Estrogen As a Regulator of Ethanol Reward and Drinking Behavior

Ethanol and the Female Brain:

Estrogen as a Regulator of Ethanol Reward and Drinking Behavior

ELISA RACHEL HILDERBRAND B.A., Knox College, 2010

DISSERTATION

Submitted as partial fulfillment of the requirements for the degree of Doctor of Philosophy in Neuroscience in the Graduate College of the University of Illinois at Chicago, 2020

Chicago, Illinois

Defense Committee:

Amy W. Lasek, Advisor David Wirtshafter, Chair Mark Brodie, Physiology & Biophysics Subhash Pandey, Psychiatry Jamie Roitman, Psychology

TABLE OF CONTENTS

CHAPTER PAGE

1. INTRODUCTION...... 1 1.1. Alcohol Use Disorder (AUD) ...... 1 1.2. Sex Differences in AUD………………………………………………………………. ....3 1.3. Sex Differences in Animal Models of AUD ...... 5 1.3.1. Operant Self-Administration ...... 6 1.3.2. Conditioned Place Preference (CPP) ...... 8 1.3.3. Two-Bottle Choice Ethanol Consumption ...... 10 1.4. Ovarian Hormones and AUD ...... 13 1.4.1. Human Studies ...... 14 1.4.2. Animal Studies...... 15 1.5. The Ovarian Steroid Hormone 17β-Estradiol and Its Receptors ...... 17 1.5.1 Estrogen Biochemistry and Synthesis ...... 18 1.5.2 Estrogen Receptors ...... 20 1.6. Neural Substrates of Reward and Their Regulation by Estradiol ...... 26 1.6.1. The Reward System ...... 27 1.6.2. Estradiol as a Reward Modulator ...... 29 1.7. Summary and Project Overview ...... 35

2. ESTRADIOL ENHANCES ETHANOL REWARD IN FEMALE MICE THROUGH ACTIVATION OF ERα AND ERβ ...... 39 2.1. Introduction ...... 39 2.2. Materials and Methods ...... 41 2.2.1. Experimental Animals ...... 41 2.2.2. Ovariectomy (OVX) ...... 42 2.2.3. Drug Treatments ...... 42 2.2.4. Behavioral Procedure ...... 43 2.2.5. Ethanol Metabolism ...... 45 2.2.6. Lentiviral Construct ...... 45 2.2.7. Stereotaxic Injection of Virus ...... 46 2.2.8. Histology...... 46 2.2.9. Statistical Analysis...... 48 2.3. Results...... 48 2.3.1. Estradiol (E2) enhances ethanol CPP in OVX mice ...... 48 2.3.2. E2 does not alter preference for the initially non-preferred Side of the CPP chamber in the absence of ethanol conditioning ...... 49 2.3.3. E2 does not Alter the rate of ethanol metabolism in OVX mice ...... 50 2.3.4. Activation of ERα or ERβ individually is not sufficient to enhance ethanol CPP in OVX mice ...... 50 2.3.5. Activation of both ERα and ERβ enhances ethanol CPP in OVX mice ...... 51 2.3.6. Lentiviral infection may induce damage in the CeA ...... 51 2.4. Discussion ...... 58 2.5. Acknowledgements ...... 62

3. VTA ESTROGEN RECEPTORS REGULATE BINGE-LIKE DRINKING IN GONADALLY INTACT FEMALE C57BL/6J MICE ...... 63 3.1. Introduction ...... 63 3.2. Material and Methods ...... 65 3.2.1. Experimental Animals ...... 65 3.2.2. OVX ...... 65 3.2.3. Drug Treatments ...... 66 3.2.4. Lentiviral Construct ...... 66 3.2.5. Stereotaxic Injection of Virus ...... 66 3.2.6. Vaginal Cytology ...... 67 3.2.7. Behavioral Procedure ...... 68 3.2.8. Confirmation of Viral Placement and in vivo Knockdown Efficiency ...... 69 3.2.9. Statistical Analysis...... 72 3.3. Results...... 72 3.3.1. Systemic treatment with PPT (an ERα agonist) suppresses fluid intake in OVX mice ...... 72 3.3.2. Ventral Tegmental Area (VTA) ERα and ERβ regulate binge-like EtOH intake in female, but not male, mice ...... 73 3.3.3. Intra-VTA ER knockdown does not alter sucrose intake in female mice ...... 75 3.3.4. Viral vector expressing shEsr1 reduces ERα protein levels in male mouse VTA ...... 76 3.3.5. qPCR analysis was not effective for measuring in vivo knockdown of viral

constructs shEsr1-1785 and shEsr2-1089 in VTA tissue ...... 76 3.4. Discussion ...... 82 3.5. Acknowledgements ...... 85

4. ESTROGEN RECEPTORS REGULATE THE EXPRESSION OF GENES INVOLVED IN ETHANOL REWARD-RELATED BEHAVIORS IN THE AMYGDALA AND VENTRAL TEGMENTAL AREA ...... 86 4.1. Introduction ...... 86 4.2. Material and Methods ...... 90 4.2.1. Experimental Animals ...... 90 4.2.2. Drug Treatments and Tissue Processing ...... 91 4.2.3. RNA Extraction, cDNA Synthesis, and qPCR ...... 93 4.2.4. Statistical Analysis...... 94 4.3. Results...... 94 4.3.1. E2 regulates gene expression in the amygdala ...... 94 4.3.2. ER-selective agonists modulate Npy and Crh expression in the amygdala and VTA ...... 96 4.4. Discussion ...... 102 4.5. Acknowledgements ...... 106

5. CONCLUSIONS ...... 107

REFERENCES ...... 113

iii

APPENDICES ...... 146 Appendix A: Supplemental Methods ...... 146 Appendix B: Approval of Animal Protocols ...... 148 Appendix C: Permissions ...... 153

VITA...... 156

This work was supported by the National Institutes of Health (grant numbers P50 AA022538, U01 AA016654, U01 AA020912, and R01 DA033429 to A.W.L. and F31 AA024344 to E.R.H.)

LIST OF FIGURES FIGURE PAGE

1. Molecular structure of the endogenous estrogens ...... 19

2. Functional domains of the classical estrogen receptors ...... 22

3. 17β-Estradiol-3-benzoate enhances ethanol conditioned place preference (CPP) in ovariectomized C57BL/6J mice ...... 53

4. EB does not alter preference for the initially non-preferred side of the CPP chamber in the absence of ethanol conditioning ...... 54

5. EB does not alter the rate of ethanol metabolism in OVX C57BL/6J mice ...... 55

6. Neither ERα- nor ERβ-selective agonist treatment alone is sufficient to enhance EtOH CPP, but combined treatment with both agonists enhances EtOH CPP ...... 56

7. Lentiviral infection may induce damage in the central nucleus of the amygdala ...... 57

8. Systemic treatment with PPT suppresses consumption of EtOH, sucrose, and water in OVX female mice ...... 77

9. Intra-VTA knockdown of ERα or ERβ reduces binge-like EtOH consumption in female mice ...... 78

10. Intra-VTA knockdown of ERα or ERβ does not alter binge-like EtOH consumption in male mice ...... 79

11. Intra-VTA knockdown of ERα has subtle effects on sucrose consumption in female mice ...... 80

12. Viral construct shEsr1-1785 reduces ERα protein levels in male mouse VTA ...... 81

13. Estradiol modulates gene expression in the central nucleus of the amygdala ...... 97

14. Estradiol modulates gene expression in the medial nucleus of the amygdala ...... 98

15. Estrogen receptor-selective agonists modulate Npy expression in the medial nucleus of the amygdala and ventral tegmental area ...... 99

16. The estrogen receptor-selective agonists PPT and DPN have no significant effects on Alk expression in the CeA, BLA, MeA, or VTA ...... 100

17. Estrogen receptor-selective agonists modulate Crh expression in the basolateral nucleus of the amygdala ...... 101

LIST OF ABBREVIATIONS

17β-HSD 17β-hydroxysteroid dehydrogenase ADH Alcohol dehydrogenase AF1 Activation function 1 AF2 Activation function 2 ALDH Aldehyde dehydrogenase ALK Anaplastic lymphoma kinase ANOVA Analysis of variance AP-1 Activating protein-1 AUD Alcohol use disorder BAC Bacterial artificial chromosome BEC Blood ethanol concentration BLA Basolateral amygdala BNST Bed nucleus of the stria terminalis CaMKII Calcium-calmodulin kinase II cAMP Cyclic adenosine monophosphate cDNA Complementary DNA CeA Central nucleus of the amygdala CMS Chronic mild stress CPA Conditioned place aversion CPP Conditioned place preference CREB cAMP response element binding protein CRF/CRH Corticotropin-releasing factor/Corticotropin-releasing hormone CRFR1 Corticotropin-releasing factor receptor 1 CTCF Corrected total cell fluorescence DA Dopamine DAT Dopamine transporter DBD DNA binding domain DID Drinking in the dark DNA Deoxyribonucleic acid DPN Diarylpropionitrile DSM-5 Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition E2 17β-estradiol EB Estradiol benzoate EGFP Enhanced green fluorescent protein ER Estrogen receptor ERE Estrogen response element

vii

ERK Extracellular signal-regulated kinase ERα Estrogen receptor α ERβ Estrogen receptor β EtOH Ethanol FAS Fetal alcohol syndrome FASD Fetal alcohol spectrum disorders FCG Four core genotypes FDA Food and Drug Administration FSH Follicle stimulating hormone GABA Gamma-Aminobutyric Acid GDX Gonadectomy/gonadectomized GFP Green fluorescent protein GnRH Gonadotropin-releasing hormone GPER G-protein-coupled estrogen receptor ICSS Intracranial self-stimulation IgG Immunoglobulin G IR Immunoreactivity IV Intravenous LBD Ligand binding domain LH Luteinizing hormone MAPK Mitogen activated protein kinase MeA Medial nucleus of the amygdala MFB Medial forebrain bundle mGluR Metabotropic glutamate receptor mRNA Messenger RNA mTOR Mammalian target of rapamycin NAc Nucleus accumbens NAD Nicotinamide adenine dinucleotide NDS Normal donkey serum NMDA N-Methyl-D-aspartate NPY Neuropeptide Y NR Nuclear receptor NR3A1 Nuclear receptor subfamily 3, group A, member 1 NR3A2 Nuclear receptor subfamily 3, group A, member 2 NSDUH National Survey on Drug Use and Health OVX Ovariectomy/ovariectomized PBS Phosphate-buffered saline PFA Paraformaldehyde

viii

PFC Prefrontal cortex PI3K Phosphatidylinositide 3-kinase PMDD Premenstrual dysphoric disorder PO Per os (orally) PPT Propylpyrazole-triol qPCR quantitative Polymerase Chain Reaction RCT Randomized controlled trial RM Repeated measures RNA Ribonucleic acid RNAi RNA interference SERM Selective estrogen receptor modulator shRNA Short hairpin RNA SP-1 Stimulating protein-1 SUD Substance use disorder TH Tyrosine hydroxylase VEH Vehicle VTA Ventral tegmental area

SUMMARY

Long regarded as a men’s health issue, alcohol use disorder (AUD) is increasingly common among women. From a national health standpoint, this is particularly concerning because the negative impact of AUD on both mental and physical wellbeing is often more severe for women than for men. Furthermore, studies show that women who develop AUD progress more rapidly from onset of recreational use to hazardous drinking behavior. Unfortunately, women are an underrepresented demographic in AUD research. Most studies investigating alcohol’s biological effects and potential therapeutic treatments for AUD have thus far been conducted in males, and little information about alcohol’s effects on the female brain is available to guide the development of more effective preventative and treatment measures. In light of the increasing risk that AUD poses to women’s health, the need to identify neural mechanisms that contribute to dangerous drinking behavior in women is compelling. A growing body of evidence implicates the ovarian steroid hormone 17β-estradiol (E2) as a regulator of female drinking behavior. Elevated E2 levels have been associated with increased voluntary ethanol intake in both human and animal studies, yet the potential neurological mechanisms underlying this effect are unknown. Here I have demonstrated that E2 enhances the rewarding properties of alcohol (ethanol) in female mice, as measured by the conditioned place preference (CPP) test. This is the first study to demonstrate that estradiol regulates ethanol reward in female mice. To investigate potential neural mechanisms by which E2 may act to enhance ethanol reward and drinking behavior, I have conducted a series of behavioral and molecular tests manipulating the activity or expression of the classical estrogen receptors (ERs), ERα and ERβ, to which E2 binds with approximately equal affinity. First, using ERα- and ERβ-selective agonists, I showed that the classical ERs regulate ethanol CPP in female mice. Notably, my results suggest that activation of both ERα and ERβ is required for estrogenic enhancement of ethanol reward, because increased CPP was observed only when the ERα agonist and the ERβ agonist were administered together and not when either was administered alone. This finding is complemented by my experiments using the drinking in the dark (DID) test, which models voluntary, binge-like ethanol drinking. Using RNAi-mediated knockdown, I demonstrated that ERα or ERβ in the ventral tegmental area (VTA) both contribute to the regulation of ethanol consumption by gonadally intact female mice. Knocking down expression of either classical ER significantly reduced binge-like ethanol intake in females. Importantly, this was a sex-specific effect, because knockdown of either receptor failed to produce a decrease in drinking when the same experiment was conducted in male mice. To further probe the mechanisms by which ERs could regulate ethanol reward-related behaviors in females, I used qPCR to investigate the effects of ER agonists on the expression of three genes known to regulate neural responses to ethanol, Crh, Npy, and Alk, within the amygdala and VTA, brain regions strongly associated with AUD. My results suggest that these genes are potential candidates for mediating the enhancement of ethanol CPP and binge-like ethanol consumption by E2, although further investigation is warranted. In summary, AUD manifests differently in men and women. My research builds upon existing literature, supporting the idea that E2 may enhance female vulnerability to AUD by increasing ethanol reward and binge-like drinking behavior. Future AUD research should investigate the potential for sex-specific treatment options, including medications that regulate ovarian hormone production and/or modulate the activity of estrogen receptors in the brain.

CHAPTER ONE: INTRODUCTION

Author’s Note: Portions of the following text were previously published in ACS Chemical Neuroscience under the title “Studying Sex Differences in Animal Models of Addiction: An Emphasis on Alcohol-Related Behaviors,” copyright (2017) American Chemical Society1. I assert that I am the first author of said title and have received permission from the publisher to reprint it in the body of this doctoral dissertation (see Appendix C).

1.1. Alcohol Use Disorder

The year is 2020. Technology and human civilization are changing rapidly, posing new challenges and opportunities for the scientific community. One particularly pressing need in biomedical research is the development of new strategies for the treatment of drug addiction, or

Substance Use Disorder (SUD): a chronic, relapsing condition characterized by compulsive drug seeking, difficulty limiting drug intake, and the emergence of a “negative emotional state (e.g., dysphoria, anxiety, irritability) reflecting a motivational withdrawal syndrome when access to the drug is prevented”2, 3. Incidence of drug overdose and related mortality in the United States have more than doubled since the year 20004, and the National Survey on Drug Use and Health

(NSDUH) reported that 20.2 million Americans aged 18 or older met the criteria for SUD5 in

2014. Of those, over 80% had an alcohol use disorder (AUD), making alcohol (ethanol) by far the most commonly abused drug in the U.S.

As of 2010, the total estimated annual cost of ethanol abuse in the U.S. was $249.0 billion6, up from $223.5 billion in 20067. For some individuals, recreational use of ethanol can lead to both acute and chronic health problems, as well as social problems, drug tolerance, craving, and withdrawal, and/or repeated, unsuccessful attempts to quit or otherwise control drug use. If a person meets enough of these criteria, as listed in the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5), that individual is considered to have an AUD3.

There are currently three pharmacotherapies approved by the FDA for the treatment of AUD: disulfiram, naltrexone, and acamprosate. Disulfiram encourages abstinence by inhibiting the enzyme aldehyde dehydrogenase (ALDH), which is responsible for eliminating acetaldehyde, a major product of ethanol metabolism that is toxic and causes extremely aversive physiological reactions (e.g. flushing, sweating, headache, dizziness, fainting, nausea and vomiting, chest pain, heart palpitations, tachycardia, respiratory distress, anxiety, and confusion) if its elimination from the body is slowed or prevented. Predictably, achieving patient compliance is a major challenge when treating with disulfiram. Naltrexone is a competitive antagonist at the μ-opioid receptor and, to a lesser degree, also blocks the κ-opioid and δ-opioid receptors8. Acamprosate is an NMDA receptor antagonist and a positive allosteric modulator of the GABAA receptor.

Several other medications have been used off-label with some efficacy9. However, there remains a sizeable population of AUD sufferers for whom available medications are ineffective9, demonstrating the need to identify new targets and compounds to treat the disorder. In order to meet this need, one important consideration for addiction researchers is the potential for sex differences in the brain’s response to ethanol.

Female mammals, human and otherwise, are severely underrepresented in biomedical research, and the field of neuroscience is no exception10, 11. In fact, a 2011 report by Beery and

Zucker found that—out of eight major disciplines, from immunology to zoology—neuroscience held the dubious distinction of showing the strongest bias against inclusion of female research subjects, with studies of male animals outnumbering those of females 5.5 to 112. Since the overwhelming majority of currently available prescription medications have been developed from preclinical research on male animals, it is not surprising that women experience higher incidence of adverse drug events13, 14 and tend to have poorer health outcomes in general,

3 compared to men15. In 2016, the US National Institutes of Health began to address this issue by mandating the consideration of biological sex in all preclinical research studies using cell-based and animal models of human disorders16, 17, but it will take a great deal of diligent and dedicated investigation to close the gaps in our knowledge of the female brain and the resultant sex differences in quality of medical care.

It is my thesis that ovarian steroid hormones contribute to the mechanisms of AUD pathogenesis in women and that this is especially true of the ovarian steroid 17β-estradiol. I will begin by reviewing the literature concerning sex differences in ethanol-related behaviors in human and animal studies and what is known about the influence of 17β-estradiol on said behaviors. I will then describe the mechanisms by which sex hormones exert their biological effects and discuss how these hormones interact with some of the brain systems that mediate behavioral effects of ethanol. Finally, I will relate the findings of my own experiments on the role of 17β-estradiol and its receptors on ethanol reward and drinking behavior in females.

1.2. Sex Differences in AUD

As of 2015, the lifetime prevalence of AUD in American women was just under 23%, compared to 36% in men18. Across the globe, men consume significantly more ethanol than women, drink more often, and are more likely to be heavy drinkers18, 19. Women are more likely to abstain from ethanol use altogether and have a lower overall risk of developing AUD18, 19. The reasons for this gender gap in ethanol use (and misuse) are complex, as drinking behavior is heavily influenced not only by biological sex differences but also by cultural and socio-economic factors20-22. Recent cohort analyses demonstrate that this gap is rapidly closing, however, with

4 younger generations of women consuming more ethanol and having a higher incidence of AUD than women in previous generations19, 23-25.

In light of these data, it seems unlikely that women are simply less prone to AUD than men by virtue of biological sex. In fact, women who develop AUD (and SUD in general) tend to exhibit a so-called “telescoping” pattern of addiction26-28. These women progress more rapidly from initiation of substance use to onset of physical and psychological health complications and, despite seeking treatment sooner, tend to report equal or more severe symptoms of dependence at the time of treatment entry than those reported by male users26. This is of particular concern given that the physiological effects of ethanol abuse are more severe in females than in males29.

In addition to increased risk of mouth, throat, esophageal, liver, and colon cancers, the risk of breast cancer in women also rises with increasing ethanol consumption30, 31. Furthermore, women develop comparable or more pronounced ethanol-related liver and cardiovascular disease at lower levels of ethanol consumption than their male counterparts and are also more vulnerable to alcoholic brain damage and related cognitive impairment29.

Psychological reasons for ethanol use also differ between the sexes. Notably, women are more likely than men to engage in heavy ethanol use as a way to alleviate psychological distress, and female alcoholics are more likely to cite negative emotions and stressful life experiences as reasons for substance use and relapse32-34. Women who binge drink—defined as the consumption of any quantity of ethanol that generates a blood ethanol concentration (BEC) of 80 mg/dL or greater, usually ≥4 standard drinks for a woman or ≥5 standard drinks for a man35—report more mentally unhealthy days (dealing with stress, depression, and emotional problems) and physically unhealthy days than their male counterparts at both low (≥4 drinks) and high (≥7 drinks) intensities of binge drinking36. Adolescent girls take longer to recover from high-dose

5 drinking than boys do, experiencing negative affective states for longer periods after heavy drinking episodes37. Women with AUD are also more likely to have comorbid psychiatric disorders, particularly anxiety and/or depression.34, 38 On the other hand, men tend to report drinking to enhance positive emotions or in response to peer pressure, and male alcoholics are more likely to cite external temptations as reasons for relapse32-34. This is not to say that women do not enjoy the experience of ethanol intoxication or that men never drink to alleviate negative affective states. In fact, the subjective ethanol experience seems to be quite similar between men and women, and some have even reported higher ratings of mental and physical wellbeing

(“feeling good”) in females than in males who were given ethanol in a laboratory setting39.

Furthermore, while women suffering from AUD are more likely to have a comorbid mood disorder, men certainly experience anxiety and depressive disorders in conjunction with AUD, especially in vulnerable populations such as veterans of military service40-42.

1.3. Sex Differences in Animal Models of AUD

The addiction cycle is conceptualized as having three stages: binge/intoxication, withdrawal/negative affect, and preoccupation/anticipation43. The interplay between positive and negative reinforcement—in the forms of achieving the drug “high” and alleviating aversive withdrawal symptoms, respectively—is thought to drive this cycle. While it is impossible to capture every aspect of human addiction behavior in an animal model, there are several useful ways to model various stages of the addiction cycle. Many of the studies examining sex differences in animal models of AUD have used behavioral tests that model the binge/intoxication or preoccupation/anticipation stage. These include operant self-administration, the conditioned place preference (CPP) test, and voluntary ethanol drinking behavior.

1.3.1. Operant Self-Administration

Self-administration is one of the methods used to study addiction-like behavior that most closely models the motivation to consume drugs. This method emphasizes the action of drugs of abuse as positive reinforcers, meaning that if an animal receives a dose of drug after performing a certain action (e.g. pressing a lever), then the animal is more likely to perform that action again44. The most common routes of drug administration in these studies are intravenous and oral, but many other routes are possible, including: intracerebroventricular, intracranial, inhalation, intragastric, and intramuscular44.

Most studies conducted in non-human primates rely on operant self-administration techniques, although measurement of ad libitum drinking is also common45. In primates, self- administration has typically been done intravenously (IV), intragastrically (directly into the stomach), or through a tube from which the animals are able to consume the ethanol by mouth

(PO)45. Since ethanol naïve primates will generally drink only small quantities of ethanol, PO self-administration generally requires some kind of induction procedure (e.g. flavoring the ethanol with palatable fruit juice). The earliest published study on ethanol consumption in non- human primates was conducted in two rhesus monkeys (one male and one female) in 196046.

While monkeys are the most common type of non-human primate used in ethanol research, at least one other study from the 1960s examined ethanol drinking behavior in great apes

(chimpanzees and orangutans)47. In this study, males of both species drank more than females, on average—though the range of individual differences in quantity of ethanol consumed was large. It has been noted that such variability in baseline ethanol consumption is common among non-human primates, which can prove useful in translational research by allowing for study of risk factors that make certain individuals more susceptible than others to heavy/risky drinking

7 behavior45. On the other hand, individual variability can impede detection of group (sex) differences in small samples as well as confound analyses of the effects of interventions. In general, sex differences in ethanol drinking among non-human primates are similar to humans, though very few primate studies have examined sex differences in any detail45. When given long-term, unlimited access to ethanol, male cynomolgus monkeys drink more than females and attain higher blood ethanol levels48. Male rhesus monkeys also drink more than females of their species when given limited access to sweetened ethanol solution49.

In contrast to what has been observed in human and non-human primates, female mice and rats tend to consume more ethanol than males across a range of behavioral paradigms50-53.

Operant ethanol self-administration generally uses oral ethanol delivery and is most often performed in rats because they acquire the behavior more readily than mice, although one study found that it is possible to induce operant responding for ethanol vapor in male C57BL/6J mice using a nose-poke task54. Oral consumption is generally preferred in ethanol studies because this is the route of administration most commonly used by humans. Rats will not readily consume unsweetened ethanol, however—except in strains selectively bred for high ethanol consumption, such as the alcohol-preferring “P” rats, or in rats that have been made dependent on ethanol—so sucrose “fading” procedures are often used to induce ethanol drinking in these studies, similar to the induction procedures used in non-human primates55. In these studies, ethanol is sweetened with decreasing concentrations of sucrose, sucralose, or other sweetening agent until drinking of unadulterated ethanol is achieved.

Moore and Lynch found that female “P” rats self-administered more ethanol than males during the first 10 days of testing, but males increased responding to levels that equaled female self-administration after the initial 10-day period56. Priddy et al. found that, while females drank

8 more ethanol than males when given ad libitum access to it in their home cages, no sex differences in consumption were found under operant conditions in either the Wistar or the

Long-Evans strain52. Others have reported higher levels of operant responding for ethanol by females57, 58. Although Randall et al. reported that male Long-Evans rats tend to have greater numbers of ethanol-reinforced responses throughout self-administration training, females showed similar or greater ethanol intake than males after the researchers accounted for differences in body weight59. This study also examined rates of responding after a period of forced abstinence or extinction and found that male Long-Evans rats showed greater reinstatement (i.e. relapse-like) responding to ethanol cues than females59. However, another set of experiments in the Sprague Dawley strain found that females reinstated operant ethanol administration at higher rates than males when exposed to a combination of ethanol-associated cues and a stressor57, 58, consistent with evidence that women are more likely than men to relapse to drinking in response to stress34.

1.3.2. Conditioned Place Preference

Place conditioning tests are a well-established method of measuring the “rewarding”

(pleasurable or appetitive) or aversive effects of a given stimulus in laboratory animals60-63.

These tests use a classical conditioning paradigm to form an association between a stimulus of interest (e.g. ethanol) and a contextually distinct environment. After the conditioning procedure, the subject animal can choose to spend time in or choose to avoid the stimulus-paired environment. If the animal chooses to spend more time in the stimulus-paired environment than it did before conditioning, then the stimulus is considered to be rewarding; this is called conditioned place preference (CPP). Conversely, if the animal chooses to avoid the stimulus-

9 paired environment, the stimulus is described as aversive. In this case, the phenomenon would be called conditioned place aversion (CPA).

Mice and rats are the most commonly used animals in CPP testing, although some researchers have used zebrafish62. Establishing CPP for ethanol in male rats that have not been specifically bred for high ethanol consumption is difficult. The Wistar rat strain may be more amenable to developing ethanol CPP, because several researchers have reported significant ethanol CPP in males of this strain64-68. Interestingly, however, obtaining ethanol CPP in male rats generally seems to depend on pretreatment with low-dose ethanol for an extended period

(~15 days) before the start of the actual conditioning procedure, suggesting that a sensitization period is necessary for males to find ethanol rewarding in this test67. This is not commonly done for other drugs in the CPP test.

Very few studies have examined ethanol CPP in females, but Torres et al. demonstrated that female Wistar rats are more sensitive to ethanol reward than males across a range of doses69.

In this study, which did not use a pre-conditioning sensitization period, neither adult nor adolescent males developed ethanol CPP. On the other hand, adult females developed CPP at both low (0.5 g/kg) and moderate (1.0 g/kg) doses of ethanol, and adolescent females developed

CPP at the moderate dose69. When adult females were ovariectomized (OVX), their preference did not differ from males, suggesting that ovarian hormones play an important role in increasing ethanol reward in female rats. Cunningham and Shields have also tested for sex differences in

EtOH CPP in mice70. Interestingly, they did not detect significant differences in the magnitude of

CPP between males and females of either the C57BL/6J or DBA/2J strains. Females did show more overall variability in behavior than males, however. Since the authors did not track or control for estrous cycle phase, it is possible that this variability was caused by cyclic

10 fluctuations in ovarian hormone levels, which may have obscured other sex differences. In

Chapter Two, I will discuss effects of OVX and hormone replacement on EtOH CPP in female

C57BL/6J mice.

In addition to its usefulness as a measure of drug reward, CPP, like operant self- administration, can also be used to assess vulnerability to a relapse-like state in animal models71, known as reinstatement. A typical reinstatement model will begin with a normal CPP conditioning procedure, followed by a period of “extinction” during which the animal is exposed to the drug-paired environment in the absence of drug. CPP is extinguished when the time spent in the drug-paired environment is roughly equal to the time spent in that environment before the conditioning period. Reinstatement of CPP is induced by re-exposure to the drug or by exposure to a stressor. Little is known about sex differences in reinstatement of ethanol CPP, as few studies have tested for such differences, but the available data suggest that sex differences in this behavior do exist. For example, one study found that, while early adolescent female mice required higher doses of ethanol to induce CPP than early adolescent males, females continued to be responsive to ethanol reward into late adolescence72. Late adolescent males, on the other hand, did not develop ethanol CPP at any dose tested. This same study found that reinstatement of CPP occurred in early adolescent males and in both early and late adolescent females.

1.3.3. Two-Bottle Choice Ethanol Consumption

The two-bottle choice test of ethanol consumption is a method of measuring voluntary ethanol drinking in the home cage and is one of the simplest tests to perform. In this test, animals are given access to two drinking bottles, one filled with normal drinking water and the other filled with an ethanol solution that ranges from 3-20%. As mentioned above, most rat strains do

11 not readily consume ethanol without the addition of sweeteners, so sucrose or saccharin is generally used at the start of these experiments to encourage drinking. “Fading” procedures, in which the amount of sweetener is gradually decreased and ethanol concentration is gradually increased, can be used to transition rats to higher levels of ethanol consumption. Mice, especially the C57BL/6 inbred strain, will readily consume ethanol in this procedure without the addition of sweetener. (For a comparison of two-bottle choice drinking behavior by different inbred mouse lines, see Belknap et al. and Yoneyama et al. 73, 74.) By providing animals with a choice between water and ethanol, this method also allows researchers to measure preference for one liquid over the other. Typically, two-bottle choice studies in rats have been used to examine preference for ethanol over a 24-hour period. One drawback of this model is that animals tend to consume relatively low (sub-intoxicating) quantities of ethanol in two-bottle choice tests, unless strains specifically bred for high ethanol consumption (e.g. “P” rats) or ethanol-dependent animals are used. However, Long-Evans and Wistar rats will consume large amounts of ethanol without sucrose fading using a 24-hr intermittent access procedure pioneered by Wise in the 1970s75, 76.

Females tend to drink more than males and show higher preference for ethanol over water in two-bottle choice tests74, 77-86. Some studies have reported equal consumption between males and females, however56, 87, 88. This may be related to animal strain differences; CD (derived from

Sprague-Dawley) or alcohol-preferring “P” rats were used in these studies, and strain is known to be an important determining factor of voluntary ethanol consumption in both rats and mice50,

74, 79. Some have reported different findings even within the same strain. Vetter-O’Hagan reported that adolescent males of the Sprague-Dawley strain consume more ethanol relative to their body weights than adolescent females and adults of both sexes, whereas adult females generally consume more than adult males89. In contrast, Lancaster et al. found that adolescent

Sprague-Dawley females drank more than males, although their consumption decreased up until puberty80. However, it was noted by Lancaster et al. that the type of alcohol (beer vs. ethanol in water) and the delivery method (graduated drinking vial vs. standard water sipper) differed from other studies80. These inconsistencies likely explain the different results obtained from this study.

After puberty, females drank more than males, especially when animals were exposed to stress by pair-feeding, suggesting that ovarian hormones may partly contribute to higher levels of drinking in females. Marco et al. also found that female Wistar rats subjected to chronic mild stress (CMS), a widely-studied animal model for depression, showed significantly higher ethanol consumption and preference for ethanol over water, compared to CMS males90. This is consistent with results from other animal studies and with evidence from the human literature, which shows that women are more susceptible than men to stress-induced increases in drinking behavior.

The drinking in the dark (DID) test is a variation on the two-bottle choice procedure and models binge-like ethanol consumption91, 92. In this test, mice are given limited access (2-4 hours) to a single bottle of ethanol during the dark portion of the light-dark cycle. This is when mice, being nocturnal animals, are most likely to be awake and naturally engaging in feeding and drinking behavior. One advantage of this procedure over others (such as 24 hour two-bottle access) is that mice will routinely drink to intoxication and achieve blood ethanol concentrations

(BECs) greater than 100 mg% 92. Because of the high levels of drinking and pharmacologically relevant BECs obtained by this test, DID has become a popular model in ethanol research and is commonly used to test for effects of genetic and pharmacological manipulations on binge-like drinking91. Similar to other ethanol consumption models, females consume more than males in the DID test50.

In summary, existing research shows that male and female rodents differ in voluntary ethanol consumption and may experience its rewarding properties differently; however, few studies have investigated the neurobiological basis for these differences. Evidence indicating that ovarian hormones enhance ethanol reward in female mice will be presented in Chapter Two.

1.4. Ovarian Hormones and AUD

The actions of gonadal steroid hormones constitute a major source of sex differences in animal behavior and physiology. The traditional theory of sexual differentiation, both of the brain and of other bodily tissues, revolves around the notion that sex genotype (XX or XY, in mammals) guides embryonic differentiation of the gonads (ovaries or testes), which then produce hormones that organize bodily tissues into female- or male-typical patterns of development93, 94.

According to this theory, the appropriately organized brain of an individual will be activated by gonadal hormones later in life (i.e. after puberty) and respond by producing either male- or female-typical patterns of behavior93, 94. In the simplest of terms, this theory is a fairly accurate description of the sexual differentiation process. We now understand that the endpoints of sexual differentiation are determined by numerous factors, however, including genes on the X and Y chromosomes that may promote sex differences independently of sex hormone actions94-96. It is therefore important to remember that, while gonadal hormones are certainly crucial mediators of the process, they are not the only factors influencing sexual differentiation in either humans or laboratory animals. That said, a large body of evidence suggests that sex differences in AUD are mediated at least in part by the actions of ovarian steroids in females.

1.4.1. Human Studies

Ovarian steroids are known to influence subjective drug experience in women. Notably, the perceived effects of psychomotor stimulants such as cocaine and amphetamine vary across the menstrual cycle.97-99 During the luteal phase, when estrogen levels are rising, women report greater experience of drug “high” than men. Administration of exogenous estrogen also enhances stimulant effects. On the other hand, when circulating estrogen levels are low (during the follicular phase), this sex difference is not observed. Some researchers have also reported subtle differences in subjective response to ethanol across the menstrual cycle. For example, increases in negative mood during the luteal phase are more pronounced in women with a family history of alcoholism (a prominent risk factor for AUD development100), particularly after drinking ethanol101. Most studies to date have been unable to detect subjective differences in ethanol response across menstrual cycle phase, however, perhaps due to the confounding effects of expectation and learned associations from previous ethanol experience102. It is important to note that plasma levels of ovarian steroids, including E2, vary not only across the menstrual cycle but also on an individual basis. There is a great deal of both inter- and intra-individual variability in cycle length (26-35 days is considered normal103) and in hormone release associated with various cycle events (e.g. ovulation) in healthy women104. Furthermore, deficits in ovarian function are common. It has been estimated that 40% of women aged 20-40 experience some degree of ovarian dysfunction, including deficits in pre-ovulatory E2 production103. This highlights a very important caveat when considering the results of studies that have investigated menstrual cycle effects on ethanol-related behaviors and the ethanol experience in women (of which there are few to begin with), since most have not directly measured E2 levels. For the reasons stated above, simply noting menstrual cycle phase is not a reliable way to determine levels of E2 or

15 other hormones at the time of behavioral testing. Convincing evidence for effects of E2 on human drinking behavior does exist, however.

A positive correlation has been demonstrated between onset of ethanol use and onset of menstruation in teenaged girls, such that girls who begin menstruating earlier in life are also more likely to begin drinking earlier105. Use of oral contraceptives containing estrogens is positively correlated with increased ethanol intake, especially if contraceptive use begins at an early age (< 20 years)106, and increased serum levels of 17β-estradiol (E2, the primary circulating form of estrogen), have been associated with higher levels of ethanol consumption in premenopausal women107, 108. Furthermore, in a recent study of naturally cycling 18- to 22-year- old women, Martel et al. reported an increased risk for binge drinking during high-E2 phases of the menstrual cycle109.

1.4.2. Animal Studies

Female macaque monkeys self-administer significantly more ethanol at mid-cycle, when circulating estrogen levels are high, than during menstruation, when estrogen levels are low110.

