Screening of Lupine Germplasm for Resistance Against Phytophthora Sojae

Botany

Screening of lupine germplasm for resistance against Phytophthora sojae

Journal: Botany

Manuscript ID cjb-2019-0163.R1

Manuscript Type: Article

Date Submitted by the 22-Jan-2020 Author:

Complete List of Authors: Beligala , Gayathri ; Bowling Green State University, Biological Sciences Michaels , Helen ; Bowling Green State University, Biological Sciences Phuntumart, Vipaporn; Bowling Green State University, Biological Sciences Draft Phytophthora sojae, Lupinus sp., Soybean, Keyword: Pathogenicity

Is the invited manuscript for consideration in a Special Not applicable (regular submission) Issue? :

https://mc06.manuscriptcentral.com/botany-pubs Page 1 of 36 Botany

Screening of lupine germplasm for resistance against Phytophthora sojae

Gayathri U. Beligala, Helen J. Michaels and Vipaporn Phuntumart*

Department of Biological Sciences, Bowling Green State University, Bowling Green, OH, 43403

Gayathri U. Beligala. [email protected]

Helen J. Michaels. [email protected]

Vipaporn Phuntumart. [email protected]

* Corresponding Author Dr. Vipaporn Phuntumart Draft Department of Biological Sciences

129 Life Sciences Building

Bowling Green State University

Bowling Green, OH 43403

Tel.: 419 372-4097

Fax: 419 372-2024

1 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 2 of 36

Abstract

Phytophthora sojae is a major pathogen in cultivated soybeans world-wide. Although incorporating resistance genes has been an effective management tool for soybean breeders, surveys of soybean fields in the Midwest US indicate that some P. sojae strains are capable of overcoming all known resistance genes.

While P. sojae is known to have a very narrow host range, it can also infect Lupinus (lupine), varieties of which may provide potential sources for novelDraft resistance genes that can be genetically engineered into soybean. The chemotactic behavior of zoospores and pathogenicity of P. sojae strain P6497 towards 17 lupine lines were explored. The two soybean varieties Williams and Williams 82 that are susceptible and resistant against P. sojae P6497, respectively, were used as controls. Chemotaxis assays showed that there was no coherent pattern between the number of zoospores colonizing the root surface and plant tolerance or resistance to phytophthora root rot. Pathogenicity tests identified two of 17 lupine lines tested (LAB 18 and LL 35) were resistant to P. sojae infection. Phylogenetic analysis of these two resistant lupine lines with Old World lupines of the Mediterranean and North African regions, and New World lupines of

America, indicated that they originated from the Old World.

Keywords: Phytophthora sojae, Lupinus sp., Soybean, Pathogenicity

2 https://mc06.manuscriptcentral.com/botany-pubs Page 3 of 36 Botany

Introduction Draft Oomycetes are a distinct group of eukaryotic, fungus-like filamentous microorganisms belonging to

Kingdom Stramenopila (Thines 2014). Phytophthora is a genus of destructive plant-damaging oomycetes

(Tyler et al. 2006; Kamoun et al. 2015). First identified in North America in the 1950s (Kaufmann and

Gerdemann 1958), Phytophthora sojae is the causal agent of root and stem rot in soybean (Glycine max L.)

leading to yield reductions of approximately 35 million bushels in 28 soybean-producing states in the US

and Ontario, Canada in 2014 (Allen et al. 2017). Infection by P. sojae primarily occurs at the pre-

emergence- and seedling stage of soybeans (Schmitthenner 1985; Dorrance et al. 2007; Tyler 2007).

Chemical control of oomycete pathogens, including P. sojae, is challenging because of difficulties in

treating the affected underground parts of the plant (Tyler 2007). Hence, breeding for resistance is the

most economic and effective tool of managing phytophthora root rot. Two main sources of resistance

against P. sojae have been utilized; i) race-specific resistance mediated by single dominant Rps (resistance

to P. sojae) genes and ii) partial/broad-spectrum resistance, also known as tolerance (Sugimoto et al. 2012).

When partial resistance becomes ineffective under high disease pressure, race specific resistance has been

3 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 4 of 36

considered as an alternative approach (Dorrance et al. 2003). In soybean, however, continuous usage of

Rps genes has been shown to lead to development of more virulent P. sojae pathotypes (Stewart et al.

2014) and the efficacy of an Rps gene depends on the population of P. sojae it is exposed to. Therefore, it was suggested that both Rps-mediated and partial resistance should be employed to efficiently develop the soybean plants with increased resistance to P. sojae (Burnham et al. 2003).

Phytophthora sojae has a narrow host range and infection is limited primarily to soybean (Tyler 2007).

However, a study by Jones and Johnson (1969) showed that P. sojae infected some lupine species including L. albus, L. angustifolius, L. luteus, L. bicolor, L. succulentus and L. densiflorus. Furthermore, Jones

(1969) expanded the previous study by including more cultivated and wild lupine species and reported that most species of Lupinus were highly susceptibleDraft to P. sojae infection. Similary, Erwin and Ribeiro (1996) reported that 26 species of the genus Lupinus are susceptible to P. sojae infection. Jones and Johnson

(1969) suggested P. sojae originated as a pathogen of lupines in North America prior to the introduction of soybean as a crop. The genus Lupinus is a diverse group of papilionoid legumes consisting of approximately 280 annual and perennial species (Eastwood et al. 2008). They can grow in a wide variety of climates (Drummond et al. 2012) and are divided into an ancestral Mediterranean and African “Old

World” group and the more species-rich American “New World” group. It has been suggested that lupines originated in the Mediterranean region and the separation of Old World and New World lupines was caused by the continental drift (Wink et al. 1999). To date, the Old World group in Europe and North

Africa consists of 13 annual species (Gladstones 1984; Pascual et al. 2006; Nevado et al. 2016) and is further subdivided into two categories on the basis of seed coat texture: smooth- and rough-seeded. The

New World lupines are evolutionary more diverse than the Old World lupines and the processes that are responsible for the rapid diversification of the New World group are poorly understood (Nevado et al.

2016). Phylogenetic analyses suggest that the diversity of the Old World is centered in the Mediterranean

4 https://mc06.manuscriptcentral.com/botany-pubs Page 5 of 36 Botany

and northern and eastern African regions, whereas New World species have two centers of diversity: (1)

Atlantic region of South America and (2) North and central America and Andes (Ainouche and Bayer

1999; Wink et al. 1999; Wolko et al. 2011). At present, lupines are distributed in a wide range of ecological

habitats across lowland and montane environments (Drummond et al. 2012; Nevado et al. 2016). Whole

genome duplications and triplications that occurred, particularly in the papilionoid legumes and the

genistoid lineage, may have contributed to the genomic complexities and novelties that enabled

adaptation to a wide array of biotic and abiotic challenges (Cannon et al. 2015; Hane et al. 2017).

Like other legumes, lupine plants can obtain nitrogen via nitrogen-fixing bacteria (Jarabo-Lorenzo et al.

2003; Beligala et al. 2017;). These beneficial bacteria are attracted to legumes via root exudates (Porter et al. 1985; Banfalvi et al. 1988; Kosslak et al. 2006;Draft Sugiyama 2019). In soybean, these exudates function not only to attract rhizosphere bacteria, but also as a zoospore attractant (Morris and Ward 1992; Tyler et al.

1996; Sugiyama 2019). In saturated soil conditions, zoospores are released from sporangia and swim

towards plant roots to infect and cause root-rot diseases in susceptible plants (Tyler 2007). A number of

studies document that zoospore attachment and pathogenicity are correlated (Chi and Sabo 1978; Erb et

al. 1986), whereas other reports show no such relationship (Tippett et al. 1976; Halsall 1978; Raftoyannis

and Dick 2006).

