Ammonia-Oxidizing Archaea Use the Most Energy Efficient Aerobic Pathway for CO2 Fixation

Ammonia-oxidizing archaea use the most energy efficient aerobic pathway for CO2 fixation

Martin Könneke, Daniel M. Schubert, Philip C. Brown, Michael Hügler, Sonja Standfest, Thomas Schwander, Lennart Schada von Borzyskowski, Tobias J. Erb, David A. Stahl, Ivan A. Berg

Supporting Information: Supplementary Appendix

SI Text Phylogenetic analysis of the proteins involved in the HP/HB cycle in N. maritimus. The enzymes of the HP/HB cycle with unequivocally identified genes consisting of more than 200 amino acids were used for the phylogenetic analysis (Table 1). The genes for biotin carrier protein (Nmar_0274, 140 amino acids), small subunit of methylmalonyl-CoA mutase (Nmar_0958, 140 amino acids) and methylmalonyl-CoA epimerase (Nmar_0953, 131 amino acids) were not analyzed, because their small size prevents reliable phylogenetic tree construction. The genes for acetyl-CoA/propionyl-CoA carboxylase and methylmalonyl-CoA carboxylase homologues can be found in autotrophic Thaumarchaeota and aerobic Crenarchaeota as well as in some heterotrophic Archaea (SI Appendix, Figs. S7-S9, Table S4). Although these enzymes are usually regarded as characteristic enzymes of the HP/HB cycle, they also participate in various heterotrophic pathways in Archaea, e.g. in the methylaspartate cycle of acetate assimilation in haloarchaea (1), propionate and leucine assimilation (2, 3), oxaloacetate or methylmalonyl-CoA decarboxylation (4, 5), anaplerotic pyruvate carboxylation (6). In all three trees (SI Appendix, Figs. S7-S9) the crenarchaeal enzymes tend to cluster with thaumarchaeal ones, but there appears to be no special connection between aerobic Crenarchaeota (Sulfolobales) and Thaumarchaeota sequences. Thaumarchaeal 4-hydroxybutyryl-CoA dehydratase genes form a separate cluster closely related to bacterial sequences; the bacterial enzymes are probably involved in aminobutyrate fermentation (Fig. 2D and SI Appendix, Fig. S6). The aerobic Crenarchaeota (Sulfolobales) sequences are closely related to those of other autotrophic Crenarchaeota possessing the dicarboxylate/4-hydroxybutyrate cycle, but only distantly related to the sequences from Thaumarchaeota (Fig. 2D and SI Appendix, Fig. S6). This suggests an independent emergence of the 4-hydroxybutyryl-CoA dehydratase gene in Thaumarchaeota and autotrophic Crenarchaeota. N. martitimus 3-hydroxybutyryl-CoA dehydrogenase Nmar_1028 is homologous to the 3-hydroxybutyryl-CoA dehydrogenase domain of archaeal bifunctional (fusion) crotonyl-CoA hydratase/3-hydroxybutyryl-CoA dehydrogenase (7). This protein is not specific for autotrophic species and is present in most of Archaea. Interestingly, the Thaumarchaeota ancestor seems to have lost the crotonyl-CoA dehydratase domain of this protein, whereas the dehydrogenase domain remained untouched. Aerobic Crenarchaeota have the “full” version of the protein, and no special connection between crenarchaeal and thaumarchaeal proteins could be seen (SI Appendix, Fig. S13). Neither the ADP-forming 3-hydroxypropionyl-CoA nor 4-hydroxybutyryl-CoA synthetases from N. maritimus are homologous to the corresponding AMP-forming synthetases from M. sedula (7-10) (Figs. 2A and 2B, SI Appendix, Figs. S10 and S11). The homologous proteins are distributed in euryarchaeal and bacterial genomes, but not in Crenarchaeota. The N. maritimus 3-hydroxypropionyl-CoA dehydratase/crotonyl-CoA hydratase Nmar_1308 shares high sequence identity with bacterial enzymes (Fig. 2C and SI Appendix, Fig. S12), mainly to those from Firmicutes, and is thus an obvious example of lateral gene transfer. The genes for reductases of the cycle (malonyl-CoA, malonic semialdehyde, acryloyl- CoA, succinyl-CoA and succinyl-CoA reductases) functioning in N. maritimus are not known. The BLASTP search using the corresponding proteins of M. sedula as queries against the genome of N. maritimus revealed the absence of closely related proteins (SI Appendix, Table S3). Furthermore, the best hits outside of aerobic Crenarchaeota (Sulfolobales) were (heterotrophic) Bacteria, Archaea and Eukarya, but never Thaumarchaeota. Therefore, N. maritimus probably uses unrelated enzymes responsible for the corresponding transformations in the HP/HB cycle. This again lends support to the hypothesis that the autotrophic cycles evolved independently. Taken together, our phylogenetic analysis indicates the absence of any specifical relationship between the proteins involved in the HP/HB cycle in Crenarchaeota and in Thaumarchaeota. This indicates that this pathway evolved independently in the ancestors of Thaumarchaeota and aerobic Crenarchaeota. Importantly, the corresponding proteins are present in all currently sequenced thaumarchaeal genomes, thus suggesting their potential for autotrophic growth using the HP/HB cycle.

Comparison of ATP requirements for the synthesis of central metabolic precursors.

The ATP costs for the different aerobic autotrophic CO2 fixation pathways (Table 3) were calculated as followed. Calvin-Benson cycle. The synthesis of the main product of the cycle, glyceraldehyde 3- phosphate, requires 9 ATP. Its further conversion to phosphoenolpyruvate via classical reactions of glycolysis leads to reimbursement of an ATP equivalent (8 ATP). Oxaloacetate is produced in phosphoenolpyruvate carboxylase reaction (no additional ATP is required, i.e. 8 ATP). Pyruvate formation from phosphoenolpyruvate in pyruvate kinase reaction leads to the release of one ATP equivalent (7 ATP for 1 pyruvate). Acetyl-CoA is synthesized through pyruvate dehydrogenase reaction (7 ATP). Glutamate precusor 2-oxoglutarate is synthesized from acetyl-CoA and oxaloacetate via citrate synthase, aconitase and isocitrate dehydrogenase reactions (15 ATP). Note that the extra costs of the oxygenase side reaction of the key enzyme of the Calvin-Benson cycle (ribulose-1,5-bisphosphate carboxylase) are not taken into account. 3-Hydroxypropionate bi-cycle. The synthesis of the main product of the cycle, pyruvate, costs 7 ATP. Acetyl-CoA is synthesized through pyruvate dehydrogenase or pyruvate:acceptor oxidoreductase reaction (7 ATP). Pyruvate conversion to phosphoenolpyruvate proceeds via pyruvate phosphate dikinase reaction (9 ATP) (11, 12). Oxaloacetate is produced from phosphoenolpyruvate via phosphoenolpyruvate carboxylase (9 ATP). 2-Oxoglutarate synthesis proceeds from acetyl-CoA and oxaloacetate via citrate synthase, aconitase and isocitrate dehydrogenase reactions (16 ATP). Note that the fate of a pyrophosphate molecule synthesized in the propionyl-CoA synthase reaction is not known. It is either hydrolyzed by soluble pyrophosphatase, or the energy could be partly recovered through the action of proton-translocating pyrophosphatase. In any case, it does not significantly change the ATP costs of the pathway. M. sedula HP/HB cycle. The main product of the cycle is acetyl-CoA (6 ATP). An additional half-turn of the cycle lead to the formation of succinyl-CoA (10 ATP), which is converted to oxaloacetate either via succinyl-CoA synthetase, succinate dehydrogenase, fumarase and malate dehydrogenase (9 ATP), or via succinyl-CoA reductase and then via succinic semialdehyde dehydrogenase, succinate dehydrogenase, fumarase and malate dehydrogenase (10 ATP) (13). Phosphoenolpyruvate synthesis requires phosphoenolpyruvate carboxykinase activity (9 or 10 ATP, depending on the pathway of succinyl-CoA conversion into oxaloacetate), and pyruvate is synthesized from malate via malic enzyme (9 or 10 ATP, depending on the pathway of succinyl-CoA conversion into malate). 2-Oxoglutarate synthesis proceeds from acetyl-CoA and oxaloacetate (15 or 16 ATP). Note that the fate of two pyrophosphate molecules synthesized in the cycle (in 3- hydroxypropionyl-CoA and 4-hydroxybutyryl-CoA synthetase reactions) is not known. It is probably hydrolyzed by soluble or proton-translocating pyrophosphatase. In the last case, one proton/pyrophosphate would be translocated through the membrane, making the pathway slightly more energetically efficient. N. maritimus HP/HB cycle. The main product of the cycle is acetyl-CoA. Since the synthetases in the cycle produce ADP instead of AMP, the synthesis of one acetyl-CoA costs 4 ATP. An additional half-turn of the cycle leads to the formation of succinyl-CoA (7 ATP), which is then converted to oxaloacetate via succinyl-CoA synthetase, succinate dehydrogenase, fumarase and malate dehydrogenase (6 ATP, see Fig. 1, SI Appendix, Table S1). Since phosphoenolpyruvate carboxykinase Nmar_0392 is the only gene in the genome capable of catalyzing C4 conversion to C3 (malic enzyme as well as phosphoenolpyruvate carboxylase genes cannot be identified), phosphoenolpyruvate synthesis requires 7 ATP. The genome of N. maritimus possesses a gene encoding pyruvate:phosphate dikinase (Nmar_0951), whereas the genes for other genes capable of catalyzing phosphoenolpyruvate/pyruvate conversion cannot be identified. Therefore, pyruvate formation from phosphoenolpyruvate leads to the release of two ATPs (5 ATP). 2- Oxoglutarate synthesis proceeds from acetyl-CoA and oxaloacetate (10 ATP). For the schemes of M. sedula and N. maritimus central carbon metabolism, see Fig. 1. The values for the amount of ATP required for the synthesis of 1 g of the cell biomass (Table 3) are designated here as the amount of ATP (in mole) required for the formation of the central metabolic precursors acetyl-CoA, pyruvate, phosphoenolpyruvate, oxaloacetate and 2-oxoglutarate necessary for the synthesis of 1 g of dry cells. The amounts of the precursors required for the biosynthesis were taken from (14). SI Materials and Methods