Furthermore, several studies have demonstrated that removal of the ovaries (ovariectomy, OVX), which depletes circulating estrogen levels, reduces ethanol intake in female rats and mice to levels similar to those seen in males111-113. This effect is not universal, as others have reported unaltered ethanol consumption after OVX in females82, 114, 115. Several factors—such as the timing of OVX (adolescence vs. adulthood), strain of animal used, degree of ethanol availability

(i.e. limited vs. continuous access), and correction for baseline levels of consumption prior to

OVX—may explain these discrepancies. The hypothesis that ovarian hormones promote ethanol consumption in females is also supported by studies that have used supplemental estrogen

16 treatment in OVX animals. For example, Ford et al. demonstrated a positive correlation between estrogen dose and ethanol consumption in the two-bottle choice test116. Furthermore, we recently found that gonadally intact females consume more ethanol than males and OVX females in the

DID test and that estrogen treatment enhances binge-like drinking behavior in OVX females117.

Additional evidence that binge-like drinking is subject to estrogenic regulation will be presented in Chapter Three.

A small number of studies have also looked for estrous cycle effects on ethanol self- administration. Three studies found no effect of estrous cycle on operant responding for ethanol in freely cycling female rats 52, 58, 118, but Roberts et al. reported a modest effect of cycle phase in animals whose cycles were synchronized with a gonadotropin-releasing hormone (GnRH) receptor agonist, with highest intake levels occurring in diestrus, when estrogen levels are rising, suggesting that it may be possible to unmask estrous cycle effects under certain testing conditions118. Evidence that estrogen promotes ethanol self-administration was recently demonstrated in ovariectomized (OVX) rats that had been treated for several weeks with supplemental estrogen. The hormone-treated rats lever-pressed at a higher rate and drank more ethanol compared with OVX control and gonadally intact female rats58. Interestingly, in this same study, estrogen had no effect on the combination of cue- and stress-induced reinstatement of operant responding58, suggesting that the sex difference observed in reinstatement may primarily be driven by organizational and/or sex chromosome effects.

Additional evidence supporting a role for ovarian steroids in AUD comes from the four core genotypes (FCG) mouse model96, 119, 120. This model separates animals into four “core genotypes”—XX animals with female-typical gonads (ovaries), XX animals with male-typical gonads (testes), XY animals with female-typical gonads, and XY animals with male-typical

17 gonads—by moving the sex-determining region (Sry) of the Y chromosome to an autosomal chromosome. Since Sry causes masculinization of the reproductive organs, this helps researchers determine which sex differences result from gonadal hormones and which are produced by genes on the X and Y chromosomes. Barker et al. used these mice to examine sex differences in ethanol consumption and habit formation in the form of operant responding121. In this study, voluntary ethanol consumption was determined by gonadal phenotype, with gonadal females consuming more than gonadal males (regardless of chromosome complement), consistent with findings from other rodent models. In the absence of reinforcement (no ethanol received) or in the case of reinforcer devaluation (ethanol adulterated with lithium chloride) sex chromosome complement, not gonadal phenotype, determined levels of habit-like nose poke responding.

1.5. The Ovarian Steroid Hormone 17β-Estradiol and Its Receptors

Early in the 20th century, researchers studying the reproductive cycle of female guinea pigs noted that the period of sexual receptivity (estrus) was associated with specific changes in the histological profile of vaginal mucosa samples—known as “vaginal estrus,” which is characterized by the presence of cornified epithelial cells122, 123. The term hormone had only just been coined by Ernest Starling in 1905, but a great deal of scientific interest and effort was already invested in isolating and locating the sources of the body’s endocrine messengers122, 124.

In 1923, zoologist Edgar Allen and biochemist Edward A. Doisy developed a bioassay to identify potential sites of hormone production in the mammalian ovary by treating OVX mice with exogenous ovarian fluid samples and monitoring the vaginal epithelium for morphological changes125. Using their assay, Allen and Doisy observed that vaginal estrus could be induced in

OVX mice by injection of ovarian follicular fluid obtained from swine125. Although it would take

18 more than a decade of additional research to establish its identity, the molecule primarily responsible for this effect was 17β-estradiol126. At this point, it will be useful to provide a brief explanation of this particular ovarian hormone’s biological origins, chemical structure, and function in vivo so the reader can better understand the mechanisms by which estradiol may act to regulate ethanol-related behaviors.

1.5.1. Estrogen Biochemistry and Synthesis

Because many early experiments in gynecological endocrinology relied on the induction of an estrus-like state in test animals as a measure of hormone presence and potency, the first ovarian hormones discovered came to be known as estrogens (for “generating estrus”). The estrogens are a group of 18-carbon (C18) molecules belonging to the sex steroid class of steroid hormones127, 128. In contrast to the corticosteroids (the other major class of steroid hormones), which are produced mainly by the cortex of the adrenal gland, sex steroids are produced primarily by the gonads (ovaries and testes) and, during pregnancy, by the placenta129. It should be noted, however, that local synthesis in the brain and other non-gonadal tissues is an important alternative source of endogenous sex steroids130-134.

Also known as gonadocorticoids or gonadal steroids, sex steroids are generally divided into three categories based on chemical structure: estrogens, androgens, and progestogens127.

Hormones of all three categories are known to possess neurological actions and are, therefore, also considered to be neurosteroids131. There is some evidence that androgens and progestogens, like estrogens, may influence neurological responses to drugs of abuse. However, in the context of this dissertation, only the estrogens will be discussed in detail.

The primary endogenous estrogens (Figure 1) are estrone (E1), estradiol (E2), and estriol

(E3), of which E2 is the most potent and plentiful in non-pregnant women of reproductive age128.

A fourth kind of estrogen, estetrol (E4), is produced by the human fetal liver and found in detectable levels only during pregnancy135. Like all steroid hormones, estrogens are synthesized from cholesterol via a series of enzymatic reactions136, 137. In females of reproductive age, this process takes place predominantly in the ovaries122, 138. The cyclic fluctuations in hormone levels associated with female reproductive system function (i.e. menstrual and estrous cycles) are both the cause and the result of a complex interplay of positive and negative feedback between the brain and ovaries103. This process is not entirely understood, but the basics are explained below.

Ovarian hormone synthesis is accomplished by the cooperative action of two different cell types, which respond to endocrine signals from the anterior pituitary in the form of

20 luteinizing hormone (LH) and follicle stimulating hormone (FSH) as well as autocrine and paracrine signals from within the ovaries122, 138. The ovaries’ steroidogenic cells are the theca cells, located in the vascular ovarian stroma, and the granulosa cells, which surround developing oocytes and are separated from the theca cells by a basal membrane138. Simply put, LH exposure stimulates the theca cells to convert cholesterol, obtained from the bloodstream, first into progestogens (C21 steroids) and then into androgens (C19 steroids). Since steroid hormones are lipophilic, the newly synthesized androgens are able to pass through the basal membrane and reach the granulosa cells by diffusion. FSH stimulation of the granulosa cells then results in the conversion of androgens into estrogens122. The key intermediary in this process is the androgen androstenedione, which, during estrogen synthesis, is converted either to testosterone via 17β- hydroxysteroid dehydrogenase (17β-HSD) or to E1 via the cytochrome P450 aromatase (also known as estrogen synthetase). E2 and E3 can then be produced from either testosterone or E1.

The requisite synthetic enzymes also exist in the testes (in males) and in “pockets” in other tissues, including brain, where local synthesis occurs132.

1.5.2. Estrogen Receptors

First studied for their critical role in the differentiation, maturation, and function of reproductive tissues, estrogens—and 17β-estradiol in particular—are now understood to be important modulators of cell function in many other tissue types as well. In mammals, neuroendocrine, skeletal, adipogenic, gastrointestinal, cardiovascular, and immune systems all require estrogens to perform optimally, and estrogen signaling in the brain is a crucial regulator of mood, cognition, and behavior131, 139-143. Estrogens are able to exert such a wide range of biological functions due to the highly dynamic functionality of their receptor proteins.

Early speculations on estrogens’ mechanism of action revolved around the idea that estrogenic effects were mediated by enzymatic processes144, 145. This notion persisted until the

1960s, when technological advancements permitted researchers to identify estrogen target tissues using radioisotopic labeling and to recognize the presence of intracellular estrogen binding sites.

In a groundbreaking experiment, Jensen et al. tracked radioactively labelled E2 and discovered that it formed a complex in the nucleus with a protein that became known as the estrogen receptor (ER)145, 146. Shortly thereafter, researchers studying the effects of E2 treatment on chicken oviduct observed dramatic increases in mRNA and protein synthesis in treated tissue147-

150. These studies introduced to the field of molecular biology the concept of ligand-activated transcription factors and laid the foundation for present-day understanding of ER function151-154.

The ER discovered by Jensen et al., now known as ERα, was thought to be the sole estrogen receptor protein until the discovery of ERβ in 1996155. Together, ERα and ERβ are called the classical (nuclear) estrogen receptors. While recent studies have confirmed the existence of other types of ER156, including the G-protein-coupled estrogen receptor (GPER, formerly known as GPR30)157, this dissertation will focus on the classical ERs.

ERα and ERβ—also identified as NR3A1 (nuclear receptor subfamily 3, group A, member 1) and NR3A2 (nuclear receptor subfamily 3, group A, member 2), respectively—are members of the nuclear receptor (NR) class of DNA-binding transcription factors, which function as dimers to regulate gene transcription and other cellular processes in response to ligand binding158-160. All NRs are characterized by a common primary structure consisting of five modular, functionally distinct domains (Figure 2): A/B, C, D, E, and F161. The A/B domain exists in the N-terminal portion of the receptor and is the least homologous (17%) when comparing

ERα and ERβ162, 163. This domain is often described as being “truncated” in ERβ relative to its

22 somewhat larger size in ERα. One important feature of the A/B domain is the presence of activation function 1 (AF1), a regulatory region that mediates many interactions between NRs and their co-activators164. AF1 itself is ~30% homologous between ERα and ERβ and accounts for some of the differences between these receptors’ transcriptional effects143, 165. This region demonstrates low levels of constitutive activity in the absence of ligand (lower in ERβ than in

ERα), is involved in receptor dimerization, and has been cited as a crucial mediator of ERβ’s ability to repress the transcriptional activity of ERα166.

In contrast to the A/B domain, the C domain is highly homologous between the classical

ERs (and between NRs in general). This region is the DNA binding domain (DBD), which contains two zinc fingers that mediate direct interactions between ERs and estrogen response elements (EREs) in gene promoter regions, and its amino acid sequence is 97% identical between ERα and ERβ163, 167-169. C-terminal to the DBD is a so-called “hinge region,” the D domain. This flexible region is known to influence intracellular trafficking and distribution of

NRs155, 162. The D domain, which is 36% homologous between ERα and ERβ, contains amino acid sequences that facilitate nuclear localization when exposed upon ligand binding163. It is also a site of posttranslational modification162.

C-terminal to the hinge region are the E and F domains. The latter of these is possibly the least well-studied of the ER functional domains, having generated comparatively little interest until the discovery of ERβ170, 171. This domain has also been difficult to study in general, since its

23 structure varies greatly between NRs161. Located at the protein’s carboxy-terminus, domain F is involved in receptor dimerization and is thought to contribute to activity differences between

ERα and ERβ, including the receptors’ differing responses to certain ligands, such as selective estrogen receptor modulator (SERM) drugs170-173. This is not surprising given the F domain’s close proximity to domain E, the ligand binding domain (LBD).

In addition to the receptor’s ligand binding pocket, the E domain also contains activation function 2 (AF2)—which, unlike AF1 in the A/B domain, functions as a regulator of co-activator interactions only when ligand is bound. AF2 also enhances the function of AF1, working cooperatively to modulate ER transcriptional activity in response to environmental signals174.

Not all of the E domain is responsible for ligand binding; it is also involved in receptor dimerization159, 162. While the portions of domain E that form the ligand binding pocket show a much greater degree of homology than those that do not directly contact ligands, the region’s amino acid sequence is still only ~55% homologous between ERα and ERβ, and this partially accounts for differences in ligand affinity between the two receptors155, 175. ERα and ERβ have similar affinities for 17β-estradiol (E2), the major endogenous ER ligand176, 177. By Scatchard

177 analysis with tritiated estradiol, the Kd of E2 at ERα is 0.19 nM, and the Kd at ERβ is 0.14 nM .

The estrogens are distinguished from other sex steroids by the presence of a phenolic A ring, which is crucial for their functional interaction with the classical ERs128. In fact, E2 is structurally very similar to testosterone, save that the latter has instead a cyclohexane A ring. The affinity of testosterone for ERα and ERβ is roughly 1000-fold less than that of E2, demonstrating the importance of the phenolic A ring as a mediator of estrogen-ER interactions. ER activity can also be modulated by a range of synthetic ligands, including SERMs such as raloxifene and tamoxifen, commonly used for the treatment of ER-positive breast cancer. The ERα-selective

24 agonist propylpyrazole-triol (PPT) and the ERβ-selective agonist diarylpropionitrile (DPN) are useful tools for examining ER subtype-specific effects on tissues and behavior. PPT demonstrates a 410-fold greater relative binding affinity (RBA) for ERα over ERβ178. DPN demonstrates a 70-fold greater RBA for ERβ than for ERα and 170-fold greater relative potency in transcription assays179, 180.

The six steroid hormone receptors encoded within modern vertebrate genomes—two ERs and one each for androgens, progestogens, and the two types of corticosteroids (glucocorticoids and mineralocorticoids)—all evolved from a common ancestor that existed ~700 million years ago181. Evolutionarily, ERs are the oldest type of steroid hormone receptor, having most likely emerged with the cephalochordates127. ERα is encoded by the gene Esr1, located on chromosome

6163, 165. The full-length ERα protein (ERα66) consists of 595 amino acids and has a molecular size of 66 kilodaltons (kDa). On the other hand, ERβ is encoded by the gene Esr2, located on chromosome 14163, 165. Full-length ERβ protein consists of 530 amino acids and has a molecular size of 54 kDa. Both Esr1 and Esr2 produce multiple known splice variants. At least three ERβ splice variants have been identified in brain tissue182. The known human ERβ splice variants are characterized by variable length deletions and substitutions in exon 8, resulting in truncation at the protein's C-terminus182. As described above, the protein's C-terminal region contains the

LBD, AF2, and the F domain. Ligand binding ability and other innate receptor functions, such as dimerization and co-regulator recruitment, are therefore altered in these splice variants. The Esr1 splice variants include ERα46 and ERα36, which modulate the function of ERα66 (the full- length protein) and are thought to be particularly important as regulators of ERα’s membrane- initiated signaling functions183. Although the majority of studies on ER splice variants have been done in vitro in the context of cancer research, and little is known about the potential actions of

25 these alternative isoforms in the brain, the prevalence of ER splice variants is known to vary by tissue type and also between males and females182, 184. Therefore, splice variants are thought to mediate some tissue-specific differences in ER function and may also explain certain sex differences.

In their classical mode of action, ERs act as ligand-dependent transcription factors. When bound to an appropriate agonist, phosphorylated ERs can form homo- or heterodimers and translocate to the cell nucleus, where they are able to activate or repress gene transcription through interactions with EREs in regulatory DNA sequences. This promotes local conformational changes in the DNA (e.g. bending and looping), thereby altering the ability of transcriptional machinery and co-regulators to interact with target DNA regions 139-143, 185, 186.

In addition to the classical signaling mechanism described above, ERs are also able to modulate gene expression through interaction with other regulatory factors (e.g. co-activators, co-repressors, histone acetyltransferases and deacetylases, and general transcriptional factors), including activating protein-1 (AP-1), stimulating protein-1 (SP-1), and cAMP response element binding protein (CREB)174, 187-190. In some cases, this allows ERs to regulate transcription at promoters where binding with EREs is weak, ineffective, or absent176, 191. Interactions with co- regulators also contribute significantly to the tissue-specificity of estrogen effects on target gene expression and intracellular signaling cascades192, 193. Both ERα and ERβ are known to localize at the plasma membrane, which allows 17β-estradiol to activate many of these pathways within minutes187. Signaling cascades known to be E2 responsive include such elements as: protein kinase A, protein kinase C, mitogen activated protein (MAP) kinase, extracellular signal- regulated kinase (ERK), phosphatidylinositide 3-kinase (PI3K), calcium-calmodulin kinase II

(CaMKII), the mammalian target of rapamycin (mTOR), cyclic adenosine monophosphate

(cAMP), and cAMP response element-binding (CREB) protein194-198. Such effects have been demonstrated, for example, in the female rodent hippocampus, where ERα and ERβ interact with metabotropic glutamate receptors (mGluRs) at the plasma membrane, triggering increases in

CREB phosphorylation and CREB-dependent gene transcription through activation of the ERK and MAPK pathways187, 199-201.

1.6. Neural Substrates of Reward and Their Regulation by Estradiol

As discussed above, sex differences in drinking and other ethanol-related behaviors likely involve sex hormones and their interactions with receptors in the brain. Drugs of abuse, including ethanol, share the property that they produce feelings of euphoria or other positive emotional states that reinforce or reward drug consumption. The term “reward” is used liberally by many neuroscientists, particularly in addiction research. This is understandable given the need to identify and describe aspects of the drug experience that drive individuals to seek out and use substances of abuse, as well as the brain systems that process these aspects, so as to identify potential treatment targets. However, “reward” is often ill-defined. The term is sometimes used more or less interchangeably with “reinforcement”—that is, something contingent upon the execution of a certain behavior that increases the probability of said behavior occurring again202.

A more nuanced definition would stipulate that “reward” also denotes a positive affective quality

(i.e. pleasure)202. In other cases (e.g. when discussing conditioned place preference), the word is used primarily in reference to the hedonic quality of an experience without including the element of reinforcement in the operant sense. It should be noted that a great deal of controversy has surrounded this topic in the past and still exists around it today. Yet the word “reward” can still

27 be a useful short-hand for neuroscientists, provided we bear in mind the complexity of the concept it represents.

1.6.1. The Reward System

The concept of a neural reward center took root in the field of psychology in the early

1950s, before neuroscience existed as a distinct discipline. In 1954, Olds and Milner found that laboratory rats would repeatedly return to and spend time in areas where they had previously received brain stimulation from electrodes implanted in certain subcortical structures—an early example of CPP203. Furthermore, if given the opportunity to activate the electrodes by lever pressing, these animals would vigorously self-stimulate. This phenomenon, known as intracranial self-stimulation (ICSS), was subsequently documented in both human and non- human primates204, 205. These findings prompted extensive research into the neuroanatomical and neurochemical bases of reward. Our knowledge of this topic has taken shape gradually over a period of decades, with contributions from countless studies. The brief summary of findings that follows here is not intended to be exhaustive but rather to give the reader some context in which to consider the role of estradiol and its classical receptors as regulators of ethanol reward.

Olds, Milner, and others identified various brain structures or regions that would support

ICSS204, 206-209. Notable among these, in the context of our modern view of the brain’s so-called

“reward system,” was the lateral hypothalamus203. Through this region passes a group of fibers known as the medial forebrain bundle (MFB), which contains a number of important axonal projection networks210. One of these is the mesocorticolimbic dopamine (DA) system, which originates with the dopaminergic cell bodies in the ventral tegmental area (VTA) and projects to a number of other structures known to regulate both natural and drug-induced reward, including

28 the nucleus accumbens (NAc, formerly known as the nucleus accumbens septi), olfactory tubercle, amygdala, bed nucleus of the stria terminalis (BNST), lateral septal area, hippocampus, and prefrontal cortex (PFC).211 In simplified discussions of reward, such as those sometimes found in introductory neuroscience texts, the release of DA from the VTA into the NAc is often treated as being synonymous with reward. This is because naturally rewarding experiences (e.g. feeding and sexual activity) and most drugs of abuse, including ethanol, either directly or indirectly increase extracellular DA concentrations in the mesocorticolimbic system2, 212. DA is certainly not the only neurotransmitter produced by mesocorticolimbic structures, however. For example, the NAc receives glutamatergic input from the PFC, amygdala and hippocampus, which also form reciprocal glutamatergic connections with one another213. Both GABAergic and

(in the NAc) cholinergic interneurons exert modulatory effects on this system, and GABAergic projection neurons from the NAc, VTA, and amygdala provide important inhibitory inputs213-215.

Adding further layers of complexity are noradrenergic and serotonergic projections from the locus coeruleus and midbrain raphe nuclei, respectively, as well as inputs from various hypothalamic and extra-hypothalamic (e.g. amygdalar) neuropeptide systems213, 216.

Furthermore, in many cases, mesocorticolimbic DA release is stronger in response to stimuli that predict a reward than in response to the reward itself—and there is no direct evidence that DA release is equivalent to pleasure, per se204. In fact, mesocorticolimbic DA release has been shown to increase in response to aversive as well as rewarding stimuli213, 217-219. It has therefore been suggested that, rather than a reward system, the mesocorticolimbic system would be more accurately described as a “sensorimotor integrator… involved in higher order motor and sensorimotor processes that are important for activational aspects of motivation, response allocation, and responsiveness to conditioned stimuli”220. That said, there can be no doubt that

29 this system is heavily involved in the development and maintenance of addiction and that studies of its function contribute valuable information to our understanding of AUD221.

1.6.2. Estradiol as a Reward Modulator

As with most aspects of its biological function, the role of estradiol and its receptors as regulators of reward and motivated behavior was first studied in the context of reproduction222,

223. Given the fact that sexual reproduction is essential for the propagation of most animal species, one can easily imagine how neurological conditions that cause reproductive behavior to be highly rewarding would be selected for evolutionarily. Reproductive behavior is not without risks, however. The act of copulation may expose participants to disease, predation, and potential injury by sexual partners or rivals224. It is therefore important for animals to balance such risks against the potential for successful reproduction. In most animal species, a female’s motivation to engage in sexual behavior is highest during times when copulation is likely to result in pregnancy, meaning that it is closely linked to ovulation222, 223. As previously discussed, E2 is essential for normal regulation of ovarian function, including ovulation, and this may explain why E2 in the female brain also plays an important role in regulating sexual motivation and reward in general223.

Our knowledge of ERα and ERβ expression patterns in brain tissue is complicated by a number of factors, particularly by differences in methodology used to study the topic (for review, see Gillies and McArthur225). One notable confounding factor is the variable use of intact vs. gonadectomized animals. As ER expression is regulated in part by gonadal steroids, gonadectomy (GDX) can substantially alter the results of such studies225. Additionally, absolute quantification of immunoreactivity and in situ hybridization signals (two commonly-used

30 techniques) is difficult, making direct comparisons between studies challenging. Furthermore, the results of some studies of ERβ expression in particular have been misleading or inconclusive due to significant problems with antibody specificity,226-228 although a bacterial artificial chromosome (BAC) transgenic mouse model with GFP expressed under control of the ERβ promoter now exists as an alternative to antibody use229. Despite the challenges described above, multiple well-designed studies have demonstrated that both ERα and ERβ are expressed in brain regions associated with reward processing and ethanol consumption, including (but certainly not limited to) the two regions of greatest interest in the context of this dissertation: the amygdala and VTA229-234.

The Amygdala

Addiction research (and neuroscience in general) tends to heavily emphasize the amygdala’s role as a regulator of negative affective states (e.g. fear/anxiety)2, 235. However, a large body of research testifies to the importance of the amygdala as a regulator of positive affective states, including both natural and drug-induced reward236-239. For example, the amygdala is recognized as a key regulator of motivational aspects of female reproductive behaviors, which are ovarian steroid-dependent in most mammalian species and are known to depend partially on DAergic neurotransmission as well240. This is particularly true of the medial nucleus of the amygdala (MeA), although other regions have also been implicated241. Clitoral stimulation induces CPP in female rats, and this is associated with MeA activation as detected by

Fos protein immunoreactivity242. Additionally, infusion of the opioid receptor antagonist naloxone into the MeA blocks the development of mating-induced CPP in female rats, demonstrating the importance of this region as a regulator of sexual reward in females243. While

31 very few studies have investigated the role of the MeA in ethanol-related behaviors (the basolateral and central nuclei have received much more attention), it is worth noting that the

MeA has been shown to regulate ethanol-induced anxiolysis in rats244, 245. This is especially interesting in light of the fact that women are more likely than men to report drinking ethanol to alleviate anxiety and are also more likely to cite life stressors (vs. external temptation) as reasons for AUD relapse32-34.

Direct evidence supporting a role for the amygdala as a regulator of ethanol reward comes from the work of Gremel and Cunningham, who demonstrated that the amygdala is necessary for the acquisition and expression of ethanol CPP246 and that infusion of the DA receptor antagonist flupenthixol into the basolateral amygdala (BLA) is sufficient to block ethanol CPP expression in mice247. This suggests a possible mechanism by which estradiol may act to regulate ethanol reward, since decreased amygdalar DA levels have been reported in OVX rats248 and estradiol benzoate (EB, a synthetic ester of E2) has been shown to dose-dependently increase amygdalar DA levels after OVX249. This increase in DA is most likely due to a stimulatory effect of estradiol on VTA DA neurons, which provide the majority of DAergic innervation to the amygdala250. Estradiol has also been shown to modulate the function and expression of the dopamine transporter (DAT) protein, however, so local effects of E2 on amygdalar DA levels are also possible251-253.

There are other, non-dopaminergic, mechanisms by which E2 may potentially regulate ethanol-related behaviors through actions in the amygdala. As described in section 1.5 of this chapter (above), E2 and its classical receptors exert effects on a multitude of genes and signaling cascades throughout the brain and body, and the possible interactions between E2 and ethanol’s neurological actions are numerous. For instance, E2 is also known to regulate production of

32 neuropeptides that modulate the amygdala’s response to ethanol—including corticotropin- releasing factor (CRF) and neuropeptide Y (NPY), which modulate some of ethanol’s effects on

GABAergic transmission within and from the amygdala and have been implicated as mediators of both anxiolytic and anxiogenic (i.e. withdrawal-related) aspects of the ethanol experience254,

255.

The VTA

As with most drugs of abuse, ethanol-induced VTA stimulation (resulting in release of

DA into the NAc and other mesocorticolimbic structures) is widely held to be a crucial mediator of ethanol reward. Both in vivo and in vitro studies have demonstrated that ethanol stimulates the firing activity of VTA DA neurons (for a thorough review of ethanol effects on the VTA, see

You et al.256 and Morikawa and Morrisett216). In fact, both alcohol-preferring and outbred rat strains will self-administer ethanol directly into the VTA, and both the acquisition and the maintenance of this behavior can be prevented by co-administration of the D2 receptor agonist quinpirole, which reduces the firing of DA neurons257-260. Furthermore, expression of ethanol

CPP in mice can be abolished by experimental manipulations of VTA neurotransmission, suggesting that this region does indeed regulate ethanol reward261-264.

Importantly, E2 is known to have sex-specific effects (found in females but not in males) on DA dynamics in the brain. I have already discussed the effects of OVX and E2 replacement on amygdalar DA levels, and similar effects have been reported in other brain regions as well.

OVX depletes, and E2 treatment increases, basal DA concentrations in the striatum of female rats265. DA levels in the striatum and PFC also vary across the estrous cycle265, 266. E2 has been shown to lower ICSS thresholds in female rats267 and to enhance amphetamine-stimulated DA

33 release223. Moreover, both estrous cycle phase and OVX/E2 replacement are known to affect ethanol-stimulated DA release in the female brain. One study by Dazzi et al. found that ethanol- induced DA release in the PFC—a major target of VTA DAergic projection neurons—varied with estrous cycle phase and could be blocked by either OVX or pretreatment with an ER antagonist266. In this study, treatment of OVX mice with the synthetic estrogen ethynylestradiol

(but not progesterone) restored ethanol’s ability to evoke mesocortical DA release. Recently,

Vandegrift et al. published a groundbreaking electrophysiological study that demonstrated direct effects of estradiol on VTA DA neurons and their sensitivity to both DA and ethanol268. They found that VTA DA neurons from the brains of gonadally intact female mice that were sacrificed during diestrus (characterized by high E2 levels) were more sensitive to the stimulatory effect of ethanol than were DA neurons in the VTA of females sacrificed when E2 was low (estrus).

Furthermore, pretreatment of VTA slices obtained from diestrus mice with an ER antagonist diminished ethanol-induced DA neuron firing, and treatment of VTA slices obtained from OVX mice with E2 enhanced ethanol-induced firing of DA neurons. Taken together, these studies strongly suggest that E2 can enhance ethanol reward in females via direct actions on DA neurons in the VTA.

Researchers have also investigated the role of the VTA in binge-like ethanol consumption using the drinking in the dark (DID) test. Several of these studies have demonstrated reduction in binge-like drinking after manipulation of GABAergic transmission within the VTA269-271. One study271 of particular relevance to our discussion of estradiol’s role in female drinking behavior examined the effects of a selective agonist at δ subunit-containing (extrasynaptic) GABAA receptors, which bind ethanol directly and are an important substrate for many ethanol-related behavioral effects (i.e. intoxication)272. In this study, Melón et al. found that intra-VTA

administration of a GABAA receptor δ subunit-selective agonist decreased binge-like ethanol consumption in an estrous cycle phase-dependent manner, such that the agonist was ineffective during estrus (when plasma E2 levels are lowest273) but significantly reduced DID ethanol consumption during other cycle phases271. Additionally, analysis of VTA-enriched tissue samples by quantitative polymerase chain reaction (qPCR) found elevated GABAA receptor δ subunit expression during diestrus (when plasma E2 levels peak273), suggesting that E2 may regulate ethanol consumption through genomic as well as non-genomic actions in the VTA.

As stated previously, E2 and its classical receptors modulate the expression of many gene products known to influence the brain’s response to ethanol. Two that have already been mentioned (with regard to their effects on amygdalar function), CRF and NPY, also modulate neurotransmission in the VTA and have been shown to regulate binge-like ethanol consumption as measured by the DID test274. Intra-VTA infusion of CRF receptor modulators reduces binge- like drinking in adult mice, and chemogenetic inhibition of BNST-to-VTA-projecting CRF neurons also reduces DID ethanol consumption275-277. NPY is known to influence the function of

DA neurons in the mesocorticolimbic system278, including the VTA specifically279, and ICV infusion of NPY significantly reduces binge-like ethanol consumption in the DID test280. Chapter

Four of this dissertation discusses the effects of estradiol and ER-specific agonists on expression of the genes that code for these neuropeptides, Crh and Npy. Also discussed in that chapter is one other regulator, novel and little-studied, of both ethanol CPP and binge-like drinking: anaplastic lymphoma kinase (ALK). Dutton et al. demonstrated that treatment with the ALK inhibitor

TAE684 abolishes ethanol CPP in male DBA/2J mice and treatment with either TAE684 or alectinib (another ALK inhibitor) significantly reduces binge-like ethanol consumption264.

Furthermore, lentiviral-mediated RNA interference (RNAi) knockdown of ALK within the VTA also significantly reduces ethanol consumption in the DID test.

1.7. Summary and Project Overview

In summary, alcohol use disorder (AUD) manifests differently in men and women. The incidence of AUD in women is increasing rapidly, and the negative impact of AUD on health is generally more severe in women compared to men, yet the overwhelming majority of animal studies aimed at developing new AUD treatments have been conducted in males. Clinical research has documented sex differences in the efficacy and side effects of numerous medications, emphasizing the need to consider biological sex in both preclinical and clinical studies. This dissertation examines the role of the ovarian steroid hormone 17β-estradiol (E2) in behavioral responses to ethanol in female mice.

Both human and animal studies have uncovered a link between ovarian steroids and ethanol consumption. In particular, E2 is known to increase ethanol intake in a variety of self- administration paradigms and to enhance ethanol reward. The neural mechanisms mediating these effects of E2 are currently unknown. This dissertation describes a series of behavioral and molecular experiments aimed at identifying mechanisms by which E2 and its classical receptors,

ERα and ERβ, may regulate the female brain’s response to ethanol. The primary hypothesis is that E2 acts in brain regions associated with both natural and artificial (i.e. drug-induced) reward to modulate the neurological effects of ethanol in a way that increases ethanol’s addictive potential, likely through activation of classical estrogen receptors. The aims of this dissertation are therefore to (1) determine whether estrogenic enhancement of ethanol reward and binge-like drinking in female mice is mediated primarily by ERα or ERβ, (2) establish which brain regions

36 are critical for the regulation of ethanol reward and binge-like drinking by E2, and (3) investigate the effects of ER agonists on ethanol-related gene expression in the amygdala and VTA, two regions known to be essential mediators of ethanol reward.

In the second chapter of this dissertation, I will describe the results of behavioral experiments designed to determine the role of ERα and ERβ as regulators of ethanol reward in female mice. My first experiment demonstrated that treatment with estradiol benzoate (EB) enhances ethanol reward in OVX C57BL/6J mice, as measured by conditioned place preference

(CPP) testing. While others have shown the importance of ovarian hormones for the development of ethanol CPP in female rats69, this is the first study to confirm that estradiol regulates ethanol CPP in female mice. Next, I conducted two control experiments. Because our

CPP protocol uses a biased conditioning side assignment method—such that animals are given ethanol on their initially non-preferred side of the CPP chamber—it was necessary to make sure that EB treatment did not directly alter preference for the non-preferred side. The first control experiment therefore examined the effects of EB treatment on preference for the non-preferred side of the CPP chamber in the absence of ethanol conditioning, with animals receiving IP saline on all conditioning days rather than alternating saline and ethanol treatments. The second control experiment was conducted to determine whether EB alters the rate of ethanol metabolism in

OVX mice. Last, to find out whether estrogenic enhancement of ethanol reward involves activation of the classical estrogen receptors, I tested the effects of two ER-selective agonists, the

ERα agonist propylpyrazole-triol (PPT) and the ERβ agonist diarylpropionitrile (DPN), on ethanol CPP in OVX mice. Last, I investigated the potential role of amygdalar ERs as regulators of ethanol CPP using lentiviral-mediated RNA interference knockdown of ERα and ERβ in the central nucleus of the amygdala (CeA) in gonadally intact female mice.

In the third chapter of this dissertation, I will describe a series of experiments examining the role of ERα and ERβ in binge-like ethanol drinking behavior, as measured by the drinking in the dark (DID) task. Because our lab previously demonstrated increased binge-like ethanol consumption in OVX mice after treatment with EB117, my first DID experiment tested whether treatment with PPT or DPN would modulate binge-like drinking behavior in OVX mice. Since the ventral tegmental area (VTA) is known to be a crucial regulator of binge-like drinking, and because estradiol modulates the response of VTA dopamine neurons to ethanol268, I next used lentiviral-mediated RNAi knockdown of ERα and ERβ to investigate the role of VTA ERs as regulators of DID behavior in gonadally intact female mice. For comparison, I also conducted the same RNAi experiment using male C57BL/6J mice to test for sex differences. Finally, I used immunohistochemistry and confocal microscopy to validate the efficacy of the lentiviral construct used to knockdown Esr1/ERα protein levels in VTA tissue. This could not be done with the Esr2/ERβ construct due to issues with ERβ antibody specificity (see section 6.2 of this chapter for details). However, the Lasek lab has validated knockdown efficiency of both vectors in vitro using Neuro2A cells (Donghong He).

The fourth chapter of this dissertation will focus on a series of quantitative polymerase chain reaction (qPCR) experiments investigating the effects of ER agonists on the expression of several genes known to regulate ethanol-related behaviors as well as neurological responses to ethanol. In the first experiment, I treated OVX mice with either EB or vehicle (VEH), then treated half the animals in each group with either ethanol or saline before sacrificing the animals and collecting tissue punches enriched in CeA or medial amygdala (MeA). I then used qPCR to measure relative expression levels of the genes coding for anaplastic lymphoma kinase (Alk), corticotropin releasing factor (Crh), neuropeptide Y (Npy), ERα (Esr1), and ERβ (Esr2). Next, I

38 treated OVX mice with PPT, DPN, or a combination of both agonists and collected tissues punches enriched in CeA, MeA, basolateral amygdala (BLA), or VTA for qPCR analysis.

The fifth and final chapter of this dissertation will summarize the findings reported in chapters Two through Four and propose directions for future research.

CHAPTER TWO: ESTRADIOL ENHANCES ETHANOL REWARD IN FEMALE MICE THROUGH ACTIVATION OF ERα AND ERβ

Author’s Note: Portions of the following text were previously published in Hormones and Behavior and Neuro Report under the titles “Estradiol enhances ethanol reward in female mice through activation of ERα and ERβ”281 and “Sex Differences in Cocaine Conditioned Place Preference,”282 respectively. I assert that I am the first author of said titles and retain the right to reprint them in the body of this doctoral dissertation (see Appendix C).

