Regulation of Host Translational Machinery by African Swine Fever Virus

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Regulation of Host Translational Machinery by African Swine Fever Virus Alfredo Castello´ ¤, Ana Quintas, Elena G. Sa´nchez, Prado Sabina, Marisa Nogal, Luis Carrasco, Yolanda Revilla* Centro de Biologı´a Molecular Severo Ochoa, CSIC-UAM, Universidad Auto´noma de Madrid, Madrid, Spain Abstract African swine fever virus (ASFV), like other complex DNA viruses, deploys a variety of strategies to evade the host’s defence systems, such as inflammatory and immune responses and cell death. Here, we analyse the modifications in the translational machinery induced by ASFV. During ASFV infection, eIF4G and eIF4E are phosphorylated (Ser1108 and Ser209, respectively), whereas 4E-BP1 is hyperphosphorylated at early times post infection and hypophosphorylated after 18 h. Indeed, a potent increase in eIF4F assembly is observed in ASFV-infected cells, which is prevented by rapamycin treatment. Phosphorylation of eIF4E, eIF4GI and 4E-BP1 is important to enhance viral protein production, but is not essential for ASFV infection as observed in rapamycin- or CGP57380-treated cells. Nevertheless, eIF4F components are indispensable for ASFV protein synthesis and virus spread, since eIF4E or eIF4G depletion in COS-7 or Vero cells strongly prevents accumulation of viral proteins and decreases virus titre. In addition, eIF4F is not only activated but also redistributed within the viral factories at early times of infection, while eIF4G and eIF4E are surrounding these areas at late times. In fact, other components of translational machinery such as eIF2a, eIF3b, eIF4E, eEF2 and ribosomal P protein are enriched in areas surrounding ASFV factories. Notably, the mitochondrial network is polarized in ASFV-infected cells co-localizing with ribosomes. Thus, translation and ATP synthesis seem to be coupled and compartmentalized at the periphery of viral factories. At later times after ASFV infection, polyadenylated mRNAs disappear from the cytoplasm of Vero cells, except within the viral factories. The distribution of these pools of mRNAs is similar to the localization of viral late mRNAs. Therefore, degradation of cellular polyadenylated mRNAs and recruitment of the translation machinery to viral factories may contribute to the inhibition of host protein synthesis, facilitating ASFV protein production in infected cells. Citation: Castello´ A, Quintas A, Sa´nchez EG, Sabina P, Nogal M, et al. (2009) Regulation of Host Translational Machinery by African Swine Fever Virus. PLoS Pathog 5(8): e1000562. doi:10.1371/journal.ppat.1000562 Editor: Ian Mohr, New York University, United States of America Received March 31, 2009; Accepted July 31, 2009; Published August 28, 2009 Copyright: ß 2009 Castello´ et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by Grants from Laboratorios Esteve, Ministerio de Educacio´n y Ciencia BFU2007-63110 and BFU2006-02182, and by an Institutional grant from the Fundacio´n Ramo´n Areces. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] ¤ Current address: European Molecular Biology Laboratory (EMBL), Heidelberg, Germany Introduction eukaryotic cells by means of phosphorylation processes [7,8]. In example, Pak-2 phosphorylate eIF4GI at the eIF4E-binding site, The vast majority of animal cytolytic viruses interfere with inhibiting the interaction between both factors [7]. On the other cellular gene expression after infection of host cells. Cellular hand, eIF4E is phosphorylated by the protein kinase Mnk-1, protein synthesis in particular is usually abrogated at times when although the role of this event is still under investigation [2,9]. In late viral proteins are being synthesized [1–3]. However, the addition, there are several eIF4E-binding proteins (4E-BPs) that molecular mechanisms by which viruses induce this phenomenon have the ability to sequester eIF4E in a phosphorylation- are still under investigation. Eukaryotic initiation factor (eIF) 4F is dependent manner [9,10]. In their hypophosphorylated form, composed of eIF4E, eIF4A and eIF4G (Figure 1A). eIF4E binds 4E-BPs inhibit cap-dependent translation on interacting with the cap structure present at the 59 end of cellular mRNAs; eIF4A is eIF4E. In contrast, hyperphosphorylation of 4E-BPs by mTOR an RNA helicase that unwinds the secondary structure near to the kinase leads to their release from eIF4E and subsequent initiation codon and eIF4G is a scaffolding protein that physically association with eIF4G, thereby assembling an active eIF4F links the mRNA and the small ribosomal subunit by means of complex [9,10]. several protein-protein interactions [4]. In particular, the