The first aim of this study is to clarify the correlation between zoospore attachment and pathogenicity of

P. sojae race 2, strain P6497 (Tyler et al. 2006) in lupine, using two soybean lines as controls. The second

aim is to identify lupine lines that are resistant to phytophthora root rot. Lastly, phylogenetic analysis of

internal transcribed spacer (ITS) regions of the ribosomal RNA genes was carried out to both confirm the

identities of the 17 lupine lines used and to help identify the geographic origins of resistant lupines. To

date, this is the first study to explore the zoospore attachment, pathogenicity, and disease severity of P.

5 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 6 of 36

sojae P6497 towards lupine lines including annuals and perennials.

Materials and Methods

Plant and pathogen materials

Seventeen germplasms (referred to as ‘lines’) of lupine were selected for this study based on their availability (Table 1). Ten lines were obtained from the USDA-ARS grain legume collection at Pullman,

WA, USA), five lines were purchased from Plant World Gardens & Nursery (Newton Abbot, Devon, UK), one line was purchased from Marde Ross & Company (Glen Ellen, CA, USA), and one line was supplied by Dr. Helen J. Michaels (Bowling Green State University, OH, USA). Phytophthora sojae race 2, strain P6497 was kindly provided by Brett Tyler, OregonDraft State University (Tyler et al. 2006). The virulence formula for P. sojae race 2 is 1b, 7 (Yang et al. 1996). Additionally, two soybean cultivars served as controls: Williams 82 (SB W82), which carries a resistance gene (Rps1k) against P. sojae P6497, as a resistant control and Williams (SB W) as a susceptible (rps) control (Bernard and Lindahl 1972; Bernard and Cremeens 1988; Dorrance et al. 2004). Soybean seeds were obtained from Dr. Paul Morris (Bowling

Green State University, OH, USA).

Preparation of zoospores

Lupine seeds (35-60) of each line were surface sterilized by submerging in 2.5% sodium hypochlorite solution and then in 80% ethanol (each for 10 min) followed by rinsing three times with sterile deionized water. To initiate germination, seeds were scarified mechanically by nicking the seed coats with a sterile blade. Scarified aseptic seeds were transferred to perforated plastic containers that were filled with sterile distilled water and covered with sterile moist paper towels. Seeds were allowed to germinate for 4-6 days at 21-25 °C in the dark. The same procedure was followed to obtain soybean seedlings, except the seed

6 https://mc06.manuscriptcentral.com/botany-pubs Page 7 of 36 Botany

scarification step was omitted. For both chemotaxis and pathogenicity assays, zoospores were produced

from P. sojae P6497 as described by Morris and Ward (1992). Briefly, P. sojae cultures were grown on V8

juice agar (150 ml of V8 juice, 3 g of CaCO3, 15 g of agar per 1 L of water) at 25 °C in the dark. To induce

sporangia formation, 5-day-old P. sojae cultures were flooded with sterile distilled water for 18 hours.

Cultures were then washed repeatedly with sterile distilled water at 15 min intervals until zoospores

were released. Zoospore density was determined using a hemocytometer (LW Scientific, GA).

Zoospore-root attraction assays

Chemotaxis assays with zoospores were performed using five-day-old seedlings of lupine lines listed in

Table 1 and the two soybean cultivars. The assays were performed in a deep-well slide (Carolina, NC) by incubating the distal ends of the tap roots (upDraft to 1 cm distance from the root tip) in a zoospore suspension at a concentration of 8 × 103 spores/ml. After 20 - 30 min of incubation at room temperature under

daylight on the lab bench, roots were rinsed with sterile distilled water and then digitally photographed

under a Amscope T490B-MT microscope (AmScope, CA) at 40× magnification. The number of zoospores

attached to each root was counted in a field of view of 1.3 mm2, along a fixed distance (0.25 mm), starting

at 1 mm from the root tip. Five replicates were examined per lupine or soybean line and five

representative zoospore counts were documented per plant.

Pathogenicity assays

Five-day-old seedlings were inoculated with a zoospore suspension as described above. They were then

transferred to a plastic tray (25 × 50 cm) with moist paper towels and covered with a transparent

polyethylene sheet to prevent drying. The inoculated plants were placed in the dark for up to five days at

room temperature to observe symptoms of the infection. Ten replicates were used per lupine/soybean

line. Root discoloration and soft rot was evaluated at 5 days post inoculation. A visual scale from 1 to 5

7 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 8 of 36

was used for rating root rot symptoms (Loyd et al. 2014) where 1 = healthy, with or without a hypersensitive response, 2 = <25% seedling rotted, 3 = 25-49% seedling rotted, 4 = 50-75% seedling rotted,

5 = 76-100% or seedling completely rotted or dead plant (Fig. 1). Susceptible (SB W) and resistant (SB

W82) soybean seedlings were used as controls.

Data analysis

Differences in zoospore-root chemotaxis among the lines were tested for significance using a one-way

ANOVA followed by Tukey’s test (Tukey 1949). Average disease severity scores were tested using a

Kruskal-Wallis test (Kruskal and Wallis 1952), with pairwise comparisons performed using a

Wilcoxon rank-sum test (Mann and Whitney 1947) with the Bonferroni multiple comparisons adjustment. For all analyses statisticalDraft significance was set at P < 0.05. Analyses were performed using R version 3.3.3 and graphs were generated with GraphPad Prism 7.

Molecular identification of lupine

Lupine seeds were obtained from four different sources as previously described (Table 1). To validate and confirm the species identities provided by our sources, sequence analysis of the ITS regions of rDNA was performed. Total genomic DNA was extracted from lupine seeds according to the methods described by Scarafoni et al. (2009) and Rogers and Bendich (1985) with modifications. Briefly, lupine seeds were ground in liquid nitrogen using a mortar and pestle and were added to 800 μl of pre-warmed (65 °C) isolation buffer [100 mM Tris–HCl (pH 8.0), 2% CTAB (cetyltrimethylammonium bromide), 1.4 M NaCl,

1% PVP (Polyvinylpyrrolidone)]. Five μl of RNAse (20 mg/ml), 2 μl of Proteinase K (20 mg/ml) and beta mercaptoethanol (0.2%) were added to the mixture followed by incubation at 65°C for 30 min with periodic shaking. The sample was extracted twice with chloroform/isoamyl alcohol (24:1). Upon centrifugation, the supernatant was added to 1 ml of CTAB precipitation buffer (1% CTAB, 1 mM EDTA,

8 https://mc06.manuscriptcentral.com/botany-pubs Page 9 of 36 Botany

25 mM Tris–HCl, pH 8.0). The sample was then centrifuged, and the pellet dissolved in 300 μl of TE

buffer (10 mM Tris–HCl, pH 8.0, 1 M NaCl, 1 mM EDTA) at 37 °C for 20 min. The DNA was precipitated

with two volumes of absolute ethanol and washed with 70% ethanol. The DNA pellet was then dried at

55 °C and dissolved in 50 μl of 10 mM Tris-Cl (pH 8.5). All centrifugations were done at 14,000 x g for 10

min.

The ITS regions (ITS1 and ITS2) and the 5.8S rDNA were amplified via PCR (Taq 2X Master Mix, New

England Biolabs, MA) according to standard procedures using universal primers ITS1 forward

5’AGCCGCCTTCATATATCT GCTT 3’ and ITS4 reverse 5’ TCCTCCGCTTATTGATATGC 3’ as described

by White et al. (1990). PCR amplicons were purified using the Qiagen MinElute PCR Purification kit (Qiagen, CA) and then quantified using nanodropDraft spectrophotometry (Thermo Fisher Scientific, PA). The purified PCR amplicons were sequenced by DNA Analysis LLC (Cincinnati, OH). The sequences were

deposited in the NCBI GenBank database with the corresponding accession numbers provided in Table 1.