2.1. Introduction

Recent decades have seen dramatic increases in ethanol consumption and the occurrence of alcohol use disorder (AUD) among the female population25, 34, 283. Furthermore, women tend to exhibit a so-called “telescoping” pattern of ethanol abuse, experiencing earlier onset of physical and psychological health complications and progressing more rapidly from first use to treatment entry26, 27. Despite the growing risk that AUD poses to women’s health, the majority of studies on ethanol’s biological effects and potential therapeutic treatments for ethanol dependence have been conducted in male animals. Little is known about sex differences in the brain’s response to ethanol or the ways in which sex-specific therapies could be developed to benefit both men and women.

Existing research suggests that 17β-estradiol (E2), the main circulating form of estrogen produced by the ovaries in premenopausal females, may increase female vulnerability to AUD.

Elevated serum levels of E2 have been associated with higher levels of ethanol consumption in premenopausal women107, 108, and numerous animal studies demonstrate effects of E2 on drinking behavior. For instance, chronic estradiol replacement has been shown to increase ethanol consumption by OVX animals and ethanol preference in a two-bottle choice paradigm without increasing water consumption116, 284, 285, and a single injection of the synthetic prodrug estradiol valerate (EV), a slow-release formulation of E2, increases consumption of both

40 sweetened and unsweetened 12% ethanol solution286. At present, however, the neurobiological mechanisms behind the ability of E2 to increase ethanol consumption are poorly understood. One possibility is that E2 increases the pleasurable or appetitive qualities of the ethanol experience

(i.e. reward).

The CPP test is a well-established method of measuring drug reward in laboratory animals61. This method uses a form of classical conditioning in which the stimulus of interest is paired with a contextually distinct environment in order to form an association between the stimulus-induced state and the environment. Naturally cycling female rats develop stronger preference than males for ethanol-paired environmental cues in the CPP test—a response that can be attenuated by OVX, suggesting that circulating E2 may enhance the pleasurable effects of ethanol in females69. In the present study, I used the CPP test to measure the effects of E2 and two estrogen receptor-selective agonists on ethanol CPP in OVX C57BL/6J mice. My results suggest that E2 increases ethanol reward in OVX mice through activation of both classical estrogen receptors, ERα and ERβ.

The finding that ER activation enhances the rewarding properties of ethanol (EtOH) in

OVX females could potentially be explained by estrogen-mediated differences in EtOH metabolism, if such differences exist. Therefore, I administered a single 2 g/kg dose of EtOH to vehicle- and estradiol-treated OVX mice and used an alcohol dehydrogenase (ADH) assay to compare blood EtOH concentrations (BECs) at seven time points post-injection. My results show no effect of E2 on BEC at any of the time points examined, suggesting that E2 effects on EtOH reward are not related to differences in EtOH metabolism. Having ruled out this potential explanation of E2’s effects, I returned my attention to the brain.

One brain region where E2 may act to regulate EtOH reward is the amygdala. The role of the amygdala in AUD is well established287-291. Abnormal protein levels in the amygdala have been identified in animal lines selectively bred for high alcohol consumption, and experimental manipulations of amygdala neurotransmission are able to modulate EtOH consumption in rodents292-297. Furthermore, the amygdala is necessary for EtOH CPP: bilateral amygdala lesions abolish—and unilateral lesions attenuate—the expression of EtOH CPP in DBA/2J mice, whether induced before or after conditioning246. ERα and ERβ are expressed in the amygdala, and these receptors are known to regulate the expression of genes that encode important modulators of amygdalar neurotransmission, such as neuropeptide Y (NPY) and corticotropin- releasing factor (CRF)142, 191, 234, 298-301. Therefore, I used lentiviral-mediated RNA-interference

(RNAi) knockdown to test whether amygdalar ERα and/or ERβ regulate EtOH CPP in gonadally intact female mice.

2.2. Material and Methods

2.2.1. Experimental Animals

Experimentally naïve, 8- to 10-week-old female C57BL/6J mice (Jackson Laboratory,

Bar Harbor, ME) were subjected to bilateral ovariectomy (OVX) or stereotaxic injection of lentivirus under anesthesia as described below. All mice were group housed with same-sex cage mates in a temperature- and humidity-controlled environment under a 12-hour light/dark cycle with lights on at 6 am and off at 6 pm. Behavioral testing was conducted during the light phase.

All mice had access to food and water ad libitum for the duration of the study and were maintained and cared for in accordance with the National Institutes of Health Guide for the Care

42 and Use of Laboratory Animals. All experimental procedures were approved by the University of

Illinois at Chicago (UIC) Institutional Animal Care and Use Committee.

2.2.2. OVX

Each mouse was anesthetized with an intraperitoneal (IP) injection of ketamine (100 mg/kg) and xylazine (8 mg/kg). Hair was shaved from the mouse’s back, and small incisions were made through the skin and underlying muscle tissue to expose the ovary. The uterine horn was pulled out of the abdominal cavity, and the ovary was dissected away from the uterine horn using cauterization. The uterine horn was then placed back into the abdominal cavity, and the incisions were closed with sterile sutures (for the muscle tissue) and wound clips (for the skin).

The same procedure was repeated on the opposite side of the spine to remove the second ovary.

Mice received a subcutaneous (SC) injection of meloxicam (2 mg/kg) immediately after surgery and 24 hours later. To confirm cessation of the estrous cycle, vaginal smears were taken daily from mice for 4-5 days and analyzed for cell content using bright field microscopy. Cessation was confirmed when cell content resembled diestrus (predominantly leukocytes) for several consecutive days. Mice were allowed to recover for 12-15 days prior to behavioral testing.

2.2.3. Drug Treatments

17β-Estradiol-3-benzoate (EB) was purchased from Sigma Aldrich (St. Louis, MO, USA) and prepared in sesame oil vehicle (VEH) to a final concentration of 4 ng/μl. 50 μl was injected

SC at a dose of 0.2 μg (~10 μg/kg). Previous studies in the Lasek lab found that this dose of EB results in serum E2 levels four hours after injection that are comparable to levels in mice in proestrus, when E2 levels peak 268, 273. To determine the effects of EB on EtOH CPP, OVX mice

43 were treated once daily, beginning on the fourth day after surgery and continuing through preference test day. EB was administered 4 hours before each conditioning session. Two selective estrogen receptor agonists were used in this study: the ERα agonist 4,4',4''-(4-Propyl-

[1H]-pyrazole-1,3,5-triyl)trisphenol (PPT) and the ERβ agonist diarylpropionitrile (DPN)

(Tocris, Minneapolis, MN, USA). PPT has a 410-fold higher affinity for ERα versus ERβ and

DPN has a 70-fold higher affinity for ERβ versus ER178, 179. PPT and DPN were prepared in sesame oil with 10% EtOH vehicle (VEH) to a final concentration of 0.5 mg/ml. 50 μl was injected SC for a dose of ~1 mg/kg PPT or DPN (with the final EtOH dose less than 0.2 g/kg).

This dose of EtOH does not induce CPP in mice302. VEH, PPT, and DPN were administered once daily, one hour prior to each conditioning session. When animals were given both PPT and

DPN, the compounds were administered as two separate injections, and controls were given two injections of VEH to account for handling effects. The timing of PPT and DPN injections was performed so that peak plasma levels of these compounds would be achieved during conditioning sessions in the CPP procedure; both are expected to achieve highly selective receptor occupancy at a dose of 1 mg/kg303. EtOH solutions were prepared with 95% ethyl alcohol stock (Decon Laboratories, King of Prussia, PA, USA) diluted to 20% v/v in 0.9% sterile saline. EtOH was administered IP at a dose of 2.0 g/kg, a moderate dose that is optimal for

CPP302.

2.2.4. Behavioral Procedure

CPP training and testing were conducted using a modified 48-channel infrared photobeam detector open field apparatus (27.3 cm L x 27.3 cm W x 20.3 cm H) and Activity

Monitor software (Med Associates, St. Albans, VT, USA) for automated data collection. Two

44 texturally distinct floor inserts and clear acrylic vertical dividing panels were custom cut by the

UIC Scientific Instrument Shop to create a two-chamber choice apparatus. The two floor panels consisted of clear acrylic fluorescent light diffuser panels in the “prismatic” and “grid” textures.

Each open field chamber was contained within a compressed wooden cabinet to reduce interference from outside light or sound during training and behavioral trials. All experiments were conducted with the apparatus lights and fans off282. The timeline and design of each CPP experiment are illustrated in Figures 3-5. For the EB experiment (VEH vs. EB), we treated 18 mice with VEH and 18 with EB. For the first selective agonist experiment (VEH vs. PPT vs.

DPN), we treated 27 mice with VEH, 32 mice with PPT, and 31 mice with DPN. For the second selective agonist experiment (VEH vs. PPT + DPN), we treated 16 mice with VEH and 16 mice with both PPT and DPN.

On the first day of the procedure (Test 1), mice were placed into separate CPP boxes and allowed 30 minutes of unrestricted access to both sides. Each mouse was then assigned to the initially non-preferred side of the apparatus for EtOH conditioning. Over the next ten days, each mouse was given an injection of EtOH (2 g/kg, IP, given on days 2, 4, 8, and 10) or an equivalent volume of saline (days 3, 5, 9, and 11) immediately before confining it to the appropriate side of the apparatus. After each 5-minute conditioning session, the mouse was promptly removed from the apparatus and returned to its home cage. On the day of the preference test (Test 2), each mouse was allowed to freely explore both chambers of the apparatus for 30 minutes (identical to Test 1). The entire CPP procedure was conducted over a period of 12 days, with a 2-day rest period between days 5 and 8. The procedure for the saline control experiment (n = 14/group; Figure 4) was identical to the one described above, except that no EtOH was administered; both sides of the apparatus were paired with saline injections.

2.2.5. Ethanol Metabolism

Each mouse was given a single SC injection daily of either EB (n = 5) or VEH (n = 5) at

8:00 am for three consecutive days, so that each animal received a total of three treatments. On the third day, four hours after the final EB or VEH treatment, mice received 2.0 g/kg EtOH by IP injection. Five minutes after EtOH injection, the tail was snipped with sterile scissors, and approximately 20 μl of blood was collected from the tail using heparinized capillary tubes. Blood was transferred to 1.5 ml Eppendorf tubes. The time of EtOH injection was staggered so that blood could be collected from all 10 animals at exactly 5, 30, 60, 90, 120, 150, and 180 minutes post-injection. Blood samples were immediately placed on ice and then transferred to a -80°C freezer for storage. Mice were euthanized at the end of the three-hour blood collection procedure.

BECs were determined using a nicotinamide adenine dinucleotide-alcohol dehydrogenase enzymatic assay304.

2.2.6. Lentiviral Construct

Lentivirus expressing short hairpin RNAs (shRNAs) targeting Esr1 (shEsr1-1785,

GGCATGGAGCATCTCTACA), Esr2 (shEsr2-1089, GTACGAAGACAGAGAAGTG), or a non-specific sequence not known to target any gene in the mouse genome (shScr) were produced in the pLL3.7 vector as previously described305. The Esr1-targeting sequence was derived from and used previously by Musatov et al306. Knockdown efficiency was determined in vitro by infection of Neuro2A cells. Compared with the shScr construct, the shEsr1 construct reduced expression of Esr1 by ~70%, and the shEsr2 construct reduced expression of Esr2 by ~95%

(Donghong He, data not shown). The pLL3.7 vector includes a cytomegalovirus (CMV)- enhanced green fluorescent protein (EGFP) reporter cassette for infection site verification.

2.2.7. Stereotaxic Injection of Virus into the CeA

Gonadally intact 8-10 week old female C57BL/6J mice (n = 64) were anesthetized with ketamine (100 mg/kg, IP) and xylazine (8 mg/kg, IP) and placed in a digital stereotaxic alignment apparatus (Model 1900, David Kopf Instruments, Tujunga, CA, USA). After bregma alignment and skull leveling, 0.28 mm diameter holes were drilled bilaterally (A/P: -0.85, M/L:

±3.0) for lentivirus microinjection. A dual-cannula insertion system (33 gauge) and microinfusion pump (Pico Plus Elite Pump 11, Harvard Apparatus, Holliston, MA, USA) were then used to deliver virus to the central nucleus of the amygdala (D/V: -4.9). Virus was infused bilaterally over a period of 5 minutes, at a rate of 0.2 μL/min, to achieve a total infusion volume of 1.0 μL per hemisphere of the brain. Cannulae were left in place for 5 min following infusion to allow the virus to diffuse away from the injection site and reduce backflow along the cannula tracts. Mice received a single treatment of meloxicam (2 mg/kg, SC) post-surgery for pain management and were monitored for two weeks following the procedure. For a more detailed description of surgical methods, see Lasek et al307. After surgery, animals were maintained for at least 7 days in the biosafety level 2 (BSL2) room where the surgery was performed, as required by biosafety procedure protocols. They were then returned to standard housing and allowed an additional 2 weeks for recovery and for sufficient RNAi knockdown of protein to be achieved before the start of behavioral testing. In all cases, the place preference conditioning procedure began 3-4 weeks after surgery. One animal did not survive the surgery.

2.2.8. Histology

In order to verify that lentiviral infection was correctly targeted to the CeA, all mice were transcardially perfused, first with ice-cold phosphate buffered saline (PBS) solution and then with 4% paraformaldehyde (PFA) in PBS. Brains were removed and post-fixed overnight

47 at 4°C in 4% PFA before being transferred to 30% sucrose solution in PBS for an additional 48 hours for cryoprotection. Brains were mounted with Tissue-Plus Optimal Cutting Temperature

(OCT; Fisher Scientific, Pittsburg, PA, USA) compound for sectioning on the cryostat (Microm

HM 550, Thermo Fisher Scientific, Kalamazoo, MI, USA), cut to 50 μm, and stored as free- floating sections in PBS until staining.

Sections were treated with 3% H2O2 in PBS for 10 min. Next, they were treated twice with 50% EtOH, each time for 10 min. PBS was used to wash and rehydrate the sections (2-3 times, 5 min each) before 30 min incubation with 10% normal donkey serum (NDS, for blocking). Anti-GFP (mouse IgG2a monoclonal 3E6, Thermo Fisher Scientific #A11120,

Waltham, MA, USA) primary antibody was diluted 1:1,500 in PBS with 0.1% Triton X-100 to enhance membrane permeability. Slices were incubated with primary antibody for 48 hours at

4o C on an automated orbital shaker.

PBS was again used to wash the sections, which were incubated for 10 min in 2% NDS

(in PBS) after washing. Biotin-conjugated horse-anti-mouse secondary antibody (Vector

Laboratories #BA-2000, Burlingame, CA, USA) was diluted 1:250 in PBS. Sections were incubated with secondary antibodies for 2 hours at room temperature on an automated orbital shaker, then washed with PBS. ABC peroxidase solution (Vectastain ABC kit, Vector

Laboratories #PK-6100) was diluted in PBS according to the manufacturer’s instructions, and sections were incubated with this solution for 1 hour. DAB peroxidase substrate (Vector

Laboratories #SK-4100) was then applied for ~1 minute, until brown color was visible to indicate GFP immunostaining. Tap water was immediately used to wash the sections and prevent overstaining. Sections were mounted on gelatin-coated slides and allowed to dry, counterstaining with Nissl stain was performed, and slides were coverslipped with Permount mounting medium.

2.2.9. Statistical Analysis

For CPP experiments, the amount of time animals spent on the EtOH-paired side before and after conditioning (Test 1 and Test 2, in seconds) was analyzed using two-way repeated measures analysis of variance (two-way RM ANOVA). Post-hoc multiple comparisons testing using Sidak’s multiple comparisons test was performed if there was a significant interaction. To compare the magnitude of CPP between treatment groups, the percentage of time that each mouse spent on the EtOH-paired side during Tests 1 and 2 was calculated by dividing the time spent on that side of the apparatus by total test time (1800 seconds) and multiplying by 100.

Percent change in time spent on the EtOH-paired side was calculated by subtracting the value for

Test 1 from the value for Test 2 (Figure 3C and Figure 6C and E). Data were analyzed by student’s t-test or one-way ANOVA, as appropriate. The EtOH metabolism study was analyzed by two-way RM ANOVA. Effect sizes are reported as Cohen’s d for t-tests and η2 for two-way

ANOVA. Error bars represent standard error of the mean (SEM). All data were analyzed using

Prism software version 6 (GraphPad, La Jolla, CA). A p value of less than 0.05 was accepted as statistically significant.

2.3. Results

2.3.1. E2 enhances ethanol CPP in OVX mice.

To determine whether E2 regulates ethanol reward in female mice, I treated OVX mice with either EB or VEH and tested them for EtOH CPP. Figure 3A illustrates the CPP procedure.

Overall, mice developed preference for the EtOH-paired side, as indicated by more time spent on

2 the EtOH-paired side after conditioning (Figure 3B, time: F1, 34 = 55.84, p < 0.0001, η = 0.62). I

2 also observed a significant time-by-treatment interaction (interaction: F1, 34 = 4.56, p = 0.04, η =

0.12). Post-hoc Sidak’s multiple comparisons test showed that there was a trend toward more time on the EtOH-paired side in EB-treated mice after conditioning (p = 0.086) relative to VEH- treated mice, whereas there was no difference between EB- and VEH-treated mice pre- conditioning (p = 0.84). When analyzed as the percent change in preference, VEH-treated mice spent 11% and EB-treated mice spent 20% more time on the EtOH-paired side after conditioning, a difference that was statistically significant (Figure 3C, t = 2.13, df = 34, p = 0.04,

Cohen’s d = 0.71). These results demonstrate that E2 enhances EtOH reward in OVX mice.

2.3.2. E2 does not alter preference for the initially non-preferred side of the CPP apparatus in the absence of ethanol conditioning.

Because my CPP protocol uses a biased group assignment method (assignment to the initially non-preferred side for EtOH conditioning), I next performed a control experiment to determine if EB itself causes a shift in preference for the non-preferred side of the apparatus, relative to VEH, in the absence of EtOH conditioning. This was done because E2 has been shown to be rewarding in a CPP procedure308. EB- and VEH-treated mice were subjected to saline conditioning, during which both sides of the apparatus were paired with saline injections

(Figure 4A). There was a significant main effect of time (Figure 4B, time: F1, 26 = 11.76, p =

0.0020), indicating that the preference of both the VEH- and EB-treated groups shifted slightly toward the initially non-preferred side (reference side). However, there was no main effect of EB treatment and no time-by-treatment interaction. There was also no difference in the % change in time spent on the reference side between VEH- and EB-treated mice (Figure 4C, t = 0.23, df =

26, p = 0.74). In addition, preference scores were much lower in saline-conditioned mice compared with those conditioned with EtOH (compare preference scores in Fig. 1C to Fig. 1F).

These results indicate that, although mice do shift their preference towards the initially non- preferred side of the conditioning chamber in the absence of drug conditioning, daily E2 treatments prior to conditioning sessions do not significantly affect this shift.

2.3.3. E2 does not alter the rate of ethanol metabolism in OVX mice.

I next tested if E2 can alter the rate of EtOH metabolism, since this might explain the enhancement of EtOH CPP by EB. VEH- and EB-treated mice were injected with 2 g/kg EtOH

(the same dose used in the CPP experiments), and blood samples were obtained 5 min to 3 hours after EtOH injection. EB treatment had no effect on the rate of EtOH metabolism in OVX mice compared with VEH-treated mice (Figure 5, time: F6,48 = 107.4, p < 0.0001; treatment: F1, 8 =

1.85, p = 0.21). These results demonstrate that the effect of EB on EtOH reward is likely not due to a change in EtOH metabolism.

2.3.4. Activation of ERα or ERβ individually is not sufficient to enhance ethanol CPP in OVX mice.

E2 binds to two classical estrogen receptors, ERα and ERβ. To determine if ERα or ERβ might be responsible for the ability of E2 to enhance EtOH reward, I performed another EtOH

CPP experiment by treating OVX mice with PPT (an ERα-selective agonist) or DPN (an ERβ- selective agonist, Figure 6A). I observed a significant main effect of time (Figure 6B, time: F1, 87

= 91.47, p < 0.0001, η2 = 0.51), indicating that mice developed preference for the EtOH-paired side. There were no significant main effects of PPT or DPN treatment and no time-by-treatment interactions. Moreover, there were no differences in the percent change in preference between

51 the three groups (Figure 6C). These results indicate that selective activation of either ERα or

ERβ is not sufficient to enhance EtOH CPP.

2.3.5. Activation of both ERα and ERβ enhances ethanol CPP in OVX mice.

I next reasoned that activation of both receptors might be necessary to increase EtOH

CPP. To test this, we treated OVX mice with both PPT and DPN and tested them for EtOH CPP

(Figure 6). There was a significant main effect of time (Figure 6D, time: F1, 30 = 50.73, p <

2 0.0001, η = 0.63) and a significant time-by-treatment interaction (interaction: F1, 30 = 5.55, p =

0.025, η2 = 0.16). Post-hoc Sidak’s multiple comparisons tests demonstrated that mice treated concurrently with PPT and DPN exhibited a trend towards more time on the EtOH-paired side after conditioning compared with VEH-treated mice (p = 0.061), whereas no difference was observed before conditioning (p = 0.87). Consistent with this observation, the percent change in preference was 17% in PPT- and DPN-treated mice and only 9% in VEH-treated mice (Figure

6E, t = 2.36, df = 30, p = 0.025, Cohen’s d = 0.83). These results demonstrate that activation of both ERα and ERβ is needed to enhance EtOH reward.

2.3.6. Lentiviral infection may induce damage in the CeA.

In order to determine whether amygdalar ERα and/or ERβ regulate EtOH CPP in gonadally intact female mice, I used lentiviral-mediated RNAi to knockdown expression of either Esr1 or Esr2 in the CeA before subjecting animals to the place conditioning procedure.

Figure 7A illustrates the CPP procedure. Unfortunately, an unusually large number of animals used in this experiment showed no sign of viral infection (GFP immunoreactivity) after histology. This was most likely due to the virus having been thawed and re-frozen too many

52 times before use, as repeated cycles of freezing/thawing can significantly degrade virus quality.

However, there was a positive side to this issue, as it provided a substantial number of “sham” operated animals (i.e. animals that underwent surgery and lentiviral infusion without developing infection in the target area). This proved valuable when analyzing the behavioral data (Figure 7).

Remarkably, when animals were grouped by infection status (presence vs. absence of GFP immunoreactivity indicative of viral infection), those with strong GFP immunoreactivity in the

CeA (GFP-IR+, Figure 7B), including the shScr control group, did not exhibit a change in preference greater than what I observed in the saline control experiment (~5%; see Figure 4 for reference), suggesting that these animals failed to develop EtOH-induced CPP. On the other hand, animals in which GFP immunoreactivity was absent (GFP-IR-, Figure 7C) exhibited a change in preference (10-13%) comparable to that observed in freely cycling females in other experiments (data not shown) and in OVX mice in Figures 3 and 6. The animal numbers for the various treatment groups among GFP-IR+ mice are as follows: shScr: n = 16, shEsr1: n = 8, shEsr2: n = 11. The animal numbers for GFP-IR- mice are: shScr: n = 4, shEsr1: n = 13, shEsr2: n = 11. Perhaps due to the relatively small sizes of most treatment groups and/or to the substantial difference in n values, the difference in % change in time spent on the EtOH-paired side between GFP-IR+ and GFP-IR- mice was not statistically significant. Overall, the results of this experiment are inconclusive. However, it is worth noting that others have reported neurotoxicity and deficits in amygdala function following viral vector-mediated transduction of shRNA in the amygdala309. As amygdala damage is known to abolish EtOH CPP in male mice246, the possibility of amygdala damage in this experiment is a plausible explanation of my results (though further experimentation would be necessary to confirm this hypothesis). This is a possibility that researchers should consider when designing similar experiments.

Figure 3. 17β-Estradiol-3-benzoate (EB) enhances ethanol conditioned place preference (CPP) in ovariectomized (OVX) C57BL/6J mice. Mice were OVX bilaterally and allowed to recover for 12-15 days before the start of behavioral procedures. (A) Timeline and design of the EtOH CPP experiment. (B) Graph shows time spent on the EtOH-paired side (in seconds) before conditioning (Test 1) and after conditioning (Test 2) in VEH- and EB-treated mice (n = 18 per group). Two-way repeated measures ANOVA revealed a significant main effect of time (****p < 0.0001) and a significant time-by-treatment interaction (#p < 0.086, by post hoc Sidak’s tests comparing EB- to VEH-treated within Test 2). (C) Graph shows percent change in preference for the EtOH-paired side in VEH- and EB-treated mice. Student’s t-test revealed a significant increase in preference for the EtOH-paired compartment in EB-treated mice (*p < 0.05). Data are presented as means ± SEM.

Figure 4. EB does not alter preference for the initially non-preferred side of the CPP chamber in the absence of ethanol conditioning. (A) Timeline of the saline control experiment. (B) Graph shows time spent on the initially non-preferred side (reference side), in seconds. Two-way ANOVA revealed a significant main effect of time (**p < 0.01, n = 14 per group). (C) Graph shows percent change in preference for the reference side. Student’s t-test found no significant difference in preference score between VEH- and EB-treated mice (p = 0.74). Data are presented as means +/- SEM.

Figure 5. EB does not alter the rate of ethanol metabolism in OVX C57BL/6J mice. OVX mice were treated with either VEH or EB (n = 5 per group). Four hours later, 2.0 g/kg EtOH was administered by IP injection. Blood was collected at seven time points post-injection. Graph shows blood EtOH concentration (BEC) in milligrams per 100 milliliters (mg%) over 180 minutes. Two-way ANOVA found no difference in BEC between VEH- and EB-treated animals at any of the seven time points measured. Data are presented as means ± SEM.

Figure 6. Neither PPT (ERα agonist) nor DPN (ERβ agonist) treatment alone is sufficient to enhance EtOH CPP, but combined treatment with both agonists enhances EtOH CPP. Mice were OVX bilaterally and allowed to recover for 12-15 days before the start of behavioral procedures. (A) Timeline and design of the CPP experiments. (B) Graph showing the time spent on the EtOH-paired side (in seconds) before conditioning (Test 1) and after conditioning (Test 2) of vehicle (VEH)-, 4,4',4''-(4- Propyl-[1H]-pyrazole-1,3,5- triyl)trisphenol (PPT)-, and diarylpropionitrile (DPN)- treated mice (n = 27-32 per group). Two-way repeated measures ANOVA revealed a significant main effect of time (****p < 0.0001). (C) Percent change in preference for the EtOH-paired side in VEH-, PPT-, and DPN- treated mice. A one-way ANOVA found no significant difference between treatment groups. (D) Graph shows time spent on the EtOH-paired side before and after conditioning by mice treated with either VEH or a combined treatment of PPT plus DPN (n = 16 per group). Two-way repeated measures ANOVA revealed a significant main effect of time (****p < 0.0001) and a significant time-by-treatment interaction (#p < 0.061, post-hoc Sidak’s test comparing VEH- to PPT+DPN-treated within Test 2). (E) Percent change in preference for the EtOH-paired side in mice treated with either VEH or a combined treatment of PPT plus DPN. Student’s t-test revealed a significant increase in preference for the EtOH-paired compartment in mice treated with PPT plus DPN vs. VEH (*p < 0.05). Data are presented as means ± SEM.

Figure 7. Lentiviral infection may induce damage in the central nucleus of the amygdala (CeA). Gonadally intact female mice were infused bilaterally into the CeA with lentivirus expressing shRNAs targeting either Esr1 (shEsr1), Esr2 (shEsr2), or a non-specific sequence not known to target any gene in the mouse genome (shScr). Animals were then subjected to the EtOH place preference conditioning procedure. In all cases, the conditioning procedure began 3-4 weeks after surgery. (A) Timeline and design of the CPP experiment. (B) Graph showing % change in time spent on the EtOH-paired side (in seconds) before conditioning (Test 1) and after conditioning (Test 2) of mice with GFP immunoreactivity (GFP-IR+) indicating lentiviral infection in the CeA. (C) Graph showing % change in time spent on the EtOH-paired side (in seconds) before conditioning (Test 1) and after conditioning (Test 2) of mice without GFP immunoreactivity (GFP-IR-) in the CeA. Animal numbers for the GFP-IR+ group are as follows: shScr: n = 16, shEsr1: n = 8, shEsr2: n = 11. Animal numbers for the GFP-IR- group: shScr: n = 4, shEsr1: n = 13, shEsr2: n = 11.

2.4. Discussion

The main conclusion from this study is that E2 enhances ethanol CPP in OVX mice, likely through activation of both ERα and ERβ. To my knowledge, this is the first study to directly demonstrate an effect of E2 on a behavioral test of EtOH reward in rodents. My findings complement previous research by Torres et al., who reported that gonadally intact female rats develop stronger preference for an EtOH-paired compartment than either males or OVX females at a dose of 1 g/kg EtOH69. In that study, only intact females developed EtOH CPP, suggesting that ovarian steroids are necessary for the acquisition and/or expression of EtOH CPP in female rats. In contrast, we found that OVX C57BL/6J mice develop EtOH CPP despite the absence of ovarian hormones. This could be due to a difference in species or the dose of EtOH used. Our results suggest that ovarian hormones are not required for the development of—but instead appear to enhance—EtOH CPP in mice. Since I found no effect of E2 on EtOH metabolism, I conclude that E2 enhances EtOH reward through a neural mechanism.

E2 was previously demonstrated to increase EtOH consumption by female rats and mice111, 116, 284, 286, 310-312, although E2 administration has also been shown to decrease EtOH intake82, 115, 313, 314. These contradictory results may be due to differences in the timing or doses of E2 used and/or to differences in the strain of mouse or rat tested. The Lasek lab recently reported that E2 administration to OVX C57BL6/J mice increases EtOH consumption in the DID procedure, which is a measure of binge-like EtOH consumption315. In general, it appears that E2 plays a modulatory role in EtOH consumption in female rodents, with most studies finding that

E2 increases EtOH consumption. The results presented here indicate that E2 also enhances the rewarding properties of EtOH in the CPP test.

The ability of E2 to increase EtOH reward may contribute to higher levels of EtOH intake by female rodents. Although both male and female rodents will drink EtOH solutions, females tend to consume more EtOH proportional to body weight and obtain higher blood EtOH concentrations (BECs) than males in a number of different EtOH consumption tests51-53, 316, 317.

Many of the studies that have examined this sex difference suggest that it is due to the presence of ovarian steroids in females. For example, Lancaster et al. have demonstrated that voluntary

EtOH intake in gonadally-intact female rats increases after puberty80. Further evidence comes from the four core genotypes (FCG) mouse model, which dissociates gonadal phenotype (ovaries or testes) from sex chromosome complement (XX or XY) by moving the sex-determining region

(Sry) of the Y chromosome to an autosomal chromosome96, 119. In the FCG model, the presence of female-typical gonads predicts alcohol drinking, with gonadal females drinking more than gonadal males, regardless of sex chromosome complement121. Studies have also reported decreased EtOH consumption in OVX rats and mice compared to naturally cycling controls111,

113, although this observation is not consistent throughout the literature82, 114.

Previous work has demonstrated that E2 also facilitates the development of CPP for other drugs of abuse. For example, others have reported heightened methamphetamine and morphine

CPP in OVX mice that were treated with E2318, 319 and increased amphetamine and cocaine CPP in E2-treated OVX rats320, 321. Silverman and Koenig also investigated effects of the selective estrogen receptor agonists PPT and DPN on amphetamine CPP. While activation of ERα by PPT had no effect, DPN treatment increased amphetamine CPP to the same degree as E2, suggesting that estrogenic enhancement of amphetamine reward is mediated by ERβ. The Lasek lab discovered similar effects on cocaine reward in OVX mice: both E2 and DPN facilitate the development of cocaine CPP, but the behavior of PPT-treated animals is not significantly

60 different from controls322. This is interesting in light of the findings I report here: that treatment with PPT or DPN alone was not sufficient to enhance EtOH CPP but activation of both ERα and

ERβ was needed to increase EtOH CPP. Taken together, these studies indicate that, although E2 can increase the rewarding properties of multiple drugs of abuse, EtOH and psychostimulant reward are likely modulated by differing E2-regulated molecular mechansims in females.

To my knowledge, I am the first to report an effect of E2 on addiction-related behavior mediated by both ERα and ERβ. This novel finding is particularly intriguing in the larger context of estrogen-regulated behaviors. In cases when both of the classical estrogen receptors have been shown to regulate a given behavior or class of behaviors—for instance, when measuring effects of PPT and DPN on anxiety-like behavior—the actions of ERα and ERβ have generally been found to oppose one another323. This is often true with regard to the molecular actions of estrogen receptors as well176, 324. Nonetheless, ERα and ERβ are also known to form functional hetero-dimers, both as regulators of gene expression and when signaling from the cell membrane194. It is possible that ERα and ERβ heterodimer formation is involved in the regulation of EtOH CPP in females, or that, alternatively, activation of each of these receptors in different brain regions, cells, and/or promoter regions is necessary to increase EtOH CPP. One caveat to the conclusion that activation of both receptors by the combination of PPT and DPN mimics the effect of E2 is that the timing of the EB treatments was different from the timing of

PPT and DPN treatments. Treatment with EB was initiated a few days after OVX and continued throughout conditioning and test days, whereas I only treated with the combination of PPT and

DPN on conditioning days. These differences in exposure history could affect perceived EtOH reward. Optimally, it would be good to know if treatment with EB only on conditioning days has the same effect as the longer treatment with EB and whether a longer treatment with each agonist

61 alone might mimic the effect of E2. However, it does appear that the activation of both ERα and

ERβ is needed to enhance EtOH CPP when the agonists are administered only on conditioning days.

It is also important to note that I only used one dose of PPT and DPN in these studies. I chose this dose because I wanted to achieve a balance between high receptor occupancy and selectivity. It is possible that increasing the doses of these agonists might reveal that activation of either ERα or ERβ is sufficient to enhance EtOH CPP. However, these agonists lose their selectivity at higher doses, making it difficult to discern if the effects of the agonists are due to high activation of the target receptor or non-selective activation of the other estrogen receptor. It will be useful in future studies to use more specific genetic manipulations of ERα and ERβ in gonadally intact females to determine the contribution of these receptors to EtOH reward under more natural physiological conditions.

Sex differences exist at all phases of the addiction cycle: binge/intoxication, withdrawal/negative affect, and preoccupation/anticipation (i.e. craving)325. From a treatment standpoint, understanding the ways in which sex hormones modulate the brain’s response to drugs of abuse is undeniably valuable. The present study adds important new information to our understanding of how ovarian steroids and estrogen receptors specifically may act to regulate

EtOH reward, which may contribute to high levels of binge drinking, in females. In particular, the findings that E2 enhances EtOH reward and that ERα and ERβ are likely both involved in this process poses an interesting contrast to what we know about the role of estrogen receptors in other types of drug reward (i.e. cocaine and other psychomotor stimulants). In future studies, this information will help us discover more about sex differences in general and about the

62 mechanisms by which different drugs of abuse can increase the vulnerability of females to become addicted to these substances.

2.5. Acknowledgements

Donghong He produced the lentivirus used in the experiments described above and quantified in vitro knockdown efficiency in Neuro2A cells. Amy Lasek assisted in EtOH administration and blood collection for the ethanol metabolism experiment.

CHAPTER THREE: VTA ESTROGEN RECEPTORS REGULATE BINGE-LIKE DRINKING BEHAVIOR IN GONADALLY INTACT FEMALE C57BL/6J MICE

3.1. Introduction

Binge drinking, defined as the consumption of a quantity of ethanol that generates blood ethanol concentrations (BECs) of 80 mg/dl or greater (usually ≥5 standard drinks for a man or ≥4 for a woman)35, has been identified as an early risk factor for alcohol dependence and may account for more than half of alcohol-attributable deaths in the United States299, 326-328. The prevalence of binge drinking is estimated at 15.0% among non-pregnant women and 1.4% among pregnant women329. Although higher ratings of mental and physical wellbeing (“feeling good”) have been reported by women after consuming ethanol, female binge drinkers report more mentally unhealthy days (dealing with stress, depression, and emotional problems) than their male counterparts at both low (≥4 drinks) and high (≥7 drinks) intensities of binge drinking36. Additionally, research on antenatal alcohol use suggests that women who engage in heavy and/or binge drinking behavior prior to conception are significantly more likely to drink during pregnancy, resulting in an increased risk of Fetal Alcohol Syndrome (FAS) and other

Fetal Alcohol Spectrum Disorders (FASD)329-331.

