Meltrin a Cytoplasmic Domain Interacts with SH3 Domains of Src and Grb2 and Is Phosphorylated by V-Src

Oncogene (2000) 19, 5842 ± 5850 ã 2000 Macmillan Publishers Ltd All rights reserved 0950 ± 9232/00 $15.00 www.nature.com/onc Meltrin a cytoplasmic domain interacts with SH3 domains of Src and Grb2 and is phosphorylated by v-Src

Akiko Suzuki1, Nae Kadota1, Tomokazu Hara1, Yoshiko Nakagami1, Toshiaki Izumi1, Tadaomi Takenawa2, Hisataka Sabe3 and Takeshi Endo*,1

1Department of Biology, Faculty of Science, Chiba University, Yayoicho, Inageku, Chiba, Chiba 263-8522, Japan; 2Department of Biochemistry, Institute of Medical Science, University of Tokyo, Shirokanedai, Minatoku, Tokyo 108-8639, Japan; 3Department of Molecular Biology, Osaka Bioscience Institute, Suita, Osaka 565-0874, Japan

Meltrin a/ADAM12 is a member of the ADAM/MDC receptor tyrosine kinases, tyrosine kinase-coupled family proteins characterized by the presence of cytokine receptors, TGF-b family receptor serine/ metalloprotease and disintegrin domains. This protein threonine kinases, and seven-pass G protein-coupled also contains a single transmembrane domain and a receptors. Integrins and cadherins not only serve as relatively long cytoplasmic domain containing several transmembrane adhesion molecules but also participate proline-rich sequences. These sequences are compatible in intracellular and extracellular signaling (Schwartz et with the consensus sequences for binding the Src al., 1995; Ben-Ze'ev, 1997; Yamada and Geiger, 1997). homology 3 (SH3) domains. To determine whether the ADAM/MDC family proteins have emerged as proline-rich sequences interact with SH3 domains in candidate molecules for proteolytic processing, cell ± several proteins, binding of recombinant SH3 domains to cell attachment, and cell fusion (Wolfsberg et al., 1995; the meltrin a cytoplasmic domain was analysed by pull- Wolfsberg and White, 1996; Huovila et al., 1996; Black down assays. The SH3 domains of Src and Yes bound and White, 1998; SchloÈ ndor and Blobel, 1999). These strongly, but that of Abl or phosphatidylinositol 3-kinase proteins contain characteristic domains: prodomain p85 subunit did not. Full-length Grb2/Ash bound preceded by N-terminal signal peptide, metallopro- strongly, whereas its N-terminal SH3 domain alone did tease, disintegrin, cysteine-rich, EGF repeat, transmem- less strongly. Src and Grb2 in bovine brain extracts also brane and cytoplasmic domains. Physiological roles of bound to meltrin a cytoplasmic domain on anity resin. the metalloprotease activity of several ADAM proteins Furthermore, immunoprecipitation with a monoclonal as proprotein convertases have been reported. antibody to meltrin a resulted in coprecipitation of Src ADAM17 is a tumor necrosis factor-a (TNF-a)- and Grb2 with meltrin a in cell extracts, suggesting that converting enzyme (TACE) and proteolytically con- Src and Grb2 are associated in vivo with meltrin a verts membrane-bound precursor of TNF-a to soluble cytoplasmic domain. This notion was also supported by mature TNF-a (Black et al., 1997; Moss et al., 1997). the ®ndings that exogenously expressed meltrin a MDC9 (meltrin g, ADAM9) in combination with cytoplasmic domain coexisted with Src and Grb2 on protein kinase Cd (PKCd) participates in shedding of the membrane rues. The C-terminal Tyr901 of meltrin the ectodomain of heparin-binding EGF-like growth a was phosphorylated both in vitro and in cultured cells factor (HB-EGF) to generate soluble HB-EGF (Izumi by v-Src. These results may imply that meltrin a et al., 1998). Kuzbanian (Kuz, ADAM10) is involved cytoplasmic domain is involved in a signal transduction in processing of the transmembrane protein Delta to for some biological function through the interaction with produce a soluble ligand for Notch (Qi et al., 1999). SH3-containing proteins. Oncogene (2000) 19, 5842 ± Fertilin a and b are the ®rst characterized ADAM 5850. proteins located on sperm head surface and considered to be mediating sperm ± egg attachment and fusion Keywords: ADAM/MDC family; meltrin a/ADAM12; during fertilization (Blobel et al., 1992). Since sperms SH3 domain; Src family; Grb2/Ash; tyrosine phos- bind to integrin a6b1 present on egg plasma membrane phorylation and fertilin b disintegrin peptide analogues prevent this binding, fertilin b is postulated to play essential roles through its disintegrin domain in the attachment of Introduction sperms to eggs (Almeida et al., 1995; Chen et al., 1999). This is con®rmed by the ®ndings that fertilin b-null A subset of various biological responses are mediated sperm is incapable of binding to egg surface (Cho et by transmembrane receptor proteins for extracellular al., 1998). MDC15 (metargidin, ADAM15) is also and intracellular signaling molecules (Birge et al., 1996; assumed to be involved in cell ± cell interaction through Thomas and Brugge, 1997). These receptor proteins the binding of its disintegrin domain to integrins avb3 include single-pass transmembrane growth factor and a5b1 (Zhang et al., 1998; Nath et al., 1999). Fertilin a contains in its cysteine-rich domain a sequence similar to a potential fusion peptide of a viral fusion protein (Blobel et al., 1992). As fusion peptides *Correspondence: T Endo, Department of Biology, Faculty of of viral fusion proteins are presumed to mediate virus ± Science, Chiba University, 1-33 Yayoicho, Inageku, Chiba, Chiba 263-8522, Japan cell membrane interactions leading to fusion, the fusion Received 30 May 2000; revised 2 October 2000; accepted 4 October peptide-like sequence of fertilin a is postulated to be 2000 implicated in sperm ± egg membrane fusion. Meltrin a, Meltrin a interacts with Src and Grb2 A Suzuki et al 5843 which has initially been cloned from a myogenic cell could be replaced by K (Feng et al., 1994; Lim et al., line, also harbors a fusion peptide-like sequence similar 1994; Alexandropoulos et al., 1995). To determine to a viral fusion peptide (Yagami-Hiromasa et al., whether these sequences were responsible for interac- 1995). In addition, Yagami-Hiromasa et al. (1995) tion with SH3 domains, we analysed in vitro binding showed that transfection of a truncated meltrin a of meltrin a cytoplasmic domain (MelCyt) to SH3 cDNA lacking prodomain and metalloprotease domain domains of Src, Yes, Abl, Grb2 and phosphatidyli- to skeletal muscle cells induced disorganized aggrega- nositol 3-kinase (PI3K) p85 subunit. Bacterially tion and cell fusion. Thus, they have postulated that expressed recombinant His-tagged MelCyt was im- meltrin a is involved in cell ± cell or cell ± matrix mobilized to Talon metal anity resin, and the interactions during skeletal muscle dierentiation. recombinant glutathione S-transferase (GST)-tagged Indeed, it is expressed during early mouse development SH3 domains were applied to the anity resin. Both in mesenchymal cells that give rise to skeletal muscle, Src and Yes SH3 domains de®nitely bound to MelCyt bones and visceral organs (Kurisaki et al., 1998). (Figure 2), but Abl and PI3K p85 SH3 domains Despite the fascinating postulation and suggestive hardly bound to it. The adaptor protein Grb2 consists evidence, however, there is no direct evidence that of SH3-SH2-SH3 domains. Full-length Grb2 bound any ADAM proteins possess bona ®de membrane strongly to MelCyt, whereas the N-terminal SH3 fusion activity (Huovila et al., 1996; Wolfsberg and domain bound less strongly and the C-terminal SH3 White, 1996). or SH2 domains hardly did (Figure 2). These results Several ADAM proteins have relatively long cyto- indicate that MelCyt interacts speci®cally with plasmic domains containing characteristic proline-rich particular SH3 domains in vitro but that the sequences (Wolfsberg and White, 1996), which are interaction is not restricted to either with the SH3 consistent with the consensus sequences for binding Src domains of tyrosine kinases or with those of the homology 3 (SH3) domain (Feng et al., 1994; Lim et adaptor protein. al., 1994; Alexandropoulos et al., 1995). The binding Next, to determine whether the Src family proteins motifs are categorized into two classes. MDC9 and Grb2 in mammalian tissues also bound to MelCyt, cytoplasmic domain contains two putative class I- the bovine brain membrane extract was added to the binding motifs and has been shown to bind Src SH3 His-tagged MelCyt immobilized to Talon. Binding domain but not Abl SH3 domain in vitro by ligand proteins were analysed by immunoblotting with two overlay blotting (Weskamp et al., 1996). Many proteins anti-c-Src polyclonal antibodies (pAbs), an anti-Fyn containing SH3 domains are localized to the plasma pAb, and an anti-Grb2 pAb. c-Src was detected as a membrane or associated with actin cytoskeleton and binding protein (Figure 3a), whereas Fyn was not participate in a variety of signal transduction pathways despite its presence in the brain membrane extract (Cohen et al., 1995; Pawson, 1995; Birge et al., 1996; (data not shown). The binding of Grb2 to MelCyt was Brown and Cooper, 1996; Thomas and Brugge, 1997). detected by the anti-Grb2 (Figure 3b). When GST ± Thus, Weskamp et al. (1996) have inferred that MDC9 MelCyt was added to the membrane extract as a may play a role in interactions with the cytoskeleton or competitor, the binding of c-Src and Grb2 was with intracellular signaling molecules through its retarded (Figure 3). These results imply that the intact cytoplasmic domain. c-Src and Grb2 as well as their recombinant SH3 Meltrin a cytoplasmic domain also contains proline- domains interact with MelCyt in vitro. rich sequences equivalent to the consensus for SH3- interacting sequence. We show here that the cytoplasmic domain bound recombinant SH3 domains of Src, Yes and Grb2 and also Src and Grb2 in brain extracts. Furthermore, Src and Grb2 were coimmunoprecipi- tated with meltrin a and colocalized with the exogenously expressed meltrin a cytoplasmic domain to the membrane rues. The C-terminal tyrosine was phosphorylated in vitro and in cultured cells by v-Src. These results support the notion that meltrin a cytoplasmic domain is involved in a signal transduction pathway through the interaction with SH3 domains.