Phylogenetic analysis

To confirm the identity/taxonomy of the lupine lines used in this study, a phylogenetic analysis was

conducted using MEGA7 software (Kumar et al. 2016). All reference ITS sequences were obtained from

NCBI GenBank. Sequence IDs starting from DQ were deposited by Hughes and Eastwood (2006),

sequence IDs starting from AF were deposited by Ainouche and Bayer (1999) and sequence IDs starting

from AY were deposited by Ree et al. (2004). Valid reference sequences for L. versicolor and L. perennis

were not available in the sequence databases and were therefore excluded from the phylogenetic analysis.

Glycine max (EF517917), Lotus japonicus (KT250888) and Genista tinctoria (AF007479) served as outgroups.

Multiple sequence alignment was generated using ClustalW (Thompson et al. 1994). The phylogeny was

constructed using the maximum-likelihood (ML) method based on the Tamura-Nei model (Tamura and

9 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 10 of 36

Nei 1993) with 1000 bootstrap replicates.

Results

Zoospore-root attraction assays

Zoospores predominantly accumulated in the elongation zones of all tested lupine and soybean roots at

1-2 mm from the root tip (Fig. 2A) where approximately 10 ± 2 zoospores per unit length (0.25 mm) were observed. Little to no zoospores (0-4 zoospores per unit length) were detected at the root cap and the area of cell differentiation in all the roots tested (Fig. 2B). Data analysis indicated similar number of zoospores attached to most lupine lines as well as the two soybean varieties (P > 0.05) with a few exceptions. Zoospore counts of L CHAMI LSF and LARDraft Yellow were significantly higher than that of LL 19, LAB 18 and LL 35 (P < 0.05). Zoospore count of L CHAMI LSF was significantly higher than that of LL 66 (P <

0.05) (Fig. 3). Most zoospores readily encysted within 15 min and formation of the germ tubes was observed from some zoospores within 30 min of initial contact with the roots of both lupine and soybean seedlings.

Pathogenicity assays

This experiment was performed independently from the chemotaxis assays. Most of the lupine lines were susceptible to P. sojae infection and typical symptoms of root and hypocotyl rot were observed.

Susceptible plants developed soft and water-soaked lesions on the site of infection within the first 5 days post-inoculation and died. A classic hypersensitive response (HR) that appeared as brown pigmentation was observed at the site of infection within 24 hours after infection in LL 35 and LAB 18.

10 https://mc06.manuscriptcentral.com/botany-pubs Page 11 of 36 Botany

Based on the scale of disease symptoms, ten lupine lines showing more than 75% of the seedling rot

(disease score > 4) were classified as susceptible (Fig. 4). Four lupine lines were identified as moderately

tolerant (disease score = 3) whereas one lupine line was classified as highly tolerant (LAN 86; disease

score = 2) based on the levels of symptoms. Two lupine lines (LL 35 and LAB 18) were identified as

resistant because they had hypersensitive response and survived the infection. When disease severity of

each lupine line was compared with the resistant soybean variety SB W82, four lupine lines (LAB 18, LL

35, L TEX and L CHAMI WC) showed highly similar levels of resistance (Wilcoxon rank-sum test, P >

0.05). To further define the resistance phenotype, these four lines were compared with the susceptible

soybean variety SB W. The results showed that LAB 18 and LL 35 were identified as truly resistant (P

value < 0.05) while L TEX and L CHAMI WC were identified as tolerant. Draft Phylogenetic analysis of lupine

To confirm the identity of lupine lines used in this study, we constructed a ML tree using ITS sequences

of 17 lupine lines used in this study along with 56 reference sequences and three outgroup sequences

(Fig. 5). Most lupine lines obtained from the USDA germplasm collection grouped with their reference

species with high boostrap support, while LM25 grouped with its reference species with a low bootstrap

value (<50%). L TEX (purchased from Marde Ross & Company Glen Ellen, CA) also grouped with

reference L, texensis species with a higher bootstrap value (>50%). In contrast, the placement of four other

lupine lines was not robust as indicated by their low bootstrap values. These include L CHAMI WC, L

CHAMI LSF, LAR Yellow (all purchased from Plant World Gardens & Nursery, Newton Abbot, Devon,

UK) and LM25 (obtained from USDA). The identities of L VER, L VER Dumpty and LP L could not be

confirmed due to the lack of sequence availability. The phylogenetic tree further indicated that the two

resistant lupine lines, LAB 18 and LL 35, belong to the Old World lupines (Fig. 5). All of the highly

susceptible lupine lines with disease severity scores greater than 4 are grouped within the New World

11 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 12 of 36

lupines (Fig. 3 and 5). These include LAR Yellow, L VER, L VER Dumpty, LS 28, LM 25 and L CHAMI

LSF.

B Discussion

Lupine has been reported as a natural host of P. sojae, and could serve as potential sources of resistance against phytophthora root rot (Jones and Johnson 1969; Erwin and Ribeiro 1996). This study determined the tolerant and resistant phenotypes of 17 lupine lines to P. sojae P6497 infection. These lines were chosen largely on the basis of germplasm availability. In the zoospore chemotaxis assay using intact roots of soybean plants, there was no difference in number of zoospores of P. sojae P6497 attached to the roots of resistant and susceptible soybean varieties, DraftWilliams 82 and Williams, respectively. The attachment was more abundant in the elongation zone of the root compared to the root cap and the area of cell differentiation. Similar observations of zoospore attachment were documented by Chi and Sabo (1978),

Hinch and Clarke (1980), Morris et al. (1995) and Hosseini et al. (2014). This preferential accumulation of zoospores within the root elongation zone is known to be caused by electrochemical and physical properties of plant roots (Gow et al. 1992). In soybean, a combination of different isoflavones, sugars and amino acids present in the root exudates is responsible for driving the zoospore-root chemotaxis (Khew and Zentmyer 1973; Morris and Ward 1992). Most lupine lines from this study displayed similar numbers of zoospore attachment comparable to both soybean varieties used in this experiment. These results suggest that zoospores of oomycete pathogens may employ similar strategies to locate host plants. White lupine (L. albus) roots are known to exude isoflavonoids (Weisskopf et al. 2006), however, to date, there has been no report of zoospore attraction to root exudates in lupine. This is the first report to study zoospore attraction using intact roots of lupines.

12 https://mc06.manuscriptcentral.com/botany-pubs Page 13 of 36 Botany

The correlation between the number of zoospores attached to intact lupine roots and disease severity is

unclear because the ten susceptible lines showed a mixture of either higher or lower zoospore attachment

compared to resistant and tolerant lines. Consistent with this observation, two susceptible lupine lines

(LAR Yellow and L CHAMI LSF), had a relatively higher zoospore attachment, while two other

susceptible lines (LS 28 and LM 25) displayed zoospore attachment that was similar to the two resistant

lines (LL 35 and LAB 18) and one tolerant line (LL 19). Numerous studies document similar observations.

Ho and Hickman (1967) reported that accumulation of P. sojae zoospores to roots was non-specific with

respect to resistant and susceptible soybean varieties. The same phenomenon was observed by Tippett et

al. (1976) and Halsall (1978) in a P. cinnamomi - eucalyptus system. Soybean and cowpea attracted similar

number P. sojae zoospores to their roots but root rot symptoms were significantly higher in soybean compared to cowpea (Hosseini et al. 2014). DraftRaftoyannis and Dick (2006) also reported that zoospore attraction and encystment are not necessarily host-specific and do not always contribute to the

subsequent pathogenicity. It has been suggested that the zoospore attachment is non-specific, and that

specificity arises with the attempted penetration and invasion of the pathogen (Beagle-Ristaino and

Rissler 1983; van West et al. 2003).