N- Given the essential role of eIF4F in cellular mRNA translation, terminal domain of eIF4G binds to eIF4E and poly(A)-binding it is not surprising that many animal viruses target eIF4F during protein (PABP), which are involved in mRNA recruitment through the viral cycle [2,3]. This is the case of some picornaviruses, interaction with the cap and the poly(A) tail, respectively (scheme retroviruses and caliciviruses, which encode proteases that cleave in Figure 1A) [5,6]. The C-terminal domain of eIF4G interacts eIF4G, separating its N-terminal and C-terminal domains [11]. with eIF4A, mitogen-activated kinase 1 (Mnk-1) and eIF3, a Other viruses such as encephalomyocarditis virus (EMCV), complex eIF that binds the 40S ribosomal subunit [4]. In addition, adenoviruses (AdV) or vesicular stomatitis virus (VSV) induce eIF4F functions are regulated by extra- and intracellular signals in the dephosphorylation of eIF4E and 4E-BPs, leading to inactiva- PLoS Pathogens | www.plospathogens.org 1 August 2009 | Volume 5 | Issue 8 | e1000562 Control of Protein Synthesis by ASFV Author Summary fully dependent on the cellular translational machinery to synthesize viral proteins. In the present work, a number of eIFs African Swine Fever Virus (ASFV) is a large DNA virus that are analyzed in ASFV-infected cells. We provide evidence that infects different species of swine, causing an acute, highly eIF4E and eIF4G are phosphorylated at Ser209 and Ser1108 contagious and often fatal disease. Infection by ASFV is respectively and these events strongly correlate with a robust viral characterized by the absence of a neutralizing immune protein synthesis and an increase of eIF4F assembly. Inhibition of response, which has so far hampered the development of either eIF4GI or eIF4E phosphorylation partially affects viral a conventional vaccine. While a number of reports have protein synthesis and virus spread, whereas the knock down of been concerned with ASFV genes and mechanisms these factors strongly avoid ASFV infection. On the other hand, regulating programmed cell death and immune evasion, eIF4GI and eIF4E are recruited within ASFV factories at 8 hpi, nothing is known so far regarding how ASFV replicates in and they are later redistributed to the periphery of these particular the infected cells. As intracellular parasites, viruses are foci. Finally, eIF4GI, eIF4E, eIF2a, eIF3b, eEF2 and ribosomes highly dependent on host translation machinery for synthesizing their own proteins. We have observed that are closely distributed to ASFV factories at 16 hpi, being ASFV the cellular protein synthesis is strongly inhibited during late mRNAs and mitochondrial network found at these areas. ASFV infection, while viral proteins are efficiently pro- duced. Furthermore, we here describe the processes by Materials and Methods which ASFV activates and redistributes the cellular machinery to synthesize its own proteins. It has been Cell culture, viruses, and reagents reported that ASFV replicates within discrete cytoplasmic Vero and COS-7 (African green monkey kidney) cells were areas known as factories. In this regard, we have identified obtained from the American Type Culture Collection (ATCC) and the presence of important cellular factors involved in the grown in Dulbecco’s Modified Eagle’s Medium supplemented with control of protein synthesis, located close to viral factories, 5% fetal bovine serum (Invitrogen Life Technologies). Cells were together with ribosomes and the mitochondrial network, grown at 37uC under a 7% CO2 atmosphere saturated with water which represents a sophisticated mechanism of viral vapor in a culture medium supplemented with 2 mM L-glutamine, control. 100 U/ml gentamicin and nonessential amino acids. The Vero- adapted ASFV strain Ba71V was propagated and titrated by plaque tion of cap-dependent translation [12–15]. By contrast, mRNAs assay on Vero cells, as described [26–29]. Infection of Vero and synthesized by some DNA viruses, such as herpes simplex virus COS-7 cells with Ba71V ASFV was carried out at a multiplicity of type 1 (HSV-1), human citomegalovirus (HCMV) or vaccinia virus 1–5 pfu/cell. Silencing was achieved by transfecting COS-7 or (VV), are translated by a cap-dependent mechanism. These viruses Vero cells twice (0 and 24 h) with 25 nM siRNAs (siControl [Gene can in fact stimulate eIF4F assembly to enhance viral protein Link], si4E [TACATTAATCGGTAGCAGGAA] [32], si4GII-2 synthesis [16–19]. In addition to eIF4F, the phosphorylation of [CAAAGACCTGGACTTTGAA] (EW, AC, PM and LC, unpub- eIF2a may play a key
Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Eef2k) Natural Product and Synthetic Small Molecule Inhibitors for Cancer Chemotherapy