Microbial strain and growth conditions. For cell extract assays, Nitrosopumilus maritimus strain SCM1 was cultivated under aerobic conditions at 28°C in 12 l or 15 l batch-cultures using a 4-(2-hydroxyethyl)-1-piperazineethanesulfonate (HEPES)-buffered medium as described previously (15, 16). Ammonia served as energy source, ambient CO2 as carbon source. Cultures were slightly shaken by hand once a day. For growth yield determination, N. maritimus strain SCM1 and Nitrosococcus oceani (provided by Eva Spieck, University of Hamburg, Germany) were grown under the same conditions in unbuffered SCM medium (15) containing 0.5 mM NH4Cl (pH 7.4; 28°C). Biomass was determined from cells washed with ammonium acetate and dryed at 60°C. Growth was monitored by following the formation of nitrite (17) and by direct counting of SYBR green I stained cells on 0.1 µm pore size polycarbonate filters by fluorescence microscopy (18). Ammonia concentration was measured with a spectrophotometric assay (19). Purity of the culture was routinely checked by phase contrast microscopy. Cells were harvested in the late growth phase with a cross- flow filtration system equipped with a 0.1 µm pore size filter cassette (Sartocon-Slice Microsart, Sartorius, Göttingen). In order to enhance the efficiency of physical destruction of the cells via French press, concentrated cells were washed once with diluted media (water : media; 7:1) followed by centrifugation (40 min at 4,650  g). Cell pellets were stored frozen at -20°C.

Syntheses. 3-Hydroxypropionate was synthesized as described previously (20). 4- hydroxybutyrate was synthesized from 58 mmol γ-butyrolactone and 58 mmol NaOH dissolved in 200 ml methanol and boiled on reflux for 5 h. After evaporation of the solvent, the white crystalline product was obtained at 99% purity (1H-, and 13C-NMR). Acetyl-CoA, propionyl-CoA, crotonyl-CoA and succinyl-CoA were synthesized from their anhydrides by the method of Simon & Shemin (21). Mesaconyl-C1-CoA was synthesized chemically from the free acid by the mixed anhydride method of Stadtman (22) and purified using high performance liquid chromatography (HPLC) (23). 4-Hydroxybutyryl-CoA was synthesized enzymatically using 0.75 U Nmar_0206 in 3.1 ml reaction mixture containing 81 mM MOPS

(pH 7.0), 10 mM MgCl2, 4.0 mM dithiothreitol (DTT), 8.3 mM CoA, 20 mM 4- hydroxybutyrate, 12 mM ATP, 16.6 mM NADH, 16.6 mM phosphoenolpyruvate, 120 U lactate dehydrogenase, and 80 U pyruvate kinase. After incubation for 1 h at 30 °C, the reaction was stopped by adding 0.3 ml of 20 % formic acid. The product was purified by preparative HPLC (24) and lyophilized. The dry powders of the CoA-esters were stored at - 20 °C.

Preparation of cell extracts. Cell extracts were prepared under both oxic and anoxic conditions. Cells were suspended in 2 volumes of 20 mM 3-(N-morpholino)propanesulfonic acid (Mops)/KOH, pH 7.0, containing 0.1 mg ml-1 DNase I and 0.5 mM DTT, and the cell suspension was passed through a chilled French pressure cell at 137 kPa. The lysate was ultracentrifuged for 1 h (100,000 x g, 4°C), and aliquots of the supernatant were stored anaerobically at -70°C until use.

Enzyme assays. Spectrophotometric enzyme assays (0.5 ml assay mixture) were performed aerobically in 0.5 ml cuvettes at 30°C, unless otherwise indicated. Anaerobic assays were done under a N2 headspace after degassing with N2. Reactions involving NAD(P)H were -1 -1 -1 -1 measured at 365 nm (εNADH = 3.4 mM cm , εNADPH = 3.5 mM cm ; Ref. 25), unless otherwise stated.

Acetyl-CoA and propionyl-CoA carboxylases were measured radiochemically by 14 determining propionyl-CoA or acetyl-CoA-dependent fixation of CO2 into acid-stable products. The reaction mixture (0.35 ml) contained 100 mM Tris/HCl (pH 7.6), 5 mM DTT, 14 -1 10 mM KCl, 5 mM MgCl2, 5 mM ATP, 15 mM NaH CO3 (22.5 kBq μmol ), and cell extract. The reaction was started by the addition of CoA-ester (1 mM). Acid-stable 14C was determined as described previously (26). Inhibition by avidin was studied by adding avidin to the cell extracts at a final concentration of 5 μg ml-1; in a control, biotin (0.2 mg ml-1) was added together with avidin to prevent inhibition.

Malonyl-CoA reductase was measured as malonyl-CoA dependent NAD(P)H oxidation

(27) in 100 mM Mops/KOH (pH 7.0) containing 5 mM DTT, 10 mM MgCl2, 0.5 mM NAD(P)H, and cell extract. The reaction was started by the addition of malonyl-CoA (0.9 mM).

Malonic semialdehyde reductase was measured in 100 mM Mops/KOH (pH 7.0) containing 5 mM DTT, 10 mM MgCl2, 0.7 mM NAD(P)H, 0.2 mM malonyl-CoA, and 1 U malonyl-CoA reductase from Sulfolobus tokodaii (27). The mixture was incubated for 15 min, allowing the formation of malonic semialdehyde, and then started by addition of cell extract.

3-Hydroxypropionyl-CoA synthetase activity was measured either as 3- hydroxypropionyl-CoA formation from 3-hydroxypropionate, ATP and CoA (ultra performance liquid chromatography, UPLC) or spectrophotometrically following ADP formation in a coupled assay. In a chromatographic assay, 3-hydroxypropionate- and ATP- dependent formation of 3-hydroxypropionyl-CoA was followed in the reaction mixture containing 100 mM Mops/KOH (pH 7.0), 5 mM DTT, 10 mM MgCl2, 3 mM ATP, 1 mM CoA, 10 mM 3-hydroxypropionate, and cell extract or purified protein. After appropriate intervals, 20 µl of the assay mixture was transferred to ice and stopped by addition of 5 µl of

1 M HCl. Protein was removed by centrifugation, and the samples were analysed by RP-C18 UPLC. In a spectrophotometric assay, 3-hydroxypropionate and CoA-dependent NADH oxidation was followed in the above mentioned reaction mixture which was supplemented with 9 mM phosphoenolpyruvate, 0.5 mM NADH, 0.9 units of pyruvate kinase and 6.3 units of lactate dehydrogenase. To determine whether AMP or ADP was formed in the reaction, myokinase (4.7 U) was added to the reaction mixture.

3-Hydroxypropionyl-CoA dehydratase was measured by coupling the reaction to crotonyl-CoA carboxylase/reductase from Rhodobacter sphaeroides which reductively carboxylates crotonyl-CoA and acryloyl-CoA to ethylmalonyl-CoA and methylmalonyl-CoA, respectively (28). The reaction mixture contained 200 mM Tris/HCl (pH 7.8), 5 mM MgCl2,

5 mM DTT, 40 mM NaHCO3, 0.5 mM NADPH, 1 mM CoA, 10 mM 3-hydroxypropionate, 10 unit of recombinant propionate CoA-transferase from Clostridium propionicum, 4 units of recombinant crotonyl-CoA carboxylase/reductase, and cell extract or purified protein. The reaction mixture was incubated 15 min to allow the formation of 3-hydroxypropionyl-CoA (its concentration after incubation was 0.9 mM), and the reaction was started by the addition of enzyme. In the control, 3-hydroxypropionate, CoA or propionate CoA-transferase were omitted. For the determination of catalytic properties of the enzyme, the concentration of 3- hydroxypropionyl-CoA was varied by adding different amounts of CoA. In each case, the sample was taken before the start of the reaction and analyzed by HPLC (29) in order to determine the actual 3-hydroxypropionyl-CoA concentration.

Succinyl-CoA reductase and succinic semialdehyde reductase were measured as described for malonyl-CoA reductase, but with succinyl-CoA (1 mM) and succinic semialdehyde (2 mM), respectively, instead of malonyl-CoA.

4-Hydroxybutyryl-CoA and succinyl-CoA synthetases were measured as described above for 3-hydroxypropionyl-CoA synthetase, but with 4-hydroxybutyrate (10 mM) or succinate (10 mM) instead of 3-hydroxypropionate.

4-Hydroxybutyryl-CoA dehydratase was measured anaerobically in the spectrophotometer by coupling the reaction to Etr1p, which catalyzes the NADPH-dependent reduction of crotonyl-CoA to butyryl-CoA (30). Anoxic reaction mixtures (0.2 ml) contained 100 mM sodium phosphate buffer (pH 7.4), 0.2 mM NADPH, 1 μg Etr1p, and 150 μM (for Nmar_0207) or 250 μM (for C. aminobutyricum enzyme) 4-hydroxybutyryl-CoA. The reaction was started by addition of 0.4-0.5 μg of enzyme that was kept anaerobically sealed on -1 -1 ice, and the reaction was followed at 30 °C and 340 nm (εNADPH = 6.22 mM cm ). Apparent

Km values for 4-hydroxybutyryl-CoA were determined by varying the concentration of the CoA ester from 20 μM - 800 μM. Oxygen sensitivity was assayed by exposing aliquots of an enzyme on ice to oxygen and quantifying its activity at different time points.

Crotonyl-CoA hydratase activity was determined in an HPLC-based assay following the formation of 3-hydroxybutyryl-CoA from crotonyl-CoA. The reaction mixture contained 200 mM Tris/HCl (pH 7.8), 5 mM DTT, 1 mM crotonyl-CoA, and cell extract or purified protein. After appropriate time intervals, 50 µl of the assay mixture was transferred to ice and stopped by addition of 10 µl of 1 M HCl. Protein was removed by centrifugation, and the samples were analysed by RP-C18 HPLC, as described previously (29).