Mice will engage in binge-like drinking behavior in a procedure known as drinking in the dark (DID). This procedure allows researchers to study ethanol (EtOH) consumption under conditions in which non-dependent mice voluntarily attain intoxicating BECs within a 2-4 hour time window91, 92. As described in Chapter One, ovarian hormones are known to regulate EtOH consumption in various experimental measures of drinking behavior, including DID. The Lasek lab previously demonstrated that estradiol benzoate (EB) increases binge-like drinking behavior in OVX mice117. However, it is not known which (if either) of the classical estrogen receptors,

ERα and ERβ, mediates this effect. Therefore, I tested the effects of two ER subtype-selective agonists, PPT and DPN, on binge-like EtOH consumption in OVX mice.

To my surprise, systemic treatment of OVX mice with the ERα-selective agonist PPT suppressed consumption not only of EtOH but also of 2% sucrose solution. Since others have reported that PPT dose-dependently decreases food intake in OVX rats without inducing conditioned taste aversion332 (suggesting that PPT does not induce gastric distress), I speculate that systemic PPT treatment decreases EtOH and sucrose consumption by decreasing appetite, perhaps via actions in the hypothalamus. Regardless of the mechanism mediating PPT’s effect on fluid intake in this experiment, it was clear that systemic treatment with ER-selective agonists was not an effective way to test for a potential role of ERα and ERβ as regulators of EtOH consumption specifically. As described in Chapter One, section 6.2, the role of the VTA as a regulator of binge-like drinking behavior is well established. ERα and ERβ are both expressed in the VTA, and numerous mechanisms exist by which these receptors could influence the VTA’s response to EtOH. Therefore, I used lentivirus-mediated RNAi to knockdown expression of Esr1 or Esr2 in the VTA of gonadally intact female C57BL/6J mice before subjecting them to the DID test. Since systemic ERα activation affected not only EtOH intake but also sucrose intake, I performed a similar RNAi knockdown DID experiment in a separate group of intact female mice using 2% sucrose instead of EtOH. For comparison, I also performed RNAi knockdown of Esr1 or Esr2 in the VTA of intact male mice. My results show that intra-VTA knockdown of Esr1 or

Esr2 significantly reduces binge-like EtOH consumption in gonadally intact female mice without affecting sucrose intake. Furthermore, there was no effect of ER knockdown in males, demonstrating that this is a sex-specific mechanism for the regulation of EtOH drinking behavior. My results emphasize the importance of studying sex differences in animal models of

65 addiction and further implicate ovarian steroids and brain-expressed estrogen receptors in the pathogenesis of AUD in females.

3.2. Material and Methods

3.2.1. Experimental Animals

Experimentally naïve female and male C57BL/6J mice were purchased from The Jackson

Laboratory (Bar Harbor, ME) at 8 weeks of age. Animals were group housed with same-sex cage mates in a temperature- and humidity-controlled environment under a 12-hour light/dark cycle

(lights on at 6 AM and off at 6 PM) until the time of surgery (OVX or craniotomy), after which they were transferred to single housing for recovery and behavioral testing. Animals were 8-10 weeks of age at the time of surgery. All mice had access to food ad libitum for the duration of the study and were maintained and cared for in accordance with the National Institutes of Health

Guide for the Care and Use of Laboratory Animals. Water was also provided ad libitum, except during behavioral testing (the details of which are described below), when water was replaced by either EtOH or 2% sucrose solution. All experimental procedures were approved by the

University of Illinois at Chicago (UIC) Institutional Animal Care and Use Committee.

3.2.2. OVX

One group of female mice (n = 32), 8 to 10 weeks of age, underwent OVX and subsequent monitoring for estrous cycle cessation as described in Chapter Two, section 2.2.

After surgery, animals were transferred to a reversed light/dark cycle room (lights on at 10 PM and off at 10 AM) and allowed two weeks for surgical recovery and acclimation to the change in light/dark cycle before the start of behavioral testing.

3.2.3. Drug Treatments

Two selective estrogen receptor agonists were used in this study (in OVX animals only): the ERα agonist 4,4',4''-(4-Propyl-[1H]-pyrazole-1,3,5-triyl)trisphenol (PPT) and the ERβ agonist diarylpropionitrile (DPN). PPT and DPN were prepared in sesame oil with 10% EtOH vehicle (VEH) to a final concentration of 0.5 mg/ml. 50 μl of this solution was injected SC for a dose of ~1 mg/kg PPT or DPN (with the final EtOH dose less than 0.2 g/kg). VEH, PPT, and

DPN were administered once daily during the DID procedure, one hour prior to each drinking session, beginning on day 0 (water consumption test; see section 2.6 of this chapter for DID procedure details). EtOH solution was prepared with 95% ethyl alcohol stock (Decon

Laboratories, King of Prussia, PA, USA) diluted to 20% v/v in the animals’ standard drinking water.

3.2.4. Lentiviral Construct

See Chapter Two, section 2.6 for details of the lentiviral constructs. The pLL3.7 vector used in lentiviral production includes a cytomegalovirus (CMV)-enhanced green fluorescent protein (EGFP) reporter cassette for infection site verification. As the VTA expresses tyrosine hydroxylase (TH, a biosynthetic enzyme in the dopamine synthesis pathway), co-staining for

GFP and TH was used during post-mortem histological processing to accurately identify and confirm infection in the VTA.

3.2.5. Stereotaxic Injection of Virus into the VTA

See Chapter Two, section 2.7 for details of the stereotaxic injection procedure. Briefly, gonadally intact, 8- to 12-week-old female (n = 64) and male (n = 32) C57BL/6J mice were

67 anesthetized and placed in a digital stereotaxic alignment apparatus. After bregma alignment and skull leveling, 0.28 mm diameter holes were drilled bilaterally (A/P: -3.2, M/L: ±0.5) for lentivirus microinjection. To improve injection site accuracy, the A/P coordinate was adjusted for each individual animal based on the ratio of measured distance between bregma and lambda over the standard distance of -4.2 (e.g. -4.0/-4.2 = 0.95; 0.95 x -3.2 = -3.04). Lentivirus was delivered to the VTA (D/V: -4.7) as previously described. After surgery, animals were maintained on a normal 12-hour light/dark cycle (lights on at 6 AM and off at 6 PM) for at least

7 days in the biosafety level 2 (BSL2) room where the surgery was performed, as required by biosafety procedure. All animals, individually housed, were then transferred to a reversed light/dark cycle room (lights on at 10 PM and off at 10 AM) and allowed at least two additional weeks to acclimate to the change in light/dark cycle. In all cases, behavioral testing began 3.5 to

4 weeks after surgery. Two males and one female did not survive the surgery.

3.2.6. Vaginal Cytology

Because gonadally intact females were used in lentiviral knockdown experiments, these animals’ estrous cycles were monitored during surgical recovery and throughout the behavioral procedure by examining vaginal cytology. Small samples of vaginal epithelial cells were collected from each animal for monitoring as follows. First, a cotton swab was moistened with sterile water and gently inserted into the vaginal opening. Since cervical stimulation can trigger pseudopregnancy in laboratory mice333, the swab was inserted not more than 1 mm into the vaginal opening. The swab was gently rotated inside the vagina, then immediately removed from the vaginal opening and wiped on a clean microscope slide. A sample from each animal was then analyzed by bright field microscopy using an EVOS® FL inverted microscope (Thermo Fisher

Scientific) to examine vaginal cytology. Previous studies have provided helpful instructions and images to guide researchers in identifying estrous cycle phase based on vaginal cytology123, 333,

334. Briefly, proestrus is characterized by a predominance of nucleated squamous epithelial cells, estrus by clumps of cornified (anucleated) epithelial cells, and metestrus by a mixed cytology profile with a combination of leucocytes, nucleated epithelial, and cornified epithelial cells.

Diestrus samples consist predominantly of leukocytes.

3.2.7. Behavioral Procedure

In order to take advantage of the mouse’s innate nocturnal ingestive behavior, the DID procedure is conducted during the dark period of the light/dark cycle. EtOH is presented three hours into the dark cycle, as this ensures that mice have sufficient time to become awake and active before they are given the opportunity to drink. Timing and duration of EtOH presentation, as well as concentration of EtOH given, have been carefully evaluated by previous researchers to determine the most effective methods for inducing high levels of drinking in mice91, 92. The behavioral procedure described below was conducted according to the guidelines established by these studies.

“Sipper tubes” for EtOH presentation were custom made by the UIC Scientific

Instrument Shop using plastic graduated measuring cylinders and metal ball bearing drinking tips with rubber seals and stoppers to prevent fluid leakage. On the day before EtOH presentation

(day 0), three hours into the dark cycle, the animals’ standard water bottles were replaced with sipper tubes full of standard drinking water. Mice were allowed to drink freely for two hours, after which the tubes were collected, water consumption was measured, and sipper tubes were replaced with standard water bottles. This allowed the animals to experience drinking from the

69 sipper tubes before the start of the EtOH consumption test and also provided a measure of water consumption to analyze for any effects of either ER agonist treatment or ER knockdown on water intake. Over the next three days (days 1-3 of the DID procedure), instead of water, mice were given access to 20% EtOH in the same sipper tubes. Mice were allowed to drink freely for two hours, after which the sipper tubes were removed and EtOH consumption was measured. On the final day of the procedure (day 4), mice were given access to EtOH sipper tubes for a total of

4 hours. Consumption was measured at 2 and 4 hours after presentation of the tubes. At the end of this final drinking session, blood samples (20 μl) for BEC analysis were obtained from each animal by lateral tail vein puncture and collected with heparinized capillary tubes. BEC was measured using a nicotinamide adenine dinucleotide-alcohol dehydrogenase (NAD-ADH) enzymatic assay304. To test for effects of ER agonist treatment or ER knockdown on sucrose consumption, instead of EtOH animals were presented with sipper tubes containing a solution of

2% sucrose in water. In all cases (water, EtOH, and sucrose solution), raw consumption data were corrected to control for individual differences in body weight.

3.2.8. Confirmation of Viral Placement and in vivo Knockdown Efficiency

In order to verify that lentiviral infection was correctly targeted to the VTA, all mice from the EtOH DID experiment (30 males and 32 females) were transcardially perfused, first with ice-cold phosphate buffered saline (PBS) solution and then with 4% paraformaldehyde

(PFA) in PBS. Brains were removed and post-fixed overnight at 4°C in 4% PFA before being transferred to 30% sucrose solution in PBS for an additional 48 hours for cryoprotection. Brains were mounted with Tissue-Plus Optimal Cutting Temperature (OCT; Fisher Scientific, Pittsburg,

PA, USA) compound for sectioning on the cryostat (Microm HM 550, Thermo Fisher Scientific,

Kalamazoo, MI, USA), cut to 40 μm, and stored as free-floating sections in PBS until staining

(see procedure below).

Sections were treated with 50% EtOH twice, each time for 10 min. PBS was then used to wash the sections (3 times, 5 min each) before 30 min incubation with 10% normal donkey serum (NDS, for blocking). Anti-GFP (donkey-anti-mouse IgG2a monoclonal 3E6, Thermo

Fisher Scientific #A11120, Waltham, MA, USA) and anti-TH (donkey-anti-rabbit IgG1K monoclonal LNC1, Millipore Sigma #MAB318, Burlington, MA, USA) primary antibodies were diluted 1:1,500 in PBS with 0.1% Triton X-100 to enhance membrane permeability. Slices were incubated with primary antibodies for 48 hours at 4o C on an automated orbital shaker.

PBS was again used to wash the sections, which were incubated for 10 min in 2% NDS

(in PBS) after washing. Alexa Fluor 488-conjugated (donkey-anti-mouse polyclonal IgG,

Jackson ImmunoResearch Laboratories #715-545-150, West Grove, PA) and Alexa Fluor 594- conjugated (donkey-anti-rabbit polyclonal IgG, Jackson ImmunoResearch Laboratories #711-

585-152) secondary antibodies were diluted 1:200 in PBS. Sections were incubated with secondary antibodies for 3 hours at room temperature on an automated orbital shaker, covered with aluminum foil to protect from light. Finally, sections were washed with PBS and mounted on clean microscope slides using Vectashield antifade mounting medium (Vector Laboratories

#H-1200, Burlingame, CA, USA). Clear nail lacquer was used to seal the edges between the slide and the coverslip for storage at 4o C. Slides were imaged using a fluorescence microscope to verify that lentiviral infection was correctly targeted to the VTA.

In order to quantify the knockdown efficiency of the shEsr1 lentiviral vector in vivo, unstained sections from the brains of 10 males used in the EtOH DID experiment—5 from the shScr treatment group (animals #49-53) and 5 from the shEsr1 treatment group (animals #60-64)

—were subjected to the same staining procedure described above, except that a primary antibody against ERα (anti-rabbit polyclonal IgG, Millipore Sigma #06-935) was used (1:10,000 dilution) instead of the TH primary antibody. Sections were then imaged on a confocal microscope, and images were analyzed using Image J software (National Institutes of Health, Bethesda, MD,

USA) to determine CTCF of Alexa Fluor 594-conjugated ERα in GFP-positive cells. To measure integrated density of Alexa Fluor 594 fluorescence in GFP-positive cells, each confocal image was opened in Image J and split to isolate red and green channel images in separate windows.

One at a time, each GFP-positive cell was outlined in the green channel window using the freehand selection tool, and the outline of the selected cell was overlaid onto the corresponding area in the red channel window. Integrated density was then measured in the selected area.

Background fluorescence was measured at three locations in the immediate vicinity of the cell of interest that did not overlap with the cell outline or with any other cells. CTCF was then calculated for each cell using the following formula: CTCF = integrated density – (area of selected cell x mean fluorescence of background readings). A total of 8 cells were analyzed from each treatment group as follows: shScr group: 1 cell each from mice #50, 51, and 52, 2 cells from mouse #53, and 3 cells from mouse #49. The CTCF of the cell from mouse #52 was a statistical outlier and was excluded from further analysis. shEsr1 group: 1 cell each from mice

#60, 61, and 63, 2 cells from mouse #64, and 3 cells from mouse #62. One cell from mouse #62 had a negative CTCF and was excluded from further analysis. Final n = 7 cells per treatment group.

Since EtOH has been shown to affect ERα expression in vitro335-337 (see also Chapter

Four, section 3.1/Figure X), one week was allowed to pass between the final EtOH drinking session and the time of sacrifice. Male brains were used in this experiment because ER

72 expression is known to vary across the estrous cycle in intact females, and this variability could be a confounding factor when assessing knockdown. Furthermore, since no behavioral effect was observed in males, it was important to confirm that the virus was effective in the males studied.

Efficacy of the shEsr2 construct could not be assessed in this manner due to unavailability of a suitably specific ERβ antibody and the low abundance of the Esr2 transcript (see Chapter One, section 6.2 for discussion).

3.2.9. Statistical Analysis

Data from the 2-hour EtOH and sucrose DID sessions (days 1-4) were analyzed using two-way repeated measures (RM) analysis of variance (ANOVA). Tukey’s multiple comparison’s test was used for post-hoc analysis of two-way ANOVA data. 2-hour water consumption (day 0) and 4-hour consumption of EtOH or 2% sucrose solution (day 4) were analyzed using one-way ANOVA, as were BEC data. Dunnett’s multiple comparisons test was used for post-hoc analysis of one-way ANOVA data. Corrected total cell fluorescence (CTCF) and qPCR data were analyzed using Student’s t-test. Error bars represent standard error of the mean (SEM). All data were analyzed using Prism software version 6 (GraphPad, La Jolla, CA,

USA). A p value of less than 0.05 was accepted as statistically significant.

3.3. Results

3.3.1. Systemic treatment with PPT suppresses fluid intake in OVX female mice.

In order to determine whether estradiol increases binge-like EtOH consumption in female mice via actions at ERα and/or ERβ, OVX mice were treated with VEH, PPT, or DPN one hour before each DID session. Analysis of the 2-hour EtOH drinking sessions by two-way ANOVA

revealed a significant effect of agonist treatment (Figure 8A: F2, 29 = 43.82, p < 0.0001). There was no effect of time and no time x treatment interaction. Dunnett's multiple comparisons test revealed that the effect of treatment was driven by the PPT-treated group, with PPT-treated mice consuming significantly less EtOH (p < 0.0001). One-way ANOVA also revealed a significant main effect of agonist treatment on EtOH consumption during the 4-hour drinking session

(Figure 8B: F2, 29 = 110.1, p < 0.0001). This effect of agonist treatment was not specific to EtOH, since one-way ANOVA also revealed a significant main effect of agonist treatment on consumption of water (Figure 8C: F2, 29 = 9.85, p = 0.0005) and 2% sucrose (Figure 8D: F2, 14 =

12.61, p = 0.007) over 2 hours. In all cases, the effect was driven by decreased consumption in the PPT-treated group (4-hr EtOH: p < 0.0001, water: p = 0.0003, sucrose: p = 0.002). DPN- treated animals did not differ from the controls under any of the conditions tested. These results demonstrate that systemic administration of the ER agonist PPT suppresses general fluid consumption in OVX mice, whereas there is no effect of the ER agonist DPN.

3.3.2. VTA ERα and ERβ regulate binge-like EtOH intake in female, but not male, mice.

In order to determine whether ERs exert regulatory effects on binge-like drinking behavior in mice through actions in the VTA, I used RNAi to knockdown expression of Esr1 or

Esr2 in the VTA of gonadally intact female and male C57BL/6J mice before measuring their

EtOH intake in the DID test. At the end of the final, 4-hour drinking session (day 4), blood was collected from each animal to measure BEC by NAD-ADH enzymatic assay. Following histological assessment, 3/32 females and 6/30 males were eliminated from behavioral analyses due to inaccurate or weak viral infection.

Two-way RM ANOVA revealed a significant main effect of shRNA treatment on EtOH intake in females during the 2-hour EtOH DID sessions (Figure 9A: F2,26 = 13.10, p < 0.0001).

There was also a significant effect of time (F3,78 = 6.02, p = 0.001), indicating that mean EtOH intake increased over the course of the DID procedure. There was no time-by-treatment interaction (F6,78 = 0.61, p = 0.72). Post-hoc analysis with Tukey’s multiple comparison’s test found a highly significant 30% reduction in 2-hour EtOH intake in the shEsr1 treatment group

(p < 0.0001) and a more modest, but still significant, 16% reduction in the shEsr2 group’s EtOH intake (p = 0.038). ER knockdown also significantly reduced females’ binge-like drinking behavior in the 4-hour EtOH DID session as measured by one-way ANOVA (Figure 9B: F2, 26 =

6.85, p = 0.0041). Dunnett's multiple comparisons test revealed that the 29% decreased in binge- like drinking observed in shEsr1-treated mice was significant (p = 0.0021). The 17% decreased observed in shEsr2-treated mice trended toward but did not reach statistical significance (p =

0.072) on EtOH intake in the 4-hour final drinking session. One-way ANOVA revealed a significant effect of shRNA treatment on blood EtOH concentration (BEC) in females (data not shown: F2, 25 = 3.53, p = 0.045). Dunnett's multiple comparisons test determined that this effect was driven by a reduction in BEC in the shEsr1 treatment group (p = 0.026). BEC in the shEsr2 group was not significantly different from control (p = 0.46).

Intra-VTA knockdown of ERs had no effect on 2-hour EtOH intake in males (Figure

10A: F2, 21 = 0.89, p = 0.43) as determined by two-way ANOVA. There was no effect of time

(F3, 63 = 1.44, p = 0.24) and no time-by-treatment interaction (F6, 63 = 1.49, p = 0.20). One-way

ANOVA found no effect of ER knockdown on males’ EtOH intake in the 4-hour drinking session (Figure 10B: F2, 22 = 1.34, p = 0.28). There was no effect of shRNA treatment on BEC in males (data not shown: F2, 21 = 0.011, p = 0.99). Additionally, there was no effect of ER

knockdown on water consumption in either females (Figure 9C: F2, 26 = 0.13, p = 0.87) or males

(Figure 10C: F2, 22 = 2.51, p = 0.10) as determined by one-way ANOVA. These results demonstrate that VTA estrogen receptors regulate binge-like EtOH consumption in female, but not male, C57BL/6J mice.

3.3.3. Intra-VTA ER knockdown does not alter sucrose intake in female mice.

Because treatment with the ERα agonist PPT suppressed sucrose consumption in OVX mice, and to determine whether the effects of intra-VTA ER knockdown were specific to EtOH or might extend to other rewarding substances, I subjected two cohorts of intact female mice (n =

16 and 15, respectively) to lentiviral-mediated ER knockdown as previously described. I then subjected those mice to a modified DID procedure in which animals were presented with sipper tubes containing 2% sucrose solution instead of EtOH. Due to an error during tissue processing, I was unable to confirm accuracy of viral placement in the second cohort’s control group (shScr).

The two control groups did not differ statistically in sucrose intake, however, so both cohorts were used in statistical analysis. Two animals were excluded from the shEsr2 treatment group due to absence of GFP fluorescence in the VTA. Final n values are as follows: shScr: n = 11, shEsr1: n = 10, shEsr2: n = 8. Two-way RM ANOVA indicated no effect of shRNA treatment in the 2-hour drinking sessions (Figure 11A: F2, 26 = 0.30, p = 0.74). There was no effect of time

(F3, 78 = 1.34, p = 0.27) and no time-by-treatment interaction (F6, 78 = 0.44, p = 0.85). Analysis of the 4-hour drinking session by one-way ANOVA revealed no effect on sucrose consumption at this time point (Figure 11B: F2, 25 = 0.66, p = 0.52), suggesting that intra-VTA ER knockdown does not alter sucrose consumption in gonadally intact female mice.

3.3.4. Viral vector expressing shEsr1 reduces ERα protein levels in male mouse VTA.

In order to quantify the knockdown efficiency of the shEsr1 lentiviral vector in vivo, the brains of male mice from the EtOH DID experiment (5 from the shScr group and 5 from the shEsr1 group) were collected after transcardial perfusion, sliced, and stained for both GFP and

ERα using fluorescent probe-conjugated antibodies. Sections were then imaged on a confocal microscope, and images were analyzed to determine CTCF of Alexa Fluor 594-conjugated ERα in GFP-positive cells (Figure 12: n = 7 cells per treatment group). The shEsr1 construct reduced

ERα immunofluorescence by 54% (Student’s t-test: p = 0.051).

3.3.5. qPCR analysis was not effective for measuring in vivo knockdown of viral constructs shEsr1-1785and shEsr2-1089 in VTA tissue.

In order to quantify the knockdown efficiency of the shEsr1 and Esr2 lentiviral vectors in vivo, the brains of female mice from the sucrose DID experiment (n = 5 per group) were collected after CO2 anesthesia by rapid decapitation and flash frozen using dry ice. Because ER expression varies across the estrous cycle, cycle phase at the time of sacrifice was determined by examining vaginal mucosa samples using light microscopy, as described in section 2.6 of this chapter. Lentiviral infection of VTA tissue was confirmed using a fluorescent protein flashlight to detect GFP, and tissue punches were collected from GFP-expressing regions for qPCR analysis. Analysis of relative Esr1 mRNA expression failed to detect a difference between the shEsr1 and shScr treatment groups. This may be due to estrous cycle phase-related variability in

ER expression, as analysis of vaginal mucosa samples found that most animals were not in the same cycle phase at the time of sacrifice. Esr2 mRNA levels were outside the range of detection.

For more detail on materials and methods used in tissue collection and analysis, see Appendix A.

Figure 8. Systemic treatment with PPT suppresses consumption of EtOH, sucrose, and water in OVX female mice. Female C57BL/6J mice were OVX bilaterally and allowed to recover for two weeks before being subjected to the DID procedure. Beginning on day 0 (water drinking session), animals were given a single SC injection of VEH (n = 10), PPT (n = 11), or DPN (n = 11) one hour before presentation of sipper tubes. (A) Graph shows EtOH intake in g/kg over 2 hours on each day of the DID procedure. Two-way RM ANOVA revealed a significant main effect of ER agonist treatment on EtOH intake (p < 0.0001). Post-hoc analysis found that this effect was driven by a significant reduction in EtOH intake in the PPT-treated group (****p < 0.0001). (B) Graph shows EtOH intake in g/kg over 4 hours on the final day of the DID procedure. One-way ANOVA also revealed a significant main effect of agonist treatment on EtOH consumption during the final, 4-hour drinking session (p < 0.0001). As in the two-hour sessions, this effect was driven by reduced EtOH consumption in the PPT-treated group (****p < 0.0001). (C) Graph shows consumption of 2% sucrose solution in mL/kg over two hours. PPT significantly reduced sucrose consumption (**p = 0.002). (D) Graph shows water intake in mL/kg over 2 hours. PPT significantly reduced water consumption (***p = 0.0003). DPN-treated animals did not differ from control under any of the conditions tested.

Figure 9. Intra-VTA knockdown of ERα or ERβ reduces binge-like EtOH consumption in female mice. Gonadally intact female C57BL/6J mice were infused bilaterally into the VTA with lentivirus expressing shRNAs targeting Esr1 (shEsr1, n = 10), Esr2 (shEsr2, n = 9), or a non- specific sequence not known to target any gene in the mouse genome (shScr, n = 10). Animals were then subjected to the DID procedure. In all cases, behavioral testing began 3.5 to 4 weeks after surgery. (A) Graph shows EtOH intake in g/kg over 2 hours on each day of the DID procedure. Two-way RM ANOVA revealed a significant main effect of shRNA treatment on EtOH intake (p < 0.0001). Post-hoc analysis with Tukey’s multiple comparison’s test found a highly significant reduction in EtOH intake in the shEsr1 treatment group (****p < 0.0001) and a smaller but still significant reduction in the shEsr2 group (*p = 0.038). (B) Graph shows EtOH intake in g/kg over 4 hours on the final day of the DID procedure. ER knockdown significantly reduced binge-like drinking behavior in the 4-hour EtOH DID session as measured by one-way ANOVA (p = 0.0041). Dunnett's multiple comparisons test revealed a significant effect of shEsr1 (**p = 0.0021) and a trend toward an effect of shEsr2 (†p = 0.072). (C) Graph shows water intake in mL/kg over 2 hours. There was no effect of ER knockdown on water intake. Data are presented as means ± SEM.

Figure 10. Intra-VTA knockdown of ERα or ERβ does not alter binge-like EtOH consumption in male mice. Gonadally intact male C57BL/6J mice were infused bilaterally into the VTA with lentivirus expressing shRNAs targeting Esr1 (shEsr1, n = 10), Esr2 (shEsr2, n = 8), or a non- specific sequence not known to target any gene in the mouse genome (shScr, n = 7). Animals were then subjected to the DID procedure. In all cases, behavioral testing began 3.5 to 4 weeks after surgery. (A) Graph shows EtOH intake in g/kg over 2 hours on each day of the DID procedure. Two-way RM ANOVA revealed no effect of shRNA treatment on EtOH intake (p = 0.43). (B) Graph shows EtOH intake in g/kg over 4 hours on the final day of the DID procedure. ER knockdown had no effect on binge-like drinking behavior in the 4-hour EtOH DID session (one-way ANOVA: p = 0.28). (C) Graph shows water intake in mL/kg over 2 hours. There was no effect of ER knockdown on water intake (one-way ANOVA: p = 0.10). Data are presented as means ± SEM.

Figure 11. Intra-VTA knockdown of ERα does not alter sucrose consumption in female mice. Gonadally intact female C57BL/6J mice were infused bilaterally into the VTA with lentivirus expressing shRNAs targeting Esr1 (shEsr1, n = 10), Esr2 (shEsr2, n = 8), or a non-specific sequence not known to target any gene in the mouse genome (shScr, n = 11). Animals were then subjected to a modified DID procedure in which 2% sucrose solution was presented instead of EtOH. In all cases, behavioral testing began 3.5 to 4 weeks after surgery. (A) Graph shows intake of 2% sucrose solution in mL/kg over 2 hours on each day of the DID procedure. Two-way RM ANOVA revealed no effect of shRNA treatment on sucrose intake (p = 0.74). (B) Graph shows sucrose intake in g/kg over 4 hours on the final day of the DID procedure. There was no effect of shRNA treatment on sucrose consumption in the 4-hour DID session (one-way ANOVA: p = 0.52). (C) Graph shows water intake in mL/kg over 2 hours. There was no effect of ER knockdown on water intake (one-way ANOVA: p = 0.80). Data are presented as means ± SEM.

Figure 12. Viral construct shEsr1-1785 reduces ERα protein levels in male mouse VTA. Slices from the brains of male mice that were infused into the VTA with lentivirus targeting either Esr1 (shEsr1) or a non- specific sequence not known to target any gene in the mouse genome (shScr) were stained for GFP and ERα using fluorescent probe- conjugated antibodies and imaged using confocal microscopy. Images were then analyzed to determine corrected total cell fluorescence of Alexa Fluor 594-conjugated ERα in GFP-positive cells (n = 7 cells per treatment group). (A-C) Representative images from shScr-treated brain tissue showing red (ERα, A) and green (GFP, B) channels separately and merged (C). (D-F) Repre- sentative images from shEsr1-treated brain tissue showing red (ERα, D) and green (GFP, E) channels separately and merged (F). White arrows indicate lentivirus-infected cells. Yellow triangles indicate uninfected cells. (G) The shEsr1 construct reduced ERα immuno-fluorescence by 54% (Student’s t-test: p = 0.051). Data presented as means ± SEM.

3.4. Discussion

In Chapter Two, I reported that EtOH CPP is enhanced in OVX mice by systemic treatment with estradiol benzoate (EB). This effect of estradiol can be replicated by treatment with the synthetic agonists PPT (selective for ERα) and DPN (selective for ERβ) when both agonists are administered together, but not when either is administered separately, suggesting that both classical ERs contribute to the effect. Most substances known to induce use disorders in humans produce CPP in rodents, and the CPP test is widely accepted as a reliable measure of drug reward and addiction potential. When considering the generalizability and potential clinical applications of these data, however, one may note that my experiments used IP injection as the route of drug administration—and this is not the route by which humans typically self-administer

EtOH for recreational use. I therefore sought to test effects of ER-selective agonists on voluntary

EtOH drinking in female mice using the DID test.

In a 2018 study, Satta et al. demonstrated that OVX decreases, and EB increases, binge- like EtOH intake in the DID test117. I found that systemic treatment (SC injection) with the ERβ agonist DPN produced no effect on EtOH intake, while the ERα agonist PPT suppressed drinking completely. It is important to note that this effect was not specific to EtOH drinking, since PPT treatment also significantly reduced consumption of both water and sucrose solution in this test. Others have reported that PPT dose-dependently decreases food intake in OVX rats but does not induce conditioned taste aversion332, suggesting that this ERα agonist does not make animals feel ill. Therefore, it is reasonable to speculate that PPT treatment decreases EtOH and sucrose consumption by decreasing appetite. Although food intake was not directly measured, decreased food intake would also explain the observed reduction in water consumption in PPT- treated animals, since prandial (food-associated) drinking comprises a substantial portion of total

83 daily water intake in laboratory mice and rats338. Further experiments would be necessary to determine the mechanism behind PPT’s effects on drinking behavior, but one possibility is that activating ERα led to decreased NPY production in areas of the brain responsible for generating appetite, such as the hypothalamus339, 340. ERα is known to negatively regulate Npy gene expression, and this is associated with appetite suppressant effects341, 342.

As described above, my experiments with systemic ER agonist administration in OVX mice led me to conclude that generalized ER activation affected drinking behavior in ways not specific to EtOH. I therefore decided to attempt localized modulation of ER function within a single brain region in hopes of achieving EtOH-specific behavioral effects. Because the VTA is known to regulate EtOH consumption and expresses both classical ERs, I decided to perform intra-VTA knockdown of ER expression in gonadally intact female mice. Daily monitoring of estrous cycle phase by vaginal swab confirmed that intra-VTA ER knockdown did not interrupt normal cycle progression, suggesting that the brain and other bodily tissues were exposed to normal ovarian hormone levels during the experiment. Therefore, the observed behavioral effects can be reasonably attributed to localized alterations in ER signaling within the VTA. These experiments showed that lentiviral-mediated knockdown of either Esr1 (ERα) or Esr2 (ERβ) suppresses binge-like EtOH intake in gonadally intact females, as measured by the DID model.

Knockdown of Esr1 produced a highly significant reduction in EtOH intake during 2-hr DID sessions (days 1-4), and this reduction in drinking behavior remained significant after 4 hours of

EtOH access (day 4). Knockdown of Esr2 produced a less pronounced but still significant decrease in EtOH intake during 2-hr DID sessions. Interestingly, the effect of Esr2 knockdown was not significant after the 4-hour drinking session, although there was a trend toward decreased drinking relative to controls at this time point. These data present an interesting

84 contrast to the findings of Satta et al., who demonstrated that OVX significantly reduced drinking behavior only during the extended access (4-hr) drinking session on day 4 of the DID procedure.117 Satta et al. found that OVX did not significantly alter drinking behavior in the 2-hr drinking sessions (days 1-3) and, furthermore, estradiol replacement in OVX mice produced a significant increase in EtOH intake only on day 4. The difference in findings between that study and the experiment illustrated in Figure 9 (above) may be explained by the pronounced differences in the way ER signaling was modified in each experiment (OVX with systemic E2 treatment vs. localized ER knockdown in gonadally intact animals).

EtOH is known to stimulate firing of dopamine (DA) neurons in VTA-containing brain slices during electrophysiological recording. Previous research has demonstrated that estradiol levels modulate EtOH's effects on VTA DA neurons in female mice268. DA neurons in VTA slices obtained from females in diestrus, when circulating E2 levels are high, are more sensitive to EtOH-stimulated firing than are neurons in VTA slices collected during estrus, when E2 levels are low. Similarly, VTA DA neurons from E2-treated OVX mice are more sensitive to EtOH than are neurons from OVX mice who received no supplemental E2. Others have observed E2- dependent increases in EtOH-induced DA release in the prefrontal cortex (PFC) of OVX rats, and treatment with the selective estrogen receptor modulator (SERM) clomifene prevented

EtOH-induced DA release in the PFC of intact rats266. The PFC, part of the mesocorticolimbic

DA system, receives dopaminergic projections from the VTA, and it is likely that ER activity could increase EtOH-stimulated DA release in other VTA targets (such as the nucleus accumbens) as well. This is one potential mechanism by which E2 and its receptors could enhance EtOH consumption and reward.

It is important to note that the effects of intra-VTA ER knockdown on binge-like drinking behavior appear to be sex-specific, since male drinking behavior was not affected by knockdown of either Esr1 or Esr2, despite the fact that both ERα and ERβ are present the male VTA. Sex differences are known to exist within the mesocorticolimbic DA system, including differences in both the organization of dopaminergic connections and the effects of gonadal steroids on dopaminergic activity343. For example, acute treatment with E2 has been shown to upregulate

DA release, receptor binding, and transporter activity in the striatum of adult female, but not male, rats343. Furthermore, E2 increases the interaction of ERα with metabotropic glutamate receptor (mGluR) 1 in females but not in males344. Recent experiments by Vandegrift et al. have demonstrated that estrogenic enhancement of EtOH-induced DA neuron excitation within the

VTA may be mediated by ERα-mGluR1 interactions345, but further research will be necessary to understand how ER signaling regulates the VTA’s response to EtOH. These experiments suggest that sex differences in EtOH intake are at least partly mediated by underlying differences in neurological activity and that estrogen receptors play a significant role in regulating EtOH drinking behavior in females.

3.5. Acknowledgements

Donghong He and Amy W. Lasek produced the lentivirus used in the experiments described above. Caroline Creasey sliced the brains for qPCR analysis (see appendix A) and assisted Dr. Lasek in collecting tissue punches and confirming viral placements in those slices.

Donghong He performed the RNA isolation, cDNA synthesis, and qPCR to measure in vivo knockdown efficiency of the lentiviral constructs and also quantified in vitro knockdown efficiency in Neuro2A cells. Cassandre Coles performed the NAD-ADH enzymatic assay to measure blood EtOH concentrations.

CHAPTER FOUR: ESTROGEN RECEPTORS REGULATE THE EXPRESSION OF GENES INVOLVED IN ETHANOL REWARD-RELATED BEHAVIORS IN THE AMYGDALA AND VENTRAL TEGMENTAL AREA

4.1. Introduction

In the previous two chapters, I found that experimental manipulations of estrogen receptor activity alter behavioral responses to EtOH in female mice. Systemic activation of ERα and ERβ enhances EtOH conditioned place preference in OVX mice, and knockdown of either receptor within the VTA reduces binge-like drinking in intact females. It is clear that the classical ERs play a role in regulating EtOH reward-related behaviors in females, but the neural mechanisms by which this occurs are currently unknown.

