J., McMahon, J. A. and McMahon, A. P. (1993). Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity. Cell 75, 1417-30. el-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W. and Vogelstein, B. (1993). WAF1, a potential mediator of p53 tumor suppression. Cell 75, 817-25. Fillippovich, I., Sorokina, N., Gatei, M., Haupt, Y., Hobson, K., Moallem, E., Spring, K., Mould, M., McGuckin, M. A., Lavin, M. F. et al. (2001). Transactivation-deficient p73alpha (p73Deltaexon2) inhibits apoptosis and competes with p53. Oncogene 20, 514-22. Flores, E. R., Sengupta, S., Miller, J. B., Newman, J. J., Bronson, R., Crowley, D., Yang, A., McKeon, F. and Jacks, T. (2005). Tumor predisposition in mice mutant for p63 and p73: evidence for broader tumor suppressor functions for the p53 family. Cancer Cell 7, 363-73.

109 Freestone, S. H., Marker, P., Grace, O. C, Tomlinson, D. C, Cunha, G. R., Harnden, P. and Thomson, A. A. (2003). Sonic hedgehog regulates prostatic growth and epithelial differentiation. Dev Biol 264, 352-62. Froster, U. G., Heinritz, W., Bennek, J., Horn, L. C. and Faber, R. (2004). Another case of autosomal dominant exstrophy of the bladder. Prenat Diagn 24, 375-7. Glucksmann, A. (1951). Cell deaths in normal vertebrate ontogeny. Biol. Rev. 26, 59-86. Green, D. R. (1998). Apoptotic pathways: the roads to ruin. Cell 94, 695-8. Gressner, O., Schilling, T., Lorenz, K., Schulze Schleithoff, E., Koch, A., Schulze- Bergkamen, H., Maria Lena, A., Candi, E., Terrinoni, A., Valeria Catani, M. et al. (2005). TAp63alpha induces apoptosis by activating signaling via death receptors and mitochondria. Embo J 24, 2458-71. Griffith, C. M. and Wiley, M. J. (1991). Effects of retinoic acid on chick tail bud development. Teratology 43, 217-24. Grob, T. J., Novak, U., Maisse, C, Barcaroli, D., Luthi, A. U., Pirnia, F., Hugh, B., Graber, H. U., De Laurenzi, V., Fey, M. F. et al. (2001). Human delta Np73 regulates a dominant negative feedback loop for TAp73 and p53. Cell Death Differ 8, 1213-23. Hakem, R., Hakem, A., Duncan, G. S., Henderson, J. T., Woo, M., Soengas, M. S., Elia, A., de la Pompa, J. L., Kagi, D., Khoo, W. et al. (1998). Differential requirement for caspase 9 in apoptotic pathways in vivo. Cell 94, 339-52. Haraguchi, R., Motoyama, J., Sasaki, H., Satoh, Y., Miyagawa, S., Nakagata, N., Moon, A. and Yamada, G. (2007). Molecular analysis of coordinated bladder and urogenital organ formation by Hedgehog signaling. Development 134, 525-33. Hayashi, K., Nakamura, S., Nishida, W. and Sobue, K. (2006a). BMP-induced Msxl and Msx2 inhibit myocardin-dependent smooth muscle gene transcription. Mol Cell Biol. Hayashi, K., Nakamura, S., Nishida, W. and Sobue, K. (2006b). Bone morphogenetic protein-induced MSX1 and MSX2 inhibit myocardin-dependent smooth muscle gene transcription. Mol Cell Biol 26, 9456-70. Headington, J. T. (1970). Differentiating neoplasms of hair germ. J Clin Pathol 23, 464- 71. Hibi, K., Trink, B., Patturajan, M., Westra, W. H., Caballero, O. L., Hill, D. E., Ratovitski, E. A., Jen, J. and Sidransky, D. (2000). AIS is an oncogene amplified in squamous cell carcinoma. Proc Natl AcadSci USA 97, 5462-7. Hirai, Y. and Kuwabara, N. (1990). Transplacentally induced anorectal malformations in rats. JPediatr Surg 25, 812-6. Hirsinger, E., Duprez, D., Jouve, C, Malapert, P., Cooke, J. and Pourquie, O. (1997). Noggin acts downstream of Wnt and Sonic Hedgehog to antagonize BMP4 in avian somite patterning. Development 124, 4605-14. Hogan, B. L. (1996). Bone morphogenetic proteins in development. Curr Opin Genet Dev 6, 432-8. Horb, M. E. and Thomsen, G. H. (1997). A vegetally localized T-box transcription factor in Xenopus eggs specifies mesoderm and endoderm and is essential for embryonic mesoderm formation. Development 124, 1689-98. Hu, G., Lee, H., Price, S. M., Shen, M. M. and Abate-Shen, C. (2001). Msx homeobox genes inhibit differentiation through upregulation of cyclin Dl. Development 128, 2373-84.