3-Hydroxybutyryl-CoA dehydrogenase was measured spectrophotometrically as (S)-3- hydroxybutyryl-CoA-dependent reduction of NAD+ in the following reaction mixture: + 100 mM Tris/HCl (pH 8.8), 5 mM DTT, 10 mM MgCl2, 0.5 mM NAD , 0.2 mM (S)-3- hydroxybutyryl-CoA, and cell extract. No activity was detected with NADP+ or (R)-3- hydroxybutyryl-CoA as substrates.

Ribulose 1,5-bisphosphate carboxylase/oxygenase was determined as ribulose 1,5- 14 bisphosphate-dependent fixation of NaH CO3 into acid-stable products, as described previously (31).

Mesaconyl-CoA C1-C4 CoA-transferase activity was measured following mesaconyl- C4-CoA formation from mesaconyl-C1-CoA in an UPLC-based assay (23). The reaction mixture contained 100 mM Mops/KOH (pH 7.0), 5 mM DTT, 5 mM MgCl2, 0.5 mM mesaconyl-C1-CoA, and cell extract. After appropriate time intervals, 20 µl of the assay mixture was transferred to ice and stopped by addition of 5 µl of 1 M HCl. Protein was removed by centrifugation, and the samples were analysed by RP-C18 UPLC.

Succinic semialdehyde dehydrogenase (non CoA-acylating) activity was measured spectrophotometrically as succinic semialdehyde-dependent reduction of NAD(P)+ in the reaction mixture containing 100 mM Mops/KOH (pH 7.0) or 100 mM Tris/HCl (pH 8.8), + 5 mM MgCl2, 5 mM DTT, 5 mM NAD(P) , 5 mM succinic semialdehyde, and cell extract. Malic enzyme [NAD(P)-dependent malate dehydrogenase (decarboxylating)] was tested in an assay mixture containing 100 mM Tris/HCl (pH 7.6), 5 mM DTT, 5 mM MnCl2, 1 mM NAD+ or NADP+, and cell extract. The reaction was started with (L)-malate (10 mM).

Pyruvate and 2-oxoglutarate:acceptor oxidoreductases were measured anoxically as 14 CO2 exchange reaction with the carboxyl group of pyruvate and 2-oxoglutarate, respectively; this represents a partial reaction of those enzymes. The reaction mixture

(0.35 ml) contained 100 mM Mops/KOH (pH 7.0), 5 mM MgCl2, 5 mM DTT, 0.2 mM CoA, 14 -1 7.5 mM NaH CO3 (110 kBq μmol ), and cell extract. The reaction was started by the addition of pyruvate or 2-oxoglutarate (10 mM), and the acid-stable 14C was determined after appropriate time intervals (26).

3-Hydroxypropionate conversion to propionyl-CoA. The reaction mixture contained

100 mM Mops/KOH (pH 7.0), 5 mM MgCl2, 1 mM NADPH, 0.5 mM CoA, 1.5 mM ATP, 10 mM 3-hydroxypropionate, and 1.5 mg protein ml-1. In a control, 3-hydroxypropionate was omitted. The reaction was performed aerobically and was started by the addition of cell extract. The reaction was stopped after different time intervals by mixing the samples (50 µl) with 10 μl of 1M HCl. The samples were centrifuged (4 °C; 20,000 × g; 15 min) and analyzed by HPLC using a RP-C18 column, as described previously (29). The identification of the CoA esters was based on co-chromatography with standards (29, 32).

4-Hydroxybutyrate conversion to acetyl-CoA by cell extracts of N. maritimus. The assay mixture contained 100 mM Mops/KOH (pH 7.0), 5 mM MgCl2, 1.5 mM ATP, 5 mM DTT, 0.5 mM CoA, 1 mM NAD+, 10 mM 4-hydroxybutyrate, and cell extract (1.5 mg protein ml–1). In a control, ATP was omitted. The reaction was performed aerobically as well as anaerobically at 30 °C and was started by the addition of cell extract. The analysis of the samples was performed as described above for 3-hydroxypropionate conversion.

Analytical UPLC. CoA and CoA-esters were identified and quantified by an Acquity UPLC system (Waters) using a reversed phase C18 column (Acquity UPLC BEH C18 column, 130 Å, 1.7 µm, 2.1 x 100 mm, Waters). A 6.5 min gradient from 2 to 10 % acetonitrile in 10 mM potassium phosphate buffer (pH 7.0) with a flow rate of 0.2 ml min-1 was used. Reaction products and standard compounds were detected by UV absorbance at 260 nm with a photodiode array detector. The amount of product was calculated from the relative peak area assuming the same coenzyme A absorption coefficient at 260 nm. The identification of the CoA esters was based on co-chromatography with standards and analysis of the UV spectra of the products. Molecular biological techniques. The in silico cloning steps were performed with the program Clone Manager 7.11 (Scientiﬁc & Educational Software). Standard protocols were used for purification, preparation, cloning, transformation and amplification of DNA (33-35). Plasmid DNA isolation, purification of PCR products and plasmids were performed using Qiagen kits according to the manufacturer’s specifications. Chromosomal DNA was extracted using an illustra bacteria genomicPrep Mini Spin Kit (GE Healthcare).

Cloning of genes from N. maritimus. The gene encoding 3-hydroxypropionyl-CoA dehydratase/crotonyl-CoA hydratase (Nmar_1308) was amplified by PCR with Mango Taq ™ DNA polymerase (Bioline, Luckenwalde, Germany) using a forward primer (5’- CTTGACAGGATCCCATGTCACTAGTTAC-3’) introducing BamHI site (underlined), and a reverse primer (5’-GAAATAATCGATAGCTATTTCTTTGACTTGTTG-3’) introducing ClaI site (underlined). PCR conditions were as follows: 34 cycles of 30 s denaturation at 95 °C, 30 s primer annealing at 60 °C, and elongation at 72 °C for 150 s. The PCR product was isolated and cloned into the expression vector pET16b containing N-terminal His-Tag.

The gene encoding 4-hydroxybutyryl-CoA dehydratase (Nmar_0207) was amplified by PCR with Q5 High Fidelity DNA polymerase (New England Biolabs, Frankfurt, Germany) using a forward primer (5’-GATGATCTCGAGTACATGGCTAATGTC-3’) introducing XhoI site (underlined), and a reverse primer (5’- GAATTGGTAAGCTTTCAGAGTACAGAATC-3’) introducing HindIII site (underlined). PCR conditions were as follows: 35 cycles of 10 s denaturation at 98 °C, 30 s primer annealing at 64 °C, and elongation at 72 °C for 50 s. The PCR product was isolated and cloned into the expression vector pET16b containing N-terminal His-Tag.

Cloning of the 4-hydroxybutyryl-CoA dehydratase gene from C. aminobutyricum. The gene was amplified by PCR with Phusion ™ DNA polymerase (Thermo Scientific, St Leon- Rot, Germany) using a forward primer (5’- TTAAGCTAGCATGGTAATGACAGCAGAACAGTAC-3’) introducing NheI site (underlined), and a reverse primer (5’- CTTAGGAATTCTAGCAACTTTTTATTTAATTCCAGCG-3’) introducing EcoRI site (underlined). PCR conditions were as follows: 35 cycles of 20 s denaturation at 98 °C, 30 s primer annealing at 55 °C, and elongation at 72 °C for 90 s. The PCR product was isolated and cloned into the expression vector pET28b containing N-terminal His-Tag, yielding plasmid pTE388. Gene synthesis. N. maritimus genes encoding 3-hydroxypropionyl-CoA synthetase (Nmar_1309) and 4-hydroxybutyryl-CoA synthetase (Nmar_0206) were synthesized by Eurofins MWG Operon (Ebersberg, Germany). The sequences were optimized through codon usage adaptation for the expression in E. coli (SI Appendix, Table S2). In order to create an NdeI restriction site, CAT was integrated in front of the start codon. Behind the stop codon, a HindIII restriction site was integrated. The synthesized genes were cloned in the expression vector pET16b containing N-terminal His-Tag.

Heterologous expression of N. maritimus genes in Escherichia coli. Except for 4- hydroxybutyryl-CoA dehydratase (Nmar_0207), all recombinant enzymes were produced in E. coli Rosetta 2 (DE3) that had been transformed with the corresponding plasmids. The cells were grown at 37 °C in LB medium supplemented with 100 µg ml-1 of ampicillin and 34 µg -1 ml of chloramphenicol. Expression was induced at an optical density at 578 nm (OD578) of 0.6 with 1 mM isopropyl-thiogalactopyranoside, and the temperature was lowered to 20 °C. The cells were harvested after additional growth for 3 h and stored at -20 °C until use (see below).

Heterologous expression of 4-hydroxybutyryl-CoA dehydratase from C. aminobutyricum and N. maritimus in Escherichia coli. Recombinant 4-hydroxybutyryl-CoA dehydratase from C. aminobutyricum was produced in E. coli BL21 (DE3) transformed with chaperone plasmid pBB541 (GroES, GroEL; Ref. 36) and pTE388 (4-hydroxybutyryl-CoA dehydratase), according to (37) with modifications, as described below. The cells were grown aerobically at 37 °C in 1 l LB medium supplemented with 50 µg ml-1 of spectinomycin and 20 µg ml-1 of kanamycin to an optical density at 600 nm (OD600) of 1. Then, the culture was transferred to a sterile Schott bottle with a stirring bar. 100 µM Fe(II)SO4 and 100 µM Fe(III)citrate were added, and the expression was induced by addition of 0.5 mM IPTG. The Schott bottle was shut tightly for anaerobic conditions, and the temperature was lowered to 20 °C with stirring at very low rpm. The expression culture was incubated over night for another 15 h, before the cells were harvested by centrifugation (4,500  g; 10 min; 4 °C). In an anaerobic chamber, the supernatant was removed and the cell pellet was immediately used for protein purification (see below). Recombinant 4-hydroxybutyryl-CoA dehydratase from N. maritimus was essentially expressed following the protocol described above, except that the LB medium contained 50 µg ml-1 spectinomycin and 100 µg ml-1 ampicillin.