ERα and ERβ exert effects on both gene transcription and cell signaling, but the most well-understood aspect of their activity is their ability to function as ligand-dependent transcription factors. Previous experiments have shown that ERs regulate expression of countless different genes346. A few stand out as logical starting points for investigation, however: Crh, which encodes corticotropin-releasing factor (i.e., corticotropin-releasing hormone), Npy, which encodes neuropeptide Y, and Alk, which encodes anaplastic lymphoma kinase. Some information about how these genes’ products regulate the brain’s response to EtOH has already been provided in Chapter One, section 6.2. More information about how their regulation by estrogen receptor activity may increase female vulnerability to AUD is provided below.

4.1.1. Corticotropin Releasing Factor (encoded by Crh)

Abnormalities in stress responsivity are a common factor in both mood and substance abuse disorders, for which comorbidity is high, particularly among women32, 347. In general, women are twice as likely as men to be diagnosed with an anxiety disorder and/or unipolar

87 depression—statistics that cannot be fully accounted for by sociological factors348-355. The heightened risk of anxiety and depression in women is most prominent during the years when circulating estrogen is high, increasing at puberty and decreasing post-menopause356-360.

Compared to men, women report more intense subjective experiences of stress361. Women with a history of childhood abuse, a major predictor of alcohol use disorder in adulthood362, exhibit aberrant HPA axis responses to psychological stress, particularly in conjunction with anxious and depressive symptomology363, 364. Female AUD sufferers are also more likely than males to be diagnosed with a comorbid mood disorder and tend to cite stressful life experiences (vs. external temptations) as reasons for substance use and relapse32.

CRF is a crucial neuropeptide regulator of both the HPA axis and extrahypothalamic stress-responsivity, affecting endocrine, autonomic, and behavioral components of the stress response365, 366. Through its actions at sites such as the prefrontal cortex and amygdala, CRF activity is known to mediate fear conditioning and anxiety-like behaviors367-370, and CRF projections to the locus coeruleus are involved in regulating emotional arousal371, 372. Both ERα and ERβ colocalize with CRF neurons in the paraventricular nucleus of the thalamus (PVN)373,

374, a region activated by stressful stimuli. CRF mRNA is decreased in this region following

OVX and restored by treatment with E2299. E2 is able to directly induce CRF gene expression in

AR-5 amygdaloid cells191 and in transfected HeLa and BE(2)-C cells374, 375 through the combined actions of ERα and ERβ. E2 replacement also increases CRF mRNA expression in the CeA and is associated with enhanced fear conditioning in OVX female mice298.

4.1.2. Neuropeptide Y (encoded by Npy)

The actions of E2 on NPY expression and release have largely been studied in the hypothalamus, due to E2’s clear role in regulating feeding and reproductive behaviors376. The suppressant effect of E2 on feeding behavior in female animals is well known332, 377-379. OVX rats and mice often experience rapid weight gain relative to naturally cycling controls—an effect that can be reversed by supplementary E2 administration342. Injections of NPY are also less effective at stimulating food intake in OVX rats receiving supplemental E2 compared to vehicle- treated controls, and E2’s effects on feeding behavior seem to be mediated largely by repression of NPY’s actions in the hypothalamus380.

Ovariectomy results in increased expression of NPY mRNA in mouse hypothalamic neurons, which can be reversed by subsequent treatment with E2299. However, Titolo et al. found that E2 treatment differentially regulates NPY mRNA expression in murine neuronal cells in vitro, depending on the relative abundance of ERα and ERβ300. NPY expression is repressed in the presence of either ERα and ERβ or ERα alone, whereas ERβ alone is able to induce expression of NPY mRNA. Follow-up experiments in vitro demonstrated that ERα-induced phosphorylation of Akt, ERK1/2, and CREB resulted in long-term repression of Npy expression301. Other studies have also demonstrated differential effects of ERα and ERβ on gene transcription140, 141, 176. Therefore, specific effects of ERα and ERβ on NPY expression in various brain regions must be investigated.

4.1.3. Anaplastic Lymphoma Kinase (encoded by Alk)

Most commonly known for its oncogenic function in human cancers, the anaplastic lymphoma kinase (Alk) gene has been identified as a novel regulator of EtOH-related

89 behaviors381. Alk polymorphisms in human subjects are associated with low EtOH responsivity and decreased reports of subjective “high” following acute EtOH. Lasek et al. have demonstrated increased sensitivity to EtOH-induced sedation in Alk-deficient Drosophila mutants and in Alk knockout mice381. Furthermore, treatment with an ALK inhibitor abolishes EtOH CPP and reduces EtOH consumption in male mice382.

ERα is known to associate with the endogenous Alk promoter in neuroblastoma cells in vitro, and treatment of cells with E2 enhances this association383. ALK protein levels in mouse

NAc and caudate putamen (CPu) are increased following acute, systemic EB treatment by subcutaneous injection. ALK levels are also increased in the NAc of Esr1KO mice, suggesting that ERα may negatively regulate Alk gene expression in some brain regions in vivo. As only one study to date has examined estrogenic regulation of Alk expression in neuronal tissue383, much remains to be determined about the role of ALK as a potential mediator of estrogen’s effects on

EtOH consumption.

4.1.4. Experimental Aims

Estrogen receptors regulate the expression of genes known to modulate the brain’s response to EtOH. ERα and ERβ are both expressed in the amygdala and VTA, regions where changes in gene expression is a hallmark of alcohol use disorders (see Chapter One, section 6.2).

Furthermore, EtOH itself is known to regulate gene expression in many brain regions, and this is true whether the exposure to EtOH is chronic384-387 or acute388, 389. Little is known about the ways in which ER activity and EtOH may influence each other’s effects on gene expression, however.

I therefore sought to examine the effects of E2 and EtOH, alone and in combination, on gene expression in the amygdala and VTA. I also sought to determine whether any observed estrogen-

90 mediated alterations in gene expression were due to selective activation of ERα and/or ERβ, since changes in gene expression—specifically expression of Crh, Npy, and/or Alk—might explain the ability of estrogen to increase alcohol consumption and/or alcohol reward. Because

ERα expression is also subject to regulation by E2390, I decided to measure expression of the genes that code for ERα and ERβ (Esr1 and Esr2) as well. My results provide a mechanistic framework for investigating where in the brain and how the classical ERs may act to regulate

EtOH reward and binge-like drinking behavior in females.

4.2. Material and Methods

4.2.1. Experimental Animals

Experimentally naïve, 8- to 10-week-old female C57BL/6J mice (Jackson Laboratory,

Bar Harbor, ME) were subjected to bilateral ovariectomy (OVX) under anesthesia as previously described (see Chapter 2, Section 2.2). Animals were housed separately for the first two days after surgery, after which they were group housed with same-sex cage mates in a temperature- and humidity-controlled environment under a 12-hour light/dark cycle (lights on at 6 am and off at 6 pm). Animals were allowed to recover for 10-14 days after surgery before the start of the experiments. To confirm cessation of the estrous cycle, vaginal smears were taken daily from mice for 4-5 days and analyzed for cell content using bright field microscopy. Cessation was confirmed when cell content resembled diestrus (predominantly leukocytes) for several consecutive days. All mice had access to food and water ad libitum for the duration of the study and were maintained and cared for in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All experimental procedures were approved by the

University of Illinois at Chicago (UIC) Institutional Animal Care and Use Committee.

4.2.2. Drug Treatments and Tissue Processing

17β-Estradiol-3-benzoate (EB) was purchased from Sigma Aldrich (St. Louis, MO, USA) and prepared in sesame oil with 10% EtOH vehicle (VEH) to a final concentration of 4 ng/μl. EB was administered in a volume of 50 μl by SC injection to achieve a dose of 0.2 μg (~10 μg/kg).

Note that the final dose of EtOH injected was negligible (< 0.2 g/kg). 4,4',4''-(4-Propyl-[1H]- pyrazole-1,3,5-triyl)trisphenol (PPT) and diarylpropionitrile (DPN) were purchased from Tocris

(Minneapolis, MN, USA) and prepared in VEH to a final concentration of 0.5 mg/ml. PPT and

DPN were administered in a volume of 50 μl by SC injection to achieve a dose of ~1 mg/kg.

When animals were treated with both PPT and DPN, each drug was given as a separate 50 μl injection. EtOH solutions were prepared with 95% ethyl alcohol stock (Decon Laboratories,

King of Prussia, PA, USA) diluted to 20% v/v in 0.9% sterile saline. EtOH was administered IP at a dose of 2.0 g/kg.

For the first experiment, each mouse was given a single SC injection daily of either VEH

(n = 22) or EB (n = 22) every morning for three consecutive days, such that each animal received a total of three treatments of VEH or EB. On the third day, mice also received 2.0 g/kg EtOH or an equivalent volume of saline by IP injection, which was administered at the same time as VEH or EB. Treatments were staggered so that one mouse received the treatments every 8 min, alternating treatment groups to control for any potential effects relating to the time of day. Four hours later, in order of treatment time, each mouse was anesthetized by CO2 inhalation and rapidly decapitated. During the 8 min interval between decapitations, the brain was collected, rinsed briefly in PBS, and sliced into 1 mm sections using a brain matrix block (Zivic

Instruments, Pittsburgh, PA, USA). Tissue punches enriched in either CeA or MeA were

92 collected using a glass Pasteur pipette (diameter of ~ 1 mm), transferred to 1.5 ml Eppendorf tubes, and placed on dry ice. At the end of the collection period, samples were transferred to the

-80°C freezer for storage until the time of RNA extraction.

For the second experiment, each mouse was given a single SC injection daily of either

VEH, PPT, DPN, or a combined treatment of PPT + DPN every morning for three consecutive days, so that each animal received a total of three treatments (n = 10 per treatment group). On the third day, treatments were staggered so that one mouse received the injection every 5 min, alternating treatment groups to control for any potential effects relating to the time of day. Four hours later, in order of treatment time, each mouse was anesthetized by CO2 inhalation and rapidly decapitated. During the 5 min interval between decapitations, the brain was collected, rinsed briefly in PBS, and flash frozen on dry ice. Frozen brains were stored in a 12-well plate at

-80°C until sectioning. On the day of sectioning, frozen brains were mounted for cryostat sectioning using Tissue-Plus Optimal Cutting Temperature (O.C.T.) compound (Scigen

Scientific, Gardena, CA, USA). Mounted samples were placed into a -10 °C Microm HM 550 cryostat chamber (Thermo Fisher Scientific, Kalamazoo, MI, USA) and allowed to warm for 30 min before slicing. Brains were sectioned into 300 μm slices, which were mounted on clean microscope slides. To prevent RNA degradation, samples were placed on blocks of dry ice immediately after mounting, then transferred to a -80 °C freezer. Finally, CeA-, MeA-, BLA-, and VTA-enriched tissue punches were collected using a 1 mm biopsy punch (Integra Miltex,

York, PA, USA), transferred to 1.5 ml Eppendorf tubes, and returned to the -80°C freezer for storage until further processing.

4.2.3. RNA Extraction, cDNA Synthesis, and qPCR

Total RNA was isolated from tissue using the GeneJet RNA Purification Kit (Thermo

Scientific, Schaumburg, IL, USA) according to the manufacturer's instructions. For the first experiment, RNA was reverse transcribed using the Maxima First Strand cDNA Synthesis Kit

(Thermo Scientific) and quantitative real-time polymerase chain reaction (qPCR) was performed using Maxima qPCR Master Mix (Thermo Scientific). Sequences of primers were as follows

(5-3’): Alk forward primer: GCCTGAGAAGAAGGCATCGGAA, Alk reverse primer:

GGAGAAGGCGTTTCTGAGGGT; Crh forward primer: CAACCTCAGCCGGTTCTGAT, Crh reverse primer: CAGCGGGACTTCTGTTGAGA; Npy forward primer:

CTCCGCTCTGCGACACTAC, Npy reverse primer: TGTCTCAGGGCTGGATCTCTT. Esr1 and Esr2 primers were purchased as pre-designed gene expression assays from Thermo Fisher

Scientific (Waltham, MA, USA): Esr1: Mm00433149_m1, Esr2: Mm00599821_m1.

Amplification of β-actin (Actb) was used as a normalization control for total RNA input.

For the second experiment, RNA was reverse transcribed using the iScript Reverse

Transcription Supermix for RT-qPCR (BioRad Laboratories, Hercules, CA, USA), and qPCR was performed using the SsoAdvanced Universal SYBR Green Supermix (BioRad).

Amplification of 60S ribosomal protein L13a (Rpl13a) was used as a normalization control for total RNA input. Rpl13a forward primer: TACCAGAAAGTTTGCTTACCTGGG, Rpl13a reverse primer: TGCCTGTTTCCGTAACCTCAAG. New Esr1 primers were designed for use with SYBR Green Supermix. Esr1 forward primer: 5'-CCTACTACCTGGAGAAGC-3', Esr1 reverse primer: 5'-GCACAGTAGCGAGTCTCCTT-3'. Relative expression levels of Esr1, Alk,

Crh, and Npy were calculated using the dCq method391.

4.2.4. Statistical Analysis

Gene expression data were analyzed by two-way ANOVA in the first experiment and by one-way ANOVA in the second. A few data points were determined to be statistical outliers and were therefore excluded from further analysis. The number of samples included in each group is indicated in the figure legends. All data were analyzed using Prism software version 6

(GraphPad, La Jolla, CA). A p value of less than 0.05 was accepted as statistically significant.

4.3. Results

4.3.1. E2 regulates gene expression in the amygdala.

ERα and ERβ are expressed in the CeA and are known to control the expression of genes that act in this brain region to influence behavioral responses to EtOH, such as Crh and Npy299.

Estradiol treatment also increases expression of the Alk gene, which has been identified as a regulator of EtOH CPP and consumption in males381-383. I hypothesized that levels of Crh, Npy, and Alk would be altered in the CeA by E2 treatment. To test this, I used qPCR to measure mRNA levels of Crh, Npy, and Alk in the CeA after EB and EtOH treatment. Since Esr1 transcription is regulated by E2392, I also measured levels of Esr1 after EB and EtOH treatment.

For Esr1, there was a significant main effect of EB treatment and a significant interaction between EB and EtOH (Figure 13A, EB: F1, 30 = 13.54, p < 0.001; interaction: F1, 30 = 4.318, p <

0.05), with Esr1 expression decreasing after EB treatment. Post-hoc Sidak’s multiple comparisons test demonstrated a significant decrease in Esr1 expression between mice treated with EB compared with VEH in the EtOH-treated group (p < 0.002). For Alk, I found a significant main effect of EB treatment (Figure 13B, EB: F1, 31 = 7.42, p = 0.011), with EB causing an overall increase in Alk expression. Conversely, for Crh, there was a significant

decrease in Crh expression after EB treatment (Figure 13C, EB: F1, 28 = 25.90, p < 0.0001). Npy levels were also significantly decreased after EB treatment (Figure 13D, EB: F1, 29 = 21.05, p <

0.0001). Acute EtOH did not significantly alter expression of any of these genes. Together, these results demonstrate that E2 alters the expression of genes involved in behavioral responses to

EtOH in the CeA.

I next examined gene expression in the MeA, since this area of the amygdala is enriched in estrogen receptors142. For Esr1 expression, there was a significant interaction between EB and

EtOH treatment (Figure 14A, interaction: F1, 30 = 4.724, p = 0.039). Post-hoc Sidak’s multiple comparisons test indicated a trend towards decreased Esr1 expression after EB treatment only in the EtOH -treated group (p = 0.059), similar to what I observed in the CeA (Figure 13A). For

Alk, I again found a significant main effect of EB treatment (Figure 14B, EB: F1, 32 = 6.97, p =

0.013), with Alk expression increasing after EB treatment, similar to what I observed in the CeA.

For Crh, there was a significant main effect of EB treatment (Figure 14C, EB: F1, 30 = 7.78, p =

0.009) and a significant interaction between EB and EtOH treatment (interaction: F1, 30 = 6.12, p

= 0.019). Post-hoc Sidak’s multiple comparisons tests demonstrated a significant decrease in Crh expression after EB treatment only in the saline-treated group (p < 0.002), suggesting that EtOH exposure may offset the effects of EB on Crh levels in this region. Finally, I found a significant main effect of EB treatment on Npy expression (Figure 14D, EB: F1, 29 = 20.29, p < 0.0001), with

Npy expression decreasing after EB treatment. I did not observe changes in Esr2 expression in the CeA or MeA. However, Esr2 transcript levels in these regions were near the lower limit of detection, so it may be that I was simply unable to quantify any changes that did occur.

4.3.2. ER-selective agonists modulate Npy and Crh expression in the amygdala and VTA.

Since I was able to replicate the behavioral effects of EB on EtOH CPP using the selective ER agonists PPT and DPN, I next tested if treatment with PPT and/or DPN would replicate EB’s effects on gene expression. I measured mRNA levels of Alk, Crh, and Npy in the

CeA, MeA, BLA, and VTA after treatment with each agonist (alone and combined). For Npy, no effect of treatment was observed in the CeA or BLA (Figure 15A and B). However, there was a trend toward a general decrease in Npy expression in the MeA (Figure 15C, F3, 34 = 2.65, p =

0.065). Post-hoc Dunnett's multiple comparisons test showed that Npy expression was significantly decreased in PPT-treated animals (p = 0.033), and there was a trend toward reduced

Npy in animals treated with both PPT and DPN (p = 0.084). In the VTA, I observed a significant main effect of ER agonist treatment (Figure 15D, F3, 27 = 3.39, p = 0.032). Post-hoc analysis with

Dunnett’s multiple comparison’s test revealed a strong trend toward increased Npy expression in

DPN-treated animals (p = 0.053). Alk expression was not significantly altered by ER agonist treatment in any of the regions tested (Figure 16). Crh expression was not significantly altered by treatment with ER-selective agonists in the CeA, MeA, or VTA (Figure 17). In the BLA, I observed a significant main effect of ER agonist treatment (Figure 17B, F3, 34 = 3.77, p < 0.020).

Dunnett's multiple comparisons test found that PPT (p = 0.014) and DPN (p = 0.036) increased

Crh expression when administered separately. There was no effect of combined PPT + DPN treatment on Crh expression in the BLA.

Figure 13. Estradiol modulates gene expression in the central nucleus of the amygdala (CeA). OVX female mice were treated once daily with either VEH or EB for three consecutive days. On the third day, mice also received either saline or 2 g/kg EtOH. CeA-enriched tissue samples were collected 4 hours after treatment and analyzed using qPCR to determine expression of Esr1, Alk, Crh, and Npy relative to Actb (n = 7-10 per group). (A) Relative Esr1 expression was lower in EB-treated animals (***p < 0.001, main effect of EB treatment by two-way ANOVA). **Significant interaction showing decreased Esr1 in EtOH-treated mice (p < 0.01). (B) EB treatment significantly increased Alk expression (*p <0.05, main effect of EB treatment by two- way ANOVA). (C) Crh expression was significantly decreased in EB-treated animals (****p < 0.0001, main effect of EB treatment by two-way ANOVA). (D) Npy expression was significantly decreased in EB-treated animals (****p < 0.0001, main effect of EB treatment by two-way ANOVA).

Figure 14. Estradiol modulates gene expression in the medial nucleus of the amygdala (MeA). OVX female mice were treated once daily with either VEH or EB for three consecutive days. On the third day, mice also received either saline or EtOH. MeA-enriched tissue samples were collected 4 hours after treatment and analyzed by qPCR to determine expression of Esr1, Alk, Crh, and Npy relative to Actb (n = 7-10 per group). (A) I observed a significant interaction between treatments (p = 0.038). In post-hoc analysis, there was a trend toward an effect of EB in EtOH-treated animals (p = 0.059). (B) EB treatment significantly increased Alk expression (*p < 0.05, main effect of EB treatment by two-way ANOVA). (C) I observed a significant main effect of EB (**p < 0.001 by two-way ANOVA) and a significant interaction between treatments (Crh was decreased by EB only in saline-treated animals (**p < 0.01). (D) Npy was significantly decreased in EB-treated animals (***p = 0.0001, main effect of EB by two-way ANOVA).

Figure 15. Estrogen receptor-selective agonists modulate Npy expression in the medial nucleus of the amygdala (MeA) and ventral tegmental area (VTA). OVX female mice were treated once daily with VEH, PPT, DPN, or PPT + DPN for three consecutive days. On the third day, mice were sacrificed 4 hours after treatment. CeA-, BLA-, MeA-, and VTA-enriched tissue samples were collected and analyzed using qPCR to determine expression of Npy relative to Rpl13a. (A & B) Npy expression in the CeA (n = 8-10 per group) and BLA (n = 8-10 per group) was not significantly altered by any of the three agonist treatments. (C) In the MeA (n = 9-10 per group), I observed a trend toward a main effect of ER agonist treatment (p = 0.065 by one-way ANOVA). In post-hoc analysis, I observed a significant decrease in Npy in PPT-treated animals (Dunnett’s multiple comparison’s test: *p < 0.03). (D) In the VTA (n = 7-9 per group), I observed a main effect of ER agonist treatment (p = 0.032 by one-way ANOVA). Post-hoc analysis with Dunnett’s multiple comparison’s test revealed a strong trend toward increased Npy expression in DPN-treated animals (†p = 0.053). Note that the Y axis in (D) ends at 3.0, as opposed to 2.0 in (A-C), because the change in Npy expression in the VTA was more dramatic than in the other regions examined.

100

Figure 16. The estrogen receptor-selective agonists PPT and DPN have no significant effects on Alk expression in the CeA, BLA, MeA, or VTA. OVX female mice were treated once daily with VEH, PPT, DPN, or PPT + DPN for three consecutive days. On the third day, mice were sacrificed 4 hours after treatment. CeA-, BLA-, MeA-, and VTA-enriched tissue samples were collected and analyzed using qPCR to determine expression of Alk relative to Rpl13a. (A-D) Alk expression in the CeA (n = 8-10 per group), BLA (n = 8-10 per group), MeA (n = 9-10 per group), and VTA (n = 7-9 per group) was not significantly altered by treatment with PPT, DPN, or PPT + DPN combined.

101

Figure 17. Estrogen receptor-selective agonists modulate Crh expression in the basolateral nucleus of the amygdala (BLA). OVX female mice were treated once daily with VEH, PPT, DPN, or PPT + DPN for three consecutive days. On the third day, mice were sacrificed 4 hours after treatment. CeA-, BLA-, MeA-, and VTA-enriched tissue samples were collected and analyzed using qPCR to determine expression of Crh relative to Rpl13a. (A, C & D) Crh expression in the CeA (n = 8-10 per group), MeA (n = 9-10 per group), and VTA (n = 7-9 per group) was not significantly altered by treatment with ER-selective agonists. (B) In the BLA (n = 8-10 per group), I observed a significant main effect of ER agonist treatment (p < 0.020 by one- way ANOVA). Dunnett's multiple comparisons test found that PPT and DPN individually increased Crh expression (VEH vs. PPT: *p = 0.014, VEH vs. DPN: *p = 0.036). There was no effect of PPT + DPN combined.

102

4.4. Discussion

In my behavioral studies, I found that estrogenic enhancement of EtOH CPP requires co- activation of ERα and ERβ. I also found that knockdown of either classical ER reduced drinking in intact female mice, suggesting that both ERα and ERβ regulate appetite for EtOH. From the behavioral studies alone, it is impossible to tell wither this is due to additive effects (e.g. ERα acting on DA signaling and ERβ acting on GABA signaling, for example) or cooperative effects

(e.g. both receptors acting as heterodimers to regulate gene expression). When considering potential mechanisms that might explain the behavioral effects described above, it is worth noting that both Crh and Npy are among the genes where cooperative actions of ERα and ERβ have been reported in vitro191, 300. My finding that levels of Npy mRNA were decreased in the amygdala of EB-treated animals is consistent with previously published studies of other brain regions. OVX results in increased expression of Npy mRNA in mouse hypothalamic neurons, which can be reversed by subsequent treatment with E2299. Furthermore, Titolo et al. found that

E2 treatment differentially regulates Npy mRNA expression in murine neuronal cells in vitro, depending on the relative abundance of ERα and ERβ: Npy expression is repressed by ERα alone and by the cooperative action of ERα and ERβ, but activated by ERβ300. Npy is also expressed at lower levels in the CeA and MeA of alcohol-preferring “P” rats and EtOH -withdrawn male

Sprague-Dawley rats, both of which develop EtOH CPP more readily than non-preferring and non-dependent controls, respectively295, 297, 393, 394. Therefore, lowering levels of NPY in the amygdala is one mechanism by which EB may increase EtOH CPP and binge-like drinking in

OVX females. My finding that Npy is decreased in the MeA of PPT-treated OVX mice, and that combined treatment with PPT plus DPN produced a trend toward decreased Npy in this region, support the hypothesis that E2 regulation of Npy expression may at least partially mediate

103 estrogenic enhancement of EtOH reward and drinking in these animals. I also observed a trend towards increased Npy in the VTA after DPN treatment. While intra-cerebroventricular infusion of NPY has been shown to decrease EtOH intake by male C57BL/6J mice in the DID test280, no studies have tested whether intra-VTA infusion of NPY modulates binge-like EtOH drinking in females. Very few studies have directly examined the effects of NPY on VTA neurotransmission. Some researchers have reported that NPY decreases the activity in a subset of

VTA DA neurons279, 395, but these experiments were not conducted in the presence of EtOH.

Future experiments are needed to determine if reducing Npy expression in the amygdala or increasing it in the VTA of female mice will facilitate EtOH CPP and drinking and, conversely, if systemic treatment with NPY or synthetic modulators of NPY receptor activity will block the

E2-mediated enhancement of EtOH CPP and drinking.

Interestingly, I also found that Crh was decreased in the CeA and MeA of OVX mice after EB treatment. In contrast, others have demonstrated that E2 is able to induce Crh expression in AR-5 amygdaloid cells 191 and in transfected HeLa and BE(2)-C cells 374, 375 through the combined actions of ERα and ERβ. Pelletier et al. found that Crh levels were decreased in mouse hypothalamus after OVX and restored by supplemental E2 treatment 299.

Jasnow et al. also found that E2 replacement increases Crh expression in the CeA of OVX mice298. There are a number of possible explanations as to why my results differ from these previous findings. For one, the relative expression of ERα and ERβ varies throughout the brain, and differences in expression patterns of these receptors and their various isoforms are thought to contribute to tissue-specific effects (see Chapter One, section 5.2). The relationship between ERα and ERβ is complex and not fully understood, but it is thought that splice variants of each play an important role in determining whether their combined actions will be cooperative or

104 repressive 185, 396. It is not currently known what splice variants of each receptor are present in various nuclei of the amygdala or how their actions may differ from those observed in other regions. Furthermore, dose and timing of treatments are important considerations when measuring effects on gene expression. In the case of the Jasnow et al. study, which found an increase in Crh expression in the CeA after EB treatment, the doses of EB used were much higher than the dose used in our study (5-10 μg vs. 0.2 μg). In contrast to our results with EB treatment, we found that Crh expression in the CeA or MeA was not significantly altered by treatment with PPT, DPN, or the combination of these two agonists. This raises the possibility that different doses of the agonists need to be tested or, alternatively, that the G-protein-coupled estrogen receptor (GPER) might mediate EB’s Crh expression-suppressing effect in these regions.

Current evidence of CRH effects on EtOH CPP is very limited 397. The only study to explore the potential modulatory role of CRH on EtOH CPP was conducted in male Crh knockout mice 398. While this study found that Crh knockout mice exhibit reduced sensitivity to the rewarding properties of EtOH, it is difficult to say how generalizable this finding is to wild- type animals or to females. Future studies are necessary to determine if a decrease in Crh in the amygdala of female mice contributes to the enhancement of EtOH CPP by E2.

Evidence from a large number of studies supports the idea that neuronal CRF signaling is a crucial regulator of binge-like EtOH intake in male mice. Systemic treatment with CRF receptor 1 (CRFR1) antagonist drugs reduces binge-like, but not moderate, levels of EtOH intake399. The CeA appears to be a particularly important component of the neurocircuitry involved in this process400. CRF signaling in the CeA is increased by binge-like EtOH drinking in male mice, and intra-CeA injections of a CRFR1 antagonist decrease EtOH intake in the DID

105 test399. This evidence suggests that decreases in CRF within the CeA would decrease binge-like

EtOH intake. It is possible that alterations in CRF expression are not part of the mechanism behind estrogenic enhancement of binge-like EtOH drinking behavior in females. It is important to note that I measured Crh transcript levels and not CRF protein, however. Additionally, I did find increased Crh expression in the BLA of OVX mice treated with PPT or DPN. It may be that

ERs stimulate production of CRF within the BLA, which is then released into the CeA.

Another potential mechanism by which E2 may regulate EtOH reward and drinking is through increasing the expression of Alk, which encodes anaplastic lymphoma kinase. In the present study, we found that Alk mRNA levels are increased in CeA and MeA of OVX mice following acute EB treatment. This is in agreement with our previously reported finding that systemic EB treatment increases Alk in the nucleus accumbens and caudate putamen of male mice 383. Dutton et al. found that ALK inhibitors decrease EtOH CPP and drinking in male mice382. It is therefore possible that increasing Alk expression could enhance EtOH reward in females. This will be important to test in future experiments. To my surprise, I did not see an effect of PPT or DPN on expression of any of the genes tested. Perhaps different doses or timing of the agonists would produce an effect. Or, it is possible that GPER might mediate EB’s effects on Alk expression in the amygdala.

One difficulty in comparing the results of my gene expression experiments to the results of my behavioral studies is that the timing of ER agonist and EtOH treatments used in the gene expression experiments was different from the treatment protocols used for the behavioral experiments. As discussed in Chapter Two, in the CPP experiments EB was administered beginning a few days after OVX and throughout the training and test days. EtOH was given four hours after EB treatment, every other day, on conditioning days. In the gene expression

106 experiments, EB was administered for three days prior to collecting tissue and was given concurrently with EtOH on the third day. In order to directly relate the findings of the gene expression experiments to the CPP results, I would need to treat the mice in exactly the same manner as I did for the CPP experiments. However, it is difficult to pinpoint the ideal timeframe for collecting tissue after the drug treatments. It is possible that the effects of E2 on enhancing

CPP are due to pre-treatment with E2 prior to conditioning, or the effects may be due to interactions between E2 and EtOH that occur during or after the conditioning sessions. Despite these caveats, it is notable that I observed ER agonist-induced gene expression changes in the amygdala and VTA that may potentially contribute to the enhancement of EtOH CPP and binge- like drinking by E2.

4.5. Acknowledgements

Antonia Savarese assisted in collecting tissue punches for the experiment examining effects of EB and EtOH on gene expression.

107

CHAPTER FIVE: CONCLUSIONS

AUD is a chronically relapsing disorder characterized by a preoccupation with drinking, loss of control in limiting EtOH intake, persistence in EtOH use despite negative consequences

(e.g., to the sufferer’s health, job function, interpersonal relationships, etc.), and emergence of a negative affective state when abstaining from EtOH use221. AUD is associated with severe costs to individual sufferers and to society as a whole in the form of drinking-related illness, mortality, healthcare expenses, and lost productivity5, 6. The efficacy of currently available AUD medications is modest401, and there is a growing need for improved treatment options, particularly among the female population25. Over the past decade, the incidence of AUD in men has increased by 35%402. In the same time, women have experienced an 84% increase in the rate of AUD occurrence402.

Though females are markedly under-represented in both clinical and preclinical AUD research, evidence suggests that the negative health consequences of AUD are often more severe for women than for men29-31. Furthermore, compared to men, women who develop AUD symptoms tend to progress more rapidly from first-time EtOH use to dependence, and female

AUD sufferers also tend to relapse more frequently following periods of abstinence26-28, 403.

A recent meta-analysis by Abagio et al. found that many studies of AUD medication have included too few women to determine whether sex differences in treatment efficacy exist404.

Women represented only 1% of subjects in the randomized controlled trials (RCTs) of disulfiram examined, and so no conclusions about the efficacy of this medication in women could be made.

The inclusion rates of female subjects in trials of acamprosate (22%) and naltrexone (23%), the other two FDA-approved AUD medications, were large enough to test for sex differences in treatment outcomes. The results of these comparisons were variable and inconclusive, however.

108

Based on analysis of 24 RCTs, 22 of which included women, acamprosate was deemed equally effective in male and female patients. One RCT found that acamprosate failed to reduce drinking in the patients studied and was equally ineffective in women and men405, 406. The meta-analysis also examined 47 studies, of which 36 included women, evaluating naltrexone's efficacy in

AUD404. While some studies found that naltrexone was an effective AUD treatment for women, others reported that it was effective only in men or that efficacy in female patients was reduced compared to males. It should also be noted that women reported higher incidence of adverse side effects with naltrexone treatment404 and that adverse events are generally associated with decreased willingness to take medication and poorer treatment outcomes407, 408. This problem is not limited to AUD medications, of course; the majority of currently available prescription medications have been developed from preclinical research conducted on male animals. Women experience higher incidence of adverse drug events and tend to have poorer health outcomes in general13-15, so opportunities for improving women’s healthcare through dedicated scientific research are numerous. For my dissertation, I decided to research female animal models of AUD because of a particular interest in the role of ovarian steroids as regulators of reward.

Both human and animal studies have uncovered a link between ovarian steroids and ethanol consumption, suggesting that activational and/or organizational effects of sex hormones may mediate sex differences in AUD. In particular, the ovarian steroid hormone 17β-estradiol

(E2) is known to increase voluntary EtOH drinking in a variety of animal models, and one study by Torres et al. also showed that OVX abolishes EtOH reward (as measured by the CPP test) in female rats69. The primary aim of my dissertation research was to investigate the neural mechanisms through which E2 enhances EtOH reward and drinking behavior in females. My hypothesis was that E2 acts in brain regions associated with reward (i.e. the amygdala and/or

109

VTA) to modulate the neurological effects of EtOH in a way that increases the drug’s addictive potential, likely through activation of one or both classical estrogen receptors, ERα and ERβ.

In the second chapter of this dissertation, I showed that estradiol benzoate (EB) enhances the rewarding properties of EtOH in OVX C57BL/6J mice, as measured by the CPP test. This is the first study to demonstrate that estradiol regulates EtOH CPP in female mice. Because EB binds with approximately equal affinity to both classical ERs, I tested the effects of the ERα agonist PPT and the ERβ agonist DPN on ethanol CPP in OVX mice in order to determine whether activation of either of these receptors would replicate the results obtained with EB treatment. My results suggest that activation of both ERα and ERβ is required for estrogenic enhancement of EtOH CPP, because PPT and DPN enhanced CPP only when administered together. This result is complemented by my experiments from Chapter Three, in which I showed that RNAi-mediated knockdown of either ERα or ERβ in the VTA of gonadally intact female mice decreased binge-like EtOH drinking behavior, as measured by the DID test. If both classical ERs regulate the positive affective experience of EtOH in females, it makes sense that reducing expression of either within the reward system could reduce the desire to consume

EtOH. Importantly, this was a sex-specific effect, because knockdown of either receptor failed to produce a decrease in EtOH intake in male mice.

In the fourth chapter of this dissertation, I used qPCR to investigate the effects of EB and

EtOH on the expression of Crh, Npy, and Alk within the amygdala. EB increased Alk and decreased Npy expression in the amygdala. These genes are potential candidates for mediating the enhancement of ethanol CPP and binge-like ethanol consumption by E2. Additional studies are needed in order to determine if the increase in Alk and/or decrease in Npy in the amygdala regulates ethanol reward-related behaviors, and if the proteins encoded by these genes are also

110 similarly altered by EB treatment. Future studies should also determine if these genes are altered in the VTA in mice treated with EB, since I have found that the VTA is one neuroanatomical site in which ERs act in females to regulate ethanol consumption.

In Chapter 4, I also investigated the effects of PPT and DPN on the expression of Alk,

Crh, and Npy within the amygdala and VTA. Although I found that EB induced changes in gene expression in the amygdala, PPT and DPN largely did not replicate these effects. There are a few possible explanations for these discrepancies: 1) the effect of EB on the expression of these particular genes might be regulated by the G-protein coupled estrogen receptor, GPER1, and not

ERα or ERβ, 2) the doses of PPT and DPN used were not comparable to EB with regard to receptor activation, and 3) the pharmacokinetics of PPT and DPN differed from EB, leading to temporally distinct patterns of gene expression. Additional experiments using different doses and/or timelines for drug administration would need to be tested in order to determine if the EB- induced changes in amygdalar gene expression are mediated by the classical ERs, however.