    Eef2k) Natural Product and Synthetic Small Molecule Inhibitors for Cancer Chemotherapy

    International Journal of Molecular Sciences Review Progress in the Development of Eukaryotic Elongation Factor 2 Kinase (eEF2K) Natural Product and Synthetic Small Molecule Inhibitors for Cancer Chemotherapy Bin Zhang 1 , Jiamei Zou 1, Qiting Zhang 2, Ze Wang 1, Ning Wang 2,* , Shan He 1 , Yufen Zhao 2 and C. Benjamin Naman 1,* 1 Li Dak Sum Yip Yio Chin Kenneth Li Marine Biopharmaceutical Research Center, College of Food and Pharmaceutical Sciences, Ningbo University, Ningbo 315800, China; [email protected] (B.Z.); [email protected] (J.Z.); [email protected] (Z.W.); [email protected] (S.H.) 2 Institute of Drug Discovery Technology, Ningbo University, Ningbo 315211, China; [email protected] (Q.Z.); [email protected] (Y.Z.) * Correspondence: [email protected] (N.W.); [email protected] (C.B.N.) Abstract: Eukaryotic elongation factor 2 kinase (eEF2K or Ca2+/calmodulin-dependent protein kinase, CAMKIII) is a new member of an atypical α-kinase family different from conventional protein kinases that is now considered as a potential target for the treatment of cancer. This protein regulates the phosphorylation of eukaryotic elongation factor 2 (eEF2) to restrain activity and inhibit the elongation stage of protein synthesis. Mounting evidence shows that eEF2K regulates the cell cycle, autophagy, apoptosis, angiogenesis, invasion, and metastasis in several types of cancers. The Citation: Zhang, B.; Zou, J.; Zhang, expression of eEF2K promotes survival of cancer cells, and the level of this protein is increased in Q.; Wang, Z.; Wang, N.; He, S.; Zhao, many cancer cells to adapt them to the microenvironment conditions including hypoxia, nutrient Y.; Naman, C.B.
  • Supplementary Information

    Supplementary Information

    SUPPLEMENTARY INFORMATION Myeloperoxidase-derived 2-chlorohexadecanal is generated in mouse heart during endotoxemia and induces modification of distinct cardiomyocyte protein subsets in vitro Jürgen Prasch, Eva Bernhart, Helga Reicher, Manfred Kollroser, Gerald N. Rechberger, Chintan N. Koyani, Christopher Trummer, Lavinia Rech, Peter P. Rainer, Astrid Hammer, Ernst Malle, Wolfgang Sattler Table S1: Biological process gene ontology (GO) enrichment analysis. #term ID term description observed background false discovery matching proteins in network (labels) gene count gene count rate GO:0006457 protein folding 10 153 5.21e-09 Cct3,Cct5,Cct8,Fkbp4,Hsp90aa1,Hsp a1l,Hspb1,Pdia3,Pdia6,Tcp1 GO:0007339 binding of sperm to 6 36 4.02e-07 Aldoa,Cct3,Cct5,Cct8,Hspa1l,Tcp1 zona pellucida GO:0061077 chaperone-mediated 6 60 2.67e-06 Cct3,Cct5,Cct8,Fkbp4,Hspb1,Tcp1 protein folding GO:0017144 drug metabolic process 11 494 4.06e-06 Aldh2,Aldoa,Eno1,Gapdh,Hsp90aa1,I dh3a,Ldha,Ndufs2,Pgam1,Phgdh,Uq crc1 GO:2000573 positive regulation of 6 69 4.16e-06 Cct3,Cct5,Cct8,Ddx39b,Hsp90aa1,Tc DNA biosynthetic p1 process GO:0009987 cellular process 47 12459 4.22e-06 Alad,Alb,Aldh2,Aldoa,Cct3,Cct5,Cct8, Dctn2,Ddx39,Ddx39b,Des,Eef1g,Eef 2,Eif3f,Eif4a2,Eno1,Fdps,Fkbp4,Gap dh,Hnrnpl,Hsp90aa1,Hspa1l,Hspb1,I dh3a,Ldha,Lmna,Lyz1,Ndufs2,Pcna, Pdia3,Pdia6,Pgam1,Phgdh,Prph,Psm d13,Rpsa,Ruvbl2,Tcp1,Tuba3b,Tubal 3,Tubb3,Tubb6,Uap1l1,Uqcrc1,Uqcrc 2,Vim,Ywhab GO:1904851 positive regulation of 4 10 4.22e-06 Cct3,Cct5,Cct8,Tcp1 establishment of protein localization to telomere GO:0046031
  • Molecular Pharmacology of Cancer Therapy in Human Colorectal Cancer by Gene Expression Profiling1,2