110 Hu, H., Xia, S. H., Li, A. D., Xu, X., Cai, Y., Han, Y. L., Wei, F., Chen, B. S., Huang, X. P., Han, Y. S. et al. (2002). Elevated expression of p63 protein in human esophageal squamous cell carcinomas. Int J Cancer 102, 580-3. Hui, C. C. and Joyner, A. L. (1993). A mouse model of greig cephalopolysyndactyly syndrome: the extra-toesJ mutation contains an intragenic deletion of the Gli3 gene. Nat Genet 3, 241-6. Hui, C. C, Slusarski, D., Piatt, K. A., Holmgren, R. and Joyner, A. L. (1994). Expression of three mouse homologs of the Drosophila segment polarity gene cubitus interruptus, Gli, Gli-2, and Gli-3, in ectoderm- and mesoderm-derived tissues suggests multiple roles during postimplantation development. Dev Biol 162, 402-13. Ince, T. A., Cviko, A. P., Quade, B. J., Yang, A., McKeon, F. D., Mutter, G. L. and Crum, C. P. (2002). p63 Coordinates anogenital modeling and epithelial cell differentiation in the developing female urogenital tract. Am J Pathol 161, 1111-7. Ingham, P. W. (1998). Transducing Hedgehog: the story so far. Embo J17, 3505-11. Ingham, P. W. and McMahon, A. P. (2001). Hedgehog signaling in animal development: paradigms and principles. Genes Dev 15, 3059-87. Jacobs, W. B., Govoni, G., Ho, D., Atwal, J. K., Barnabe-Heider, F., Keyes, W. M., Mills, A. A., Miller, F. D. and Kaplan, D. R. (2005). P63 Is an Essential Proapoptotic Protein during Neural Development. Neuron 48, 743-756. Jeffery, T. K., Upton, P. D., Trembath, R. C. and Morrell, N. W. (2005). BMP4 inhibits proliferation and promotes myocyte differentiation of lung fibroblasts via Smadl and JNK pathways. Am J Physiol Lung Cell Mol Physiol 288, L370-8. Jenkins, D., Winyard, P. J. and Woolf, A. S. (2007). Immunohistochemical analysis of Sonic hedgehog signalling in normal human urinary tract development. J Anat. Jowett, A. K., Vainio, S., Ferguson, M. W., Sharpe, P. T. and Thesleff, I. (1993). Epithelial-mesenchymal interactions are required for msx 1 and msx 2 gene expression in the developing murine molar tooth. Development 117, 461-70. Kaghad, M., Bonnet, H., Yang, A., Creancier, L., Biscan, J. C, Valent, A., Minty, A., Chalon, P., Lelias, J. M., Dumont, X. et al. (1997). Monoallelically expressed gene related to p53 at lp36, a region frequently deleted in neuroblastoma and other human cancers. Cell 90, 809-19. Kanai-Azuma, M., Kanai, Y., Gad, J. M., Tajima, Y., Taya, C, Kurohmaru, M., Sanai, Y., Yonekawa, H., Yazaki, K., Tam, P. P. et al. (2002). Depletion of definitive gut endoderm in Soxl7-null mutant mice. Development 129, 2367-79. Kedinger, M., Duluc, I., Fritsch, C, Lorentz, O., Plateroti, M. and Freund, J. N. (1998). Intestinal epithelial-mesenchymal cell interactions. Ann N Y Acad Sci 859, 1-17. Kedinger, M., Simon-Assmann, P., Bouziges, F. and Haffen, K. (1988). Epithelial- mesenchymal interactions in intestinal epithelial differentiation. Scand J Gastroenterol Suppl 151, 62-9. Kikuchi, Y., Agathon, A., Alexander, J., Thisse, C, Waldron, S., Yelon, D., Thisse, B. and Stainier, D. Y. (2001). casanova encodes a novel Sox-related protein necessary and sufficient for early endoderm formation in zebrafish. Genes Dev 15, 1493-505. King, K. E., Iyemere, V. P., Weissberg, P. L. and Shanahan, C. M. (2003). Kruppel-like factor 4 (KLF4/GKLF) is a target of bone morphogenetic proteins and transforming growth factor beta 1 in the regulation of vascular smooth muscle cell phenotype. J Biol Chem 278, 11661-9.