Internal transcribed spacer regions of rDNA have been previously used as a marker for phylogenetic

inferences of Lupinus (Ainouche and Bayer 1999; Wink et al. 1999; Hughes and Eastwood 2006). To

confirm the identity of lupine lines in this study, we sequenced the ITS and constructed a ML tree. Based

on this phylogenetic tree, the identities of 10 of 17 lines used in the present study were confirmed and

concordant with the species names provided by the germplasm source. The identity of seven lupine lines

could not be confirmed because there were no published reference sequences available, or ITS sequences

were inadequate to resolve the relationships within the Western North American clade or to identify

unique mutations differentiating the reference taxa. These results can be attributed to multiple factors.

13 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 14 of 36

Firstly, there is the complex taxonomic nature of the New World species compared to those of the Old

World (Ainouche and Bayer 1999; Naganowska et al. 2003). Secondly, maintaince of the genetic integrity of each variety by seed producers is still in question (Young 1996; Smith and Baxter 2002). Lastly, species diversification is exceedingly high in New World lupines, with the Andean lupines exhibiting the highest diversification rate among plant genera (Nevado et al. 2016). Therefore, ITS sequence alone cannot provide sufficient information to resolve relationships among the New World species. In order to achieve fully resolved phylogenies including both Old World and New World lupines, multilocus sequence analysis using a combination of ITS sequences and additional molecular markers (Drummond 2008;

Drummond et al. 2012) is essential.

The comparison of disease severity of all 17Draft lupine lines and the two soybean varieties against P. sojae P6497 shows that the two lupine lines LL 35 and LAB 18 can be defined as resistant. These two lines possess strong potential as candidates to be used in further screening for resistance genes. Interestingly, all the highly susceptible lupine lines belong to the New World group while the five tolerant lupine lines cluster with both Old World and New World lineages. Some cultivated lupine species, such as L. albus, L. luteus and L. angustifolius, are known to contain certain proteins (Pinto and Ricardo 1995; Sikorski et al.

1999; Bantignies et al. 2000; Regalado et al. 2000; Jimenez-Lopez et al. 2016) and secondary metabolites

(Fukui et al. 1973) that have antifungal properties and may play a role in either constitutive- or inducible defense responses. However, no extensive screening has been done to seek resistance mechanisms to

Phytopthora in lupine by production of these inhibitory metabolites, pathogenesis-related proteins, or other mechanisms. Considering the emergence of large numbers of pathotypes in the field (Dorrance et al. 2008; Stewart et al. 2014; Dorrance et al. 2016), it will be necessary to conduct pathogenicity assays against other pathotypes of P. sojae to properly confirm the resistant phenotype of these two lupine lines.

High-throughput in planta screening using a bacterial type III secretion system could be employed to

14 https://mc06.manuscriptcentral.com/botany-pubs Page 15 of 36 Botany

determine whether specific P. sojae effectors can induce a hypersensitive reaction in these two lupine lines

(Ham et al. 1998; Anderson et al. 2012; Chang et al. 2014; Deb et al. 2017).

Phylogenetic analysis indicated that the two resistant lupine lines (LL 35 and LAB 18) are clustered with

L. luteus and L. albus, respectively with high bootstrap support. These two species belong to the Old

World lupines that are believed to have originated and been initially domesticated in the Mediterranean

region of Southern Europe and North-Western Africa (Wolko et al. 2011). Two main mechanisms have

been proposed to explain the development of plant disease resistance. First, resistance could develop via

pathogen-host coevolution or second, through convergent evolution (McDowell 2004). For the lupine-P.

sojae interaction, the development of resistance could be explained by both mechanisms. Since both LAB18 and LL35 belong to the Old World lupines,Draft the resistance against P. sojae could be due to the long association of these lupine lines and P. sojae, similar to the development of Rps genes in soybean (Ryley et

al. 1998; Huang et al. 2016). Support for convergent evolution explanation comes from the fact that P. sojae

has a considerably more narrow host range compared to other Phytophthora species and the resistance in

these two lupine lines would be due to selective pressures from other pathogens. Research from Mukhtar

et al. (2011) and Deb et al. (2017) showed that many pathogens share a common set of effector targets that

enable them to subvert a host’s metabolism. Ashfield et al. (2004) and Petit-Houdenot and Fudal (2017)

demonstrated that non-orthologous R genes from different plants can recognize the same Avr gene,

indicating that some R gene specificities have evolved independently in different plant species through

convergent evolution. Furthermore, highly diverse population of P. sojae pathotypes were isolated in

China where soybeans are grown (Cui et al. 2010; Tian et al. 2016). Therefore, it is most likely that

resistance in these two lupine lines is due to selective pressures from other pathogens. Our study

suggests that novel resistance genes to P. sojae may be present in lupine accessions, and once molecular

15 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 16 of 36

targets have been identified, these resistance genes could be incorporated into the soybean genome via genome editing technology.

In summary, the two of seventeen lupine lines examined were revealed to be resistant to P. sojae P6497.

These lines could be used to screen with multiple isolates of P. sojae using high-throughput in planta effector screening that has been developed by Anderson et al. (2012). Zoospore attachment was not correlated with disease severity in our P. sojae-soybean and P. sojae-lupine systems. Lastly, multilocus sequence analysis is necessary to complement the information provided by ITS for accurate species identification of lupine.

Acknowledgements Draft

This research was funded by the United States Department of Agriculture - National Institute of Food and Agriculture (USDA-NIFA) Agriculture and Food Research Initiative Oomycete-Soybean CAP (award

2011-68004-30104). We thank Patrick Elia and Clarice Coyne for providing the USDA lupine germplasm,

Dr. Brett Tyler for providing P. sojae P6497, and Dr. Paul Morris for providing soybean seeds as well as for comments and edits of the manuscript. We also thank Suthakaran Ratnasingam for assistance with the statistical analysis and Dilshan Beligala, Satyaki Ghosh, Alexander Howard and Rachel Wilson for their contributions to the experiments. Finally, we thank Drs. Moira van Staaden and Michael Geusz for their support in technical editing of the manuscript.

Compliance with Ethical Standards

Conflict of Interest: The authors have no conflict of interest

References

16 https://mc06.manuscriptcentral.com/botany-pubs Page 17 of 36 Botany

Ainouche, A. K., and Bayer, R. J. 1999. Phylogenetic relationships in Lupinus (Fabaceae: Papilionoideae)

based on internal transcribed spacer sequences (ITS) of nuclear ribosomal DNA. Am. J. Bot. 86(4):

590–607. doi: 10.2307/2656820.

Allen, T. W., Bradley, C.A., Sisson, A.J., Byamukama, E., Chilvers, M.I., Coker, C.M., et al. 2017. Soybean

yield loss estimates due to diseases in the United States and Ontario, Canada, from 2010 to 2014.

Plant Heal. Prog. 18(1): 19–27. doi: 10.1094/PHP-RS-16-0066.

Anderson, R. G., Casady, M. S., Fee, R. A., Vaughan, M. M., Deb, D., Fedkenheuer, K., et al. 2012.

Homologous RXLR effectors from Hyaloperonospora arabidopsidis and Phytophthora sojae suppress

immunity in distantly related plants. Plant J. 72(6): 882–893. doi: 10.1111/j.1365-313X.2012.05079.x. Ashfield, T., Ong, L. E., Nobuta, K., Schneider,Draft C. M., and Innes, R. W. 2004. Convergent evolution of disease resistance gene specificity in two flowering plant families. The Plant Cell, 16(2): 309–318.

doi: 10.1105/tpc.016725.