Results

Binding of meltrin a cytoplasmic domain to SH3 domains of Src and Grb2 in vitro Meltrin a has relatively long cytoplasmic domain, which is abundant in proline and arginine. Scrutiny of Figure 1 (a) Schematic representation of functional domains of the sequence revealed that the domain contains ®ve meltrin a. SP, signal peptide; FP-like, fusion peptide-like putative consensus sequences of SH3-binding motifs: sequence; TM, transmembrane domain. (b) SH3-binding motifs in meltrin a cytoplasmic domain. Shown is the amino acid three class I and two class II motifs (Figure 1). The sequence of the cytoplasmic domain (amino acids 728 ± 903). consensus sequence of the class I and class II motifs Amino acid sequences denoted by single and double underlines are RXXPXXP and XPXXPXR, respectively, where R represent class I and II SH3-binding motifs, respectively

Oncogene Meltrin a interacts with Src and Grb2 A Suzuki et al 5844

Figure 2 In vitro binding of SH3 domains of Src family proteins and Grb2 to MelCyt. (a) Recombinant GST-tagged proteins used for the pull-down assay. (b) Binding proteins to MelCyt determined by the pull-down assay. His-tagged MelCyt was immobilized to Talon, and the GST-tagged proteins were applied to the anity resin. Proteins bound to the anity resin were eluted and analysed by SDS ± PAGE. Asterisks indicate the positions of pulled-down proteins