    Molecular Pharmacology of Cancer Therapy in Human Colorectal Cancer by Gene Expression Profiling1,2

    [CANCER RESEARCH 63, 6855–6863, October 15, 2003] Molecular Pharmacology of Cancer Therapy in Human Colorectal Cancer by Gene Expression Profiling1,2 Paul A. Clarke,3 Mark L. George, Sandra Easdale, David Cunningham, R. Ian Swift, Mark E. Hill, Diana M. Tait, and Paul Workman Cancer Research UK Centre for Cancer Therapeutics, Institute of Cancer Research, Sutton, Surrey SM2 5NG [P. A. C., M. L. G., S. E., P. W.]; Department of Gastrointestinal Oncology, Royal Marsden Hospital, Sutton, Surrey [D. C., M. E. H., D. M. T.]; and Department of Surgery, Mayday Hospital, Croydon, Surrey [M. L. G., R. I. S.], United Kingdom ABSTRACT ment with a single dose of MMC4 and during a continuous infusion of 5FU. In this study, we report for the first time gene expression Global gene expression profiling has potential for elucidating the com- profiling in cancer patients before, and critically, during the period of plex cellular effects and mechanisms of action of novel targeted anticancer exposure to chemotherapy. We have demonstrated that the approach agents or existing chemotherapeutics for which the precise molecular is feasible, and we have detected a novel molecular response that mechanism of action may be unclear. In this study, decreased expression would not have been predicted from in vitro studies and that would of genes required for RNA and protein synthesis, and for metabolism were have otherwise been missed by conventional approaches. The results detected in rectal cancer biopsies taken from patients during a 5-fluorou- also suggest a possible new therapeutic approach. Overall our obser- racil infusion. Our observations demonstrate that this approach is feasible and can detect responses that may have otherwise been missed by con- vations suggest that gene expression profiling in response to treatment ventional methods.
  • Phosphorylation and Signal Transduction Pathways in Translational Control

    Phosphorylation and Signal Transduction Pathways in Translational Control

    Downloaded from http://cshperspectives.cshlp.org/ on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Phosphorylation and Signal Transduction Pathways in Translational Control Christopher G. Proud Nutrition & Metabolism, South Australian Health & Medical Research Institute, North Terrace, Adelaide SA5000, Australia; and School of Biological Sciences, University of Adelaide, Adelaide SA5000, Australia Correspondence: [email protected] Protein synthesis, including the translation of specific messenger RNAs (mRNAs), is regulated by extracellular stimuli such as hormones and by the levels of certain nutrients within cells. This control involves several well-understood signaling pathways and protein kinases, which regulate the phosphorylation of proteins that control the translational machinery. These path- ways include the mechanistic target of rapamycin complex 1 (mTORC1), its downstream effectors, and the mitogen-activated protein (MAP) kinase (extracellular ligand-regulated kinase [ERK]) signaling pathway. This review describes the regulatory mechanisms that control translation initiation and elongation factors, in particular the effects of phosphoryla- tion on their interactions or activities. It also discusses current knowledge concerning the impact of these control systems on the translation of specific mRNAs or subsets of mRNAs, both in physiological processes and in diseases such as cancer. he control of protein synthesis plays key roles Accordingly, sophisticated control mecha- Tin cell growth and proliferation and in nisms exist to allow extracellular stimuli (e.g., many other processes, via shaping the cellular hormones, growth factors), intracellular metab- proteome. The importance of translational con- olites (essential amino acids, nucleotides) and trol is underscored, for example, by the lack of cues, such as energy status, to regulate protein concordance between the transcriptome and the synthesis.
  • Trans-Acting Factors Affecting Retroviral Recoding