The results presented in this dissertation provide evidence that ERs are important for increasing ethanol reward-related behaviors and suggest that AUD treatment for women should take into consideration hormonal status. One therapeutic strategy that could be implemented immediately is the use of menstrual cycle-tracking applications to allow patients and their mental health providers to observe trends in drinking behavior over time and determine whether ovarian hormone levels are influencing EtOH intake on a patient-by-patient basis. Numerous menstrual tracking digital applications are already available to download for use with modern smartphones.

Although many of the available apps have issues with information accuracy and data privacy409, some implement appropriate security measures and are considered acceptable for clinical use.

One app called PreMentricS already has a clinical presence due to its usefulness in diagnosing

111 and monitoring premenstrual dysphoric disorder (PMDD), which is characterized by severe menstrual cycle-related disruptions in psychological and physical wellbeing410, 411. Because the app allows users to track not only pre-set symptoms (e.g. “breast tenderness” and

“headache/migraine”) but also user-added symptoms, PreMentricS could be repurposed to test for cycle-related changes in EtOH craving and drinking behavior. This could help shape protective behaviors in vulnerable individuals by increasing awareness of when hormone- associated changes in EtOH craving are likely to occur. Such testing could also help mental health care providers determine whether hormone-regulating medications would be a helpful component of treatment for women with AUD.

One implication of my research is that treatments that decrease circulating levels of E2 may decrease drinking behavior. This suggests a number of possible medication changes or additions that mental health care providers may want to consider when treating women with

AUD. For example, contraceptives containing E2 may be contraindicated in female AUD sufferers. However, women who struggle with EtOH misuse are at high risk for unplanned pregnancy, so it is crucial that women with AUD have access to effective methods of contraception331, 412, 413. Progestin-only methods, such as progestin-only pills, etonogestrel implants, or levonorgestrel IUDs, may be preferable for some patients—although further research is necessary to determine whether or not this is true. Another potential treatment option is the suppression of endogenous E2 production with GnRH analogue drugs, such as Lupron

(leuprolide). This may be useful for women whose drinking is exacerbated by cyclic hormone changes, because it stabilizes hormones at low levels that can be safely maintained over time if low-dose exogenous E2 and progesterone are given to prevent bone and cardiovascular issues414,

415.

112

In conclusion, AUD poses an increasingly large risk to women’s mental and physical wellbeing. As an understudied demographic, female AUD patients suffer from a lack of adequate treatment options. A growing body of research, including the experiments described in this dissertation, suggests that E2 influences the female brain in ways that can enhance vulnerability to AUD development. Future AUD research should investigate the potential for sex-specific treatment options, including medications that regulate ovarian hormone production and/or modulate the activity of estrogen receptors in the brain.

Acknowledgements

My research adviser, Dr. Amy W. Lasek, provided commentary and editing assistance— not only on this chapter, but on this dissertation in its entirety. I would like to thank her and the other members of my dissertation committee for their guidance on this project and throughout my graduate education.

113

REFERENCES

1. Hilderbrand, E. R., and Lasek, A. W. (2017) Studying Sex Differences in Animal Models of Addiction: An Emphasis on Alcohol-Related Behaviors, ACS Chem Neurosci.

2. Koob, G. F., and Volkow, N. D. (2016) Neurobiology of addiction: a neurocircuitry analysis, Lancet Psychiatry 3, 760-773.

3. Hasin, D. S., O'Brien, C. P., Auriacombe, M., Borges, G., Bucholz, K., Budney, A., Compton, W. M., Crowley, T., Ling, W., Petry, N. M., Schuckit, M., and Grant, B. F. (2013) DSM-5 criteria for substance use disorders: recommendations and rationale, Am J Psychiatry 170, 834- 851.

4. Rudd, R. A., Seth, P., David, F., and Scholl, L. (2016) Increases in Drug and Opioid-Involved Overdose Deaths - United States, 2010-2015, MMWR Morb Mortal Wkly Rep 65, 1445-1452.

5. Lipari, R. N., and Van Horn, S. L. (2013) Trends in Substance Use Disorders Among Adults Aged 18 or Older. In The CBHSQ Report, Rockville (MD).

6. Sacks, J. J., Gonzales, K. R., Bouchery, E. E., Tomedi, L. E., and Brewer, R. D. (2015) 2010 National and State Costs of Excessive Alcohol Consumption, Am J Prev Med 49, e73-e79.

7. Bouchery, E. E., Harwood, H. J., Sacks, J. J., Simon, C. J., and Brewer, R. D. (2011) Economic costs of excessive alcohol consumption in the U.S., 2006, American journal of preventive medicine 41, 516-524.

8. Niciu, M. J., and Arias, A. J. (2013) Targeted opioid receptor antagonists in the treatment of alcohol use disorders, CNS Drugs 27, 777-787.

9. Kim, Y., Hack, L. M., Ahn, E. S., and Kim, J. (2018) Practical outpatient pharmacotherapy for alcohol use disorder, Drugs Context 7, 212308.

10. Zucker, I., and Beery, A. K. (2010) Males still dominate animal studies, Nature 465, 690.

11. Mazure, C. M., and Jones, D. P. (2015) Twenty years and still counting: including women as participants and studying sex and gender in biomedical research, BMC Womens Health 15, 94.

12. Beery, A. K., and Zucker, I. (2011) Sex bias in neuroscience and biomedical research, Neurosci Biobehav Rev 35, 565-572.

13. Anderson, G. D. (2008) Gender differences in pharmacological response, Int Rev Neurobiol 83, 1-10.

14. Miller, M. A. (2001) Gender-based differences in the toxicity of pharmaceuticals--the Food and Drug Administration's perspective, Int J Toxicol 20, 149-152.

15. Vlassoff, C. (2007) Gender differences in determinants and consequences of health and illness, J Health Popul Nutr 25, 47-61.

114

16. Clayton, J. A., and Collins, F. S. (2014) Policy: NIH to balance sex in cell and animal studies, Nature 509, 282-283.

17. McCullough, L. D., de Vries, G. J., Miller, V. M., Becker, J. B., Sandberg, K., and McCarthy, M. M. (2014) NIH initiative to balance sex of animals in preclinical studies: generative questions to guide policy, implementation, and metrics, Biol Sex Differ 5, 15.

18. Grant, B. F., Goldstein, R. B., Saha, T. D., Chou, S. P., Jung, J., Zhang, H., Pickering, R. P., Ruan, W. J., Smith, S. M., Huang, B., and Hasin, D. S. (2015) Epidemiology of DSM-5 Alcohol Use Disorder: Results From the National Epidemiologic Survey on Alcohol and Related Conditions III, JAMA Psychiatry 72, 757-766.

19. Wilsnack, S. C. (2012) The GENACIS project: a review of findings and some implications for global needs in women-focused substance abuse prevention and intervention, Subst Abuse Rehabil 3, 5-15.

20. Holmila, M., and Raitasalo, K. (2005) Gender differences in drinking: why do they still exist?, Addiction 100, 1763-1769.

21. Wells, J. E., Haro, J. M., Karam, E., Lee, S., Lepine, J. P., Medina-Mora, M. E., Nakane, H., Posada, J., Anthony, J. C., Cheng, H., Degenhardt, L., Angermeyer, M., Bruffaerts, R., de Girolamo, G., de Graaf, R., Glantz, M., and Gureje, O. (2011) Cross-national comparisons of sex differences in opportunities to use alcohol or drugs, and the transitions to use, Subst Use Misuse 46, 1169-1178.

22. Becker, J. B., McClellan, M., and Reed, B. G. (2016) Sociocultural context for sex differences in addiction, Addict Biol 21, 1052-1059.

23. Keyes, K. M., Grant, B. F., and Hasin, D. S. (2008) Evidence for a closing gender gap in alcohol use, abuse, and dependence in the United States population, Drug Alcohol Depend 93, 21-29.

24. Colell, E., Sanchez-Niubo, A., and Domingo-Salvany, A. (2013) Sex differences in the cumulative incidence of substance use by birth cohort, Int J Drug Policy 24, 319-325.

25. White, A., Castle, I. J., Chen, C. M., Shirley, M., Roach, D., and Hingson, R. (2015) Converging Patterns of Alcohol Use and Related Outcomes Among Females and Males in the United States, 2002 to 2012, Alcohol Clin Exp Res 39, 1712-1726.

26. Hernandez-Avila, C. A., Rounsaville, B. J., and Kranzler, H. R. (2004) Opioid-, cannabis- and alcohol-dependent women show more rapid progression to substance abuse treatment, Drug Alcohol Depend 74, 265-272.

27. Becker, J. B. (2016) Sex differences in addiction, Dialogues Clin Neurosci 18, 395-402.

28. Agabio, R., Pisanu, C., Gessa, G. L., and Franconi, F. (2017) Sex Differences in Alcohol Use Disorder, Curr Med Chem 24, 2661-2670.

115

29. Wilsnack, S. C., Wilsnack, R. W., and Kantor, L. W. (2013) Focus on: women and the costs of alcohol use, Alcohol Res 35, 219-228.

30. (2000) 10th Special Report to the U.S. Congress on Alcohol and Health, U.S. Department of Health and Human Services, NIAAA.

31. (2014) Excessive Alcohol Use and Risks to Women's Health, Centers for Disease Control and Prevention (CDC).

32. Kerr-Correa, F., Igami, T. Z., Hiroce, V., and Tucci, A. M. (2007) Patterns of alcohol use between genders: a cross-cultural evaluation, J Affect Disord 102, 265-275.

33. Erol, A., and Karpyak, V. M. (2015) Sex and gender-related differences in alcohol use and its consequences: Contemporary knowledge and future research considerations, Drug Alcohol Depend 156, 1-13.

34. Greenfield, S. F., Back, S. E., Lawson, K., and Brady, K. T. (2010) Substance abuse in women, Psychiatr Clin North Am 33, 339-355.

35. (2004) NIAAA council approves definition of binge drinking., Council NIoAAaAA. NIAAA Newsletter.

36. Wen, X. J., Kanny, D., Thompson, W. W., Okoro, C. A., Town, M., and Balluz, L. S. (2012) Binge drinking intensity and health-related quality of life among US adult binge drinkers, Prev Chronic Dis 9, E86.

37. Bekman, N. M., Winward, J. L., Lau, L. L., Wagner, C. C., and Brown, S. A. (2013) The impact of adolescent binge drinking and sustained abstinence on affective state, Alcohol Clin Exp Res 37, 1432-1439.

38. Conway, K. P., Compton, W., Stinson, F. S., and Grant, B. F. (2006) Lifetime comorbidity of DSM-IV mood and anxiety disorders and specific drug use disorders: results from the National Epidemiologic Survey on Alcohol and Related Conditions, J Clin Psychiatry 67, 247-257.

39. McCance-Katz, E. F., Hart, C. L., Boyarsky, B., Kosten, T., and Jatlow, P. (2005) Gender effects following repeated administration of cocaine and alcohol in humans, Subst Use Misuse 40, 511-528.

40. Carter, A. C., Capone, C., and Short, E. E. (2011) Co-occurring Posttraumatic Stress Disorder and Alcohol Use Disorders in Veteran Populations, J Dual Diagn 7, 285-299.

41. Yoon, G., Petrakis, I. L., and Rosenheck, R. A. (2015) Correlates of major depressive disorder with and without comorbid alcohol use disorder nationally in the veterans health administration, Am J Addict 24, 419-426.

42. Fuehrlein, B. S., Mota, N., Arias, A. J., Trevisan, L. A., Kachadourian, L. K., Krystal, J. H., Southwick, S. M., and Pietrzak, R. H. (2016) The burden of alcohol use disorders in US military

116 veterans: results from the National Health and Resilience in Veterans Study, Addiction 111, 1786-1794.

43. Koob, G. F. (2013) Addiction is a Reward Deficit and Stress Surfeit Disorder, Front Psychiatry 4, 72.

44. Lynch, W. J., Nicholson, K. L., Dance, M. E., Morgan, R. W., and Foley, P. L. (2010) Animal models of substance abuse and addiction: implications for science, animal welfare, and society, Comp Med 60, 177-188.

45. Grant, K. A., and Bennett, A. J. (2003) Advances in nonhuman primate alcohol abuse and alcoholism research, Pharmacol Ther 100, 235-255.

46. Clark, R., and Polish, E. (1960) Avoidance Conditioning and Alcohol Consumption in Rhesus Monkeys, Science 132, 223-224.

47. Fitz-Gerald, F. L., Barfield, M. A., and Warrington, R. J. (1968) Voluntary alcohol consumption in chimpanzees and orangutans, Q J Stud Alcohol 29, 330-336.

48. Vivian, J. A., Green, H. L., Young, J. E., Majerksy, L. S., Thomas, B. W., Shively, C. A., Tobin, J. R., Nader, M. A., and Grant, K. A. (2001) Induction and maintenance of ethanol self- administration in cynomolgus monkeys (Macaca fascicularis): long-term characterization of sex and individual differences, Alcohol Clin Exp Res 25, 1087-1097.

49. Fahlke, C., Lorenz, J. G., Long, J., Champoux, M., Suomi, S. J., and Higley, J. D. (2000) Rearing experiences and stress-induced plasma cortisol as early risk factors for excessive alcohol consumption in nonhuman primates, Alcohol Clin Exp Res 24, 644-650.

50. Rhodes, J. S., Ford, M. M., Yu, C. H., Brown, L. L., Finn, D. A., Garland, T., Jr., and Crabbe, J. C. (2007) Mouse inbred strain differences in ethanol drinking to intoxication, Genes Brain Behav 6, 1-18.

51. Jury, N. J., DiBerto, J. F., Kash, T. L., and Holmes, A. (2017) Sex differences in the behavioral sequelae of chronic ethanol exposure, Alcohol 58, 53-60.

52. Priddy, B. M., Carmack, S. A., Thomas, L. C., Vendruscolo, J. C., Koob, G. F., and Vendruscolo, L. F. (2017) Sex, strain, and estrous cycle influences on alcohol drinking in rats, Pharmacol Biochem Behav 152, 61-67.

53. Becker, J. B., and Koob, G. F. (2016) Sex Differences in Animal Models: Focus on Addiction, Pharmacol Rev 68, 242-263.

54. Kantak, K. M., and Luzzo, C. (2007) Ethanol vapor self-administration in adult C57BL/6J male mice, Drug Alcohol Depend 86, 123-131.

55. Becker, J. B., and Hu, M. (2008) Sex differences in drug abuse, Front Neuroendocrinol 29, 36-47.

117

56. Moore, C. F., and Lynch, W. J. (2015) Alcohol preferring (P) rats as a model for examining sex differences in alcohol use disorder and its treatment, Pharmacol Biochem Behav 132, 1-9.

57. Bertholomey, M. L., Nagarajan, V., and Torregrossa, M. M. (2016) Sex differences in reinstatement of alcohol seeking in response to cues and yohimbine in rats with and without a history of adolescent corticosterone exposure, Psychopharmacology (Berl) 233, 2277-2287.

58. Bertholomey, M. L., and Torregrossa, M. M. (2017) Gonadal hormones affect alcohol drinking, but not cue+yohimbine-induced alcohol seeking, in male and female rats, Physiology & behavior.

59. Randall, P. A., Stewart, R. T., and Besheer, J. (2017) Sex differences in alcohol self- administration and relapse-like behavior in Long-Evans rats, Pharmacol Biochem Behav 156, 1- 9.

60. Prus, A. J., James, J. R., and Rosecrans, J. A. (2009) Conditioned Place Preference. In Methods of Behavior Analysis in Neuroscience (Buccafusco, J. J., Ed.) 2nd ed., Boca Raton (FL).

61. Cunningham, C. L., Gremel, C. M., and Groblewski, P. A. (2006) Drug-induced conditioned place preference and aversion in mice, Nat Protoc 1, 1662-1670.

62. Lucke-Wold, B. (2011) The Varied Uses of Conditioned Place Preference in Behavioral Neuroscience Research: An Investigation of Alcohol Administration in Model Organisms, Impulse (Columbia) 2011.

63. Tzschentke, T. M. (2007) Measuring reward with the conditioned place preference (CPP) paradigm: update of the last decade, Addict Biol 12, 227-462.

64. Gawel, K., Labuz, K., Gibula-Bruzda, E., Jenda, M., Marszalek-Grabska, M., Silberring, J., and Kotlinska, J. H. (2016) Acquisition and reinstatement of ethanol-induced conditioned place preference in rats: Effects of the cholinesterase inhibitors donepezil and rivastigmine, J Psychopharmacol 30, 676-687.

65. Kotlinska, J., Pachuta, A., Dylag, T., and Silberring, J. (2007) Neuropeptide FF (NPFF) reduces the expression of morphine- but not of ethanol-induced conditioned place preference in rats, Peptides 28, 2235-2242.

66. Kotlinska, J. H., Bochenski, M., and Danysz, W. (2011) The role of group I mGlu receptors in the expression of ethanol-induced conditioned place preference and ethanol withdrawal seizures in rats, Eur J Pharmacol 670, 154-161.

67. Bienkowski, P., Kuca, P., Piasecki, J., and Kostowski, W. (1996) Low dose of ethanol induces conditioned place preference in rats after repeated exposures to ethanol or saline injections, Alcohol Alcohol 31, 547-553.

68. Gibula-Bruzda, E., Marszalek-Grabska, M., Gawel, K., Witkowska, E., Izdebski, J., and Kotlinska, J. H. (2015) The influence of the new enkephalin derivative,

118 cyclo[N(epsilon),N(beta)-carbonyl-d-Lys(2),Dap(5)] enkephalinamide (cUENK6), on reinstatement of ethanol-induced conditioned place preference in rats, Physiol Behav 145, 50-56.

69. Torres, O. V., Walker, E. M., Beas, B. S., and O'Dell, L. E. (2014) Female rats display enhanced rewarding effects of ethanol that are hormone dependent, Alcohol Clin Exp Res 38, 108-115.

70. Cunningham, C. L., and Shields, C. N. (2018) Effects of sex on ethanol conditioned place preference, activity and variability in C57BL/6J and DBA/2J mice, Pharmacol Biochem Behav 173, 84-89.

71. Katz, J. L., and Higgins, S. T. (2003) The validity of the reinstatement model of craving and relapse to drug use, Psychopharmacology (Berl) 168, 21-30.

72. Roger-Sanchez, C., Aguilar, M. A., Rodriguez-Arias, M., Aragon, C. M., and Minarro, J. (2012) Age- and sex-related differences in the acquisition and reinstatement of ethanol CPP in mice, Neurotoxicol Teratol 34, 108-115.

73. Belknap, J. K., Crabbe, J. C., and Young, E. R. (1993) Voluntary consumption of ethanol in 15 inbred mouse strains, Psychopharmacology 112, 503-510.

74. Yoneyama, N., Crabbe, J. C., Ford, M. M., Murillo, A., and Finn, D. A. (2008) Voluntary ethanol consumption in 22 inbred mouse strains, Alcohol 42, 149-160.

75. Wise, R. A. (1973) Voluntary ethanol intake in rats following exposure to ethanol on various schedules, Psychopharmacologia 29, 203-210.

76. Simms, J. A., Steensland, P., Medina, B., Abernathy, K. E., Chandler, L. J., Wise, R., and Bartlett, S. E. (2008) Intermittent access to 20% ethanol induces high ethanol consumption in Long-Evans and Wistar rats, Alcohol Clin Exp Res 32, 1816-1823.

77. Varlinskaya, E. I., Truxell, E. M., and Spear, L. P. (2015) Ethanol intake under social circumstances or alone in sprague-dawley rats: impact of age, sex, social activity, and social anxiety-like behavior, Alcoholism, clinical and experimental research 39, 117-125.

78. Sluyter, F., Hof, M., Ellenbroek, B. A., Degen, S. B., and Cools, A. R. (2000) Genetic, sex, and early environmental effects on the voluntary alcohol intake in Wistar rats, Pharmacol Biochem Behav 67, 801-808.

79. Li, T. K., and Lumeng, L. (1984) Alcohol preference and voluntary alcohol intakes of inbred rat strains and the National Institutes of Health heterogeneous stock of rats, Alcohol Clin Exp Res 8, 485-486.

80. Lancaster, F. E., Brown, T. D., Coker, K. L., Elliott, J. A., and Wren, S. B. (1996) Sex differences in alcohol preference and drinking patterns emerge during the early postpubertal period, Alcohol Clin Exp Res 20, 1043-1049.

119

81. Lancaster, F. E., and Spiegel, K. S. (1992) Sex differences in pattern of drinking, Alcohol 9, 415-420.

82. Almeida, O. F., Shoaib, M., Deicke, J., Fischer, D., Darwish, M. H., and Patchev, V. K. (1998) Gender differences in ethanol preference and ingestion in rats. The role of the gonadal steroid environment, J Clin Invest 101, 2677-2685.

83. Juarez, J., and Barrios de Tomasi, E. (1999) Sex differences in alcohol drinking patterns during forced and voluntary consumption in rats, Alcohol 19, 15-22.

84. Vendruscolo, L. F., Terenina-Rigaldie, E., Raba, F., Ramos, A., Takahashi, R. N., and Mormede, P. (2006) Evidence for a female-specific effect of a chromosome 4 locus on anxiety- related behaviors and ethanol drinking in rats, Genes Brain Behav 5, 441-450.

85. Vendruscolo, L. F., Izidio, G. S., Takahashi, R. N., and Ramos, A. (2008) Chronic methylphenidate treatment during adolescence increases anxiety-related behaviors and ethanol drinking in adult spontaneously hypertensive rats, Behav Pharmacol 19, 21-27.

86. de la Torre, M. L., Escarabajal, M. D., and Aguero, A. (2015) Sex differences in adult Wistar rats in the voluntary consumption of ethanol after pre-exposure to ethanol-induced flavor avoidance learning, Pharmacol Biochem Behav 137, 7-15.

87. Bell, R. L., Rodd, Z. A., Sable, H. J., Schultz, J. A., Hsu, C. C., Lumeng, L., Murphy, J. M., and McBride, W. J. (2006) Daily patterns of ethanol drinking in peri-adolescent and adult alcohol-preferring (P) rats, Pharmacol Biochem Behav 83, 35-46.

88. Schramm-Sapyta, N. L., Francis, R., MacDonald, A., Keistler, C., O'Neill, L., and Kuhn, C. M. (2014) Effect of sex on ethanol consumption and conditioned taste aversion in adolescent and adult rats, Psychopharmacology 231, 1831-1839.

89. Vetter-O'Hagen, C., Varlinskaya, E., and Spear, L. (2009) Sex differences in ethanol intake and sensitivity to aversive effects during adolescence and adulthood, Alcohol Alcohol 44, 547- 554.

90. Marco, E. M., Ballesta, J. A., Irala, C., Hernandez, M. D., Serrano, M. E., Mela, V., Lopez- Gallardo, M., and Viveros, M. P. (2017) Sex-dependent influence of chronic mild stress (CMS) on voluntary alcohol consumption; study of neurobiological consequences, Pharmacol Biochem Behav 152, 68-80.

91. Thiele, T. E., and Navarro, M. (2014) "Drinking in the dark" (DID) procedures: a model of binge-like ethanol drinking in non-dependent mice, Alcohol 48, 235-241.

92. Rhodes, J. S., Best, K., Belknap, J. K., Finn, D. A., and Crabbe, J. C. (2005) Evaluation of a simple model of ethanol drinking to intoxication in C57BL/6J mice, Physiol Behav 84, 53-63.

93. Sanchis-Segura, C., and Becker, J. B. (2016) Why we should consider sex (and study sex differences) in addiction research, Addict Biol 21, 995-1006.

120

94. Arnold, A. P. (2012) The end of gonad-centric sex determination in mammals, Trends Genet 28, 55-61.

95. Arnold, A. P., Chen, X., Link, J. C., Itoh, Y., and Reue, K. (2013) Cell-autonomous sex determination outside of the gonad, Dev Dyn 242, 371-379.

96. Arnold, A. P., and Chen, X. (2009) What does the "four core genotypes" mouse model tell us about sex differences in the brain and other tissues?, Front Neuroendocrinol 30, 1-9.

97. Justice, A. J., and De Wit, H. (2000) Acute effects of d-amphetamine during the early and late follicular phases of the menstrual cycle in women, Pharmacol Biochem Behav 66, 509-515.

98. Justice, A. J., and de Wit, H. (1999) Acute effects of d-amphetamine during the follicular and luteal phases of the menstrual cycle in women, Psychopharmacology (Berl) 145, 67-75.

99. Justice, A. J., and de Wit, H. (2000) Acute effects of estradiol pretreatment on the response to d-amphetamine in women, Neuroendocrinology 71, 51-59.

100. Uhart, M., Oswald, L., McCaul, M. E., Chong, R., and Wand, G. S. (2006) Hormonal responses to psychological stress and family history of alcoholism, Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 31, 2255-2263.

101. Evans, S. M., and Levin, F. R. (2011) Response to alcohol in women: role of the menstrual cycle and a family history of alcoholism, Drug and alcohol dependence 114, 18-30.

102. Terner, J. M., and de Wit, H. (2006) Menstrual cycle phase and responses to drugs of abuse in humans, Drug and alcohol dependence 84, 1-13.

103. Mihm, M., Gangooly, S., and Muttukrishna, S. (2011) The normal menstrual cycle in women, Anim Reprod Sci 124, 229-236.

104. Becker, J. B., Arnold, A. P., Berkley, K. J., Blaustein, J. D., Eckel, L. A., Hampson, E., Herman, J. P., Marts, S., Sadee, W., Steiner, M., Taylor, J., and Young, E. (2005) Strategies and methods for research on sex differences in brain and behavior, Endocrinology 146, 1650-1673.

105. Wilson, D. M., Killen, J. D., Hayward, C., Robinson, T. N., Hammer, L. D., Kraemer, H. C., Varady, A., and Taylor, C. B. (1994) Timing and rate of sexual maturation and the onset of cigarette and alcohol use among teenage girls, Arch Pediatr Adolesc Med 148, 789-795.

106. Lund, E., and Jacobsen, B. K. (1990) Use of oral contraceptives in relation to dietary habits and alcohol consumption, Contraception 42, 171-177.

107. Muti, P., Trevisan, M., Micheli, A., Krogh, V., Bolelli, G., Sciajno, R., Schunemann, H. J., and Berrino, F. (1998) Alcohol consumption and total estradiol in premenopausal women, Cancer Epidemiol Biomarkers Prev 7, 189-193.

108. Martin, C. A., Mainous, A. G., 3rd, Curry, T., and Martin, D. (1999) Alcohol use in adolescent females: correlates with estradiol and testosterone, Am J Addict 8, 9-14.

121

109. Martel, M. M., Eisenlohr-Moul, T., and Roberts, B. (2017) Interactive effects of ovarian steroid hormones on alcohol use and binge drinking across the menstrual cycle, J Abnorm Psychol 126, 1104-1113.

110. Mello, N. K., Bree, M. P., and Mendelson, J. H. (1986) Alcohol and food self- administration by female Macaque monkeys as a function of menstrual cycle phase, Physiol Behav 36, 959-966.

111. Ford, M. M., Eldridge, J. C., and Samson, H. H. (2002) Ethanol consumption in the female Long-Evans rat: a modulatory role of estradiol, Alcohol 26, 103-113.

112. Forger, N. G., and Morin, L. P. (1982) Reproductive state modulates ethanol intake in rats: effects of ovariectomy, ethanol concentration, estrous cycle and pregnancy, Pharmacol Biochem Behav 17, 323-331.

113. Becker, H. C., Anton, R. F., De Trana, C., and Randall, C. L. (1985) Sensitivity to ethanol in female mice: effects of ovariectomy and strain, Life Sci 37, 1293-1300.

114. Vetter-O'Hagen, C. S., and Spear, L. P. (2011) The effects of gonadectomy on age- and sex- typical patterns of ethanol consumption in Sprague-Dawley rats, Alcohol Clin Exp Res 35, 2039- 2049.

115. Hilakivi-Clarke, L. (1996) Role of estradiol in alcohol intake and alcohol-related behaviors, Journal of studies on alcohol 57, 162-170.

116. Ford, M. M., Eldridge, J. C., and Samson, H. H. (2004) Determination of an estradiol dose- response relationship in the modulation of ethanol intake, Alcohol Clin Exp Res 28, 20-28.

117. Satta, R., Hilderbrand, E. R., and Lasek, A. W. (2018) Ovarian Hormones Contribute to High Levels of Binge-Like Drinking by Female Mice, Alcohol Clin Exp Res 42, 286-294.

118. Roberts, A. J., Smith, A. D., Weiss, F., Rivier, C., and Koob, G. F. (1998) Estrous cycle effects on operant responding for ethanol in female rats, Alcohol Clin Exp Res 22, 1564-1569.

119. De Vries, G. J., Rissman, E. F., Simerly, R. B., Yang, L. Y., Scordalakes, E. M., Auger, C. J., Swain, A., Lovell-Badge, R., Burgoyne, P. S., and Arnold, A. P. (2002) A model system for study of sex chromosome effects on sexually dimorphic neural and behavioral traits, J Neurosci 22, 9005-9014.

120. Cox, K. H., Bonthuis, P. J., and Rissman, E. F. (2014) Mouse model systems to study sex chromosome genes and behavior: relevance to humans, Front Neuroendocrinol 35, 405-419.

121. Barker, J. M., Torregrossa, M. M., Arnold, A. P., and Taylor, J. R. (2010) Dissociation of genetic and hormonal influences on sex differences in alcoholism-related behaviors, J Neurosci 30, 9140-9144.

122. Shoham, Z., and Schachter, M. (1996) Estrogen biosynthesis--regulation, action, remote effects, and value of monitoring in ovarian stimulation cycles, Fertility and sterility 65, 687-701.

122

123. Caligioni, C. S. (2009) Assessing reproductive status/stages in mice, Curr Protoc Neurosci Appendix 4, Appendix 4I.

124. Tata, J. R. (2005) One hundred years of hormones, EMBO Rep 6, 490-496.

125. Allen, E., and Doisy, E. A. (1983) Landmark article Sept 8, 1923. An ovarian hormone. Preliminary report on its localization, extraction and partial purification, and action in test animals. By Edgar Allen and Edward A. Doisy, JAMA 250, 2681-2683.

126. Simpson, E., and Santen, R. J. (2015) Celebrating 75 years of oestradiol, J Mol Endocrinol 55, T1-20.

127. Guerriero, G. (2009) Vertebrate sex steroid receptors: evolution, ligands, and neurodistribution, Ann N Y Acad Sci 1163, 154-168.

128. Baker, M. E. (2013) What are the physiological estrogens?, Steroids 78, 337-340.

129. Cui, J., Shen, Y., and Li, R. (2013) Estrogen synthesis and signaling pathways during aging: from periphery to brain, Trends Mol Med 19, 197-209.

130. Tsutsui, K., Ukena, K., Sakamoto, H., Okuyama, S., and Haraguchi, S. (2011) Biosynthesis, mode of action, and functional significance of neurosteroids in the purkinje cell, Frontiers in endocrinology 2, 61.

131. Panzica, G. C., and Melcangi, R. C. (2008) The endocrine nervous system: source and target for neuroactive steroids, Brain research reviews 57, 271-276.

132. Barakat, R., Oakley, O., Kim, H., Jin, J., and Ko, C. J. (2016) Extra-gonadal sites of estrogen biosynthesis and function, BMB Rep 49, 488-496.

133. Simpson, E. R. (2003) Sources of estrogen and their importance, J Steroid Biochem Mol Biol 86, 225-230.

134. Nelson, L. R., and Bulun, S. E. (2001) Estrogen production and action, J Am Acad Dermatol 45, S116-124.

135. Holinka, C. F., Diczfalusy, E., and Coelingh Bennink, H. J. (2008) Estetrol: a unique steroid in human pregnancy, J Steroid Biochem Mol Biol 110, 138-143.

136. Hojo, Y., and Kawato, S. (2018) Neurosteroids in Adult Hippocampus of Male and Female Rodents: Biosynthesis and Actions of Sex Steroids, Frontiers in endocrinology 9, 183.

137. Fishman, J., and Raju, M. S. (1981) Mechanism of estrogen biosynthesis. Stereochemistry of C-1 hydrogen elimination in the aromatization of 2 beta-hydroxy-19-oxoandrostenedione, The Journal of biological chemistry 256, 4472-4477.

138. Havelock, J. C., Rainey, W. E., and Carr, B. R. (2004) Ovarian granulosa cell lines, Mol Cell Endocrinol 228, 67-78.

123

139. Faulds, M. H., Zhao, C., Dahlman-Wright, K., and Gustafsson, J. A. (2012) The diversity of sex steroid action: regulation of metabolism by estrogen signaling, The Journal of endocrinology 212, 3-12.

140. McEwen, B. (2002) Estrogen actions throughout the brain, Recent progress in hormone research 57, 357-384.

141. McEwen, B. S., and Alves, S. E. (1999) Estrogen actions in the central nervous system, Endocrine reviews 20, 279-307.

142. Mitra, S. W., Hoskin, E., Yudkovitz, J., Pear, L., Wilkinson, H. A., Hayashi, S., Pfaff, D. W., Ogawa, S., Rohrer, S. P., Schaeffer, J. M., McEwen, B. S., and Alves, S. E. (2003) Immunolocalization of estrogen receptor beta in the mouse brain: comparison with estrogen receptor alpha, Endocrinology 144, 2055-2067.

143. Lee, H. R., Kim, T. H., and Choi, K. C. (2012) Functions and physiological roles of two types of estrogen receptors, ERalpha and ERbeta, identified by estrogen receptor knockout mouse, Lab Anim Res 28, 71-76.

144. Talalay, P., Hurlock, B., and Williams-Ashman, H. G. (1958) ON A COENZYMATIC FUNCTION OF ESTRADIOL-17beta, Proceedings of the National Academy of Sciences of the United States of America 44, 862-884.

145. Jensen, E. V., Jacobson, H. I., Walf, A. A., and Frye, C. A. (2010) Estrogen action: a historic perspective on the implications of considering alternative approaches, Physiol Behav 99, 151-162.

146. Jensen, E. V. (1962) On the mechanism of estrogen action, Perspect Biol Med 6, 47-59.

147. Means, A. R., Comstock, J. P., Rosenfeld, G. C., and O'Malley, B. W. (1972) Ovalbumin messenger RNA of chick oviduct: partial characterization, estrogen dependence, and translation in vitro, Proceedings of the National Academy of Sciences of the United States of America 69, 1146-1150.

148. O'Malley, B. W. (1967) In vitro hormonal induction of a specific protein (avidin) in chick oviduct, Biochemistry 6, 2546-2551.

149. O'Malley, B. W., and McGuire, W. L. (1968) Studies on the mechanism of estrogen- mediated tissue differentiation: regulation of nuclear transcription and induction of new RNA species, Proceedings of the National Academy of Sciences of the United States of America 60, 1527-1534.

150. O'Malley, B. W., Rosenfeld, G. C., Comstock, J. P., and Means, A. R. (1972) Induction of specific translatable messenger RNA's by oestrogen and progesterone, Acta Endocrinol Suppl (Copenh) 168, 381-395.

151. O'Malley, B. W. (1971) Mechanisms of action of steroid hormones, N Engl J Med 284, 370- 377.

124

152. O'Malley, B. W., and Means, A. R. (1976) The mechanism of steroid-hormone regulation of transcription of specific eukaryotic genes, Prog Nucleic Acid Res Mol Biol 19, 403-419.

153. Means, A. R., and O'Malley, B. W. (1972) Mechanism of estrogen action: early transcriptional and translational events, Metabolism 21, 357-370.

154. Green, S., and Chambon, P. (1988) Nuclear receptors enhance our understanding of transcription regulation, Trends Genet 4, 309-314.

155. Kuiper, G. G., Enmark, E., Pelto-Huikko, M., Nilsson, S., and Gustafsson, J. A. (1996) Cloning of a novel receptor expressed in rat prostate and ovary, Proceedings of the National Academy of Sciences of the United States of America 93, 5925-5930.

156. Toran-Allerand, C. D. (2004) Minireview: A plethora of estrogen receptors in the brain: where will it end?, Endocrinology 145, 1069-1074.

157. Prossnitz, E. R., and Hathaway, H. J. (2015) What have we learned about GPER function in physiology and disease from knockout mice?, J Steroid Biochem Mol Biol 153, 114-126.