Heterologous expression and purification of propionate CoA-transferase of Clostridium propionicum. A strep-tagged C. propionicum propionate CoA-transferase was heterologously produced in E. coli Rosetta 2 (DE3) using the plasmid pASK-7plus-pct obtained from Prof. Thorsten Selmer (Aachen, Germany) (38). The cells were grown at 37 °C in lysogenic broth supplemented with 0.2 % glucose, 50 µg ml-1 of carbenicillin and 34 µg ml-1 of -1 chloramphenicol. Expression was induced at an OD578 of 0.6 with 200 ng ml of anhydrotetracycline, and the cells were harvested after additional growth for 2 h and stored at -20 °C until use. For the purification of the enzyme, 8 g cells were suspended in 50 mM HEPES (pH 7.6) containing 150 mM NaCl and 0.1 mg ml-1 DNase I. The suspension was passed twice through a chilled French pressure cell at 137 MPa, and the cell lysate was centrifuged for 1 h (100,000  g; 4 °C). The supernatant was applied at a flow rate of 1 ml min-1 to a 6-ml Strep-Tactin® Superflow® column (IBA, Göttingen) that had been equilibrated with 50 mM HEPES containing 150 mM NaCl (pH 7.6). The recombinant protein was eluted with the same buffer containing 2.5 mM desthiobiotin. The enzyme was concentrated using a 10K Microsep advance centrifugal device (Pall Corporation), mixed with glycerol to a final concentration of 50% (v/v) and stored at -20 °C.

Heterologous expression and purification of crotonyl-CoA carboxylase/reductase of R. sphaeroides. A histidine-tagged version of the enzyme was produced using the plasmid pTE42 as described in detail in (28).

Purification of recombinant N. maritimus proteins. Except for 4-hydroxybutyryl-CoA dehydratase (Nmar_0207) purification, frozen E. coli cells from the respective overexpression of N. maritimus genes were suspended in a double volume of 20 mM Tris/HCl (pH 7.8) -1 containing 300 mM NaCl, 5 mM MgCl2 and 0.1 mg ml DNase I. The suspensions were passed twice through a chilled French pressure cell at 137 MPa, and the cell lysates were centrifuged for 1 h (100,000 × g; 4°C). The supernatant was applied at a flow rate of 0.3 ml min-1 to a 1-ml Protino Ni-NTA column (Macherey-Nagel) that had been equilibrated with 20 mM Tris/HCl containing 300 mM NaCl (pH 7.8). The column was washed with the same buffer containing 50 mM imidazole at a flow rate of 1 ml min-1 to elute unwanted protein.

The recombinant His10-tagged enzymes were eluted with the same buffer containing 300 mM imidazole. The enzymes were concentrated using a 10K Microsep advance centrifugal device (Pall Corporation) and immediately used for the enzyme characterization (for 4- hydroxybutyryl-CoA synthetase) or stored at -20 °C (for 3-hydroxypropionyl-CoA synthetase and 3-hydroxypropionyl-CoA dehydratase/crotonyl-CoA hydratase).

Purification of 4-hydroxybutyryl-CoA dehydratase from C. aminobutyricum and N. maritimus. All steps were carried out under anaerobic conditions. The freshly harvested pellets (approximately 1-2 g fresh weight) were suspended in a double volume of 20 mM Tris/HCl (pH 8.0) containing 500 mM NaCl and 0.1 mg ml-1 DNAse I. The suspension was passed through a French pressure cell into an anaerobic vial, and the lysate was centrifuged (50,000  g; 30 min; 4 °C). Buffer A, containing 20 mM Tris/HCl (pH 8.0), 500 mM NaCl, 5 mM β-mercaptoethanol and 15 mM imidazole, and buffer B, containing 20 mM Tris/HCl (pH 8.0), 500 mM NaCl, 5 mM β-mercaptoethanol and 500 mM imidazole were prepared, and degassed. The supernatant was applied onto a 1 ml Ni-Sepharose Fast Flow column (HisTrap FF; GE Healthcare) that had been equilibrated with 10 ml of buffer A. The column was washed with 10 ml of a solution of 10% buffer B in buffer A, before the protein was eluted with buffer B. Then the buffer was exchanged to 20 mM Tris/HCl (pH 8.0), containing 500 mM NaCl and 5 mM dithiothreitol by using a desalting column (PD-10; GE Healthcare), and the protein was concentrated by ultrafiltration (Amicon Ultra; 0.5 ml; 30K). The protein was kept anaerobically sealed on ice, and was directly used for enzyme measurements.

Calculation of in vivo specific carbon fixation rate of N. maritimus. The specific growth rate (µ) was calculated from the generation time td of the culture, µ = ln 2/td. The specific substrate (S) consumption (dS) per time unit (dt) is: dS/dt = (µ/Y)∙X, where Y represents the growth yield (1 g of dry cell mass formed per 0.5 g of carbon fixed), and X represents the cell dry mass in g (1 g of cell dry mass, corresponding to approximately 0.5 g of protein). Based on this equation, the specific carbon fixation rate was calculated. N. maritimus grew with a generation time of 35 h, which corresponds to a specific carbon fixation rate in vivo of -1 -1 27 nmol min mg protein. Because one C2-compound (acetyl-CoA) is synthesized in the HP/HB cycle, the minimal in vivo activity of enzymes in the cycle is 13.5 nmol min-1 mg-1 protein.

Database search and phylogenetic analysis. Query sequences were obtained from the National Center for Biotechnology Information (NCBI) data base. The BLAST searches were performed via NCBI BLAST server (http://www.ncbi.nlm.nih.gov/BLAST/) (39). The amino acid sequences were aligned with sequences from GenBank using CLUSTALW (40) implemented within BioEdit software (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). The alignments are available from the authors upon request. The phylogenetic tree was reconstructed using a neighbour-joining algorithm (41) in the TREECONW program package (42). The positions with gaps were not taken into account in the phylogenetic reconstructions. The following number of positions was used during the analysis: 3-hydroxypropionyl-CoA synthetase (Figs. 2A, S10), 532 amino acids; 4-hydroxybutyryl-CoA synthetase (Figs. 2B, S11), 625 amino acids; 3-hydroxypropionyl-CoA dehydratase/crotonyl-CoA hydratase (Figs. 2C, S12), 245 amino acids; 4-hydroxybutyryl-CoA dehydratase (Figs. 2D, S6), 365 amino acids; biotin carboxylase subunit/domain of biotin-dependent enzymes (Fig. S7), 390 amino acids; carboxyl transferase subunit/domain of biotin-dependent enzymes (Fig. S8), 363 amino acids; methylmalonyl-CoA mutase (Fig. S9), 483 amino acids; 3-hydroxybutyryl-CoA dehydrogenase (Fig. S13), 260 amino acids.

Other methods. DNA sequence determination of purified plasmids was performed by GATC Biotech (Konstanz, Germany). SDS-polyacrylamide gel electrophoresis (SDS/PAGE; 12.5 %) was performed using the Laemmli method (43). Proteins were visualized by Coomassie blue staining (44). Protein concentration was measured according to the Bradford method (45), using bovine serum albumin as standard. Biotinylated proteins in cell extracts of lysogeny broth-grown E. coli K12 and autotrophically-grown N. maritimus were detected with peroxidase-conjugated avidin (46).

Materials. Chemicals were obtained from Fluka (Neu-Ulm, Germany), Sigma-Aldrich (Deisenhofen, Germany), Merck (Darmstadt, Germany), Serva (Heidelberg, Germany), or Roth (Karlsruhe, Germany). Biochemicals were from Roche Diagnostics (Mannheim, Germany), Applichem (Darmstadt, Germany), or Gerbu (Craiberg, Germany). Materials for cloning and expression were purchased from MBI Fermentas (St. Leon-Rot, Germany), New England Biolabs (Frankfurt, Germany), Novagen (Schwalbach, Germany), Genaxxon Bioscience GmbH (Biberach, Germany), MWG Biotech AG (Ebersberg, Germany), Biomers (Ulm, Germany), or Qiagen (Hilden, Germany). Materials and equipment for protein purification were obtained from GE Healthcare (Freiburg, Germany), Macherey-Nagel (Düren, Germany), Pall Corporation (Dreieich, Germany) or Millipore (Eschborn, Germany). 14 NaH CO3 was obtained from Hartmann Analytic (Braunschweig, Germany).

1. Khomyakova M, Bükmez Ö, Thomas LK, Erb TJ, Berg IA (2011) A methylaspartate cycle in haloarchaea. Science 331(6015):334-337.

2. Chong PK, Burja AM, Radianingtyas H, Fazeli A, Wright PC (2007) Proteome analysis of Sulfolobus solfataricus P2 propanol metabolism. J Proteome Res 6(4):1430-1439.

3. Yamauchi N (2010) The pathway of leucine to mevalonate in halophilic archaea: efficient incorporation of leucine into isoprenoidal lipid with the involvement of isovaleryl-CoA dehydrogenase in Halobacterium salinarum. Biosci Biotechnol Biochem 74(2):443-446.

4. Estelmann S, et al. (2011) Carbon dioxide fixation in 'Archaeoglobus lithotrophicus': are there multiple autotrophic pathways? FEMS Microbiol Lett 319(1):65-72. 5. Dahinden P, Pos KM, Taralczak M, Dimroth P (2004) Oxaloacetate decarboxylase of Archaeoglobus fulgidus: cloning of genes and expression in Escherichia coli. Arch Microbiol 182(5):414-420.

6. Mukhopadhyay B, Purwantini E, Kreder CL, Wolfe RS (2001) Oxaloacetate synthesis in the methanarchaeon Methanosarcina barkeri: pyruvate carboxylase genes and a putative Escherichia coli-type bifunctional biotin protein ligase gene (bpl/birA) exhibit a unique organization. J Bacteriol 183(12):3804-3810.

7. Ramos-Vera WH, Weiss M, Strittmatter E, Kockelkorn D, Fuchs G (2011) Identification of missing genes and enzymes for autotrophic carbon fixation in crenarchaeota. J Bacteriol 193(5):1201-1211.