Banfalvi, Z., Nieuwkoop, A., Schell, M., Besl, L., and Stacey, G. 1988. Regulation of nod gene expression

in Bradyrhizobium japonicum. MGG Mol. Gen. Genet. 214(3): 420–424. doi: 10.1007/bf00330475.

Bantignies, B., Séguin, J., Muzac, I., Dédaldéchamp, F., Gulick, P., and Ibrahim, R. 2000. Direct evidence

for ribonucleolytic activity of a PR-10-like protein from white lupin roots. Plant Mol. Biol. 42(6):

871–881.

Beagle-Ristaino, J. E., and Rissler, J. F. 1983. Histopathology of susceptible and resistant soybean roots

inoculated with zoospores of Phytophthora megasperma f. sp. glycinea. Phytopathology, 73: 590-595.

doi: 10.1094/Phyto-73-590.

Beligala, D. H., Michaels, H. J., Devries, M., and Phuntumart, V. 2017. Multilocus sequence analysis of

root nodule bacteria associated with Lupinus spp. and Glycine max. Adv. Microbiol. 7: 790. doi:

10.4236/aim.2017.711063.

17 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 18 of 36

Bernard, R. L., and Cremeens, C. R. 1988. Registration of ‘Williams 82’soybean. Crop Sci. 28(6): 1027–1028.

Bernard, R. L., and Lindahl, D. A. 1972. Registration of Williams soybean1 (reg. no. 94). Crop Sci. 12(5):

716–716.

Burnham, K. D., Dorrance, A. E., VanToai, T. T., and St Martin, S. K. 2003. Quantitative trait loci for

partial resistance to Phytophthora sojae in soybean. Crop Sci. 43(5): 1610–1617.

Cannon, S. B., McKain, M. R., Harkess, A., Nelson, M. N., Dash, S., Deyholos, M. K., et al. 2015. Multiple

polyploidy events in the early radiation of nodulating and nonnodulating legumes. Mol. Biol. Evol.

32(1): 193–210. doi: 10.1093/molbev/msu296.

Chang, J. H., Desveaux, D., and Creason, A. L. 2014. The ABCs and 123s of bacterial secretion systems in

plant pathogenesis. Annu. Rev. Phytopathol. 52: 317–345. doi: 10.1146/annurev-phyto-011014- 015624. Draft Chi, C. C., and Sabo, F. E. 1978. Chemotaxis of zoospores of Phytophthora megasperma to primary roots of

alfalfa seedlings. Can. J. Bot. 56(7): 795–800. doi: 10.1139/b78-091.

Cui, L., Yin, W., Tang, Q., Dong, S., Zheng, X., Zhang, Z., and Wang, Y. 2010. Distribution, pathotypes,

and metalaxyl sensitivity of Phytophthora sojae from Heilongjiang and Fujian provinces in China.

Plant Dis. 94(7): 881–884. doi: 10.1094/PDIS-94-7-0881.

Deb, D., Anderson, R. G., How-Yew-Kin, T., Tyler, B. M., and McDowell, J. M. 2017. Conserved RxLR

effectors from oomycetes Hyaloperonospora arabidopsidis and Phytophthora sojae suppress PAMP- and

effector-triggered immunity in diverse plants. Mol. Plant-Microbe Interact. 31(3): 374–385. doi:

10.1094/MPMI-07-17-0169-FI.

Dorrance, A. E., Berry, S. A., Anderson, T. R., and Meharg, C. 2008. Isolation, storage, pathotype

characterization, and evaluation of resistance for Phytophthora sojae in soybean. Plant Heal. Prog.

9(1): 35. doi: 10.1094/PHP-2008-0118-01-DG.

18 https://mc06.manuscriptcentral.com/botany-pubs Page 19 of 36 Botany

Dorrance, A. E., Kurle, J., Robertson, A. E., Bradley, C. A., Giesler, L., Wise, K., and Concibido, V. C. 2016.

Pathotype diversity of Phytophthora sojae in eleven states in the United States. Plant Dis. 100(7):

1429–1437. doi: 10.1094/PDIS-08-15-0879-RE.

Dorrance, A. E., McClure, S. A., and Martin, S. K. St. 2003. Effect of partial resistance on phytophthora

stem rot incidence and yield of soybean in Ohio. Plant Dis. 87(3): 308–312.

Dorrance, A.E., Meharg, C., Anderson, T.R., and Berry, S. A. 2004. Evaluation of soybean differentials for

their interaction with Phytophthora sojae. Plant Heal. Prog. 5(1): 9. doi: 10.1094/PHP-2004-0309-01-

RS.

Dorrance, A. E., Mills, D., Robertson, A. E., Draper, M. A., Giesler, L., and Tenuta, A. 2007. Phytophthora

root and stem rot of soybean. Plant Heal. Instr. :1. doi: 10.1094/PHI-I-2007-0830-07. Drummond, C. S. 2008. Diversification of LupinusDraft (Leguminosae) in the western New World: Derived evolution of perennial life history and colonization of montane habitats. Mol. Phylogenet. Evol.

48(2): 408–421. doi: 10.1016/j.ympev.2008.03.009.

Drummond, C. S., Eastwood, R. J., Miotto, S. T. S., and Hughes, C. E. 2012. Multiple continental radiations

and correlates of diversification in Lupinus (Leguminosae): Testing for key innovation with

incomplete taxon sampling. Syst. Biol. 61(3): 443–460. doi: 10.1093/sysbio/syr126.

Eastwood, R. J., Drummond, C. S., Schifino-Wittmann, M. T., and Hughes, C. E. 2008. Diversity and

evolutionary history of lupins–insights from new phylogenies. In Lupins for health and wealth:

Proceedings of the 12th international lupin conference. Edited by. J. A. Palta and J. B. Berger.

International Lupin Association, Fremantle, Australia, pp. 346–354.

Erb, W. A., Moore, J. N., and Sterne, R. E. 1986. Attraction of Phytophthora cinnamomi zoospores to

blueberry roots. HortScience, 21(6): 1361–1363.

Erwin, D. C., and Ribeiro, O. K. 1996. Phytophthora diseases worldwide. American Phytopathological

Society (APS Press), St. Paul, MN.

19 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 20 of 36

Fukui, H., Egawa, H., Koshimizu, K., and Mitsui, T. 1973. A new isoflavone with antifungal activity from

immature fruits of Lupinus luteus. Agric. Biol. Chem. 37(2): 417–421.

Gladstones, J. S. 1984. Present situation and potential of Mediterranean-African lupins for crop

production. In Proceedings of the Third International Lupin Conference. 4-8 June 1984. La

Rochelle, France. pp. 18–37.

Gow, N. A. R., Morris, B. M., and Reid, B. 1992. The electrophysiology of root-zoospore interactions. In

Perspectives in Plant Cell Recognition. Edited by J. A. Callow and J. R. Green, Cambridge

University Press, Cambridge, UK. pp. 173–192.

Halsall, D. M. 1978. A comparison of Phytophthora cinnamomi infection in Eucalyptus sieberi, a susceptible

species, and Eucalyptus maculata a field resistant species. Aust. J. Bot. 26(5): 643–655. Ham, J. H., Bauer, D. W., Fouts, D. E., and Collmer,Draft A. 1998. A cloned Erwinia chrysanthemi Hrp (type III protein secretion) system functions in Escherichia coli to deliver Pseudomonas syringae Avr signals to

plant cells and to secrete Avr proteins in culture. Proc. Natl. Acad. Sci. U.S.A. 95(17): 10206–10211.

doi: 10.1073/pnas.95.17.10206.

Hane, J.K., Ming, Y., Kamphuis, L.G., Nelson, M.N., Garg, G., Atkins, C.A., et al. 2017. A comprehensive

draft genome sequence for lupin (Lupinus angustifolius), an emerging health food: insights into

plant–microbe interactions and legume evolution. Plant Biotechnol. J. 15(3): 318–330. doi:

10.1111/pbi.12615.