158. Evans, R. M. (1988) The steroid and thyroid hormone receptor superfamily, Science 240, 889-895.

159. Kumar, V., Green, S., Stack, G., Berry, M., Jin, J. R., and Chambon, P. (1987) Functional domains of the human estrogen receptor, Cell 51, 941-951.

160. Mangelsdorf, D. J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., and Evans, R. M. (1995) The nuclear receptor superfamily: the second decade, Cell 83, 835-839.

161. Pawlak, M., Lefebvre, P., and Staels, B. (2012) General molecular biology and architecture of nuclear receptors, Curr Top Med Chem 12, 486-504.

162. Kumar, R., Zakharov, M. N., Khan, S. H., Miki, R., Jang, H., Toraldo, G., Singh, R., Bhasin, S., and Jasuja, R. (2011) The dynamic structure of the estrogen receptor, J Amino Acids 2011, 812540.

163. Yasar, P., Ayaz, G., User, S. D., Gupur, G., and Muyan, M. (2017) Molecular mechanism of estrogen-estrogen receptor signaling, Reprod Med Biol 16, 4-20.

164. Warnmark, A., Treuter, E., Wright, A. P., and Gustafsson, J. A. (2003) Activation functions 1 and 2 of nuclear receptors: molecular strategies for transcriptional activation, Molecular endocrinology 17, 1901-1909.

165. Kong, E. H., Pike, A. C., and Hubbard, R. E. (2003) Structure and mechanism of the oestrogen receptor, Biochem Soc Trans 31, 56-59.

166. Gougelet, A., Mueller, S. O., Korach, K. S., and Renoir, J. M. (2007) Oestrogen receptors pathways to oestrogen responsive elements: the transactivation function-1 acts as the keystone of

125 oestrogen receptor (ER)beta-mediated transcriptional repression of ERalpha, J Steroid Biochem Mol Biol 104, 110-122.

167. Klein-Hitpass, L., Ryffel, G. U., Heitlinger, E., and Cato, A. C. (1988) A 13 bp palindrome is a functional estrogen responsive element and interacts specifically with estrogen receptor, Nucleic Acids Res 16, 647-663.

168. Klein-Hitpass, L., Tsai, S. Y., Greene, G. L., Clark, J. H., Tsai, M. J., and O'Malley, B. W. (1989) Specific binding of estrogen receptor to the estrogen response element, Molecular and cellular biology 9, 43-49.

169. Geserick, C., Meyer, H. A., and Haendler, B. (2005) The role of DNA response elements as allosteric modulators of steroid receptor function, Mol Cell Endocrinol 236, 1-7.

170. Skafar, D. F., and Zhao, C. (2008) The multifunctional estrogen receptor-alpha F domain, Endocrine 33, 1-8.

171. Koide, A., Zhao, C., Naganuma, M., Abrams, J., Deighton-Collins, S., Skafar, D. F., and Koide, S. (2007) Identification of regions within the F domain of the human estrogen receptor alpha that are important for modulating transactivation and protein-protein interactions, Molecular endocrinology 21, 829-842.

172. Montano, M. M., Muller, V., Trobaugh, A., and Katzenellenbogen, B. S. (1995) The carboxy-terminal F domain of the human estrogen receptor: role in the transcriptional activity of the receptor and the effectiveness of antiestrogens as estrogen antagonists, Molecular endocrinology 9, 814-825.

173. Yang, J., Singleton, D. W., Shaughnessy, E. A., and Khan, S. A. (2008) The F-domain of estrogen receptor-alpha inhibits ligand induced receptor dimerization, Mol Cell Endocrinol 295, 94-100.

174. Edwards, D. P. (2000) The role of coactivators and corepressors in the biology and mechanism of action of steroid hormone receptors, J Mammary Gland Biol Neoplasia 5, 307- 324.

175. Seielstad, D. A., Carlson, K. E., Kushner, P. J., Greene, G. L., and Katzenellenbogen, J. A. (1995) Analysis of the structural core of the human estrogen receptor ligand binding domain by selective proteolysis/mass spectrometric analysis, Biochemistry 34, 12605-12615.

176. Heldring, N., Pike, A., Andersson, S., Matthews, J., Cheng, G., Hartman, J., Tujague, M., Strom, A., Treuter, E., Warner, M., and Gustafsson, J. A. (2007) Estrogen receptors: how do they signal and what are their targets, Physiological reviews 87, 905-931.

177. Petersen, D. N., Tkalcevic, G. T., Koza-Taylor, P. H., Turi, T. G., and Brown, T. A. (1998) Identification of estrogen receptor beta2, a functional variant of estrogen receptor beta expressed in normal rat tissues, Endocrinology 139, 1082-1092.

126

178. Stauffer, S. R., Coletta, C. J., Tedesco, R., Nishiguchi, G., Carlson, K., Sun, J., Katzenellenbogen, B. S., and Katzenellenbogen, J. A. (2000) Pyrazole ligands: structure- affinity/activity relationships and estrogen receptor-alpha-selective agonists, Journal of medicinal chemistry 43, 4934-4947.

179. Meyers, M. J., Sun, J., Carlson, K. E., Marriner, G. A., Katzenellenbogen, B. S., and Katzenellenbogen, J. A. (2001) Estrogen receptor-beta potency-selective ligands: structure- activity relationship studies of diarylpropionitriles and their acetylene and polar analogues, Journal of medicinal chemistry 44, 4230-4251.

180. Sun, J., Baudry, J., Katzenellenbogen, J. A., and Katzenellenbogen, B. S. (2003) Molecular basis for the subtype discrimination of the estrogen receptor-beta-selective ligand, diarylpropionitrile, Molecular endocrinology 17, 247-258.

181. Arnal, J. F., Lenfant, F., Metivier, R., Flouriot, G., Henrion, D., Adlanmerini, M., Fontaine, C., Gourdy, P., Chambon, P., Katzenellenbogen, B., and Katzenellenbogen, J. (2017) Membrane and Nuclear Estrogen Receptor Alpha Actions: From Tissue Specificity to Medical Implications, Physiological reviews 97, 1045-1087.

182. Mott, N. N., and Pak, T. R. (2012) Characterisation of human oestrogen receptor beta (ERbeta) splice variants in neuronal cells, J Neuroendocrinol 24, 1311-1321.

183. Lin, A. H., Li, R. W., Ho, E. Y., Leung, G. P., Leung, S. W., Vanhoutte, P. M., and Man, R. Y. (2013) Differential ligand binding affinities of human estrogen receptor-alpha isoforms, PloS one 8, e63199.

184. Irsik, D. L., Carmines, P. K., and Lane, P. H. (2013) Classical estrogen receptors and ERalpha splice variants in the mouse, PloS one 8, e70926.

185. Nilsson, S., Makela, S., Treuter, E., Tujague, M., Thomsen, J., Andersson, G., Enmark, E., Pettersson, K., Warner, M., and Gustafsson, J. A. (2001) Mechanisms of estrogen action, Physiological reviews 81, 1535-1565.

186. McDevitt, M. A., Glidewell-Kenney, C., Jimenez, M. A., Ahearn, P. C., Weiss, J., Jameson, J. L., and Levine, J. E. (2008) New insights into the classical and non-classical actions of estrogen: evidence from estrogen receptor knock-out and knock-in mice, Mol Cell Endocrinol 290, 24-30.

187. Galea, L. A. M., Frick, K. M., Hampson, E., Sohrabji, F., and Choleris, E. (2017) Why estrogens matter for behavior and brain health, Neurosci Biobehav Rev 76, 363-379.

188. Fortress, A. M., and Frick, K. M. (2014) Epigenetic regulation of estrogen-dependent memory, Front Neuroendocrinol 35, 530-549.

189. Banerjee, S., Chambliss, K. L., Mineo, C., and Shaul, P. W. (2014) Recent insights into non-nuclear actions of estrogen receptor alpha, Steroids 81, 64-69.

127

190. Carlstrom, L., Ke, Z. J., Unnerstall, J. R., Cohen, R. S., and Pandey, S. C. (2001) Estrogen modulation of the cyclic AMP response element-binding protein pathway. Effects of long-term and acute treatments, Neuroendocrinology 74, 227-243.

191. Lalmansingh, A. S., and Uht, R. M. (2008) Estradiol regulates corticotropin-releasing hormone gene (crh) expression in a rapid and phasic manner that parallels estrogen receptor- alpha and -beta recruitment to a 3',5'-cyclic adenosine 5'-monophosphate regulatory region of the proximal crh promoter, Endocrinology 149, 346-357.

192. Zhao, C., Dahlman-Wright, K., and Gustafsson, J. A. (2010) Estrogen signaling via estrogen receptor {beta}, The Journal of biological chemistry 285, 39575-39579.

193. Zhao, C., Dahlman-Wright, K., and Gustafsson, J. A. (2008) Estrogen receptor beta: an overview and update, Nuclear receptor signaling 6, e003.

194. Levin, E. R. (2009) Plasma membrane estrogen receptors, Trends in endocrinology and metabolism: TEM 20, 477-482.

195. Aronica, S. M., Kraus, W. L., and Katzenellenbogen, B. S. (1994) Estrogen action via the cAMP signaling pathway: stimulation of adenylate cyclase and cAMP-regulated gene transcription, Proceedings of the National Academy of Sciences of the United States of America 91, 8517-8521.

196. Zhou, Y., Watters, J. J., and Dorsa, D. M. (1996) Estrogen rapidly induces the phosphorylation of the cAMP response element binding protein in rat brain, Endocrinology 137, 2163-2166.

197. Gu, G., Rojo, A. A., Zee, M. C., Yu, J., and Simerly, R. B. (1996) Hormonal regulation of CREB phosphorylation in the anteroventral periventricular nucleus, The Journal of neuroscience : the official journal of the Society for Neuroscience 16, 3035-3044.

198. Maharjan, S., Serova, L. I., and Sabban, E. L. (2010) Membrane-initiated estradiol signaling increases tyrosine hydroxylase promoter activity with ER alpha in PC12 cells, Journal of neurochemistry 112, 42-55.

199. Boulware, M. I., Heisler, J. D., and Frick, K. M. (2013) The memory-enhancing effects of hippocampal estrogen receptor activation involve metabotropic glutamate receptor signaling, J Neurosci 33, 15184-15194.

200. Boulware, M. I., and Mermelstein, P. G. (2005) The influence of estradiol on nervous system function, Drug News Perspect 18, 631-637.

201. Meitzen, J., Luoma, J. I., Boulware, M. I., Hedges, V. L., Peterson, B. M., Tuomela, K., Britson, K. A., and Mermelstein, P. G. (2013) Palmitoylation of estrogen receptors is essential for neuronal membrane signaling, Endocrinology 154, 4293-4304.

202. Koob, G. F. (1992) Drugs of abuse: anatomy, pharmacology and function of reward pathways, Trends Pharmacol Sci 13, 177-184.

128

203. Olds, J., and Milner, P. (1954) Positive reinforcement produced by electrical stimulation of septal area and other regions of rat brain, J Comp Physiol Psychol 47, 419-427.

204. Adinoff, B. (2004) Neurobiologic processes in drug reward and addiction, Harv Rev Psychiatry 12, 305-320.

205. Routtenberg, A., Gardner, E. L., and Huang, Y. H. (1971) Self-stimulation pathways in the monkey, Macaca mulatta, Exp Neurol 33, 213-224.

206. Olds, J. (1956) Neurophysiology of drive, Psychiatr Res Rep Am Psychiatr Assoc 6, 15-20.

207. Olds, J. (1962) Hypothalamic substrates of reward, Physiological reviews 42, 554-604.

208. Olds, M. E., and Olds, J. (1963) Approach-avoidance analysis of rat diencephalon, The Journal of comparative neurology 120, 259-295.

209. Gallistel, C. R., Shizgal, P., and Yeomans, J. S. (1981) A portrait of the substrate for self- stimulation, Psychol Rev 88, 228-273.

210. You, Z. B., Chen, Y. Q., and Wise, R. A. (2001) Dopamine and glutamate release in the nucleus accumbens and ventral tegmental area of rat following lateral hypothalamic self- stimulation, Neuroscience 107, 629-639.

211. Gardner, E. L., and Ashby, C. R., Jr. (2000) Heterogeneity of the mesotelencephalic dopamine fibers: physiology and pharmacology, Neurosci Biobehav Rev 24, 115-118.

212. Lovinger, D. M., and Roberto, M. (2013) Synaptic effects induced by alcohol, Curr Top Behav Neurosci 13, 31-86.

213. Russo, S. J., and Nestler, E. J. (2013) The brain reward circuitry in mood disorders, Nat Rev Neurosci 14, 609-625.

214. Creed, M. C., Ntamati, N. R., and Tan, K. R. (2014) VTA GABA neurons modulate specific learning behaviors through the control of dopamine and cholinergic systems, Front Behav Neurosci 8, 8.

215. Seo, D. O., Funderburk, S. C., Bhatti, D. L., Motard, L. E., Newbold, D., Girven, K. S., McCall, J. G., Krashes, M., Sparta, D. R., and Bruchas, M. R. (2016) A GABAergic Projection from the Centromedial Nuclei of the Amygdala to Ventromedial Prefrontal Cortex Modulates Reward Behavior, J Neurosci 36, 10831-10842.

216. Morikawa, H., and Morrisett, R. A. (2010) Ethanol action on dopaminergic neurons in the ventral tegmental area: interaction with intrinsic ion channels and neurotransmitter inputs, Int Rev Neurobiol 91, 235-288.

217. Berridge, K. C., and Robinson, T. E. (1998) What is the role of dopamine in reward: hedonic impact, reward learning, or incentive salience?, Brain Res Brain Res Rev 28, 309-369.

129

218. Juarez, B., and Han, M. H. (2016) Diversity of Dopaminergic Neural Circuits in Response to Drug Exposure, Neuropsychopharmacology 41, 2424-2446.

219. Lammel, S., Lim, B. K., and Malenka, R. C. (2014) Reward and aversion in a heterogeneous midbrain dopamine system, Neuropharmacology 76 Pt B, 351-359.

220. Salamone, J. D., Cousins, M. S., and Snyder, B. J. (1997) Behavioral functions of nucleus accumbens dopamine: empirical and conceptual problems with the anhedonia hypothesis, Neurosci Biobehav Rev 21, 341-359.

221. Koob, G. F. (2013) Theoretical frameworks and mechanistic aspects of alcohol addiction: alcohol addiction as a reward deficit disorder, Curr Top Behav Neurosci 13, 3-30.

222. Cummings, J. A., and Becker, J. B. (2012) Quantitative assessment of female sexual motivation in the rat: Hormonal control of motivation, J Neurosci Methods 204, 227-233.

223. Yoest, K. E., Cummings, J. A., and Becker, J. B. (2014) Estradiol, dopamine and motivation, Cent Nerv Syst Agents Med Chem 14, 83-89.

224. Buss, D. M., and Schmitt, D. P. (1993) Sexual strategies theory: an evolutionary perspective on human mating, Psychol Rev 100, 204-232.

225. Gillies, G. E., and McArthur, S. (2010) Estrogen actions in the brain and the basis for differential action in men and women: a case for sex-specific medicines, Pharmacol Rev 62, 155- 198.

226. Andersson, S., Sundberg, M., Pristovsek, N., Ibrahim, A., Jonsson, P., Katona, B., Clausson, C. M., Zieba, A., Ramstrom, M., Soderberg, O., Williams, C., and Asplund, A. (2017) Corrigendum: Insufficient antibody validation challenges oestrogen receptor beta research, Nat Commun 8, 16164.

227. Andersson, S., Sundberg, M., Pristovsek, N., Ibrahim, A., Jonsson, P., Katona, B., Clausson, C. M., Zieba, A., Ramstrom, M., Soderberg, O., Williams, C., and Asplund, A. (2017) Insufficient antibody validation challenges oestrogen receptor beta research, Nat Commun 8, 15840.

228. Snyder, M. A., Smejkalova, T., Forlano, P. M., and Woolley, C. S. (2010) Multiple ERbeta antisera label in ERbeta knockout and null mouse tissues, J Neurosci Methods 188, 226-234.

229. Milner, T. A., Thompson, L. I., Wang, G., Kievits, J. A., Martin, E., Zhou, P., McEwen, B. S., Pfaff, D. W., and Waters, E. M. (2010) Distribution of estrogen receptor beta containing cells in the brains of bacterial artificial chromosome transgenic mice, Brain research 1351, 74-96.

230. Creutz, L. M., and Kritzer, M. F. (2002) Estrogen receptor-beta immunoreactivity in the midbrain of adult rats: regional, subregional, and cellular localization in the A10, A9, and A8 dopamine cell groups, The Journal of comparative neurology 446, 288-300.

130

231. Kritzer, M. F., and Creutz, L. M. (2008) Region and sex differences in constituent dopamine neurons and immunoreactivity for intracellular estrogen and androgen receptors in mesocortical projections in rats, J Neurosci 28, 9525-9535.

232. Kritzer, M. F. (1997) Selective colocalization of immunoreactivity for intracellular gonadal hormone receptors and tyrosine hydroxylase in the ventral tegmental area, substantia nigra, and retrorubral fields in the rat, The Journal of comparative neurology 379, 247-260.

233. Vanderhorst, V. G., Gustafsson, J. A., and Ulfhake, B. (2005) Estrogen receptor-alpha and - beta immunoreactive neurons in the brainstem and spinal cord of male and female mice: relationships to monoaminergic, cholinergic, and spinal projection systems, The Journal of comparative neurology 488, 152-179.

234. Shughrue, P. J., Lane, M. V., and Merchenthaler, I. (1997) Comparative distribution of estrogen receptor-alpha and -beta mRNA in the rat central nervous system, The Journal of comparative neurology 388, 507-525.

235. Koob, G. F., and Volkow, N. D. (2010) Neurocircuitry of addiction, Neuropsychopharmacology 35, 217-238.

236. Murray, E. A. (2007) The amygdala, reward and emotion, Trends Cogn Sci 11, 489-497.

237. Baxter, M. G., and Murray, E. A. (2002) The amygdala and reward, Nat Rev Neurosci 3, 563-573.

238. Stuber, G. D., Sparta, D. R., Stamatakis, A. M., van Leeuwen, W. A., Hardjoprajitno, J. E., Cho, S., Tye, K. M., Kempadoo, K. A., Zhang, F., Deisseroth, K., and Bonci, A. (2011) Excitatory transmission from the amygdala to nucleus accumbens facilitates reward seeking, Nature 475, 377-380.

239. Morrison, S. E., and Salzman, C. D. (2010) Re-valuing the amygdala, Curr Opin Neurobiol 20, 221-230.

240. Holder, M. K., and Mong, J. A. (2017) The Role of Ovarian Hormones and the Medial Amygdala in Sexual Motivation, Curr Sex Health Rep 9, 262-270.

241. Moncho-Bogani, J., Martinez-Garcia, F., Novejarque, A., and Lanuza, E. (2005) Attraction to sexual pheromones and associated odorants in female mice involves activation of the reward system and basolateral amygdala, The European journal of neuroscience 21, 2186-2198.

242. Parada, M., Chamas, L., Censi, S., Coria-Avila, G., and Pfaus, J. G. (2010) Clitoral stimulation induces conditioned place preference and Fos activation in the rat, Hormones and behavior 57, 112-118.

243. Garcia-Horsman, S. P., Agmo, A., and Paredes, R. G. (2008) Infusions of naloxone into the medial preoptic area, ventromedial nucleus of the hypothalamus, and amygdala block conditioned place preference induced by paced mating behavior, Hormones and behavior 54, 709-716.

131

244. Sakharkar, A. J., Zhang, H., Tang, L., Shi, G., and Pandey, S. C. (2012) Histone deacetylases (HDAC)-induced histone modifications in the amygdala: a role in rapid tolerance to the anxiolytic effects of ethanol, Alcohol Clin Exp Res 36, 61-71.

245. Pandey, S. C., Zhang, H., Roy, A., and Misra, K. (2006) Central and medial amygdaloid brain-derived neurotrophic factor signaling plays a critical role in alcohol-drinking and anxiety- like behaviors, J Neurosci 26, 8320-8331.

246. Gremel, C. M., and Cunningham, C. L. (2008) Roles of the nucleus accumbens and amygdala in the acquisition and expression of ethanol-conditioned behavior in mice, J Neurosci 28, 1076-1084.

247. Gremel, C. M., and Cunningham, C. L. (2009) Involvement of amygdala dopamine and nucleus accumbens NMDA receptors in ethanol-seeking behavior in mice, Neuropsychopharmacology 34, 1443-1453.

248. Izumo, N., Ishibashi, Y., Ohba, M., Morikawa, T., and Manabe, T. (2012) Decreased voluntary activity and amygdala levels of serotonin and dopamine in ovariectomized rats, Behav Brain Res 227, 1-6.

249. Liu, B., and Xie, J. (2004) Increased dopamine release in vivo by estradiol benzoate from the central amygdaloid nucleus of Parkinson's disease model rats, J Neurochem 90, 654-658.

250. Lee, J. H., Lee, S., and Kim, J. H. (2016) Amygdala Circuits for Fear Memory: A Key Role for Dopamine Regulation, Neuroscientist.

251. Watson, C. S., Alyea, R. A., Hawkins, B. E., Thomas, M. L., Cunningham, K. A., and Jakubas, A. A. (2006) Estradiol effects on the dopamine transporter - protein levels, subcellular location, and function, J Mol Signal 1, 5.

252. Karakaya, S., Kipp, M., and Beyer, C. (2007) Oestrogen regulates the expression and function of dopamine transporters in astrocytes of the nigrostriatal system, J Neuroendocrinol 19, 682-690.

253. Thompson, T. L., Bridges, S. R., and Weirs, W. J. (2001) Alteration of dopamine transport in the striatum and nucleus accumbens of ovariectomized and estrogen-primed rats following N- (p-isothiocyanatophenethyl) spiperone (NIPS) treatment, Brain Res Bull 54, 631-638.

254. Roberto, M., Gilpin, N. W., and Siggins, G. R. (2012) The central amygdala and alcohol: role of gamma-aminobutyric acid, glutamate, and neuropeptides, Cold Spring Harb Perspect Med 2, a012195.

255. Gilpin, N. W. (2012) Corticotropin-releasing factor (CRF) and neuropeptide Y (NPY): effects on inhibitory transmission in central amygdala, and anxiety- & alcohol-related behaviors, Alcohol 46, 329-337.

132

256. You, C., Vandegrift, B., and Brodie, M. S. (2018) Ethanol actions on the ventral tegmental area: novel potential targets on reward pathway neurons, Psychopharmacology (Berl) 235, 1711- 1726.

257. Rodd-Henricks, Z. A., McKinzie, D. L., Melendez, R. I., Berry, N., Murphy, J. M., and McBride, W. J. (2003) Effects of serotonin-3 receptor antagonists on the intracranial self- administration of ethanol within the ventral tegmental area of Wistar rats, Psychopharmacology (Berl) 165, 252-259.

258. Rodd, Z. A., Melendez, R. I., Bell, R. L., Kuc, K. A., Zhang, Y., Murphy, J. M., and McBride, W. J. (2004) Intracranial self-administration of ethanol within the ventral tegmental area of male Wistar rats: evidence for involvement of dopamine neurons, J Neurosci 24, 1050- 1057.

259. Rodd, Z. A., Bell, R. L., Zhang, Y., Murphy, J. M., Goldstein, A., Zaffaroni, A., Li, T. K., and McBride, W. J. (2005) Regional heterogeneity for the intracranial self-administration of ethanol and acetaldehyde within the ventral tegmental area of alcohol-preferring (P) rats: involvement of dopamine and serotonin, Neuropsychopharmacology 30, 330-338.

260. Gatto, G. J., McBride, W. J., Murphy, J. M., Lumeng, L., and Li, T. K. (1994) Ethanol self- infusion into the ventral tegmental area by alcohol-preferring rats, Alcohol 11, 557-564.

261. Pina, M. M., and Cunningham, C. L. (2017) Ethanol-seeking behavior is expressed directly through an extended amygdala to midbrain neural circuit, Neurobiol Learn Mem 137, 83-91.

262. Pina, M. M., and Cunningham, C. L. (2016) Involvement of ventral tegmental area ionotropic glutamate receptors in the expression of ethanol-induced conditioned place preference, Behav Brain Res 313, 23-29.

263. Bechtholt, A. J., and Cunningham, C. L. (2005) Ethanol-induced conditioned place preference is expressed through a ventral tegmental area dependent mechanism, Behav Neurosci 119, 213-223.

264. Dutton, J. W., 3rd, Chen, H., You, C., Brodie, M. S., and Lasek, A. W. (2017) Anaplastic lymphoma kinase regulates binge-like drinking and dopamine receptor sensitivity in the ventral tegmental area, Addict Biol 22, 665-678.

265. Xiao, L., and Becker, J. B. (1994) Quantitative microdialysis determination of extracellular striatal dopamine concentration in male and female rats: effects of estrous cycle and gonadectomy, Neuroscience letters 180, 155-158.

266. Dazzi, L., Seu, E., Cherchi, G., Barbieri, P. P., Matzeu, A., and Biggio, G. (2007) Estrous cycle-dependent changes in basal and ethanol-induced activity of cortical dopaminergic neurons in the rat, Neuropsychopharmacology 32, 892-901.

267. Galankin, T., Shekunova, E., and Zvartau, E. (2010) Estradiol lowers intracranial self- stimulation thresholds and enhances cocaine facilitation of intracranial self-stimulation in rats, Hormones and behavior 58, 827-834.

133

268. Vandegrift, B. J., You, C., Satta, R., Brodie, M. S., and Lasek, A. W. (2017) Estradiol increases the sensitivity of ventral tegmental area dopamine neurons to dopamine and ethanol, PloS one 12, e0187698.

269. Melon, L. C., and Boehm, S. L., 2nd. (2011) GABAA receptors in the posterior, but not anterior, ventral tegmental area mediate Ro15-4513-induced attenuation of binge-like ethanol consumption in C57BL/6J female mice, Behav Brain Res 220, 230-237.

270. Moore, E. M., and Boehm, S. L., 2nd. (2009) Site-specific microinjection of baclofen into the anterior ventral tegmental area reduces binge-like ethanol intake in male C57BL/6J mice, Behav Neurosci 123, 555-563.

271. Melon, L. C., Nolan, Z. T., Colar, D., Moore, E. M., and Boehm, S. L., 2nd. (2017) Activation of extrasynaptic delta-GABAA receptors globally or within the posterior-VTA has estrous-dependent effects on consumption of alcohol and estrous-independent effects on locomotion, Hormones and behavior 95, 65-75.

272. Santhakumar, V., Wallner, M., and Otis, T. S. (2007) Ethanol acts directly on extrasynaptic subtypes of GABAA receptors to increase tonic inhibition, Alcohol 41, 211-221.

273. Nilsson, M. E., Vandenput, L., Tivesten, A., Norlen, A. K., Lagerquist, M. K., Windahl, S. H., Borjesson, A. E., Farman, H. H., Poutanen, M., Benrick, A., Maliqueo, M., Stener-Victorin, E., Ryberg, H., and Ohlsson, C. (2015) Measurement of a Comprehensive Sex Steroid Profile in Rodent Serum by High-Sensitive Gas Chromatography-Tandem Mass Spectrometry, Endocrinology 156, 2492-2502.

274. Sprow, G. M., and Thiele, T. E. (2012) The neurobiology of binge-like ethanol drinking: evidence from rodent models, Physiol Behav 106, 325-331.

275. Sparta, D. R., Hopf, F. W., Gibb, S. L., Cho, S. L., Stuber, G. D., Messing, R. O., Ron, D., and Bonci, A. (2013) Binge ethanol-drinking potentiates corticotropin releasing factor R1 receptor activity in the ventral tegmental area, Alcohol Clin Exp Res 37, 1680-1687.

276. Albrechet-Souza, L., Hwa, L. S., Han, X., Zhang, E. Y., DeBold, J. F., and Miczek, K. A. (2015) Corticotropin Releasing Factor Binding Protein and CRF2 Receptors in the Ventral Tegmental Area: Modulation of Ethanol Binge Drinking in C57BL/6J Mice, Alcohol Clin Exp Res 39, 1609-1618.

277. Rinker, J. A., Marshall, S. A., Mazzone, C. M., Lowery-Gionta, E. G., Gulati, V., Pleil, K. E., Kash, T. L., Navarro, M., and Thiele, T. E. (2017) Extended Amygdala to Ventral Tegmental Area Corticotropin-Releasing Factor Circuit Controls Binge Ethanol Intake, Biol Psychiatry 81, 930-940.

278. Quarta, D., and Smolders, I. (2014) Rewarding, reinforcing and incentive salient events involve orexigenic hypothalamic neuropeptides regulating mesolimbic dopaminergic neurotransmission, Eur J Pharm Sci 57, 2-10.

134

279. West, K. S., and Roseberry, A. G. (2017) Neuropeptide-Y alters VTA dopamine neuron activity through both pre- and postsynaptic mechanisms, J Neurophysiol 118, 625-633.

280. Sparrow, A. M., Lowery-Gionta, E. G., Pleil, K. E., Li, C., Sprow, G. M., Cox, B. R., Rinker, J. A., Jijon, A. M., Pena, J., Navarro, M., Kash, T. L., and Thiele, T. E. (2012) Central neuropeptide Y modulates binge-like ethanol drinking in C57BL/6J mice via Y1 and Y2 receptors, Neuropsychopharmacology 37, 1409-1421.

281. Hilderbrand, E. R., and Lasek, A. W. (2018) Estradiol enhances ethanol reward in female mice through activation of ERalpha and ERbeta, Hormones and behavior 98, 159-164.

282. Hilderbrand, E. R., and Lasek, A. W. (2014) Sex differences in cocaine conditioned place preference in C57BL/6J mice, Neuroreport 25, 105-109.

283. Grucza, R. A., Bucholz, K. K., Rice, J. P., and Bierut, L. J. (2008) Secular trends in the lifetime prevalence of alcohol dependence in the United States: a re-evaluation, Alcohol Clin Exp Res 32, 763-770.

284. Rajasingh, J., Bord, E., Qin, G., Ii, M., Silver, M., Hamada, H., Ahluwalia, D., Goukassian, D., Zhu, Y., Losordo, D. W., and Kishore, R. (2007) Enhanced voluntary alcohol consumption after estrogen supplementation negates estrogen-mediated vascular repair in ovariectomized mice, Endocrinology 148, 3618-3624.

285. Mackie, A. R., Krishnamurthy, P., Verma, S. K., Thorne, T., Ramirez, V., Qin, G., Abramova, T., Hamada, H., Losordo, D. W., and Kishore, R. (2013) Alcohol consumption negates estrogen-mediated myocardial repair in ovariectomized mice by inhibiting endothelial progenitor cell mobilization and function, The Journal of biological chemistry 288, 18022- 18034.

286. Reid, M. L., Hubbell, C. L., and Reid, L. D. (2003) A pharmacological dose of estradiol can enhance appetites for alcoholic beverages, Pharmacology, biochemistry, and behavior 74, 381- 388.

287. Koob, G. F. (2008) A role for brain stress systems in addiction, Neuron 59, 11-34.

288. Koob, G. F., Buck, C. L., Cohen, A., Edwards, S., Park, P. E., Schlosburg, J. E., Schmeichel, B., Vendruscolo, L. F., Wade, C. L., Whitfield, T. W., Jr., and George, O. (2014) Addiction as a stress surfeit disorder, Neuropharmacology 76 Pt B, 370-382.

289. Martin-Fardon, R., Zorrilla, E. P., Ciccocioppo, R., and Weiss, F. (2010) Role of innate and drug-induced dysregulation of brain stress and arousal systems in addiction: Focus on corticotropin-releasing factor, nociceptin/orphanin FQ, and orexin/hypocretin, Brain research 1314, 145-161.

290. Koob, G. F. (2003) Alcoholism: allostasis and beyond, Alcoholism, clinical and experimental research 27, 232-243.

135

291. Koob, G. F. (2003) Neuroadaptive mechanisms of addiction: studies on the extended amygdala, European neuropsychopharmacology : the journal of the European College of Neuropsychopharmacology 13, 442-452.

292. Richter, R. M., Zorrilla, E. P., Basso, A. M., Koob, G. F., and Weiss, F. (2000) Altered amygdalar CRF release and increased anxiety-like behavior in Sardinian alcohol-preferring rats: a microdialysis and behavioral study, Alcoholism, clinical and experimental research 24, 1765- 1772.

293. Ciccocioppo, R., Economidou, D., Cippitelli, A., Cucculelli, M., Ubaldi, M., Soverchia, L., Lourdusamy, A., and Massi, M. (2006) Genetically selected Marchigian Sardinian alcohol- preferring (msP) rats: an animal model to study the neurobiology of alcoholism, Addiction biology 11, 339-355.

294. Herman, M. A., Kallupi, M., Luu, G., Oleata, C. S., Heilig, M., Koob, G. F., Ciccocioppo, R., and Roberto, M. (2013) Enhanced GABAergic transmission in the central nucleus of the amygdala of genetically selected Marchigian Sardinian rats: alcohol and CRF effects, Neuropharmacology 67, 337-348.

295. Suzuki, R., Lumeng, L., McBride, W. J., Li, T. K., and Hwang, B. H. (2004) Reduced neuropeptide Y mRNA expression in the central nucleus of amygdala of alcohol preferring (P) rats: its potential involvement in alcohol preference and anxiety, Brain research 1014, 251-254.

296. Prakash, A., Zhang, H., and Pandey, S. C. (2008) Innate differences in the expression of brain-derived neurotrophic factor in the regions within the extended amygdala between alcohol preferring and nonpreferring rats, Alcoholism, clinical and experimental research 32, 909-920.

297. Pandey, S. C., Zhang, H., Roy, A., and Xu, T. (2005) Deficits in amygdaloid cAMP- responsive element-binding protein signaling play a role in genetic predisposition to anxiety and alcoholism, The Journal of clinical investigation 115, 2762-2773.

298. Jasnow, A. M., Schulkin, J., and Pfaff, D. W. (2006) Estrogen facilitates fear conditioning and increases corticotropin-releasing hormone mRNA expression in the central amygdala in female mice, Hormones and behavior 49, 197-205.

299. Pelletier, G., Li, S., Luu-The, V., and Labrie, F. (2007) Oestrogenic regulation of pro- opiomelanocortin, neuropeptide Y and corticotrophin-releasing hormone mRNAs in mouse hypothalamus, J Neuroendocrinol 19, 426-431.

300. Titolo, D., Cai, F., and Belsham, D. D. (2006) Coordinate regulation of neuropeptide Y and agouti-related peptide gene expression by estrogen depends on the ratio of estrogen receptor (ER) alpha to ERbeta in clonal hypothalamic neurons, Mol Endocrinol 20, 2080-2092.

301. Titolo, D., Mayer, C. M., Dhillon, S. S., Cai, F., and Belsham, D. D. (2008) Estrogen facilitates both phosphatidylinositol 3-kinase/Akt and ERK1/2 mitogen-activated protein kinase membrane signaling required for long-term neuropeptide Y transcriptional regulation in clonal, immortalized neurons, The Journal of neuroscience : the official journal of the Society for Neuroscience 28, 6473-6482.

136

302. Groblewski, P. A., Bax, L. S., and Cunningham, C. L. (2008) Reference-dose place conditioning with ethanol in mice: empirical and theoretical analysis, Psychopharmacology (Berl) 201, 97-106.

303. Sepehr, E., Lebl-Rinnova, M., Mann, M. K., Pisani, S. L., Churchwell, M. I., Korol, D. L., Katzenellenbogen, J. A., and Doerge, D. R. (2012) Pharmacokinetics of the estrogen receptor subtype-selective ligands, PPT and DPN: quantification using UPLC-ES/MS/MS, Journal of pharmaceutical and biomedical analysis 71, 119-126.

304. Zapata, A., Gonzales, R. A., and Shippenberg, T. S. (2006) Repeated ethanol intoxication induces behavioral sensitization in the absence of a sensitized accumbens dopamine response in C57BL/6J and DBA/2J mice, Neuropsychopharmacology 31, 396-405.

305. Lasek, A. W., Janak, P. H., He, L., Whistler, J. L., and Heberlein, U. (2007) Downregulation of mu opioid receptor by RNA interference in the ventral tegmental area reduces ethanol consumption in mice, Genes Brain Behav 6, 728-735.

306. Musatov, S., Chen, W., Pfaff, D. W., Kaplitt, M. G., and Ogawa, S. (2006) RNAi-mediated silencing of estrogen receptor {alpha} in the ventromedial nucleus of hypothalamus abolishes female sexual behaviors, Proceedings of the National Academy of Sciences of the United States of America 103, 10456-10460.