8. Berg IA, Kockelkorn D, Buckel W, Fuchs G (2007) A 3-hydroxypropionate/4- hydroxybutyrate autotrophic carbon dioxide assimilation pathway in Archaea. Science 318(5857):1782-1786.

9. Musfeldt M, Schönheit P (2002) Novel type of ADP-forming acetyl coenzyme A synthetase in hyperthermophilic archaea: heterologous expression and characterization of isoenzymes from the sulfate reducer Archaeoglobus fulgidus and the methanogen Methanococcus jannaschii. J Bacteriol 184(3):636-644.

10. Hawkins AS, Han Y, Bennett RK, Adams MW, Kelly RM (2013) Role of 4-

hydroxybutyrate-CoA synthetase in the CO2 fixation cycle in thermoacidophilic archaea. J Biol Chem 288(6):4012-4022.

11. Holo H, Sirevåg R (1986) Autotrophic growth and CO2 fixation of Chloroflexus aurantiacus. Arch Microbiol 145(2):173-180.

12. Ivanovsky RN, Krasilnikova EN, Fal YI (1993) A pathway of the autotrophic CO2 fixation in Chloroflexus aurantiacus. Arch Microbiol 159(3):257-264.

13. Estelmann S, et al. (2011) Labeling and enzyme studies of the central carbon metabolism in Metallosphaera sedula. J Bacteriol 193(5):1191-1200.

14. Neidhardt FC, Ingraham JL, Schaechter M (1990) Physiology of the bacterial cell: a molecular approach (Sinauer, Sunderland, Mass.).

15. Könneke M, et al. (2005) Isolation of an autotrophic ammonia-oxidizing marine archaeon. Nature 437(7058):543-546. 16. Martens-Habbena W, Berube PM, Urakawa H, de la Torre JR, Stahl DA (2009) Ammonia oxidation kinetics determine niche separation of nitrifying Archaea and Bacteria. Nature 461(7266):976-979.

17. Strickland JDH, Parsons TR (1972) A practical handbook of seawater analysis (Fisheries

Research Board of Canada Series, Ottawa).

18. Lunau M, Lemke A, Walther K, Martens-Habbena W, Simon M (2005) An improved

method for counting bacteria from sediments and turbid environments by epifluorescence

microscopy. Environ Microbiol 7(7):961-968.

19. Solorzano L (1969) Determination of ammonia in natural waters by the

phenolhypochlorite method. Limnol Oceanogr 14(5):799-801.

20. Herter S, et al. (2001) Autotrophic CO2 fixation by Chloroflexus aurantiacus: study of glyoxylate formation and assimilation via the 3-hydroxypropionate cycle. J Bacteriol 183(14):4305-4316.

21. Simon EJ, Shemin D (1953) The preparation of S-succinyl coenzyme-A. J Am Chem Soc 75(10):2520.

22. Stadtman ER (1957) Preparation and assay of acyl coenzyme A and other thiol esters; use of hydroxylamine. Methods Enzymol 3:931-941.

23. Zarzycki J, Brecht V, Müller M, Fuchs G (2009) Identifying the missing steps of the

autotrophic 3-hydroxypropionate CO2 fixation cycle in Chloroflexus aurantiacus. Proc Natl Acad Sci USA 106(50):21317-21322.

24. Rosenthal RG, et al. (2014) Direct evidence for a covalent ene adduct intermediate in NAD(P)H-dependent enzymes. Nat Chem Biol 10(1):50-55.

25. Bergmeyer HU (1975) Neue Werte für die molaren Extinktions-Koeffizienten von NADH

und NADPH zum Gebrauch im Routine-Laboratorium. Z Klin Chem Klin Biochem

13(11):507–508.

26. Hügler M, Huber H, Stetter KO, Fuchs G (2003) Autotrophic CO2 fixation pathways in

archaea (Crenarchaea). Arch Microbiol 179(3):160-173. 27. Alber B, et al. (2006) Malonyl-coenzyme A reductase in the modified 3-

hydroxypropionate cycle for autotrophic carbon fixation in archaeal Metallosphaera and

Sulfolobus spp. J Bacteriol 188(24):8551-8559.

28. Erb TJ, Brecht V, Fuchs G, Müller M, Alber BE (2009) Carboxylation mechanism and

stereochemistry of crotonyl-CoA carboxylase/reductase, a carboxylating enoyl-thioester

reductase. Proc Natl Acad Sci USA 106(22):8871-8876.

29. Erb TJ, et al. (2007) Synthesis of C5-dicarboxylic acids from C2-units involving crotonyl-

CoA carboxylase/reductase: the ethylmalonyl-CoA pathway. Proc Natl Acad Sci USA

104(25):10631-10636.

30. Torkko JM, et al. (2001) Candida tropicalis Etr1p and Saccharomyces cerevisiae Ybr026p (Mrf1′p), 2-enoyl thioester reductases essential for mitochondrial respiratory competence. Mol Cell Biol 21(18):6243–6253.

31. Berg IA, Ramos-Vera WH, Petri A, Huber H, Fuchs G (2010) Study of the distribution of

autotrophic CO2 fixation cycles in Crenarchaeota. Microbiology 156(1):256-269.

32. Berg IA, Kockelkorn D, Buckel W, Fuchs G (2007) A 3-hydroxypropionate/4- hydroxybutyrate autotrophic carbon dioxide assimilation pathway in Archaea. Science 318(5857):1782-1786.

33. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, New York).

34. Studier FW, Moffatt BA (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189(1):113-130.

35. Ausubel FM, et al. (1987) Current Protocols in Molecular Biology (Wiley, New York).

36. Tomoyasu T, Mogk A, Langen H, Goloubinoff P, Bukau B (2001) Genetic dissection of the roles of chaperones and proteases in protein folding and degradation in the Escherichia coli cytosol. Mol Microbiol 40(2):397-413.

37. Zhang J (2010) On the enzymatic mechanism of 4-hydroxybutyryl-CoA dehydratase and 4-hydroxybutyrate CoA-transferase from Clostridium aminobutyricum. PhD Thesis, University of Marburg. 38. Selmer T, Willanzheimer A, Hetzel M (2002) Propionate CoA-transferase from Clostridium propionicum. Cloning of gene and identification of glutamate 324 at the active site. Eur J Biochem 269(1):372-380.

39. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215(3):403-410.

40. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22(22):4673-4680.

41. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4(4):406-425.

42. Van de Peer Y, De Wachter R (1994) TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput Appl Biosci 10(5):569-570.

43. Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259):680–685.

44. Zehr BD, Savin TJ, Hall RE (1989) A one-step, low background Coomassie staining procedure for polyacrylamide gels. Anal Biochem 182(1):157-159.

45. Bradford M (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72(1- 2):248-254.

46. Menendez C, et al. (1999) Presence of acetyl coenzyme A (CoA) carboxylase and propionyl-CoA carboxylase in autotrophic Crenarchaeota and indication for operation of a 3-hydroxypropionate cycle in autotrophic carbon fixation. J Bacteriol 181(4):1088- 1098.

47. Bräsen C, Schönheit P (2004) Unusual ADP-forming acetyl-coenzyme A synthetases from the mesophilic halophilic euryarchaeon Haloarcula marismortui and from the hyperthermophilic crenarchaeon Pyrobaculum aerophilum. Arch Microbiol 182(4):277- 287.

48. Taylor RC, Brown AK, Singh A, Bhatt A, Besra GS (2010) Characterization of a β- hydroxybutyryl-CoA dehydrogenase from Mycobacterium tuberculosis. Microbiology 156(7):1975-1982. 49. Alber B, et al. (2006) Malonyl-coenzyme A reductase in the modified 3- hydroxypropionate cycle for autotrophic carbon fixation in archaeal Metallosphaera and Sulfolobus spp. J Bacteriol 188(24):8551-8559.

50. Kockelkorn D, Fuchs G (2009) Malonic semialdehyde reductase, succinic semialdehyde reductase, and succinyl-coenzyme A reductase from Metallosphaera sedula: enzymes of the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in Sulfolobales. J Bacteriol 191(20):6352-6362.

51. Teufel R, Kung JW, Kockelkorn D, Alber BE, Fuchs G (2009) 3-Hydroxypropionyl- coenzyme A dehydratase and acryloyl-coenzyme A reductase, enzymes of the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in the Sulfolobales. J Bacteriol 191(14):4572-4581.

Supporting Figures

Fig. S1. Detection of biotin-containing proteins in cell extracts of E. coli and N. maritimus. The proteins were separated by SDS-PAGE, electrotransferred to nitrocellulose membrane, and biotin-containing proteins were stained with peroxidase-conjugated avidin. The mass of the biotinylated protein detected in N. maritimus cell extract matches the expected mass of Nmar_0274 (18.5 kDa).

Marker E. coli N. maritimus

29 kDa 20 kDa 14 kDa

Fig. S2. Conversion of 3-hydroxypropionate to propionyl-CoA in the presence of MgATP, CoA and NADPH by cell extracts of N. maritimus. CoA-esters formed during the conversion were analyzed by reversed-phase C18 high-performance liquid chromatography (HPLC). Samples were withdrawn immediately after addition of cell extract (0 min) and after 120 min of incubation (120 min). In a control, 3-hydroxypropionate was omitted, and the sample was withdrawn after 120 min of incubation. At 18.5 min, an unidentified CoA-ester was detected. The formation of this product was not observed, if dialysed cell extract was used.

1,5

CoA 0 min 1

1,50,5

10 10 15 20 25

260 120 min

A 0,5 Propionyl-CoA

1,50 10 15 20 25

120 min, 1 control

0,5

0 10 15 20 25 retention time (min)

Fig. S3. Conversion of 4-hydroxybutyrate to acetyl-CoA in the presence of MgATP, CoA and NAD+ by dialyzed cell extracts of N. maritimus. CoA-esters formed during the conversion were analyzed by reversed-phase C18 high-performance liquid chromatography (HPLC). Samples were withdrawn immediately after addition of the cell extract (0 min) and after 120 min of incubation (120 min). In a control, ATP was omitted, and the sample was withdrawn after 120 min of incubation.