Hinch, J. M., and Clarke, A. E. 1980. Adhesion of fungal zoospores to root surfaces is mediated by

carbohydrate determinants of the root slime. Physiol. Plant Pathol. 16(3): 303–307. doi:

10.1016/S0048-4059(80)80001-4.

Ho, H. H., and Hickman, C. J. 1967. Asexual reproduction and behavior of zoospores of Phytophthora

megasperma var. sojae. Can. J. Bot. 45(11): 1963–1981.

20 https://mc06.manuscriptcentral.com/botany-pubs Page 21 of 36 Botany

Hosseini, S., Heyman, F., Olsson, U., Broberg, A., Jensen, D. F., and Karlsson, M. 2014. Zoospore

chemotaxis of closely related legume‐root infecting Phytophthora species towards host isoflavones.

Plant Pathol. 63(3): 708–714. doi: 10.1111/ppa.12137.

Huang, J., Guo, N., Li, Y., Sun, J., Hu, G., Zhang, H., Li, Y., Zhang, X., et al. 2016. Phenotypic evaluation

and genetic dissection of resistance to Phytophthora sojae in the Chinese soybean mini core

collection. BMC Genet. 17(1): 85. doi: 10.1186/s12863-016-0383-4.

Hughes, C., and Eastwood, R. 2006. Island radiation on a continental scale: exceptional rates of plant

diversification after uplift of the Andes. Proc. Natl. Acad. Sci. U.S.A. 103(27): 10334–10339. doi:

10.1073/pnas.0601928103.

Jarabo-Lorenzo, A., Pérez-Galdona, R., Donate-Correa, J., Rivas, R., Velázquez, E., Hernández, M., et al. 2003. Genetic diversity of BradyrhizobialDraft populations from diverse geographic origins that nodulate Lupinus spp. and Ornithopus spp. Syst. Appl. Microbiol. 26(4): 611–623.

Jimenez-Lopez, J. C., Melser, S., DeBoer, K., Thatcher, L. F., Kamphuis, L. G., Foley, R. C., and Singh, K. B.

2016. Narrow-leafed lupin (Lupinus angustifolius) β1-and β6-conglutin proteins exhibit antifungal

activity, protecting plants against necrotrophic pathogen induced damage from Sclerotinia

sclerotiorum and Phytophthora nicotianae. Front. Plant Sci. 7: 1856. doi: 10.3389/fpls.2016.01856.

Jones, J. P. 1969. Reaction of Lupinus species to Phytophthora megasperma var. sojae. Plant Dis. Rep. 53: 907–

909.

Jones, J. P., and Johnson, H. W. 1969. Lupine a new host for Phytophthora megasperma var sojae.

Phytopathology, 59: 504–507.

Kamoun, S., Furzer, O., Jones, J. D. G., Judelson, H. S., Ali, G. S., Dalio, R. J. D., et al. 2015. The Top 10

oomycete pathogens in molecular plant pathology. Mol. Plant Pathol. 16(4): 413–434. doi:

10.1111/mpp.12190.

Kaufmann, M. J., and Gerdemann, J. W. 1958. Root and stem rot of soybean caused by Phytophthora sojae

21 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 22 of 36

n. sp. Phytopathology, 48.

Khew, K. L., and Zentmyer, G. A. 1973. Chemotactic response of zoospores of five species of Phytophthora.

Phytopathology, 63(151): 1–17.

Kosslak, R. M., Bookland, R., Barkei, J., Paaren, H. E., and Appelbaum, E. R. 2006. Induction of

Bradyrhizobium japonicum common nod genes by isoflavones isolated from Glycine max. Proc. Natl.

Acad. Sci. U.S.A. 84(21): 7428–7432. doi: 10.1073/pnas.84.21.7428.

Kruskal, W. H., and Wallis, W. A. 1952. Use of ranks in one-criterion variance analysis. J. Am. Stat. Assoc.

47(260): 583–621.

Kumar, S., Stecher, G., and Tamura, K. 2016. MEGA7: Molecular evolutionary genetics analysis version

7.0 for bigger datasets. Mol. Biol. Evol. 33(7): 1870–1874. doi: 10.1093/molbev/msw054. Loyd, A. L., Benson, D. M., and Ivors, K. L. Draft2014. Phytophthora populations in nursery irrigation water in relationship to pathogenicity and infection frequency of Rhododendron and Pieris. Plant Dis. 98(9):

1213–1220. doi: 10.1094/PDIS-11-13-1157-RE.

Mann, H. B., and Whitney, D. R. 1947. On a test of whether one of two random variables is stochastically

larger than the other. Ann. Math. Stat. 18(1): 50–60.

McDowell, J. M. 2004. Convergent evolution of disease resistance genes. Trends Plant Sci. 9(7): 315–317.

doi: 10.1016/j.tplants.2004.05.002.

Morris, B. M., Reid, B., and Gow, N. A. R. 1995. Tactic response of zoospores of the fungus Phytophthora

palmivora to solutions of different pH in relation to plant infection. Microbiology, 141(5): 1231–1237.

Morris, P. F., and Ward, E. W. B. 1992. Chemoattraction of zoospores of the soybean pathogen,

Phytophthora sojae, by isoflavones. Physiol. Mol. Plant Pathol. 40(1): 17–22. doi: 10.1016/0885-

5765(92)90067-6.

22 https://mc06.manuscriptcentral.com/botany-pubs Page 23 of 36 Botany

Mukhtar, M. S., Carvunis, A. R., Dreze, M., Epple, P., Steinbrenner, J., Moore, J., et al. 2011. Independently

evolved virulence effectors converge onto hubs in a plant immune system network. Science,

333(6042): 596–601. doi: 10.1126/science.1203659.

Naganowska, B., Wolko, B., Śliwińska, E., and Kaczmarek, Z. 2003. Nuclear DNA content variation and

species relationships in the genus Lupinus (Fabaceae). Ann. Bot. 92(3): 349–355. doi:

10.1093/aob/mcg145.

Nevado, B., Atchison, G. W., Hughes, C. E., and Filatov, D. A. 2016. Widespread adaptive evolution

during repeated evolutionary radiations in New World lupins. Nat. Commun. 7: 12384. doi:

10.1038/ncomms12384.

Pascual, H., Muguerza, N. B., and Laberge, G. 2006. Lupinus mariae-josephi H. Pascual-a new lupin species adapted to calcareous soils. Grain Legum.Draft 46: 8–9. Petit-Houdenot, Y., and Fudal, I. 2017. Complex interactions between fungal avirulence genes and their

corresponding plant resistance genes and consequences for disease resistance management. Front.

Plant Sci. 8: 1072. doi: 10.3389/fpls.2017.01072.

Pinto, M. P., and Ricardo, C. P. 1995. Lupinus albus L. pathogenesis-related proteins that show similarity

to PR-10 proteins. Plant Physiol. 109(4): 1345–1351. doi: 10.1104/pp.109.4.1345.

Porter, P. M., Banwart, W. L., and Hassett, J. J. 1985. HPLC isolation and GC-MS identification of

genistein, daidzein, and coumestrol from unhydrolyzed soybean root extracts. Environ. Exp. Bot.

25(3): 229–232. doi: 10.1016/0098-8472(85)90006-1.

Raftoyannis, Y., and Dick, M. W. 2006. Zoospore encystment and pathogenicity of Phytophthora and

Pythium species on plant roots. Microbiol. Res. 161(1): 1–8. doi: 10.1016/j.micres.2005.04.003.

Ree, R. H., Citerne, H. L., Lavin, M., and Cronk, Q. C. B. 2004. Heterogeneous selection on LEGCYC

paralogs in relation to flower morphology and the phylogeny of Lupinus (Leguminosae). Mol. Biol.