307. Lasek, A. W., and Azouaou, N. (2010) Virus-delivered RNA interference in mouse brain to study addiction-related behaviors, Methods Mol Biol 602, 283-298.

308. Walf, A. A., Rhodes, M. E., Meade, J. R., Harney, J. P., and Frye, C. A. (2007) Estradiol- induced conditioned place preference may require actions at estrogen receptors in the nucleus accumbens, Neuropsychopharmacology 32, 522-530.

309. de Solis, C. A., Holehonnur, R., Banerjee, A., Luong, J. A., Lella, S. K., Ho, A., Pahlavan, B., and Ploski, J. E. (2015) Viral delivery of shRNA to amygdala neurons leads to neurotoxicity and deficits in Pavlovian fear conditioning, Neurobiol Learn Mem 124, 34-47.

310. Quirarte, G. L., Reid, L. D., de la Teja, I. S., Reid, M. L., Sanchez, M. A., Diaz-Trujillo, A., Aguilar-Vazquez, A., and Prado-Alcala, R. A. (2007) Estradiol valerate and alcohol intake: dose- response assessments, BMC pharmacology 7, 3.

311. Marinelli, P. W., Quirion, R., and Gianoulakis, C. (2003) Estradiol valerate and alcohol intake: a comparison between Wistar and Lewis rats and the putative role of endorphins, Behav Brain Res 139, 59-67.

312. Reid, L. D., Marinelli, P. W., Bennett, S. M., Fiscale, L. T., Narciso, S. P., Oparowski, C. J., Reid, M. L., Merrigan, B. A., Moricone, J., Hubbell, C. L., and Gianoulakis, C. (2002) One injection of estradiol valerate induces dramatic changes in rats' intake of alcoholic beverages, Pharmacology, biochemistry, and behavior 72, 601-616.

313. Sandberg, D., David, S., and Stewart, J. (1982) Effects of estradiol benzoate on the pattern of eating and ethanol consumption, Physiol Behav 29, 61-65.

137

314. Sandberg, D., and Stewart, J. (1982) Effects of estradiol benzoate and MER-25 on ethanol consumption in the ovariectomized rat, J Comp Physiol Psychol 96, 635-648.

315. Satta, R., Hilderbrand, E. R., and Lasek, A. W. (2017) Ovarian Hormones Contribute to High Levels of Binge-Like Drinking by Female Mice, Alcohol Clin Exp Res.

316. Hwa, L. S., Chu, A., Levinson, S. A., Kayyali, T. M., DeBold, J. F., and Miczek, K. A. (2011) Persistent escalation of alcohol drinking in C57BL/6J mice with intermittent access to 20% ethanol, Alcohol Clin Exp Res 35, 1938-1947.

317. Middaugh, L. D., Kelley, B. M., Bandy, A. L., and McGroarty, K. K. (1999) Ethanol consumption by C57BL/6 mice: influence of gender and procedural variables, Alcohol 17, 175- 183.

318. Chen, H. H., Yang, Y. K., Yeh, T. L., Cherng, C. F., Hsu, H. C., Hsiao, S. Y., and Yu, L. (2003) Methamphetamine-induced conditioned place preference is facilitated by estradiol pretreatment in female mice, Chin J Physiol 46, 169-174.

319. Mirbaha, H., Tabaeizadeh, M., Shaterian-Mohammadi, H., Tahsili-Fahadan, P., and Dehpour, A. R. (2009) Estrogen pretreatment modulates morphine-induced conditioned place preference in ovariectomized mice, Pharmacology, biochemistry, and behavior 92, 399-403.

320. Silverman, J. L., and Koenig, J. I. (2007) Evidence for the involvement of ERbeta and RGS9-2 in 17-beta estradiol enhancement of amphetamine-induced place preference behavior, Hormones and behavior 52, 146-155.

321. Segarra, A. C., Torres-Diaz, Y. M., Silva, R. D., Puig-Ramos, A., Menendez-Delmestre, R., Rivera-Bermudez, J. G., Amadeo, W., and Agosto-Rivera, J. L. (2014) Estrogen receptors mediate estradiol's effect on sensitization and CPP to cocaine in female rats: role of contextual cues, Hormones and behavior 65, 77-87.

322. Satta, R., Certa, B., He, D., and Lasek, A. W. (2017) Estrogen Receptor beta in the nucleus accumbens regulates the rewarding properties of cocaine in female mice, Int J Neuropsychopharm.

323. Weiser, M. J., Foradori, C. D., and Handa, R. J. (2008) Estrogen receptor beta in the brain: from form to function, Brain research reviews 57, 309-320.

324. Matthews, J., and Gustafsson, J. A. (2003) Estrogen signaling: a subtle balance between ER alpha and ER beta, Molecular interventions 3, 281-292.

325. Becker, J. B., McClellan, M. L., and Reed, B. G. (2017) Sex differences, gender and addiction, J Neurosci Res 95, 136-147.

326. Jennison, K. M. (2004) The short-term effects and unintended long-term consequences of binge drinking in college: a 10-year follow-up study, The American journal of drug and alcohol abuse 30, 659-684.

138

327. McCarty, C. A., Ebel, B. E., Garrison, M. M., DiGiuseppe, D. L., Christakis, D. A., and Rivara, F. P. (2004) Continuity of binge and harmful drinking from late adolescence to early adulthood, Pediatrics 114, 714-719.

328. Stahre, M. A., Brewer, R. D., Fonseca, V. P., and Naimi, T. S. (2009) Binge drinking among U.S. active-duty military personnel, American journal of preventive medicine 36, 208- 217.

329. (2012) Alcohol Use and Binge Drinking Among Women of Childbearing Age — United States, 2006–2010, Centers for Disease Control and Prevention (CDC) 61, 534-538.

330. Anderson, A. E., Hure, A. J., Forder, P. M., Powers, J., Kay-Lambkin, F. J., and Loxton, D. J. (2014) Risky drinking patterns are being continued into pregnancy: a prospective cohort study, PloS one 9, e86171.

331. Naimi, T. S., Lipscomb, L. E., Brewer, R. D., and Gilbert, B. C. (2003) Binge drinking in the preconception period and the risk of unintended pregnancy: implications for women and their children, Pediatrics 111, 1136-1141.

332. Santollo, J., Wiley, M. D., and Eckel, L. A. (2007) Acute activation of ER alpha decreases food intake, meal size, and body weight in ovariectomized rats, Am J Physiol Regul Integr Comp Physiol 293, R2194-2201.

333. Byers, S. L., Wiles, M. V., Dunn, S. L., and Taft, R. A. (2012) Mouse estrous cycle identification tool and images, PloS one 7, e35538.

334. Nelson, J. F., Felicio, L. S., Randall, P. K., Sims, C., and Finch, C. E. (1982) A longitudinal study of estrous cyclicity in aging C57BL/6J mice: I. Cycle frequency, length and vaginal cytology, Biology of reproduction 27, 327-339.

335. Etique, N., Chardard, D., Chesnel, A., Merlin, J. L., Flament, S., and Grillier-Vuissoz, I. (2004) Ethanol stimulates proliferation, ERalpha and aromatase expression in MCF-7 human breast cancer cells, Int J Mol Med 13, 149-155.

336. Singletary, K. W., Frey, R. S., and Yan, W. (2001) Effect of ethanol on proliferation and estrogen receptor-alpha expression in human breast cancer cells, Cancer Lett 165, 131-137.

337. Fan, S., Meng, Q., Gao, B., Grossman, J., Yadegari, M., Goldberg, I. D., and Rosen, E. M. (2000) Alcohol stimulates estrogen receptor signaling in human breast cancer cell lines, Cancer Res 60, 5635-5639.

338. Zorrilla, E. P., Inoue, K., Fekete, E. M., Tabarin, A., Valdez, G. R., and Koob, G. F. (2005) Measuring meals: structure of prandial food and water intake of rats, Am J Physiol Regul Integr Comp Physiol 288, R1450-1467.

339. Sohn, J. W. (2015) Network of hypothalamic neurons that control appetite, BMB Rep 48, 229-233.

139

340. Andermann, M. L., and Lowell, B. B. (2017) Toward a Wiring Diagram Understanding of Appetite Control, Neuron 95, 757-778.

341. Dhillon, S. S., and Belsham, D. D. (2011) Estrogen inhibits NPY secretion through membrane-associated estrogen receptor (ER)-alpha in clonal, immortalized hypothalamic neurons, Int J Obes (Lond) 35, 198-207.

342. Bonavera, J. J., Dube, M. G., Kalra, P. S., and Kalra, S. P. (1994) Anorectic effects of estrogen may be mediated by decreased neuropeptide-Y release in the hypothalamic paraventricular nucleus, Endocrinology 134, 2367-2370.

343. Yoest, K. E., Quigley, J. A., and Becker, J. B. (2018) Rapid effects of ovarian hormones in dorsal striatum and nucleus accumbens, Hormones and behavior 104, 119-129.

344. Tabatadze, N., Huang, G., May, R. M., Jain, A., and Woolley, C. S. (2015) Sex Differences in Molecular Signaling at Inhibitory Synapses in the Hippocampus, J Neurosci 35, 11252-11265.

345. Vandegrift, B. J., Hilderbrand, E. R., Satta, R., Tai, R., He, D., You, C., Coles, C., Chen, H., Brodie, M. S., and Lasek, A. W. . (2019) Estrogen Receptor α Regulates Ethanol Excitation of Ventral Tegmental Area Neurons and Binge Drinking in Female Mice, bioRxiv.

346. Gegenhuber, B., and Tollkuhn, J. (2019) Signatures of sex: Sex differences in gene expression in the vertebrate brain, Wiley Interdiscip Rev Dev Biol, e348.

347. Stephens, M. A., and Wand, G. (2012) Stress and the HPA axis: role of glucocorticoids in alcohol dependence, Alcohol research : current reviews 34, 468-483.

348. Bangasser, D. A. (2013) Sex differences in stress-related receptors: ''micro'' differences with ''macro'' implications for mood and anxiety disorders, Biology of sex differences 4, 2.

349. Breslau, N., Schultz, L., and Peterson, E. (1995) Sex differences in depression: a role for preexisting anxiety, Psychiatry research 58, 1-12.

350. Iteke, O., Bakare, M. O., Agomoh, A. O., Uwakwe, R., and Onwukwe, J. U. (2011) Road traffic accidents and posttraumatic stress disorder in an orthopedic setting in South-Eastern Nigeria: a controlled study, Scandinavian journal of trauma, resuscitation and emergency medicine 19, 39.

351. Breslau, N., Chilcoat, H. D., Kessler, R. C., Peterson, E. L., and Lucia, V. C. (1999) Vulnerability to assaultive violence: further specification of the sex difference in post-traumatic stress disorder, Psychological medicine 29, 813-821.

352. Tolin, D. F., and Foa, E. B. (2006) Sex differences in trauma and posttraumatic stress disorder: a quantitative review of 25 years of research, Psychological bulletin 132, 959-992.

353. Breslau, N. (2009) The epidemiology of trauma, PTSD, and other posttrauma disorders, Trauma, violence & abuse 10, 198-210.

140

354. Marcus, S. M., Young, E. A., Kerber, K. B., Kornstein, S., Farabaugh, A. H., Mitchell, J., Wisniewski, S. R., Balasubramani, G. K., Trivedi, M. H., and Rush, A. J. (2005) Gender differences in depression: findings from the STAR*D study, Journal of affective disorders 87, 141-150.

355. Kessler, R. C., McGonagle, K. A., Swartz, M., Blazer, D. G., and Nelson, C. B. (1993) Sex and depression in the National Comorbidity Survey. I: Lifetime prevalence, chronicity and recurrence, Journal of affective disorders 29, 85-96.

356. Young, E. A., and Altemus, M. (2004) Puberty, ovarian steroids, and stress, Annals of the New York Academy of Sciences 1021, 124-133.

357. Bebbington, P., Dunn, G., Jenkins, R., Lewis, G., Brugha, T., Farrell, M., and Meltzer, H. (2003) The influence of age and sex on the prevalence of depressive conditions: report from the National Survey of Psychiatric Morbidity, International review of psychiatry 15, 74-83.

358. Bebbington, P. E., Dunn, G., Jenkins, R., Lewis, G., Brugha, T., Farrell, M., and Meltzer, H. (1998) The influence of age and sex on the prevalence of depressive conditions: report from the National Survey of Psychiatric Morbidity, Psychological medicine 28, 9-19.

359. Ter Horst, G. J., Wichmann, R., Gerrits, M., Westenbroek, C., and Lin, Y. (2009) Sex differences in stress responses: focus on ovarian hormones, Physiology & behavior 97, 239-249.

360. Angold, A., Costello, E. J., and Worthman, C. M. (1998) Puberty and depression: the roles of age, pubertal status and pubertal timing, Psychological medicine 28, 51-61.

361. Kudielka, B. M., and Kirschbaum, C. (2005) Sex differences in HPA axis responses to stress: a review, Biological psychology 69, 113-132.

362. Mirsal, H., Kalyoncu, A., Pektas, O., Tan, D., and Beyazyurek, M. (2004) Childhood trauma in alcoholics, Alcohol and alcoholism 39, 126-129.

363. Heim, C., Newport, D. J., Bonsall, R., Miller, A. H., and Nemeroff, C. B. (2001) Altered pituitary-adrenal axis responses to provocative challenge tests in adult survivors of childhood abuse, The American journal of psychiatry 158, 575-581.

364. Heim, C., Newport, D. J., Heit, S., Graham, Y. P., Wilcox, M., Bonsall, R., Miller, A. H., and Nemeroff, C. B. (2000) Pituitary-adrenal and autonomic responses to stress in women after sexual and physical abuse in childhood, JAMA : the journal of the American Medical Association 284, 592-597.

365. Bale, T. L., and Vale, W. W. (2004) CRF and CRF receptors: role in stress responsivity and other behaviors, Annual review of pharmacology and toxicology 44, 525-557.

366. Fekete, E. M., and Zorrilla, E. P. (2007) Physiology, pharmacology, and therapeutic relevance of urocortins in mammals: ancient CRF paralogs, Frontiers in neuroendocrinology 28, 1-27.

141

367. Isogawa, K., Bush, D. E., and LeDoux, J. E. (2013) Contrasting effects of pretraining, posttraining, and pretesting infusions of corticotropin-releasing factor into the lateral amygdala: attenuation of fear memory formation but facilitation of its expression, Biological psychiatry 73, 353-359.

368. Gafford, G. M., Guo, J. D., Flandreau, E. I., Hazra, R., Rainnie, D. G., and Ressler, K. J. (2012) Cell-type specific deletion of GABA(A)alpha1 in corticotropin-releasing factor- containing neurons enhances anxiety and disrupts fear extinction, Proceedings of the National Academy of Sciences of the United States of America 109, 16330-16335.

369. Gray, T. S. (1993) Amygdaloid CRF pathways. Role in autonomic, neuroendocrine, and behavioral responses to stress, Annals of the New York Academy of Sciences 697, 53-60.

370. Bijlsma, E. Y., van Leeuwen, M. L., Westphal, K. G., Olivier, B., and Groenink, L. (2011) Local repeated corticotropin-releasing factor infusion exacerbates anxiety- and fear-related behavior: differential involvement of the basolateral amygdala and medial prefrontal cortex, Neuroscience 173, 82-92.

371. Page, M. E., Berridge, C. W., Foote, S. L., and Valentino, R. J. (1993) Corticotropin- releasing factor in the locus coeruleus mediates EEG activation associated with hypotensive stress, Neuroscience letters 164, 81-84.

372. Valentino, R. J., and Van Bockstaele, E. (2008) Convergent regulation of locus coeruleus activity as an adaptive response to stress, European journal of pharmacology 583, 194-203.

373. Bao, A. M., Hestiantoro, A., Van Someren, E. J., Swaab, D. F., and Zhou, J. N. (2005) Colocalization of corticotropin-releasing hormone and oestrogen receptor-alpha in the paraventricular nucleus of the hypothalamus in mood disorders, Brain : a journal of neurology 128, 1301-1313.

374. Miller, W. J., Suzuki, S., Miller, L. K., Handa, R., and Uht, R. M. (2004) Estrogen receptor (ER)beta isoforms rather than ERalpha regulate corticotropin-releasing hormone promoter activity through an alternate pathway, The Journal of neuroscience : the official journal of the Society for Neuroscience 24, 10628-10635.

375. Chen, X. N., Zhu, H., Meng, Q. Y., and Zhou, J. N. (2008) Estrogen receptor-alpha and - beta regulate the human corticotropin-releasing hormone gene through similar pathways, Brain Res 1223, 1-10.

376. Acosta-Martinez, M., Horton, T., and Levine, J. E. (2007) Estrogen receptors in neuropeptide Y neurons: at the crossroads of feeding and reproduction, Trends Endocrinol Metab 18, 48-50.

377. Wade, G. N., Gray, J. M., and Bartness, T. J. (1985) Gonadal influences on adiposity, International journal of obesity 9 Suppl 1, 83-92.

142

378. Brown, L. M., and Clegg, D. J. (2010) Central effects of estradiol in the regulation of food intake, body weight, and adiposity, The Journal of steroid biochemistry and molecular biology 122, 65-73.

379. Santollo, J., Torregrossa, A. M., and Eckel, L. A. (2011) Estradiol acts in the medial preoptic area, arcuate nucleus, and dorsal raphe nucleus to reduce food intake in ovariectomized rats, Hormones and behavior 60, 86-93.

380. Santollo, J., and Eckel, L. A. (2008) Estradiol decreases the orexigenic effect of neuropeptide Y, but not agouti-related protein, in ovariectomized rats, Behavioural brain research 191, 173-177.

381. Lasek, A. W., Lim, J., Kliethermes, C. L., Berger, K. H., Joslyn, G., Brush, G., Xue, L., Robertson, M., Moore, M. S., Vranizan, K., Morris, S. W., Schuckit, M. A., White, R. L., and Heberlein, U. (2011) An evolutionary conserved role for anaplastic lymphoma kinase in behavioral responses to ethanol, PLoS One 6, e22636.

382. Dutton, J. W., 3rd, Chen, H., You, C., Brodie, M. S., and Lasek, A. W. (2016) Anaplastic lymphoma kinase regulates binge-like drinking and dopamine receptor sensitivity in the ventral tegmental area, Addiction biology.

383. Lasek, A. W., Gesch, J., Giorgetti, F., Kharazia, V., and Heberlein, U. (2011) Alk is a transcriptional target of LMO4 and ERalpha that promotes cocaine sensitization and reward, The Journal of neuroscience : the official journal of the Society for Neuroscience 31, 14134-14141.

384. Melendez, R. I., McGinty, J. F., Kalivas, P. W., and Becker, H. C. (2012) Brain region- specific gene expression changes after chronic intermittent ethanol exposure and early withdrawal in C57BL/6J mice, Addict Biol 17, 351-364.

385. McBride, W. J., Kimpel, M. W., McClintick, J. N., Ding, Z. M., Edenberg, H. J., Liang, T., Rodd, Z. A., and Bell, R. L. (2014) Changes in gene expression within the extended amygdala following binge-like alcohol drinking by adolescent alcohol-preferring (P) rats, Pharmacol Biochem Behav 117, 52-60.

386. Osterndorff-Kahanek, E. A., Becker, H. C., Lopez, M. F., Farris, S. P., Tiwari, G. R., Nunez, Y. O., Harris, R. A., and Mayfield, R. D. (2015) Chronic ethanol exposure produces time- and brain region-dependent changes in gene coexpression networks, PloS one 10, e0121522.

387. Marballi, K., Genabai, N. K., Blednov, Y. A., Harris, R. A., and Ponomarev, I. (2016) Alcohol consumption induces global gene expression changes in VTA dopaminergic neurons, Genes Brain Behav 15, 318-326.

388. Kerns, R. T., Ravindranathan, A., Hassan, S., Cage, M. P., York, T., Sikela, J. M., Williams, R. W., and Miles, M. F. (2005) Ethanol-responsive brain region expression networks: implications for behavioral responses to acute ethanol in DBA/2J versus C57BL/6J mice, J Neurosci 25, 2255-2266.

143

389. Vilpoux, C., Warnault, V., Pierrefiche, O., Daoust, M., and Naassila, M. (2009) Ethanol- sensitive brain regions in rat and mouse: a cartographic review, using immediate early gene expression, Alcohol Clin Exp Res 33, 945-969.

390. Pinzone, J. J., Stevenson, H., Strobl, J. S., and Berg, P. E. (2004) Molecular and cellular determinants of estrogen receptor alpha expression, Molecular and cellular biology 24, 4605- 4612.

391. Livak, K. J., and Schmittgen, T. D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods 25, 402-408.

392. Liu, X., and Shi, H. (2015) Regulation of Estrogen Receptor alpha Expression in the Hypothalamus by Sex Steroids: Implication in the Regulation of Energy Homeostasis, International journal of endocrinology 2015, 949085.

393. Zhang, H., and Pandey, S. C. (2003) Effects of PKA modulation on the expression of neuropeptide Y in rat amygdaloid structures during ethanol withdrawal, Peptides 24, 1397-1402.

394. Gilpin, N. W., Henderson, A. N., Badia-Elder, N. E., and Stewart, R. B. (2011) Effects of neuropeptide Y and ethanol on arousal and anxiety-like behavior in alcohol-preferring rats, Alcohol 45, 137-145.

395. Korotkova, T. M., Brown, R. E., Sergeeva, O. A., Ponomarenko, A. A., and Haas, H. L. (2006) Effects of arousal- and feeding-related neuropeptides on dopaminergic and GABAergic neurons in the ventral tegmental area of the rat, The European journal of neuroscience 23, 2677- 2685.

396. Foster, T. C. (2012) Role of estrogen receptor alpha and beta expression and signaling on cognitive function during aging, Hippocampus 22, 656-669.

397. Quadros, I. M., Macedo, G. C., Domingues, L. P., and Favoretto, C. A. (2016) An Update on CRF Mechanisms Underlying Alcohol Use Disorders and Dependence, Front Endocrinol (Lausanne) 7, 134.

398. Olive, M. F., Mehmert, K. K., Koenig, H. N., Camarini, R., Kim, J. A., Nannini, M. A., Ou, C. J., and Hodge, C. W. (2003) A role for corticotropin releasing factor (CRF) in ethanol consumption, sensitivity, and reward as revealed by CRF-deficient mice, Psychopharmacology (Berl) 165, 181-187.

399. Lowery-Gionta, E. G., Navarro, M., Li, C., Pleil, K. E., Rinker, J. A., Cox, B. R., Sprow, G. M., Kash, T. L., and Thiele, T. E. (2012) Corticotropin releasing factor signaling in the central amygdala is recruited during binge-like ethanol consumption in C57BL/6J mice, J Neurosci 32, 3405-3413.

400. Gilpin, N. W., Herman, M. A., and Roberto, M. (2015) The central amygdala as an integrative hub for anxiety and alcohol use disorders, Biol Psychiatry 77, 859-869.

144

401. Zindel, L. R., and Kranzler, H. R. (2014) Pharmacotherapy of alcohol use disorders: seventy-five years of progress, J Stud Alcohol Drugs Suppl 75 Suppl 17, 79-88.

402. Peltier, M. R., Verplaetse, T. L., Mineur, Y. S., Petrakis, I. L., Cosgrove, K. P., Picciotto, M. R., and McKee, S. A. (2019) Sex differences in stress-related alcohol use, Neurobiol Stress 10, 100149.

403. Hudson, A., and Stamp, J. A. (2011) Ovarian hormones and propensity to drug relapse: a review, Neurosci Biobehav Rev 35, 427-436.

404. Agabio, R., Pani, P. P., Preti, A., Gessa, G. L., and Franconi, F. (2016) Efficacy of Medications Approved for the Treatment of Alcohol Dependence and Alcohol Withdrawal Syndrome in Female Patients: A Descriptive Review, Eur Addict Res 22, 1-16.

405. Anton, R. F., O'Malley, S. S., Ciraulo, D. A., Cisler, R. A., Couper, D., Donovan, D. M., Gastfriend, D. R., Hosking, J. D., Johnson, B. A., LoCastro, J. S., Longabaugh, R., Mason, B. J., Mattson, M. E., Miller, W. R., Pettinati, H. M., Randall, C. L., Swift, R., Weiss, R. D., Williams, L. D., and Zweben, A. (2006) Combined pharmacotherapies and behavioral interventions for alcohol dependence: the COMBINE study: a randomized controlled trial, JAMA 295, 2003-2017.

406. Greenfield, S. F., Pettinati, H. M., O'Malley, S., Randall, P. K., and Randall, C. L. (2010) Gender differences in alcohol treatment: an analysis of outcome from the COMBINE study, Alcohol Clin Exp Res 34, 1803-1812.

407. Oncken, C., Van Kirk, J., and Kranzler, H. R. (2001) Adverse effects of oral naltrexone: analysis of data from two clinical trials, Psychopharmacology (Berl) 154, 397-402.

408. Swift, R., Oslin, D. W., Alexander, M., and Forman, R. (2011) Adherence monitoring in naltrexone pharmacotherapy trials: a systematic review, J Stud Alcohol Drugs 72, 1012-1018.

409. Moglia, M. L., Nguyen, H. V., Chyjek, K., Chen, K. T., and Castano, P. M. (2016) Evaluation of Smartphone Menstrual Cycle Tracking Applications Using an Adapted APPLICATIONS Scoring System, Obstet Gynecol 127, 1153-1160.

410. Lanza di Scalea, T., and Pearlstein, T. (2017) Premenstrual Dysphoric Disorder, Psychiatr Clin North Am 40, 201-216.

411. Walsh, S., Ismaili, E., Naheed, B., and O'Brien, S. (2015) Diagnosis, pathophysiology and management of premenstrual syndrome, The Obstetrician & Gynaecologist 17, 99-104.

412. Connery, H. S., Albright, B. B., and Rodolico, J. M. (2014) Adolescent substance use and unplanned pregnancy: strategies for risk reduction, Obstet Gynecol Clin North Am 41, 191-203.

413. Lundsberg, L. S., Peglow, S., Qasba, N., Yonkers, K. A., and Gariepy, A. M. (2018) Is Preconception Substance Use Associated With Unplanned or Poorly Timed Pregnancy?, J Addict Med 12, 321-328.

145

414. Mezrow, G., Shoupe, D., Spicer, D., Lobo, R., Leung, B., and Pike, M. (1994) Depot leuprolide acetate with estrogen and progestin add-back for long-term treatment of premenstrual syndrome, Fertility and sterility 62, 932-937.

415. Mitwally, M. F., Gotlieb, L., and Casper, R. F. (2002) Prevention of bone loss and hypoestrogenic symptoms by estrogen and interrupted progestogen add-back in long-term GnRH-agonist down-regulated patients with endometriosis and premenstrual syndrome, Menopause 9, 236-241.

146

APPENDIX A: SUPPLEMENTAL METHODS

qPCR analysis of lentiviral knockdown efficiency in female mouse VTA

Female mice used in the sucrose DID experiment (n = 31; see Chapter Three, section) were anesthetized by CO2 inhalation and rapidly decapitated for analysis of ER mRNA expression by qPCR. Brains were collected, rinsed briefly in PBS, and flash frozen on dry ice.

Frozen brains were stored in a 12-well plate at -80 °C until sectioning. On the day of sectioning, frozen brains were mounted on specimen chucks using OCT compound. Mounted brains were placed into the cryostat chamber, which was set to -10 °C, and allowed to warm for at least 30 min before slicing. Brains were then sectioned into 300 μm slices, which were mounted on clean microscope slides. To prevent RNA degradation, samples were placed on blocks of dry ice immediately after mounting and then transferred to a -80 °C freezer. On the day of tissue collection, samples were removed from the freezer in small groups (a few slides at a time) and placed on blocks of dry ice to maintain tissue temperature. In order to confirm accuracy of viral placement, a fluorescent protein flashlight (Nightsea, Lexington, MA USA) was used to visualize GFP-expressing regions of the sliced tissue. Tissue samples were collected from GFP- expressing regions using a 1.0 mm biopsy punch (Integra Miltex, York, PA, USA), transferred to

1.5 ml Eppendorf tubes, and returned to the -80 °C freezer for storage until the time of RNA isolation.

Since ER expression varies with estrous cycle phase, vaginal mucosa samples were taken from every mouse (immediately before CO2 anesthesia) using moistened cotton swabs and smeared on clean microscope slides. The slides were then viewed using a light microscope, and

147 samples were analyzed for cell content in order to determine estrous cycle phase so that cycle phase at the time of sacrifice could be taken into account when analyzing qPCR data.

Total RNA was isolated from tissue punches using the RNeasy Mini Kit (Qiagen #74104,

Germantown, MD, USA) according to the manufacturer's instructions. RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor

(Applied Biosystems/Thermo Fisher Scientific), and quantitative real-time polymerase chain reaction (qPCR) was performed using the SsoAdvanced Universal SYBR Green Supermix

(BioRad Laboratories, Hercules, CA, USA). Amplification of 60S ribosomal protein L13a

(Rpl13a) was used as a normalization control for total RNA input. Rpl13a forward primer: 5’-

TAC CAG AAA GTT TGC TTA CCT GGG-3’, Rpl13a reverse primer: 5’-TGC CTG TTT CCG

TAA CCT CAA G-3’. Relative expression of Esr1 and Esr2 was measured to determine in vivo knockdown efficiency of the shEsr1 and shEsr2 constructs in VTA tissue. Esr1 forward primer:

5’-CCT ACT ACC TGG AGA AGC-3’, Esr1 reverse primer: 5’-GCA CAG TAG CGA GTC

TCC TT-3’. Esr2 forward primer: 5’-TGG CTG ACA AGG AAC TGG TG-3’, Esr2 reverse primer: 5’-TAC TCC CTG TCC AGA ACG AG-3’. Since TH expression is characteristic of

VTA tissue, relative levels of TH mRNA were also quantified to help confirm injection site accuracy. Th forward primer: 5’-TCT TGA AGG AAC GGA CTG GC-3’, Th reverse primer: 5’-

GAG TGC ATA GGT GAG GAG GE-3’. Relative expression of Esr1, Esr2, and Th was calculated using the dCq method391.

148

APPENDIX B: APPROVAL OF ANIMAL PROTOCOLS

149

150

151

152

153

APPENDIX C: PERMISSIONS

154

155

156

VITA

NAME: Elisa R. Hilderbrand

EDUCATION:

 University of Illinois at Chicago, Graduate Program in Neuroscience (2012-present); Mentor: Amy W. Lasek, Ph.D.  Knox College, Galesburg, IL: Bachelor of Arts in Neuroscience, Cum Laude (2006-2010)

ACADEMIC AND PROFESSIONAL HONORS

 NRSA F31 Individual National Research Service Grant Award (NIAAA; 2016-2018)  Best Abstract – UIC Women’s Health Research Day (2016)  Best Poster – UIC Center for Alcohol Research in Epigenetics (CARE) retreat (2016)  UIC Center for Clinical and Translational Science (CCTS) Pre-doctoral Education for Clinical and Translational Scientists (PECTS) Fellowship Award (2015-2016)  Best Presentation – UIC Neuroscience Graduate Student Symposium (2015)  University Fellow, University of Illinois at Chicago, Chicago, IL (2012-2013)  Hermann Muelder Academic Scholarship, Knox College, Galesburg, IL (2006-2010)  Performing Arts Scholarship in Dance, Knox College, Galesburg, IL (2006-2010)  Performing Arts Scholarship in Theater, Knox College, Galesburg, IL (2006-2010)

PUBLICATIONS:

 Hilderbrand, E.R., and Lasek, A.W. Estradiol enhances ethanol reward in female mice through activation of ERα and ERβ. Hormones and Behavior (2018, Feb); 98:159-164. PMID: 29305887  Satta, R., Hilderbrand, E.R., and Lasek, A.W. Ovarian Hormones Contribute to High Levels of Binge-Like Drinking by Female Mice. Alcohol Clin. Exp. Res. (2018, Feb); 42(2):286-294. PMID: 29205408  Hilderbrand, E.R., and Lasek, A.W. Studying Sex Differences in Animal Models of Addiction: An Emphasis on Alcohol-Related Behaviors. ACS Chem. Neurosci. (2017, Dec 26).  Hilderbrand, E.R., and Lasek, A.W. Sex differences in cocaine conditioned place preference in C57BL/6J mice. Neuroreport, 25(2):105-9 (2014, Jan).

157

SEMINARS:

 Hilderbrand, E.R. and Lasek, A.W. Estrogen Receptors Regulate Ethanol Reward in Females, Psychiatric Institute Neuroscience Seminar, UIC (Oct. 10, 2016).  Hilderbrand, E.R. and Lasek, A.W. Estrogenic enhancement of ethanol reward requires activation of both ERα and ERβ, Women’s Health Research Day, UIC (April 20, 2016).  Hilderbrand, E.R., Satta, R., and Lasek, A.W. Ethanol and the Female Brain: Estrogen as a Regulator of Ethanol Reward and Binge Drinking Behavior. Psychiatric Institute Neuroscience Seminar, UIC (Aug. 10, 2015).  Hilderbrand, E.R., Satta, R., and Lasek, A.W. Estradiol enhances ethanol conditioned place preference in female C57BL/6J mice through actions at ERα. Society for Neuroscience, Chicago Chapter, annual meeting (March 20, 2015).

POSTER PRESENTATIONS:

 Hilderbrand, E.R. and Lasek, A.W. Amygdalar estrogen receptors as regulators of ethanol reward in females. Research Society on Alcoholism (RSA) annual meeting (June 24-28, 2017) †*  Hilderbrand, E.R. and Lasek, A.W. Estrogenic enhancement of ethanol reward requires activation of both ERα and ERβ. Research Society on Alcoholism (RSA) annual meeting (June 25-29, 2016) and Society for Neuroscience (SfN) annual meeting (Nov. 12-16, 2016) †*  Hilderbrand, E.R., Satta, R., and Lasek, A.W. Estradiol enhances ethanol reward and binge-like drinking in female C57BL/6J mice,* for UIC’s Psychiatry Research Forum Extravaganza (2014).  Hilderbrand, E.R., and Lasek. A.W. Sex differences in cocaine conditioned place preference in C57BL/6J mice, for UIC’s Psychiatry Research Forum Extravaganza (2013).

†Also presented at UIC’s annual Center for Alcohol Research in Epigenetics retreat. *Also presented at UIC’s annual Neuroscience Day graduate research forum.

TEACHING EXPERIENCE (UIC):

 PSCH 363, Behavioral Neuroscience: Course Director (2018-2019)  BIOS 386, Neurobiology Seminar: Course Director (2016)  BIOS 386, Neurobiology Seminar: Instructor (2015-2018)  BIOS 483, Neuroanatomy: Teaching Assistant (2015)  BIOS 484, Neuroscience I: Guest Lecturer (2014)

158

Example Lectures:

◦ PSCH 363: Body Fluid Homeostasis (2018-2019) ◦ BIOS 386: Sexual Differentiation of the Brain and Neural Regulation of Sexual Behavior (2018) ◦ BIOS 386: Sex Matters: the Importance of Sex-Inclusive Research in Biomedicine (2017) ◦ BIOS 483: Anatomy and Function of the Amygdala (2015) ◦ BIOS 386: The Neuroscience of Sex (2015) ◦ BIOS 484: Basic Processes in Neurogenesis (2014)

RESEARCH EXPERIENCE:

 University of Illinois at Chicago, Department of Psychiatry, Graduate Program in Neuroscience (2014-2018): Dissertation Research in the laboratory of Amy W. Lasek, PhD, on the role of estrogen receptors as regulators of ethanol reward and binge-like drinking behavior in female mice.

 University of Illinois at Chicago, Department of Psychiatry, Graduate Program in Neuroscience (2013): Research Rotation in the laboratory of Amy W. Lasek, PhD. Studied sex differences in cocaine conditioned place preference in mice.

 University of Illinois at Chicago, Department of Psychiatry, Graduate Program in Neuroscience (2012): Research Rotation in the laboratory of Dr. Greg Thatcher, PhD. Studied the effects of RXR agonist drug treatment in a mouse model of Alzheimer's Disease.

 Behavioral Neuroscience, Knox College (2010): In-class experiment. Studied the effects of neonatal amygdala lesions on the development of social behavior and fear responses in rats under Esther Penick, PhD, and Heather Hoffmann, PhD.

 Methods of Neuroscience, Knox College (2010): In-class experiment. Studied the effects of estradiol treatment on nucleus accumbens function (electrophysiology) in prepubescent male rats under Esther Penick, PhD.