    Trans-Acting Factors Affecting Retroviral Recoding

    TRANS-ACTING FACTORS AFFECTING RETROVIRAL RECODING Lisa Green Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2012 © 2012 Lisa Green All Rights Reserved Thesis Abstract Trans-Acting Factors Affecting Retroviral Recoding Lisa Green The production of retroviral enzymes requires a translational recoding event which subverts normal decoding, either by direct suppression of termination with the insertion of an amino acid at a stop codon (readthrough), or by an alteration of the reading frame of the mRNA (frameshift). It has been determined that retroviral readthrough and frameshift require cis-acting factors in the mRNA to stimulate recoding on the eukaryotic ribosome. Here we investigate the affects of trans-acting factors on recoding, primarily in the context of the MoMLV gag-pol junction. We report the effects of a host protein, Large Ribosomal Protein Four (RPL4), on the efficiency of recoding. Using a dual luciferase reporter assay, we show that transfection of cells with an RPL4 cDNA expression construct enhances recoding efficiency in a dose-dependent manner. The increase in the frequency of recoding can be more than 2-fold, adequate to disrupt normal viral production. This effect is cell line specific, and appears to be distinct to RPL4 among ribosomal proteins. The RPL4 increase occurs with both retroviral readthrough and frameshift sequences, and even at other viral readthrough regions that do not involve RNA secondary structures. We show that RPL4 effects are negated by release factor over-expression, and that RPL4 will increase readthrough above the levels of a hyperactive mutant and in addition to G418.
  • PDF of Eric Lecuyer's Talk

    PDF of Eric Lecuyer's Talk

    Gene Expression Regulation in Subcellular Space Eric Lécuyer, PhD Associate Professor and Axis Director, RNA Biology Lab Systems Biology Axis, IRCM Associate Research Professor, Département de Biochimie Université de Montréal Associate Member, Division of Experimental Medicine, McGill University VizBi 2018 Meeting The Central Dogma in Subcellular Space Crick, Nature 227: 561 (1970) Biological Functions of Localized mRNAs mRNA Protein Extracellular Vesicles Cody et al. (2013). WIREs Dev Biol Raposo and Stoorvogel (2013) J Cell Biol Cis-Regulatory RNA Localization Elements Van De Bor and Davis, 2004. Curr.Opin.Cell.Biol. Global Screen for Localized mRNAs in Drosophila http://fly-fish.ccbr.utoronto.ca (Lécuyer et al. Cell, 2007) Diverse RNA Subcellular Localization Patterns RNA DNA Correlations in mRNA-Protein Localization Localization Patterns Terms Ontology Gene RNA Protein DNA (Lécuyer et al. Cell, 2007) Models and Approaches to Decipher the mRNA Localization Pathways Drosophila & RNA/Protein High-Content Screening Human Cell Models Imaging & RNA Sequencing + + Cell Fractionation and RNA Sequencing (CeFra-seq) to Study Global RNA Distribution Cell Fractionation-Seq to Study RNA Localization RNA and Protein Extraction, RiboDepletion or PolyA+ RNA-seq and MS profiling (K562, HepG2 and D17) Wang et al (2012) Cell https://www.encodeproject.org/ Lefebvre et al (2017) Methods Benoît Bouvrette et al (2018) RNA Interesting Examples of RNA Localization ANKRD52 (mRNA and ciRNA) Total Nuclear Cytosolic ciRNA Membrane Insoluble mRNA ANKRD52 DANCR
  • Loss of Eif4e Phosphorylation Engenders Depression-Like Behaviors Via Selective Mrna Translation

    Loss of Eif4e Phosphorylation Engenders Depression-Like Behaviors Via Selective Mrna Translation