Evol. 21(2): 321–331. doi: 10.1093/molbev/msh022.

23 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 24 of 36

Regalado, A. P., Pinheiro, C., Vidal, S., Chaves, I., Ricardo, C. P. P., and Rodrigues-Pousada, C. 2000. The

Lupinus albus class-III chitinase gene, IF3, is constitutively expressed in vegetative organs and

developing seeds. Planta, 210(4): 543–550. doi: 10.1007/s004250050043.

Rogers, S. O., and Bendich, A. J. 1985. Extraction of DNA from milligram amounts of fresh, herbarium

and mummified plant tissues. Plant Mol. Biol. 5(2): 69–76.

Ryley, M. J., Obst, N. R., Irwin, J. A. G., and Drenth, A. 1998. Changes in the racial composition of

Phytophthora sojae in Australia between 1979 and 1996. Plant Dis. 82(9): 1048-1054.

Scarafoni, A., Ronchi, A., and Duranti, M. 2009. A real-time PCR method for the detection and

quantification of lupin flour in wheat flour-based matrices. Food Chem. 115(3): 1088–1093. doi:

10.1016/j.foodchem.2008.12.087. Schmitthenner, A. F. 1985. Problems and progressDraft in control of phytophthora root rot of soybean. Plant Dis. 69(4): 362–368. doi: 10.1094/PD-69-362.

Sikorski, M. M., Biesiadka, J., Kasperska, A. E., Kopcińska, J., Łotocka, B., Golinowski, W., and Legocki, A.

B. 1999. Expression of genes encoding PR10 class pathogenesis-related proteins is inhibited in

yellow lupine root nodules. Plant Sci. 149(2): 125–137. doi: 10.1016/S0168-9452(99)00148-X.

Smith, P., and Baxter, L. 2002. South Australian seed certification scheme-procedures and standards

manual. Seed Serv. Prim. Ind. Resour. South Aust. Plant Res. Centre, Hartley Grove, Urrbrae, SA.

5064.

Stewart, S., Abeysekara, N., and Robertson, A. E. 2014. Pathotype and genetic shifts in a population of

Phytophthora sojae under soybean cultivar rotation. Plant Dis. 98(5): 614–624. doi: 10.1094/PDIS-05-

13-0575-RE.

Sugimoto, T., Kato, M., Yoshida, S., Matsumoto, I., Kobayashi, T., Kaga, A., et al. 2012. Pathogenic

diversity of Phytophthora sojae and breeding strategies to develop Phytophthora-resistant soybeans.

Breed. Sci. 61(5): 511–522. doi: 10.1270/jsbbs.61.511.

24 https://mc06.manuscriptcentral.com/botany-pubs Page 25 of 36 Botany

Sugiyama, A. 2019. The soybean rhizosphere: Metabolites, microbes, and beyond—A review. J. Adv. Res.

19: 67-73. doi: 10.1016/j.jare.2019.03.005.

Tamura, K., and Nei, M. 1993. Estimation of the number of nucleotide substitutions in the control region

of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10(3): 512–526. doi:

10.1093/oxfordjournals.molbev.a040023.

Thines, M. 2014. Phylogeny and evolution of plant pathogenic oomycetes-a global overview. Eur. J. Plant

Pathol. 138(3): 431–447. doi: 10.1007/s10658-013-0366-5.

Thompson, J., and Burdon, J. 1992. Gene-for-gene coevolution between plants and parasites. Nature,

360(6400): 121–125. doi: 10.1038/360121a0.

Thompson, J. D., Higgins, D. G., and Gibson, T. J. 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignmentDraft through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22(22): 4673–80. doi: 10.1093/nar/22.22.4673.

Tian, M., Zhao, L., Li, S. Huang, J., Sui, Z., Wen, J., and Li, Y. 2016. Pathotypes and metalaxyl sensitivity

of Phytophthora sojae and their distribution in Heilongjiang, China 2011–2015. J. Gen. Plant Pathol.

82(3): 132-141. doi: 10.1007/s10327-016-0654-y.

Tippett, J. T., Holland, A. A., Marks, G. C., and O’brien, T. P. 1976. Penetration of Phytophthora cinnamomi

into disease tolerant and susceptible eucalypts. Arch. Microbiol. 108(3): 231–242.

Tukey, J. W. 1949. Comparing individual means in the analysis of variance. Biometrics. 5(2): 99–114.

Tyler, B. M. 2007. Phytophthora sojae: root rot pathogen of soybean and model oomycete. Mol. Plant Pathol.

8(1): 1–8. doi: 10.1111/j.1364-3703.2006.00373.x.

Tyler B., M., Tripathy, S., Zhang, X., Dehal, P., Jiang, R. H., Aerts, A., et al. 2006. Phytophthora genome

sequences uncover evolutionary origins and mechanisms of pathogenesis. Science, 313(5791): 1261–

1266. doi: 10.1126/science.1128796.

Tyler, B. M., Wu, M., Wang, J., Cheung, W., and Morris, P. F. 1996. Chemotactic preferences and strain

25 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 26 of 36

variation in the response of Phytophthora sojae zoospores to host isoflavones. Appl. Environ.

Microbiol. 62(8): 2811–2817. van West, P., Appiah, A. A., and Gow, N. A. R. 2003. Advances in research on oomycete root pathogens.

Physiol. Mol. Plant Pathol. 62(2): 99–113. doi: 10.1016/S0885-5765(03)00044-4.

Weisskopf, L., Tomasi, N., Santelia, D., Martinoia, E., Langlade, N. B., Tabacchi, R., and Abou-Mansour,

E. 2006. Isoflavonoid exudation from white lupin roots is influenced by phosphate supply, root

type and cluster-root stage. New Phytol. 171(3): 657–668. doi: 10.1111/j.1469-8137.2006.01776.x.

White, T. J., Bruns, T., Lee, S., and Taylor, J. L. 1990. Amplification and direct sequencing of fungal

ribosomal RNA genes for phylogenetics. In PCR protocols: a guide to methods and applications.

Edited by M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, New York. pp. 315–322. Draft

Wink, M., Merino, F., and Käss, E. 1999. Molecular evolution of lupins (Leguminosae: Lupinus). In Lupin,

an Ancient Crop for the New Millennium. Proceedings of the 9th International Lupin Conference.

Klink/Müritz, Germany, 20-24 June 1999. Edited by E. Van Santen, M. Wink S. Weissmann and P.

Roemer. International Lupin Association, Canterbury, New Zealand. pp. 278-286.

Wolko, B., Clements, J. C., Naganowska, B., Nelson, M. N., and Yang, H. 2011. Lupinus. In Wild crop

relatives: Genomic and breeding resources, Springer, Heidelberg, Germany. pp. 153–206.

Yang, X. B., Ruff, R. L., Meng, X. Q., and Workneh, F. 1996. Races of Phytophthora sojae in Iowa soybean

fields. Plant Dis. 80(12): 1418–1420.

Young, S. A. 1996. Verification of germplasm origin and genetic status by seed certification agencies. In

Wild Land Shrub and Arid Land Restoration Symposium: Proceedings. 19-21 October 1993. Las

Vegas, NV. pp. 293–295.

26 https://mc06.manuscriptcentral.com/botany-pubs Page 27 of 36 Botany

Draft

27 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 28 of 36

Table 1. Lupine germplasm used in this study.