1,5

CoA 0 min 1

0,5

1,5

0 12 17 22 27 1

120 min

260 A 0,5 Acetyl-CoA

1,50 12 17 22 27

1 120 min, control

0,5

0 12 17 22 27 retention time (min) Fig. S4. Oxygen sensitivity of 4-hydroxybutyryl-CoA dehydratase from N. maritimus (A) and Clostridium aminobutyricum (B). 4-Hydroxybutyryl-CoA dehydratase activity was measured after incubation of the enzyme for different time intervals at anaerobic (red) or aerobic (blue) conditions. The data shown in A are the mean results of two independent experiments of a minimum of two measurements per time point and experiment. Error bars indicate the standard deviation of the combined (minimum) four values. The data in B are the the result of a single experiment with a minimum of two measurements per time point for the anaerobic measurements and single values for the aerobic measurements (due to the fast inactivation of the enzyme by oxygen).

Fig. S5. Comparison of growth of N. maritimus (A) and the bacterial ammonia oxidizer

Nitrosococcus oceani (B) in the same synthetic medium containing 0.5 mM NH4Cl at 28°C. Growth was monitored by direct counting of SYBRGreen I-stained cells and by following the formation of nitrite. Cultures reaching the stationary growth phase were used to determine the specific growth yield.

Fig. S6. Phylogenetic tree of representative 4-hydroxybutyryl-CoA dehydratase proteins. Archaeal sequences are shown in red, thaumarchaeal sequences are shown in bold red. Bacterial proteins are in black. The tree is based on amino acid sequence analysis and rooted with 4-hydroxyphenylacetate 3- monooxygenase (HpaB) from E. coli, which is a flavoprotein that resembles the flavin-binding domain of 4-hydroxybutyryl-CoA dehydratase. Standard NCBI BLASTP search with 4-hydroxybutyryl-CoA dehydratase from N. maritimus (Nmar_0207) as a query was performed, and the sequences with expectation value above 1e-50 were used. The tree represents all 4-hydroxybutyryl-CoA dehydratase homologues in Archaea and the selected bacterial sequences belonging to the major clusters on the tree. Tree topology and evolutionary distances are given by the neighbor-joining method with Poisson correction. The scale bar represents a difference of 0.1 substitutions per site. Numbers at nodes indicate the percentage bootstrap values for the clade of this group in 1,000 replications. The branches with values below 70% are drawn as unresolved. The accession numbers of the sequences used for the construction of the tree are listed in Table S4.

0.1 100 Cand. Nitrosoarchaeum koreensis AR1 Thaum- 72 Nitrosopumilus maritimus archaeota 100 Cand. Nitrosopumilus sp. AR2 Cand. Nitrosopumilus salaria 100 Cand. Nitrosoarchaeum limnia 84 99 Cand. Nitrosoarchaeum koreensis Cenarchaeum symbiosum Cand. Nitrososphaera gargensis Plesiocystis pacifica Runella slithyformis 100 100 Patulibacter sp. I11 Alcanivorax hongdengensis Aureococcus anophagefferens 92 99 Fusobacterium necrophorum „Anaerobe Thermoanaerobacter siderophilus 100 84 Acidaminococcus intestini cluster“ Clostridium aminobutyricum 99 Porphyromonas gingivalis Clostridium kluyveri 88 Megasphaera elsdenii 79 100 Treponema vincentii Archaeoglobus fulgidus-1 99 Eubacterium limosum Geobacter metallireducens Syntrophus aciditrophicus 100 99 Ignicoccus hospitalis Pyrolobus fumarii Crenarchaeota 100 Metallosphaera cuprina type-1 74 Metallosphaera sedula 100 Metallosphaera yellowstonensis 100 100 Sulfolobus acidocaldarius 100 Acidianus hospitalis Sulfolobus tokodaii Sulfolobus islandicus 100 96 Thermoproteus tenax Thermoproteus uzoniensis 94 100 Pyrobaculum aerophilum 98 Pyrobaculum oguniense Pyrobaculum calidifontis Pyrobaculum sp. 1860 88 100 Pyrobaculum neutrophilum 82 Pyrobaculum islandicum 100 Clostridium bolteae Archaeoglobus fulgidus-3 Oligotropha carboxidovorans 100 100 Cupriavidus basilensis 98 Leptothrix cholodnii Polynucleobacter necessarius 100 Caldisphaera lagunensis 79 100 Ferroglobus placidus Archaeoglobus fulgidus-2 87 Archaeoglobus sulfaticallidus 100 Gordonia terrae Rhodococcus opacus 89 80 Vulcanisaeta moutnovskia-2 Ferroplasma acidarmanus Crenarchaeota 100 Pyrobaculum oguniense type-2 85 100 Vulcanisaeta moutnovskia-1 84 Vulcanisaeta distributa Metallosphaera yellowstonensis 89 Sulfolobus tokodaii 85 Metallosphaera sedula 80 Sulfolobus acidocaldarius 100 Sulfolobus islandicus Sulfolobus solfataricus HpaB, Escherichia coli Fig. S7. Phylogenetic tree of biotin carboxylase subunit/domain of biotin-dependent enzymes. Desulfur/Therm, Desulfurococcales/Thermoproteales. The tree is based on amino acid sequence analysis and shows homologues of biotin carboxylase in Archaea as well as selected bacterial and eukaryotic sequences. For the construction of the tree, archaeal homologues were identified using standard NCBI BLASTP search with Msed_0147 as a query; in some cases, the sequences representing several species of the same genus were deleted. Thaumarchaeal sequences are shown in red, crenarchaeal sequences in green, euryarchaeal sequences in azure, and bacterial sequences in black. The corresponding sequences in methanogens are encoding biotin carboxylase domain of pyruvate carboxylase (6). Tree topology and evolutionary distances are given by the neighbor-joining method with Poisson correction. The scale bar represented a difference of 0.1 substitutions per site. The accession numbers of the sequences used for the construction of the tree are listed in Table S4.

0.1 Haloarchaea

Desulfur/ Therm

Thaumarchaeota

Methanogens Sulfolobales

Archaeoglobales

Methanogens Fig. S8. Phylogenetic tree of carboxyl transferase subunit/domain of biotin-dependent enzymes. Thaumarchaeal sequences are shown in red, crenarchaeal sequences are shown in green, euryarchaeal sequences are shown in azure, and bacterial sequences are shown in black. In some cases (i.e., in Thermococcales), the carboxyl transferase homologues function probably as methylmalonyl-CoA decarboxylase. These species are lacking biotin carboxylase subunit. Therm./Desulfuroc./Ferv., Thermoproteales/ Desulfurococcales/ Fervidicoccales. The tree is based on amino acid sequence analysis. Tree topology and evolutionary distances are given by the neighbor-joining method with Poisson correction. The scale bar represents a difference of 0.1 substitutions per site. For some nodes, the percentage bootstrap values for the clade of this group in 1,000 replications are shown. The accession numbers of the sequences used for the construction of the tree are listed in Table S4.

0.1

Thaumarchaeota

Desulfurococcales

Sulfolobales Therm./Desulfuroc./Ferv.

Archaeoglobales

100 Thermococcales 100 90

60 8

Haloarchaea

Fig. S9. Phylogenetic tree of homologues of a large subunit of methylmalonyl-CoA mutase from N. maritimus (Nmar_0954). Thaumarchaeal sequences are shown in red, crenarchaeal sequences in green, euryarchaeal sequences in azure, and bacterial sequences in black. The tree is based on amino acid sequence analysis. Standard NCBI BLASTP search with Nmar_0954 as a query was performed, and first 500 hits were analyzed. For the clarity, the amount of the sequences was reduced, and only sequences representing major clusters on the tree were used. Tree topology and evolutionary distances are given by the neighbor-joining method with Poisson correction. The scale bar represents a difference of 0.1 substitutions per site. Numbers at nodes indicate the percentage bootstrap values for the clade of this group in 1,000 replications. The accession numbers of the sequences used for the construction of the tree are listed in Table S4.

0.1

Thaumarchaeota

Crenarchaeota

Euryarchaeota

100

Bacteria

Fig. S10. Phylogenetic tree of homologues of 3-hydroxypropionyl-CoA synthetase from N. maritimus (Nmar_1309). Thaumarchaeal sequences are shown in red, euryarchaeal in blue. Note that Archaeoglobus fulgidus-3 protein was shown to catalyze aryl-CoA synthetase reaction in the degradation of aromatic amino acids (9). The tree is based on amino acid sequence analysis. Standard NCBI BLASTP search with Nmar_1309 as a query was performed, and the sequences with expectation value above 1e-70 and the query coverage over 80% were used. For the clarity, the amount of the sequences was reduced, and only sequences representing major clusters on the tree were used. Tree topology and evolutionary distances are given by the neighbor-joining method with Poisson correction. The scale bar represents a difference of 0.1 substitutions per site. Numbers at nodes indicate the percentage bootstrap values for the clade of this group in 1,000 replications. The accession numbers of the sequences used for the construction of the tree are listed in Table S4.