Association of Src and Grb2 with immunoprecipitated meltrin a To address whether meltrin a was associated with Src family proteins and Grb2 in cultured cells, lysates of C2 myoblasts and myotubes were immunoprecipitated with the anti-MelCyt monoclonal antibody (mAb) MC11. This mAb immunoprecipitates both endogenous and exogenously expressed meltrin a (see Figure 7a). The immunoprecipitates of the undierentiated Figure 3 In vitro binding of Src and Grb2 in bovine brain to MelCyt. (a) Binding of c-Src detected by immunoblotting with the and dierentiated C2 cells were analysed by immuno- anti-c-Src pAb (sc-18). (b) Binding of Grb2 detected with the anti- blotting with the anti-c-Src pAbs or the anti-Grb2 Grb2 pAb. His ± MelCyt was immobilized to Talon, and the pAb. The blots showed that c-Src (Figure 4a) and bovine brain membrane extract was applied to the anity resin. Grb2 (Figure 4b) were coprecipitated with meltrin a in GST ± MelCyt was added to the extract as a competitor. Proteins bound to the resin were dissociated and analysed by immuno- both myoblast and myotube lysates. When the lysates blotting. The addition of the competitor (+) resulted in were incubated with the anti-sarcomeric myosin heavy interference with the binding of both c-Src (a) and Grb2 (b). In chain mAb MF20 as a control, no precipitation of Src (a), the lower band represents a proteolytic fragment of c-Src or Grb2 was detected. Consequently, Src and Grb2 because its amount increased with the elapse of time. Another are likely to be associated with meltrin a in vivo as antibody anti-c-Src pAb (sc-19) gave a similar result well.

Colocalization of MelCyt with Src and Grb2 Since MelCyt was associated with Src and Grb2, we further investigated whether meltrin a coincided with Src and Grb2 in cells. However, endogenous meltrin a was not detected by immuno¯uorescence microscopy with any of the anti-MelCyt mAbs or pAb. Moreover, the exogenously expressed full-length meltrin a accumulated in the endoplasmic reticulum as has been shown with some ADAM proteins (Alfandari et al., Figure 4 Association of Src and Grb2 with immunoprecipitated 1997; Lum et al., 1998) (N Kadota et al., unpublished meltrin a.(a) Association of Src with immunoprecipitated meltrin observations). Thus, we applied transfection of pCMV/ a.(b) Association of Grb2 with immunoprecipitated meltrin a. MelCyt expressing MelCyt instead of full-length meltrin Lysates of C2 myoblasts (Mb) and myotubes (Mt) were immunoprecipitated with the anti-MelCyt mAb MC11 or anti- a. This plasmid and the plasmid expressing c-Src were myosin heavy chain mAb MF20 (a negative control). Src and cotransfected to C3H/10T1/2 (10T1/2) ®broblasts, and Grb2 were detected by immunoblotting with anti-c-Src pAb (sc- location of the proteins were detected by confocal laser 18) (a) and anti-Grb2 pAb (b), respectively. Anti-c-Src pAb (sc- scanning microscopy using the anti-MelCyt mAb MC11 19) gave a result similar to that presented in (a) and the anti-c-Src. Both the proteins were colocalized to the membrane rues in addition to some cytoplasmic distributions (Figure 5a,b). Indeed, Src has been demonstrated to be concentrated on certain membrane- When pCMV/MelCyt and the plasmid expressing associated structures (Nigg et al., 1982; David-Pfeuty Grb2 were cotransfected, immuno¯uorescent staining and Nouvian-Dooghe, 1990; Tsukita et al., 1991). with MC11 and the anti-Grb2 also located both the

Oncogene Meltrin a interacts with Src and Grb2 A Suzuki et al 5845 PY20 showed that Tyr of the MelCyt was phosphorylated when v-Src was transfected (Figure 7b). This phosphorylation took place on Tyr901 because Mel- Cyt(Y901F) was not phosphorylated. Accordingly, Tyr901 is phosphorylated by v-Src in vivo as well as in vitro. Endogenous mature meltrin a was also de®nitely phosphorylated on Tyr in v-Src-transfected cells, whereas pro-meltrin a was phosphorylated only slightly (Figure 7b, lanes 2 and 3). Considering that pro-meltrin a was more abundant than mature meltrin a in these cells (Figure 7a), the mature protein was much more easily phosphorylated than its precursor. These results may suggest that the binding of v- and c- Src to mature meltrin a is required for the phosphorylation of its cytoplasmic domain.

Discussion

In the present study, we have shown that meltrin a cytoplasmic domain, which contains multiple SH3- binding motifs, binds SH3 domains of Src and Grb2 both in vitro and in vivo. Furthermore, Tyr901 in the Figure 5 Colocalization of MelCyt with Src and Grb2 to the cytoplasmic domain is phosphorylated by v-Src not membrane rues examined by confocal microscopy. (a and b) 10T1/2 cells cotransfected with pCMV/MelCyt and pBabe/Src. only in vitro but also in cultured cells. SH3 domains of Localization of MelCyt (a) and c-Src (b) was detected by Src family proteins and Grb2 recognize both class I immuno¯uorescent staining with MC11 and the anti-c-Src pAb and class II ligands, but they have unique ligand (sc-18). (c and d) 10T1/2 cells cotransfected with pCMV/MelCyt preferences among the consensus sequences (Feng et and pCMV myc-Grb2. Localization of MelCyt (c) and Grb2 (d) al., 1994; Lim et al., 1994; Alexandropoulos et al., was detected by immuno¯uorescent staining with MC11 and the anti-Grb2 pAb. These proteins were colocalized to the membrane 1995; Sparks et al., 1996). As meltrin a cytoplasmic rues (arrows) domain contains three class I and two class II motifs, binding of both Src and Grb2 seems to be possible. It is of interest whether the binding of Src and Grb2 takes place simultaneously. On the other hand, MDC9 proteins to the membrane rues (Figure 5c,d). This cytoplasmic domain contains two class I motifs but no location of Grb2 is consistent with the report that class II motif. Since both these class I motifs have been microinjected Grb2 is accumulated in membrane rues shown to bind Src SH3 domains in vitro (Weskamp et (Bar-Sagi et al., 1993). These results corroborate the al., 1996), they may not bind SH3 domains of Grb2 or notion that meltrin a cytoplasmic domain interacts with other adaptor proteins. Thus, MDC9 may not be Src and Grb2 in vivo. involved in a Grb2-mediated signal transduction process, in which meltrin a participates. A various types of proteins that interact with Src Phosphorylation of meltrin a cytoplasmic domain by Src family kinases and Grb2 through the SH3 domains Several Src-binding proteins are phosphorylated at have been identi®ed (Birge et al., 1996; Brown and their Tyr residues directly by Src (Brown and Cooper, Cooper, 1996; Thomas and Brugge, 1997). Several type 1996; Thomas and Brugge, 1997). To examine whether 1 transmembrane proteins have been reported, to a Tyr residue in MelCyt was phosphorylated by Src, which Grb2 binds through its SH3 domain. These GST-MelCyt was incubated with GST ± v-Src and 32P include b-dystroglycan, receptor protein-tyrosine phos- incorporation was analysed by autoradiography. En- phatase a (RPTPa) and CD28 (Yang et al., 1995; den olase, which contains six putatively phosphorylatable Hertog and Hunter, 1996; Okkenhaug and Rottapel, Tyr by Src, was used as a positive control of substrate 1998). Meltrin a is another type 1 transmembrane for v-Src. MelCyt was phosphorylated by v-Src, protein that interacts with Grb2 SH3 domain. whereas MelCyt(Y901F), in which the sole Tyr at 901 Although Grb2 contains two SH3 domains at its N- was replaced with Phe, was not (Figure 6). Thus, and C-termini, the anity of these SH3 domains to the Tyr901 is the sole phosphorylation site in MelCyt by v- ligands is usually not equal. For instance, the N- Src in vitro. The ratio of intensity of phosphorylated terminal SH3 prefers the ligand motifs in Sos and bands of enolase and MelCyt apparently re¯ects the dynamin, whereas the C-terminal SH3 has higher ratio of phosphorylation site numbers (6 : 1). anity to RPTPa and CD28 (Gout et al., 1993; den We further addressed whether Tyr901 was phos- Hertog and Hunter, 1996; Okkenhaug and Rottapel, phorylated by v-Src also in cultured cells. Plasmids 1998). However, the individual SH3 domain moieties expressing MelCyt and v-Src were cotransfected to are often unable to bind to the ligands, and both SH3 10T1/2 cells. MelCyt in the cell lysate was immuno- domains are often required for optimal binding to the precipitated with the mAb MC11. Endogenous pro- ligands (den Hertog and Hunter, 1996; Okkenhaug and meltrin a (115 kDa) and processed mature meltrin a Rottapel, 1998). This seems to explain the result that (86 kDa) were also immunoprecipitated (Figure 7a). full-length Grb2 bound to MelCyt much more strongly Immunoblotting with the anti-phosphotyrosine mAb than the individual N- and C-terminal SH3 domains.

Oncogene Meltrin a interacts with Src and Grb2 A Suzuki et al 5846

Figure 6 In vitro phosphorylation of MelCyt by v-Src. Enolase (a positive control for Src substrate), GST ± MelCyt, and GST ± MelCyt(Y901F) were incubated with GST ± v-Src as indicated in the presence of [g-32P]ATP. (a) SDS ± PAGE pattern of mixed proteins. (b) Proteins phosphorylated by v-Src detected by autoradiography. GST ± MelCyt but not GST ± MelCyt(Y901F) was phosphorylated. GST ± v-Src was autophosphorylated. Since MelCyt and MelCyt(Y901F) comprise amino acids 769 ± 903 and 744 ± 903, respectively (see Materials and methods), the former migrated faster than the latter

might link meltrin a and unidenti®ed transmembrane proteins or cytoplasmic proteins containing phosphotyrosine. Although Grb2 serves as an adaptor in the RPTK ± Ras signaling, the binding of Grb2 or Src through their SH3 domains to dynamin results in the activation of dynamin GTPase (Gout et al., 1993; Miki et al., 1994). In this consequence, the association of SH3-containing signaling proteins with dynamin may regulate endocytosis. Similarly, the binding of SH3 domains of Grb2 or Src might regulate the activity of meltrin a such as metalloprotease and cell adhesion activities (see below). Phosphorylation of C-terminal Tyr527 in c-Src by Csk leads to intramolecular interactions of the SH2 and SH3 domains and stabilizes the inactive closed conformation of the kinase. Displacement of the intramolecular interactions of the SH2 and SH3 domains with high-anity ligands as well as dephos- phorylation of Tyr527 or autophosphorylation of Tyr416 in the kinase domain results in the open Figure 7 Phosphorylation of MelCyt and endogenous meltrin a conformation essential for the Src kinase activity by v-Src in cultured cells. Empty pBK-CMV vector, pCMV/v-Src, (Brown and Cooper, 1996; Thomas and Brugge, pMelCyt, and pMelCyt(Y901F) were cotransfected to 10T1/2 cells 1997). Since meltrin a bound c-Src presumably through as indicated. The cell lysates were immunoprecipitated with the SH3 domain in vivo as well as in vitro, the kinase MC11. (a) Detection of meltrin a by immunoblotting with the anti-MelCyt pAb after immunoprecipitation. (b) Detection of should have been activated. Thus, it is important to phosphotyrosine-containing proteins by immunoblotting with identify the substrate of c-Src that is associated with PY20 after immunoprecipitation. Top and bottom panels meltrin a. One of the possible substrates is meltrin a represent shorter (5 s) and longer (60 s) exposures, respectively, itself because meltrin a was phosphorylated by v-Src. of chemiluminescent images. As both MelCyt and MelCyt To our knowledge, meltrin a is the ®rst identi®ed (Y901F) comprise amino acids 744 ± 903, they migrated with equal mobility single-pass transmembrane protein that interacts with Src family kinases through the SH3 domain and is phosphorylated by Src family kinases. v-Src binds through its SH3 domain to four-pass transmembrane protein connexin 43 and phosphorylates it (Kanemitsu Grb2 mediates the signaling from receptor protein- et al., 1997). It is postulated that this interaction tyrosine kinase (RPTK) to activation of Ras and the facilitates the phosphorylation of Tyr265 in connexin following MAP kinase cascade. This is achieved by by v-Src and subsequent interaction between Src SH2 binding of its SH2 domain to phosphotyrosine on and the phosphotyrosine. This stabilized association RPTK and of its SH3 domains to the Ras guanine may cause further phosphorylation of another Tyr in nucleotide exchange factor Sos (Pawson, 1995; Birge et connexin by v-Src and multiple phosphorylation of Ser al., 1996). In some cases, connecting proteins such as residues by v-Src-associated kinases (Kanemitsu et al., Shc mediate RPTK to Grb2 signaling. From the 1997). If this scheme is applicable to meltrin a, analogy to this signal transduction cascade, Grb2 phosphorylation of Tyr901 by Src may induce the

Oncogene Meltrin a interacts with Src and Grb2 A Suzuki et al 5847 concerted binding of Src SH2 domain. Indeed, meltrin not to the processed forms of these ADAM proteins, a cytoplasmic domain contains multiple Ser/Thr they may have a role in regulating the intracellular residues compatible with consensus phosphorylation processing, transport, or ®nal subcellular localization sites by several protein Ser/Thr kinases including of the ADAMs (Howard et al., 1999). Although these protein kinase A (PKA), PKC, and casein kinase II. proteins do not bind to meltrin a cytoplasmic domain, In this context, it is worth noting that MDC9 is these ®ndings and the in vitro binding of Src SH3 associated with and phosphorylated by PKCd and that domain to MDC9 (Weskamp et al., 1996) suggest that constitutively active PKCd or MDC9 is involved in meltrin a also interacts with some SH3-containing ectodomain shedding of proHB-EGF (Izumi et al., proteins besides Src family kinases and Grb2. 1998). As the secreted form of human meltrin a In addition to the physiological roles brought about (ADAM12-S) also possesses metalloprotease activity by the interaction between meltrin a and Src or Grb2, (Loechel et al., 1998), it is intriguing to determine we may also need to identify the signals that induce the whether Src and PKC participate in activation of its interaction. Some SH3-mediated interactions, for protease activity. instance Grb2 ± Sos interaction, are constitutive, but Putative physiological roles of ADAM proteins the others may be inducible (Cohen et al., 1995; include the regulation of cell adhesion and cell fusion. Pawson, 1995; Birge et al., 1996). Identi®cation of Although fertilin a and meltrin a contain viral fusion upstream signals, if any, and downstream signals from peptide-like sequences, their direct role in cell fusion the interaction between meltrin a and SH3-containing has not been proved (Huovila et al., 1996; Wolfsberg proteins is required for elucidation of molecular and White, 1996). On the other hand, disintegrin mechanisms for physiological actions of meltrin a. domains of fertilin b and MDC15 have been shown to This may reveal a novel type of signal transduction interact with particular types of integrins (Almeida et pathway. al., 1995; Zhang et al., 1998; Chen et al., 1999; Iba et al., 1999). In the case of human ADAM12-S, cysteine- rich domain is involved in the binding to heparan sulfate proteoglycan (Iba et al., 1999). These associa- Materials and methods tions may account for the roles of these ADAM Cell culture proteins in cell ± cell or cell ± matrix interaction. The location of MelCyt to the plasma membrane-associated The mouse C2 skeletal muscle cells (Yae and Saxel, 1977) structures supports a possible role of meltrin a in the were cultured as described (Endo, 1992). The proliferating cell ± cell or cell ± matrix interaction. As cell adhesion, myoblasts were maintained at 378C in DME medium supplemented with 10% fetal bovine serum (growth medium). for example through integrins, is regulated by To induce terminal dierentiation, * 26105 cells (* 20% intracellular signaling (Schwartz et al., 1995; Yamada con¯uency) were plated in the growth medium on a 100-mm and Geiger, 1997), implication of Src family kinases dish and maintained for 16 ± 24 h, and then the medium was and Grb2 in cell adhesion through meltrin a remains to replaced with DME medium supplemented with 5% horse be examined. serum (dierentiation medium). Myotubes developed exten- ADAM proteins are synthesized as proproteins with sively by 96 h after the shift to the dierentiation medium. prodomains and processed into mature forms. At least The mouse C3H/10T1/2 (10T1/2) ®broblasts (Rezniko et al., some of them including meltrin a are likely to be 1973) were cultured in the growth medium. processed by furin or furin-like endopeptidase in a late Golgi compartment (Loechel et al., 1998; Lum et al., cDNA cloning 1998; Roghani et al., 1999). Appreciable amounts of Cytoplasmic RNA was prepared from C2 myotubes as the unprocessed ADAM proteins are present probably described previously (Endo and Nadal-Ginard, 1987), and in the ER or early Golgi compartments (Loechel et al., poly(A)+ RNA was isolated by using Oligotex-dT30 Super 1998; Lum et al., 1998; Roghani et al., 1999). We (Roche). The ®rst strand cDNA was synthesized with showed here that processed mature meltrin a was much SuperScript II RNase H(7) reverse transcriptase (Gibco more easily phosphorylated on Tyr than its precursor. BRL) to 2 mg of the template poly(A)+ RNA primed with a Although c-Src and Grb2 were distributed in cytoplas- meltrin a 3' primer. To clone a 1979 bp cDNA fragment of mic perinuclear region and vesicular structures (see meltrin a (DDBJ/EMBL/GenBank accession number D50411, nucleotides 962 ± 2940), reverse transcription-PCR Figure 5) as well as in the plasma membrane-associated + structures, the plasma membrane-associated meltrin a was carried out to C2 myotube poly(A) RNA. The C2 myotube cDNA library constructed in l ZAPII (Matsumoto seems to serve as a much better substrate for Src et al., 1997) was screened with this cDNA fragment labeled kinases than the ER- or Golgi-associated precursor. with [a-32P]dCTP (4111 TBq/mmol, ICN Biomedicals) by This notion may also support the possible implication using BcaBEST labeling kit (Takara Shuzo). A 2922-bp of phosphorylation of meltrin a in the cellular cDNA including the entire coding region of meltrin a interactions or in the metalloprotease activity that (nucleotides 209 ± 3130) was cloned. pBluescript SK(7) meltrin a exerts on the plasma membrane. However, phagemid containing cloned cDNAs were obtained by in low yield and purity of bacterially expressed recombi- vivo excision. Nucleotide sequence of the cDNAs was nant full-length meltrin a and accumulation in the ER determined with LI-COR 4000 automated DNA sequencing of exogenously expressed full-length meltrin a (N system by use of SequiTherm Long-Read Cycle Sequencing Kadota et al., unpublished observations) interfere with Kit-LC (Epicentre Technologies). examining this possibility. Recently, Howard et al. (1999) have shown that SH3 Preparation of recombinant proteins domain-containing endophilin I and SH3PX1 interact The NcoI fragment of meltrin a cDNA encoding MelCyt with SH3-binding motifs of MDC9 and MDC15. Since (amino acids 744 ± 903) was fused in frame to His-tag in these proteins preferentially bind to the precursors but pQE-31 vector (Qiagen). The recombinant protein of His-

Oncogene Meltrin a interacts with Src and Grb2 A Suzuki et al 5848 tagged MelCyt was expressed in the E. coli strain XL1-Blue. (150 mM NaCl, 50 mM Tris-HCl, pH 8.0, 1% Nonidet P-40, The E. coli was sonicated in Solution A (150 mM NaCl and 0.5% sodium deoxycholate, 0.1% SDS, 0.1 mM PMSF and 20 mM Tris-HCl, pH 8.0) containing 1% Triton X-100 and 1mM sodium vanadate). After microcentrifugation for insoluble materials were removed by centrifugation. The 15 min, the supernatant solution was preabsorbed with lysate was applied to Talon metal anity resin (Clontech), Protein G ± Sepharose 4FF (Amersham Pharmacia). The and the bound recombinant protein was eluted with Elution anti-MelCyt mAb MC11 or the anti-myosin heavy chain buer H (100 mM imidazole in Solution A). The SmaI mAb MF20 (Bader et al., 1982) as a negative control was fragment of meltrin a cDNA fragment encoding a part of its added to the supernatant and mixed for 1 h by rotation. cytoplasmic domain (amino acids 769 ± 903) was subcloned in Protein G ± Sepharose was then added to the supernatant and pGEX-2T vector (Amersham Pharmacia). Recombinant mixed for 1 h. The Protein G ± Sepharose beads were washed plasmids of pGEX-3X vector (Amersham Pharmacia) con- ®ve times with PIPA lysis buer. Proteins bound to the beads taining each of the cDNAs encoding SH3 domains of Src, were dissociated with 9 M urea, treated with SDS sample Yes and Abl were provided by Dr M Sudol. pGEX-3X buer, subjected to SDS ± PAGE, and transferred to vectors containing each of the cDNAs encoding full-length Immobilon transfer membranes. Bound proteins were Grb2, its N- and C-terminal SH3 domains, SH2 domain and detected by immunoblotting with the anti-c-Src pAbs (sc-18 PI3K p85 SH3 domain are described elsewhere (Miki et al., and sc-19) and the anti-Grb2 pAb by using Renaissance 1994; Shibasaki et al., 1994). All these GST-tagged proteins Western blot chemiluminescence reagent. were expressed in XL1-Blue and anity-puri®ed with glutathione-Sepharose 4B (Amersham Pharmacia). The Transfection of MelCyt and confocal laser scanning microscopy bound proteins were eluted with Elution buer G (1 mg/ml glutathione in 50 mM Tris-HCl, pH 8.0). MelCyt cDNA encoding amino acids 728 ± 903 was synthesized by PCR and subcloned in pBK-CMV vector (Strata- gene) (pCMV/MelCyt). Chicken c-src DNA subcloned in In vitro binding assay pBabePuro vector (pBabe/Src) is described by Sabe et al. The His-tagged MelCyt was immobilized to Talon metal (1992). An EcoRI site was introduced in the rat Ash/Grb2 anity resin. Each of the anity puri®ed GST-tagged cDNA sequence (Matuoka et al., 1992) corresponding to the proteins were added and mixed for 2 h by rotation at 48C. ®rst and the second amino acids (MetlGlu). The EcoRI Unbound proteins were removed by washing with Washing fragment containing the entire coding sequence was fused in buer (500 mM NaCl, 20 mM Tris-HCl, pH 8.0 and 0.1% frame to Myc-tag in pCMVmyc vector (Matsumoto et al., Triton X-100). The proteins associated with the immobilized 1997) (pCMVmyc-Grb2). pCMV/MelCyt and pBabe/Src or MelCyt were eluted with Elution buer H. They were pCMVmyc-Grb2 were cotransfected to 10T1/2 cells by analysed by SDS ± PAGE. calcium phosphate-mediated method as described (Endo et Bovine brain membrane extract was prepared according to al., 1996). Matsui et al. (1996). In some case, GST ± MelCyt was added Twenty-four hours after the transfection, the cells were to this extract as a competitor. These extracts were ®xed and processed for immuno¯uorescence microscopy preabsorbed with Talon and mixed with the His ± MelCyt- (Endo and Nadal-Ginard, 1998). MelCyt was detected by immobilized Talon for 2 h by rotating at 48C. Unbound the staining with the mAb MC11 followed by the staining proteins were removed by washing with Washing buer. The with FITC-conjugated goat anti-mouse IgG (anity-puri®ed, proteins bound to the immobilized MelCyt were dissociated Cappel), c-Src and Grb2 were detected by the staining with with SDS sample buer, subjected to SDS ± PAGE, and the anti-c-Src pAb (sc-18) and the anti-Grb2 pAb, respec- transferred to Immobilon transfer membranes (Millipore). tively, and with rhodamine-conjugated goat anti-rabbit IgG Src family proteins and Grb2 were detected by immunoblot- (anity-puri®ed, Cappel). Specimens were observed with a ting with the anti-c-Src pAbs (Santa Cruz, sc-18 and sc-19), Zeiss LSM 410 confocal laser scanning microscope by using a anti-Fyn pAb (sc-16), and the anti-Ash/Grb2 pAb (Matuoka Zeiss 636Plan Apochromat lens. et al., 1993), respectively, by using Renaissance Western blot chemiluminescence reagent Plus (NEN). In vitro phosphorylation NcoI±XhoI fragment of pSR-XD2 (Cross and Hanafusa, Production of polyclonal and monoclonal antibodies 1983) (presented by Drs M Hamaguchi and H Hanafusa) GST moiety was removed from the GST ± MelCyt by containing entire v-src coding sequence was subcloned in digesting with 10 U/ml bovine thrombin (Sigma). The pGEX-2T. A point mutation of Tyr901 to Phe in MelCyt cytoplasmic domain was separated by SDS ± PAGE and [MelCyt(Y901F)] was introduced by synthesizing the mutated recovered from the gel. The protein emulsi®ed with Freund's cDNA by PCR with sense (CAAAAGGAAGACGTTGAT- complete adjuvant (Difco) was subcutaneously injected into a GCG) and antisense (CACTTGATAAAGGCATTGTGG) New Zealand white rabbit. The protein emulsi®ed with primers. The mutated cDNA was also subcloned in pGEX- Freund's incomplete adjuvant was used for the second and 2T. The recombinant proteins were expressed and puri®ed as the third injection. After the third injection, whole blood was described above. In vitro phosphorylation of MelCyt by v-Src collected and IgG fraction was isolated. The antibody was was assayed according to Carter (1997). Brie¯y, phosphor- anity-puri®ed through HiTrap NHS-activated (Amersham ylation reaction was started by adding GST ± v-Src to anity- Pharmacia) coupled with the recombinant GST ± MelCyt. puri®ed GST ± MelCyt, GST ± MelCyt(Y901F), or acid-dena- The recombinant protein of His ± MelCyt was injected into tured enolase in tyrosine kinase reaction buer (20 mM a BALB/c mouse intraperitoneally for immunization. After HEPES, 1 mM MnCl2,1mM DTT and 0.1 mM sodium the third injection, splenocytes of the mouse were fused with vanadate) containing 5 mM MgCl2,5mM ATP and 5 mCi/ml the mouse myeloma X63Ag8.653 cells with polyethylene glycol [g-32P]ATP. The reaction was conducted for 10 min at 308C 1500 (Roche). Hybridomas were cloned by limiting dilution and stopped by adding ice-cold 26SDS sample buer. and screened by ELISA and immunoblotting. mAbs secreted Proteins were resolved by SDS ± PAGE and phosphorylation by the hybridomas were recovered in cell culture medium. was analysed by autoradiography.

Immunoprecipitation Phosphorylation in transfected cells C2 myoblasts and myotubes were harvested, washed with MelCyt and MelCyt(Y901F) cDNAs with its termination PBS, and lysed with ®ve volumes of cold RIPA lysis buer codon were subcloned in pEGFP-N1 vector (Clontech)

Oncogene Meltrin a interacts with Src and Grb2 A Suzuki et al 5849 [pMelCyt and pMelCyt(Y901F)]. They express MelCyt and Acknowledgments MelCyt(Y901F) without EGFP-tag owing to the presence of We are grateful to Dr Marius Sudol for the generous gift termination codon upstream of the EGFP sequence. Either of the SH3 domain cDNA collections and to Drs Michinari one of these plasmids and v-src ligated in pBK-CMV Hamaguchi and Hidesaburo Hanafusa for pSR-XD2. C3H/ (pCMV/v-Src) were cotransfected to 10T1/2 cells. The cells 10T1/2 cells were obtained from Japanese Cancer Research were lysed with RIPA lysis buer, and MelCyt was Resources Bank (JCRB). This study was partly supported immunoprecipitated with MC11 as described above. Phos- by research grants from the Ministry of Education, phorylation of Tyr in the immunoprecipitated protein was Science, Sports, and Culture of Japan and from the detected by immunoblotting with horseradish peroxidase- Ministry of Health and Welfare of Japan for Nervous conjugated anti-phosphotyrosine mAb PY20 (Transduction and Mental Disorders (8A-1 and 11B-1). Laboratories) by using Renaissance Western blot chemiluminescence reagent.

References

Alexandropoulos K, Cheng G and Baltimore D. (1995). Huovila A-PJ, Almeida EAC and White JM. (1996). Curr. Proc. Natl. Acad. Sci. USA, 92, 3110 ± 3114. Opin. Cell. Biol., 8, 692 ± 699. AlfandariD,WolfsbergTG,WhiteJMandDeSimoneDW. Iba K, Albrechtsen R, Gilpin BJ, Loechel F and Wewer UM. (1997). Dev. Biol., 182, 314 ± 330. (1999). Am.J.Pathol.,154, 1489 ± 1501. Almeida EAC, Huovila A-PJ, Sutherland AE, Stephens LE, IzumiY,HirataM,HasuwaH,IwamotoR,UmetaT, Calarco PG, Shaw LM, Mercurio AM, Sonnenberg A, Miyado K, Tamai Y, Kurisaki T, Sehara-Fujisawa A, Primako P, Myles DG and White JM. (1995). Cell, 81, Ohno S and Mekada E. (1998). EMBO J., 17, 7260 ± 7272. 1095 ± 1104. Kanemitsu MY, Loo LWM, Simon S, Lau AF and Eckhart Bader D, Masaki T and Fischman DA. (1982). J. Cell. Biol., W. (1997). J. Biol. Chem., 272, 22824 ± 22831. 95, 763 ± 770. Kurisaki T, Masuda A, Osumi N, Nabeshima Y and Bar-Sagi D, Rotin D, Batzer A, Mandiyan V and Schles- Fujisawa-Sehara A. (1998). Mech. Dev., 73, 211 ± 215. singer J. (1993). Cell, 74, 83 ± 91. Lim WA, Richards FM and Fox RO. (1994). Nature, 372, Ben-Ze'ev A. (1997). Curr. Opin. Cell. Biol., 9, 99 ± 108. 375 ± 379. Birge RB, Knudsen BS, Besser D and Hanafusa H. (1996). LoechelF,GilpinBJ,EngvallE,AlbrechtsenRandWewer Genes Cells, 1, 595 ± 613. UM. (1998). J. Biol. Chem., 273, 16993 ± 16997. Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Lum L, Reid MS and Blobel CP. (1998). J. Biol. Chem., 273, Wolfson MF, Castner BJ, Stocking KL, Reddy P, 26236 ± 26247. Srinivasan S, Nelson N, Boiani N, Schooley KA, Gerhart Matsui T, Amano M, Yamamoto T, Chihara K, Nakafuku M, Davis R, Fitzner JN, Johnson RS, Paxton RJ, March M, Ito M, Nakano T, Okawa K, Iwamatsu A and CJ and Cerretti DP. (1997). Nature, 385, 729 ± 733. Kaibuchi K. (1996). EMBO J., 15, 2208 ± 2216. Black RA and White JM. (1998). Curr. Opin. Cell. Biol., 10, Matsumoto K, Asano T and Endo T. (1997). Oncogene, 15, 654 ± 659. 2409 ± 2417. Blobel CP, Wolfsberg TG, Turck CW, Myles DG, Primako Matuoka K, Shibata M, Yamakawa A and Takenawa T. P and White JM. (1992). Nature, 356, 248 ± 252. (1992). Proc. Natl. Acad. Sci. USA, 89, 9015 ± 9019. Brown MT and Cooper JA. (1996). Biochim. Biophys. Acta, Matuoka K, Shibasaki F, Shibata M and Takenawa T. 1287, 121 ± 149. (1993). EMBO J., 12, 3467 ± 3473. Carter N. (1997). Current Protocols in Protein Science. Miki H, Miura K, Matuoka K, Nakata T, Hirokawa N, Coligan JE, Dunn BM, Ploegh HL, Speicher DW and Orita S, Kaibuchi K, Takai Y and Takenawa T. (1994). J. Wing®eld PT (eds). John Wiley & Sons, Inc., pp. 13.7.1 ± Biol. Chem., 269, 5489 ± 5492. 13.7.22. Moss ML, Jin S-LC, Milla ME, Bickett DM, Burkhart W, Chen MS, Almeida EAC, Huovila A-PJ, Takahashi Y, Shaw Carter HL, Chen W-J, Clay WC, Didsbury JR, Hassler D, LM, Mercurio AM and White JM. (1999). J. Cell. Biol., Homan CR, Kost TA, Lambert MH, Leesnitzer MA, 144, 549 ± 561. McCauley P, McGeehan G, Mitchell J, Moyer M, Pahel Cho C, Bunch DO, Faure J-E, Goulding EH, Eddy EM, G, Rocque W, Overton LK, Schoenen F, Seaton T, Su J-L, Primako P and Myles DG. (1998). Science, 281, 1857 ± Warner J, Willard D and Becherer JD. (1997). Nature, 1859. 385, 733 ± 736. Cohen GB, Ren R and Baltimore D. (1995). Cell, 80, 237 ± Nath D, Slocombe PM, Stephens PE, Warn A, Hutchinson 248. GR, Yamada KM, Docherty AJP and Murphy G. (1999). Cross FR and Hanafusa H. (1983). Cell, 34, 597 ± 607. J. Cell. Sci., 112, 579 ± 587. David-Pfeuty T and Nouvian-Dooghe Y. (1990). J. Cell. Nigg EA, Sefton BM, Hunter T, Walter G and Singer SJ. Biol., 111, 3097 ± 3116. (1982). Proc. Natl. Acad. Sci. USA, 79, 5322 ± 5326. den Hertog J and Hunter T. (1996). EMBO J., 15, 3016 ± Okkenhaug K and Rottapel R. (1998). J. Biol. Chem., 273, 3027. 21194 ± 21202. Endo T. (1992). J. Biochem., 112, 321 ± 329. Pawson T. (1995). Nature, 373, 573 ± 580. Endo T and Nadal-Ginard B. (1987). Cell, 49, 515 ± 526. QiH,RandMD,WuX,SestanN,WangW,RakicP,XuT Endo T and Nadal-Ginard B. (1998). J. Cell. Sci., 111, and Artavanis-Tsakonas S. (1999). Science, 283, 91 ± 94. 1081 ± 1093. Rezniko CA, Brankow DW and Heidelberger C. (1973). Endo T, Matsumoto K, Hama T, Ohtsuka Y, Katsura G and Cancer Res., 33, 3231 ± 3238. Obinata T. (1996). J. Biol. Chem., 271, 27855 ± 27862. Roghani M, Becherer JD, Moss ML, Atherton RE, Feng S, Chen JK, Yu H, Simon JA and Schreiber SL. (1994). Erdjument-Bromage H, Arribas J, Blackburn RK, Science, 266, 1241 ± 1247. Weskamp G, Tempst P and Blobel CP. (1999). J. Biol. Gout I, Dhand R, Hiles ID, Fry MJ, Panayotou G, Das P, Chem., 274, 3531 ± 3540. Truong O, Totty NF, Hsuan J, Booker GW, Campbell ID Sabe H, Knudsen B, Okada M, Nada S, Nakagawa H and and Water®eld MD. (1993). Cell, 75, 25 ± 36. Hanafusa H. (1992). Proc. Natl. Acad. Sci. USA, 89, Howard L, Nelson KK, Maciewicz RA and Blobel CP. 2190 ± 2194. (1999). J. Biol. Chem., 274, 31693 ± 31699.

Oncogene Meltrin a interacts with Src and Grb2 A Suzuki et al 5850 SchloÈ ndor J and Blobel CP. (1999). J. Cell. Sci., 112, 3603 ± Wolfsberg TG, Primako P, Myles DG and White JM. 3617. (1995). J. Cell. Biol., 131, 275 ± 278. Schwartz MA, Schaller MD and Ginsberg MH. (1995). Wolfsberg TG and White JM. (1996). Dev. Biol., 180, 389 ± Annu. Rev. Cell. Dev. Biol., 11, 549 ± 599. 401. Shibasaki F, Fukami K, Fukui Y and Takanawa T. (1994). Yae D and Saxel O. (1977). Nature, 270, 725 ± 727. Biochem. J., 302, 551 ± 557. Yang B, Jung D, Motto D, Meyer J, Koretzky G and Sparks AB, Rider JE, Homan NG, Fowlkes DM, Quilliam Campbell KP. (1995). J. Biol. Chem., 270, 11711 ± 11714. LA and Kay BK. (1996). Proc. Natl. Acad. Sci. USA, 93, Yagami-Hiromasa T, Sato T, Kurisaki T, Kamijo K, 1540 ± 1544. Nabeshima Y and Fujisawa-Sehara A. (1995). Nature, Thomas SM and Brugge JS. (1997). Annu. Rev. Cell. Dev. 377, 652 ± 656. Biol., 13, 513 ± 609. Yamada KM and Geiger B. (1997). Curr. Opin. Cell. Biol., 9, Tsukita S, Oishi K, Akiyama T, Yamanashi Y, Yamamoto T 76 ± 85. and Tsukita S. (1991). J. Cell. Biol., 113, 867 ± 879. Zhang X-P, Kamata T, Yokoyama K, Puzon-McLaughlin W Weskamp G, KraÈ tzschmar J, Reid MS and Blobel CP. and Takada Y. (1998). J. Biol. Chem., 273, 7345 ± 7350. (1996). J. Cell. Biol., 132, 717 ± 726.

Oncogene