    2118 • The Journal of Neuroscience, February 21, 2018 • 38(8):2118–2133 Neurobiology of Disease Loss of eIF4E Phosphorylation Engenders Depression-like Behaviors via Selective mRNA Translation X Ineˆs S. Amorim,1,2* Sonal Kedia,1,2* XStella Kouloulia,1,2* XKonstanze Simbriger,1,2* XIlse Gantois,3 X Seyed Mehdi Jafarnejad,3 Yupeng Li,1,2 Agniete Kampaite,1,2 Tine Pooters,1 XNicola Romano`,1 and X Christos G. Gkogkas1,2,4 1Centre for Discovery Brain Sciences, University of Edinburgh, Edinburgh EH8 9XD, United Kingdom, 2Patrick Wild Centre, University of Edinburgh, Edinburgh EH8 9XD, United Kingdom, 3Goodman Cancer Research Centre and Biochemistry Department, McGill University, Montre´al, Quebec H3A 1A3, Canada, and 4Simons Initiative for the Developing Brain, University of Edinburgh, Edinburgh EH8 9XD, United Kingdom The MAPK/ERK (mitogen-activated protein kinases/extracellular signal-regulated kinase) pathway is a cardinal regulator of synaptic plasticity, learning, and memory in the hippocampus. One of major endpoints of this signaling cascade is the 5Ј mRNA cap binding protein eIF4E (eukaryotic Initiation Factor 4E), which is phosphorylated on Ser 209 by MNK (MAPK-interacting protein kinases) and controls mRNA translation. The precise role of phospho-eIF4E in the brain is yet to be determined. Herein, we demonstrate that ablation of eIF4E phosphorylation in male mice (4Eki mice) does not impair long-term spatial or contextual fear memory, or the late phase of LTP. Using unbiased translational profiling in mouse brain, we show that phospho-eIF4E differentially regulates the translation of a subset of mRNAs linked to inflammation, the extracellular matrix, pituitary hormones, and the serotonin pathway.
  • ATP Depletion Increases Phosphorylation of Elongation Factor

    ATP Depletion Increases Phosphorylation of Elongation Factor

    FEBS Letters 531 (2002) 448^452 FEBS 26715 View metadata, citation and similar papers at core.ac.uk brought to you by CORE ATP depletion increases phosphorylation of elongation factorprovided eEF2 by Elsevier - Publisher in Connector adult cardiomyocytes independently of inhibition of mTOR signalling Laura E. McLeod, Christopher G. Proudà Division of Molecular Physiology, Faculty of Life Sciences, University of Dundee, Dundee DD1 5EH, UK Received 27 August 2002; revised 11 October 2002; accepted 11 October 2002 First published online 22 October 2002 Edited by Jacques Hanoune These targets for mTOR signalling include the kinases that Abstract Translation elongation consumes a high proportion of cellular energy and can be regulated by phosphorylation of phosphorylate ribosomal S6 [4]. Two S6 kinase genes exist in elongation factor eEF2 which inhibits its activity. We have mammals, the product of the S6K1 gene being better under- studied the e¡ects of ATP depletion on the phosphorylation of stood than S6K2. Rapamycin blocks the activation of the S6 eEF2 in adult rat ventricular cardiomyocytes. Energy depletion kinases, indicating an essential role for mTOR in their regu- rapidly leads to inhibition of protein synthesis and increased lation. mTOR is also required for regulation of the eukaryotic phosphorylation of eEF2. Stimulation of the AMP-activated initiation factor (eIF) 4E-binding protein, 4E-BP1, which in protein kinase also causes increases eEF2 phosphorylation. its hypophosphorylated state binds to and inhibits eIF4E. Only at later times is an e¡ect on mTOR signalling observed. eIF4E interacts with the 5P-cap of the mRNA (which contains These data suggest that energy depletion leads to inhibition of 7-methylGTP) and also binds the sca¡old protein eIF4G, protein synthesis through phosphorylation of eEF2 independent- thereby recruiting other factors and the 40S ribosomal subunit ly of inhibition of mTOR signalling.
  • Eukaryotic Translation Initiation Factors As Promising Targets in Cancer Therapy

    Eukaryotic Translation Initiation Factors As Promising Targets in Cancer Therapy

    Hao et al. Cell Communication and Signaling (2020) 18:175 https://doi.org/10.1186/s12964-020-00607-9 REVIEW Open Access Eukaryotic translation initiation factors as promising targets in cancer therapy Peiqi Hao1,2†, Jiaojiao Yu1†, Richard Ward3, Yin Liu2, Qiao Hao2,SuAn2* and Tianrui Xu2* Abstract The regulation of the translation of messenger RNA (mRNA) in eukaryotic cells is critical for gene expression, and occurs principally at the initiation phase which is mainly regulated by eukaryotic initiation factors (eIFs). eIFs are fundamental for the translation of mRNA and as such act as the primary targets of several signaling pathways to regulate gene expression. Mis-regulated mRNA expression is a common feature of tumorigenesis and the abnormal activity of eIF complexes triggered by upstream signaling pathways is detected in many tumors, leading to the selective translation of mRNA encoding proteins involved in tumorigenesis, metastasis, or resistance to anti-cancer drugs, and making eIFs a promising therapeutic target for various types of cancers. Here, we briefly outline our current understanding of the biology of eIFs, mainly focusing on the effects of several signaling pathways upon their functions and discuss their contributions to the initiation and progression of tumor growth. An overview of the progress in developing agents targeting the components of translation machinery for cancer treatment is also provided. Keywords: eIF, mRNA translation, Cancer, MAPK, PI3K/Akt, mTOR Background eukaryotes utilize many more initiation factors than do pro- The regulation of gene expression in eukaryotes can occur karyotes, reflecting the greater biological complexity of at different stages including gene transcription and mRNA eukaryotic translation.
  • Hyperactive Mtor and MNK1 Phosphorylation of Eif4e Confer Tamoxifen Resistance and Estrogen Independence Through Selective Mrna Translation Reprogramming