0.1

100 Nitrosopumilus maritimus Candidatus Nitrosopumilus koreensis 100 90 Candidatus Nitrosopumilus salaria 100 Candidatus Nitrosopumilus sp. AR2 100 100 Candidatus Nitrosoarchaeum limnia Cenarchaeum symbiosum Candidatus Nitrososphaera gargensis Desulfococcus oleovorans 95 Methanosaeta thermophila 100 Methanosaeta concilii 77 Syntrophus aciditrophicus-1 100 Archaeoglobus fulgidus-1 Archaeoglobus fulgidus-2 90 Archaeoglobus fulgidus-3 100 Oligotropha carboxidovorans 99 Afipia felis 100 Bradyrhizobium japonicum 73 Mesorhizobium alhagi 99 100 Methylobacterium nodulans Cupriavidus metallidurans 74 100 Burkholderia phenoliruptrix 100 Burkholderia graminis Amycolatopsis mediterranei 100 Saccharomonospora marina Nocardiopsis dassonvillei Streptomyces rimosus Streptomyces aurantiacus 97 100 Streptomyces griseoflavus 95 Streptomyces coelicolor 100 Syntrophus aciditrophicus Desulfobacter postgatei 99 97 Wolinella succinogenes Thermovibrio ammonificans 99 Methanoregula boonei-1 Methanospirillum hungatei-1 99 Methanoplanus limicola-1 100 Methanoplanus limicola-2 Methanospirillum hungatei-2 94 Methanoregula boonei-2 99 Paracoccus denitrificans Starkeya novella Fig. S11. Phylogenetic tree of homologues of the 4-hydroxybutyryl-CoA synthetase from N. maritimus (Nmar_0206). Thaumarchaeal sequences are shown in red and bold, euryarchaeal sequences in blue, eukaryotic in brown. Note that the corresponding proteins from Archaeoglobus fulgidus and haloarchaea were shown to catalyze acetyl-CoA synthetase reaction (9, 47). The tree is based on amino acid sequence analysis. Standard NCBI BLASTP search with Nmar_0206 as a query was performed, and the sequences with expectation value above 1e-150 were used. For the clarity, the sequences from the uncultured organisms and (in some cases) those representing several species of the same genus were deleted. Tree topology and evolutionary distances are given by the neighbor-joining method with Poisson correction. The scale bar represents a difference of 0.1 substitutions per site. Numbers at nodes indicate the percentage bootstrap values for the clade of this group in 1,000 replications. The accession numbers of the sequences used for the construction of the tree are listed in Table S4.

0.1

Natrinema pallidum Natronococcus occultus 100 Haloterrigena limicola Natrialba magadii Halobiforma lacisalsi 76 Halococcus saccharolyticus Halalkalicoccus jeotgali 72 Halorubrum californiensis 100 Halogeometricum borinquense Haloferax denitrificans 100 Halorhabdus utahensis 96 Halosimplex carlsbadense 100 Haloarcula hispanica Halomicrobium katesii Natronomonas moolapensis 100 Kyrpidia tusciae 100 Thermaerobacter marianensis Sutterella parvirubra 100 Roseiflexus castenholzii 100 Chloroflexus aurantiacus Oscillochloris trichoides 97 Methanocella conradii Methanobacterium formicicum 84 100 Methanohalophilus mahii Methanomethylovorans hollandica 100 Desulfotomaculum hydrothermale 99 Desulfurispora thermophila 92 Ammonifex degensii 92 Methanobrevibacter smithii Giardia lamblia 100 Thermodesulfovibrio yellowstonii Thermodesulfobacterium geofontis Thermodesulfatator indicus Thermodesulfobium narugense Candidatus Kuenenia stuttgartiensis 100 Desulfovibrio magneticus 100 Desulfovibrio hydrothermalis Desulfovibrio salexigens 100 Desulfotignum phosphitoxidans 100 Desulfobacula toluolica 100 Desulfobacterium autotrophicum-1 Desulfococcus oleovorans 88 86 Syntrophobacter fumaroxidans 90 Desulfobacterium autotrophicum-2 75 100 Desulfatibacillum alkenivorans Magnetococcus marinus Caldithrix abyssi 98 Pleurocapsa sp. PCC 7327 Entamoeba histolytica 100 Methanocaldococcus vulcanius 97 Methanocaldococcus villosus 100 Methanotorris formicicus 100 Anaerolinea thermophila-1 75 Aciduliprofundum boonei Candidatus Nitrososphaera gargensis 100 Cenarchaeum symbiosum 100 100 Candidatus Nitrosoarchaeum koreensis 100 Candidatus Nitrosoarchaeum limnia Nitrosopumilus maritimus 77 Candidatus Nitrosopumilus salaria 100 Candidatus Nitrosopumilus sp. AR2 Methanomassiliicoccus luminyensis Archaeoglobus fulgidus Anaerolinea thermophila-2 Fig. S12. Phylogenetic tree of homologues of 3-hydroxypropionyl-CoA dehydratase/crotonyl-CoA hydratase from N. maritimus (Nmar_1308). Thaumarchaeal sequences are shown in red, and bacterial sequences in black. The tree is based on amino acid sequence analysis. Standard NCBI BLASTP search with Nmar_1308 as a query was performed, and the sequences with expectation value above 1e-70 were used. For the clarity, the amount of the sequences was reduced, and only sequences representing major clusters on the tree were used. Tree topology and evolutionary distances are given by the neighbor- joining method with Poisson correction. The scale bar represents a difference of 0.1 substitutions per site. Numbers at nodes indicate the percentage bootstrap values for the clade of this group in 1,000 replications. Only values above 70% were considered. The accession numbers of the sequences used for the construction of the tree are listed in Table S4.

0.1

94 Oscillibacter valericigenes 99 Anaerotruncus colihominis 73 Fusobacterium necrophorum Fusobacterium nucleatum 71 Treponema phagedenis 100 Allobaculum stercoricanis Eubacterium dolichum 100 Clostridium perfringens 96 Clostridium botulinum Clostridium kluyveri Clostridium tetanomorphum Clostridium acetobutylicum Thermobrachium celere Peptoniphilus indolicus 100 Odoribacter splanchnicus 79 94 Butyricimonas synergistica 100 Clostridium difficile 100 Ilyobacter polytropus-1 Ilyobacter polytropus-2 Desulfitobacterium metallireducens Porphyromonas endodontalis Lactobacillus suebicus Pelotomaculum thermopropionicum Carboxydothermus hydrogenoformans-1 Thermoanaerobacter tengcongensis 98 Nitrolancetus hollandicus Sphaerobacter thermophilus Geobacter metallireducens Syntrophothermus lipocalidus Candidatus Nitrososphaera gargensis 100 Cenarchaeum symbiosum 100 Candidatus Nitrosoarchaeum limnia 100 71 Candidatus Nitrosopumilus salaria Candidatus Nitrosopumilus sp. 100 Candidatus Nitrosopumilus koreensis 75 Nitrosopumilus maritimus 84 Megasphaera elsdenii 99 Anaeroglobus geminatus-1 100 Anaeroglobus geminatus-2 Megasphaera elsdenii 100 Syntrophomonas wolfei-1 Syntrophomonas wolfei-2 Zymophilus raffinosivorans Desulfotomaculum kuznetsovii Desulfosporosinus youngiae Carboxydothermus hydrogenoformans-2 Geopsychrobacter electrodiphilus Dethiobacter alkaliphilus Pelosinus fermentans-1 95 Pelosinus fermentans-2 94 Acetonema longum Thermosinus carboxydivorans Eremococcus coleocola Carnobacterium sp. AT7 Fig. S13. Phylogenetic tree of homologues of the 3-hydroxybutyryl-CoA dehydrogenase from N. maritimus (Nmar_1028). Thaumarchaeal sequences are shown in red, crenarchaeal in green. The tree is based on amino acid sequence analysis and rooted with characterized 3-hydroxybutyryl-CoA dehydrogenase from Mycobacterium tuberculosis (48). Standard NCBI BLASTP search with Nmar_1028 as a query was performed, and the sequences with expectation value above 1e-90 were used. In most Archaea besides Thaumarchaeota, the homologous proteins are the fusions of a 3- hydroxyacyl-CoA dehydrogenase domain and a crotonase domain; proteins without crotonase domain are marked with asterisk. For the calculation of the alignment, the crotonase domain was deleted. Only the sequences from cultured organisms are shown. In some cases, the sequences representing several species of the same genus were deleted. Tree topology and evolutionary distances are given by the neighbor-joining method with Poisson correction. The scale bar represents a difference of 0.1 substitutions per site. Numbers at nodes indicate the percentage bootstrap values for the clade of this group in 1,000 replications. The branches with values below 70% are drawn as unresolved. The accession numbers of the sequences used for the construction of the tree are listed in Table S4.

0.1

100 Sulfolobus solfataricus-1 100 Sulfolobus islandicus-1 95 Sulfolobus acidocaldarius-1 99 Sulfolobus acidocaldarius-2 100 Sulfolobus solfataricus-2* 90 Sulfolobus islandicus-2* 100 Caldisphaera lagunensis Acidilobus saccharovorans Archaeoglobus sulfaticallidus-1 Caldivirga maquilingensis Candidatus Caldiarchaeum subterraneum Pyrobaculum oguniense-1* 96 Pyrobaculum oguniense-2* 100 Vulcanisaeta moutnovskia Vulcanisaeta distributa Candidatus Korarchaeum cryptofilum Candidatus Nitrososphaera gargensis* 100 Cenarchaeum symbiosum* 100 Candidatus Nitrosoarchaeum limnia* 100 78 Candidatus Nitrosopumilus sp. AR2* Candidatus Nitrosopumilus salaria* 100 Candidatus Nitrosopumilus koreensis* 96 Nitrosopumilus maritimus* Ferroglobus placidus Salinarchaeum sp. Harcht-Bsk1 96 Haloferax volcanii 99 Haloferax mediterranei 100 Halogranum salarium 74 Halosarcina pallida 100 Haladaptatus paucihalophilus Natronomonas pharaonis Natronorubrum bangense Halobiforma lacisalsi 92 Natrialba magadii Natrinema pellirubrum Natronococcus jeotgali 98 Natronolimnobius innermongolicus Haloterrigena turkmenica Archaeoglobus sulfaticallidus-2 Mycobacterium tuberculosis Table S1. Activities of enzymes from various carbon assimilation pathways in cell extracts of N. maritimus.

Enzyme Specific activity Genes in N. (nmol min-1 mg-1 protein) maritimus

Ribulose 1,5-bisphosphate <0.1 – carboxylase/oxygenase

Mesaconyl-CoA C1-C4 CoA-transferase <0.1 –

Succinyl-CoA synthetase (ADP-forming) 13.6 ± 2.0 Nmar_1123/1124

Succinic semialdehyde dehydrogenase <0.1 ? (NAD+/NADP+)

Malate dehydrogenase, decarboxylating <0.2 – (NAD+/NADP+)

Pyruvate:acceptor oxidoreductase <0.1 Nmar_0413/0414 (pyruvatesynthase)

2-Oxoglutarate:acceptor oxidoreductase <0.1 Nmar_0413/0414 (2-oxoglutarate synthase)

?, gene cannot be unambiguously identified based on bioinformatic analysis. The data are mean values and deviations of several independent enzyme assays. Table S2. Gene synthesized for heterologous overexpression in E. coli.