Ill Kingsley, D. M. (1994). What do BMPs do in mammals? Clues from the mouse short-ear mutation. Trends Genet 10, 16-21. Kmita, M. and Duboule, D. (2003). Organizing axes in time and space; 25 years of colinear tinkering. Science 301, 331-3. Knudson, C. M., Tung, K. S., Tourtellotte, W. G., Brown, G. A. and Korsmeyer, S. J. (1995). Bax-deficient mice with lymphoid hyperplasia and male germ cell death. Science 270, 96-9. Koga, F., Kawakami, S., Kumagai, J., Takizawa, T., Ando, N., Arai, G., Kageyama, Y. and Kihara, K. (2003). Impaired Delta Np63 expression associates with reduced beta- catenin and aggressive phenotypes of urothelial neoplasms. Br J Cancer 88, 740-7. Kondo, T., Dolle, P., Zakany, J. and Duboule, D. (1996). Function of posterior HoxD genes in the morphogenesis of the anal sphincter. Development 122, 2651-9. Kosaki, R., Fukuhara, Y., Kosuga, M., Okuyama, T., Kawashima, N., Honna, T., Ueoka, K. and Kosaki, K. (2005). OEIS complex with del(3)(ql2.2ql3.2). Am J Med Genet A 135,224-6. Koster, M. I., Kim, S., Mills, A. A., DeMayo, F. J. and Roop, D. R. (2004). p63 is the molecular switch for initiation of an epithelial stratification program. Genes Dev 18, 126- 31. Kuida, K., Haydar, T. F., Kuan, C. Y„, Gu, Y., Taya, C, Karasuyama, H., Su, M. S., Rakic, P. and Flavell, R. A. (1998). Reduced apoptosis and cytochrome c-mediated caspase activation in mice lacking caspase 9. Cell 94, 325-37. Kuida, K., Zheng, T. S., Na, S., Kuan, C, Yang, D., Karasuyama, H., Rakic, P. and Flavell, R. A. (1996). Decreased apoptosis in the brain and premature lethality in CPP32- deficient mice. Nature 384, 368-72. Kurita, T. and Cunha, G. R. (2001). Roles of p63 in differentiation of Mullerian duct epithelial cells. Ann N YAcadSci 948, 9-12. Kurita, T., Medina, R. T., Mills, A. A. and Cunha, G. R. (2004a). Role of p63 and basal cells in the prostate. Development 131, 4955-64. Kurita, T., Mills, A. A. and Cunha, G. R. (2004b). Roles of p63 in the diethylstilbestrol- induced cervicovaginal adenosis. Development 131, 1639-49. Kuster, W. (1986). Further reports of urinary tract involvement in EEC syndrome. Am J Dis Child 140, 411. Larue, L. and Bellacosa, A. (2005). Epithelial-mesenchymal transition in development and cancer: role of phosphatidylinositol 3' kinase/AKT pathways. Oncogene 24, 7443-54. Last, R. (1984). Anatomy: regional and applied. Edinburgh, London, Melbourne, New York: Churchill Livingstone. Laurikkala, J., Mikkola, M. L., James, M., Tummers, M., Mills, A. A. and Thesleff, I. (2006). p63 regulates multiple signalling pathways required for ectodermal organogenesis and differentiation. Development 133, 1553-63. Lee, H. and Kimelman, D. (2002). A dominant-negative form of p63 is required for epidermal proliferation in zebrafish. Dev Cell 2, 607-16. Lee, H. O., Lee, J. H., Choi, E., Seol, J. Y., Yun, Y. and Lee, H. (2006). A dominant negative form of p63 inhibits apoptosis in a p53-independent manner. Biochem Biophys Res Commun 344, 166-72. Lemaire, P. and Yasuo, H. (1998). Developmental signalling: a careful balancing act. CwrrJB/o/8,R228-31.

112 Lengyel, J. A. and Iwaki, D. D. (2002). It takes guts: the Drosophila hindgut as a model system for organogenesis. Dev Biol 243, 1-19. Levine, A. J. (1997). p53, the cellular gatekeeper for growth and division. Cell 88, 323-31. Li, X. and Cao, X. (2003). BMP signaling and HOX transcription factors in limb development. Front Biosci 8, s805-12. Li, X., Nie, S., Chang, C, Qiu, T. and Cao, X. (2006). Smads oppose Hox transcriptional activities. Exp Cell Res 312, 854-64. Liefer, K. M., Koster, M. I., Wang, X. J., Yang, A., McKeon, F. and Roop, D. R. (2000). Down-regulation of p63 is required for epidermal UV-B-induced apoptosis. Cancer Res 60, 4016-20. Little, N. A. and Jochemsen, A. G. (2002). p63. IntJBiochem Cell Biol 34, 6-9. Liu, C, Knezevic, V. and Mackem, S. (2004). Ventral tail bud mesenchyme is a signaling center for tail paraxial mesoderm induction. Dev Dyn 229, 600-6. Liu, G., Moro, A., Zhang, J. J., Cheng, W., Qiu, W. and Kim, P. C. (2007). The role of Shh transcription activator GH2 in chick cloacal development. Dev Biol 303, 448-60. Liu, W., Li, Y., Cunha, S., Hayward, G. and Baskin, L. (2000). Diffusable growth factors induce bladder smooth muscle differentiation. In Vitro Cell Dev Biol Anim 36, 476- 84. Ludwig, M., Utsch, B. and Reutter, H. (2005). [Genetic and molecular biological aspects of the bladder exstrophy-epispadias complex (BEEC)]. Urologe A 44, 1037-8, 1040-4. Maas, S. M., de Jong, T. P., Buss, P. and Hennekam, R, C. (1996). EEC syndrome and genitourinary anomalies: an update. Am J Med Genet 63, 472-8. Madison, B. B., Braunstein, K., Kuizon, E., Portman, K., Qiao, X. T. and Gumucio, D. L. (2005). Epithelial hedgehog signals pattern the intestinal crypt-villus axis. Development 132, 279-89. Martinez-Frias, M. L., Bermejo, E., Rodriguez-Pinilla, E. and Frias, J. L. (2001). Exstrophy of the cloaca and exstrophy of the bladder: two different expressions of a primary developmental field defect. Am J Med Genet 99, 261-9. Maruoka, Y., Ohbayashi, N., Hoshikawa, M., Itoh, N., Hogan, B. L. and Furuta, Y. (1998). Comparison of the expression of three highly related genes, Fgf8, Fgfl7 and Fgfl8, in the mouse embryo. Mech Dev 74, 175-7. McBride, H. J., Fatke, B. and Fraser, S. E. (2003). Wnt signaling components in the chicken intestinal tract. Dev Biol 256, 18-33. McKeon, F. (2004). p63 and the epithelial stem cell: more than status quo? Genes Dev 18, 465-9. Messelink, E. J., Aronson, D. C, Knuist, M., Heij, H. A. and Vos, A. (1994). Four cases of bladder exstrophy in two families. J Med Genet 31, 490-2. Mill, P., Mo, R., Fu, H., Grachtchouk, M., Kim, P. C, Dlugosz, A. A. and Hui, C. C. (2003). Sonic hedgehog-dependent activation of Gli2 is essential for embryonic hair follicle development. Genes Dev 17, 282-94. Mills, A. A., Zheng, B., Wang, X. J., Vogel, H., Roop, D. R. and Bradley, A. (1999). p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature 398, 708- 13. Miyashita, T. and Reed, J. C. (1995). Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80, 293-9.

113 Mo, R., Freer, A. ML, Zinyk, D. L., Crackower, M. A., Michaud, J., Heng, H. H., Chik, K. W., Shi, X. ML, Tsui, L. C, Cheng, S. H. et al. (1997). Specific and redundant functions of GH2 and Gli3 zinc finger genes in skeletal patterning and development. Development 124, 113-23. Mo, R., Kim, J. EL, Zhang, J., Chiang, C, Hui, C. C. and Kim, P. C. (2001). Anorectal malformations caused by defects in sonic hedgehog signaling. Am J Pathol 159, 765-74. Moll, U. M. and Slade, N. (2004). p63 and p73: roles in development and tumor formation. Mol Cancer Res 2, 371-86. Monsoro-Burq, A. HL, Duprez, D., Watanabe, Y., Bontoux, M., Vincent, C, Brickell, P. and Le Douarin, N. (1996). The role of bone morphogenetic proteins in vertebral development. Development 122, 3607-16. Moore, K. L. and Persaud, T. V. N. (2003). The Developing Human. Philadelphia: Saunders. Morita, M., Uramoto, EL, Nakata, S., Ono, K., Sugaya, M., Yoshimatsu, T., Oyama, T., Hanagiri, T., Sugio, K. and Yasumoto, K. (2005). Expression of deltaNp63 in squamous cell carcinoma of the esophagus. Anticancer Res 25, 3533-9. Mowat, M., Cheng, A., Kimura, N., Bernstein, A. and Benchimol, S. (1985). Rearrangements of the cellular p53 gene in erythroleukaemic cells transformed by Friend virus. Nature 314, 633-6. Muecke, E. C. (1964). The Role of the Cloacal Membrane in Exstrophy: the First Successful Experimental Study. J Urol 92, 659-67. Murata, K., Ota, S., Niki, T., Goto, A., Li, C. P., Ruriko, U. M., Ishikawa, S., Aburatani, EL, Kuriyama, T. and Fukayama, M. (2007). p63 - Key molecule in the early phase of epithelial abnormality in idiopathic pulmonary fibrosis. Exp Mol Pathol. Murray-Zmijewski, F., Lane, D. P. and Bourdon, J. C. (2006). p53/p63/p73 isoforms: an orchestra of isoforms to harmonise cell differentiation and response to stress. Cell Death Differ. Nardi, A. C, Ferreira, U., Netto Junior, N. R., Magna, L. A., Rodini, E. S. and Richieri-Costa, A. (1992). Urinary tract involvement in EEC syndrome: a clinical study in 25 Brazilian patients. Am J Med Genet 44, 803-6. Nelson, C. P., Dunn, R. L. and Wei, J. T. (2005). Contemporary epidemiology of bladder exstrophy in the United States. J Urol 173, 1728-31. Nieuwenhuis, E. and Hui, C. C. (2005). Hedgehog signaling and congenital malformations. Clin Genet 67, 193-208. Nigro, J. M., Baker, S. J., Preisinger, A. C, Jessup, J. M., Hostetter, R., Cleary, K., Bigner, S. EL, Davidson, N., Baylin, S., Devilee, P. et al. (1989). Mutations in the p53 gene occur in diverse human tumour types. Nature 342, 705-8. Niswander, L., Jeffrey, S., Martin, G. R. and Tickle, C. (1994). A positive feedback loop coordinates growth and patterning in the vertebrate limb. Nature 371, 609-12. Nusslein-Volhard, C. and Wieschaus, E. (1980). Mutations affecting segment number and polarity in Drosophila. Nature 287, 795-801. Nylander, K., Coates, P. J. and Hall, P. A. (2000). Characterization of the expression pattern of p63 alpha and delta Np63 alpha in benign and malignant oral epithelial lesions. Int J Cancer 87, 368-72.

114 Nylander, K., Vojtesek, B., Nenutil, R., Lindgren, B., Roos, G., Zhanxiang, W., Sjostrom, B., Dahlqvist, A. and Coates, P. J. (2002). Differential expression of p63 isoforms in normal tissues and neoplastic cells. J Pathol 198, 417-27. O'Quinn, J. R., Hennekam, R. C, Jorde, L. B. and Bamshad, M. (1998). Syndromic ectrodactyly with severe limb, ectodermal, urogenital, and palatal defects maps to chromosome 19. Am J Hum Genet 62, 130-5. Offner, N., Duval, N., Jamrich, M. and Durand, B. (2005). The pro-apoptotic activity of a vertebrate Bar-like homeobox gene plays a key role in patterning the Xenopus neural plate by limiting the number of chordin- and shh-expressing cells. Development 132, 1807- 18. Ovchinnikov, D. A., Selever, J., Wang, Y., Chen, Y. T., Mishina, Y., Martin, J. F. and Behringer, R. R. (2006). BMP receptor type IA in limb bud mesenchyme regulates distal outgrowth and patterning. Dev Biol 295, 103-15. Owens, G. K. (1995). Regulation of differentiation of vascular smooth muscle cells. Physiol Rev 75, 487-517. Park, E. J., Ogden, L. A., Talbot, A., Evans, S., Cai, C. L., Black, B. L., Frank, D. U. and Moon, A. M. (2006). Required, tissue-specific roles for Fgf8 in outflow tract formation and remodeling. Development 133, 2419-33. Park, H. L., Bai, C, Piatt, K. A., Matise, M. P., Beeghly, A., Hui, C. C, Nakashima, M. and Joyner, A. L. (2000). Mouse GUI mutants are viable but have defects in SHH signaling in combination with a Gli2 mutation. Development 127, 1593-605. Parrott, T., Gray, S. and Skandalakis, J. (1994). Embryology for surgeons. Baltimore: Williams & Wilkins. Parsa, R., Yang, A., McKeon, F. and Green, H. (1999). Association of p63 with proliferative potential in normal and neoplastic human keratinocytes. J Invest Dermatol 113, 1099-105. Pepinsky, R. B., Zeng, C, Wen, D., Rayhorn, P., Baker, D. P., Williams, K. P., Bixler, S. A., Ambrose, C. M., Garber, E. A., Miatkowski, K. et al. (1998). Identification of a palmitic acid-modified form of human Sonic hedgehog. J Biol Chem 273, 14037-45. Perriton, C. L., Powles, N., Chiang, C, Maconochie, M. K. and Cohn, M. J. (2002). Sonic hedgehog signaling from the urethral epithelium controls external genital development. Dev Biol 247, 26-46. Persson, M., Stamataki, D., te Welscher, P., Andersson, E., Bose, J., Ruther, U., Ericson, J. and Briscoe, J. (2002). Dorsal-ventral patterning of the spinal cord requires Gli3 transcriptional repressor activity. Genes Dev 16, 2865-78. Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29, e45. Plateroti, M., Freund, J. N., Leberquier, C. and Kedinger, M. (1997). Mesenchyme- mediated effects of retinoic acid during rat intestinal development. J Cell Sci 110 ( Pt 10), 1227-38. Porter, J. A., Young, K. E. and Beachy, P. A. (1996). Cholesterol modification of hedgehog signaling proteins in animal development. Science 274, 255-9. Pozniak, C. D., Barnabe-Heider, F., Rymar, V. V., Lee, A. F., Sadikot, A. F. and Miller, F. D. (2002). p73 is required for survival and maintenance of CNS neurons. J Neurosci 22, 9800-9.

115 Pozniak, C. D., Radinovic, S., Yang, A., McKeon, F., Kaplan, D. R. and Miller, F. D. (2000). An anti-apoptotic role for the p53 family member, p73, during developmental neuron death. Science 289, 304-6. Qiu, W., Kohen-Avramoglu, R., Rashid-Kolvear, F., Au, C. S., Chong, T. M., Lewis, G. F., Trinh, D. K., Austin, R. C, Urade, R. and Adeli, K. (2004). Overexpression of the endoplasmic reticulum 60 protein ER-60 downregulates apoBlOO secretion by inducing its intracellular degradation via a nonproteasomal pathway: evidence for an ER-60-mediated and pCMB-sensitive intracellular degradative pathway. Biochemistry 43, 4819-31. Quan, Q. B., Sullivan, M. J., Beasley, S. W. and Mandhan, P. (2007). Psl3 development of the urinary bladder in etu-exposed fetal rats is affected by downregulation of shh and its target genescages. ANZJSurg 11 Suppl 1, A58. Quinn, L. M., Latham, S. E. and Kalionis, B. (2000). The homeobox genes MSX2 and MOX2 are candidates for regulating epithelial-mesenchymal cell interactions in the human placenta. Placenta 21 Suppl A, S50-4. Raatikainen-Ahokas, A., Hytonen, M., Tenhunen, A., Sainio, K. and Sariola, H. (2000). BMP-4 affects the differentiation of metanephric mesenchyme and reveals an early anterior-posterior axis of the embryonic kidney. Dev Dyn 217, 146-58. Ramalho-Santos, M., Melton, D. A. and McMahon, A. P. (2000). Hedgehog signals regulate multiple aspects of gastrointestinal development. Development 127, 2763-72. Reutter, EL, Shapiro, E. and Gruen, J. R. (2003). Seven new cases of familial isolated bladder exstrophy and epispadias complex (BEEC) and review of the literature. Am J Med Genet A 120,215-21. Reutter, H., Thauvin-Robinet, C, Boemers, T. M., Rosch, W. H. and Ludwig, M. (2006). Bladder exstrophy-epispadias complex: Investigation of suppressor of variegation, enhancer of zeste and Trithorax (SET) as a candidate gene in a large cohort of patients. Scand J Urol Nephrol 40, 221 -4. Riddle, R. D., Johnson, R. L., Laufer, E. and Tabin, C. (1993). Sonic hedgehog mediates the polarizing activity of the ZPA. Cell 75, 1401-16. Rietveld, A., Neutz, S., Simons, K. and Eaton, S. (1999). Association of sterol- and glycosylphosphatidylinositol-linked proteins with Drosophila raft lipid microdomains. J Biol Chem 274, 12049-54. Robbins, D. J., Nybakken, K. E., Kobayashi, R., Sisson, J. C, Bishop, J. M. and Therond, P. P. (1997). Hedgehog elicits signal transduction by means of a large complex containing the kinesin-related protein costal2. Cell 90, 225-34. Roberts, D. J., Johnson, R. L., Burke, A. C, Nelson, C. E., Morgan, B. A. and Tabin, C. (1995). Sonic hedgehog is an endodermal signal inducing Bmp-4 and Hox genes during induction and regionalization of the chick hindgut. Development 121, 3163-74. Roberts, D. J., Smith, D. M., Goff, D. J. and Tabin, C. J. (1998). Epithelial- mesenchymal signaling during the regionalization of the chick gut. Development 125, 2791-801. Rollnick, B. R. and Hoo, J. J. (1988). Genitourinary anomalies are a component manifestation in the ectodermal dysplasia, ectrodactyly, cleft lip/palate (EEC) syndrome. Am J Med Genet 29, 131-6. Sah, V. P., Attardi, L. D., Mulligan, G. J., Williams, B. O., Bronson, R. T. and Jacks, T. (1995). A subset of p53-deficient embryos exhibit exencephaly. Nat Genet 10, 175-80.

116 Sasaki, H., Nishizaki, Y., Hui, C, Nakafuku, M. and Kondoh, H. (1999). Regulation of GH2 and Gli3 activities by an amino-terminal repression domain: implication of GH2 and Gli3 as primary mediators of Shh signaling. Development 126, 3915-24. Sasaki, Y., Iwai, N., Tsuda, T. and Kimura, O. (2004). Sonic hedgehog and bone morphogenetic protein 4 expressions in the hindgut region of murine embryos with anorectal malformations. JPediatr Surg 39, 170-3; discussion 170-3. Satokata, I. and Maas, R. (1994). Msxl deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nat Genet 6, 348-56. Scrable, H., Sasaki, T. and Maier, B. (2005). DeltaNp53 or p44: priming the p53 pump. IntJBiochem Cell Biol 37, 913-9. Serber, Z., Lai, H. C, Yang, A., Ou, H. D., Sigal, M. S., Kelly, A. E., Darimont, B. D., Duijf, P. H., Van Bokhoven, H., McKeon, F. et al. (2002). A C-terminal inhibitory domain controls the activity of p63 by an intramolecular mechanism. Mol Cell Biol 22, 8601-11. Shapiro, E., Lepor, H. and Jeffs, R. D. (1984). The inheritance of the exstrophy- epispadias complex. J Urol 132, 308-10. Shaulian, E., Zauberman, A., Ginsberg, D. and Oren, M. (1992). Identification of a minimal transforming domain of p53: negative dominance through abrogation of sequence- specific DNA binding. Mol Cell Biol 12, 5581-92. Shaw, N. J., Georgopoulos, N. T., Southgate, J. and Trejdosiewiez, L. K. (2005). Effects of loss of p53 and pl6 function on life span and survival of human urothelial cells. Int J Cancer 116, 634-9. Shi, X., Yang, X., Chen, D., Chang, Z. and Cao, X. (1999). Smadl interacts with homeobox DNA-binding proteins in bone morphogenetic protein signaling. J Biol Chem 274,13711-7. Shiroyanagi, Y., Liu, B., Cao, M., Agras, K., Li, J., Hsieh, M. H., Willingham, E. J. and Baskin, L. S. (2007). Urothelial sonic hedgehog signaling plays an important role in bladder smooth muscle formation. Differentiation. Shivdasani, R. A. (2002). Molecular regulation of vertebrate early endoderm development. Dev Biol 249, 191-203. Signoretti, S., Pires, M. M., Lindauer, M., Horner, J. W., Grisanzio, C, Dhar, S., Majumder, P., McKeon, F., Kantoff, P. W., Sellers, W. R. et al. (2005). p63 regulates commitment to the prostate cell lineage. Proc Natl Acad Sci USA 102, 11355-60. Silberg, D. G., Swain, G. P., Suh, E. R. and Traber, P. G. (2000). Cdxl and cdx2 expression during intestinal development. Gastroenterology 119, 961-71. Smith, J. (1999). T-box genes: what they do and how they do it. Trends Genet 15, 154-8. Stott, D., Kispert, A. and Herrmann, B. G. (1993). Rescue of the tail defect of Brachyury mice. Genes Dev 7, 197-203. Sukegawa, A., Narita, T., Kameda, T., Saitoh, K., Nohno, T., Iba, H., Yasugi, S. and Fukuda, K. (2000). The concentric structure of the developing gut is regulated by Sonic hedgehog derived from endodermal epithelium. Development 127, 1971-80. Taipale, J. and Beachy, P. A. (2001). The Hedgehog and Wnt signalling pathways in cancer. Nature 411, 349-54. Takeda, M., Saito, Y., Sekine, R., Onitsuka, I., Maeda, R. and Maeno, M. (2000). Xenopus msx-1 regulates dorso-ventral axis formation by suppressing the expression of organizer genes. Comp Biochem Physiol B Biochem Mol Biol 126, 157-68.

117 Tarchini, B., Duboule, D. and Kmita, M. (2006). Regulatory constraints in the evolution of the tetrapod limb anterior-posterior polarity. Nature 443, 985-8. Teleman, A. A. and Cohen, S. M. (2000). Dpp gradient formation in the Drosophila wing imaginal disc. Cell 103, 971-80. Thauvin-Robinet, C, Faivre, L., Cusin, V., Khau Van Kien, P., Callier, P., Parker, K. L., Fellous, M., Borgnon, J., Gounot, E., Huet, F. et al. (2004). Cloacal exstrophy in an infant with 9q34.1-qter deletion resulting from a de novo unbalanced translocation between chromosome 9q and Yq. Am J Med Genet A 126, 303-7. Thayer, S. P., di Magliano, M. P., Heiser, P. W., Nielsen, C. M., Roberts, D. J., Lauwers, G. Y., Qi, Y. P., Gysin, S., Fernandez-del Castillo, C, Yajnik, V. et al. (2003). Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis. Nature 425, 851-6. Thievessen, I., Wolter, M., Prior, A., Seifert, H. H. and Schulz, W. A. (2005). Hedgehog signaling in normal urothelial cells and in urothelial carcinoma cell lines. J Cell Physiol 203, 372-7. Utsch, B., DiFeo, A., Kujat, A., Karle, S., Schuster, V., Lenk, H., Jacobs, U., Muller, M., Dotsch, J., Rascher, W. et al. (2006). Bladder exstrophy and Epstein type congenital macrothrombocytopenia: evidence for a common cause? Am J Med Genet A 140, 2251-3. Varley, C, Hill, G., Pellegrin, S., Shaw, N. J., Selby, P. J., Trejdosiewicz, L. K. and Southgate, J. (2005). Autocrine regulation of human urothelial cell proliferation and migration during regenerative responses in vitro. Exp Cell Res 306, 216-29. Vaux, D. L. and Korsmeyer, S. J. (1999). Cell death in development. Cell 96, 245-54. Walsh, G. S., Orike, N., Kaplan, D. R. and Miller, F. D. (2004). The invulnerability of adult neurons: a critical role for p73. JNeurosci 24, 9638-47. Wang, D., Chang, P. S., Wang, Z., Sutherland, L., Richardson, J. A., Small, E., Krieg, P. A. and Olson, E. N. (2001). Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor. Cell 105, 851-62. Wang, D. Z. and Olson, E. N. (2004). Control of smooth muscle development by the myocardin family of transcriptional coactivators. Curr Opin Genet Dev 14, 558-66. Wang, Y. and Sassoon, D. (1995). Ectoderm-mesenchyme and mesenchyme-mesenchyme interactions regulate Msx-1 expression and cellular differentiation in the murine limb bud. Dev Biol 168, 374-82. Warne, S. A., Godley, M. L. and Wilcox, D. T. (2004). Surgical reconstruction of cloacal malformation can alter bladder function: a comparative study with anorectal anomalies. J Urol 172, 2377-81; discussion 2381. Warot, X., Fromental-Ramain, C, Fraulob, V., Chambon, P. and Dolle, P. (1997). Gene dosage-dependent effects of the Hoxa-13 and Hoxd-13 mutations on morphogenesis of the terminal parts of the digestive and urogenital tracts. Development 124, 4781-91. Watkins, D. N., Berman, D. M., Burkholder, S. G., Wang, B., Beachy, P. A. and Baylin, S. B. (2003). Hedgehog signalling within airway epithelial progenitors and in small-cell lung cancer. Nature 422, 313-7. Watson, I. R., Blanch, A., Lin, D. C, Ohh, M. and Irwin, M. S. (2006). Mdm2-mediated NEDD8 modification of TAp73 regulates its transactivation function. J Biol Chem 281, 34096-103. Weaver, M., Batts, L. and Hogan, B. L. (2003). Tissue interactions pattern the mesenchyme of the embryonic mouse lung. Dev Biol 258, 169-84.