Speciesa Lupine Life Cycle GenBank Source of the lupine line

line accession

numbersb

L. albus (PI 540318) LAB 18 Annual MK532380 USDA-ARS Pullman, WA, USA

L. angustifolius (PI 383239) LAN 39 Annual MK532381 USDA-ARS Pullman, WA, USA

L. angustifolius (PI 385105) LAN 05 Annual MK532382 USDA-ARS Pullman, WA, USA

L. angustifolius (PI 385086) LAN 86 Annual MK532383 USDA-ARS Pullman, WA, USA

L. luteus (PI 240750) LL 50 Annual MK532384 USDA-ARS Pullman, WA, USA

L. luteus (PI 384566) LL 66 Annual MK532386 USDA-ARS Pullman, WA, USA L. luteus (PI 516635) LL 35 DraftAnnual MK532385 USDA-ARS Pullman, WA, USA L. luteus (PI 660719) LL 19 Annual MK532387 USDA-ARS Pullman, WA, USA

L. mutabilis (PI 478525) LM 25 Annual MK532388 USDA-ARS Pullman, WA, USA

L. succulentus LS 28 Perennial MK532389 USDA-ARS Pullman, WA, USA

L. arboreus LAR Perennial MK532390 Plant World Gardens & Nursery,

Yellow Newton Abbot, Devon, UK

L. versicolor L VER Perennial MK482721 Plant World Gardens & Nursery,

Newton Abbot, Devon, UK

L. versicolor L VER Perennial MK482722 Plant World Gardens & Nursery,

Dumpty Newton Abbot, Devon, UK

L. chamissonis L CHAMI Perennial MK532391 Plant World Gardens & Nursery,

WCc Newton Abbot, Devon, UK

L. chamissonis L CHAMI Perennial MK532392 Plant World Gardens & Nursery,

28 https://mc06.manuscriptcentral.com/botany-pubs Page 29 of 36 Botany

LSF Newton Abbot, Devon, UK

L. texensis L TEX Perennial MK532393 Marde Ross & Company, Glen

Ellen, CA

L. perennis LP L Perennial MK482723 Supplied by Dr. Helen J Michaels,

Department of Biological Science,

Bowling Green State University,

Bowling Green, OH, USA

aProvided by the source of each lupine line. USDA accession numbers are provided within brackets.

bGenBank accession numbers of the internal transcribed spacer (ITS)1-5.8S-ITS2 rDNA sequences from

this study. Draft

29 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 30 of 36

Fig. 1. Disease rating scale of root rot symptoms. A, 1 = healthy, with or without a hypersensitive response, 2 = <25% seedling rotted, 3 = 25-49% seedling rotted, 4 = 50-75% seedling rotted, 5 = 76-100% or seedling completely rotted or dead plant. ADraft disease score of 1, 2 and 3 indicate resistance, high tolerance and moderate tolerance, respectively where 4 and 5 represent the susceptible. B, Infected Williams 82 and

Williams were used as resistant and susceptible controls, respectively.

Fig. 2. The attachment of zoospores to lupine root at A, elongation zone and B, root cap.

Fig. 3. Chemoattraction of zoospores to the roots of lupine lines and soybean varieties tested. Error bars indicate standard error of the mean. Means with the same letters are not significantly different (P > 0.05,

Tukey’s test), n=5.

Fig. 4. Average disease severity scores of lupine lines tested. Error bars indicate standard error of the mean. Asterisks indicate statistically significant differences of lupine lines compared with the susceptible soybean variety (SB W), using Wilcoxon rank-sum test with the Bonferroni’s adjustment for multiple comparisons, n=10.

30 https://mc06.manuscriptcentral.com/botany-pubs Page 31 of 36 Botany

Fig. 5. Phylogenetic analysis of lupine lines based on the internal transcribed spacer (ITS) sequences. The

phylogenetic tree was inferred by Maximum Likelihood method using MEGA7. Lupine lines used in this

study are shown in boldface. Bootstrap values (1000 replicates) above 50% are given at the branching

points. Diamond symbol represents bootstrap value of 50%. Old World species are in red whereas New

World species are in green. Glycine max, Lotus japonicus and Genista tinctoria were used as the outgroups.

The scale bar indicates the number of substitutions per site.

Draft

31 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 32 of 36

Fig. 1. Disease rating scale of root rot symptoms. A, 1 = healthy, with or without a hypersensitive response, 2 = <25% seedling rotted, 3 = 25-49% seedling rotted, 4 = 50-75% seedling rotted, 5 = 76-100% or seedling completely rotted or dead plant. A disease score of 1, 2 and 3 indicate resistance, high tolerance and moderate tolerance, respectively where 4 and 5 represent the susceptible. B, Infected Williams 82 and Williams were used as resistant and susceptible controls, respectively. 95x38mmDraft (300 x 300 DPI)

https://mc06.manuscriptcentral.com/botany-pubs Page 33 of 36 Botany

Fig. 2. The attachment of zoospores to lupine root at A, elongation zone and B, root cap.

95x38mm (300 x 300 DPI) Draft

https://mc06.manuscriptcentral.com/botany-pubs Botany Page 34 of 36

Draft

178x144mm (300 x 300 DPI)

https://mc06.manuscriptcentral.com/botany-pubs Page 35 of 36 Botany

Draft

https://mc06.manuscriptcentral.com/botany-pubs Botany AF007490 Lupinus luteolusPage 36 of 36 AF007491 Lupinus pusillus DQ524253 Lupinus microcarpus 76 AF007487 Lupinus affinis 100 AY338942 Lupinus densiflorus 90 DQ524276 Lupinus odoratus 82 DQ524213 Lupinus brevicaulis DQ524318 Lupinus truncatus DQ524212 Lupinus concinnus 86 DQ524209 Lupinus bicolor DQ524235 Lupinus hirsutissimus 54 LS 28 AF007494 Lupinus succulentus AF007492 Lupinus excubitus DQ524243 Lupinus latifolius L VER Dumpty L VER L CHAMI LSF LAR Yellow AF007493 Lupinus duranii AY338939 Lupinus grayi DQ524218 Lupinus chamissonis DQ524196 Lupinus arboreus LP L AY338935 Lupinus sericeus 63 AY338934 Lupinus andersonii AF007496 Lupinus polyphyllus L CHAMI WC DQ524246 Lupinus lepidus DQ524197 Lupinus argenteus AF007495 Lupinus arcticus AF007497 Lupinus minimus Draft AY338932 Lupinus breweri DQ524259 Lupinus montanus Tree scale: 0.01 AY338928 Lupinus nanus DQ524286 Lupinus prostratus ♦ DQ524220 Lupinus chrysanthus DQ524216 Lupinus chachas LM 25 DQ524270 Lupinus mutabilis DQ524201 Lupinus ballianus DQ524284 Lupinus piurensis DQ524200 Lupinus mantaroensis DQ524324 Lupinus weberbaueri DQ524297 Lupinus semperflorens DQ524237 Lupinus huaronensis AF007482 Lupinus sparsiflorus DQ524198 Lupinus arizonicus LAN 05 DQ524193 Lupinus angustifolius LAN 39 99 LAN 86 60 DQ524236 Lupinus hispanicus LL 50 85 97 LL 35 86 LL 19 LL 66 DQ524249 Lupinus luteus 100 DQ524322 Lupinus villosus DQ524226 Lupinus cumulicola 77 DQ524211 Lupinus bracteolaris 90 DQ524206 Lupinus bandelierae DQ524260 Lupinus multiflorus 96 99 DQ524278 Lupinus paraguariensis 77 DQ524233 Lupinus havardii 100 L TEX 77 DQ524316 Lupinus texensis 100 98 LAB 18 DQ524191 Lupinus albus 53 DQ524252 Lupinus micranthus DQ524222 Lupinus cosentinii 99 AY338948 Lupinus digitatus https://mc06.manuscriptcentral.com/botany-pubs89 AF007479 Lupinus palaestinus AF007471 Genista tinctoria KT250888 Lotus japonicus EF517917 Glycine max