    Hyperactive Mtor and MNK1 Phosphorylation of Eif4e Confer Tamoxifen Resistance and Estrogen Independence Through Selective Mrna Translation Reprogramming

    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Hyperactive mTOR and MNK1 phosphorylation of eIF4E confer tamoxifen resistance and estrogen independence through selective mRNA translation reprogramming Phillip A. Geter,1 Amanda W. Ernlund,1 Sofia Bakogianni,1 Amandine Alard,1 Rezina Arju,1 Shah Giashuddin,2 Abhilash Gadi,1 Jacqueline Bromberg,3,4 and Robert J. Schneider1,3,4 1Department of Microbiology, Alexandria Center for Life Science, New York University School of Medicine, New York, New York 10016, USA; 2New York Presbyterian-Brooklyn Methodist Hospital, Brooklyn, New York 11215, USA; 3Memorial Sloan Kettering Cancer Institute, New York, New York 10016 USA; 4Perlmutter Cancer Center, New York University School of Medicine, New York, New York 10016 USA The majority of breast cancers expresses the estrogen receptor (ER+) and is treated with anti-estrogen therapies, particularly tamoxifen in premenopausal women. However, tamoxifen resistance is responsible for a large propor- tion of breast cancer deaths. Using small molecule inhibitors, phospho-mimetic proteins, tamoxifen-sensitive and tamoxifen-resistant breast cancer cells, a tamoxifen-resistant patient-derived xenograft model, patient tumor tis- sues, and genome-wide transcription and translation studies, we show that tamoxifen resistance involves selective mRNA translational reprogramming to an anti-estrogen state by Runx2 and other mRNAs. Tamoxifen-resistant translational reprogramming is shown to be mediated by increased expression of eIF4E and its increased availability by hyperactive mTOR and to require phosphorylation of eIF4E at Ser209 by increased MNK activity. Resensitization to tamoxifen is restored only by reducing eIF4E expression or mTOR activity and also blocking MNK1 phosphor- ylation of eIF4E.
  • Inflammatory and Adipogenic Stromal Subpopulations in Visceral Adipose Tissue Of

    Inflammatory and Adipogenic Stromal Subpopulations in Visceral Adipose Tissue Of

    RESEARCH COMMUNICATION Identification of functionally distinct fibro- inflammatory and adipogenic stromal subpopulations in visceral adipose tissue of adult mice Chelsea Hepler1†, Bo Shan1, Qianbin Zhang1, Gervaise H Henry2, Mengle Shao1, Lavanya Vishvanath1, Alexandra L Ghaben1, Angela B Mobley3, Douglas Strand2, Gary C Hon4, Rana K Gupta1* 1Touchstone Diabetes Center, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, United States; 2Department of Urology, University of Texas Southwestern Medical Center, Dallas, United States; 3Department of Immunology, University of Texas Southwestern Medical Center, Dallas, United States; 4Cecil H. and Ida Green Center for Reproductive Biology Sciences, Division of Basic Reproductive Biology Research, Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, Dallas, United States Abstract White adipose tissue (WAT) remodeling is dictated by coordinated interactions between adipocytes and resident stromal-vascular cells; however, the functional heterogeneity of adipose stromal cells has remained unresolved. We combined single-cell RNA-sequencing and FACS to identify and isolate functionally distinct subpopulations of PDGFRb+ stromal cells within visceral WAT of adult mice. LY6C- CD9- PDGFRb+ cells represent highly adipogenic visceral adipocyte precursor cells (‘APCs’), whereas LY6C+ PDGFRb+ cells represent fibro-inflammatory progenitors (‘FIPs’). FIPs lack adipogenic capacity, display pro-fibrogenic/pro-inflammatory *For correspondence: