Number 2 February 2014

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Volume 18 - Number 2 February 2014

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles (“cards”) on genes, leukaemias, solid tumours, cancer-prone diseases, and also more traditional review articles (“deep insights”) on the above subjects and on surrounding topics. It also present case reports in hematology and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Carol Moreau, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008.

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Editor

Jean-Loup Huret (Poitiers, France) Editorial Board

Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections Adriana Zamecnikova (Kuwait) Leukaemia Section

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Volume 18, Number 2, February 2014

Table of contents

Gene Section

ADAMTS12 (ADAM Metallopeptidase With Thrombospondin Type 1 Motif, 12) 78 Santiago Cal, Alvaro J Obaya CPM (carboxypeptidase M) 82 Anne-Marie Lambeir GALNT6 (UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalacto saminyltransferase 6 (GalNAc-T6)) 90 Jae-Hyun Park, Yusuke Nakamura LRP1B (low density lipoprotein receptor-related protein 1B) 93 Hugo Prazeres, Catarina Salgado, Cecília Duarte, Paula Soares MIR296 (microRNA 296) 102 Chiara Verdelli, Sabrina Corbetta PIAS1 (protein inhibitor of activated STAT, 1) 106 Andrea Rabellino, Pier Paolo Scaglioni PRUNE (prune exopolyphosphatase) 110 Massimo Zollo RNF11 (ring finger protein 11) 112 Elena Santonico, Anna Mattioni, Alberto Calderone TALDO1 (transaldolase 1) 117 Zachary Oaks, Andras Perl

Leukaemia Section t(X;14)(p11.4;q32.33) IGH/GPR34 122 Iwona Wlodarska

Solid Tumour Section

Pancreatic tumors: an overview 125 Carlos A Tirado, David S Shabsovich, Jianling Ji, David Dawson

Deep Insight Section

The contribution of circadian rhythms to cancer formation and mortality 133 Tana L Birky, Molly S Bray

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Case Report Section

A case of sole i(4)(p10) in myelodysplastic syndrome 146 François Desangles, Aurélie Servonnet, Hubert Nielly, Serge Cremades, Jean-Etienne Pilo

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

ADAMTS12 (ADAM Metallopeptidase With Thrombospondin Type 1 Motif, 12) Santiago Cal, Alvaro J Obaya Departamento de Bioquimica y Biologia Molecular, Instituto Universitario de Oncologia (IUOPA), Universidad de Oviedo, 33006, Asturias, Spain (SC), Biologia Funcional, Instituto Universitario de Oncologia (IUOPA), Universidad de Oviedo, 33006, Asturias, Spain (AJO)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/ADAMTS12ID575ch5p13.html DOI: 10.4267/2042/53078 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

signal peptide, a prodomain involved in maintaining Abstract enzyme latency and a catalytic domain that contains the Review on ADAMTS12, with data on DNA/RNA, on consensus sequence HEXXHGXXHD involved in the the protein encoded and where the gene is implicated. coordination of the zinc atom necessary for catalytic activity of the enzyme. This sequence ends in an Asp Identity residue which distinguishes ADAMTSs from other metalloproteases such as MMPs. Following this Other names: PRO4389 catalytic region there are several other domains HGNC (Hugo): ADAMTS12 characterized as a disintegrin-like domain, a central Location: 5p13.3 thrombospondin-1 (TSP-1) motif, a cysteine-rich domain, a spacer region and a variable number of TSP- DNA/RNA 1 repeats, three in the case of ADAMTS-12. A structural hallmark of ADAMTS-12 is the presence of Description a second spacer region followed by four additional 24 exons, spans approximately 368.66 Kb of genomic TSP-1 repeats (Figure 1) (Cal et al., 2001). DNA in the telomere-to-centromere orientation. The translation initiation codon is located to exon 1, Expression and the stop codon to exon 24. ADAMTS12 cDNA was originally cloned from a human fetal lung cDNA library and its expression was Transcription also detected in human fetal fibroblasts following ADAMTS12 Human mRNA of 8.77 Kb as detected by treatment with TGF-β. By real-time polymerase chain northern-blot. reaction (PCR) assay ADAMTS12 expression can also be detected in cartilage, synovium, tendon, skeletal Protein muscle and fat. ADAMTS12 was also found widely expressed in gastrointestinal, pancreatic and colon Description carcinomas but not in the paired normal tissues, The open reading frame encodes a 1594 amino acid suggesting that this enzyme could also participate in protein, with an estimated molecular weight of 178 the development and/or progression of tumors from kDa. ADAMTS-12 shares a structural multidomain different origin (Cal et al., 2001; Liu et al., 2006; complex architecture with the rest of members of the Moncada-Pazos et al., 2009). ADAMTS family. This organization includes a

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 78 ADAMTS12 (ADAM Metallopeptidase With Thrombospondin Type 1 Motif, 12) Cal S, Obaya AJ

Figure 1. Domain organization of ADAMTS-12. Pro: prodomain; TSP: thrombospondin type-1 domains.

Localisation Implicated in Extracellular. Various cancers Function Note Several studies performed to characterized ADAMTS- Different studies have highlighted the role of 12 function indicate its role as being a host-protective ADAMTS12 as a tumor-suppressor gene. ADAMTS- enzyme with antitumor properties (Llamazares et al., 12 is able to alter the tumorigenic effects of hepatocyte 2007; Moncada-Pazos et al., 2009; El-Hour et al., growth factor (HGF) in Madin-Darby canine kidney 2010; Wang et al., 2011). Additionally, ADAMTS-12 (MDCK) cells (Llamazares et al., 2007). ADAMTS-12 has a role in trophoblasts invasion during placental also prevents the formation of tubules by bovine aortic development which is independent of the proteolytic endothelial cells in the presence of vascular endothelial domain (Beristain et al., 2011). growth factor (VEGF). Additionally, growth of ADAMTS-12 also participates in other pathological subcutaneous tumors induced by the human lung tumor processes such as inflammation, allergen-induced cell line A549 is compromised when ADAMTS12 is inflammation and hyperresponsiveness, and it is also exogenously expressed. Analysis of the epigenetic involved in arthritic processes (Liu, 2009; Moncada- status of ADAMTS12 promoter has reinforced the role Pazos et al., 2012; Nah et al., 2012; Paulissen et al., of ADAMTS-12 as an in vivo tumor-suppressor 2012). enzyme. In fact, ADAMTS12 is epigenetically silenced Furthermore, different genomic approximations have in tumor cells from different sources such as colon described how other human pathologies like asthma, cancer cell lines, breast cancer cell lines, cervix cancer schizophrenia or predisposition to pediatric stroke are cell lines or lymphoma cell lines (Moncada-Pazos et related to ADAMTS12 locus (Kurz et al., 2006; Arnin al., 2009). In particular, methylation levels of et al., 2012; Bespalova et al., 2012). However, besides ADAMTS12 gene promoter were very high in a colon its participation in pathological situations little is cancer sample panel that included both cancer cell lines known about ADAMTS-12 partners and/or substrates and tumor samples, whereas it was found not or barely in normal or pathogenic processes. methylated in normal cells and tissues. However and similar to what has been found in gastrointestinal and Homology pancreatic carcinomas, ADAMTS12 expression was The ADAMTS12 gene is conserved in chimpanzee higher in colon tumor samples cells than in normal (Refseq: XP_517836), macaque (Refseq: tissues. This apparent contradiction resides in the fact XM_001090049), dog (Refseq: XM_536508), cow that ADAMTS-12 is produced by the stromal cells (Refseq: NM_001192609), mouse (Refseq: surrounding neoplastic cells and not by the tumor cells NM_175501), rat (Refseq: NM_001106420), chicken themselves, which was confirmed using different (Refseq: XM_003642975), and zebrafish (Refseq: approaches. For instance, immunofluorescence XM_001343335). techniques allowed the localization of this protease in ADAMTS-12 belongs to the A Disintegrin And the proximity to alpha smooth muscle actin positive Metalloprotease Domains with ThromboSpondin cells, which suggests that cancer-associated fibroblasts motifs (ADAMTS) family, which consists of 19 could be responsible for ADAMTS12 expression. By secreted zinc metalloproteinases (Porter et al., 2005). contrast, ADAMTS-12 staining resulted negative in the All members of the family share the same structural case of tumor cells. ADAMTS12 expression in domain design. fibroblasts was verified through the use of co-cultures ADAMTS-12 is closely related to ADAMTS-7 since of colon fibroblasts with colon cancer cells. both proteins display the C-terminal TSP residues Furthermore, this expression could be associated with a separated by two spacer regions (spacer-1 and spacer- functional effect as colon cancer cells showed minor 2). growth rates and an increase in apoptosis when co- The rest of the members contain only one spacer region cultured with colon fibroblasts in comparison to the followed by a variable number of TSP domains. colon tumor cell line cultured alone. Consequently,

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 79 ADAMTS12 (ADAM Metallopeptidase With Thrombospondin Type 1 Motif, 12) Cal S, Obaya AJ

colon miofibroblast-ADAMTS12 expression could be susceptibility to inflammatory processes (Moncada- part of a protective response aimed to compensate for Pazos et al., 2012). In this sense, it has been shown the epigenetic silencing of this gene in tumor cells how Adamts12 deficiency is responsible for increase (Moncada-Pazos et al., 2009). Moreover, ADAMTS12 inflammation in mice that was not limited to a certain expression in colorectal cancer significantly correlated tissue as it was a common phenomenon affecting with the tumor histological grade, depth of tumor several organs. Different experimental conditions to invasion, lymph node metastasis, and Duke's stage. In induce colitis, endotoxic sepsis, pancreatitis or fact, patients with low or no ADAMTS12 expression in allergen-induced lung inflammation demonstrated that the tumor stroma had a significantly poor overall absence of ADAMTS-12 resulted in a more severe survival or disease-free survival (Wang et al., 2011). inflammation phenotype as well as a delayed recovery Phenotypic analysis of the Adamts12-deficient mouse from these anomalies. These changes were has confirmed the role of this metalloprotease as a accompanied by an increase in inflammatory markers tumor-protective enzyme (El-Hour et al., 2010). and, at the same time, the clinical symptoms observed This mouse develops normally and does not show any in Adamts12-deficient mice were also concomitant obvious phenotype. However, different models to with neutrophilia or eosinophilia and mast cells analyze the angiogenesis process in vivo, including recruitment in affected tissues (Moncada-Pazos et al., malignant keratinocyte transplantation, aortic ring 2012; Paulissen et al., 2012). In vitro culture of human assay and Matrigel plug, supported that this protease neutrophils indicated that the presence of ADAMTS-12 exhibits anti-angiogenic properties (El-Hour et al., might be a player in inducing neutrophil clearance, a 2010). Additionally, both intact ADAMTS-12 and a required step for the resolution of an inflammation catalytically inactive form of ADAMTS-12 showed a process. similar ability to inhibit the spreading of endothelial Arthritis cells. These data were in line with the previous results indicating that antitumor functions of ADAMTS-12 do Note not depend on its metalloprotease domain (Llamazares ADAMTS-12 shows aggrecan-degrading activity, et al., 2007). similarly to aggrecanases ADAMTS-4 and ADAMTS- However, there are some data showing that ADAMTS- 5, and to other members of the family such as 12 could also be a potential pro-tumor agent (Beristain ADAMTS-1, ADAMTS-9, ADAMTS-15, ADAMTS- et al., 2011). Thus, in placental cytotrophoblasts the 16 and ADAMTS-18 (Lin and Liu, 2010). expression of ADAMTS12 is able to exploit the same Nevertheless, the ability of ADAMTS-12 to degrade molecular machinery found in metastatic carcinoma aggrecan is reduced and it has only been reported to cells. Comparing ADAMTS-family members- occur in vitro (Llamazares et al., 2007). Although expression in highly versus poorly invasive cells during barely detectable in adult tissues real-time polymerase placental development, ADAMTS12 was preferentially chain reaction (PCR) assay revealed ADAMTS12 expressed by the highly invasive cytotrophoblast cell expression in cartilage, synovium, tendon, skeletal line EVT. muscle and fat (Liu et al., 2006). In vitro experiments Furthermore, TGF-β or IL-1β, are also able to have also been used to demonstrate ADAMTS-12 respectively induce or restrain ADAMTS12 expression proteolytic activity towards cartilage oligomeric matrix in these cells as they also did in colon fibroblasts. protein (COMP), other component of cartilage. This, Analyzing the domains involved in this process together with ADAMTS-12 aggrecanolytic activity, demonstrated how the metalloprotease domain does not may indicate a role of ADAMTS-12 in arthritic fulfill a relevant role in this pro-invasive phenotype diseases (Liu et al., 2006). In this regard, profiling (Beristain et al., 2011). analysis demonstrated a significant upregulation of In summary, there are several studies suggesting ADAMTS-12 in cartilage from patients with ADAMTS-12 as being involved in tumor progression. osteoarthritis when compared with normal cartilage Nowadays, more data indicate this protein as a new (Kevorkian et al., 2004). Thus, ADAMTS-7 and member of the growing type of metalloproteases ADAMTS-12, apart from the known aggrecanases showing tumor-suppressor properties (Lopez-Otin and ADAMTS-4 and -5, seem to be important players in Matrisian, 2007). However, some data indicate a the degradation of components of cartilaginous tissue different role for this gene specifically regarding during arthritic processes (Liu, 2009). In relation to cellular invasion, which suggest that ADAMTS-12- potential endogenous inhibitors, it has been described function in tumor progression might depend on that α2-macroglobulin and the granulin-epithelin different interactions occurring within the extracellular precursor, a growth factor highly expressed in microenvironment. chondrocytes, can interact with ADAMTS-12, leading to an inhibition of its COMP- Inflammation degrading activity (Luan et al., 2008; Guo et al., 2010). Note Loss-of-function of Adamts-12 enhances mouse

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 80 ADAMTS12 (ADAM Metallopeptidase With Thrombospondin Type 1 Motif, 12) Cal S, Obaya AJ

JM, Ectors F, Noel A, Lopez-Otin C. Higher sensitivity of References Adamts12-deficient mice to tumor growth and angiogenesis. Oncogene. 2010 May 20;29(20):3025-32 Cal S, Arguelles JM, Fernandez PL, López-Otín C. Identification, characterization, and intracellular processing of Guo F, Lai Y, Tian Q, Lin EA, Kong L, Liu C. Granulin-epithelin ADAM-TS12, a novel human disintegrin with a complex precursor binds directly to ADAMTS-7 and ADAMTS-12 and structural organization involving multiple thrombospondin-1 inhibits their degradation of cartilage oligomeric matrix protein. repeats. J Biol Chem. 2001 May 25;276(21):17932-40 Arthritis Rheum. 2010 Jul;62(7):2023-36 Kevorkian L, Young DA, Darrah C, Donell ST, Shepstone L, Lin EA, Liu CJ. The role of ADAMTSs in arthritis. Protein Cell. Porter S, Brockbank SM, Edwards DR, Parker AE, Clark IM. 2010 Jan;1(1):33-47 Expression profiling of metalloproteinases and their inhibitors in cartilage. Arthritis Rheum. 2004 Jan;50(1):131-41 Beristain AG, Zhu H, Leung PC. Regulated expression of ADAMTS-12 in human trophoblastic cells: a role for ADAMTS- Porter S, Clark IM, Kevorkian L, Edwards DR. The ADAMTS 12 in epithelial cell invasion? PLoS One. 2011 Apr metalloproteinases. Biochem J. 2005 Feb 15;386(Pt 1):15-27 11;6(4):e18473 Kurz T, Hoffjan S, Hayes MG, Schneider D, Nicolae R, Wang D, Zhu T, Zhang FB, He C. Expression of ADAMTS12 in Heinzmann A, Jerkic SP, Parry R, Cox NJ, Deichmann KA, colorectal cancer-associated stroma prevents cancer Ober C. Fine mapping and positional candidate studies on development and is a good prognostic indicator of colorectal chromosome 5p13 identify multiple asthma susceptibility loci. J cancer. Dig Dis Sci. 2011 Nov;56(11):3281-7 Allergy Clin Immunol. 2006 Aug;118(2):396-402 Arning A, Hiersche M, Witten A, Kurlemann G, Kurnik K, Liu CJ, Kong W, Xu K, Luan Y, Ilalov K, Sehgal B, Yu S, Manner D, Stoll M, Nowak-Göttl U. A genome-wide association Howell RD, Di Cesare PE. ADAMTS-12 associates with and study identifies a gene network of ADAMTS genes in the degrades cartilage oligomeric matrix protein. J Biol Chem. predisposition to pediatric stroke. Blood. 2012 Dec 2006 Jun 9;281(23):15800-8 20;120(26):5231-6 Llamazares M, Obaya AJ, Moncada-Pazos A, Heljasvaara R, Bespalova IN, Angelo GW, Ritter BP, Hunter J, Reyes- Espada J, López-Otín C, Cal S. The ADAMTS12 Rabanillo ML, Siever LJ, Silverman JM. Genetic variations in metalloproteinase exhibits anti-tumorigenic properties through the ADAMTS12 gene are associated with schizophrenia in modulation of the Ras-dependent ERK signalling pathway. J Puerto Rican patients of Spanish descent. Neuromolecular Cell Sci. 2007 Oct 15;120(Pt 20):3544-52 Med. 2012 Mar;14(1):53-64 López-Otín C, Matrisian LM. Emerging roles of proteases in Moncada-Pazos A, Obaya AJ, Llamazares M, Heljasvaara R, tumour suppression. Nat Rev Cancer. 2007 Oct;7(10):800-8 Suárez MF, Colado E, Noël A, Cal S, López-Otín C. ADAMTS- 12 metalloprotease is necessary for normal inflammatory Luan Y, Kong L, Howell DR, Ilalov K, Fajardo M, Bai XH, Di response. J Biol Chem. 2012 Nov 16;287(47):39554-63 Cesare PE, Goldring MB, Abramson SB, Liu CJ. Inhibition of ADAMTS-7 and ADAMTS-12 degradation of cartilage Nah SS, Lee S, Joo J, Kim HK, Sohn DR, Kwon JT, Woo KM, oligomeric matrix protein by alpha-2-macroglobulin. Hong SJ, Kim HJ. Association of ADAMTS12 polymorphisms Osteoarthritis Cartilage. 2008 Nov;16(11):1413-20 with rheumatoid arthritis. Mol Med Rep. 2012 Jul;6(1):227-31 Liu CJ. The role of ADAMTS-7 and ADAMTS-12 in the Paulissen G, El Hour M, Rocks N, Guéders MM, Bureau F, pathogenesis of arthritis. Nat Clin Pract Rheumatol. 2009 Foidart JM, Lopez-Otin C, Noel A, Cataldo DD. Control of Jan;5(1):38-45 allergen-induced inflammation and hyperresponsiveness by the metalloproteinase ADAMTS-12. J Immunol. 2012 Oct Moncada-Pazos A, Obaya AJ, Fraga MF, Viloria CG, Capellá 15;189(8):4135-43 G, Gausachs M, Esteller M, López-Otín C, Cal S. The ADAMTS12 metalloprotease gene is epigenetically silenced in This article should be referenced as such: tumor cells and transcriptionally activated in the stroma during progression of colon cancer. J Cell Sci. 2009 Aug 15;122(Pt Cal S, Obaya AJ. ADAMTS12 (ADAM Metallopeptidase With 16):2906-13 Thrombospondin Type 1 Motif, 12). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2):78-81. El Hour M, Moncada-Pazos A, Blacher S, Masset A, Cal S, Berndt S, Detilleux J, Host L, Obaya AJ, Maillard C, Foidart

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 81 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

CPM (carboxypeptidase M) Anne-Marie Lambeir Laboratory of Medical Biochemistry, University of Antwerp, Universiteitsplein 1, B-2610 Belgium (AML)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/CPMID51348ch12q15.html DOI: 10.4267/2042/53079 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

element (DPE). A number of potential transcription Abstract factor binding sites were identified in the 5' region Review on CPM, with data on DNA/RNA, on the flanking the proximal initiation sites, including a protein encoded and where the gene is implicated. vitamin D3 responsive element and Sp1. The distal promoter (~ 30 kb upstream of the coding region) Identity differs from the proximal promoter in that it mainly consists of repetitive elements and lacks common HGNC (Hugo): CPM promoter elements. Inr sequences and a putative DPE Location: 12q15 were found together with putative Ets, C/EBP, Oct-1, Note AP-1 and NF-kB sites. Basal transcriptional activity of CPM was mapped to chromosome 12q13-qter by the proximal and distal promoter regions was cell type- chromosome assignment in somatic cell hybrids. dependent pointing towards a tissue-specific expression Fluorescent in situ hybridisation located CPM distal to of CPM. Transcriptional initiation from the distal start D12S375 and proximal to the D12S8 microsatellite site appeared less common (Li et al., 2002). markers. After completion of the reference sequence of Apart from the full length CPM mRNA, three chromosome 12, CPM was located in 12q14.3. alternatively splice variants of CPM were detected. Missing exon 3 and/or 5, these products lead to a DNA/RNA premature stop codon and possibly to the generation of truncated CPM proteins (Pessoa et al., 2002). Several Description bands ranging from about 2.4 kb to 15 kb were The intron/exon structure of the CPM gene was detected in Northern blots of CPM mRNA from determined from screening human kidney and placenta various human tissues, with a major band at 4.2 kb cDNA libraries (Bektas et al., 2001). The CPM gene (Tan et al., 1989; Nagae et al., 1993). Heterogeneity in contains 11 exons and spans 112.5 kb. The coding the CPM mRNA was observed, principally ensuing region is located in exons 2-9. from the 3' region. Together with alternative splicing of three separate exons (1, 1A and 1B), the utilization of Transcription various transcription start sites contributes to Transcription is initiated from multiple transcription heterogeneity at the 5' region. 5' and 3' heterogeneity start sites clustered in two distinct regions that are however did not change the CPM protein sequence (Li flanked by two independent, functional promoters. The et al., 2002). proximal promoter (~ 350 bp upstream of the coding The Ensemble database (viewed June 2013) lists 13 region) is characterized by the presence of CpG transcripts for CPM of which 3 are coding for the full- islands, a classical TATA box (25 bp upstream of the length protein and 4 are coding for shorter forms. Of major initiation site), an initiator sequence (Inr) around the remainder, there is 1 non-coding processed the TATA box, and a putative downstream promoter transcript, 3 are labelled non-sense mediated decay and 2 have a retained intron.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 82 CPM (carboxypeptidase M) Lambeir AM

The 12q14-15 chromosomal region contains some known oncogenes and genes involved in cell cycle control, differentiation, receptor signalling and cytokine biology, as well as some miRNAs. The names of those genes are placed in boxes. The approximate length and positions of the genes on the + (right) and - (left) strands are depicted as grey blocks. Pseudogenes and uncharacterized loci are not shown. The information was retrieved from the Gene data bank (NCBI). The expanded region illustrates how CPM is located just downstream of the tumor biomarker and oncogene MDM2 on the complementary strand.

terminal domain. The spherical carboxypeptidase Protein domain (first 295 amino acids) is arranged in a typical Note α/β hydrolase fold and carries the catalytic site. A CPM is a basic metallo-carboxypeptidase. The NC- funnel-shaped entrance gives access to the active site. IUBMB code assigned to CPM is EC 3.4.17.12. In the The C-terminal domain (86 residues) consists of a MEROPS database CPM belongs to clan MC, family seven-stranded β-barrel and resembles the plasma M14, subfamily B. protein transthyretin/prealbumin (Reverter et al., 2004). CPM is attached to the outer membrane by a glycosyl- Description phosphatidyl-inositol (GPI) anchor located at the C- The CPM structure consists of two domains, the terminus (Deddish et al., 1990). classical carboxypeptidase domain and the C-

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 83 CPM (carboxypeptidase M) Lambeir AM

The coding region of CPM is depicted by alternating blue en black letters to highlight the exon junctions (exon 2 to 9). The translated amino acid sequence is shown above the nucleotide sequence. The secretion signal peptide is shown in italics, the Zn 2+ ligands in bold. Amino acids located in α-helices are highlighted in red and the β-sheets in yellow.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 84 CPM (carboxypeptidase M) Lambeir AM

Bowman's basement membrane and in glomerular mesangial cells (Denis et al., 2013). In the central and peripheral nervous systems CPM expression is associated with myelin and myelin- forming cells (Nagae et al., 1992; Kang et al., 2011). A soluble form of CPM, lacking the membrane anchor, was found in urine, amnion and seminal fluid and in broncho-alveolar lavage fluid. CPM was at least twice discovered as the target of antibodies raised against cell surface antigens: once on mature macrophages and once on the human B-lineage acute lymphoblastic leukemia cell line Pre ALP. Expression of CPM was reported in late stages of myeloid cell development and in particular stages of B lymphocyte development, i.e. committed precursors and germinal center cells. The expression of CPM in different stages of hematopoietic stem cell differentiation was comprehensively reviewed (Deiteren et al., 2009; Denis et al., 2012). The reader is referred to the publications listed in these reviews; some highlights are repeated below. CPM expression was evident in hematopoietic progenitors (CFU-GM, CFU-Meg and BFU-E). The surface expression of CPM was upregulated during ex vivo expansion of cord blood CD34 + stem cells to CFU-GM and CFU-Meg (Marquez-Curtis et al., 2008). The 3D-structure of CPM was determined by X-ray CPM expression is weak on freshly isolated blood crystallography (Reverter et al., 2004). It is shown in this figure monocytes. In contrast to macrophages maturated in as a ribbon drawing with α-helices and β-strands respectively shown in orange and blue, and the residual chain in grey. The vitro, macrophages of body fluids (pleural, peritoneal catalytic carboxypeptidase domain is shown on top and the and alveolar) and tissue macrophages in situ express cup-shaped C-terminal domain on bottom of the structure. The only low levels of CPM. In defined pathological disordered linker connecting the C-terminal domain and the conditions, some exudate macrophages did express GPI-anchoring segment is not visible in the structure. The catalytic zinc ion is depicted as a pink sphere, whereas the considerable levels of CPM, e.g. alveolar macrophages. three zinc ligands are shown in dark blue. The cysteine Inflammatory macrophages in situ were CPM negative residues involved in disulfide bridges are depicted in red. PDB- except those associated with rejected renal allografts code: 1UWY. Drawn with MOE 2009.10. (Andreesen et al., 1988). CPM is expressed selectively Expression in tissue granulomas and foam cells (Tsakiris et al., CPM is widely expressed in the different organs, but 2012) and on tumor associated macrophages (Denis et expression levels vary and it is only expressed by al., 2013; Tsakiris et al., 2008). Peripheral granulocytes certain cell types. Expression was studied in some all possessed CPM surface expression. The expression detail in the lung, in the female reproductive system, of CPM on several immortalized cell lines was and in the kidney. reviewed (Denis and Lambeir, 2013). THP-1 cells, that In the lung CPM is a marker of type I pulmonary are close to the mature macrophage, express high levels alveolar epithelial cells (Nagae et al., 1993). of CPM. CPM expression is locally regulated during the CPM expression was observed early in mesenchymal different phases of the menstrual cycle, endometrial differentiation, i.e. in mesenchymal stem cells (MSC) maturation and implantation. Overall, CPM is likely and CFU-F progenitor cells (Marques-Curtis et al., involved in the control of proliferation and functional 2008). CPM was upregulated in early and late stages of differentiation of many cellular system within the bone marrow or adipose tissue derived MSC female reproductive system (Yoshioka et al., 1998; differentiation into the osteogenic, chondrogenic and Fujiwara et al., 1999; Fujiwara et al., 2005; Nishioka et adipogenic lineages (Lui at al., 2007). CPM expression al., 2003). was greatly increased in early and late stadia of MSC In the kidney, CPM expression is high at the apical differentiation into the adipocyte and osteogenic surface of proximal and distal tubuli and the thick lineage compared to the chondrogenic lineage. ascending limbs of the loop of Henle. Soluble CPM Differential transcript analysis identified CPM as a was detected in the tubular lumina. CPM was also surface marker of heterogeneous peripheral blood- expressed at the parietal epithelium beneath the derived smooth muscle progenitor cells (Wang et al., 2012).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 85 CPM (carboxypeptidase M) Lambeir AM

Localisation shown to discriminate well-differentiated liposarcoma from lipomas (Erickson-Johnson et al., 2009). These The GPI anchor directs CPM to lipid rafts in the outer well-differentiated liposarcomas typically show membrane of cells, such as macrophages. In the kidney telomeric associations, supernumerary ring CPM is found in the lumen and on the luminal side of chromosomes, and giant rod marker chromosomes. epithelial cells in proximal and distal tubules. The abnormal chromosomes consist of amplified Intracellular CPM immunoreactivity was also observed genomic sequences derived from chromosome bands (Denis et al., 2013). 12q13-15 and comprise several genes, including the Function MDM2 gene. The function of CPM in the different cells and organs MDM2/CPM amplification was proposed as a tool for is not well understood. The expression pattern of CPM classification of lipomatous tumors and evaluation of in specific cells in the different systems suggests roles the impact of surgical procedures on the risk of local in development and/or differentiation. recurrence (Zhang et al., 2010). On the one hand CPM may be important for the Clear cell lung carcinoma recycling of amino acids or the local release of arginine. Note On the other hand, CPM may function by modulating In lung adenocarcinoma, CPM and epidermal growth signaling cascades of its substrates (Deiteren et al., factor receptor (EGFR) protein expression appeared to 2009). The classical substrates for CPM are be heterogeneous. CPM and EGFR were mainly anaphylatoxins and kinins, produced during restricted to tumor cell membranes. CPM expression inflammation. However, many other potential was not limited to a specific histotype, and did not substrates have been identified, including hormones, correlate with tumor grade nor stage. chemokines and growth factors. A functional CPM negatively correlated with disease survival association of CPM with the bradykinin-1 receptor (a (Tsakiris et al., 2008). 80% of the CPM-positive G-protein coupled receptor) has been demonstrated adenocarcinoma were EGFR-positive. The coexistence (Zhang et al., 2008; Zhang et al., 2011). CPM enhances of CPM and EGFR strongly predicted a poor outcome. bradykinin-1 receptor signaling on two levels: (1) by An unfavourable role for CPM-EGFR co-expression converting bradykinin to a better agonist (des-arg- was suggested in early tumor stages. Two cases of bradykinin), and (2) by altering the conformation of the CPM --EGFR + primary lung adenocarcinoma became receptor on the membrane. Therefore, one can CPM +-EGFR + when metastasized to the brain, speculate that the functions of CPM are linked to the suggesting CPM is an inducible protein. functions of bradykinin, e.g. release of inflammatory cytokines, vasodilation and pain. Renal cell carcinoma Homology Note Tumor cells of renal cell carcinoma subtypes lose CPM CPM has significant homology with the M14B expression upon dedifferentiation. In a study of 7 clear subfamily members CPN, CPH/E, CPZ, CPD, CPX-1, cell renal carcinoma specimens and 1 chromophobe CPX-2 and adipocyte enhancer-binding protein 1 renal cell carcinoma CPM was colocalized with CD31 (AEBP1). (endothelium), vimentin (tumor marker) and CD68 (macrophages) (Denis et al., 2013). Denis et al., 2013 Mutations also studied coexpression of CPM and EGFR by immunohistochemistry using a tissue microarray Note containing 104 cases of various renal tumors and In the NCBI databases a number of variants can be diseased renal tissue. found in the CPM genomic sequence that were An association between the CPM histology-score (H- reported in association studies related to blood pressure score) and tumor grade was observed for clear cell regulation and heart function (Vasan et al., 2007) and carcinoma. Cluster analysis of the CPM and EGFR H- asthma and smoking (Litonjua et al., 2008; Pan et al., scores in this study showed coexisting high scores for 2010). However the clinical relevance of these findings CPM and EGFR only for papillary renal carcinoma. is unknown. In papillary renal carcinoma expression of CPM is upregulated along with tumoral dedifferentiation. Implicated in Molecular genetic analysis of papillary renal cell Liposarcoma tumors revealed loss of the chromosome Y markers together with trisomy of chromosomes 3q, 7, 8, 12, 16, Note 17 and 20. Trisomy of 12, 16 and 20 possibly are CPM gene amplification was detected in well- related to tumor progression. Allelic duplications were differentiated liposarcomas but not in atypical detected at the 12q12-14 chromosomal regions (to lipomatous tumors. Using FISH and chromogenic in which the CPM gene maps), among others. situ hybridization, amplification of the CPM gene was

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 86 CPM (carboxypeptidase M) Lambeir AM

Adenocarcinoma Primary breast cancer cells with Note complete response to therapy with Transcript analysis indicated that adenocarcinoma cells gemcitabine, epirubicin and docetaxel are positive for CPM (Ramaswamy et al., 2003). Note Endometrium and myometrium tumor Transcript analysis showed that these cells were tissue positive for CPM (Thuerigen et al., 2006). Note Breakpoints Transcript analysis indicated an upregulation of CPM compared to healthy tissue (Pessoa et al., 2002). Note Invasive ductal breast carcinoma The chromosome 12q13-15 bands were associated with a variety of benign and malignant solid tumor types by Note cytogenetic studies. Among the benign tumors, uterine Transcript analysis indicated an upregulation of CPM leiomyoma, pleomorphic adenoma of the salivary compared to healthy tissue (Overall et al., 2004). gland, and lipoma all cluster to the 12q13-15 Clear cell ovarian cancer chromosomal region, which is also involved in hemangiopericytoma, endometrial polyps, Note chondromatous tumors, pulmonary chondroid Transcript analysis indicated an upregulation of CPM hamartoma, and in a number of cases of benign compared to healthy tissue (Schwartz et al., 2002). epithelial breast tumors, diffuse astrocytomas, and a Primary cutaneous squamous cell giant-cell bone tumor. Recurrent aberrations in 12q13- carcinoma 15 also have been detected in malignancies such as myxoid liposarcoma, soft tissue clear-cell sarcoma, Note chronic idiopathic myelofibrosis, and primary diffuse Transcript analysis indicated an upregulation of CPM large B cell lymphomas. Using directional (Haider et al., 2006). chromosome walking and uterine leiomyoma-derived Soft tissue carcinomas (synovial cell lines, a breakpoint hot spot region was found at sarcoma, gastrointestinal stromal 12q13-15 (named Uterine Leiomyoma Cluster Region tumors, dedifferentiated-pleomorphic on chromosome 12, ULCR12) (Schoenmakers et al., 1994). Another breakpoint cluster region of 1.7 Mb liposarcomas) was detected on chromosome 12q15 comprising the Note breakpoints of uterine leiomyoma, lipoma, and salivary Transcript analysis indicated an upregulation of CPM gland adenoma cells (Van de Ven et al., 1995). This (Francis et al., 2007). multiple-aberration region contains essentially all Lung cancer breakpoints of chromosome 12 (Wanshura et al., 1995). CPM was localized in the 12q15 region at one Note of the chromosomal breakpoints in radiation- CPM activity was increased in bronchoalveolar lavage transformed epithelial breast cell lines. Complex fluid of lung cancer patients (Dragovic et al., 1995). translocations were detected at this breakpoint. Since Rapidly growing hepatoma these gene rearrangements could alter CPM gene expression, CPM likely represents a breast cancer- Note involved candidate gene (Unger et al., 2010). EST CPM activity was increased (Deddish et al., 1990). analysis identified CPM as a putative fusion gene Pancreatic ductal adenocarcinoma resulting from chromosome rearrangement. The Note ChimerDB database contains one instance where CPM Transcript analysis indicated an upregulation of CPM acts as the 5' partner in a fusion gene (C7ORF64 (Johnson et al., 2006). 7q21.2) and two instances where it is the 3' fusion partner (CYP19A1 15q21.1 and KIAA1737 14q24.3). Small cell lung cancer The clinical consequences of these fusions are not Note known. Transcript analysis indicated a downregulation of CPM (Cohen et al., 1997). References Leukemic mantle cell lymphoma Andreesen R, Gadd S, Costabel U, Leser HG, Speth V, Cesnik B, Atkins RC. Human macrophage maturation and Note heterogeneity: restricted expression of late differentiation Transcript analysis indicated a downregulation of CPM antigens in situ. Cell Tissue Res. 1988 Aug;253(2):271-9 (Rizzatti et al., 2005).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 87 CPM (carboxypeptidase M) Lambeir AM

Tan F, Chan SJ, Steiner DF, Schilling JW, Skidgel RA. Pessoa LG, da Silva ID, Baptista HA, Pesquero JL, Paiva AC, Molecular cloning and sequencing of the cDNA for human Bader M, Pesquero JB. Molecular structure and alternative membrane-bound carboxypeptidase M. Comparison with splicing of the human carboxypeptidase M gene. Biol Chem. carboxypeptidases A, B, H, and N. J Biol Chem. 1989 Aug 2002 Feb;383(2):263-9 5;264(22):13165-70 Schwartz DR, Kardia SL, Shedden KA, Kuick R, Michailidis G, Deddish PA, Dragovic T, Erdös EG, Weber G. High Taylor JM, Misek DE, Wu R, Zhai Y, Darrah DM, Reed H, concentration of neutral endopeptidase (enkephalinase E.C. Ellenson LH, Giordano TJ, Fearon ER, Hanash SM, Cho KR. 3.4.24.11) in a malignant tumor: rat hepatoma 3924A. Biochem Gene expression in ovarian cancer reflects both morphology Biophys Res Commun. 1990 May 31;169(1):81-6 and biological behavior, distinguishing clear cell from other poor-prognosis ovarian carcinomas. Cancer Res. 2002 Aug Deddish PA, Skidgel RA, Kriho VB, Li XY, Becker RP, Erdös 15;62(16):4722-9 EG. Carboxypeptidase M in Madin-Darby canine kidney cells. Evidence that carboxypeptidase M has a phosphatidylinositol Nishioka Y, Higuchi T, Sato Y, Yoshioka S, Tatsumi K, glycan anchor. J Biol Chem. 1990 Sep 5;265(25):15083-9 Fujiwara H, Fujii S. Human migrating extravillous trophoblasts express a cell surface peptidase, carboxypeptidase-M. Mol Nagae A, Deddish PA, Becker RP, Anderson CH, Abe M, Tan Hum Reprod. 2003 Dec;9(12):799-806 F, Skidgel RA, Erdös EG. Carboxypeptidase M in brain and peripheral nerves. J Neurochem. 1992 Dec;59(6):2201-12 Ramaswamy S, Ross KN, Lander ES, Golub TR. A molecular signature of metastasis in primary solid tumors. Nat Genet. Nagae A, Abe M, Becker RP, Deddish PA, Skidgel RA, Erdös 2003 Jan;33(1):49-54 EG. High concentration of carboxypeptidase M in lungs: presence of the enzyme in alveolar type I cells. Am J Respir Overall CM, Tam EM, Kappelhoff R, Connor A, Ewart T, Cell Mol Biol. 1993 Aug;9(2):221-9 Morrison CJ, Puente X, López-Otín C, Seth A. Protease degradomics: mass spectrometry discovery of protease Schoenmakers EF, Mols R, Wanschura S, Kools PF, Geurts substrates and the CLIP-CHIP, a dedicated DNA microarray of JM, Bartnitzke S, Bullerdiek J, van den Berghe H, Van de Ven all human proteases and inhibitors. Biol Chem. 2004 WJ. Identification, molecular cloning, and characterization of Jun;385(6):493-504 the chromosome 12 breakpoint cluster region of uterine leiomyomas. Genes Chromosomes Cancer. 1994 Reverter D, Maskos K, Tan F, Skidgel RA, Bode W. Crystal Oct;11(2):106-18 structure of human carboxypeptidase M, a membrane-bound enzyme that regulates peptide hormone activity. J Mol Biol. Dragovi ć T, Schraufnagel DE, Becker RP, Sekosan M, Votta- 2004 Apr 23;338(2):257-69 Velis EG, Erdös EG. Carboxypeptidase M activity is increased in bronchoalveolar lavage in human lung disease. Am J Respir Fujiwara H, Higuchi T, Sato Y, Nishioka Y, Zeng BX, Yoshioka Crit Care Med. 1995 Aug;152(2):760-4 S, Tatsumi K, Ueda M, Maeda M. Regulation of human extravillous trophoblast function by membrane-bound Van de Ven WJ, Schoenmakers EF, Wanschura S, peptidases. Biochim Biophys Acta. 2005 Aug 1;1751(1):26-32 Kazmierczak B, Kools PF, Geurts JM, Bartnitzke S, Van den Berghe H, Bullerdiek J. Molecular characterization of MAR, a Rizzatti EG, Falcão RP, Panepucci RA, Proto-Siqueira R, multiple aberration region on human chromosome segment Anselmo-Lima WT, Okamoto OK, Zago MA. Gene expression 12q13-q15 implicated in various solid tumors. Genes profiling of mantle cell lymphoma cells reveals aberrant Chromosomes Cancer. 1995 Apr;12(4):296-303 expression of genes from the PI3K-AKT, WNT and TGFbeta signalling pathways. Br J Haematol. 2005 Aug;130(4):516-26 Wanschura S, Kazmierczak B, Schoenmakers E, Meyen E, Bartnitzke S, Van de Ven W, Bullerdiek J, Schloot W. Regional Haider AS, Peters SB, Kaporis H, Cardinale I, Fei J, Ott J, fine mapping of the multiple-aberration region involved in Blumenberg M, Bowcock AM, Krueger JG, Carucci JA. uterine leiomyoma, lipoma, and pleomorphic adenoma of the Genomic analysis defines a cancer-specific gene expression salivary gland to 12q15. Genes Chromosomes Cancer. 1995 signature for human squamous cell carcinoma and Sep;14(1):68-70 distinguishes malignant hyperproliferation from benign hyperplasia. J Invest Dermatol. 2006 Apr;126(4):869-81 Cohen AJ, Skidgel RA, Gilman LB, Black JK, Bunn PA Jr, Helfrich B, Franklin WA, Miller YE. Carboxypeptidase M. Johnson SK, Dennis RA, Barone GW, Lamps LW, Haun RS. Variable expression in normal human lung and inactivation in Differential expression of insulin-like growth factor binding lung cancer. Chest. 1997 Jun;111(6 Suppl):149S protein-5 in pancreatic adenocarcinomas: identification using DNA microarray. Mol Carcinog. 2006 Nov;45(11):814-27 Yoshioka S, Fujiwara H, Yamada S, Nakayama T, Higuchi T, Inoue T, Mori T, Maeda M. Membrane-bound Thuerigen O, Schneeweiss A, Toedt G, Warnat P, Hahn M, carboxypeptidase-M is expressed on human ovarian follicles Kramer H, Brors B, Rudlowski C, Benner A, Schuetz F, Tews and corpora lutea of menstrual cycle and early pregnancy. Mol B, Eils R, Sinn HP, Sohn C, Lichter P. Gene expression Hum Reprod. 1998 Jul;4(7):709-17 signature predicting pathologic complete response with gemcitabine, epirubicin, and docetaxel in primary breast Fujiwara H, Imai K, Inoue T, Maeda M, Fujii S. Membrane- cancer. J Clin Oncol. 2006 Apr 20;24(12):1839-45 bound cell surface peptidases in reproductive organs. Endocr J. 1999 Feb;46(1):11-25 Francis P, Namløs HM, Müller C, Edén P, Fernebro J, Berner JM, Bjerkehagen B, Akerman M, Bendahl PO, Isinger A, Bektas A, Hughes JN, Warram JH, Krolewski AS, Doria A. Rydholm A, Myklebost O, Nilbert M. Diagnostic and prognostic Type 2 diabetes locus on 12q15. Further mapping and gene expression signatures in 177 soft tissue sarcomas: mutation screening of two candidate genes. Diabetes. 2001 hypoxia-induced transcription profile signifies metastatic Jan;50(1):204-8 potential. BMC Genomics. 2007 Mar 14;8:73 Li J, Rehli M, Timblin B, Tan F, Krause SW, Skidgel RA. Liu TM, Martina M, Hutmacher DW, Hui JH, Lee EH, Lim B. Structure of the human carboxypeptidase M gene. Identification of common pathways mediating differentiation of Identification of a proximal GC-rich promoter and a unique bone marrow- and adipose tissue-derived human distal promoter that consists of repetitive elements. Gene. mesenchymal stem cells into three mesenchymal lineages. 2002 Feb 6;284(1-2):189-202 Stem Cells. 2007 Mar;25(3):750-60

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 88 CPM (carboxypeptidase M) Lambeir AM

Vasan RS, Larson MG, Aragam J, Wang TJ, Mitchell GF, identified by high-resolution breakpoint analysis of Kathiresan S, Newton-Cheh C, Vita JA, Keyes MJ, O'Donnell chromosomal aberrations. Endocr Relat Cancer. 2010 CJ, Levy D, Benjamin EJ. Genome-wide association of Mar;17(1):87-98 echocardiographic dimensions, brachial artery endothelial function and treadmill exercise responses in the Framingham Zhang H, Erickson-Johnson M, Wang X, Oliveira JL, Heart Study. BMC Med Genet. 2007 Sep 19;8 Suppl 1:S2 Nascimento AG, Sim FH, Wenger DE, Zamolyi RQ, Pannain VL, Oliveira AM. Molecular testing for lipomatous tumors: Litonjua AA, Lasky-Su J, Schneiter K, Tantisira KG, Lazarus R, critical analysis and test recommendations based on the Klanderman B, Lima JJ, Irvin CG, Peters SP, Hanrahan JP, analysis of 405 extremity-based tumors. Am J Surg Pathol. Liggett SB, Hawkins GA, Meyers DA, Bleecker ER, Lange C, 2010 Sep;34(9):1304-11 Weiss ST. ARG1 is a novel bronchodilator response gene: screening and replication in four asthma cohorts. Am J Respir Kang HJ, Kawasawa YI, Cheng F, Zhu Y, Xu X, Li M, Sousa Crit Care Med. 2008 Oct 1;178(7):688-94 AM, Pletikos M, Meyer KA, Sedmak G, Guennel T, Shin Y, Johnson MB, Krsnik Z, Mayer S, Fertuzinhos S, Umlauf S, Marquez-Curtis L, Jalili A, Deiteren K, Shirvaikar N, Lambeir Lisgo SN, Vortmeyer A, Weinberger DR, Mane S, Hyde TM, AM, Janowska-Wieczorek A. Carboxypeptidase M expressed Huttner A, Reimers M, Kleinman JE, Sestan N. Spatio- by human bone marrow cells cleaves the C-terminal lysine of temporal transcriptome of the human brain. Nature. 2011 Oct stromal cell-derived factor-1alpha: another player in 26;478(7370):483-9 hematopoietic stem/progenitor cell mobilization? Stem Cells. 2008 May;26(5):1211-20 Zhang X, Tan F, Brovkovych V, Zhang Y, Skidgel RA. Cross- talk between carboxypeptidase M and the kinin B1 receptor Tsakiris I, Soos G, Nemes Z, Kiss SS, Andras C, Szantó J, mediates a new mode of G protein-coupled receptor signaling. Dezso B. The presence of carboxypeptidase-M in tumour cells J Biol Chem. 2011 May 27;286(21):18547-61 signifies epidermal growth factor receptor expression in lung adenocarcinomas: the coexistence predicts a poor prognosis Tsakiris I, Torocsik D, Gyongyosi A, Dozsa A, Szatmari I, regardless of EGFR levels. J Cancer Res Clin Oncol. 2008 Szanto A, Soos G, Nemes Z, Igali L, Marton I, Takats Z, Nagy Apr;134(4):439-51 L, Dezso B. Carboxypeptidase-M is regulated by lipids and CSFs in macrophages and dendritic cells and expressed Zhang X, Tan F, Zhang Y, Skidgel RA. Carboxypeptidase M selectively in tissue granulomas and foam cells. Lab Invest. and kinin B1 receptors interact to facilitate efficient b1 signaling 2012 Mar;92(3):345-61 from B2 agonists. J Biol Chem. 2008 Mar 21;283(12):7994- 8004 Wang CH, Lee YS, Lin SJ, Mei HF, Lin SY, Liu MH, Chen JR, Cherng WJ. Surface markers of heterogeneous peripheral Deiteren K, Hendriks D, Scharpé S, Lambeir AM. blood-derived smooth muscle progenitor cells. Arterioscler Carboxypeptidase M: Multiple alliances and unknown partners. Thromb Vasc Biol. 2012 Aug;32(8):1875-83 Clin Chim Acta. 2009 Jan;399(1-2):24-39 Denis CJ, Deiteren K, Hendriks D, Proost P, Lambeir AM. Erickson-Johnson MR, Seys AR, Roth CW, King AA, Hulshizer Carboxypeptidase M in apoptosis, adipogenesis and cancer. RL, Wang X, Asmann YW, Lloyd RV, Jacob EK, Oliveira AM. Clin Chim Acta. 2013 Jan 16;415:306-16 Carboxypeptidase M: a biomarker for the discrimination of well-differentiated liposarcoma from lipoma. Mod Pathol. 2009 Denis CJ, Lambeir AM. The potential of carboxypeptidase M Dec;22(12):1541-7 as a therapeutic target in cancer. Expert Opin Ther Targets. 2013 Mar;17(3):265-79 Pan F, Yang TL, Chen XD, Chen Y, Gao G, Liu YZ, Pei YF, Sha BY, Jiang Y, Xu C, Recker RR, Deng HW. Impact Denis CJ, Van Acker N, De Schepper S, De Bie M, Andries L, Fransen E, Hendriks D, Kockx MM, Lambeir AM. Mapping of of female cigarette smoking on circulating B cells in vivo: the carboxypeptidase m in normal human kidney and renal cell suppressed ICOSLG, TCF3, and VCAM1 gene functional carcinoma: expression in tumor-associated neovasculature network may inhibit normal cell function. Immunogenetics. and macrophages. J Histochem Cytochem. 2013 2010 Apr;62(4):237-51 Mar;61(3):218-35

Unger K, Wienberg J, Riches A, Hieber L, Walch A, Brown A, This article should be referenced as such: O'Brien PC, Briscoe C, Gray L, Rodriguez E, Jackl G, Knijnenburg J, Tallini G, Ferguson-Smith M, Zitzelsberger H. Lambeir AM. CPM (carboxypeptidase M). Atlas Genet Novel gene rearrangements in transformed breast cells Cytogenet Oncol Haematol. 2014; 18(2):82-89.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 89 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

GALNT6 (UDP -N-acetyl -alpha -D-galactosamine: polypeptide N -acetylgalactosaminyltransferase 6 (GalNAc -T6)) Jae-Hyun Park, Yusuke Nakamura Section of Hematology/Oncology, Department of Medicine, The University of Chicago, Chicago, USA (JHP, YN)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/GALNT6ID50683ch12q13.html DOI: 10.4267/2042/53080 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

chromosome at q13.13 location. The GALNT6 gene is Abstract composed of 12 exons and ORF (open reading frame) Review on GALNT6, with data on DNA/RNA, on the is 1869 bp. protein encoded and where the gene is implicated. Protein Identity Note Other names: GALNAC-T6, GalNAcT6 Human GALNT6 gene encodes 622 amino acids of HGNC (Hugo): GALNT6 71159 Da. The protein is involved in the first step of O-type Location: 12q13.13 glycosylation by transferring UDP-GalNAc to Ser/Thr site of substrate protein. GALNT6 was firstly identified DNA/RNA as a glycosyltransferase with high sequence similarity Note to GALNT3 (Bennett et al., 1999). GALNT6 is highly expressed in many types of cancer, GALNT6 has similar kinetic properties with other but expression of GALNT6 is hardly detectable in GALNTs but preferentially glycosylated fibronectin human normal tissues (Park et al., 2010). peptide in vitro. Because of expression in WI38 fibroblast cells, GALNT6 was regarded as a candidate Description for synthesis of the oncofetal fibronectin (Bennett et Human GALNT6 gene is located on 12 al., 1999). GALNT6 has two possible N-type glycosylation sites at N476 and N611.

Functional domain of GALNT6. The protein contains signal peptide (1-34 aa), Gal/GalNAc transferase motif (180-370 aa), and ricin/lectin-like domain (496-622 aa).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 90 GALNT6 (UDP-N-acetyl-alpha-D-galactosamine:polypeptide Park JH, Nakamura Y N-acetylgalactosaminyltransferase 6 (GalNAc-T6))

Description transition) in normal mammary epithelial cell (Park et al., 2011). The mucin-type O-glycosylation is initiated by The GALNT6-mediated O-glycosylation of fibronectin GALNT family members that transfer N-acetyl-alpha- was also reported in the TGF-β-induced EMT process D-galactosamine (GalNAc) to serine or threonine in human prostate cells (Freire-de-Lima et al., 2011). residues on the target protein (Ten Hagen et al., 2003). This modification occurs in the Golgi complex and is Homology presumably controlled by the expressions and GALNT6 has 30~63% of amino acid homology with distributions of GALNT proteins (Brooks et al., 2007). other family members, with the highest homology to Interestingly, structural alterations of these glycan GALNT3 (63%). In crystal structure analysis of murine chains are often detected in cancer cells, especially in GALNT isoforms, GALNT1 was reported to be more breast cancer. For instances, the O-glycans were often similar to GALNT6 according to the electrostatic truncated (core 1-based type) in breast carcinoma cells, surface potential models (Fritz et al., 2004). whereas they were extended its chain (core 2-based type) in normal breast cells (Burchell et al., 2001). O- Implicated in type glycosylation is one of common modifications that have multiple functions related to the folding, stability, Breast cancer and targeting of various glycoproteins (Carraway et al., Note 2007). Accumulating evidences have suggested that the High expression of GALNT6 was frequently observed GALNT family members are involved in several in human breast cancers (Berois et al., 2006; Freire et cellular functions by catalyzing substrates specific to al., 2006; Patani et al., 2008; Park et al., 2010). In each member. For instances, glycosylation by particular, strong expression of GALNT6 was reported GALNT3 prevents proteolytic processing of FGF23 in most of DCIS (ductal carcinoma in situ) indicating (fibroblast growth factor 23) and that by GALNT14 that GALNT6 should play important roles in early promotes ligand-stimulated clustering of death human breast carcinogenesis (Berois et al., 2006). receptors (Wagner et al., 2007; Ichikawa et al., 2009). On the other hand, a study of metastatic breast cancer Expression showed that GALNT6 expression was frequently GALNT6 is highly expressed in many types of cancer detected in bone marrow biopsy samples and therefore including breast, gastric, kidney, oral, and pancreatic suggested that GALNT6 would be a good target for cancer (Berois et al., 2006; Gomes et al., 2009; Kitada detection of disseminated breast cancer cells (Freire et et al., 2013; Wandall et al., 2007; Li et al., 2011). al., 2006). However, in human normal tissues, GALNT6 is merely Prognosis expressed in normal tissues and vital organs including Disease free survival was elongated in breast cancer lung, heart, liver, and kidney (Park et al., 2010). A patients who showed negative expression of GALNT6 specific expression of GALNT6 was also reported in from bone marrow biopsy (Freire et al., 2006). the nonkeratinized epithelium of ocular cicatricial Gastric cancer pemphigoid (OCP) patients (Argüeso et al., 2003). Note Localisation High expression of GALNT6 was reported in human Similarly to other isoforms in the GALNT family, gastric cancers. A heterogeneous expression and GALNT6 is localized in the Golgi complex as shown staining pattern of GALNT6 was observed in 79% of by double immunofluorescence staining with anti- gastric carcinomas, and its expression level was GALNT6 mAb and anti-Golgi-58k mAb (Park et al., associated with the presence of venous invasion 2010). (Gomes et al., 2009). Function Oral cancer GALNT6 is involved in the first step of O-type Note glycosylation, and thereby may influence on folding, GALNT6 was expressed in the oral squamous stability, and subcellular localization of target proteins. carcinoma cells, but not expressed in normal stromal GALNT6 was reported to stabilize MUC1 protein fibroblasts (Wandall et al., 2007). throughout O-glycosylation and subsequently the accumulated MUC1 protein promoted breast cancer Pancreatic cancer cell proliferation and induced anti-adhesive effects Note (Park et al., 2010). By O-glycosylation of fibronectin GALNT6 was highly expressed in pancreatic cancer, protein, GALNT6 showed transformational potentials but not expressed in normal ductal epithelium. A close through disruptive acinar morphogenesis and cellular relationship was noted between GALNT6-positive changes similar to EMT (epithelial-to-mesenchymal expression and pathological well/moderate

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 91 GALNT6 (UDP-N-acetyl-alpha-D-galactosamine:polypeptide Park JH, Nakamura Y N-acetylgalactosaminyltransferase 6 (GalNAc-T6))

differentiated type, small tumor size, and absence of potential new marker for detection of bone marrow- vascular invasion (Li et al., 2011). disseminated breast cancer cells. Int J Cancer. 2006 Sep 15;119(6):1383-8 Prognosis In contrast to other reports, the outcome of the patients Brooks SA, Carter TM, Bennett EP, Clausen H, Mandel U. Immunolocalisation of members of the polypeptide N- who had GALNT6-positive expression was acetylgalactosaminyl transferase (ppGalNAc-T) family is significantly better than that with GALNT6-negative consistent with biologically relevant altered cell surface expression, especially in the early period after surgery glycosylation in breast cancer. Acta Histochem. (Li et al., 2011). 2007;109(4):273-84 Carraway KL 3rd, Funes M, Workman HC, Sweeney C. Renal cell carcinoma Contribution of membrane mucins to tumor progression Note through modulation of cellular growth signaling pathways. Curr GALNT6 was weakly expressed in 64 out of 254 renal Top Dev Biol. 2007;78:1-22 cell carcinomas (Kitada et al., 2013). Wagner KW, Punnoose EA, Januario T et al.. Death-receptor O-glycosylation controls tumor-cell sensitivity to the Prognosis proapoptotic ligand Apo2L/TRAIL. Nat Med. 2007 GALNT6-positive patients showed poor prognosis with Sep;13(9):1070-7 lower disease-specific survival rate (Kitada et al., Wandall HH, Dabelsteen S, Sørensen JA, Krogdahl A, Mandel 2013). U, Dabelsteen E. Molecular basis for the presence of glycosylated onco-foetal fibronectin in oral carcinomas: the Ocular cicatricial pemphigoid (OCP) production of glycosylated onco-foetal fibronectin by carcinoma Note cells. Oral Oncol. 2007 Mar;43(3):301-9 OCP is one of the subsets of mucous membrane Patani N, Jiang W, Mokbel K. Prognostic utility of pemphigoid, which may be caused by aberrant glycosyltransferase expression in breast cancer. Cancer synthesis of mucin O-glycans and thus by alteration of Genomics Proteomics. 2008 Nov-Dec;5(6):333-40 the physicochemical properties of mucins. GALNT6 Gomes J, Marcos NT, Berois N, Osinaga E et al.. Expression was expressed in the apical stratified epithelia, but of UDP-N-acetyl-D-galactosamine: polypeptide N- acetylgalactosaminyltransferase-6 in gastric mucosa, intestinal specific expression of GALNT6 was detected in metaplasia, and gastric carcinoma. J Histochem Cytochem. nonkeratinized epithelium of OCP patients, without 2009 Jan;57(1):79-86 expression in keratinized epithelium nor normal Ichikawa S, Sorenson AH, Austin AM, Mackenzie DS, Fritz TA, subjects (Argüeso et al., 2003). Moh A, Hui SL, Econs MJ. Ablation of the Galnt3 gene leads to low-circulating intact fibroblast growth factor 23 (Fgf23) References concentrations and hyperphosphatemia despite increased Fgf23 expression. Endocrinology. 2009 Jun;150(6):2543-50 Bennett EP, Hassan H, Mandel U et al.. Cloning and characterization of a close homologue of human UDP-N- Park JH, Nishidate T, Kijima K, Ohashi T, Takegawa K, acetyl-alpha-D-galactosamine:Polypeptide N- Fujikane T, Hirata K, Nakamura Y, Katagiri T. Critical roles of acetylgalactosaminyltransferase-T3, designated GalNAc-T6. mucin 1 glycosylation by transactivated polypeptide N- Evidence for genetic but not functional redundancy. J Biol acetylgalactosaminyltransferase 6 in mammary Chem. 1999 Sep 3;274(36):25362-70 carcinogenesis. Cancer Res. 2010 Apr 1;70(7):2759-69 Burchell JM, Mungul A, Taylor-Papadimitriou J. O-linked Freire-de-Lima L, Gelfenbeyn K, Ding Y et al.. Involvement of glycosylation in the mammary gland: changes that occur O-glycosylation defining oncofetal fibronectin in epithelial- during malignancy. J Mammary Gland Biol Neoplasia. 2001 mesenchymal transition process. Proc Natl Acad Sci U S A. Jul;6(3):355-64 2011 Oct 25;108(43):17690-5 Argüeso P, Tisdale A, Mandel U, Letko E, Foster CS, Gipson Li Z, Yamada S, Inenaga S, Imamura T, Wu Y et al.. IK. The cell-layer- and cell-type-specific distribution of GalNAc- Polypeptide N-acetylgalactosaminyltransferase 6 expression in transferases in the ocular surface epithelia is altered during pancreatic cancer is an independent prognostic factor keratinization. Invest Ophthalmol Vis Sci. 2003 Jan;44(1):86- indicating better overall survival. Br J Cancer. 2011 Jun 92 7;104(12):1882-9 Ten Hagen KG, Fritz TA, Tabak LA. All in the family: the UDP- Park JH, Katagiri T, Chung S, Kijima K, Nakamura Y. GalNAc:polypeptide N-acetylgalactosaminyltransferases. Polypeptide N-acetylgalactosaminyltransferase 6 disrupts Glycobiology. 2003 Jan;13(1):1R-16R mammary acinar morphogenesis through O-glycosylation of fibronectin. Neoplasia. 2011 Apr;13(4):320-6 Fritz TA, Hurley JH, Trinh LB, Shiloach J, Tabak LA. The beginnings of mucin biosynthesis: the crystal structure of UDP- Kitada S, Yamada S, Kuma A, Ouchi S et al.. Polypeptide N- GalNAc:polypeptide alpha-N-acetylgalactosaminyltransferase- acetylgalactosaminyl transferase 3 independently predicts T1. Proc Natl Acad Sci U S A. 2004 Oct 26;101(43):15307-12 high-grade tumours and poor prognosis in patients with renal cell carcinomas. Br J Cancer. 2013 Jul 23;109(2):472-81 Berois N, Mazal D, Ubillos L, Trajtenberg F et al.. UDP-N- acetyl-D-galactosamine: polypeptide N- This article should be referenced as such: acetylgalactosaminyltransferase-6 as a new immunohistochemical breast cancer marker. J Histochem Park JH, Nakamura Y. GALNT6 (UDP-N-acetyl-alpha-D- Cytochem. 2006 Mar;54(3):317-28 galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)). Atlas Genet Cytogenet Oncol Haematol. 2014; Freire T, Berois N, Sóñora C, Varangot M, Barrios E, Osinaga 18(2):90-92. E. UDP-N-acetyl-D-galactosamine:polypeptide N- acetylgalactosaminyltransferase 6 (ppGalNAc-T6) mRNA as a

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 92 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

LRP1B (low density lipoprotein receptor -related protein 1B) Hugo Prazeres, Catarina Salgado, Cecília Duarte, Paula Soares Institute of Molecular Pathology and Immunology of the University of Porto (IPATIMUP), 4200-465 Porto, Portugal (HP, CS, CD, PS)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/LRP1BID41200ch2q22.html DOI: 10.4267/2042/53081 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Location: 2q22.1 Review on LRP1B, with data on DNA/RNA, on the Local order: Centromere ... - HNMT - SPOPL - protein encoded and where the gene is implicated. NXPH2 - LRP1B - KYNU - ARHGAP15 - GTDC1 - ZEB - ... qter Identity Note Other names: LRP-DIT, LRPDIT LRP1B is encoded in the long arm of chromosome 2, HGNC (Hugo): LRP1B from the minus strand.

Mapping diagram.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 93 LRP1B (low density lipoprotein receptor-related protein 1B) Prazeres H, et al.

DNA diagram. Overview of sequence-related elements in the LRP1B gene. The gene comprises 91 exons, an upstream CpG- enriched region, an element for the P300 transcription factor (within intron 1) and a downstream 3' UTR sequence which encodes a mRNA binding site for miR-548a-5p.

alternative splicing of exon 90, which impact DNA/RNA differential binding of partners interacting with the Description cytoplasmic domain of LRP1B (Shiroshima et al., 2009). LRP1B genomic sequence spans 1.9 Mbs, with a genetic structure composed of 91 exons that comprise Pseudogene 16.5 Kbs of coding sequence (Liu et al., 2000b). Intron No LRP1B pseudogene is annotated. 1 is very large and contains a functionally validated binding site for the P300 Histone Acetyltransferase Protein transcription factor (Prazeres et al., 2011). A CpG enriched region spans the 5' UTR, exon 1 and upstream Description sequence of intron 1 (Sonoda et al., 2004; Prazeres et Like other members of the LDL receptor family, the al., 2011). The 3' UTR encodes sequences that are modular structures within LRP1B include an several predicted microRNA binding sites. Functional extracellular region with interspersed cysteine-rich studies validated binding of miR-548a-5p (Prazeres et complement-type repeats (CRs) and EGF repeats with al., 2011). β-propeller structure, a transmembrane domain and a Transcription cytoplasmic domain with endocytosis NPXY motifs. In what concerns the specific structure of LRP1B, it has Expression is epigenetically regulated, both by DNA four putative ligand-binding clusters (I, II, III, and IV, methylation and presumably by histone modification. from the amino terminus) that consist of 2, 8, 10, and This comes from finding of promoter hypermethylation 12 CRs, respectively. These domain clusters are in several types of cancer (Sonoda et al., 2004; separated from one another by three clusters of EGF Nakagawa et al., 2006; Rahmatpanah et al., 2006; precursor repeats and (F/Y) WXD spacer repeats. Taylor et al., 2007a; Taylor et al., 2007b; Lu et al., LRP1B contains a putative furin endopeptidase 2010) with demethylation agents such as 5-azacytidine processing site (REKR) at positions 3954-3957 or siRNA for DNMT1 results in LRP1B re-expression (Willnow et al., 1999). This post-translational (Sonoda et al., 2004; Prazeres et al., 2011). Also, processing event results in the formation of mature treatment with Histone Deacetylase Inhibitors, such as LRP as a noncovalently associated heterodimer, Tricostatin A, induces expression of LRP1B (Sonoda et consisting of an extracellular 515-kDa subunit and a al., 2004; Prazeres et al., 2011). transmembrane 85-kDa subunit. Transcripts with alternative C-terminal result from

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 94 LRP1B (low density lipoprotein receptor-related protein 1B) Prazeres H, et al.

Protein diagram. LRP1B is composed of modular domains, namely extracellular cysteine ligand-binding repeats (CRs) and epidermal growth factor precursor-like domains with β-propeller structure, single pass transmembrane region and cytoplasmatic domains with endocytosis NPXY motifs that are nonetheless homologous to other LDL Receptor Family members, for which the prototypic member is the LDL Receptor. The specificity in LRP1B structure comes from the number and organization of these modules.

The transmembrane domain of LRP1B is separated Soluble LRP1B ectodomains may be released to the from domain IV and by a cassette of six epidermal extracellular milieu through the action of shedases and growth factor-like precursor repeats. The cytoplasmic exert anchorage independent functions (Dietrich et al., tail of LRP1B contains two NPXY motifs. Between 2010). these two, there is a unique insertion of 33 amino acid Function residues contributed by exon 90 (Willnow et al., 1999). The modular protein domains of Lipoprotein Receptors Expression (LRs) account for three important properties. First, LRP1B is expressed at higher levels in the central individual LRs have been shown to recognize multiple nervous system, thyroid, skeletal muscle and testis. In (more then 30) structurally unrelated extracellular other organs lower expression levels are detected (Haas ligands, that include lipoprotein complexes but also et al., 2011). many other categories of molecules. Second, LRs are capable of engaging endocytosis, resulting in clearance Localisation of their ligands from the extracellular milieu. Third, LRP1B expression localizes to the cell membrane as LRs can associate with other membrane bound well as to several categories of membrane vesicles receptors, such as integrins and receptor tyrosine involved in intracellular traffic. Proteomic analysis has kinases, and with intracellular signaling molecules. The also detected LRP1B in extracellular vesicles, namely classical roles of LRPs are to act as scavenger receptors as a component of exosomes (Looze et al., 2009).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 95 LRP1B (low density lipoprotein receptor-related protein 1B) Prazeres H, et al.

in the clearance of a myriad of extracellular ligands One of the partners, PICK1 recognizes the C-terminus from the pericellular environment (Herz and of LRP1B and inhibits phosphorylation of LRP1B by Strickland, 2001; May et al., 2007). The best studied PKC alpha (Shiroshima et al., 2009). The output of ligands of LRs include lipoprotein complexes and these interactions in terms of signaling pathways proteinase/proteinase inhibitor complexes, such as α2 activated in consequence of LRP1B activity remains macroglobulin and members of the urokinase unexplored. Plasminogen Activating (uPA) system (uPA, uPAR Proteolytic release of LRP1B domains: and PAI-1) (Herz et al., 1992; Nykjaer et al., 1992). LRP1B ectodomains resulting from proteolytic LRP1B functions at the extracellular and cell shedding of the extracellular region can be found in the membrane levels: soluble form (Dietrich et al., 2010). In order to characterize LRP1B ligands, immobilized LRP1B has also been shown to undergo regulated recombinant extracellular sub-domains of LRP1B have intra-membrane proteolysis in a gamma-secretase- been used as decoys to perform affinity dependent manner, releasing an intracellular domain chromatography using brain lysates (Liu et al., 2001) (ICD) that then translocates to the nucleus (Liu et al., or in serum (Haas et al., 2011) as a source of potential 2007). physiological ligands. Using this strategy, LRP1B has The functions of the ICD in the nucleus are unknown. been previously found to bind lipoproteins and ligands Functions associated with heterologous ligands: of the uPA system (Liu et al., 2001; Li et al., 2002; LRP1B may also act as a receptor for heterologous Knisely et al., 2007). Also several serum proteins, biomolecules such as the Pseudomonas exotoxin including fibrinogen and apoE-carrying lipoproteins (Pastrana et al., 2005) and, most interestingly, for showed affinity to LRP1B extracellular regions (Haas certain drugs, putting emphasis on the role of et al., 2011). endocytosis in cellular drug uptake (Chung and Wasan, It should nevertheless be noted that these approaches 2004). inherently under-estimate the full impact of LRP1B In accordance with this, reduced uptake of liposomes activity since, in the former study (Liu et al., 2001), the by LRP1B may underlie the mechanism of acquired proteome which has been interrogated was derived resistance to liposomal doxorubicin chemotherapy in from brain-lysate fractions, rather than the extracellular high-grade serous ovarian cancers that display LRP1B proteome which shares the physiological milieu with deletion (Cowin et al., 2012). LRP1B. In the latter study (Haas et al., 2011), the use of serum restricts candidate ligands to systemic Homology circulating factors and neglects local factors that may LRP1B is a member of the LDL receptor family which play a role in the tissue microenvironment. Evidence is composed of seven receptors structurally that LRP1B activity may, directly or indirectly, homologous to the LDL receptor, the prototypic gene modulate the abundance of multiple extracellular of familial hypercholesterolemia (Hobbs et al., 1992). factors comes from the analysis of conditioned media These receptors, commonly known as lipoprotein from LRP1B overexpressing cells, relative to their receptors (LRs), include the LDL receptor, very low parental counterparts. Conditioned media from cells density lipoprotein (VLDL) receptor, apoE receptor 2, overexpressing LRP1B shows a reduction in the multiple epidermal growth factor-like domains 7 amounts of MMP2 as well as other metalloproteinases, (MEGF7), glycoprotein 330 (gp330/megalin/LRP2), growth factors, cytokines and angiogenic factors, LRP1 and LRP1B. In addition, the family includes indicating that LRP1B impacts the overall extracellular members that are more distantly related, such as LRP5, proteome (Prazeres et al., 2011). LRP6 and SorLa/LRP11. It is thus expected that LRP1B, in analogy with other The close similarity in protein domain structure LRs, can displays a myriad of additional extracellular between LRPs strongly suggests that Lipoprotein ligands that impact the physiology in the extracellular Receptors may share a comparable spectrum of microenvironment. ligands. LRP1B ligands also include the cellular prion protein Nevertheless, this deduction may not be (Taylor and Hooper, 2007; Lu et al., 2010). straightforward. At the membrane level, LRP1B has been shown to For instance, LRP1B ligands of the uPA system were modulate the localization of Urokinase and PDGF found to overlap those of LRP1, its closest related receptors (Tanaga et al., 2004) and to retain beta- member (Liu et al., 2001). amyloid precursor protein at the cell surface and However, distinct properties are displayed by LRP1B reducing amyloid-beta peptide production (Cam et al., since, in contrast to LRP1, cells expressing LRP1B 2004). display a substantially slower rate of uPA/PAI-1 Intracellular LRP1B partners: complex internalization (Knisely et al., 2007), which Six interacting partners of the LRP1B cytoplasmic impairs the regeneration of free uPAR on the cell region have been identified by yeast two-hybrid screen surface and correlates with a diminished rate of cell and immunoprecipitation. migration (Liu et al., 2001; Li et al., 2002). This

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 96 LRP1B (low density lipoprotein receptor-related protein 1B) Prazeres H, et al.

emphasizes that the functions of LRs may be events such as genetic deletions (observable by overlapping and yet distinct as a result of their ligand homozygous deletion), accompanied by epigenetic spectrum and kinetics of endocytosis (Liu et al., 2001). silencing (DNA methylation), or sometimes by microRNA overexpression (Prazeres et al., 2011). Mutations The role of LRP1B as a tumor suppressor may result from modulation of cell migration and invasive Germinal capacity, through regulation of the urokinase No germline LRP1B mutations have been plasminogen system (Liu et al., 2001). Cells expressing characterized. LRP1B display a substantially slower rate of uPA/PAI- 1 complex internalization (Knisely et al., 2007) which Somatic impairs the regeneration of unoccupied uPAR on the The LRP1B gene was originally isolated by positional cell surface and correlates with a diminished rate of cloning on the basis of homozygous deletions (HD) cell migration (Li et al., 2002; Tanaga et al., 2004). detected in human lung cancer cell lines (Kohno et al., Aside from members of the plasminogen system, 2010; Liu et al., 2000a; Liu et al., 2000b). In a LRP1B expression has been shown to deplete the genomic-wide screen, LRP1B was reported amongst extracellular medium of MMP2 and other factors the top 10 most significantly deleted genes across 3312 (Prazeres et al., 2011). These results support the human cancer specimens (Beroukhim et al., 2010). hypothesis that LRP1B endocytosis may (directly or Mapping of focal deletions found in these cancer indirectly) constrain the abundance of critical factors in specimens are published at the tumor microenvironment. http://www.broadinstitute.org/tumorscape/pages/portal Home.jsf. In individual studies of specific tumor types, Lung cancer LRP1B deletions have been reproducibly been Note observed in lung (Nagayama et al., 2007; Kohno et al., Nagayama, Kohno et al. (2007) have described that 2010), esophagus (Sonoda et al., 2004), oral (Cengiz et homozygous deletions (HD) was searched for in 43 al., 2007), breast (Kadota et al., 2010), renal (Langbein lung cancer cell lines. The gene LRP1B was also et al., 2002; Ni et al., 2013), neural (Roversi et al., included among the genes. Fifty-one homozygous 2006; Yin et al., 2009), thyroid (Prazeres et al., 2011) deletions regions containing 113 genes were identified. and ovarian cancer (Chung and Wasan, 2004). The LRP1B was the third most frequent targets of HD. Aside from deletions, LRP1B point mutations have All eight HD segments at the LRP1B gene locus been reported in a significant percentages of lung detected in that study included its coding exons, cancer (Ding et al., 2008) as well as in the sequencing consistent with previous reports (Liu et al., 2000a; of genomes derived from melanoma (Nikolaev et al., Sonoda et al., 2004). At present, the pathogenic 2011) and triple negative breast cancer (Craig et al., significance of LRP1B deletions is unclear; however, 2013). frequent HD in these loci indicates that the inactivation of this gene has major roles in the development of lung Implicated in cancer. LRP1B was mapped at the fragile sites, FRA2F, FRA3B, and FRA16D, and had been found Cancer, across types homozygously deleted in a subset of lung cancers (Liu Note et al., 2000a; Zöchbauer-Müller et al., 2000; Paige et The diversity of biological ligands underlies the role of al., 2001; Fabbri et al., 2005; Smith et al., 2006). LRs in multiple pathologic processes, that include Kohno, Otsuka et al. (2010) have verified homozygous atherosclerosis (Tanaga et al., 2004; Seki et al., 2005) deletions in 176 genes. They consisted of 171 protein- Alzheimer's disease (Jaeger and Pietrzik, 2008; Lillis et encoding genes and five miRNA genes. These 176 al., 2008; Wagner and Pietrzik, 2012) and cancer, the genes were located in 45 regions on 17 chromosomes. focus of this description below. They included known tumor suppressor genes, as well LRP1B, a member of the low-density lipoprotein as candidate tumor suppressor genes shown to be (LDL) receptor family, was identified as a putative hemizygously or homozygously deleted in several tumor suppressor. The down-expression of LRP1B was types of human cancers, such as LRP1B (Sonoda et al., observed in multiple primary cancers. 2004). Oncogenesis Esophageal carcinoma The "signature" of LRP1B inactivation is archetypal of Note a tumor suppressor gene and reflects selection towards The expression of LRP1B mRNA is frequently lost in bi-allelic inactivation and complete abrogation of the esophageal squamous cell carcinoma (ESCs) as a gene function. consequence of either homozygous deletions or DNA In tumors, one can observe that multiple inactivation methylation and the re-expression of this gene inhibits hits, of structural and regulatory nature, have taken growth of ESC cells. These two types of events place, on both alleles through diverse combinations of affecting the LRP1B gene may be useful as novel

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 97 LRP1B (low density lipoprotein receptor-related protein 1B) Prazeres H, et al.

diagnostic markers for ESC because of their high Their observation provided an insight into the potential frequencies, although it remains unclear whether contribution of LRP1B to tumorigenesis, and that precancerous lesions of this tumor contain either of LRP1B may be explored as a molecular target in RCC those alterations. The apparent multiplicity of tumor- therapy by regulated epigenetic activation means. suppressing activities of LRP1B, however, suggests These functional specificities in cell spreading, that this molecule might be a useful starting point for migration and invasion strongly validated that LRP1B development of novel therapeutic strategies (Sonoda et may function as a tumor suppressor, and exert opposite al., 2004). effects to LRP1 on cell transformation and malignant Oral carcinoma progression. Note Glioma Genome-wide LOH analysis demonstrated high LOH Note ratio of 2q21-23 region by using the markers D2S1334 Data analysis of full-coverage chromosome 19 and D2S1399 in head and neck cancer (Beder et al., highlighted two main regions of copynumber gain, 2003). So far no other study showed frequent LOH of never described before in gliomas, at 19p13.11 and this region in oral cancer, but it has been suggested that 19q13.13-13.2. at least one tumor suppressor gene exists at 2q21-24 Genomic hotspot detection facilitated the identification and involves in the carcinogenesis of various cancers of small intervals resulting in positional candidate including oral carcinoma. One candidate gene could be genes such as LRP1B (2q22.3) for losses, and other for LRP1B, which has already been proposed to function gains. as a tumor suppressor (Cengiz et al., 2007). These data increase the current knowledge about Breast cancer cryptic genetic changes in gliomas and may facilitate the further identification of novel genetic elements, Note which may provide us with molecular tools for the Kadota, Yang et al. (2010) have observed intragenic improved diagnostics and therapeutic decision-making deletions within several genes which potentially in these tumors (Roversi et al., 2006). function as breast cancer tumor suppressor loci. These LRP1B has been found frequently mutated in included deletions which disrupted LRP1B in glioblastoma (GBM) (Roversi et al., 2006). A novel MCF10CA1h and MCF10CA1a cell lines. internal deletion of LRP1B was discovered in the U118 Renal cancer GBM cell line and four GBM samples. Nucleotide sequencing of the LRP1B gene from U118 cells Prognosis showed loss of exons 3 to 18 and an early stop codon, In urothelial cancer, only 8% of cases with Grade 1 and suggesting that the protein was no longer functional. none with Grade 2 tumors showed loss of This data suggest that LRP1B acts as a tumor heterozygosity at the LRP1B gene, whereas 49% of the suppressor gene in glioma cells and is aberrant in GBM Grade 3 cases had allelic loss at the LRP1B genomic (Yin et al., 2009). region, which can be taken to indicate that alteration of the LRP1B gene region is associated with high grade of Thyroid cancer urothelial cancer (Langbein et al., 2002). Note Oncogenesis In non-medullary thyroid cancer, LRP1B under- Ni, Hu et al. (2013) have investigated the expression of expression is significantly lower in highly aggressive LRP1B in Renal cell cancer (RCC) and its function on undifferentiated thyroid tumors (Prazeres et al., 2011). cell migration. LRP1B expression levels are significantly associated They found that LRP1B mRNA was widely expressed with vascular invasion in follicular thyroid cancer in the normal renal tubular epithelial cells, but it was (Prazeres et al., 2011). frequently down-expressed in RCC tissues and cell Oncogenesis lines. Prazeres, Torres et al. (2011) have shown that LRP1B The depletion of LRP1B increased the anchorage- inactivation (by chromosomal, epigenetic and independent growth, cell migration and invasion in microRNA (miR)-mediated mechanisms) resulted in vitro. Moreover, the expression and activation of Rho changes to the tumor environment that confer cancer family members, actin cytoskeletons and focal cells an increased growth and invasive capacity. adhesions complex (FAC) were also affected, Restoration of LRP1B impaired in vitro and in vivo indicating that down-expression of LRP1B led to the tumor growth, inhibited cell invasion and led to a increase of cell migration and invasion, which is reduction of matrix metalloproteinase 2 in the possibly mediated by actin cytoskeleton remodeling, extracellular medium. and expressional alteration of FAC components. At the This emphasized the role of an endocytic receptor same time, they also found that silencing of LRP1B acting as a tumor suppressor by modulating the obviously occurred in T1 of TNM. The result suggests extracellular environment composition in a way that that silencing of LRP1B is an early event in RCC. constrains the invasive behavior of the cancer cells.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 98 LRP1B (low density lipoprotein receptor-related protein 1B) Prazeres H, et al.

Ovarian cancer results strongly suggest that LRP1B plays a role in the regulation of migration activity of SMCs through the Prognosis modification of PDGF signals in the process of LRP1B binds to fibrinogen and apoE-containing atherosclerosis. ligands (Haas et al., 2011) and importantly, several Tanaga, Bujo et al. (2004) have described that LRP1B studies have suggested that LDL receptor family modulates the catabolism of uPAR and PDGFR, members are involved in uptake of anionic liposomes affecting the migration of smooth muscle cells (SMCs). and drugs (Chung and Wasan, 2004; Lakkaraju et al., This functional characterization of LRP1B opens novel 2002). avenues for elucidating the (patho)physiological Due to high degree of intratumoral heterogeneity and significance of SMC migration in atheromatous the large number of chemotherapeutic agents plaques. commonly used in the relapse setting in high-grade serous cancer (HGSC) patients, the most common References subtype of ovarian cancer, it is likely that there will be multiple mechanisms of acquired resistance. It was Herz J, Clouthier DE, Hammer RE. LDL receptor-related described that the deletion or downregulation of the protein internalizes and degrades uPA-PAI-1 complexes and is essential for embryo implantation. Cell. 1992 Oct 30;71(3):411-21 lipid transporter LRP1B emerged as a significant correlate of acquired resistance. Functional studies Hobbs HH, Brown MS, Goldstein JL. Molecular genetics of the LDL receptor gene in familial hypercholesterolemia. Hum showed that reducing LRP1B expression was sufficient Mutat. 1992;1(6):445-66 to reduce the sensitivity of HGSC cell lines to liposomal doxorubicin, but not to doxorubicin, whereas Nykjaer A, Petersen CM, Møller B, Jensen PH, Moestrup SK, Holtet TL, Etzerodt M, Thøgersen HC, Munch M, Andreasen LRP1B overexpression was sufficient to increase PA. Purified alpha 2-macroglobulin receptor/LDL receptor- sensitivity to liposomal doxorubicin. These data related protein binds urokinase.plasminogen activator inhibitor indicates that LRP1B loss contributes to the emergence type-1 complex. Evidence that the alpha 2-macroglobulin of resistance to chemotherapy, specifically to liposomal receptor mediates cellular degradation of urokinase receptor- bound complexes. J Biol Chem. 1992 Jul 25;267(21):14543-6 doxorubicin (Cowin et al., 2012). In conclusion, in high-grade serous ovarian cancers, Willnow TE, Nykjaer A, Herz J. Lipoprotein receptors: new LRP1B deletion is associated with worse prognosis as roles for ancient proteins. Nat Cell Biol. 1999 Oct;1(6):E157-62 a result of acquired chemotherapy resistance to Liu CX, Musco S, Lisitsina NM, Forgacs E, Minna JD, Lisitsyn liposomal doxorubicin (Cowin et al., 2012). NA. LRP-DIT, a putative endocytic receptor gene, is frequently inactivated in non-small cell lung cancer cell lines. Cancer Res. Alzheimer's disease 2000 Apr 1;60(7):1961-7 Note Liu CX, Musco S, Lisitsina NM, Yaklichkin SY, Lisitsyn NA. Initially, LDL receptor gene family was of high interest Genomic organization of a new candidate tumor suppressor gene, LRP1B. Genomics. 2000 Oct 15;69(2):271-4 due to its key function in cholesterol/apolipoprotein E (ApoE) uptake, with the e4 allele of ApoE as the Zöchbauer-Müller S, Wistuba II, Minna JD, Gazdar AF. Fragile histidine triad (FHIT) gene abnormalities in lung cancer. Clin strongest genetic risk factor for late-onset Alzheimer's Lung Cancer. 2000 Nov;2(2):141-5 disease (AD). In a review, Jaeger and Pietrzik (2008) have Herz J, Strickland DK. LRP: a multifunctional scavenger and signaling receptor. J Clin Invest. 2001 Sep;108(6):779-84 highlighted the involvement of different lipoprotein receptors in AD. Their functional implications reach Liu CX, Li Y, Obermoeller-McCormick LM, Schwartz AL, Bu G. from mediating amyloid precursor protein (APP) The putative tumor suppressor LRP1B, a novel member of the low density lipoprotein (LDL) receptor family, exhibits both internalization, as LRP1B, intracellular trafficking, A β overlapping and distinct properties with the LDL receptor- clearance out of the brain (LRP1) to an involvement in related protein. J Biol Chem. 2001 Aug 3;276(31):28889-96 ApoE/cholesterol metabolism. These findings implicate Lakkaraju A, Rahman YE, Dubinsky JM. Low-density an important role for lipoprotein receptors in the lipoprotein receptor-related protein mediates the endocytosis underlying mechanisms leading to the development of of anionic liposomes in neurons. J Biol Chem. 2002 Apr AD. These mechanisms will give way to new 26;277(17):15085-92 therapeutic strategies for the treatment of Langbein S, Szakacs O, Wilhelm M, Sukosd F, Weber S, neurodegenerative diseases via interference with the Jauch A, Lopez Beltran A, Alken P, Kälble T, Kovacs G. role of lipoprotein receptors. Alteration of the LRP1B gene region is associated with high grade of urothelial cancer. Lab Invest. 2002 May;82(5):639-43 Atherosclerosis Li Y, Knisely JM, Lu W, McCormick LM, Wang J, Henkin J, Note Schwartz AL, Bu G. Low density lipoprotein (LDL) receptor- related protein 1B impairs urokinase receptor regeneration on Seki, Bujo et al. (2005) have characterized the the cell surface and inhibits cell migration. J Biol Chem. 2002 functions of three groups of cultured smooth muscle Nov 1;277(44):42366-71 cells (SMCs) with different origins in atherosclerotic Beder LB, Gunduz M, Ouchida M, Fukushima K, Gunduz E, Ito arteries, in order to know a functional significance of S, Sakai A, Nagai N, Nishizaki K, Shimizu K. Genome-wide LRP1B in the increased migration of SMCs. The analyses on loss of heterozygosity in head and neck squamous cell carcinomas. Lab Invest. 2003 Jan;83(1):99-105

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 99 LRP1B (low density lipoprotein receptor-related protein 1B) Prazeres H, et al.

Cam JA, Zerbinatti CV, Knisely JM, Hecimovic S, Li Y, Bu G. a 100-kb resolution. Genes Chromosomes Cancer. 2007 The low density lipoprotein receptor-related protein 1B retains Nov;46(11):1000-10 beta-amyloid precursor protein at the cell surface and reduces amyloid-beta peptide production. J Biol Chem. 2004 Jul Taylor DR, Hooper NM. The low-density lipoprotein receptor- 9;279(28):29639-46 related protein 1 (LRP1) mediates the endocytosis of the cellular prion protein. Biochem J. 2007 Feb 15;402(1):17-23 Chung NS, Wasan KM. Potential role of the low-density lipoprotein receptor family as mediators of cellular drug uptake. Taylor KH, Kramer RS, Davis JW, Guo J, Duff DJ, Xu D, Adv Drug Deliv Rev. 2004 May 7;56(9):1315-34 Caldwell CW, Shi H. Ultradeep bisulfite sequencing analysis of DNA methylation patterns in multiple gene promoters by 454 Sonoda I, Imoto I, Inoue J, Shibata T, Shimada Y, Chin K, sequencing. Cancer Res. 2007a Sep 15;67(18):8511-8 Imamura M, Amagasa T, Gray JW, Hirohashi S, Inazawa J. Frequent silencing of low density lipoprotein receptor-related Taylor KH, Pena-Hernandez KE, Davis JW, Arthur GL, Duff protein 1B (LRP1B) expression by genetic and epigenetic DJ, Shi H, Rahmatpanah FB, Sjahputera O, Caldwell CW. mechanisms in esophageal squamous cell carcinoma. Cancer Large-scale CpG methylation analysis identifies novel Res. 2004 Jun 1;64(11):3741-7 candidate genes and reveals methylation hotspots in acute lymphoblastic leukemia. Cancer Res. 2007b Mar Tanaga K, Bujo H, Zhu Y, Kanaki T, Hirayama S, Takahashi K, 15;67(6):2617-25 Inoue M, Mikami K, Schneider WJ, Saito Y. LRP1B attenuates the migration of smooth muscle cells by reducing membrane Ding L, Getz G, Wheeler DA, Mardis ER, McLellan MD, localization of urokinase and PDGF receptors. Arterioscler Cibulskis K, Sougnez C, Greulich H, Muzny DM, Morgan MB, Thromb Vasc Biol. 2004 Aug;24(8):1422-8 Fulton L, Fulton RS, Zhang Q, Wendl MC, Lawrence MS, Larson DE, Chen K, Dooling DJ, Sabo A, Hawes AC, Shen H, Pastrana DV, Hanson AJ, Knisely J, Bu G, Fitzgerald DJ. LRP Jhangiani SN, Lewis LR, Hall O, Zhu Y, Mathew T, Ren Y, Yao 1 B functions as a receptor for Pseudomonas exotoxin. J, Scherer SE, Clerc K, Metcalf GA, Ng B, Milosavljevic A, Biochim Biophys Acta. 2005 Sep 25;1741(3):234-9 Gonzalez-Garay ML, Osborne JR, Meyer R, Shi X, Tang Y, Koboldt DC, Lin L, Abbott R, Miner TL, Pohl C, Fewell G, Seki N, Bujo H, Jiang M, Tanaga K, Takahashi K, Yagui K, Haipek C, Schmidt H, Dunford-Shore BH, Kraja A, Crosby SD, Hashimoto N, Schneider WJ, Saito Y. LRP1B is a negative Sawyer CS, Vickery T, Sander S, Robinson J, Winckler W, modulator of increased migration activity of intimal smooth Baldwin J, Chirieac LR, Dutt A, Fennell T, Hanna M, Johnson muscle cells from rabbit aortic plaques. Biochem Biophys Res BE, Onofrio RC, Thomas RK, Tonon G, Weir BA, Zhao X, Commun. 2005 Jun 17;331(4):964-70 Ziaugra L, Zody MC, Giordano T, Orringer MB, Roth JA, Spitz Nakagawa T, Pimkhaokham A, Suzuki E, Omura K, Inazawa J, MR, Wistuba II, Ozenberger B, Good PJ, Chang AC, Beer DG, Imoto I. Genetic or epigenetic silencing of low density Watson MA, Ladanyi M, Broderick S, Yoshizawa A, Travis WD, lipoprotein receptor-related protein 1B expression in oral Pao W, Province MA, Weinstock GM, Varmus HE, Gabriel SB, squamous cell carcinoma. Cancer Sci. 2006 Oct;97(10):1070-4 Lander ES, Gibbs RA, Meyerson M, Wilson RK. Somatic mutations affect key pathways in lung adenocarcinoma. Rahmatpanah FB, Carstens S, Guo J, Sjahputera O, Taylor Nature. 2008 Oct 23;455(7216):1069-75 KH, Duff D, Shi H, Davis JW, Hooshmand SI, Chitma-Matsiga R, Caldwell CW. Differential DNA methylation patterns of small Jaeger S, Pietrzik CU. Functional role of lipoprotein receptors B-cell lymphoma subclasses with different clinical behavior. in Alzheimer's disease. Curr Alzheimer Res. 2008 Feb;5(1):15-25 Leukemia. 2006 Oct;20(10):1855-62 Lillis AP, Van Duyn LB, Murphy-Ullrich JE, Strickland DK. LDL Roversi G, Pfundt R, Moroni RF, Magnani I, van Reijmersdal receptor-related protein 1: unique tissue-specific functions S, Pollo B, Straatman H, Larizza L, Schoenmakers EF. revealed by selective gene knockout studies. Physiol Rev. Identification of novel genomic markers related to progression 2008 Jul;88(3):887-918 to glioblastoma through genomic profiling of 25 primary glioma Looze C, Yui D, Leung L, Ingham M, Kaler M, Yao X, Wu WW, cell lines. Oncogene. 2006 Mar 9;25(10):1571-83 Shen RF, Daniels MP, Levine SJ. Proteomic profiling of human Smith DI, Zhu Y, McAvoy S, Kuhn R. Common fragile sites, plasma exosomes identifies PPARgamma as an exosome- extremely large genes, neural development and cancer. associated protein. Biochem Biophys Res Commun. 2009 Jan Cancer Lett. 2006 Jan 28;232(1):48-57 16;378(3):433-8 Cengiz B, Gunduz M, Nagatsuka H, Beder L, Gunduz E, Shiroshima T, Oka C, Kawaichi M. Identification of LRP1B- Tamamura R, Mahmut N, Fukushima K, Ali MA, Naomoto Y, interacting proteins and inhibition of protein kinase Calpha- Shimizu K, Nagai N. Fine deletion mapping of chromosome phosphorylation of LRP1B by association with PICK1. FEBS 2q21-37 shows three preferentially deleted regions in oral Lett. 2009 Jan 5;583(1):43-8 cancer. Oral Oncol. 2007 Mar;43(3):241-7 Yin D, Ogawa S, Kawamata N, Tunici P, Finocchiaro G, Eoli Knisely JM, Li Y, Griffith JM, Geuze HJ, Schwartz AL, Bu G. M, Ruckert C, Huynh T, Liu G, Kato M, Sanada M, Slow endocytosis of the LDL receptor-related protein 1B: Jauch A, Dugas M, Black KL, Koeffler HP. High-resolution implications for a novel cytoplasmic tail conformation. Exp Cell genomic copy number profiling of glioblastoma multiforme by Res. 2007 Sep 10;313(15):3298-307 single nucleotide polymorphism DNA microarray. Mol Cancer Liu CX, Ranganathan S, Robinson S, Strickland DK. gamma- Res. 2009 May;7(5):665-77 Secretase-mediated release of the low density lipoprotein Beroukhim R, Mermel CH, Porter D, Wei G, Raychaudhuri S, receptor-related protein 1B intracellular domain suppresses Donovan J, Barretina J, Boehm JS, Dobson J, Urashima M, anchorage-independent growth of neuroglioma cells. J Biol Chem. 2007 Mar 9;282(10):7504-11 Mc Henry KT, Pinchback RM, Ligon AH, Cho YJ, Haery L, Greulich H, Reich M, Winckler W, Lawrence MS, Weir BA, May P, Woldt E, Matz RL, Boucher P. The LDL receptor- Tanaka KE, Chiang DY, Bass AJ, Loo A, Hoffman C, Prensner related protein (LRP) family: an old family of proteins with new J, Liefeld T, Gao Q, Yecies D, Signoretti S, Maher E, Kaye FJ, physiological functions. Ann Med. 2007;39(3):219-28 Sasaki H, Tepper JE, Fletcher JA, Tabernero J, Baselga J, Nagayama K, Kohno T, Sato M, Arai Y, Minna JD, Yokota J. Tsao MS, Demichelis F, Rubin MA, Janne PA, Daly MJ, Homozygous deletion scanning of the lung cancer genome at Nucera C, Levine RL, Ebert BL, Gabriel S, Rustgi AK,

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 100 LRP1B (low density lipoprotein receptor-related protein 1B) Prazeres H, et al.

Antonescu CR, Ladanyi M, Letai A, Garraway LA, Loda M, Prazeres H, Torres J, Rodrigues F, Pinto M, Pastoriza MC, Beer DG, True LD, Okamoto A, Pomeroy SL, Singer S, Golub Gomes D, Cameselle-Teijeiro J, Vidal A, Martins TC, TR, Lander ES, Getz G, Sellers WR, Meyerson M. The Sobrinho-Simões M, Soares P. Chromosomal, epigenetic and landscape of somatic copy-number alteration across human microRNA-mediated inactivation of LRP1B, a modulator of the cancers. Nature. 2010 Feb 18;463(7283):899-905 extracellular environment of thyroid cancer cells. Oncogene. 2011 Mar 17;30(11):1302-17 Dietrich MF, van der Weyden L, Prosser HM, Bradley A, Herz J, Adams DJ. Ectodomains of the LDL receptor-related Cowin PA, George J, Fereday S, Loehrer E, Van Loo P, proteins LRP1b and LRP4 have anchorage independent Cullinane C, Etemadmoghadam D, Ftouni S, Galletta L, functions in vivo. PLoS One. 2010 Apr 7;5(4):e9960 Anglesio MS, Hendley J, Bowes L, Sheppard KE, Christie EL, Pearson RB, Harnett PR, Heinzelmann-Schwarz V, Kadota M, Yang HH, Gomez B, Sato M, Clifford RJ, Friedlander M, McNally O, Quinn M, Campbell P, deFazio A, Meerzaman D, Dunn BK, Wakefield LM, Lee MP. Delineating Bowtell DD. LRP1B deletion in high-grade serous ovarian genetic alterations for tumor progression in the MCF10A series cancers is associated with acquired chemotherapy resistance of breast cancer cell lines. PLoS One. 2010 Feb 15;5(2):e9201 to liposomal doxorubicin. Cancer Res. 2012 Aug Kohno T, Otsuka A, Girard L, Sato M, Iwakawa R, Ogiwara H, 15;72(16):4060-73 Sanchez-Cespedes M, Minna JD, Yokota J. A catalog of genes Wagner T, Pietrzik CU. The role of lipoprotein receptors on the homozygously deleted in human lung cancer and the physiological function of APP. Exp Brain Res. 2012 Apr;217(3- candidacy of PTPRD as a tumor suppressor gene. Genes 4):377-87 Chromosomes Cancer. 2010 Apr;49(4):342-52 Craig DW, O'Shaughnessy JA, Kiefer JA, Aldrich J, Sinari S, Lu YJ, Wu CS, Li HP, Liu HP, Lu CY, Leu YW, Wang CS, Moses TM, Wong S, Dinh J, Christoforides A, Blum JL, Aitelli Chen LC, Lin KH, Chang YS. Aberrant methylation impairs low CL, Osborne CR, Izatt T, Kurdoglu A, Baker A, Koeman J, density lipoprotein receptor-related protein 1B tumor Barbacioru C, Sakarya O, De La Vega FM, Siddiqui A, Hoang suppressor function in gastric cancer. Genes Chromosomes L, Billings PR, Salhia B, Tolcher AW, Trent JM, Mousses S, Cancer. 2010 May;49(5):412-24 Von Hoff D, Carpten JD. Genome and transcriptome Haas J, Beer AG, Widschwendter P, Oberdanner J, Salzmann sequencing in prospective metastatic triple-negative breast K, Sarg B, Lindner H, Herz J, Patsch JR, Marschang P. LRP1b cancer uncovers therapeutic vulnerabilities. Mol Cancer Ther. shows restricted expression in human tissues and binds to 2013 Jan;12(1):104-16 several extracellular ligands, including fibrinogen and apoE- Ni S, Hu J, Duan Y, Shi S, Li R, Wu H, Qu Y, Li Y. Down carrying lipoproteins. Atherosclerosis. 2011 Jun;216(2):342-7 expression of LRP1B promotes cell migration via RhoA/Cdc42 Nikolaev SI, Rimoldi D, Iseli C, Valsesia A, Robyr D, Gehrig C, pathway and actin cytoskeleton remodeling in renal cell Harshman K, Guipponi M, Bukach O, Zoete V, Michielin O, cancer. Cancer Sci. 2013 Jul;104(7):817-25 Muehlethaler K, Speiser D, Beckmann JS, Xenarios I, Halazonetis TD, Jongeneel CV, Stevenson BJ, Antonarakis This article should be referenced as such: SE. Exome sequencing identifies recurrent somatic MAP2K1 Prazeres H, Salgado C, Duarte C, Soares P. LRP1B (low and MAP2K2 mutations in melanoma. Nat Genet. 2011 Dec density lipoprotein receptor-related protein 1B). Atlas Genet 25;44(2):133-9 Cytogenet Oncol Haematol. 2014; 18(2):93-101.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 101 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

MIR296 (microRNA 296) Chiara Verdelli, Sabrina Corbetta Molecular Biology Lab, IRCCS Policlinico San Donato, Piazza Malan 1, 20097 San Donato Milanese (MI), Italy (CV), Dept. Biomedical Sciences for the Health, University of Milan, IRCCS Policlinico San Donato, Piazza E.Malan 1, 20097 San Donato Milanese (MI), Italy (SC)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR296ID51538ch20q13.html DOI: 10.4267/2042/53082 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

20q13.32 are: miR296 ; miR298; GNAS-AS1, GNAS Abstract antisense RNA 1; GNAS, GNAS complex locus. Review on MIR296, with data on DNA/RNA and Note: miR296 has been implicated in cancerogenesis where the gene is implicated. and it has been reported both over-expressed and lost in different human cancer cell types, suggesting that it Identity functions as an oncogene or an oncosuppressor in Other names: MIRN296, miRNA296 different biological settings. HGNC (Hugo): MIR296 Furthermore, miR296 has been also described to contribute to carcinogenesis by dysregulating p53. Location: 20q13.32 miR296 has been named an "angiomiR" because of its Local order: Orientation: minus strand. role in angiogenesis. Based on Mapviewer, genes flanking miR296 on

Schematic representation of human chromosome 20 with highlight of miR296 locus (red dash).

Stem-loop structure of miR-296, with mature miR-296-3p and miR-296-5p sequences highlighted in red.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 102 MIR296 (microRNA 296) Verdelli C, Corbetta S

miR-296 plays important roles in different cell types and cellular pathways, regulating several distinct Mutations mRNAs. Recently, miR-296, along with miR-298, has been demonstrated to be part of the GNAS complex locus, a highly complex cluster with imprinted gene expression, coding a stimulatory G-protein alpha subunit (Gs-α), involved in many signal transduction pathways (Robson et al., 2012). miR-296 was initially found to be specifically expressed in differentiated mouse embryonic stem cells, directly cross-talking with Nanog, Oct4 and Sox2 gene (Houbaviy et al., 2003). It was also characterized in human embryonic stem cells (Suh et al., 2004; Lakshmipathy et al., 2007). miR-296 has been involved in antiviral responses induced by IFN α/IFN β, inhibiting HCV replication directly targeting viral transcripts (Pedersen et al., 2007). In a large series of human cancer cell lines and carcinoma specimens, miR-296 was identified as a comprehensive regulator of cell tumorigenicity, migration and invasion by inhibition of the expression of one of its targets, Scrib, a cytoplasmic protein that participates in multiprotein complexes (Vaira et al., 2012). DNA/RNA Note Accession: NR_029844 Description Note Size: 80 bases. SNP ID: rs117258475 Sequence: >gi|262206120|ref|NR_029844.1| Homo Position: chr20:57392686 sapiens microRNA 296 (MIR296), microRNA. SNP Loc relative to pre-miR: 64 AGGACCCTTCCAGAGGGCCCCCCCTCAATCCT Ref-allele: C/U GTTGTGCCTAATTCAGAGGGTTGGGTGGAGGC TCTCCT GAAGGGCTCT. Implicated in Transcription Various cancers Pre-miR296: Note Accession: MI0000747 Sequence: miR-296 is variably expressed in different human AGGACCCUUCCAGAGGGCCCCCCCUCAAUCCU cancers, it has been shown to be reduced or over- GUUGUGCCUAAUUCAGAGGGUUGGGUGGAGG expressed and to correlate with metastatic disease. CUCUCCUGAAGGGCUCU miR-296 has an inhibitory function on different targets. Mature sequence hsa-miR296-5p Lung carcinomas Accession: MIMAT0000690 Note Lenght: 21 nt In lung carcinomas, miR-296 is a tumour-suppressive Sequence: 14-agggcccccccucaauccugu-34 miR as it has been found to be lost. Mature sequence hsa-miR296-3p The loss results in a repression of Numbl expression. Accession: MIMAT0004679 Numbl becomes overexpressed and mislocalized in Lenght: 22 nt cancer cells from a variety of human tumors (Vaira et Sequence: 48-gaggguuggguggaggcucucc-69 al., 2013).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 103 MIR296 (microRNA 296) Verdelli C, Corbetta S

Hepatocellular carcinomas reflect more aggressive tumor phenotype and increased tumor cell invasiveness (Shivapurkar et al., 2012). Note miR-296 is lost during hepatocellular carcinomas Immortalized cells progression. The loss of miR-296 deregulates cell Note polarity and plasticity. The resulting effect is an over- In immortalized cells, miR-296 is frequently expression of Scrib. miR296 regulates cell migration, upregulated and the over-expression has been reported invasion, and tumorigenicity, through the to determine p53 down-regulation. A number of cancer transcriptional repression of Scrib. miR296 or Scrib cells express high levels of miR-296, that levels predict tumor relapse in hepatocellular downregulates p21WAF1 mRNA expression via carcinoma patients (Vaira et al., 2012). interaction with its 3' untranslated region (Yoon et al., Prostate cancers 2011). Note Angiogenesis miR-296 is a specific regulator of the oncogene Note HMGA1 in prostate cancer cells and is associated with miR-296 was identified in endothelial cells of normal prostate cancer growth and invasion. In this type of and neoplastic tissues, where it promoted angiogenesis cancer there is an inverse correlation between HMGA1 through inhibition of one of its target gene, the and miR-296 expression levels, and low miR-296 hepatocyte growth factor-regulated tyrosine kinase expression levels correlate with advanced tumor grade substrate (HGS). HGS normally stimulates degradation and stage (Wei et al., 2011). of growth factors receptors, such as vascular Parathyroid carcinomas endothelial receptor-2 (VEGFR2) and platelet derived growth factor receptor β (PDGFR-β) (Wurdinger et al., Note 2008). miR-296 has been found to be down-regulated in parathyroid carcinomas compared to normal Hypertension parathyroid glands. miR-296 expression levels Note negatively correlated with hepatocyte growth factor The human with-no-lysine kinase-4 (hWNK4) is a receptor-regulated tyrosine kinase substrate mRNA member of the serine-threonine protein kinase family expression levels. miR-296 might have a role as an and may be involved in pathophysiological processes oncosuppressor gene in these type of neoplasia of hypertension as it regulates diverse ion transporters. (Corbetta et al., 2009). Expression of hWNK4 can be downregulated by miR- Esophageal carcinomas 296 at the posttranscriptional level in a cell-specific manner (Mao et al., 2010). Note In squamous cell carcinomas of the esophagus, miR- Anti-viral defences 296 is reported to be over-expressed and to have a pro- Note tumorigenic role. High levels of miR-296 are Human miR-296-5p inhibits enterovirus EV71 associated with resistance to chemotherapy, while its replication by targeting the viral genome. miR-296 has forced down-regulation resulted in increased sensitivity a role as critical effectors in intricate networks of host- to standard chemotherapeutic agents and in decreased pathogen: effectively miR-296-5p was found to be tumorigenesis of esophageal carcinoma cell lines, significantly increased in response to EV71 infection. likely through reduction of cyclin D1 and upregulation Overexpression of miR296-5p inhibited EV71 of p27 (Hong et al., 2010). infection (Zheng et al., 2013). Gastric cancers Note References miR-296-5p overexpression significantly promoted Houbaviy HB, Murray MF, Sharp PA. Embryonic stem cell- gastric cancer cells growth through repression of specific MicroRNAs. Dev Cell. 2003 Aug;5(2):351-8 Caudal-related homeobox 1 (CDX1), an intestinal- Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, specific transcription factor, reported to have vital roles Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS. Human in gastric intestinal metaplasia (Li et al., 2013). embryonic stem cells express a unique set of microRNAs. Dev Biol. 2004 Jun 15;270(2):488-98 Colon cancers Lakshmipathy U, Love B, Goff LA, Jörnsten R, Graichen R, Note Hart RP, Chesnut JD. MicroRNA expression pattern of undifferentiated and differentiated human embryonic stem Decrease in miR-296 circulating levels, in patients with cells. Stem Cells Dev. 2007 Dec;16(6):1003-16 colon cancer, predicts chemotherapy resistance and is associated with metastasis formation. Low levels of Pedersen IM, Cheng G, Wieland S, Volinia S, Croce CM, Chisari FV, David M. Interferon modulation of cellular circulating miR-296 in patients with colon cancers microRNAs as an antiviral mechanism. Nature. 2007 Oct 18;449(7164):919-22

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 104 MIR296 (microRNA 296) Verdelli C, Corbetta S

Tay Y, Zhang J, Thomson AM, Lim B, Rigoutsos I. MicroRNAs Robson JE, Eaton SA, Underhill P, Williams D, Peters J. to Nanog, Oct4 and Sox2 coding regions modulate embryonic MicroRNAs 296 and 298 are imprinted and part of the stem cell differentiation. Nature. 2008 Oct 23;455(7216):1124-8 GNAS/Gnas cluster and miR-296 targets IKBKE and Tmed9. RNA. 2012 Jan;18(1):135-44 Würdinger T, Tannous BA, Saydam O, Skog J, Grau S, Soutschek J, Weissleder R, Breakefield XO, Krichevsky AM. Vaira V, Faversani A, Dohi T, Montorsi M, Augello C, Gatti S, miR-296 regulates growth factor receptor overexpression in Coggi G, Altieri DC, Bosari S. miR-296 regulation of a cell angiogenic endothelial cells. Cancer Cell. 2008 Nov polarity-cell plasticity module controls tumor progression. 4;14(5):382-93 Oncogene. 2012 Jan 5;31(1):27-38 Corbetta S, Vaira V, Guarnieri V, Scillitani A, Eller-Vainicher C, Li T, Lu YY, Zhao XD, Guo HQ, Liu CH, Li H, Zhou L, Han YN, Ferrero S, Vicentini L, Chiodini I, Bisceglia M, Beck-Peccoz P, Wu KC, Nie YZ, Shi YQ, Fan DM. MicroRNA-296-5p increases Bosari S, Spada A. Differential expression of microRNAs in proliferation in gastric cancer through repression of Caudal- human parathyroid carcinomas compared with normal related homeobox 1. Oncogene. 2013 Jan 28; parathyroid tissue. Endocr Relat Cancer. 2010 Mar;17(1):135-46 Shivapurkar N, Mikhail S, Navarro R, Bai W, Marshall J, Hong L, Han Y, Zhang H, Li M, Gong T, Sun L, Wu K, Zhao Q, Hwang J, Pishvaian M, Wellstein A, He AR. Decrease in blood Fan D. The prognostic and chemotherapeutic value of miR-296 miR-296 predicts chemotherapy resistance and poor clinical in esophageal squamous cell carcinoma. Ann Surg. 2010 outcome in patients receiving systemic chemotherapy for Jun;251(6):1056-63 metastatic colon cancer. Int J Colorectal Dis. 2013 Jun;28(6):887 Mao J, Li C, Zhang Y, Li Y, Zhao Y. Human with-no-lysine kinase-4 3'-UTR acting as the enhancer and being targeted by Vaira V, Faversani A, Martin NM, Garlick DS, Ferrero S, miR-296. Int J Biochem Cell Biol. 2010 Sep;42(9):1536-43 Nosotti M, Kissil JL, Bosari S, Altieri DC. Regulation of lung cancer metastasis by Klf4-Numb-like signaling. Cancer Res. Wei JJ, Wu X, Peng Y, Shi G, Basturk O, Yang X, Daniels G, 2013 Apr 15;73(8):2695-705 Osman I, Ouyang J, Hernando E, Pellicer A, Rhim JS, Melamed J, Lee P. Regulation of HMGA1 expression by Zheng Z, Ke X, Wang M, He S, Li Q, Zheng C, Zhang Z, Liu Y, microRNA-296 affects prostate cancer growth and invasion. Wang H. Human microRNA hsa-miR-296-5p suppresses Clin Cancer Res. 2011 Mar 15;17(6):1297-305 enterovirus 71 replication by targeting the viral genome. J Virol. 2013 May;87(10):5645-56 Yoon AR, Gao R, Kaul Z, Choi IK, Ryu J, Noble JR, Kato Y, Saito S, Hirano T, Ishii T, Reddel RR, Yun CO, Kaul SC, This article should be referenced as such: Wadhwa R. MicroRNA-296 is enriched in cancer cells and downregulates p21WAF1 mRNA expression via interaction Verdelli C, Corbetta S. MIR296 (microRNA 296). Atlas Genet with its 3' untranslated region. Nucleic Acids Res. 2011 Cytogenet Oncol Haematol. 2014; 18(2):102-105. Oct;39(18):8078-91

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 105 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

PIAS1 (protein inhibitor of activated STAT, 1) Andrea Rabellino, Pier Paolo Scaglioni Division of Hematology and Oncology and Simmons Cancer Center, University of Texas Southwestern Medical Center, Dallas, TX, USA (AR, PPS)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/PIAS1ID45688ch15q23.html DOI: 10.4267/2042/53083 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract approximately 134,8 kb of genomic DNA. Review on PIAS1, with data on DNA/RNA, on the Transcription protein encoded and where the gene is implicated. PIAS1 gene encodes a 2309 bp mRNA transcript. Identity Pseudogene Other names: DDXBP1, GBP, GU/RH-II, ZMIZ3 No pseudogenes have been reported. HGNC (Hugo): PIAS1 Location: 15q23 Protein Description The human PIAS1 protein is composed of 651 amino acids, with a predicted molecular weight of 71,85 kDa. PIAS1 has five distinct functional domains, with different functions: the SAP (scaffold attachment factor-A/B, Acinus and PIAS), the PINIT motif, the RING-type zinc-binding domain, the SBD (SUMO binding domain, also indicated as SIM, SUMO interacting motif) and a C-terminal serine/threonine rich region. The SAP domain contains a LXXLL motif which is involved in direct-DNA binding or in physical Chromosomal mapping of PIAS1. Modified from Weiskirchen interaction with other proteins involved in DNA- et al., 2001. binding, such as transcription factors, co-regulators and Note nuclear receptors (Aravind and Koonin, 2000). PIAS1 gene was initially located at 15q22 The PINIT motif is involved in the sub-cellular (Weiskirchen et al., 2001). organization of PIAS1 (Duval et al., 2003). The RING domain is essential for the E3 SUMO-ligase DNA/RNA activity of PIAS1 and also mediates protein-protein interactions (Hochstrasser, 2001). Description The SBD domain interact in a non-covalently way with PIAS1 gene is composed of 14 exons and spans SUMO proteins (Rytinki et al., 2009).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 106 PIAS1 (protein inhibitor of activated STAT, 1) Rabellino A, Scaglioni PP

Structural organization of PIAS1 human gene.

Schematic representation of PIAS1 protein. The different domains are illustrated. A purple square represents the SUMO binding domain (SBD).

The C-terminal portion of PIAS1 is a serine/threonine Inflammation and immunity: upon various rich region: this is the most variable region within the inflammatory stimuli, IKKa phosphorylates PIAS1 PIAS proteins family. PIAS1 undergoes several post- associating it with the promoter of NF-κB target genes translational modifications, including phosphorylation, (Liu et al., 2007). acetylation, methylation, SUMOylation and PIAS1 regulates the natural T regulatory cells by ubiquitination (Liu et al., 2005; Depaux et al., 2007; restricting their differentiation through the recruitment Rytinki et al., 2009; Stehmeier and Muller, 2009; of the protein DNA-methyltransferase and CBX5 at the Weber et al., 2009). FOXP3 promoter (Liu et al., 2010). Expression DNA damage: PIAS1 co-operates with PIAS4 promoting double-strand DNA breaks repair (Galanty PIAS1 is ubiquitously expressed. et al., 2009). Localisation Cancer: PIAS1 SUMOylates the promyelocytic leukemia (PML) gene and promotes its Nuclear. ubiquitin/proteasome-dependent degradation, inhibiting Function its tumor suppressor functions. PIAS1 also SUMOylates the PML-RARA oncoprotein of acute PIAS1 has been implicated in several cellular functions promyelocytic leukemia (APL); in this case, PIAS1- and most of them have been associated to its SUMO dependent SUMOylation is required for the E3-ligase activity (Schimdt and Müller, 2003; Shuai degradation of PML-RARA in APL cells treated with and Liu, 2005; Rytinki et al., 2009). arsenic trioxide (Rabellino et al., 2012). Transcriptional regulation: PIAS1 is a negative regulator of several transcription factors. PIAS1 was Homology initially described as a negative regulator of the STAT1 PIAS1 belongs to the PIAS proteins family and is signal by blocking the DNA-binding activity of STAT1 evolutionary conserved from yeast to man. PIAS1 can (Liu et al., 1998). PIAS1 SUMOylates the TP53 tumor be found in Saccharomyces cerevisiae, in plants suppressor, inhibiting its activity (Kahyo et al., 2001; (Arabidopis thaliana and Oryza sativa), Schmidt and Müller, 2002). PIAS1 SUMOylates the Caernorhabditis elegans, Drosophila melanogaster, androgen receptor (AR) repressing the AR-dependent Danio renio, Xenopus laevis, Gallus gallus and transcription (Nishida and Yasuda, 2002). PIAS1 also mammals. All PIAS1 orthologues share a high degree regulates the homeoprotein Msx1 by regulating its of homology. subnuclear localization and its DNA-binding The human PIAS family consists of at least 5 different specificity in a SUMO E3-ligase independent manner members: PIAS1, PIAS2 (with two variants called (Lee et al., 2006). PIAS1 SUMOylates the PIASx α and PIASx β), PIAS3 and PIAS4 (also known progesterone receptor (PR), and cAMP attenuates as PIASy). All family members share high protein ligand-dependent SUMOylation of PR (Jones et al., homology, except for the C-terminus (Shuai and Liu, 2006). 2005; Rytinki et al., 2009).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 107 PIAS1 (protein inhibitor of activated STAT, 1) Rabellino A, Scaglioni PP

Schematic representation of the mutations of human PIAS1 protein found in tumor samples. Notably, most of the mutations reside in the PINIT domain.

Furthermore, high expression of mRNA levels of Mutations PIAS1 in NSCLC specimens correlates with PIAS1 Note gene amplification (Rabellino et al., 2012). No translocations involving PIAS1 gene have been reported so far. Breakpoints Germinal Note No germinal mutations of PIAS1 have been reported. None. Somatic References At least 25 different somatic mutations have been Liu B, Liao J, Rao X, Kushner SA, Chung CD, Chang DD, described in different tumor types. All the informations Shuai K. Inhibition of Stat1-mediated gene activation by PIAS1. in this regard can be found at the COSMIC website. Proc Natl Acad Sci U S A. 1998 Sep 1;95(18):10626-31 Aravind L, Koonin EV. SAP - a putative DNA-binding motif Implicated in involved in chromosomal organization. Trends Biochem Sci. 2000 Mar;25(3):112-4 Prostate cancer Hochstrasser M. SP-RING for SUMO: new functions bloom for Note a ubiquitin-like protein. Cell. 2001 Oct 5;107(1):5-8 High expression of PIAS1 is found in malignant areas Kahyo T, Nishida T, Yasuda H. Involvement of PIAS1 in the of prostate cancer as compared to benign areas. sumoylation of tumor suppressor p53. Mol Cell. 2001 Immunohistochemistry staining positively correlates Sep;8(3):713-8 with positive staining for the PCNA and Ki-67 Weiskirchen R, Moser M, Weiskirchen S, Erdel M, Dahmen S, proliferative markers suggesting a pro-proliferative role Buettner R, Gressner AM. LIM-domain protein cysteine- and of PIAS1 in prostate cancer (Hoefer, 2012). glycine-rich protein 2 (CRP2) is a novel marker of hepatic stellate cells and binding partner of the protein inhibitor of Colon cancer activated STAT1. Biochem J. 2001 Nov 1;359(Pt 3):485-96 Note Nishida T, Yasuda H. PIAS1 and PIASxalpha function as Activated STAT3 signaling has been involved in colon SUMO-E3 ligases toward androgen receptor and repress androgen receptor-dependent transcription. J Biol Chem. 2002 cancer. PIAS1 is a negative regulator of the STAT Nov 1;277(44):41311-7 signaling. Accordingly, PIAS1 expression is high in colonic non-tumor cells and adenomas, and lower in Schmidt D, Müller S. Members of the PIAS family act as SUMO ligases for c-Jun and p53 and repress p53 activity. Proc colon cancer cells (Coppola et al., 2009). Natl Acad Sci U S A. 2002 Mar 5;99(5):2872-7 Gastric cancer Duval D, Duval G, Kedinger C, Poch O, Boeuf H. The 'PINIT' Prognosis motif, of a newly identified conserved domain of the PIAS protein family, is essential for nuclear retention of PIAS3L. One study shows that 70% of the gastric tumors FEBS Lett. 2003 Nov 6;554(1-2):111-8 specimens analyzed show a low level of PIAS1 Schmidt D, Müller S. PIAS/SUMO: new partners in expression. Moreover, the low expression of PIAS1 transcriptional regulation. Cell Mol Life Sci. 2003 significantly correlates with tumor staging (Chen et al., Dec;60(12):2561-74 2012). Liu B, Yang R, Wong KA, Getman C, Stein N, Teitell MA, Non-small cell lung cancer (NSCLC) Cheng G, Wu H, Shuai K. Negative regulation of NF-kappaB signaling by PIAS1. Mol Cell Biol. 2005 Feb;25(3):1113-23 Note Shuai K, Liu B. Regulation of gene-activation pathways by PIAS1-dependent SUMOylation of PML leads to its PIAS proteins in the immune system. Nat Rev Immunol. 2005 degradation, blocking the tumor suppression activity of Aug;5(8):593-605 PML. Accordingly with this observation obtained with Jones MC, Fusi L, Higham JH, Abdel-Hafiz H, Horwitz KB, in vitro experiments, a correlation between high level Lam EW, Brosens JJ. Regulation of the SUMO pathway of PIAS1 protein expression and low level of PML was sensitizes differentiating human endometrial stromal cells to reported in NSCLC specimens. progesterone. Proc Natl Acad Sci U S A. 2006 Oct 31;103(44):16272-7

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 108 PIAS1 (protein inhibitor of activated STAT, 1) Rabellino A, Scaglioni PP

Lee H, Quinn JC, Prasanth KV, Swiss VA, Economides KD, Weber S, Maass F, Schuemann M, Krause E, Suske G, Bauer Camacho MM, Spector DL, Abate-Shen C. PIAS1 confers UM. PRMT1-mediated arginine methylation of PIAS1 regulates DNA-binding specificity on the Msx1 homeoprotein. Genes STAT1 signaling. Genes Dev. 2009 Jan 1;23(1):118-32 Dev. 2006 Apr 1;20(7):784-94 Liu B, Tahk S, Yee KM, Fan G, Shuai K. The ligase PIAS1 Depaux A, Regnier-Ricard F, Germani A, Varin-Blank N. A restricts natural regulatory T cell differentiation by epigenetic crosstalk between hSiah2 and Pias E3-ligases modulates repression. Science. 2010 Oct 22;330(6003):521-5 Pias-dependent activation. Oncogene. 2007 Oct 11;26(46):6665-76 Chen P, Zhao D, Sun Y, Huang L, Zhang S, Yuan Y. Protein inhibitor of activated STAT-1 is downregulated in gastric Liu B, Yang Y, Chernishof V, Loo RR, Jang H, Tahk S, Yang cancer tissue and involved in cell metastasis. Oncol Rep. 2012 R, Mink S, Shultz D, Bellone CJ, Loo JA, Shuai K. Dec;28(6):2149-55 Proinflammatory stimuli induce IKKalpha-mediated phosphorylation of PIAS1 to restrict inflammation and Hoefer J, Schäfer G, Klocker H, Erb HH, Mills IG, Hengst L, immunity. Cell. 2007 Jun 1;129(5):903-14 Puhr M, Culig Z. PIAS1 is increased in human prostate cancer and enhances proliferation through inhibition of p21. Am J Coppola D, Parikh V, Boulware D, Blanck G. Substantially Pathol. 2012 May;180(5):2097-107 reduced expression of PIAS1 is associated with colon cancer development. J Cancer Res Clin Oncol. 2009 Rabellino A, Carter B, Konstantinidou G, Wu SY, Rimessi A, Sep;135(9):1287-91 Byers LA, Heymach JV, Girard L, Chiang CM, Teruya- Feldstein J, Scaglioni PP. The SUMO E3-ligase PIAS1 Galanty Y, Belotserkovskaya R, Coates J, Polo S, Miller KM, regulates the tumor suppressor PML and its oncogenic Jackson SP. Mammalian SUMO E3-ligases PIAS1 and PIAS4 counterpart PML-RARA. Cancer Res. 2012 May 1;72(9):2275-84 promote responses to DNA double-strand breaks. Nature. 2009 Dec 17;462(7275):935-9 This article should be referenced as such: Rytinki MM, Kaikkonen S, Pehkonen P, Jääskeläinen T, Rabellino A, Scaglioni PP. PIAS1 (protein inhibitor of activated Palvimo JJ. PIAS proteins: pleiotropic interactors associated STAT, 1). Atlas Genet Cytogenet Oncol Haematol. 2014; with SUMO. Cell Mol Life Sci. 2009 Sep;66(18):3029-41 18(2):106-109. Stehmeier P, Muller S. Phospho-regulated SUMO interaction modules connect the SUMO system to CK2 signaling. Mol Cell. 2009 Feb 13;33(3):400-9

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 109 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

PRUNE (prune exopolyphosphatase) Massimo Zollo Department of Molecular Medicine and Medical Biotechnology, Federico II, Naples, Italy and CEINGE, Biotecnologie Avanzate, Naples, Italy (MZ)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/PRUNEID40895ch1q21.html DOI : 10.4267/2042/53084 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Protein Short communication on PRUNE, with data on Description DNA/RNA, on the protein encoded and where the gene Prune, a 62 kDa protein, belongs to the DHH family is implicated. phosphoesterase proteins including RecJ DNA repair exonucleases, pyrophosphatases (PPASEs) and Identity exopolyphospatases (PPX). The DHH super-family can Other names: DRES-17, DRES17, HTCD37 be divided into two main groups on the basis of a C- terminal motif that is very well conserved within each HGNC (Hugo): PRUNE group, but not across the groups. All the members of Location: 1q21.3 this super-family possess four other motifs that contain Note highly conserved charged residues predicted to be Prune stands for the human homologue of the responsible for binding ions and catalyzing the Drosophila prune gene. Prune protein was initially phosphoesterase reaction. The most characteristic of identified in Drosophila, in which its mutation caused a these is the third motif, with the signature DHH (Asp- brownish-purple "prune" eye color due to significant His-His), after which this superfamily was named. loss of drosopterins "red pigments", compared to the Prune is a cyclic nucleotides phosphodiesterase. Due to bright red eye of the wild-type fly, thus explaining its its protein similarities, Prune might possess other mutant name. Then the human homologue gene was biochemical functionalities within the DHH family of identified (the human clone, DRES17). proteins. The region between amino acids 353-370 of the h- DNA/RNA Prune C-terminal is part of the h-Prune DHH2 domain, and in particular constitutes the second part of the last Description helix and a turned region that interacts with the The prune gene is approximately 1,4 kb in length, preceding helix; accordingly, this region in the h-Prune consisting of 8 exons and 7 introns. C-terminal has a clear helical propensity. Therefore, Transcription the IDP h-Prune C-terminal domain that does not have specific interactions with the globular portions of the 11 transcripts. whole protein begins at residue 371 and retains the Pseudogene secondary structure propensities ( α2 and α3) indicated A Prune pseudogene, missing exon 4, is located in the by the NMR analysis, with a more compact C-terminal 13q12 chromosomal region (acc. no. AF126025) region (amino acids 410-440) (Carotenuto et al., 2013). (Reymond et al., 1999).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 110 PRUNE (prune exopolyphosphatase) Zollo M

Expression Brain development H-prune overexpression in breast, colorectal and Note gastric cancers correlates with the degree of lymph- Interestingly, Prune has also been shown to be highly node and distant metastases. expressed in brain development together with nm23- Localisation H1, expression was observed in cortex, hippocampus, midbrain and during cerebellum development. Prune is localized intracellularly to the cytoplasm. Function References Prune has a role in the metastatic processes through Banfi S, Borsani G, Rossi E, Bernard L, Guffanti A, Rubboli F, specific inhibition of the anti-metastasis function of Marchitiello A, Giglio S, Coluccia E, Zollo M, Zuffardi O, nm23-H1 in vivo. Ballabio A. Identification and mapping of human cDNAs homologous to Drosophila mutant genes through EST Acting as a cytoplasmic cyclic nucleotides database searching. Nat Genet. 1996 Jun;13(2):167-74 phosphodiesterases (cNMP-PDE), Prune is involved in both promoting cellular mobility and stimulating Reymond A, Volorio S, Merla G, Al-Maghtheh M, Zuffardi O, Bulfone A, Ballabio A, Zollo M. Evidence for interaction expression of genes involved in metastatic pathways. between human PRUNE and nm23-H1 NDPKinase. An additional function has being discovered linking to Oncogene. 1999 Dec 2;18(51):7244-52 the first mammalian exopolyphosphatase activity D'Angelo A, Garzia L, André A, Carotenuto P, Aglio V, homologue protein, by degrading Poly-P in the Guardiola O, Arrigoni G, Cossu A, Palmieri G, Aravind L, Zollo cytoplasm, as a source of energy within the cell. M. Prune cAMP phosphodiesterase binds nm23-H1 and promotes cancer metastasis. Cancer Cell. 2004 Feb;5(2):137- Homology 49 The PRUNE gene is conserved in Rhesus monkey, D'Angelo A, Zollo M. Unraveling genes and pathways dog, cow, mouse, rat, chicken, zebrafish, fruit fly, influenced by H-prune PDE overexpression: a model to study mosquito, S. cerevisiae, K. lactis, E. gossypii, S. cellular motility. Cell Cycle. 2004 Jun;3(6):758-61 pombe, M. oryzae, and N. crassa. Zollo M, Andrè A, Cossu A, Sini MC, D'Angelo A, Marino N, Budroni M, Tanda F, Arrigoni G, Palmieri G. Overexpression of h-prune in breast cancer is correlated with advanced disease Implicated in status. Clin Cancer Res. 2005 Jan 1;11(1):199-205 Various cancers Kobayashi T, Hino S, Oue N, Asahara T, Zollo M, Yasui W, Kikuchi A. Glycogen synthase kinase 3 and h-prune regulate Note cell migration by modulating focal adhesions. Mol Cell Biol. Prune participates in the complex network of 2006 Feb;26(3):898-911 interactions with proteins involved in cell cycle and Garzia L, D'Angelo A, Amoresano A, Knauer SK, Cirulli C, cell motility. Campanella C, Stauber RH, Steegborn C, Iolascon A, Zollo M. It is known that: (i) Prune together with glycogen Phosphorylation of nm23-H1 by CKI induces its complex synthase kinase-3 (GSK3 β), a kinase involved in WNT formation with h-prune and promotes cell motility. Oncogene. signaling pathway, cooperatively regulates the 2008 Mar 20;27(13):1853-64 disassembly of focal adhesions to promote cell Tammenkoski M, Koivula K, Cusanelli E, Zollo M, Steegborn migration; (ii) Prune via interaction with Gelsolin, an C, Baykov AA, Lahti R. Human metastasis regulator protein H- prune is a short-chain exopolyphosphatase. Biochemistry. ATP-severing protein acting in focal adhesions, leads 2008 Sep 9;47(36):9707-13 to invasive properties for cancer cells. (iii) the h-prune interaction with NM23 in breast cells results in an Galasso A, Zollo M. The Nm23-H1-h-Prune complex in cellular physiology: a 'tip of the iceberg' protein network perspective. increase in h-prune PDE activity, thus inducing Mol Cell Biochem. 2009 Sep;329(1-2):149-59 negative regulation of nm23-H1 antimetastatic Virgilio A, Spano D, Esposito V, Di Dato V, Citarella G, Marino function. N, Maffia V, De Martino D, De Antonellis P, Galeone A, Zollo Colorectal and gastric cancers M. Novel pyrimidopyrimidine derivatives for inhibition of cellular proliferation and motility induced by h-prune in breast cancer. Note Eur J Med Chem. 2012 Nov;57:41-50 H-Prune overexpression correlates with T and N stages Carotenuto M, Pedone E, Diana D et al.. Neuroblastoma in colorectal cancer and its expression is an tumorigenesis is regulated through the Nm23-H1/h-Prune C- independent predictor of survival of patients with terminal interaction. Sci Rep. 2013;3:1351 gastric cancer. This article should be referenced as such: Breast cancer Zollo M. PRUNE (prune exopolyphosphatase). Atlas Genet Note Cytogenet Oncol Haematol. 2014; 18(2):110-111. In breast carcinoma, the overexpression of h-prune is accociated with lymph node status and metastasis formation.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 111 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

RNF11 (ring finger protein 11) Elena Santonico, Anna Mattioni, Alberto Calderone Department of Biology, University of Rome Tor Vergata, Rome, Italy (ES, AM, AC)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/RNF11ID44143ch1p32.html DOI: 10.4267/2042/53085 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

human chromosome 1p32.3, plus strand. Unigene Abstract cluster Hs.309641, Entrez Gene ID: 26994. The human Review on RNF11, with data on DNA/RNA, on the RNF11 gene is located in a genomic region where protein encoded and where the gene is implicated. frequent alterations, deletions and chromosomal translocations, have been observed in T-cell acute Identity lymphoblastic leukemia (Raimondi, 1993; Seki et al., 1999). Other names: SID1669 Description HGNC (Hugo): RNF11 In humans, RNF11, the gene coding for RNF11, is Location: 1p32.3 located on human chromosome 1p32.3. The coding Local order: According to NCBI Map Viewer, RNF11 sequence spans more than 37 kb of genomic DNA, in gene is located between: C1orf185 (chromosome 1 the telomere-to-centromere orientation. open reading frame 185), CFL1P2 (cofilin1 pseudogene 2) (in telomeric position); LOC100422413, Transcription EPS15 (epidermal growth factor receptor pathway The coding region of RNF11 is subdivided in 3 exons substrate 15) TTC39A (tetratricopeptide repeat domain and includes additional 0,5 and 2,2 kb of 5' and 3' UTR 39A) (in centromeric position); the RPS2P8 (ribosomal regions, respectively. The open reading frame includes protein S2 pseudogene 8) sequence maps to the minus 465 bp and codes for a protein of 154 amino acids. A strand of the RNF11 gene in opposite transcriptional very rare transcript encoding a sequence lacking exon 2 orientation. has been identified (Kitching et al., 2003). RNA is expressed at low levels in lung, liver, kidney, pancreas, DNA/RNA colon, spleen, prostate, thymus, ovary, small intestine and peripheral blood lymphocytes; stronger expression Note is observed in testes, heart, brain and placenta, while According to NCBI Map Viewer, RNF11 gene is the highest level of RNF11 mRNA is in the skeletal located at 51701945 - 51739119 (37175 bp) in muscle (Kitching et al., 2003).

Analysis of the RNF11 genomic context. Adapted from NCBI.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 112 RNF11 (ring finger protein 11) Santonico E, et al.

DNA diagram of RNF11 gene. RNF11, Gene ID: 26994, chr: 51701945-51739119. Three exons.

Cartoon representation of domain organization of RNF11. The WW-binding motif (PPPY) and the RING domain are shown. The asterisks (*) represent the acylated residues, Gly2 and Cys4 respectively.

In tumor cell lines the strongest expression of the mediate protein-protein interactions involved in RNF11 transcript was reported in LnCAP prostate and ubiquitin-mediated pathways. RNF11 interacts with the HTB126 breast tumor cells (Kitching et al., 2003). In WW domains of the E3 ubiquitin-ligases NEDD4, human brain RNF11 mRNA is detectable at similar ITCH, SMURF2 and WWP1 and it's ubiquitinated by levels in frontal cortex, striatum, hippocampus, pons Itch, Smurf2, UBE2D1 and WWP1 (Connor and Seth, and medulla (Pranski et al., 2012b). A functional 2004; Santonico et al., 2010; Scheper et al., 2009; consensus Ets1 transcription factor binding site (EBS) Subramaniam et al., 2003). The mature protein is is conserved in the human and mouse RNF11 promoter anchored to intracellular membranes of the early and data suggest a role of Ets1 factor in RNF11 endosome and the endosome recycling compartments expression during embryonic bone formation (Gao et (Santonico et al., 2010). Membrane binding requires al., 2005). The presence of a miR-19 target site in 3' two acylation motifs driving the myristoylation of Gly2 UTR of RNF11 mRNA has been reported. Moreover, it and the S-palmitoylation of Cys4. Membrane has been demonstrated that miR-19b levels are anchoring via acylation is necessary in order for inversely related with endogenous RNF11 mRNA RNF11 to be post-translationally modified by the levels (Gantier et al., 2012; Kumps et al., 2013), clearly addition of several ubiquitin moieties (Santonico et al., indicating an important role for RNF11 in the effect of 2010). Four serine (Ser) residues have been identified miR-19b on NF-κB signaling. as murine RNF11 phosphorylation sites (Ser7, Ser14, Pseudogene Ser25, Ser54) with differences between different tissues (Phosphomouse database). RNF11 is also No human pseudogene for RNF11 has been identified. phosphorylated on Threonine 135 by PKB/AKT1, promoting degradation by the proteasome (Connor et Protein al., 2005). Description Expression The RNF11 gene encodes for a 154 amino acid 17444 The expression of this gene has been shown to be kDa protein (Uniprot Q9Y3C5) that is ubiquitously induced by mutant RET proteins (MEN2A/MEN2B). expressed in human tissues. RNF11 amino acid The germline mutations in RET gene are known to be sequence is strongly evolutionarily conserved. It responsible for the development of multiple endocrine contains a WW domain binding PPPY motif and a neoplasia (MEN). The expression of RNF11 was also carboxy-terminal RING-H2 domain (C3H2C3-type induced in TGW human neuroblastoma cells in RING finger), a variant RING finger motif carrying response to glial cell line-derived neurotrophic factor two histidines in place of cysteines. It binds two zinc stimulation (Watanabe et al., 2002). RNF11 is atoms. The PY motif and the RING-H2 domain overexpressed in invasive breast cancers, in

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 113 RNF11 (ring finger protein 11) Santonico E, et al.

adenocarcinomas of the pancreas, colon cancer and in compartment, by interacting with SARA and Hrs, both bladder tumors (Subramaniam et al., 2003). Intense reported to be regulators of endocytic trafficking, on RNF11 expression was observed in osteoblasts in the early-, late- and recycling endosome compartments. mandible, calvarial bones and in the periosteal layer of Data demonstrate that RNF11 and SARA participate developing endochondral bones of mouse embrios, structurally and functionally in the ESCRT-dependent while was undetectable in cartilage tissue at any stage lysosomal degradation of EGF receptor (Kostaras et al., of development. The expression of both the RNF11 2012). mRNA and protein was higher in the immature osteoblast than in the mature osteoblast (Gao et al., Mutations 2005). RNF11 is variably expressed in neurons and excluded from white matter (Anderson et al., 2007). Note An A to G transition (c124-2A>G) mutating the intron Localisation 1 acceptor splice site of the RNF11 gene has been RNF11 is primarly cytoplasmic (early endosome, identified in bovine RNF11 gene. The RNA product recycling endosome). Nuclear localization has been corresponds to a transcript skipping exon 2 and with a detected following phosphorylation by PKB/AKT1 frameshift appending illegitimate residues. The protein (Connor et al., 2005). The intracellular localization is product is severely truncated (41/154 amino acids) and dependent on the interaction of RNF11 with the GGA misses the RING-finger domain (Sartelet et al., 2012). protein family of clathrin adaptors, involving the recognition of an N-terminal di-leucine motif in Implicated in RNF11 by the VHS domain of GGA1 (Santonico et al., 2010). Various cancers Function Note RNF11 is overexpressed in invasive breast cancers, in Belongs to the RING E3-ligase protein family. RNF11 adenocarcinomas of the pancreas, colon cancer and in interacts with UbcH5 a, b and c, and with Smurf2. The bladder tumors (Burger et al., 2006; Subramaniam et interaction causes ubiquitination of both RNF11 and al., 2003). Smurf2. RNF11 bound to Smurf2 can prevent Smurf2- mediated ubiquitination of the TGFbeta receptor (Azmi Breast cancer and Seth, 2005); accordingly, the overexpression of Note RNF11 in transfected tumor cells can restore TGFbeta A direct involvement of RNF11 in oncogenesis has not responsiveness (Subramaniam et al., 2003) while been clearly established. Nevertheless, it has been RNF11 knock-down abrogates the TGFbeta signal shown that RNF11 competes with Smad7 in the (Colland et al., 2004). RNF11 directly enhances TGF- interaction with Smurf2. Smurf2/Smad7 complex beta signalling by binding Smad4, the common Smad ubiquitinates T βRI leading to degradation of the for TGF-beta, activin and BMP signalling and receptor and TGF β resistance in cancer cells, thus the increasing and/or stabilizing Smad4 steady-state levels interaction of RNF11 with Smurf2 could be important (Azmi and Seth, 2009). RNF11 binds WWP1, to restore TGF β signalling. Furthermore, RNF11 also interfering with its function, and it cooperates with directly interacts with Smad4 and enhances its trans- Smurf2 to degrade the de-ubiquitinating enzyme activation potential (Azmi and Seth, 2005). AMSH thus up-regulating EGFR and TGF-beta On the other side, it has also been suggested that signalling (Chen et al., 2008; Li and Seth, 2004). RNF11 could stimulate the positive effects of the RNF11 is an essential component of the A20 ubiquitin- TGF β signalling on later tumor progression and editing complex, comprising also RIP1, ITCH and metastasis (Subramaniam et al., 2003). Other evidences TAX1BP1, which ensures the transient nature of of a putative function of RNF11 in oncogenesis come inflammatory signaling pathways (Jacque and Ley, from the observation that RNF11 interacts with several 2009; Shembade et al., 2009; Verstrepen et al., 2010). proteins, such as E3 ubiquitin ligases and RNF11 promotes the association of A20 to RIP1 in a deubiquitinating enzymes, that are involved in TNF-dependent manner, leading to the inactivation of oncogenesis. Among them, AMSH (associated key signaling molecules. A20 deubiquitinates 'Lys-63' moleculate with the SH3 domain of STAM) interacts polyubiquitin chains on RIP1 and catalyzes the with RNF11 and has been shown to upregulate BMP/ formation of 'Lys-48'-polyubiquitin chains. This leads TGF β signalling pathway by binding to Smad6 and to RIP1 proteosomal degradation and consequently Smad7. The interaction with RNF11 promotes AMSH termination of the TNF- or LPS-mediated activation of degradation, probably mediated by Smurf2/RNF11 NF-kappa-B (Jacque and Ley, 2009; Shembade et al., complex and therefore abrogates the positive effects of 2009). RNF11 has been shown to be involved in the AMSH on TGF β signalling, leading to cell regulation of EGFR degradation in the lysosomal proliferation and malignant progression.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 114 RNF11 (ring finger protein 11) Santonico E, et al.

The RNF11 human interactome. RNF11 is involved in direct/enzymatic or indirect interactions with several proteins. The RNF11 human interactome is drawn according to MINT database. RNF11 interactors are clustered according to common biological function. The table below shows the Uniprot code and protein name of each RNF11 binding partner in the interaction network and the PubMed identifier(PMID) describing the interaction. The interactome browser mentha has been used to obtain the graphical representation (mentha: a resource to browse integrated protein interaction networks. In press; http://mentha.uniroma2.it/browser/index.html?ids=Q9Y3C5&org=9606).

Parkinson's disease (PD) the reduced expression of RNF11 or the expression of functionally compromised mutants suggest that RNF11 Note may have a role in neurodegenerative disease The gene RNF11 is contained within PARK10 and pathogenesis and progression. produced a signal of altered expression in PD brains (Noureddine et al., 2005). Moreover, in Parkinson Alzheimer disease disease, RNF11 is sequestered in Lewy bodies and Note neuritis. RNF11 is expressed by vulnerable neurons of RNF11 is sequestered in Lewy bodies in human brains the substantia nigra and it is involved in the protein with Alzheimer disease with Lewy pathology. degradation pathway mediated by the ubiquitin- Regulation of the inflammatory proteasome system (UPS), which has been repeatedly suggested as relevant in the etiology of PD (Anderson response et al., 2007). RNF11 has been shown to modulate NF- Note κB signaling in neuroblastoma cells and in primary The splice site variant caused by the A to G transition cortical neurons, indicating a critical role in the c124-2A>G has been shown to compromise growth regulation of regulating the inflammatory signaling in and regulation of the inflammatory response in Belgian the central nervous system. Accordingly, depletion of Blue Cattle (Sartelet et al., 2012). RNF11 has been RNF11 increases production of the inflammatory shown to negatively regulate NF-κB signaling in cytokine MCP-1 following TNF-α; activation, resulting human monocytic cell lines by interacting with the A20 in aberrant regulation of inflammatory signaling ubiquitin-editing complex. Accordingly, depletion of (Pranski et al., 2012a). Moreover, RNF11 has been RNF11 causes aberrant regulation of inflammatory shown to be a negative regulator of NF-κB signaling in signaling (Shembade et al., 2009). Endogenous RNF11 microglial cell lines and confers protection against mRNA levels have been reported to be inversely LPS-induced cell cytotoxicity (Dalal et al., 2012). related with miR-19b levels (Gantier et al., 2012; Finally, loss of RNF11-mediated inhibition of NF-κB Kumps et al., 2013), clearly indicating an important signaling in dopaminergic cells is protective against 6- role for RNF11 in the effect of miR-19b on NF-κB OHDA toxicity and promotes neuronal survival signaling. Finally, RNF11 has been shown to act as (Pranski et al., 2013). The effects observed following

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 115 RNF11 (ring finger protein 11) Santonico E, et al.

negative regulator of the RIG-I/MDA5 pathway and Azmi PB, Seth AK. The RING finger protein11 binds to Smad4 virus-induced IFN-beta production and enhances Smad4-dependant TGF-beta signalling. Anticancer Res. 2009 Jun;29(6):2253-63 (Charoenthongtrakul et al., 2013). Jacque E, Ley SC. RNF11, a new piece in the A20 puzzle. References EMBO J. 2009 Mar 4;28(5):455-6 Scheper J, Oliva B, Villà-Freixa J, Thomson TM. Analysis of Raimondi SC. Current status of cytogenetic research in electrostatic contributions to the selectivity of interactions childhood acute lymphoblastic leukemia. Blood. 1993 May between RING-finger domains and ubiquitin-conjugating 1;81(9):2237-51 enzymes. Proteins. 2009 Jan;74(1):92-103 Seki N, Hattori A, Hayashi A, Kozuma S, Sasaki M, Suzuki Y, Shembade N, Parvatiyar K, Harhaj NS, Harhaj EW. The Sugano S, Muramatsu MA, Saito T. Cloning and expression ubiquitin-editing enzyme A20 requires RNF11 to downregulate profile of mouse and human genes, Rnf11/RNF11, encoding a NF-kappaB signalling. EMBO J. 2009 Mar 4;28(5):513-22 novel RING-H2 finger protein. Biochim Biophys Acta. 1999 Dec 23;1489(2-3):421-7 Santonico E, Belleudi F, Panni S, Torrisi MR, Cesareni G, Castagnoli L. Multiple modification and protein interaction Watanabe T, Ichihara M, Hashimoto M et al.. Characterization signals drive the Ring finger protein 11 (RNF11) E3 ligase to of gene expression induced by RET with MEN2A or MEN2B the endosomal compartment. Oncogene. 2010 Oct mutation. Am J Pathol. 2002 Jul;161(1):249-56 14;29(41):5604-18 Kitching R, Wong MJ, Koehler D, Burger AM, Landberg G, Verstrepen L, Verhelst K, van Loo G, Carpentier I, Ley SC, Gish G, Seth A. The RING-H2 protein RNF11 is differentially Beyaert R. Expression, biological activities and mechanisms of expressed in breast tumours and interacts with HECT-type E3 action of A20 (TNFAIP3). Biochem Pharmacol. 2010 Dec ligases. Biochim Biophys Acta. 2003 Oct 15;1639(2):104-12 15;80(12):2009-20 Subramaniam V, Li H, Wong M, Kitching R, Attisano L, Wrana Dalal NV, Pranski EL, Tansey MG, Lah JJ, Levey AI, Betarbet J, Zubovits J, Burger AM, Seth A. The RING-H2 protein RS. RNF11 modulates microglia activation through NF-κB RNF11 is overexpressed in breast cancer and is a target of signalling cascade. Neurosci Lett. 2012 Oct 24;528(2):174-9 Smurf2 E3 ligase. Br J Cancer. 2003 Oct 20;89(8):1538-44 Gantier MP, Stunden HJ, McCoy CE, Behlke MA et al.. A miR- Colland F, Jacq X, Trouplin V, Mougin C, Groizeleau C, 19 regulon that controls NF-κB signaling. Nucleic Acids Res. Hamburger A, Meil A, Wojcik J, Legrain P, Gauthier JM. 2012 Sep;40(16):8048-58 Functional proteomics mapping of a human signaling pathway. Genome Res. 2004 Jul;14(7):1324-32 Kostaras E, Sflomos G, Pedersen NM, Stenmark H, Fotsis T, Murphy C. SARA and RNF11 interact with each other and Connor MK, Seth A. A central role for the ring finger protein ESCRT-0 core proteins and regulate degradative EGFR RNF11 in ubiquitin-mediated proteolysis via interactions with trafficking. Oncogene. 2013 Oct 31;32(44):5220-32 E2s and E3s. Oncogene. 2004 Mar 15;23(11):2089-95 Pranski EL, Dalal NV, Herskowitz JH, Orr AL, Roesch LA, Fritz Li H, Seth A. An RNF11: Smurf2 complex mediates JJ, Heilman C, Lah JJ, Levey AI, Betarbet RS. Neuronal RING ubiquitination of the AMSH protein. Oncogene. 2004 Mar finger protein 11 (RNF11) regulates canonical NF-κB signaling. 11;23(10):1801-8 J Neuroinflammation. 2012a Apr 16;9:67 Azmi P, Seth A. RNF11 is a multifunctional modulator of Pranski EL, Van Sanford CD, Dalal NV, Orr AL, Karmali D, growth factor receptor signalling and transcriptional regulation. Cooper DS, Costa N, Heilman CJ, Gearing M, Lah JJ, Levey Eur J Cancer. 2005 Nov;41(16):2549-60 AI, Betarbet RS. Comparative distribution of protein Connor MK, Azmi PB, Subramaniam V, Li H, Seth A. components of the A20 ubiquitin-editing complex in normal Molecular characterization of ring finger protein 11. Mol Cancer human brain. Neurosci Lett. 2012b Jun 27;520(1):104-9 Res. 2005 Aug;3(8):453-61 Sartelet A, Druet T, Michaux C, Fasquelle C, Géron S, Tamma Gao Y, Ganss BW, Wang H, Kitching RE, Seth A. The RING N, Zhang Z, Coppieters W, Georges M, Charlier C. A splice finger protein RNF11 is expressed in bone cells during site variant in the bovine RNF11 gene compromises growth osteogenesis and is regulated by Ets1. Exp Cell Res. 2005 and regulation of the inflammatory response. PLoS Genet. Mar 10;304(1):127-35 2012;8(3):e1002581 Noureddine MA, Li YJ, van der Walt JM et al.. Genomic Charoenthongtrakul S, Gao L, Parvatiyar K, Lee D, Harhaj EW. convergence to identify candidate genes for Parkinson RING finger protein 11 targets TBK1/IKKi kinases to inhibit disease: SAGE analysis of the substantia nigra. Mov Disord. antiviral signaling. PLoS One. 2013;8(1):e53717 2005 Oct;20(10):1299-309 Kumps C, Fieuw A, Mestdagh P, Menten B et al.. Focal DNA Burger A, Amemiya Y, Kitching R, Seth AK. Novel RING E3 copy number changes in neuroblastoma target MYCN ubiquitin ligases in breast cancer. Neoplasia. 2006 regulated genes. PLoS One. 2013;8(1):e52321 Aug;8(8):689-95 Pranski EL, Dalal NV, Sanford CV, Herskowitz JH, Gearing M, Anderson LR, Betarbet R, Gearing M, Gulcher J, Hicks AA, Lazo C, Miller GW, Lah JJ, Levey AI, Betarbet RS. RING finger Stefánsson K, Lah JJ, Levey AI. PARK10 candidate RNF11 is protein 11 (RNF11) modulates susceptibility to 6-OHDA- expressed by vulnerable neurons and localizes to Lewy bodies induced nigral degeneration and behavioral deficits through in Parkinson disease brain. J Neuropathol Exp Neurol. 2007 NF-κB signaling in dopaminergic cells. Neurobiol Dis. 2013 Oct;66(10):955-64 Jun;54:264-79 Chen C, Zhou Z, Liu R, Li Y, Azmi PB, Seth AK. The WW This article should be referenced as such: domain containing E3 ubiquitin protein ligase 1 upregulates ErbB2 and EGFR through RING finger protein 11. Oncogene. Santonico E, Mattioni A, Calderone A. RNF11 (ring finger 2008 Nov 20;27(54):6845-55 protein 11). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2):112-116.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 116 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

TALDO1 (transaldolase 1) Zachary Oaks, Andras Perl Departments of Medicine, Microbiology, and Immunology, Biochemistry and Molecular Biology, Neuroscience and Physiology, and Pathology, SUNY Upstate Medical University, Syracuse, New York, USA (ZO, AP)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/TALDO1ID50613ch11p15.html DOI: 10.4267/2042/53086 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Size: 17593 bases; Orientation: TALDO1 is on the plus Abstract strand. Short communication on TALDO1, with data on DNA/RNA, on the protein encoded and where the gene Description is implicated. Exons 2 and 3 of TALDO1 contain retrotransposable Identity elements (Banki et al., 1994). Other names: TAL, TAL-H, TALDOR, TALH Transcription HGNC (Hugo): TALDO1 TALDO1 has 8 exons and its mRNA is composed of 1319 bp. Location: 11p15.5 DNA/RNA Pseudogene TALDO1P1 (Transaldolase 1 pseudogene 1). Note Starts at 747432 bp from pter and ends at 765024 bp from pter according to hg19-Feb_2009.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 117 TALDO1 (transaldolase 1) Oaks Z, Perl A

The 3-dimensional structure of transaldolase from Thorell et al., 2000. Image downloaded from http://www.ebi.ac.uk.

From blast of reference proteins (Refseq) against human Transaldolase (NP_006746.1).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 118 TALDO1 (transaldolase 1) Oaks Z, Perl A

deficiency results in the accumulation of Protein sedoheptulose-7-phosphate and polyols. Further studies Description into TAL deficiency determined that the deletion of S171 resulted in a complete loss of enzymatic activity Transaldolase (TAL) is a 337 amino acid protein in the and rapid degradation in the proteasome (Grossman et non-oxidative phase of the pentose phosphate pathway al., 2004). Missense mutations at arginine 192, in (PPP) with a predicted mass of 37.55kDa. TAL has an which the arginine is mutated to either a histidine or α/β barrel and that includes lysine 142 which is cysteine, also results in loss of TAL activity and liver responsible for generating the Schiff base intermediate damage in patients (Verhoeven et al., 2005; Wamelink during sugar phosphate metabolism (Thorell et al.,200). at al., 2008). In addition to liver damage, renal and A mass spectrometry based investigation of the cardiac complications are also present in these patients acetylome identified TAL acetylation at lysines 286, (Verhoeven et al., 2001; Valayannopoulos et al., 2006; 269, 321, 219 (Choudhary et al., 2009). Verhoeven et al., 2005; Wamelink et al., 2008). It has also been proposed that TAL activity may be In a mouse model of TAL deficiency, sperm affected by phosphorylation (Lachaise et al., 2001). dysmotility and subsequent male infertility are present Expression (Perl et al., 2006). Furthermore, TAL deficiency results TALDO1 is ubiquitously expressed, except in in the development of hepatosteatosis, cirrhosis, and erythrocytes. hepatocellular carcinoma in both homozygous TAL knockouts and heterozygous mice relative to C57Bl/6 Localisation wild type mice (Hanczko et al., 2009). Cytosol and nucleus (Colombo et al., 1997). The pathogenic mechanism of liver damage in TAL Function deficiency is linked to depletion of NADPH, oxidative stress, and mitochondrial dysfunction (Perl et al., The reversible reaction carried out by TAL is: erythros- 2011). 4-phosphate+fructose-6-phophateglyceraldehydes-3- In TAL deficiency, it has been proposed that oxidative phosphate+sedoheptulose-7-phosphate. TAL has been stress is exacerbated by increased aldose reductase proposed as the rate limiting enzyme in the non- activity which generates polyols and depletes NADPH oxidative PPP (Banki et al., 1996; Heinrich et al., 1976; (Perl et al., 2011). Low NADPH diminishes the cells Perl, 2007; Wood, 1985). ability to regulate cellular redox and polyols can induce Homology proliferation through JNK/c-Jun (Perl et al., 2011). Thus, TAL deficiency and insufficiency predispose to Using the blastp function within Homo sapiens, the oxidative stress which promotes liver damage, only protein to share homology within humans (a increased proliferation, and hepatocellular carcinoma. paralog) was sorting nexin 32 (SNX32) with an identity of 36%. Squamous cell carcinoma of the head Mutations and neck Cytogenetics Germinal 3 SNPs in the TALDO1 gene have been associated Homozygous deletion of Serine 171 due to the loss of with different squamous cell carcinoma of the head and 3bp in the TALDO1 sequence results in liver cirrhosis neck risk. and subsequent carcinogenesis. The conversion of cytosine to either guanine or thymine at 490bp upstream of the origin of replication Implicated in (rs10794338) was protective against tumorigenesis (Basta et al., 2008). Hepatocellular carcinoma In contrast, the mutation of thymine to adenine at position 1874 (rs3901233) and adenine to cytosine at Cytogenetics position 2187 (rs4963163) increase the risk of Deletion of nucleotides 512-514 in TALDO1 resulted squamous cell cancer of the head and neck (Basta et al., in the loss of serine 171 in the TAL protein and 2008). subsequent TAL deficiency (Verhoeven et al., 2001; Valayannopoulos et al., 2006). TAL

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 119 TALDO1 (transaldolase 1) Oaks Z, Perl A

From blastp of NP_006746.1 against all non-redundant protein sequences.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 120 TALDO1 (transaldolase 1) Oaks Z, Perl A

Perl A, Qian Y, Chohan KR, Shirley CR, Amidon W, Banerjee References S, Middleton FA, Conkrite KL, Barcza M, Gonchoroff N, Suarez SS, Banki K.. Transaldolase is essential for maintenance of the Heinrich PC, Morris HP, Weber G. Behavior of transaldolase mitochondrial transmembrane potential and fertility of (EC 2.2.1.2) and transketolase (EC 2.2.1.1) Activities in spermatozoa. Proc Natl Acad Sci U S A. 2006 Oct normal, neoplastic, differentiating, and regenerating liver. 3;103(40):14813-8. Epub 2006 Sep 26. Cancer Res. 1976 Sep;36(9 pt.1):3189-97 Valayannopoulos V, Verhoeven NM, Mention K, Salomons GS, Wood T.. The pentose phosphate pathway. New York: Sommelet D, Gonzales M, Touati G, de Lonlay P, Jakobs C, Academic Press. 1985. Saudubray JM.. Transaldolase deficiency: a new cause of Banki K, Halladay D, Perl A.. Cloning and expression of the hydrops fetalis and neonatal multi-organ disease. J Pediatr. human gene for transaldolase. A novel highly repetitive 2006 Nov;149(5):713-7. element constitutes an integral part of the coding sequence. J Perl A.. The pathogenesis of transaldolase deficiency. IUBMB Biol Chem. 1994 Jan 28;269(4):2847-51. Life. 2007 Jun;59(6):365-73. (REVIEW) Banki K, Hutter E, Colombo E, Gonchoroff NJ, Perl A.. Basta PV, Bensen JT, Tse CK, Perou CM, Sullivan PF, Olshan Glutathione levels and sensitivity to apoptosis are regulated by AF.. Genetic variation in Transaldolase 1 and risk of squamous changes in transaldolase expression. J Biol Chem. 1996 Dec cell carcinoma of the head and neck. Cancer Detect Prev. 20;271(51):32994-3001. 2008;32(3):200-8. doi: 10.1016/j.cdp.2008.08.008. Epub 2008 Colombo E, Banki K, Tatum AH, Daucher J, Ferrante P, Sep 20. Murray RS, Phillips PE, Perl A.. Comparative analysis of Wamelink MM, Struys EA, Salomons GS, Fowler D, Jakobs C, antibody and cell-mediated autoimmunity to transaldolase and Clayton PT.. Transaldolase deficiency in a two-year-old boy myelin basic protein in patients with multiple sclerosis. J Clin with cirrhosis. Mol Genet Metab. 2008 Jun;94(2):255-8. doi: Invest. 1997 Mar 15;99(6):1238-50. 10.1016/j.ymgme.2008.01.011. Epub 2008 Mar 10. Thorell S, Gergely P Jr, Banki K, Perl A, Schneider G.. The Choudhary C, Kumar C, Gnad F, Nielsen ML, Rehman M, three-dimensional structure of human transaldolase. FEBS Walther TC, Olsen JV, Mann M.. Lysine acetylation targets Lett. 2000 Jun 23;475(3):205-8. protein complexes and co-regulates major cellular functions. Lachaise F, Martin G, Drougard C, Perl A, Vuillaume M, Science. 2009 Aug 14;325(5942):834-40. doi: Wegnez M, Sarasin A, Daya-Grosjean L.. Relationship 10.1126/science.1175371. Epub 2009 Jul 16. between posttranslational modification of transaldolase and Hanczko R, Fernandez DR, Doherty E, Qian Y, Vas G, Niland catalase deficiency in UV-sensitive repair-deficient xeroderma B, Telarico T, Garba A, Banerjee S, Middleton FA, Barrett D, pigmentosum fibroblasts and SV40-transformed human cells. Barcza M, Banki K, Landas SK, Perl A.. Prevention of Free Radic Biol Med. 2001 Jun 15;30(12):1365-73. hepatocarcinogenesis and increased susceptibility to Verhoeven NM, Huck JH, Roos B, Struys EA, Salomons GS, acetaminophen-induced liver failure in transaldolase-deficient Douwes AC, van der Knaap MS, Jakobs C.. Transaldolase mice by N-acetylcysteine. J Clin Invest. 2009 Jun;119(6):1546- deficiency: liver cirrhosis associated with a new inborn error in 57. doi: 10.1172/JCI35722. Epub 2009 May 11. the pentose phosphate pathway. Am J Hum Genet. 2001 Perl A, Hanczko R, Telarico T, Oaks Z, Landas S.. Oxidative May;68(5):1086-92. Epub 2001 Mar 27. stress, inflammation and carcinogenesis are controlled through Grossman CE, Niland B, Stancato C, Verhoeven NM, Van Der the pentose phosphate pathway by transaldolase. Trends Mol Knaap MS, Jakobs C, Brown LM, Vajda S, Banki K, Perl A.. Med. 2011 Jul;17(7):395-403. doi: Deletion of Ser-171 causes inactivation, proteasome-mediated 10.1016/j.molmed.2011.01.014. Epub 2011 Mar 2. (REVIEW) degradation and complete deficiency of human transaldolase. Biochem J. 2004 Sep 1;382(Pt 2):725-31. This article should be referenced as such: Verhoeven NM, Wallot M, Huck JH, Dirsch O, Ballauf A, Oaks Z, Perl A. TALDO1 (transaldolase 1). Atlas Genet Neudorf U, Salomons GS, van der Knaap MS, Voit T, Jakobs Cytogenet Oncol Haematol. 2014; 18(2):117-121. C.. A newborn with severe liver failure, cardiomyopathy and transaldolase deficiency. J Inherit Metab Dis. 2005;28(2):169-79.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 121 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(X;14)(p11.4;q32.33) IGH/GPR34 Iwona Wlodarska Center for Human Genetics, KU Leuven, Leuven, Belgium (IW)

Published in Atlas Database: August 2013 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/tX14p11q32ID1637.html DOI: 10.4267/2042/53087 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

one of 19 (5.2) cases of extranodal DLBCL with clonal Abstract chromosomal abnormalities collected in Center for Short communication on t(X;14)(p11.4;q32.33) Human Genetics, KU Leuven, Leuven, Belgium IGH/GPR34, with data on clinics, and the genes (Baens et al., 2012). t(X;14)/IGH-GPR34 and the well implicated. known t(1;14)/IGH-BCL10, t(3;14)/IGH-FOXP1, t(11;18)/API2-MALT1 and t(14;18)/IGH-MALT1 are Clinics and pathology mutually exclusive in MALT lymphoma. Disease Prognosis B-cell non Hodgkin's lymphoma, including mucosa- Unknown so far. associated lymphoid tissue (MALT) lymphoma, nodal marginal zone lymphoma (nMZL) and gastric diffuse Cytogenetics large B-cell lymphoma (DLBCL) Cytogenetics molecular Etiology FISH and molecular studies demonstrated involvement Five cases have been reported so far: three females of IGH/14q32.33 (Fig. 2a) and the GPR34 gene at aged 60-69 years with primary MALT lymphoma Xp11.4 (Fig. 2b). involving the lung (two cases) and the parotid gland (one case), one 82-years old female with nMZL and Additional anomalies one 82-years old male with gastric DLBCL. All Cytogenetic data are available in four cases. The patients had an underlying disorder, including Sjögren translocation occurred as the sole aberration in one case syndrome, a leukocytoclastic vasculitis and and was accompanied by 2 to 4 additional polyneuropathy, and Helicobacter Pylori-negative chromosomal abnormalities in the remaining cases. chronic gastritis with intestinal metaplasia. Subclonal duplication of der(14)t(X;14) or extra copy t(X;14)(p11.4;q32.33) is a rare translocation, being of IGH-GPR34 were found in three reported cases. identified in 2 of 61 (3.3%) cases of MALT lymphoma, in one of 43 (2.3%) cases of nMZL and

Figure 1. Partial karyotype of t(X;14)(p11.4;q32.33). Duplication of der(14) occurs recurrently in t(X;14)-positive cases.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 122 t(X;14)(p11.4;q32.33) IGH/GPR34 Wlodarska I

Figure 2. FISH analysis of t(X;14)(p11.4;q32.33). Applied probes: (a) LSI IGH; (b) BAC clones flanking the Xp11.4 breakpoint (RP11- 204C16/red and RP11-1174J21/green) (Baens et al., 2012).

The natural ligand of GPR34 and downstream Genes involved and proteins signaling pathways are largely unknown. GPR34 IGH Location Location Xp11.4 14q32.33 Note Alias: G Protein-Coupled Receptor 34. Result of the chromosomal DNA/RNA anomaly GPR34 consists of 3 exons, but only one is protein coding exon. Transcript length: 1924 bps. Hybrid gene Transcription is from centromere to telomere. GPR34 Note and the neighboring GPR82 are housed by intron 5 of Sequence analysis of one case with CASK. Expression of GPR34 mRNA is ubiquitous in t(X;14)(p11.4;q32.33) showed that the Xp11.4 human tissues. breakpoint fell between exon 1 and 2 of GPR82, the Protein gene located in close vicinity to GPR34, and the GPR34 codes for a G protein-coupled receptor that 14q32.33 breakpoint occurred in the IGHA2 switch belongs to the largest family of cell surface molecules region, placing both genes in close proximity to the involved in signal transmission. These integral IGHA2 3' regulatory region enhancers, HS4, HS1, membrane proteins contain 7 putative transmembrane HS2, and HS3 (Ansell et al., 2012). domains and mediate signals to the interior of the cell. Overexpression of GPR34 mRNA, but not GPR82 and The predicted 381-amino acid GPR34 has a calculated CASK, indicates that the translocation targets GPR34. relative molecular mass of approximately 44 kDa, The functional consequences of the translocation potential N-glycosylation sites within the extracellular remain elusive. N-terminal region, consensus acceptor phosphorylation Experimental data of Ansell et al. (2012) indicate that sites for protein kinase A and C, and potential receptor- overexpression of GPR34 leads to constitutive specific kinase phosphorylation sites (multiple serine activation of the ERK pathway, and also implicate a and threonine residues). The receptor encoded by role of GPR34 in the activation of CREB, AP-1, PKC GPR34 is most similar to the PY2 receptor subfamily and NF-kB. Activation of NF-kB and ERK by GPR34, of GPCR and it is evolutionarily conserved being however, was not confirmed by Baens et al. (2012). present in all vertebrate classes. GPR34 protein is ubiquitously expressed; its highest levels of expression References were found in placenta, spleen and brain (Engemaier et Engemaier E, Römpler H, Schöneberg T, Schulz A. Genomic al., 2006). Experimental data suggest that GPR34 is and supragenomic structure of the nucleotide-like G-protein- required for adequate immune responses to antigen and coupled receptor GPR34. Genomics. 2006 Feb;87(2):254-64 pathogen contact.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 123 t(X;14)(p11.4;q32.33) IGH/GPR34 Wlodarska I

Ansell SM, Akasaka T, McPhail E, Manske M, Braggio E, Vandenberghe P, De Wolf-Peeters C, Wlodarska I. Price-Troska T, Ziesmer S, Secreto F, Fonseca R, Gupta M, t(X;14)(p11.4;q32.33) is recurrent in marginal zone lymphoma Law M, Witzig TE, Dyer MJ, Dogan A, Cerhan JR, Novak AJ. and up-regulates GPR34. Haematologica. 2012 Feb;97(2):184-8 t(X;14)(p11;q32) in MALT lymphoma involving GPR34 reveals a role for GPR34 in tumor cell growth. Blood. 2012 Nov This article should be referenced as such: 8;120(19):3949-57 Wlodarska I. t(X;14)(p11.4;q32.33) IGH/GPR34. Atlas Genet Baens M, Finalet Ferreiro J, Tousseyn T, Urbankova H, Cytogenet Oncol Haematol. 2014; 18(2):122-124. Michaux L, de Leval L, Dierickx D, Wolter P, Sagaert X,

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 124 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Solid Tumour Section Review

Pancreatic tumors: an overview Carlos A Tirado, David S Shabsovich, Jianling Ji, David Dawson Department of Pathology and Laboratory Medicine, David Geffen UCLA School of Medicine, Los Angeles, CA, USA (CAT, JJ, DD), Department of Microbiology, Immunology, and Molecular Genetics, David Geffen UCLA School of Medicine, Los Angeles, CA, USA (DSS)

Published in Atlas Database: August 2013 Online updated version : http://AtlasGeneticsOncology.org/Tumors/PancreaTumOverviewID5054.html DOI: 10.4267/2042/53088 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Intraductal tubular neoplasms Abstract Cystic acinar neoplasms Review on pancreatic tumors with data on clinics, and - Acinar cell cystadenoma the genes implicated. - Acinar cell cystadenocarcinoma Solid Classification Invasive pancreatic ductal adenocarcinoma (and its variants) Note - Tubular adenocarcinoma The classification system here is adapted from those - Adenosquamous carcinoma outlined in both the AFIP Atlas of Tumor Pathology - Colloid carcinoma Fourth Series (2007) and WHO Classification of - Medullary carcinoma Tumors of the Digestive System (2010). Pancreatic - Hepatoid carcinoma tumors can be subdivided on various criteria, such as - Signet ring cell carcinoma their gross features (i.e., solid vs. cystic), anatomic - Undifferentiated carcinoma location (i.e., intraductal), histogenesis (i.e., epithelial - Undifferentiated carcinoma with osteoclast-like giant vs. non-epithelial) or clinical behavior. cells Classification Acinar cell carcinoma Epithelial tumors Neuroendocrine neoplasms Cystic - Neuroendocrine microadenoma Serous neoplasms - Neuroendocrine tumors (NET) - Serous cystadenoma -- NET G1 -- Microcystic serous cystadenoma -- NET G2 -- Macrocystic serous cystadenoma -- Neuroendocrine carcinoma (NEC) -- Solid serous cystadenoma --- Small cell NEC - Von Hippel-Landau (VHL)-associated serous cystic --- Large cell NEC neoplasm -- Functional NETs (associated with clinical syndrome) - Serous cystadenocarcinoma --- Insulinoma Mucinous cystic neoplasm (MCN) --- Gastrinoma - MCN with low or intermediate grade dysplasia --- Glucagonoma - MCN with high grade dysplasia --- Serotonin-producing NET - MCN with associated invasive carcinoma --- Somatostatinoma Intraductal papillary mucinous neoplasms (IPMN) --- VIPoma - IPMN with low or intermediate grade dysplasia Mixed tumors (combined acinar, ductal and/or - IPMN with high grade dysplasia endocrine differentiation) - IPMN with associated invasive carcinoma Solid-pseudopapillary neoplasms (SPN) Intraductal oncocytic papillary neoplasms (IOPN) Pancreatoblastoma

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 125 Pancreatic tumors: an overview Tirado CA, et al.

Non-epithelial tumors (rare) calories, obesity, prior gastrectomy and certain Mesenchymal tumors (various histologies, benign or occupational (i.e., coal gas and metal workers) and malignant) chemical exposures (i.e., benzidine, solvents, DDT and Lymphangioma gasoline). Diets high in fruits and vegetables, folate Lymphoma and vitamin C are reported to be protective. Chronic Mature cystic teratoma pancreatitis and longstanding diabetes mellitus are also Secondary tumors (including metastasis) linked to an increased risk of pancreatic cancer (Yadav Non-neoplastic tumors and other lesions presenting and Lowenfels, 2013). The development of chronic as masses (partial list) pancreatitis or adult-onset diabetes mellitus has been Cystic shown to be temporally linked to an increased risk for - Groove pancreatitis (paraampullary duodenal wall the subsequent development of PDAC, although it is cyst) unclear to what extent these events represent preceding - Pancreatic pseudocyst causal factors as opposed to early manifestations of - Ductal retention cyst clinically undetected or nascent PDAC. - Congenital cyst Approximately 10% of PDAC have familial - Foregut cyst inheritance, although only a minority (~20%) of - Lymphoepithelial cyst familial PDAC has been linked to a known genetic Solid syndrome or causal gene mutation. Hereditary - Chronic pancreatitis syndromes associated with familial pancreatic cancer - Lymphocytic sclerosing pancreatitis (autoimmune (along with their cumulative lifetime risk for pancreatitis) developing PDAC by age 70) include: FAP (5%), - Heterotopic spleen hereditary breast and ovarian cancer associated with BRCA1/BRCA2 (5%), Lynch syndrome (<5%), Clinics and pathology FAMMM (17%), Peutz-Jeghers (36%), as well as cystic fibrosis (<5%) and hereditary pancreatitis (40%) Note linked to PRSS1 and SPINK1. (Templeton and The vast majority of malignant pancreatic tumors Brentall, 2013). (>85%) are pancreatic ductal adenocarcinomas (PDAC), the focus of this section. Clinics Clinical presentation is often non-specific for PDAC, Etiology which along with a lack of a viable early screening An evolving consensus arising from lineage tracing strategy for the general population, contributes to the studies in animal models implicate acinar cells (and not late detection of disease in many patients. Some ductal epithelium) as the likely cell of origin for common presenting symptoms include epigastric pain PDAC. Precursor pancreatic intraepithelial neoplasia radiating to the back, weight loss, jaundice and/or light (PanIN) lesions have been shown to arise in the context colored stools (more typically for tumors in the head of of inflammation and acinar cell injury through a the pancreas), digestive problems, anorexia, nausea, transitional process referred to as acinar-to-ductal pancreatitis-related symptoms, new-onset diabetes and metaplasia (ADM). ADM and PanIN formation is even depression. Diagnostic imaging techniques facilitated by oncogenic KRAS2 in combination with include computerized tomography (with PDAC other molecular events and contributing factors (Morris commonly presenting as hypodense mass with possible et al., 2010). The concept of chronic inflammation and pancreatic and/or bile duct dilation), endoscopic injury to the pancreas as an inciting event and/or ultrasound or endoscopic retrograde promoter of pancreatic cancer progression is bolstered cholangiopancreatography (ERCP). by the significantly increased (50-80 fold) risk of Pathology PDAC seen in patients with hereditary pancreatitis, as well as an increased risk for PDAC associated with the Precursor lesions that can give rise to invasive PDAC occurrence of chronic pancreatitis in the general include pancreatic intraepithelial neoplasia (PanIN), population. IPMN and MCN. A majority of invasive PDAC arises from PanIN, dysplastic ductal proliferations showing Epidemiology variable epithelial atypia. PanINs are typically not The vast majority of PDAC arises sporadically. Age is recognized grossly and are generally smaller than 0.5 a significant factor linked to the development of cm. Most IPMNs tend to be greater than 1.0 cm in size. pancreatic cancer, with more than 80% of cases A consensus classification system for PanIN lesions occurring after 60 years of age and only rare cases based on increasing cytologic atypia has been adopted before the age of 40. Various dietary, lifestyle and (PanIN1A, 1B, 2 or 3). There is a parallel stepwise environmental factors have been correlated with an accumulation of molecular events found in PDAC increased risk for PDAC. A partial list of risk factors associated with increasing PanIN grade (Hruban et al., includes cigarette smoking, diets high in fat and total 2001). IPMN are cystic or solid mass forming lesions

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 126 Pancreatic tumors: an overview Tirado CA, et al.

arising within the ductal tree itself, typically associated Prognosis with abundant mucin production and demonstrating a PDAC accounts for over 220000 annual deaths papillary growth pattern of columnar epithelium of worldwide, with five year survival for all PDAC gastric foveolar, intestinal and/or pancreaticobiliary patients reported to be 5-6% (Raimondi et al., 2009). differentiation. IPMNs involving the main pancreatic Most PDAC patients present with non-operative, duct (main-duct type) versus those isolated to side- locally advanced (AJCC Stage III) or metastatic (AJCC branch ducts (branch-duct type) are distinguished Stage IV) disease. Fewer than 20% of patients present clinically because of a higher risk of malignant with resectable disease (AJCC Stage I or II). Overall progression associated with the former. Unlike IPMN, five year survival is still only 15-20% for early stage MCNs are mucinous cyst-forming lesions that do not patients following successful R0 surgical resection, communicate with the ductal system. MCNs almost primarily due to metastatic or recurrent local disease exclusively occur in women (>95%) and arise at a (Paulson et al., 2013). This suggests a large percentage median age of 40-50 years. The histologic sine qua non of resected patients have clinically unrecognized for MCNs is their distinctive ovarian-type stroma systemic disease at the time of surgery. Important (Basturk et al., 2009). prognostic factors include initial stage, with Most PDAC are solid tumors and arise in the head of significantly improved survival for patients who the pancreas (~70%), with the remainder occurring in undergo resection. Factors impacting survival in the either the body and/or the tail of the pancreas. Many setting of resection include margin status, tumor size, PDACs invade beyond the pancreas itself to involve histologic grade and lymph node involvement peripancreatic soft tissues with variable direct (Hidalgo, 2010). extension into adjacent anatomic structures, which depending on the location of the primary tumor may include the bile duct, ampulla, small or large bowel, Genetics peritoneum, stomach and spleen (pT3). Involvement of Note the celiac axis or mesenteric artery constitutes locally Conventional and molecular cytogenetic analyses of advanced disease (pT4). Common sites of distant PDAC have demonstrated significant intratumor metastatic spread include the liver and lungs, although cytogenetic heterogeneity (ICH), with complex nearly every other organ site has been shown to be cytogenetic abnormalities and extensive multiclonality. involved at lesser frequencies. Histologically, PDAC Extensive ICH in PDAC has been shown to correlate presents as haphazard growth pattern of invasive with a more dismal prognosis than those with less glands that provoke an intense desmoplastic complex cytogenetic abnormalities (Heim and fibroinflammatory stromal reaction; this robust stromal Mitelman, 2009). reaction facilitates tumor cell growth and acts as a significant barrier to effective drug delivery (Feig et al., Cytogenetics 2012). PDAC infiltrates along existing duct, nerve and vessel structures to aggressively invade the pancreas Cytogenetics Morphological and surrounding tissues. Histologic grade is most Conventional cytogenetic analysis has revealed the commonly based on the degree of gland formation, following numerical aberrations to be associated with although other criteria (i.e., mitotic activity, nuclear PDAC: -4, -6, +7, -9, +11, -12, -13, -17, -18, +20, -21, atypia, etc.) have also been proposed as alternatives. -22, -X and -Y. The most common losses in the Treatment aforementioned aneuplodies are -18, -17, and -21 and PDAC is notoriously resistant to chemotherapy, with the most common gains are +7 and +20. Balanced and only modest survival benefits realized in the adjuvant unbalanced structural aberrations revealed by or neoadjuvant setting. Until recently, single agent cytogenetic analysis include chromosomal arms 1p, 1q, chemotherapy (gemcitabine or 5-FU) was the standard 3p, 3q, 5p, 6p, 6q, 7q, 8q, 8p, 9p, 11q, 11p, 12p, 15q, chemotherapy regimen employed in either early stage 17p, 17q, 18q, 19p, 19q, 20p, and 20q (Heim and or advanced pancreatic cancer. Radiation therapy has Mitelman, 2009). remained a subject of some controversy and its use Cytogenetics Molecular varies depending on institution. Recent advances Molecular cytogenetic techniques most commonly include the use of multi-agent cytotoxic chemotherapy, utilized in the analysis of PDAC published in current as well as the addition of agents targeting specific literature include fluorescence in situ hybridization molecular pathways (i.e., EGFR inhibition) or the (FISH), comparative genomic hybridization (CGH), tumor stroma, which have resulted in improved single nucleotide polymorphism (SNP) arrays, spectral survival outcomes in clinical trials and are now being karyotyping (SKY), whole-genome sequencing, widely adopted as standard of care for patients able to etc.CGH analysis applied to malignant PDAC cell lines tolerate these regimens (Paulson et al., 2013).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 127 Pancreatic tumors: an overview Tirado CA, et al.

has elucidated regions of significant copy number TP53 aberrations. Gains of the long arms of chromosomes Location 11, 8, 3, and 1, as well as losses of 18q, 17p, and 8p 17p13.1 were reported to have been the most commonly altered regions. Further analysis showed that the following Note chromosomal bands/regions were most affected by TP53 mutations have been implicated in up to 75% of copy number aberrations: 8q24.2-q24.3, 8q21-qter, pancreatic cancers and typically arise in later stage 3q23-qter, and 14q11.2-qter (Griffin et al., 2007). PanIN lesions (Iacobuzio-Donahue, 2012; Iacobuzio- SNP array analyses have revealed significant gains at Donahue et al., 2012). chromosomal bands 1q21.2-q21.3, 7q36.3, 8q24.3, and Protein 20q13.32-q13.33, as well as significant losses at bands TP53 acts as a tumor suppressor gene and codes for the 1p35.3, 9p22.3, 12q23.1, 17p12-p13.3, and 18q21.2. ubiquitously expressed p53 protein, which acts as Furthermore, loss of heterozygosity (LOH) has been multifunctional protein involved in regulating cell identified at significant amounts on chromosomal cycle progression, senescence, DNA repair and bands spanning 9p21.2-p24.1, 17p11.2-q13.3, and apoptosis. 18q12.1-q12.3 (Gutierrez et al., 2011; Willis et al., 2012). The aforementioned bands are also loci of genes CDKN2A implicated in the genesis of a number of solid-organ Location and hematological malignancies (for example, 9p21.3 CDKN2A and SMAD4). Note CDKN2A inactivation has been implicated in > 95% of Genes involved and proteins pancreatic cancers via a number of mechanisms Note including genetic deletion and promoter DNA A number of genes have been implicated or are hypermethylation gene silencing. suspects in the etiology of PDAC; however, precise It is commonly inactivated at an intermediate stage of diagnostic and prognostic significance has not been PanIN progression (Iacobuzio-Donahue, 2012). established for most, which require further Protein investigation as to their specific roles in pancreatic CDKN2A is a tumor suppressor gene that codes for the carcinogenesis and usefulness as prognostic or P16-INK4a protein, which functions to inhibit cell predictive biomarkers. cycle progression at the G1-S checkpoint. Exomic sequencing reveals PDAC tumors average SMAD4 greater than 60 genetic alterations, which includes of a small number of key driver genes mutated at high Location frequency (KRAS2, TP53, CDKN2A and SMAD4) 18q21.2 along with a far larger number of heterogenous genes Note mutated at lower frequency across the full spectrum of SMAD4 is mutated in up to 55% of pancreatic cancers patients (Jones et al., 2008). and typically arise in later stage PanIN lesions or KRAS2 invasive PDAC (Iacobuzio-Donahue, 2012). SMAD4 inactivation/protein loss is a prognostic Location marker associated with increased metastatic activity in 12p12.1 pancreatic malignancies and thus portends worse Note prognosis (Iacobuzio-Donahue et al., 2012). KRAS2 mutations have been implicated in > 95% of Protein PDAC. Observed in early PanIN lesions and capable of SMAD4 codes for a namesake protein that is driving PanIN and PDAC formation in genetically ubiquitously expressed and functions mainly in TGF- engineered mouse models, oncogenic mutation of beta signaling. KRAS2 is a bona fide early or initiating event for The actions of the Smad4 protein recruit other proteins PDAC carcinogenesis (Iacobuzio-Donahue, 2012; in the Smad family and synergistically affect Iacobuzio-Donahue et al., 2012). Mutations most transcription by modifying DNA-binding proteins. commonly occur at codons 12 (54-74%), 13 (3-5%), and 61 (3-5%) (Schultz et al., 2012). ATM Location Protein KRAS2 codes for the ubiquitous RAS protein, which is 11q22.3 found on the plasma membrane and mediates GTP- Note mediated signal transduction pathways involved in cell ATM mutations (generally germline mutations) have proliferation, survival and motility, among others. been implicated in 2.5% of cases of familial pancreatic

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 128 Pancreatic tumors: an overview Tirado CA, et al.

cancer and 8% of non-familial pancreatic cancer cases Note (Iacobuzio-Donahue et al., 2012). ATM has been Inactivation mutations of TSC2 have been observed in identified as a prominent susceptibility gene in 8.8% of pancreatic neuroendocrine tumor cases (Jiao et pancreatic malignancies as well, causing a five-fold al., 2011). increase in the risk of pancreatic cancer development in Many signal inputs, such as growth factors, energy individuals with ATM aberrations (Roberts and Klein, availability and Wnt signaling converge with TSC2 to 2012). regulate mTOR signaling (Dazert and Hall, 2011). Protein Loss of tuberin expression by immunohistochemistry ATM codes for a protein that is ubiquitously expressed has been described to occur in more than 50% of and functions in cell-cycle regulation (checkpoint PDAC as well (Kataoka et al., 2005). initiation) by phosphorylating a number of regulatory Protein proteins (for example, p53 and BRCA1). TSC2 codes for a cytoplasmic protein that is widely ATM also functions in DNA repair and damage control expressed and is thought to function in GTPase associated signaling pathways. activation and regulation as well as negative regulation BRCA1 of the mTOR pathway. Location BRCA2 17q21.31 Location Note 13q13.1 BRCA1 mutations are most attributed to familial Note pancreatic cancer, and are observed in approximately BRCA2 has been established as a familial pancreatic 3.7% of cases (Iqbal et al., 2012). BRCA1 is cancer gene and mutations of it have been observed in considered a susceptibility gene, and aberrations have 6.1% of cases of familial pancreatic cancer (Iqbal et al., been observed to increase pancreatic cancer 2012). This gene has been the subject of PARP development by 2.2-fold. inhibitors and DNA cross-linking agents, which can The gene has also been a target of PARP inhibitors and potentially provide viable therapeutic agents for DNA cross-linking agents in clinical trials (Roberts and pancreatic malignancies (Iacobuzio-Donahue et al., Klein, 2012). 2012). Protein Protein BRCA1 codes for a ubiquitously expressed namesake BRCA2 codes for a namesake, ubiquitously expressed protein that functions mainly in DNA repair and nuclear protein and functions mainly in DNA repair damage control, cell-cycle regulation, ubiquitination, and damage control; however, it possesses less major transcription regulation, etc. Mutations have been roles in cell-cycle checkpoint and transcription observed to arise via changes to the primary DNA regulation. sequence. Epigenetic events (usually aberrant methylation) can PALB2 also contribute to its dysregulation. Location TGFBR2 16p12.2 Location Note 3p24.1 PALB2 has been reported as a familial pancreatic cancer gene. The truncated PALB2 protein has been Note observed in 3.1% of familial pancreatic cancer cases TGFBR2 mutations are implicated in 4.1% of (Jones et al., 2009). pancreatic cancer cases (Goggins et al., 1998). Comprehensive pathway-based analysis of genome- Protein wide association studies finds 43 pancreatic cancer PALB2 is a tumor suppressor gene that codes for a related single-nucleotide polymorphisms (SNPs) in the namesake nuclear protein and forms a complex with TGFBR2 gene, and highlights 2 SNPs within the BRCA1 and BRCA2 which plays an essential role in Th1/Th2 immune response pathway (Li et al., 2012). homologous recombination DNA repair. Protein PTEN TGFBR2 codes for a member of the transmembrane Location serine/threonine kinase family receptor of TGF-β. 10q23.31 TGFBR2 mediates TGF-β cell signaling to regulate cell Note differentiation and proliferation. PTEN mutations are implicated in up to 7.3% of TSC2 pancreatic neuroendocrine tumor cases and individuals Location that possess such mutations (as well as mutations in 16p13.3 TSC2 (8.8% of cases) and PIK3CA (1.4% of cases))

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 129 Pancreatic tumors: an overview Tirado CA, et al.

could potentially be responsive to agents that inhibit observed in pancreatic malignancies (Shain et al., the mTOR pathway regulated by the aforementioned 2012). genes (Iacobuzio-Donahue et al., 2012). Although ARID1A mutations have been implicated in 8% of PTEN mutations are only rarely detected in PDAC, its pancreatic cancers, including nonsense and indel loss of function in PDAC has been attributed to a mutations (Jones et al., 2012). number of other mechanisms including promoter The internal duplication of ARID1A exons 2-4 in hypermethylation gene silencing and other pathway PANC1 cells has been reported (Shain et al., 2012). alterations including changes in AKT expression. Protein Protein The protein encoded by ARID1A is a key component PTEN codes for a namesake, widely expressed of the highly conserved SWI-SNF chromatin cytoplasmic protein that functions in phosphatase remodeling complex. regulation and tumor suppression. It specifically binds an AT-rich DNA sequence and BRAF facilitates transcription. Location MLH1 7q34 Location Note 3p21.3 BRAF mutations have been implicated in 16% of Note PDAC cases (Schultz et al., 2012). In intraductal 26% of the PDAC showed microsatellite instability papillary mucinous neoplasms (IPMNs) of the (MSI), 23% of which also showed hypermethylation of pancreas, missense mutations within exon 15 have the promoter of MLH1 (Yamamoto et al., 2001). In been found in 2.7% cases (Schonleben et al., 2007). So another study, the MLH1 hypermethylation rate was far, no BRAF V600E mutation has been observed in 4% in pancreatic carcinomas. pancreatic cancer. Protein Protein MLH1 codes for a protein that plays an essential role in BRAF codes for a namesake protein belonging to the DNA mismatch repair along with a set of genes known raf family of serine/threonine protein kinases. The as mismatch repair genes. RAS/BRAF/MEK/ERK pathway functions in cell STK11 apoptosis, proliferation and differentiation. Location AKT2 19p13.3 Location Note 19q13.1-q13.2 Germline mutations in the STK11 gene are found in Note ~70% of Peutz-Jeghers syndrome (PJS) cases (Volikos AKT2 amplification has been implicated in 20% of et al., 2006; Aretz et al., 2005; Chow et al., 2006). PDAC samples (Ruggeri et al., 1998). 32-43% of The mutation can be a point mutation or the deletion of PDAC samples showed a high intensity of AKT2 parts of the gene. For PJS patients, the cumulative risk (Altomare et al., 2002; Yamamoto et al., 2004). for pancreatic cancer is 26% at age of 70 (Korsse et al., Overexpression of AKT2 is sufficient for the 2013). metastasis of PDAC (Ruggeri et al., 1998). The Protein mechanisms for AKT2 overexpression in pancreatic Human STK11 encodes for the LKB1 protein that is cancer involve PTEN loss and/or PI3K activation expressed in all human tissues (Rowan et al., 2000). (Altomare et al., 2002). STK11 is a tumor suppressor gene since it can Protein negatively regulate the activity of mTOR complex 1 AKT2 codes for a namesake protein belonging to a (mTORC1) (Dazert and Hall, 2011). STK11 also subfamily of serine/threonine kinases containing SH2- functions in cell cycle arrest, p53 mediated apoptosis, like domains. AKT2 functions to promote cancer cell Wnt signaling and TGF-beta signaling. survival, migration, and invasion. Akt2 is also an important signaling molecule in the insulin signaling To be noted pathway. Note ARID1A Some data regarding precise loci, proteins, and Location functions of the aforementioned genes relevant to 1p35.3 pancreas tumors was gathered from the Atlas of Note Genetics and Cytogenetics in Oncology and ARID1A is the likely target of 1p36.11 deletion Haematology database.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 130 Pancreatic tumors: an overview Tirado CA, et al.

Jones S, Zhang X, Parsons DW, Lin JC, Leary RJ, Angenendt References P, Mankoo P, Carter H, Kamiyama H, Jimeno A, Hong SM, Fu B, Lin MT, Calhoun ES, Kamiyama M, Walter K, Nikolskaya T, Goggins M, Shekher M, Turnacioglu K, Yeo CJ, Hruban RH, Nikolsky Y, Hartigan J, Smith DR, Hidalgo M, Leach SD, Klein Kern SE. Genetic alterations of the transforming growth factor AP, Jaffee EM, Goggins M, Maitra A, Iacobuzio-Donahue C, beta receptor genes in pancreatic and biliary Eshleman JR, Kern SE, Hruban RH, Karchin R, Papadopoulos adenocarcinomas. Cancer Res. 1998 Dec 1;58(23):5329-32 N, Parmigiani G, Vogelstein B, Velculescu VE, Kinzler KW.. Ruggeri BA, Huang L, Wood M, Cheng JQ, Testa JR. Core signaling pathways in human pancreatic cancers Amplification and overexpression of the AKT2 oncogene in a revealed by global genomic analyses. Science. 2008 Sep subset of human pancreatic ductal adenocarcinomas. Mol 26;321(5897):1801-6. doi: 10.1126/science.1164368. Epub Carcinog. 1998 Feb;21(2):81-6 2008 Sep 4. Rowan A, Churchman M, Jefferey R, Hanby A, Poulsom R, Basturk O, Coban I, Adsay NV.. Pancreatic cysts: pathologic Tomlinson I. In situ analysis of LKB1/STK11 mRNA expression classification, differential diagnosis, and clinical implications. in human normal tissues and tumours. J Pathol. 2000 Arch Pathol Lab Med. 2009 Mar;133(3):423-38. doi: Oct;192(2):203-6 10.1043/1543-2165-133.3.423. (REVIEW) Hruban RH, Adsay NV, Albores-Saavedra J, Compton C, Heim S, Mitelman F.. Cancer Cytogenetics: Chromosomal and Garrett ES, Goodman SN, Kern SE, Klimstra DS, Klöppel G, Molecular Genetic Aberrations of Tumor Cells (Third Edition). Longnecker DS, Lüttges J, Offerhaus GJ. Pancreatic Wiley-Blackwell. Hoboken, New Jersey, United States of intraepithelial neoplasia: a new nomenclature and classification America. 2009. system for pancreatic duct lesions. Am J Surg Pathol. 2001 Jones S, Hruban RH, Kamiyama M, Borges M, Zhang X, May;25(5):579-86 Parsons DW, Lin JC, Palmisano E, Brune K, Jaffee EM, Yamamoto H, Itoh F, Nakamura H, Fukushima H, Sasaki S, Iacobuzio-Donahue CA, Maitra A, Parmigiani G, Kern SE, Perucho M, Imai K. Genetic and clinical features of human Velculescu VE, Kinzler KW, Vogelstein B, Eshleman JR, pancreatic ductal adenocarcinomas with widespread Goggins M, Klein AP.. Exomic sequencing identifies PALB2 as microsatellite instability. Cancer Res. 2001 Apr 1;61(7):3139- a pancreatic cancer susceptibility gene. Science. 2009 Apr 44 10;324(5924):217. doi: 10.1126/science.1171202. Epub 2009 Mar 5. Altomare DA, Tanno S, De Rienzo A, Klein-Szanto AJ, Tanno S, Skele KL, Hoffman JP, Testa JR. Frequent activation of Raimondi S, Maisonneuve P, Lowenfels AB.. Epidemiology of AKT2 kinase in human pancreatic carcinomas. J Cell Biochem. pancreatic cancer: an overview. Nat Rev Gastroenterol 2002;87(4):470-6 Hepatol. 2009 Dec;6(12):699-708. doi: 10.1038/nrgastro.2009.177. Epub 2009 Oct 6. (REVIEW) Yamamoto S, Tomita Y, Hoshida Y, Morooka T, Nagano H, Dono K, Umeshita K, Sakon M, Ishikawa O, Ohigashi H, Bosman FT, Carneiro F, Hruban RH, Theise ND.. Tumors of Nakamori S, Monden M, Aozasa K. Prognostic significance of the Pancreas. WHO Classification of Tumors of the Digestive activated Akt expression in pancreatic ductal adenocarcinoma. System. Chapter 12. International Agency for Research on Clin Cancer Res. 2004 Apr 15;10(8):2846-50 Cancer , Lyon, France. 2010. Aretz S, Stienen D, Uhlhaas S, Loff S, Back W, Pagenstecher Hidalgo M.. Pancreatic cancer. N Engl J Med. 2010 Apr C, McLeod DR, Graham GE, Mangold E, Santer R, Propping 29;362(17):1605-17. doi: 10.1056/NEJMra0901557. (REVIEW) P, Friedl W. High proportion of large genomic STK11 deletions Morris JP 4th, Wang SC, Hebrok M.. KRAS, Hedgehog, Wnt in Peutz-Jeghers syndrome. Hum Mutat. 2005 Dec;26(6):513-9 and the twisted developmental biology of pancreatic ductal Kataoka K, Fujimoto K, Ito D, Koizumi M, Toyoda E, Mori T, adenocarcinoma. Nat Rev Cancer. 2010 Oct;10(10):683-95. Kami K, Doi R. Expression and prognostic value of tuberous doi: 10.1038/nrc2899. Epub 2010 Sep 3. (REVIEW) sclerosis complex 2 gene product tuberin in human pancreatic Dazert E, Hall MN.. mTOR signaling in disease. Curr Opin Cell cancer. Surgery. 2005 Sep;138(3):450-5 Biol. 2011 Dec;23(6):744-55. doi: 10.1016/j.ceb.2011.09.003. Chow E, Meldrum CJ, Crooks R, Macrae F, Spigelman AD, Epub 2011 Sep 29. (REVIEW) Scott RJ. An updated mutation spectrum in an Australian Gutierrez ML, Munoz-Bellvis L, Abad Mdel M, Bengoechea O, series of PJS patients provides further evidence for only one Gonzalez-Gonzalez M, Orfao A, Sayagues JM.. Association gene locus. Clin Genet. 2006 Nov;70(5):409-14 between genetic subgroups of pancreatic ductal Volikos E, Robinson J, Aittomäki K, Mecklin JP, Järvinen H, adenocarcinoma defined by high density 500 K SNP-arrays Westerman AM, de Rooji FW, Vogel T, Moeslein G, Launonen and tumor histopathology. PLoS One. 2011;6(7):e22315. doi: V, Tomlinson IP, Silver AR, Aaltonen LA. LKB1 exonic and 10.1371/journal.pone.0022315. Epub 2011 Jul 21. whole gene deletions are a common cause of Peutz-Jeghers Jiao Y, Shi C, Edil BH, de Wilde RF, Klimstra DS, Maitra A, syndrome. J Med Genet. 2006 May;43(5):e18 Schulick RD, Tang LH, Wolfgang CL, Choti MA, Velculescu Griffin CA, Morsberger L, Hawkins AL, Haddadin M, Patel A, VE, Diaz LA Jr, Vogelstein B, Kinzler KW, Hruban RH, Ried T, Schrock E, Perlman EJ, Jaffee E. Molecular Papadopoulos N.. DAXX/ATRX, MEN1, and mTOR pathway cytogenetic characterization of pancreas cancer cell lines genes are frequently altered in pancreatic neuroendocrine reveals high complexity chromosomal alterations. Cytogenet tumors. Science. 2011 Mar 4;331(6021):1199-203. doi: Genome Res. 2007;118(2-4):148-56 10.1126/science.1200609. Epub 2011 Jan 20. Hruban RH, Pitman MB, Klimstra DS.. Tumors of the Feig C, Gopinathan A, Neesse A, Chan DS, Cook N, Tuveson Pancreas. AFIP Atlas of Tumor Pathology Series 4; American DA.. The pancreas cancer microenvironment. Clin Cancer Registry of Pathology, Washington DC, USA, 2007. Res. 2012 Aug 15;18(16):4266-76. doi: 10.1158/1078- 0432.CCR-11-3114. (REVIEW) Schonleben F, Qiu W, Bruckman KC, Ciau NT, Li X, Lauerman MH, Frucht H, Chabot JA, Allendorf JD, Remotti HE, Su GH.. Iacobuzio-Donahue CA.. Genetic evolution of pancreatic BRAF and KRAS gene mutations in intraductal papillary cancer: lessons learnt from the pancreatic cancer genome mucinous neoplasm/carcinoma (IPMN/IPMC) of the pancreas. sequencing project. Gut. 2012 Jul;61(7):1085-94. doi: Cancer Lett. 2007 May 8;249(2):242-8. Epub 2006 Nov 9. 10.1136/gut.2010.236026. Epub 2011 Jul 11.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 131 Pancreatic tumors: an overview Tirado CA, et al.

Iacobuzio-Donahue CA, Velculescu VE, Wolfgang CL, Hruban alterations define SWItch/Sucrose NonFermentable (SWI/SNF) RH.. Genetic basis of pancreas cancer development and chromatin remodeler as a central tumor suppressive complex progression: insights from whole-exome and whole-genome in pancreatic cancer. Proc Natl Acad Sci U S A. 2012 Jan sequencing. Clin Cancer Res. 2012 Aug 15;18(16):4257-65. 31;109(5):E252-9. doi: 10.1073/pnas.1114817109. Epub 2012 doi: 10.1158/1078-0432.CCR-12-0315. (REVIEW) Jan 10. Iqbal J, Ragone A, Lubinski J, Lynch HT, Moller P, Ghadirian Schultz NA, Roslind A, Christensen IJ, Horn T, Hogdall E, P, Foulkes WD, Armel S, Eisen A, Neuhausen SL, Senter L, Pedersen LN, Kruhoffer M, Burcharth F, Wojdemann M, Singer CF, Ainsworth P, Kim-Sing C, Tung N, Friedman E, Johansen JS.. Frequencies and prognostic role of KRAS and Llacuachaqui M, Ping S, Narod SA; Hereditary Breast Cancer BRAF mutations in patients with localized pancreatic and Study Group.. The incidence of pancreatic cancer in BRCA1 ampullary adenocarcinomas. Pancreas. 2012 Jul;41(5):759-66. and BRCA2 mutation carriers. Br J Cancer. 2012 Dec doi: 10.1097/MPA.0b013e31823cd9df. 4;107(12):2005-9. doi: 10.1038/bjc.2012.483. Epub 2012 Oct 25. Willis JA, Olson SH, Orlow I, Mukherjee S, McWilliams RR, Jones S, Li M, Parsons DW, Zhang X, Wesseling J, Kristel P, Kurtz RC, Klein RJ.. A replication study and genome-wide Schmidt MK, Markowitz S, Yan H, Bigner D, Hruban RH, scan of single-nucleotide polymorphisms associated with Eshleman JR, Iacobuzio-Donahue CA, Goggins M, Maitra A, pancreatic cancer risk and overall survival. Clin Cancer Res. Malek SN, Powell S, Vogelstein B, Kinzler KW, Velculescu VE, 2012 Jul 15;18(14):3942-51. doi: 10.1158/1078-0432.CCR-11- Papadopoulos N.. Somatic mutations in the chromatin 2856. Epub 2012 Jun 4. remodeling gene ARID1A occur in several tumor types. Hum Mutat. 2012 Jan;33(1):100-3. doi: 10.1002/humu.21633. Epub Korsse SE, Harinck F, van Lier MG, Biermann K, Offerhaus 2011 Nov 23. GJ, Krak N, Looman CW, van Veelen W, Kuipers EJ, Wagner A, Dekker E, Mathus-Vliegen EM, Fockens P, van Leerdam Li D, Duell EJ, Yu K, Risch HA, Olson SH, Kooperberg C, ME, Bruno MJ.. Pancreatic cancer risk in Peutz-Jeghers Wolpin BM, Jiao L, Dong X, Wheeler B, Arslan AA, Bueno-de- syndrome patients: a large cohort study and implications for Mesquita HB, Fuchs CS, Gallinger S, Gross M, Hartge P, surveillance. J Med Genet. 2013 Jan;50(1):59-64. doi: Hoover RN, Holly EA, Jacobs EJ, Klein AP, LaCroix A, 10.1136/jmedgenet-2012-101277. Mandelson MT, Petersen G, Zheng W, Agalliu I, Albanes D, Boutron-Ruault MC, Bracci PM, Buring JE, Canzian F, Chang Paulson AS, Tran Cao HS, Tempero MA, Lowy AM.. K, Chanock SJ, Cotterchio M, Gaziano JM, Giovannucci EL, Therapeutic advances in pancreatic cancer. Gastroenterology. Goggins M, Hallmans G, Hankinson SE, Hoffman Bolton JA, 2013 Jun;144(6):1316-26. doi: 10.1053/j.gastro.2013.01.078. Hunter DJ, Hutchinson A, Jacobs KB, Jenab M, Khaw KT, (REVIEW) Kraft P, Krogh V, Kurtz RC, McWilliams RR, Mendelsohn JB, Templeton AW, Brentnall TA.. Screening and surgical Patel AV, Rabe KG, Riboli E, Shu XO, Tjonneland A, Tobias outcomes of familial pancreatic cancer. Surg Clin North Am. GS, Trichopoulos D, Virtamo J, Visvanathan K, Watters J, Yu 2013 Jun;93(3):629-45. doi: 10.1016/j.suc.2013.02.002. Epub H, Zeleniuch-Jacquotte A, Amundadottir L, Stolzenberg- 2013 Apr 13. (REVIEW) Solomon RZ.. Pathway analysis of genome-wide association study data highlights pancreatic development genes as Yadav D, Lowenfels AB.. The epidemiology of pancreatitis and susceptibility factors for pancreatic cancer. Carcinogenesis. pancreatic cancer. Gastroenterology. 2013 Jun;144(6):1252- 2012 Jul;33(7):1384-90. doi: 10.1093/carcin/bgs151. Epub 61. doi: 10.1053/j.gastro.2013.01.068. (REVIEW) 2012 Apr 20. This article should be referenced as such: Roberts NJ, Klein AP.. Genome-wide sequencing to identify the cause of hereditary cancer syndromes: With examples Tirado CA, Shabsovich DS, Ji J, Dawson D. Pancreatic from familial pancreatic cancer. Cancer Lett. 2012 Nov 27. pii: tumors: an overview. Atlas Genet Cytogenet Oncol Haematol. S0304-3835(12)00655-6. doi: 10.1016/j.canlet.2012.11.008. 2014; 18(2):125-132. Shain AH, Giacomini CP, Matsukuma K, Karikari CA, Bashyam MD, Hidalgo M, Maitra A, Pollack JR.. Convergent structural

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 132 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Deep Insight Section

The contribution of circadian rhythms to cancer formation and mortality Tana L Birky, Molly S Bray Department of Psychology, University of Alabama at Birmingham, Birmingham, AL, UK (TLB), Departments of Epidemiology and Genetics, University of Alabama at Birmingham, Birmingham, AL, UK and Department of Nutritional Sciences, University of Texas at Austin, Austin, TX, USA (MSB)

Published in Atlas Database: August 2013 Online updated version : http://AtlasGeneticsOncology.org/Deep/CircadianEffectsID20124.html DOI: 10.4267/2042/53089 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Cellular circadian clocks represent a coordinated system of gene expression stimulated by both environmental and physiological cues that induces and maintains the rhythmicity of many metabolic processes. Circadian clocks confer the important benefit of anticipation of rhythmic environmental variation which serves to improve the health and survival of the organism. When disruption of these circadian patterns of gene expression occurs due to alterations in the physical (light/dark) and behavioral (feeding/sleeping) environments and/or due to genetic variation in the DNA sequence of clock component and clock regulated genes, negative health consequences can arise. One such consequence appears to be increased risk for cancer development. Circadian disruption has been associated with higher rates of tumorigenesis, faster tumor growth, and increased cancer severity in humans and animal models. Tumor formation is also associated with circadian disruption within the affected cells, and metabolic processes of the cancer host tend to lose their rhythmicity as the cancer becomes more severe. In addition, response to cancer treatment has been shown to have a time-dependent component in certain individuals. Knowledge of the type of circadian disruptions that induce or result from cancer can allow for temporally augmented treatments of cancer, ultimately making cancer treatments more effective and less harmful.

Introduction that isolated cells can maintain oscillatory activity and function (Kondratov et al., 2007). This mechanism is Circadian rhythms refer to daily organismal governed by multiple highly conserved positive and fluctuations that occur consistently within a 24-hour negative feedback loops whose cycles approximate 24 cycle and correspond with anticipated changes in the hours (see figure 1). In the positive component of the environment. These rhythms, which include sleeping feedback loop, BMAL1 forms a heterodimer with patterns, oscillation of gene expression, and varied CLOCK, which then binds to E-box elements in secretion of hormones, are present in nearly all promoter regions to drive the transcription of both organisms (Bell-Pedersen et al., 2005; Kondratov et al., bmal1 and clock genes (Bell-Pedersen et al., 2005; Ko 2007). They have likely evolved because of their and Takahashi, 2006; Kondratov et al., 2007; Stow and ability to confer the benefit of anticipation. When a Gumz, 2011). In addition, the BMAL1/CLOCK dimer specific type of stimulus is encountered repeatedly and drives transcription of the period ( per ) and consistently, organismal activity can begin to predict cryptochrome (cry ) gene families, retinoic acid orphan the stimulus and prepare for it, aiding in survival (Bell- receptor alpha ( ror α), and nuclear receptor subfamily 1 Pedersen et al., 2005; Ko and Takahashi, 2006). These group D ( nr1d2 or rev-erb α) (Ko and Takahashi, 2006; rhythms continue to approximate 24 hour cycles even Kondratov et al., 2007; Stow and Gumz, 2011). PER in the absence of timed environmental stimuli and CRY proteins then create the negative feedback (Kondratov et al., 2007). loop by forming a complex which acts to inhibit the A circadian clock is a transcriptional timing transcription mediated by the BMAL1/CLOCK dimer, mechanism that is present ubiquitously in mammalian ultimately resulting in downregulation of their own cells such

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 133 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

production (Kondratov et al., 2007; Stow and Gumz, Per family gene expression have all been shown to be 2011). RORA and REV-ERB α interact with ROR upregulated when host cells are exposed to radiation, elements to enhance and inhibit bmal1 expression, and PER family proteins appear to play a role in DNA respectively (Kondratov et al., 2007; Stow and Gumz, damage control and tumor suppression (Fu et al., 2002; 2011). In addition, the timeless ( tim ) gene has been Gery et al., 2006; Rana and Mahmood, 2010). speculated to play a role in the maintenance of Transfection of a Per1 overexpression vector into circadian rhythms as well, although its function may be cultured human colon cancer cells exposed to ionizing more important in altering rhythms based on external radiation led to greater DNA damage-induced stimuli (Kondratov et al., 2007; Engelen et al., 2013). apoptosis than cells transfected with an empty vector The interplay of these feedback loops ultimately leads (Gery et al., 2006). In contrast, small interfering RNA to consistent, daily cycles of gene/protein expression (siRNA) inhibition of endogenous Per1 expression led that can be maintained within each cell (Ko and to less DNA damage-induced apoptosis, creating Takahashi, 2006; Kondratov et al., 2007; Stow and conditions which could readily allow for the replication Gumz, 2011). of damaged cells and tumor formation, and revealing Nearly all cells have a clock mechanism, but the that even endogenous levels of PER1 have an suprachiasmatic nucleus (SCN) or "master clock" acts oncostatic effect (Gery et al., 2006). Similar in vitro to set the central clock in the brain by aligning its effects were seen when a Per2 expression plasmid was rhythms with light signals registered by the retina and transfected into human leukemia cells, with increased transmitted through the retinohypothalamic tract (Bell- PER2 causing an increase in cell growth arrest, Pedersen et al., 2005; Ko and Takahashi, 2006; apoptosis, and an upregulation of the tumor Kondratov et al., 2007). While the SCN contributes to suppressing protein p53 while siRNA knockdown of the synchronization of cellular circadian mechanisms Per2 led to a downregulation of p53 (Sun et al., 2010). in the peripheral tissues of the body, neurohumoral While PER1 and PER2 have shown evidence of signals driven in large part by food intake are thought oncostatic effects, surprisingly, CRY1 may have an to be the primary entrainers of peripheral clocks (Bell- oncogenic effect. Contrary to some of the previous Pedersen et al., 2005; Kondratov et al., 2007). findings examining Cry gene family expression in Although multiple stimuli and activities can entrain the cancerous tissue, Yu et al. found Cry1 mRNA circadian system in lieu of light, light is commonly overexpression in 8 of 10 paired tissue samples from used to experimentally induce circadian disruption patients with colorectal cancer (Yu et al., 2013). (Bell-Pedersen et al., 2005; Kondratov et al., 2007). Additionally, they reported high CRY1 expression in Cellular mechanisms linking 101 of 168 paired samples, low expression in the other 67, and a correlation between the cancer stage and circadian rhythms to cancer CRY1 expression, with more severe diagnoses being Multiple studies have provided compelling evidence associated with higher CRY1 expression levels (Yu et that both central and peripheral circadian clocks al., 2013). To explore the role of CRY1 in regulate many energy homeostatic functions, including tumorigenesis, Cry1 was overexpressed in a human insulin sensitivity, endocrine regulation, satiety colorectal cancer cell line, and showed that cells signaling, cellular proliferation, and cellular substrate transfected with a Cry1 -expressing plasmid metabolism. Thus, disruption of the circadian clock demonstrated significantly more cellular growth, (e.g., via dyssynchrony between light/dark cycles and proliferation, and increased migration capacity than sleep/wake/feeding behavior) has the potential to those transfected with an inert control (Yu et al., 2013). induce a host of disease states, including cancer. To In addition, siRNA knockdown of endogenous Cry1 examine whether circadian disruption can induce or expression inhibited cell colony formation and reduced exacerbate the migration capacity (Yu et al., 2013). These studies development of cancer at the cellular level, several point to a putative non-circadian function of Cry1 in studies have examined and/or manipulated the cancer etiology. expression of core circadian and related genes in Bmal1 also appears to play a role in cancer risk and human cell models of cancer. Clock , Bmal1 , Cry1 , and oncogenesis.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 134 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

Figure 1. The BMAL1/CLOCK heterodimer drives the transcription of several genes. PER and CRY family proteins form heterodimers that inhibit the actions of the BMAL1/CLOCK heterodimer. RORA and REV-ERB α act to activate and inhibit bmal1 transcription, respectively. Adapted from Stow and Gumz, 2011 (JASN).

Bmal1 deficient human cells are less likely to undergo growth associated with the deletion of DBC1 (Chini cell cycle arrest due to DNA damage, and knockdown EN et al., 2013). caused by Bmal1 targeting small hairpin RNAs Circadian gene dysregulation in (shRNAs) reveal a potential modulatory effect of p53 on p21, a process which may be involved in DNA- cancerous tissue damage induced apoptosis (Mullenders et al., 2009; The relationship between circadian rhythms and cancer Rana and Mahmood, 2010). In murine colon cancer is also seen at the cellular level when comparing cells, shRNA bmal1 knockdown produced similar cancerous to non-cancerous human tissue. Both results, including increased cell growth, decreased circadian rhythmicity and core circadian gene apoptosis, as well as downregulation of Per family expression appear to be disrupted in cancerous cells. genes and upregulation of rev-erb α (Zeng et al., 2010). Several circadian genes have been shown to be The protein DBC1 (deleted in breast cancer 1), which correlated with poor prognosis when overexpressed in is speculated to be associated with tumorigenesis, has various cancers, including Cry1 in colorectal cancer been shown to regulate and increase REV-ERB α and Timeless in lung cancer (Rana and Mahmood, expression and stability as well as modulate its 2010; Yoshida et al., 2013; Yu et al., 2013). A series of transcription repression activity on Bmal1 (Chini CC et studies using tissue from 30-70 patients with al., 2013; Chini EN et al., 2013). In human embryonic subcortical gliomas showed abnormal expression kidney cells, the tandem transfection of Dbc1 and Rev- patterns of critical circadian genes in high-grade versus erb α plasmids resulted in lower Bmal1 transcription low-grade gliomas and high-grade gliomas compared and cell cycle arrest than the transfection of either to surrounding non-glioma tissue, in which higher plasmid alone or a control plasmid (Chini EN et al., levels of CLOCK and lower levels of PER1, PER2, 2013). Independent of the interaction of DBC1 with CRY1, CRY2 and corresponding mRNA were reported circadian genes, overexpression of DBC1 has been (Xia et al., 2010; Luo et al., 2012; Chen et al., 2013). reported in several different cancers and is correlated Tissue samples from 32 patient skin biopsies revealed with poorer prognoses in breast carcinoma, lymphoma, lower mRNA levels of the same circadian genes colorectal cancer, gastric carcinoma, and others (Cha et excluding Cry2 that were seen in of both malignant al., 2009; Lee et al., 2011; Kim et al., 2012; Park et al., melanoma and nonmalignant nevus tumors compared 2013; Zhang et al., 2013). The downstream effects of to surrounding skin tissue (Lengyel et al., 2013). DBC1 on REV-ERB α and subsequently on Bmal1 can Downregulation of PER1 was also shown in tissue lead to disruption of typical protein oscillations, which collected from 38 patients who had been diagnosed but could be a factor in the physiological effects on tumor not yet treated for buccal squamous cell carcinoma;

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 135 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

this effect was significantly correlated with increased near complete control of environmental factors. risk of metastasis and clinical stage, where more severe Transgenic mouse models with functional disruptions risk and diagnosis corresponded with more PER1 of circadian genes have many phenotypes that parallel downregulation (Zhao et al., 2013). Nevertheless, the the pathologies seen in humans experiencing consistent studies described above have their limitations since circadian disruptions. Clock dominant negative ∆19 they all collected their human tissue samples from a mutant mice show hypoinsulinemia, hyperglycemia, single three hour period and did not categorize tissue and obesity, consistent with the high risk of diabetes by collection time (Zhao et al., 2013). While these and obesity seen in humans (Kondratov et al., 2007). studies do not measure the target genes over time due Bmal1 -/- mice show premature aging, sterility, to practical considerations of subject burden, since they metabolic defects, and shorter average lifespan than all compare the cancerous tissue to non-cancerous their wild-type counterparts (Kondratov et al., 2007). tissue collected at the same time from the same patient, Interestingly, mice with only one copy of Bmal1 the compared samples do provide important (Bmal1 +/-) exhibit increased spontaneous tumors as information related to protein abundance of circadian well as an increased sensitivity to tumor formation components and cancer risk. after irradiation (Lee et al., 2010). Per2 -/- mice show a Recently, a study by Chen et al. used 55 samples of decrease in DNA damage response along with higher breast cancer and paired non-cancerous tissue collected rates of tumor formation from exposure to low levels of from 5 different time points from 10am until 8pm and ionizing radiation, which coincides with the human reported differential expression of at least one PER data showing a downregulation of Per expression in protein for all type II or type III breast cancer tissue cancerous versus non-cancerous tissue (Kondratov et samples compared to their paired control tissue (Chen al., 2007; Rana and Mahmood, 2010). In addition, et al., 2005). The overall expression of the samples was mPer2 m/m homozygous mutant mice have higher not lower as they were in the previous studies, which mortality rates and are naturally cancer prone (Fu et al., could be due to variability in collection time points, 2002). The m Per2 m/m mice also have higher sensitivity although the fact that distinct cell populations of the to the effects of radiation, including a more than ten- same cancer tissue expressed different PER expression fold increase in the likelihood of cancer induction, and could indicate heterogeneity even within breast cancer show resistance to radiation induced-apoptosis, further cell populations (Chen et al., 2005). An abnormal emphasizing the importance of a functional PER2 in pattern of circadian gene expression was also observed tumor suppression (Fu et al., 2002). Knockout mice in tissue from 38 patients with diagnosed but not lacking both Per1 and Per2 or both Cry1 and Cry2 treated colorectal carcinoma collected across 6 time were shown to have higher rates of spontaneous tumor points between 10am and 10pm; PER2 formation, higher rates of tumorigenesis after immunostaining showed a heterogeneous expression irradiation, and increased tumor formation and growth pattern in the cancerous tissue compared to the when exposed to continuous, alternating phase homogeneous expression seen in paired non-cancerous advances and delays (Lee et al., 2010). However, Per1 - tissues, with a trend of decreased PER2 expression in /-, Cry1 -/-, Cry2 -/- and Rev-erb α-/- mice do not have cancerous versus non-cancerous tissue (Wang et al., strong phenotypes, with Per1 -/- mice showing increased 2011). A study by Lin et al. examined mRNA drug sensitivity but little else, both Cry1 -/- and Cry2 -/- expression of several circadian genes, including Per mice exhibiting high bone mass but no metabolic or and Cry family genes, as well as Clock , Bmal1 , and tumorigenesis abnormalities, and Rev-erb α-/- mice Timeless , and revealed significant decreases in levels being phenotypically indistinguishable from wild-type of Per , Cry2 , and Timeless expression in hepatocellular mice (Kondratov et al., 2007; Rana and Mahmood, carcinoma samples collected from 46 patients in one of 2010). five time points from 8am to 6pm (Lin et al., 2008). Heterogeneous immunostaining patterns were also Surgical and environmental apparent in many of the cancerous as opposed to paired circadian disruption in animal non-cancerous tissue samples, and the number of genes models whose expression was disrupted was positively correlated with tumor size (Lin et al., 2008). These Though transgenic models can shed light on gene studies reveal that cancerous tissues show both function, total knockout models have limitations in that disrupted and less homogenous expression of circadian all tissues are lacking a specific gene, and the organism genes than their non-cancerous counterparts, but cannot has undergone the entirety of its development without convey causal relationships between these factors. that gene. Because of these possible confounding factors, several studies have employed environmentally Transgenic mouse models or surgically induced circadian disruption rather than As convincing as the accumulation of human and genetic interventions and have demonstrated that such cellular data may be, animal models can provide even manipulations can influence morbidity and cancer more insight by allowing for genetic manipulations and sensitivity. Rats exposed to continuous or increased

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 136 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

daily light rather than the typical 12 hour light/dark Although a relationship between the disruption of cycle have shown increased spontaneous specific circadian gene expression and disordered SCN tumorigenesis, decreased lifespan, as well as more function or light/dark hours has consistently been infectious diseases, abdominal obesity, hyperglycemia, demonstrated, the exact nature of the relationship and hyper-cholesterolemia (Vinogradova et al., 2009; between circadian gene expression and oncogenesis is Bukalev et al., 2012). Mice with ablated SCN regions still unclear. To examine if the expression of a single showed completely disrupted rest/activity patterns, circadian gene could induce the tumorigenic effects along with phase shifts and blunted amplitudes of observed in light-induced circadian phase shifts, Yu et processes that typically showcase 24-hour rhythmicity, al. examined the overexpression of a specific circadian such as body temperature, serum corticosterone, and gene, Cry1 , in a xenografted tumor (Yu et al., 2013). circulating lymphocyte count (Filipski and Lévi, 2009). Nine mice were administered bilateral subcutaneous Additionally, subjection to chronic jet lag via injections of human colorectal cancer cells, with one alterations in light/dark timing disrupted rest/activity, side being injected with cells that overexpressed Cry1 body temperature, and serum corticosterone patterns, and the other maintaining endogenous levels of Cry1 similar to SCN lesions (Filipski et al., 2004). expression (Yu et al., 2013). After four weeks, tumors Moreover, jet lag conditions caused a marked overexpressing Cry1 were over 50% larger and heavier disruption of the typical circadian expression of all the than tumors originating from wildtype Cry1 (Yu et al., examined genes, including bmal1 , cry1 , per2 , and rev- 2013). Another study subcutaneously injected murine erb α mRNA in liver tissue, and increased the risk of colon cancer cell lines that had either normal or development of several cancers (Filipski et al., 2005; downregulated bmal1 expression into the axilla of mice Lee et al., 2010). to induce tumor growth (Zeng et al., 2010). Tumors In order to focus on the effects of these disruptive derived from cell lines with downregulated bmal1 grew factors on tumor growth, xenografts of human cancer faster than those with normal bmal1 expression, with cells or induction of tumors by other means can be the bmal1 suppressed tumor growing to twice the size informative. Filipski et al. performed several of the control tumor after 31 days (Zeng et al., 2010). experiments exploring various methods of circadian More experiments utilizing this tumor-specific/gene- disruption and recovery, and their effects on tumor specific abnormal expression model would be growth (Filipski and Levi, 2009). Destruction of the informative to the oncogenic and oncostatic properties SCN after tumor inoculation produced accelerated for all circadian genes. growth in both slow-growing (pancreatic Circadian disruption in humans and adenocarcinoma) and fast-growing (Glasgow osteosarcoma) tumors, doubling the size of the tumors the melatonin hypothesis compared to their sham lesioned counterparts by day The importance of circadian rhythms in relation to 12 and 22, respectively (Filipski and Levi, 2009). In various aspects of human health has been a topic of non-lesioned mice bearing tumors, meal timing was extensive research. Several studies have indicated that used as an entrainment factor, with a four hour feeding people with jobs causing "jet-lag" and disallowing time at the beginning of the light phase causing a typical sleep patterns, such as shift workers, pilots and decrease in tumor growth for both types of tumors as flight attendants, are at a higher risk for health issues compared to mice given access to food ad libitum including heart disease, obesity, mood disorders, (Filipski and Levi, 2009). Chronic jet-lag simulated by diabetes, gastrointestinal symptoms, and overall five 8-hour light advances caused an increase in mortality (Healy and Waterhouse, 1995; Anisimov, mortality rates and nearly a 50% increase in Glasgow 2003; Bray and Young, 2007; Kondratov et al., 2007; osteosarcoma tumor size by day 11 compared to mice Pan et al., 2011; Schernhammer and Thompson, 2011). exposed to normal light/dark cycles (Filipski et al., Similar results can be found for people with profound 2004; Filipski and Levi, 2009). Chronic jet lag also sleep disturbances not necessarily caused by caused phase shifts and altered mRNA expression of occupation (Hublin et al., 2007; Kondratov et al., 2007; bmal1 and per2 in the livers of tumor-bearing mice Adamantidis and de Lecea, 2008). Intriguingly, this (Filipski et al., 2005). To investigate whether meal increased risk extends to several cancers, but is most timing could mitigate the increased tumorigenesis commonly seen in hormonally regulated cancers such effect cause by chronic jet lag, mice were exposed to as breast, prostate, ovarian, and thyroid cancer (Davis the jet lag conditions but also given a consistent cycle et al., 2001; Hansen, 2001; Anisimov, 2003; of 12 hours access to food then 12 hours without Schernhammer et al., 2003; Megdal et al., 2005; access, which slowed tumor growth to rates to those Anisimov, 2006; Kubo et al., 2006; Schernhammer et similar to the non-jet lagged mice (Filipski and Levi, al., 2006; Blask, 2009; Hansen and Stevens, 2011; 2009). Meal timing also nearly restored per2 and rev- Poole et al., 2011; Monsees et al., 2012; Luo et al., erb α mRNA expression patterns but dampened those of 2013). In fact, the International Agency for Research bmal1 in the liver, and induced a more typical on Cancer Working Group concluded that shift-work sinusoidal expression of per2 , bmal1 , and rev-erb α in with circadian disruption is probably carcinogenic to the tumor tissue (Filipski and Levi, 2009). humans (Straif et al., 2007). Mortality risk for cancer

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 137 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

patients increases when severe rest-activity pattern study by Kloog and colleagues used a composite image disruptions are present, and behavioral and molecular for nighttime light levels in 1996/1997 from the daily circadian disruptions are more frequent and prominent readings by U.S. satellites to assess nighttime light in later stages of cancer development (Mormont and levels across 164 countries, and compared these levels Lévi, 1997; Mormont et al., 2000; Mormont and to breast cancer rates reported by GLOBOCAN (Kloog Waterhouse, 2002; Innominato et al., 2009; Innominato et al., 2010). The investigators reported that higher et al., 2012). light at night levels were associated with higher breast Certain cancer rates are higher in industrialized cancer incidence rates even after controlling for other countries, and light pollution is thought to be a possible risk factors, which corresponds with their previous contributor to this phenomenon (Anisimov, 2006; findings in communities in Israel (Kloog et al., 2008; Kloog et al., 2010; Spivey, 2010). This theory, known Kloog et al., 2010). In addition, intensity of light as the melatonin hypothesis, attributes increased cancer exposure in the bedroom during sleeping hours has risk to decreased melatonin excretion due to the been indicated to be a strong predictor of breast cancer presence of light at night. Melatonin levels have a while controlling for other known predictive factors typical circadian rhythmicity, with the peak of (Anisimov, 2003; Blask, 2009; Kloog et al., 2011). circulating melatonin levels occurring in the middle of Environmental studies of light exposure during night the night around 4am, a time at which natural light is hours may be confounded by the variability of light rarely present and most humans are asleep (Healy and intensities and frequencies across countries and Waterhouse, 1995; Rohr and Herold, 2002; Stow and settings. Investigations of blindness and visual Gumz, 2011). However, with the advent of artificial impairment have been performed to control for such light, sleep/wake and work cycles have become more environmental variability (Rohr and Herold, 2002). malleable, and light exposure can easily occur during The possibility of blindness as a protective trait has times that are atypical evolutionarily. It is important to been examined using public data available from the last note that melatonin production in the pineal gland can five decades from national cancer registries, blindness be suppressed by both natural and artificial light registries, and national hospital discharge surveys. The (Stevens et al., 1992; Rohr and Herold, 2002; data were derived from Norway, USA, Sweden, and Anisimov, 2003; Nakahara et al., 2003; Blask, 2009; Finland, collectively including over 50000 visually Stow and Gumz, 2011), and plasma melatonin levels impaired patients (Hahn, 1991; Feychting et al., 1998; are often used as an indicator of circadian phase Verkasalo et al., 1999; Kliukiene et al., 2001; Rohr and because of the interconnectedness of the pineal gland Herold, 2002; Pukkala et al., 2006). Consistent with the and the SCN. Anomalies in melatonin cycles are melatonin hypothesis, these studies have reliably considered symptomatic of circadian disruption (Healy reported that women with near to total blindness have and Waterhouse, 1995; Rohr and Herold, 2002; approximately half the incidence of breast cancer as Nakahara et al., 2003). compared to sighted women (Hahn, 1991; Feychting et While suppression of melatonin occurs as a result of al., 1998; Verkasalo et al., 1999; Kliukiene et al., 2001; exposure to visible light, melatonin synthesis remains Rohr and Herold, 2002; Pukkala et al., 2006). rhythmic in the absence of light. Therefore, if While the above findings are consistent with the melatonin is a protective factor in tumorigenesis, then melatonin hypothesis, more direct evidence for the role populations exposed to less light should have lower of melatonin in cancer risk can be found in clinical and cancer risks. Indeed, Alaska, Canada, and Greenland experimental data. In humans, decreasing melatonin had less than half the global incidence of breast cancer levels have been suggested as markers for certain types based on epidemiological data collected from 1968- of cancer, particularly those in which tumors are 1988, where the darkness during the winter months hormonally dependent (Karasek et al., 2000). In may have bestowed a protective element (Erren and addition, lower melatonin levels in urine have been Piekarski, 1999). Unfortunately, this protective element shown in women with breast cancer compared to may be declining, as breast cancer rates have continued matched controls, and diminished pineal gland to rise since the previous data was collected (Fredslund function, which results in lower melatonin levels, has and Bonefeld-Jørgensen, 2012). While still lower than long been suggested to be involved in the promotion of global incidence rates, epidemiological data from the breast cancer and other cancers (Cohen et al., 1978; range of 1988-2008 in Greenland, Canada, Arctic Schernhammer and Hankinson, 2005). A study by Russia, and Alaska have shown a consistent trend of Schernhammer and Hankinson examined the increasing breast cancer incidence (Fredslund and association of urinary melatonin and breast cancer risk Bonefeld-Jørgensen, 2012). Changing environmental by taking urinary samples from nearly 30000 cancer- factors, including increased exposure to light at night free women who participated in the Nurse's Health through TV and computer screen time and outdoor Study from 1996-1999 (Schernhammer and Hankinson, high intensity output lamps, may be contributing to the 2005). A four-year follow-up revealed that the quarter increase in breast cancer rates (Pauley, 2004). with the lowest urinary melatonin had over twice as To substantiate the claim that levels of light at night many cases of breast cancer than the quarter with the exposure can lead to higher breast cancer incidence, a highest urinary melatonin concentration

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 138 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

(Schernhammer and Hankinson, 2005). A darkness (1-2,5 µW/cm 2), or complete darkness comprehensive summary of the various mechanisms by (0 µW/cm 2) and implanted with human breast cancer which melatonin may produce an oncostatic effects are xenografts, latency-to-onset growth was recorded at 11 presented by Srinivasan and colleagues (Srinivasan et days for dim light exposure, 12 days for near darkness, al., 2008). and 15 days for complete darkness, demonstrating an Melatonin has been shown to have anti-oncogenic increase in latency with decreasing levels of light at effects in several human cancer cell lines. The effects night (Dauchy et al., 2011). The same effect was of application of physiological levels of melatonin, observed in rats with hepatomas, reporting latency-to- pharmacological levels of melatonin, or a control onset at 5, 9, and 13 days with decreasing light at night diluent for 24 hours was examined in human breast and (Dauchy et al., 2011). Blood melatonin levels in non- prostate cancer cell culture; physiological levels of tumor bearing rats exposed to the varying degrees of melatonin were shown to decrease cell proliferation in light at night intensity were similar in dim light at night these cell lines, which may be due to their modulation as in daytime, and a ten-fold increase of melatonin of the cell cycle length or inhibition of DNA synthesis levels in near darkness compared to dim light was (Cos et al., 2002; Jung-Hynes et al., 2011; Kostoglou- observed, which increased even further to normal Athanassiou, 2013; Liu et al., 2013). In addition, levels in complete darkness (Dauchy et al., 2011). physiological levels of melatonin were shown to These findings expose a direct relationship between stimulate multiple DNA repair systems and reduce the intensity of light at night and peak nighttime melatonin metastatic properties of human breast cancer cells levels and provide evidence that disruption of (Sliwinski et al., 2007; Liu et al., 2013). At melatonin expression can exacerbate tumor growth pharmacologically relevant levels, melatonin decreased (Dauchy et al., 2011). cell proliferation in a variety of cancer cell type, To examine the mediating effects of melatonin including cervical cancer, gliomas, and ovarian cancer, administration on tumor development, intestinal tumors and has also been shown to induce apoptosis in specific were induced in rats by giving them five injections of cancer cell lines without cytotoxicity to any non- 1,2-dimethylhydrazine weekly for six months with or cancerous cells (Kostoglou-Athanassiou, 2013; without a corresponding nighttime injection of Rodriguez et al., 2013). melatonin (Anisimov et al., 1997). Of the 21 rats given To examine the tumorigenic effects of "light at night" the carcinogen alone, all developed at least one tumor in animal models, Blask and colleagues exposed rats with an average of 3,8 tumors per rat, and of the 21 with human breast cancer xenografts to one of six given melatonin as well as the carcinogen, only 14 different intensities of light during their normal dark developed any tumors and had an average of 1,5 phase, ranging from total darkness to bright light, and tumors per rat (Anisimov et al., 1997). In another reported a dose-related tumor growth rate and blood- study, tumors in the vagina and uterine cervix were melatonin suppression, with more light at night induced in mice by applying the same carcinogen corresponding to faster tumor growth rates and lower intravaginally twice a week for 3 hours each with or blood-melatonin levels (Blask et al., 2009). One without the five nighttime injections of melatonin per noteworthy finding was that "dim light" (0,08 µW/cm 2) week (Anisimov et al., 2000). Of the 20 mice exposed caused less melatonin suppression but nearly solely to the carcinogen, 10 tumors developed in the equivalent levels of tumor growth as "bright light" vagina and uterine cervix, 8 of which were classified as (345 µW/cm 2) at night (Blask et al., 2009), further malignant, and of the 20 rats given melatonin along supporting the importance of light at night and with the carcinogen, only 5 developed tumors with melatonin levels. In another study, blood collected at none in the uterine cervix, and all were benign night from pre-menopausal women was perfused into (Anisimov et al., 2000). To examine the joint and in situ rat hepatomas or human breast cancer independent effects of testosterone and melatonin, rats xenografts, resulting in inhibited signal transduction were given an intragastric dose of the carcinogen activity; this oncostatic effect was not present when the dimethylbenzathracene to induce the appearance of tumors were perfused with blood collected during the mammary tumors; ovariectomies were performed on daytime or at night after 90 minutes of bright light rats with tumors that developed within 12 weeks, and exposure (Blask et al., 2005). Melatonin levels were rats were treated with testosterone only, a combination five times higher in the blood collected at night without of testosterone and melatonin, or untreated (Cos et al., light exposure than the other blood collection 2006). Mice treated with solely testosterone showed conditions, and the introduction of a nonselective steep increases in the number and growth rate of melatonin receptor antagonist blocked the tumor- tumors, and these effects were mitigated by the suppressing effects, providing support for melatonin as administration of melatonin, returning both values to the primary oncostatic factor in these studies (Blask et similar levels as the untreated rats (Cos et al., 2006). In al., 2005). addition, the melatonin group showed the highest In rats exposed to dim light (8,8 µW/cm 2), near survival rates of any of the groups (Cos et al., 2006).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 139 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

Melatonin treatment and anticancer of 100 patients with non-small lung cancer (Lissoni et al., 2003). Other studies have reported consistent effects results of increased survival, tolerance, progression- Melatonin has been studied for its effectiveness in free time, as well as reductions in anxiety and pain cancer treatments and is especially appealing because (Vijayalaxmi et al., 2002). Overall, the collection of of its endogenous presence and lack of adverse side data on melatonin use in tandem with current cancer effects (Vijayalaxmi et al., 2002; Jung and Ahmad, treatment appears to be very positive, with minimal 2006). Several non-randomized studies lacking placebo additional risk. controls have shown potential for the usage of melatonin in addition to other anticancer treatments, Circadian rhythmicity of response demonstrating increased measures of quality of life, to anticancer drugs decreased anxiety, and potential for response to In order to examine the effect of drug administration anticancer treatment in patients who were previously timing, animals entrained to a 12 hour light/dark cycle unresponsive without melatonin (Jung and Ahmad, were divided into one of several groups representing 2006). A small study conducted by Lissoni and different circadian times of drug administration. colleagues examined 63 patients with non-small lung Differential rates of survival, tumor growth, activity, cancer who did not respond to cisplatin treatment and maximum dose, weight loss, leukocyte count, etc., thus had no other viable treatment options (Lissoni et were observed among the timed treatment groups, al., 1992). The patients were randomly assigned to a which was attributed to circadian variations in group receiving only supportive care, which included tolerability, efficacy, and side effects (Blumenthal et steroid and anticonvulsant agents, or a daily evening al., 1999). The most beneficial time points of lowest dose of 10 mg of melatonin; patients treated with toxicity or highest efficacy observed in animal studies melatonin showed higher survival rates and can then be extrapolated to chronotherapeutic performance status (Lissoni et al., 1992). A similar administration of chemotherapy for human patients and study headed by Lissoni supplemented 50 patients with can be optimized through computational modeling unresectable brain metastases with either supportive (Lévi et al., 2010). Chronotherapy, a method of care alone, or supportive care and a daily 20 mg dose chronomodulated drug administration that accounts for of melatonin in the evening (Lissoni et al., 1994). The the interaction of cellular circadian rhythms and the mean survival times were 5 months with supportive corresponding changes in efficacy and tolerance of care alone and 9 months with melatonin added, with a anti-cancer drugs, ideally allows for greater survival mean progression free period of 6 months and 3 while maintaining or potentially decreasing the months, respectively (Lissoni et al., 1994). In addition, intensity and number of side effects (Librodo et al., the melatonin group suffered from fewer steroid- 2012). Currently, at least thirty anticancer drugs have induced complications and showed improved quality of demonstrated up to a ten-fold tolerability variance life (Lissoni et al., 1994). Another study of 60 patients depending on time of day administered, most in which with non-small lung cancer showed increased survival the highest tolerability time point corresponded with when given interleukin and melatonin versus a the highest anti-tumor efficacy (Lévi, 1996; Lévi et al., chemotherapy treatment of cisplatin and etoposide 2010). The increase in drug efficacy at specific (Barni et al., 1995). In a larger study with 250 patients circadian time points continues even when the with metastatic solid tumors from lung cancer, face or cancerous cells exhibit disrupted or completely ablated neck cancer, breast cancer, or gastrointestinal tract circadian organization (Lévi et al., 2010). These anti- neoplasms, patients were treated, with a chemotherapy cancer effects in rodents help to inform cancer regime based on their cancer type, with or without 20 treatment strategies that can be used in humans. mg of melatonin each evening (Lissoni et al., 1999). Several clinical trials have been performed in an Patients given melatonin in the evenings had a clinical attempt to highlight the potential advantages of response rate of 34%, while only 15% of those without chronotherapy versus conventional drug melatonin treatment achieved a clinical response, and administration, particularly using the antimetabolite 5- the groups showed a one year survival rate of over 50% fluorouracil in the treatment of colorectal cancer. A and less than 25%, respectively (Lissoni et al., 1999). phase I trial of 5-fluorouracil administered with 1-folic In addition, the average progression-free time was acid utilized programmable pumps to deliver five days approximately 4 months for the group receiving of timed infusions, lasting from 10pm to 10am and chemotherapy alone and was 9 months for the peaking at 4am, to several groups of patients with melatonin group, and the majority of chemotherapy- metastatic colorectal cancer (Garufi et al., 1997). The related toxicities had less than half the frequency in the doses were increased with each group given this melatonin and chemotherapy versus the chemotherapy treatment to determine the maximum tolerated dose, alone group (Lissoni et al., 1999). Similar levels of and the timed treatment revealed low toxicity and increased chemotherapy tolerance, higher survival, and promisingly high efficacy rates for both previously increased response were also found in a five-year study treated and untreated patients (Garufi et al., 1997).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 140 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

A phase II trial utilizing a similar drug administration Because of heterogeneity among patients, the schedule with the addition of oxaliplatin showed that individualization of treatment plans has the potential to the chronomodulated drug administration allowed for be very efficacious. Patients can have differing activity higher drug doses, resulted in higher rates of schedules, tumor growth rates, and discrepancies progression free and overall survival time, and caused between tumor and other cell cycles which all can be fewer severe side effects (e.g., stomatitis) compared to monitored and used to determine the most effective and patients given constant rates of infusion (Lévi et al., least risky treatment plan (Bernard et al., 2010). 1994). Additional randomized phase II trials comparing Mathematical simulations of individualized treatments chronomodulated administration and constant based on these patient characteristics have shown administration have shown that groups with advanced methods to optimize tumor cell death while minimizing colorectal cancer subjected to chronomodulated drug non-tumor cell death by exploiting the differing infusion had up to a 20% increase in objective response circadian profile of the tumor cells compared to the rate, increased tolerance, severely decreased patient's other cells, and have even suggested 29 hour frequencies of dose-limiting toxicity effects, and fewer treatment intervals as a possible method to maintain patients dropping out from treatment when compared efficacy while minimizing risk due to individual to conventional flat-rate infusions (Buroker et al., variations in optimal administration time (Bernard et 1994; Lévi et al., 1994; Focan et al., 2000; Librodo et al., 2010). Investigation of individualized timed al., 2012). A meta-analysis performed on five studies treatment is especially important since the most comparing these two treatment plans in advanced effective and most lethal 24 hour interval schedule for colorectal cancer showed that chronomodulated drug a patient can be separated by only a few hours, with administration provided a significant increase in larger variability of treatment efficacy and toxicity overall survival rates while maintaining similar being seen among women (Bernard et al., 2010). Still, frequencies and intensities of side effects (Liao et al., the inclusion of a time-dependent aspect of drug 2010). In addition, a study of 77 patients with administration should be considered since it can allow metastatic colorectal cancer who had previously shown for more effective and less harmful treatments for to be resistant to treatments involving 5-fluorouracil, cancer in some individuals. oxaliplatin, and leucovorin were treated with these Conclusion drugs in a chronomodulated schedule, and were able to halt disease progression for a median time of 5,5 Evidence from epidemiologic studies, cellular studies, months in 61 of the patients (Gholam et al., 2006). rodent studies, and clinical trials all indicate that the To further investigate the potential benefits of genesis and proliferation of cancer can result from chronomodulated versus conventional flat-rate circadian abnormalities and be altered by circadian- administration, phase III trials have been conducted. A based treatments. Genetically or environmentally trial of 554 previously untreated patients with disrupted circadian processes seem to counteract the colorectal cancer were randomly assigned to be given naturally inhibitive properties of circadian gene either a conventional 2-day flat rate infusion or a expression and melatonin on oncogenesis present in chronomodulated 4-day infusion of fluorouracil, both rodents oxaliplatin, and leucovorin (Giacchetti et al., 2006). and humans with properly aligned rhythms. This Sex appeared as an important factor in the efficacy of connection is expressed such that circadian disruption chronomodulated versus conventional treatment; men appears to both induce tumorigenesis and cause poorer showed a median survival rate of 21 months versus 18 outcomes from cancer, whereas maintained rhythms months and a 2-year survival rate of 44% versus 34% seem to inhibit oncogenesis and increase survival rates. for chronomodulated versus conventional treatment, Because circadian rhythms span across many levels of respectively, while women showed a median survival complexity within an organism, they must be rate of 16 months versus 19 months, and a 2-year understood on multiple levels from circadian genes to survival rate of 27% versus 41% (Giacchetti et al., behavior. Cancer treatment or prevention may be 2006). While treatment-related toxicities were similar modified at one or more of these levels, and it should both between treatment groups and sexes, the overall be understood that circadian variables are both present trend shows that chronomodulated treatment was within the patient and are able to be manipulated by the beneficial in men and was potentially detrimental in environment when trying to determine an effective women (Giacchetti et al., 2006). A meta-analysis treatment plan. including two other phase III trials and totaling 842 Currently, the clinical trials using chronotherapy that patients comparing the same two schedules of drug have been conducted to date have produced some administration concluded that chronomodulated promising and some seemingly inconsistent results. administration of anti-cancer drugs is safe and However, when examining the results of clinical trials, beneficial for males but not females, which may baseline gender, cancer, and circadian differences must partially be a result of the majority of the relevant be taken into account which may resolve perceived animal testing being performed on male rodents inconsistencies. It could be that chronomodulated (Giacchetti et al., 2012). delivery of drugs is only preferable in hormonally

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 141 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

regulated cancers, useful in males but not females, or Feychting M, Osterlund B, Ahlbom A. Reduced cancer only advantageous when the patient's circadian incidence among the blind. Epidemiology. 1998 Sep;9(5):490-4 rhythms are intact. Although many unknowns remain Blumenthal RD, Reising A, Lew W, Dunn R, Ying Z, in circadian rhythms and cancer interaction, it seems Goldenberg DM. Chronotolerance of experimental radioimmunotherapy: clearance, toxicity, and maximal clear that there is a circadian component to both the tolerated dose of 131I-anti-carcinoembryonic antigen (CEA) induction and progression of several types of cancer, IgG as a function of time of day of dosing in a murine model. and this compilation of information suggests that Eur J Cancer. 1999 May;35(5):815-24 cancer prevention and treatment should include Erren TC, Piekarski C. Does winter darkness in the Artic circadian aspects in order to be maximally effective. protect against cancer? The melatonin hypothesis revisited. Med Hypotheses. 1999 Jul;53(1):1-5 References Lissoni P, Barni S, Mandalà M, Ardizzoia A, Paolorossi F, Vaghi M, Longarini R, Malugani F, Tancini G. Decreased Cohen M, Lippman M, Chabner B. Role of pineal gland in toxicity and increased efficacy of cancer chemotherapy using aetiology and treatment of breast cancer. Lancet. 1978 Oct the pineal hormone melatonin in metastatic solid tumour 14;2(8094):814-6 patients with poor clinical status. Eur J Cancer. 1999 Hahn RA. Profound bilateral blindness and the incidence of Nov;35(12):1688-92 breast cancer. Epidemiology. 1991 May;2(3):208-10 Verkasalo PK, Pukkala E, Stevens RG, Ojamo M, Rudanko Lissoni P, Barni S, Ardizzoia A, Paolorossi F, Crispino S, SL. Inverse association between breast cancer incidence and Tancini G, Tisi E, Archili C, De Toma D, Pipino G. Randomized degree of visual impairment in Finland. Br J Cancer. 1999 study with the pineal hormone melatonin versus supportive Jul;80(9):1459-60 care alone in advanced nonsmall cell lung cancer resistant to a Anisimov VN, Zabezhinski MA, Popovich IG, Zaripova EA, first-line chemotherapy containing cisplatin. Oncology. Musatov SA, Andre V, Vigreux C, Godard T, Sichel F. 1992;49(5):336-9 Inhibitory effect of melatonin on 7, 12- Stevens RG, Davis S, Thomas DB, Anderson LE, Wilson BW. dimethylbenz[a]anthracene-induced carcinogenesis of the Electric power, pineal function, and the risk of breast cancer. uterine cervix and vagina in mice and mutagenesis in vitro. FASEB J. 1992 Feb 1;6(3):853-60 Cancer Lett. 2000 Aug 11;156(2):199-205 Buroker TR, O'Connell MJ, Wieand HS, Krook JE, Gerstner Focan C, Kreutz F, Focan-Henrard D, Moeneclaey N. JB, Mailliard JA, Schaefer PL, Levitt R, Kardinal CG, Gesme Chronotherapy with 5-fluorouracil, folinic acid and carboplatin DH Jr. Randomized comparison of two schedules of for metastatic colorectal cancer; an interesting therapeutic fluorouracil and leucovorin in the treatment of advanced index in a phase II trial. Eur J Cancer. 2000 Feb;36(3):341-7 colorectal cancer. J Clin Oncol. 1994 Jan;12(1):14-20 Karasek M, Kowalski AJ, Zylinska K. Serum melatonin Lévi FA, Zidani R, Vannetzel JM, Perpoint B, Focan C, circadian profile in women suffering from the genital tract Faggiuolo R, Chollet P, Garufi C, Itzhaki M, Dogliotti L. cancers. Neuro Endocrinol Lett. 2000;21(2):109-113 Chronomodulated versus fixed-infusion-rate delivery of Mormont MC, Waterhouse J, Bleuzen P, Giacchetti S, Jami A, ambulatory chemotherapy with oxaliplatin, fluorouracil, and Bogdan A, Lellouch J, Misset JL, Touitou Y, Lévi F. Marked folinic acid (leucovorin) in patients with colorectal cancer 24-h rest/activity rhythms are associated with better quality of metastases: a randomized multi-institutional trial. J Natl life, better response, and longer survival in patients with Cancer Inst. 1994 Nov 2;86(21):1608-17 metastatic colorectal cancer and good performance status. Lissoni P, Barni S, Ardizzoia A, Tancini G, Conti A, Maestroni Clin Cancer Res. 2000 Aug;6(8):3038-45 G. A randomized study with the pineal hormone melatonin Davis S, Mirick DK, Stevens RG. Night shift work, light at night, versus supportive care alone in patients with brain metastases and risk of breast cancer. J Natl Cancer Inst. 2001 Oct due to solid neoplasms. Cancer. 1994 Feb 1;73(3):699-701 17;93(20):1557-62 Barni S, Lissoni P, Cazzaniga M, Ardizzoia A, Meregalli S, Hansen J. Light at night, shiftwork, and breast cancer risk. J Fossati V, Fumagalli L, Brivio F, Tancini G. A randomized Natl Cancer Inst. 2001 Oct 17;93(20):1513-5 study of low-dose subcutaneous interleukin-2 plus melatonin versus supportive care alone in metastatic colorectal cancer Kliukiene J, Tynes T, Andersen A. Risk of breast cancer patients progressing under 5-fluorouracil and folates. among Norwegian women with visual impairment. Br J Cancer. Oncology. 1995 May-Jun;52(3):243-5 2001 Feb 2;84(3):397-9 Healy D, Waterhouse JM. The circadian system and the Cos S, Mediavilla MD, Fernández R, González-Lamuño D, therapeutics of the affective disorders. Pharmacol Ther. 1995 Sánchez-Barceló EJ. Does melatonin induce apoptosis in Feb;65(2):241-63 MCF-7 human breast cancer cells in vitro? J Pineal Res. 2002 Mar;32(2):90-6 Anisimov VN, Popovich IG, Zabezhinski MA. Melatonin and colon carcinogenesis: I. Inhibitory effect of melatonin on Fu L, Pelicano H, Liu J, Huang P, Lee C. The circadian gene development of intestinal tumors induced by 1,2- Period2 plays an important role in tumor suppression and DNA dimethylhydrazine in rats. Carcinogenesis. 1997 damage response in vivo. Cell. 2002 Oct 4;111(1):41-50 Aug;18(8):1549-53 Mormont MC, Waterhouse J. Contribution of the rest-activity Garufi C, Lévi F, Aschelter AM, Pace R, Giunta S, Nisticò C, circadian rhythm to quality of life in cancer patients. Chronobiol Gallà DA, Silecchia GF, Franchi F, Narduzzi C, Terzoli E. A Int. 2002 Jan;19(1):313-23 phase I trial of 5-day chronomodulated infusion of 5- fluorouracil and 1-folinic acid in patients with metastatic Rohr UD, Herold J. Melatonin deficiencies in women. colorectal cancer. Eur J Cancer. 1997 Sep;33(10):1566-71 Maturitas. 2002 Apr 15;41 Suppl 1:S85-104 Mormont MC, Lévi F. Circadian-system alterations during Vijayalaxmi, Thomas CR Jr, Reiter RJ, Herman TS. Melatonin: cancer processes: a review. Int J Cancer. 1997 Jan from basic research to cancer treatment clinics. J Clin Oncol. 17;70(2):241-7 2002 May 15;20(10):2575-601

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 142 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

Anisimov VN. The role of pineal gland in breast cancer metastatic colorectal cancer. Oncologist. 2006 Nov- development. Crit Rev Oncol Hematol. 2003 Jun;46(3):221-34 Dec;11(10):1072-80 Lissoni P, Chilelli M, Villa S, Cerizza L, Tancini G. Five years Giacchetti S, Bjarnason G, Garufi C, Genet D, Iacobelli S, survival in metastatic non-small cell lung cancer patients Tampellini M, Smaaland R, Focan C, Coudert B, Humblet Y, treated with chemotherapy alone or chemotherapy and Canon JL, Adenis A, Lo Re G, Carvalho C, Schueller J, melatonin: a randomized trial. J Pineal Res. 2003 Anciaux N, Lentz MA, Baron B, Gorlia T, Lévi F. Phase III trial Aug;35(1):12-5 comparing 4-day chronomodulated therapy versus 2-day conventional delivery of fluorouracil, leucovorin, and oxaliplatin Nakahara D, Nakamura M, Iigo M, Okamura H. Bimodal as first-line chemotherapy of metastatic colorectal cancer: the circadian secretion of melatonin from the pineal gland in a European Organisation for Research and Treatment of Cancer living CBA mouse. Proc Natl Acad Sci U S A. 2003 Aug Chronotherapy Group. J Clin Oncol. 2006 Aug 1;24(22):3562-9 5;100(16):9584-9 Jung B, Ahmad N. Melatonin in cancer management: progress Schernhammer ES, Laden F, Speizer FE, Willett WC, Hunter and promise. Cancer Res. 2006 Oct 15;66(20):9789-93 DJ, Kawachi I, Fuchs CS, Colditz GA. Night-shift work and risk of colorectal cancer in the nurses' health study. J Natl Cancer Ko CH, Takahashi JS. Molecular components of the Inst. 2003 Jun 4;95(11):825-8 mammalian circadian clock. Hum Mol Genet. 2006 Oct 15;15 Spec No 2:R271-7 Filipski E, Delaunay F, King VM, Wu MW, Claustrat B, Gréchez-Cassiau A, Guettier C, Hastings MH, Francis L. Kubo T, Ozasa K, Mikami K, Wakai K, Fujino Y, Watanabe Y, Effects of chronic jet lag on tumor progression in mice. Cancer Miki T, Nakao M, Hayashi K, Suzuki K, Mori M, Washio M, Res. 2004 Nov 1;64(21):7879-85 Sakauchi F, Ito Y, Yoshimura T, Tamakoshi A. Prospective cohort study of the risk of prostate cancer among rotating-shift Pauley SM. Lighting for the human circadian clock: recent workers: findings from the Japan collaborative cohort study. research indicates that lighting has become a public health Am J Epidemiol. 2006 Sep 15;164(6):549-55 issue. Med Hypotheses. 2004;63(4):588-96 Pukkala E, Ojamo M, Rudanko SL, Stevens RG, Verkasalo Bell-Pedersen D, Cassone VM, Earnest DJ, Golden SS, PK. Does incidence of breast cancer and prostate cancer Hardin PE, Thomas TL, Zoran MJ. Circadian rhythms from decrease with increasing degree of visual impairment. Cancer multiple oscillators: lessons from diverse organisms. Nat Rev Causes Control. 2006 May;17(4):573-6 Genet. 2005 Jul;6(7):544-56 Schernhammer ES, Kroenke CH, Laden F, Hankinson SE. Blask DE, Brainard GC, Dauchy RT, Hanifin JP, Davidson LK, Night work and risk of breast cancer. Epidemiology. 2006 Krause JA, Sauer LA, Rivera-Bermudez MA, Dubocovich ML, Jan;17(1):108-11 Jasser SA, Lynch DT, Rollag MD, Zalatan F. Melatonin- depleted blood from premenopausal women exposed to light Bray MS, Young ME. Circadian rhythms in the development of at night stimulates growth of human breast cancer xenografts obesity: potential role for the circadian clock within the in nude rats. Cancer Res. 2005 Dec 1;65(23):11174-84 adipocyte. Obes Rev. 2007 Mar;8(2):169-81 Chen ST, Choo KB, Hou MF, Yeh KT, Kuo SJ, Chang JG. Hublin C, Partinen M, Koskenvuo M, Kaprio J. Sleep and Deregulated expression of the PER1, PER2 and PER3 genes mortality: a population-based 22-year follow-up study. Sleep. in breast cancers. Carcinogenesis. 2005 Jul;26(7):1241-6 2007 Oct;30(10):1245-53 Filipski E, Innominato PF, Wu M, Li XM, Iacobelli S, Xian LJ, Kondratov RV, Gorbacheva VY, Antoch MP. The role of Lévi F. Effects of light and food schedules on liver and tumor mammalian circadian proteins in normal physiology and molecular clocks in mice. J Natl Cancer Inst. 2005 Apr genotoxic stress responses. Curr Top Dev Biol. 2007;78:173- 6;97(7):507-17 216 Megdal SP, Kroenke CH, Laden F, Pukkala E, Schernhammer Sliwinski T, Rozej W, Morawiec-Bajda A, Morawiec Z, Reiter ES. Night work and breast cancer risk: a systematic review R, Blasiak J. Protective action of melatonin against oxidative and meta-analysis. Eur J Cancer. 2005 Sep;41(13):2023-32 DNA damage: chemical inactivation versus base-excision repair. Mutat Res. 2007 Dec 1;634(1-2):220-7 Schernhammer ES, Hankinson SE. Urinary melatonin levels and breast cancer risk. J Natl Cancer Inst. 2005 Jul Straif K, Baan R, Grosse Y, Secretan B, El Ghissassi F, 20;97(14):1084-7 Bouvard V, Altieri A, Benbrahim-Tallaa L, Cogliano V. Carcinogenicity of shift-work, painting, and fire-fighting. Lancet Anisimov VN. Light pollution, reproductive function and cancer Oncol. 2007 Dec;8(12):1065-6 risk. Neuro Endocrinol Lett. 2006 Feb-Apr;27(1-2):35-52 Adamantidis A, de Lecea L. Sleep and metabolism: shared Cos S, González A, Güezmes A, Mediavilla MD, Martínez- circuits, new connections. Trends Endocrinol Metab. 2008 Campa C, Alonso-González C, Sánchez-Barceló EJ. Melatonin Dec;19(10):362-70 inhibits the growth of DMBA-induced mammary tumors by decreasing the local biosynthesis of estrogens through the Kloog I, Haim A, Stevens RG, Barchana M, Portnov BA. Light modulation of aromatase activity. Int J Cancer. 2006 Jan at night co-distributes with incident breast but not lung cancer 15;118(2):274-8 in the female population of Israel. Chronobiol Int. 2008 Feb;25(1):65-81 Gery S, Komatsu N, Baldjyan L, Yu A, Koo D, Koeffler HP. The circadian gene per1 plays an important role in cell growth and Lin YM, Chang JH, Yeh KT, Yang MY, Liu TC, Lin SF, Su WW, DNA damage control in human cancer cells. Mol Cell. 2006 Chang JG. Disturbance of circadian gene expression in May 5;22(3):375-82 hepatocellular carcinoma. Mol Carcinog. 2008 Dec;47(12):925-33 Gholam D, Giacchetti S, Brézault-Bonnet C, Bouchahda M, Srinivasan V, Spence DW, Pandi-Perumal SR, Trakht I, Hauteville D, Adam R, Ducot B, Ghémard O, Kustlinger F, Cardinali DP. Therapeutic actions of melatonin in cancer: possible mechanisms. Integr Cancer Ther. 2008 Sep;7(3):189-203 Jasmin C, Lévi F. Chronomodulated irinotecan, oxaliplatin, and leucovorin-modulated 5-Fluorouracil as ambulatory salvage Blask DE. Melatonin, sleep disturbance and cancer risk. Sleep therapy in patients with irinotecan- and oxaliplatin-resistant Med Rev. 2009 Aug;13(4):257-64

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 143 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

Blask DE, Dauchy RT, Brainard GC, Hanifin JP. Circadian Dauchy RT, Dupepe LM, Ooms TG, Dauchy EM, Hill CR, Mao stage-dependent inhibition of human breast cancer metabolism L, Belancio VP, Slakey LM, Hill SM, Blask DE. Eliminating and growth by the nocturnal melatonin signal: consequences animal facility light-at-night contamination and its effect on of its disruption by light at night in rats and women. Integr circadian regulation of rodent physiology, tumor growth, and Cancer Ther. 2009 Dec;8(4):347-53 metabolism: a challenge in the relocation of a cancer research laboratory. J Am Assoc Lab Anim Sci. 2011 May;50(3):326-36 Cha EJ, Noh SJ, Kwon KS, Kim CY, Park BH, Park HS, Lee H, Chung MJ, Kang MJ, Lee DG, Moon WS, Jang KY. Expression Hansen J, Stevens RG. Night shiftwork and breast cancer risk: of DBC1 and SIRT1 is associated with poor prognosis of overall evidence. Occup Environ Med. 2011 Mar;68(3):236 gastric carcinoma. Clin Cancer Res. 2009 Jul 1;15(13):4453-9 Jung-Hynes B, Schmit TL, Reagan-Shaw SR, Siddiqui IA, Filipski E, Lévi F. Circadian disruption in experimental cancer Mukhtar H, Ahmad N. Melatonin, a novel Sirt1 inhibitor, processes. Integr Cancer Ther. 2009 Dec;8(4):298-302 imparts antiproliferative effects against prostate cancer in vitro in culture and in vivo in TRAMP model. J Pineal Res. 2011 Innominato PF, Focan C, Gorlia T, Moreau T, Garufi C, Mar;50(2):140-9 Waterhouse J, Giacchetti S, Coudert B, Iacobelli S, Genet D, Tampellini M, Chollet P, Lentz MA, Mormont MC, Lévi F, Kloog I, Portnov BA, Rennert HS, Haim A. Does the modern Bjarnason GA. Circadian rhythm in rest and activity: a urbanized sleeping habitat pose a breast cancer risk? biological correlate of quality of life and a predictor of survival Chronobiol Int. 2011 Feb;28(1):76-80 in patients with metastatic colorectal cancer. Cancer Res. 2009 Jun 1;69(11):4700-7 Lee H, Kim KR, Noh SJ, Park HS, Kwon KS, Park BH, Jung SH, Youn HJ, Lee BK, Chung MJ, Koh DH, Moon WS, Jang Mullenders J, Fabius AW, Madiredjo M, Bernards R, KY. Expression of DBC1 and SIRT1 is associated with poor Beijersbergen RL. A large scale shRNA barcode screen prognosis for breast carcinoma. Hum Pathol. 2011 identifies the circadian clock component ARNTL as putative Feb;42(2):204-13 regulator of the p53 tumor suppressor pathway. PLoS One. 2009;4(3):e4798 Pan A, Schernhammer ES, Sun Q, Hu FB. Rotating night shift work and risk of type 2 diabetes: two prospective cohort Vinogradova IA, Anisimov VN, Bukalev AV, Semenchenko AV, studies in women. PLoS Med. 2011 Dec;8(12):e1001141 Zabezhinski MA. Circadian disruption induced by light-at-night accelerates aging and promotes tumorigenesis in rats. Aging Poole EM, Schernhammer ES, Tworoger SS. Rotating night (Albany NY). 2009 Oct 2;1(10):855-65 shift work and risk of ovarian cancer. Cancer Epidemiol Biomarkers Prev. 2011 May;20(5):934-8 Bernard S, Cajavec Bernard B, Lévi F, Herzel H. Tumor growth rate determines the timing of optimal chronomodulated Schernhammer ES, Thompson CA. Light at night and health: treatment schedules. PLoS Comput Biol. 2010 Mar the perils of rotating shift work. Occup Environ Med. 2011 19;6(3):e1000712 May;68(5):310-1 Kloog I, Stevens RG, Haim A, Portnov BA. Nighttime light level Stow LR, Gumz ML. The circadian clock in the kidney. J Am co-distributes with breast cancer incidence worldwide. Cancer Soc Nephrol. 2011 Apr;22(4):598-604 Causes Control. 2010 Dec;21(12):2059-68 Wang Y, Hua L, Lu C, Chen Z. Expression of circadian clock Lee S, Donehower LA, Herron AJ, Moore DD, Fu L. Disrupting gene human Period2 (hPer2) in human colorectal carcinoma. circadian homeostasis of sympathetic signaling promotes World J Surg Oncol. 2011 Dec 13;9:166 tumor development in mice. PLoS One. 2010 Jun Bukalev AV, Vinogradova IA, Zabezhinski ĭ MA, Semenchenko 7;5(6):e10995 AV, Anisimov VN. [Light pollution increases morbidity and Lévi F, Okyar A, Dulong S, Innominato PF, Clairambault J. mortality rate from different causes in male rats]. Adv Gerontol. Circadian timing in cancer treatments. Annu Rev Pharmacol 2012;25(1):49-56 Toxicol. 2010;50:377-421 Fredslund SO, Bonefeld-Jørgensen EC. Breast cancer in the Liao C, Li J, Bin Q, Cao Y, Gao F. Chronomodulated Arctic--changes over the past decades. Int J Circumpolar chemotherapy versus conventional chemotherapy for Health. 2012 Aug 16;71:19155 advanced colorectal cancer: a meta-analysis of five Giacchetti S, Dugué PA, Innominato PF, Bjarnason GA, Focan randomized controlled trials. Int J Colorectal Dis. 2010 C, Garufi C, Tumolo S, Coudert B, Iacobelli S, Smaaland R, Mar;25(3):343-50 Tampellini M, Adam R, Moreau T, Lévi F. Sex moderates Rana S, Mahmood S. Circadian rhythm and its role in circadian chemotherapy effects on survival of patients with malignancy. J Circadian Rhythms. 2010 Mar 31;8:3 metastatic colorectal cancer: a meta-analysis. Ann Oncol. 2012 Dec;23(12):3110-6 Spivey A. Light at night and breast cancer risk worldwide. Environ Health Perspect. 2010 Dec;118(12):a525 Innominato PF, Giacchetti S, Bjarnason GA, Focan C, Garufi C, Coudert B, Iacobelli S, Tampellini M, Durando X, Mormont Sun CM, Huang SF, Zeng JM, Liu DB, Xiao Q, Tian WJ, Zhu MC, Waterhouse J, Lévi FA. Prediction of overall survival XD, Huang ZG, Feng WL. Per2 inhibits k562 leukemia cell through circadian rest-activity monitoring during chemotherapy growth in vitro and in vivo through cell cycle arrest and for metastatic colorectal cancer. Int J Cancer. 2012 Dec apoptosis induction. Pathol Oncol Res. 2010 Sep;16(3):403-11 1;131(11):2684-92 Xia HC, Niu ZF, Ma H, Cao SZ, Hao SC, Liu ZT, Wang F. Kim SH, Kim JH, Yu EJ, Lee KW, Park CK. The Deregulated expression of the Per1 and Per2 in human overexpression of DBC1 in esophageal squamous cell gliomas. Can J Neurol Sci. 2010 May;37(3):365-70 carcinoma correlates with poor prognosis. Histol Histopathol. 2012 Jan;27(1):49-58 Zeng ZL, Wu MW, Sun J, Sun YL, Cai YC, Huang YJ, Xian LJ. Effects of the biological clock gene Bmal1 on tumour growth Librodo P, Buckley M, Luk M, Bisso A. Chronotherapeutic drug and anti-cancer drug activity. J Biochem. 2010 delivery. J Infus Nurs. 2012 Sep-Oct;35(5):329-34 Sep;148(3):319-26

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 144 The contribution of circadian rhythms to cancer formation and mortality Birky TL, Bray MS

Luo Y, Wang F, Chen LA, Chen XW, Chen ZJ, Liu PF, li FF, Li Luo J, Sands M, Wactawski-Wende J, Song Y, Margolis KL. CY, Liang W. Deregulated expression of cry1 and cry2 in Sleep disturbance and incidence of thyroid cancer in human gliomas. Asian Pac J Cancer Prev. 2012;13(11):5725-8 postmenopausal women the Women's Health Initiative. Am J Epidemiol. 2013 Jan 1;177(1):42-9 Monsees GM, Kraft P, Hankinson SE, Hunter DJ, Schernhammer ES. Circadian genes and breast cancer Park HS, Bae JS, Noh SJ, Kim KM, Lee H, Moon WS, Chung susceptibility in rotating shift workers. Int J Cancer. 2012 Dec MJ, Kang MJ, Lee DG, Jang KY. Expression of DBC1 and 1;131(11):2547-52 Androgen Receptor Predict Poor Prognosis in Diffuse Large B Cell Lymphoma. Transl Oncol. 2013 Jun;6(3):370-81 Chen Z, Liu P, Li C, Luo Y, Chen I, Liang W, Chen X, Feng Y, Xia H, Wang F. Deregulated expression of the clock genes in Rodriguez C, Martín V, Herrera F, García-Santos G, gliomas. Technol Cancer Res Treat. 2013 Feb;12(1):91-7 Rodriguez-Blanco J, Casado-Zapico S, Sánchez-Sánchez AM, Suárez S, Puente-Moncada N, Anítua MJ, Antolín I. Chini CC, Escande C, Nin V, Chini EN. DBC1 (Deleted in Mechanisms involved in the pro-apoptotic effect of melatonin in Breast Cancer 1) modulates the stability and function of the cancer cells. Int J Mol Sci. 2013 Mar 25;14(4):6597-613 nuclear receptor Rev-erb α. Biochem J. 2013 May 1;451(3):453-61 Yoshida K, Sato M, Hase T, Elshazley M, Yamashita R, Usami N, Taniguchi T, Yokoi K, Nakamura S, Kondo M, Girard L, Chini EN, Chini CC, Nin V, Escande C. Deleted in breast Minna JD, Hasegawa Y. TIMELESS is overexpressed in lung cancer-1 (DBC-1) in the interface between metabolism, aging cancer and its expression correlates with poor patient survival. and cancer. Biosci Rep. 2013 Aug 23;33(4) Cancer Sci. 2013 Feb;104(2):171-7 Engelen E, Janssens RC, Yagita K, Smits VA, van der Yu H, Meng X, Wu J, Pan C, Ying X, Zhou Y, Liu R, Huang W. Horst GT, Tamanini F. Mammalian TIMELESS is involved in Cryptochrome 1 overexpression correlates with tumor period determination and DNA damage-dependent phase progression and poor prognosis in patients with colorectal advancing of the circadian clock. PLoS One. 2013;8(2):e56623 cancer. PLoS One. 2013;8(4):e61679 Kostoglou-Athanassiou I. Therapeutic applications of Zhang Y, Gu Y, Sha S, Kong X, Zhu H, Xu B, Li Y, Wu K. melatonin. Ther Adv Endocrinol Metab. 2013 Feb;4(1):13-24 DBC1 is over-expressed and associated with poor prognosis in colorectal cancer. Int J Clin Oncol. 2013 Jan 9; Lengyel Z, Lovig C, Kommedal S, Keszthelyi R, Szekeres G, Battyáni Z, Csernus V, Nagy AD. Altered expression patterns Zhao N, Yang K, Yang G, Chen D, Tang H, Zhao D, Zhao C. of clock gene mRNAs and clock proteins in human skin Aberrant expression of clock gene period1 and its correlations tumors. Tumour Biol. 2013 Apr;34(2):811-9 with the growth, proliferation and metastasis of buccal squamous cell carcinoma. PLoS One. 2013;8(2):e55894 Liu R, Fu A, Hoffman AE, Zheng T, Zhu Y. Melatonin enhances DNA repair capacity possibly by affecting genes This article should be referenced as such: involved in DNA damage responsive pathways. BMC Cell Biol. 2013 Jan 7;14:1 Birky TL, Bray MS. The contribution of circadian rhythms to cancer formation and mortality. Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2):133-145.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 145 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Case Report Section Paper co-edited with the European LeukemiaNet

A case of sole i(4)(p10) in myelodysplastic syndrome François Desangles, Aurélie Servonnet, Hubert Nielly, Serge Cremades, Jean-Etienne Pilo Laboratoire de Biologie Medicale, HIA Val de Grace, 74bd Port-Royal, F 75005 Paris, France (FD, AS), Medecine - Oncologie, HIA Begin, 69 ave de Paris, F 94160 Saint Mande, France (HN, SC), Laboratoire de Biologie Medicale, HIA Begin, 69 ave de Paris, F 94160 Saint Mande, France (JEP)

Published in Atlas Database: July 2013 Online updated version : http://AtlasGeneticsOncology.org/Reports/i4p10DesanglesID100073.html DOI: 10.4267/2042/53090 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Diagnosis RAEB2 (WHO 2008) Case report on a case of sole i(4)(p10) in myelodysplastic syndrome. Survival Clinics Date of diagnosis: 01-2013 Treatment: Azacytidine. Blood transfusions were no Age and sex more needed since. 79 years old male patient. Complete remission: no Previous history Treatment related death: no No preleukemia, previous malignancy (the patient had Relapse: no an acute myeloid leukemia (AML) of unknown type, Status: Alive 20 years ago), no inborn condition of note. Survival: 4 months Organomegaly No hepatomegaly, no splenomegaly, no enlarged Karyotype lymph nodes, no central nervous system involvement. Sample: Bone marrow Blood Culture time: 24h WBC: 2.7 X 10 9/l Banding: BHG HB: 9.7g/dl Results 9 Platelets: 73 X 10 /l 47,XY,+i(4)(p10).ish i(4)(p10)(FRGFR3++, Blasts: 0% wcp4+)[12] / 47,XY,+8[1] Bone marrow: Hypercellullar, multilineage dysplasia: Other molecular cytogenetics technics 13% blasts, no Auer rods, 12% ring sideroblasts, 4% FISH. probe cytocell: FGFR3/IGH; ERG1; basophils. RELN/TES; ETO/AML1 (RUNX1T1/RUNX1). probe Cyto-Pathology Q-Biogene: wcp4. Other molecular cytogenetics results Classification nuc ish 5p15(D5S721,D5S23x2)5q31(ERG1x2)[100] ; Cytology nuc ish 7q22(RELNx2)7q31(TESx2)[100] ; nuc ish 8q22(RUNX1T1x2),21q22(RUNX1x2)[100] ; nuc ish Refractory anemia with excess blasts (RAEB)

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 146 A case of sole i(4)(p10) in myelodysplastic syndrome Desangles F, et al.

4p16(FGFR3x4),14q32(IGHx2)[40/50] ; ish prognosis value of this karyotype anomaly: first, to +i(4)4p16(wcp4+,FGFR3++)[3/3] date the duration of treatment is only three months, but also the age of the patient, and a previous history of Comments AML are factors which impact the prognosis too greatly by themselves. Isochromosome 4p currently We present a new case of isochromosome 4p in a does not have a specific prognostic value in myeloid myeloid proliferation. The patient, a 79 years old man proliferations. developed an MDS (RAEB2), occurring 20 years after At the present time, what interpretation of i(4)(p10) can an acute myeloid leukemia not otherwise documented. be proposed? "Considering that trisomy 4 as the sole Cytogenetics on bone marrow aspirate revealed a abnormality of karyotype is common anomalies in unique abnormality in the karyotype, an additional AML and MDS", Chen et al. (1999) suppose that isochromosome 4p. FISH with wpc4 and FGFR3 "amplification of genes on 4p but not on 4q may play a probes confirmed the i(4p) as an extra chromosome. crucial role in the pathogenesis of MDS and AML". The most frequent molecular/cytogenetic abnormalities Recently, two genes located on chromosome 4 were in myeloid proliferations were absent: 5q31, 7q22-q31 identified as playing a role in myeloid proliferations. In probes (for del 5q or del 7q) and ETO + AML1 probes 2003, Dvorak et al. have described the increased (for +8 or +21) showed no abnormality.To our expression of FGFR3 (4p16), a member of the family knowledge, this is the sixth reported case of myeloid of tyrosine kinase genes, in myeloid proliferating cells proliferation with an isochromosome 4p as the sole of CML and AML. Furthermore TET2 in 4q24 is a karyotype abnormality. The previous published cases putative tumor suppressor in myeloid proliferations were M4-AML (3 cases), M2-AML (1 case) and (Delhommeau et al., 2009; Jankowska et al., 2009, RAEB-T (1 case) (Hagemeijer et al., 1981; Hoo et al., Vainchenker et al., 2011). Thus it can be assumed that 1995; Chen et al., 1999; Soriani et al., 2010). In this the presence of a supernumerary isochromosome 4p short series, only one relapse is recorded after 9 can increase the expression of FGFR3 in 4p16 without months, it is the unique case of double i(4p); two cases increasing the copy number of the tumor suppressor are noted as being in complete remission and two are gene TET2 in 4q24. not documented. The present case is not relevant to the Call for Collaborations [email protected]

Figure 1: RHG; partial panel of chromosomes 4 and i(4)(p10).

Figure 2: one metaphase labelled by wcp4: two normal chromosomes 4 and one extra derived chromosome 4.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 147 A case of sole i(4)(p10) in myelodysplastic syndrome Desangles F, et al.

Figure 3: nuc ish(FGFR3x4,IGHx2); FGFR3 red and IGH green.

Figure 4: two normal chromosomes 4 labelled by an FGFR3 red probe, one extra chromosome labelled by an FGFR3 red probes and two normal chromosomes 14 labelled by an IGH green probe.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 148 A case of sole i(4)(p10) in myelodysplastic syndrome Desangles F, et al.

Lécluse Y, Plo I, Dreyfus FJ, Marzac C, Casadevall N, References Lacombe C, Romana SP, Dessen P, Soulier J, Viguié F, Fontenay M, Vainchenker W, Bernard OA. Mutation in TET2 in Hagemeijer A, Hählen K, Abels J. Cytogenetic follow-up of myeloid cancers. N Engl J Med. 2009 May 28;360(22):2289- patients with nonlymphocytic leukemia. II. Acute 301 nonlymphocytic leukemia. Cancer Genet Cytogenet. 1981 Mar;3(2):109-24 Jankowska AM, Szpurka H, Tiu RV, Makishima H, Afable M, Huh J, O'Keefe CL, Ganetzky R, McDevitt MA, Maciejewski Hoo JJ, Gregory SA, Jones B, Szego K. Supernumerary JP. Loss of heterozygosity 4q24 and TET2 mutations isochromosome 4p in ANLL-M4 myelomonocytic type is associated with myelodysplastic/myeloproliferative neoplasms. associated with favorable prognosis. Cancer Genet Cytogenet. Blood. 2009 Jun 18;113(25):6403-10 1995 Feb;79(2):127-9 Soriani S, Marbello L, Colosimo A, Scarpati B, Grillo G, Chen Z, Richkind K, Roherty S, Velasco J, Lytle C, Brothman Cesana C. Double supernumerary isochromosome 4p in acute AR, Sandberg AA. A group of previously not recognized myelomonocytic leukemia. Leuk Res. 2010 Dec;34(12):e342-4 cytogenetic abnormalities in myeloid hematological malignancies. Cancer Genet Cytogenet. 1999 Sep;113(2):162- Vainchenker W, Delhommeau F, Constantinescu SN, Bernard 5 OA. New mutations and pathogenesis of myeloproliferative neoplasms. Blood. 2011 Aug 18;118(7):1723-35 Dvorak P, Dvorakova D, Doubek M, Faitova J, Pacholikova J, Hampl A, Mayer J. Increased expression of fibroblast growth This article should be referenced as such: factor receptor 3 in CD34+ BCR-ABL+ cells from patients with chronic myeloid leukemia. Leukemia. 2003 Dec;17(12):2418-25 Desangles F, Servonnet A, Nielly H, Cremades S, Pilo JE. A case of sole i(4)(p10) in myelodysplastic syndrome. Atlas Delhommeau F, Dupont S, Della Valle V, James C, Trannoy S, Genet Cytogenet Oncol Haematol. 2014; 18(2):146-149. Massé A, Kosmider O, Le Couedic JP, Robert F, Alberdi A,

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 149 Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas. Iconography is most welcome: there is no space restriction. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by bibliographic databases. Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction. Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with iconography of chromosomes. It is mandatory to use the specific "Submission form for Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German, Italian, and Spanish are welcome.

Subscription : The Atlas is FREE !

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose any potential conflict. Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete anonymity is difficult to achieve, informed consent should be obtained. Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org

A case of sole i(4)(p10) in myelodysplastic syndrome Desangles F, et al.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(2) 151