118 Wells, J. M. and Melton, D. A. (2000). Early mouse endoderm is patterned by soluble factors from adjacent germ layers. Development 127, 1563-72. Westfall, M. D., Mays, D. J., Sniezek, J. C. and Pietenpol, J. A. (2003). The Delta Np63 alpha phosphoprotein binds the p21 and 14-3-3 sigma promoters in vivo and has transcriptional repressor activity that is reduced by Hay-Wells syndrome-derived mutations. Mol Cell Biol 23, 2264-76. Winnier, G., Blessing, M., Labosky, P. A. and Hogan, B. L. (1995). Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev 9, 2105-16. Wu, H. Y., Baskin, L. S., Liu, W., Li, Y. W., Hayward, S. and Cunha, G. R. (1999). Understanding bladder regeneration: smooth muscle ontogeny. J Urol 162, 1101-5. Xie, J., Murone, M., Luoh, S. M., Ryan, A., Gu, Q., Zhang, C, Bonifas, J. M., Lam, C. W., Hynes, M., Goddard, A. et al. (1998). Activating Smoothened mutations in sporadic basal-cell carcinoma. Nature 391, 90-2. Yang, A., Kaghad, M., Caput, D. and McKeon, F. (2002). On the shoulders of giants: p63, p73 and the rise of p53. Trends Genet 18, 90-5. Yang, A., Kaghad, M., Wang, Y., Gillett, E., Fleming, M. D., Dotsch, V., Andrews, N. C, Caput, D. and McKeon, F. (1998). p63, ap53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell 2, 305-16. Yang, A., Schweitzer, R., Sun, D., Kaghad, M., Walker, N., Bronson, R. T., Tabin, C, Sharpe, A., Caput, D., Crum, C. et al. (1999). p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature 398, 714-8. Yang, Y., Drossopoulou, G., Chuang, P. T., Duprez, D., Marti, E., Bumcrot, D., Vargesson, N., Clarke, J., Niswander, L., MeMahon, A. et al. (1997). Relationship between dose, distance and time in Sonic Hedgehog-mediated regulation of anteroposterior polarity in the chick limb. Development 124, 4393-404. Yasuo, H. and Lemaire, P. (1999). A two-step model for the fate determination of presumptive endodermal blastomeres in Xenopus embryos. Curr Biol 9, 869-79. Yu, J., Carroll, T. J. and MeMahon, A. P. (2002). Sonic hedgehog regulates proliferation and differentiation of mesenchymal cells in the mouse metanephric kidney. Development 129,5301-12. Yu, J., Gonzalez, S., Martinez, L., Diez-Pardo, J. A. and Tovar, J. A. (2003). Effects of retinoic acid on the neural crest-controlled organs of fetal rats. Pediatr Surg Int 19, 355-8. Yu, J., Manabe, M., Wu, X. R., Xu, C, Surya, B. and Sun, T. T. (1990). Uroplakin I: a 27-kD protein associated with the asymmetric unit membrane of mammalian urothelium. J Cell Biol 111, 1207'-16. Yucel, S., Liu, W., Cordero, D., Donjacour, A., Cunha, G. and Baskin, L. S. (2004). Anatomical studies of the fibroblast growth factor-10 mutant, Sonic Hedge Hog mutant and androgen receptor mutant mouse genital tubercle. Adv Exp Med Biol 545, 123-48. Zeng, X., Goetz, J. A., Suber, L. M., Scott, W. J., Jr., Schreiner, C. M. and Robbins, D. J. (2001). A freely diffusible form of Sonic hedgehog mediates long-range signalling. Nature 411, 716-20. Zimmerman, L. B., De Jesus-Escobar, J. M. and Harland, R. M. (1996). The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4. Cell 86, 599- 606.

119 120 121