Gene Optimized gene sequence

3-hydroxypropionyl- ATGGCCGCCGTGAAAAAAATTTTCGATGAAATCATTGAGACGGACCATAAGGTGATTACCGAGGAATCGTC CAAAAGCATTCTGAAGAATTACGGGGTGAAGGTACCGCCGTACGCGCTGGTCACCTCGGCCGAAGAGGCG CoA synthetase GCAAAAGAGGCGAAAAAAATCGGGTTTCCCCTGGTCATGAAGGTTGTGTCACCGCAGATCCTGCATAAAAC AGATGTGGGCGGCGTAAAGGTTGGTCTGGATAACGTGGCGGATGTCAAGAAAACCTTTACAGACATGTATG (Nmar_1309) GGCGTCTGAGCAAAAAAAAAGGCGTAAATGTAAAAGGTATCCTGCTGGAGAAAATGGTTCCGAAAGGCGT AGAACTGATCGTGGGTATTCAGAACGATTCGCAGTTCGGTCCGATTATCATGGTCGGTATGGGCGGCATCA TGACCGAAGTCATGAAAGATGTAGCATTTCGGATGTTACCGATTACGACCTCCGATGCGAAATCCATGTTG AACGAACTGAAGGGCTCGAAACTCTTAAAAGGCTTTCGCGGAAGTGAACCGATTGATACGAACCTGGTGG CAAAGATGCTGGTCAATATCGGGAAACTCGGTGTTGAAAATGCGGATTACATCAACTCTATTGACTTCAAT CCTGTAATCGTCTATCCGAAAAGTCACTATGTTGTGGATGCGAAAATTATCCTCAATAAAGAAAAAAAGAA GAACAGTATCTCGAAAGCCAAACCGAGCATTACGGATATGGAAACCTTCTTTACCCCAAAATCCGTGGCAC TGGTTGGCGCGAGTGCGAGCCCAGGTAAAATTGGCAACAGCATTCTGGACAGCCTTGTGAACTACGACTTC AAAGGCAAAGTGTACCCGATTAATCCCAAAGCTGACAAAATTTTCGGTCAGAAATGCTATCCGTCTGTGGC CGACATTCCGGGCAAAGTTGATCTTGTGGTGGTCAGTGTTGACCTCTCGATGACACCACCGGTACTGGAGG ATTGTGCGAAGAAAGGCGTCCATAGTGTGGTGATTGTCTCAGGCGGTGGCAAAGAGTTAGGTGGGGAACG TGCCGCGTATGAAGCGGAAGTTGCACGCCTCAGCAAAAAGCACAAGATCCGCATCATTGGCCCAAACTGC ATTGGTATGTTCAATGCCGCCAATCGCTTAGATTGCGCCTTTCAAGGGCAAGAACGCATGGTCCGCAGCAA ATTGGGCCCTGTTGCGTTCTTCAGCCAGTCTGGCACTATGGGCATCTCTATGTTGGAATCTGCCGATACCTT CGGACTGTCGAAAATGATTAGTTTTGGCAACCGTTCCGATGTGGATGAAGCCGACATGATTTGGTATGCAG CGAACGACCCGCAGACCAAAGTCATTGGTCTGTATGTCGAGGGTTTTGGGGATGGACGGAAATTTATTAAC GTGGCAAAGCGCGTTATGAAAGAAAAAAAAAAACCTATCGTTATCTGGAAATCAGGACGTACGGCGGCTG GCGCGAAACAAGCGGCCTCCCATACCGGCTCATTAGGCGGTTCAAACGCAATTATTATGGGCGCGTTTAAA CAAGCGGGCATTATTTCCGTTGATAGCTACCAGGAACTGGCCGGCGTTCTGAAAGCACTTGCTTGGCAACC AGCTGCCAAAGGTAACAAAGTCGCGATGACGAGCAATGGGGCTGGACCTATGATTGGTGGTATCGATCAG CTGGAGAAATTTGGCTTGGCAATCGGAAAACTGAGCCCAAAACTGTTGAAGAAAATGAAATCTCGCTTTCC TCCCGCTGTGCCGATTCACAACGGGAATCCCGCTGACGTAGGTGGTGGTGCAACTGCTGATGACTATCAGT TCGTTATTCAGCAGTTCATGGATGAAAAAAACATCGACATCGCCATGCCGTGGTTTGTGTTTCAGGATGACC CACTGGAAGAAACCATTGTGGATCATCTTGCTGGGTTTCAAAAGAAAGCCAAGAAACCGCTGTTATGTGGA GGTAATGGTGGCCCTTATACTGAGAAAATGATCAAACTGATTGAAAAGCACAATGTGCCGGTTTACCAAGA CTTGCGTACTTGGGTAGCAGCTGCATCTGCGCTTCATCAGTGGGGTAAAATCAGCAAGAAATAA

4-hydroxybutyryl- ACGGATAGTCCCATCCTGTCCCCGAAAAGTATTGCCGTTATCGGCGCCTCCGATAAACGCGGTTCTGTGGG CGCTACTATCACATCCAACATTATGAACGGCTTTAAAGGCACCGTTTACCCTATTTCGCCAACCCGCGATAC CoA synthetase GGTATTCTATAAGAAAGCCTACAAATCGGTGCTGGATGTTCCGAAGAGTATTGACCTCGCAGTCATTGTCA TCAAAAACACTTTAGTGACCCCTGTGCTGGAAGAATGCGGGAAAAAGAAAATCAAAGGAGTGATCATCAT (Nmar_0206) TACCGCCGGATTTAAAGAAGTCGACGAAGAAGGGGCGAAACGCGAACAACAAGTAATTGACATCGCGAAG AAATATAACATGCAAGTCGTTGGGCCTAATTGCTTGGGTGTTATGAATCTGGACAGCAAAACGATGATGAA CTCAACGTTTCTGAAAGTGACCCCGAAATCCGGCAAAATTGCTCTCGTATCACAATCGGGTGCGATTTGCG CTGCACTGGTCGAGGATGCGTCTGCGCAGGGCATTGGTTTCTCTGCGGTTGTATCGTTAGGCAACAAAGCC GTGATGTCGGAAGTGGACGTTCTGAAAATTTTGGCTAATCACAAACAGACCGAAGTTATCGTTATGTACCT CGAAGATATGGGAGATGGGCAGGAATTTCTGAAAGTCTGCAAGAATATCACAAAAAAGTTGAAAAAGCCG GTTTTAGTGTTAAAGAGCGGTCGTTCCCCGGAGGGCGCAAAGGCTGCGATGAGTCATACCGGCGCACTGAT GGGTTCTGATGAAATTTATGACGCACTGTTAAAACAGAGCGGGGCGATTCGTGTAGACACTATGGAAGAAC TGTTCGACTATGCGACCGCATTTAGCAAACAGCCGCTCCCGAGTAATGGCGATCTGGTCATCGTGTCGAAC GCGGGCGGTCCAGCAATTATTTCCACAGACGCGTGTAGCAAAGCGAAGATCAAAATGGCCGATATTACCTC GATTCGCAAGAAAATCGACGAAGTGATCCCACCCTGGGGTAGCTCACGGAATCCCGTCGATATCGTCGGCG ATGCTGATTTCAACCGCTTTCATAACGTGCTTGACCGCGTACTGAAACATCCGAAAGTTGGGAGCGTCATTT CCATGTGTACCCCTTCTGGCACCTTGAATTATGACAAACTGGCCGAAGTGATTGTCGAAATGAGCAAGAAA TATAAGAAAACCATGCTGGCTTCTCTTATGGGTCTGGATGAGGGCGTCACGAATCGCGAGATTCTGGCGGA TGGTAACGTGCCGTATTACACGTATGCCGAAGGAGCCATTCGTACCTTAGCCGCAATGATTCGTTTCTCTGA TTGGGTTAAAAGCAGTCCGGGCAAGATCACGAAATTTAAAGTGAACAAAGCCAAAGCAAAAAAAATTTTC GATCAGGTGAAAAAAGAGAAACGTCCAAATCTTCTGGAGGAAGAAGGCCAAGAAGTGCTCAAAGCATACG GCTTGCCGCTGCCGAAAAGTACACTGGCCAAAAATGAAGCTGAAGCTGTAAAAGCGGCCAAGAAAATTGG CTATCCCGTTGTGATGAAAATTGCGAGCCCACAGATTATCCACAAATCAGATGCGGGTGGTGTGAAAGTGA ACTTGACTAACGACGCGGAAGTCAAAGATGCGTTTAAAACCATTGTCAAGAATGCCAAGAAATACAACAA GAAAGCAGAGATCAAAGGGGTACTGATTGTGGAAATGGTTAAAGGCGGGAAAGAGTTGATCATTGGTTCG AAACTGGAACCTGGCTTTGGCCCGGTGATTATGCTTGGCATGGGTGGTATCTACGTTGAAGTGCTGAAAGA CGTGACGTTTAAGCTGGCACCGGTAACTGACAAAGAAGCCGATGATATGATCGCGTCAATCAAAACGCAG AAACTGCTGCAGGGAGTCCGTGGTGAGAAACCGTCAGATATCGTAAAACTGAGCGAGTGTATTCAACGCTT AAGCCAGCTGGTTAGCGATTTCAAGGAGATCAAAGAACTTGATATGAATCCGGTTCTTGTTATGGAGAAAG GAAAAGGTTGTCGCATTCTCGATGTGCGGATTGGTCTGTAA

Table S3. Identification of homologues of the key enzymes of the crenarchaeal HP/HB cycle (M. sedula) in N. maritimus.

M. sedula enzyme Best hit outside Sulfolobales Best hit in N. maritimus (% identity) (% identity)

Malonyl-CoA/ Archaeoglobus profundus DSM Nmar_1586* succinyl-CoA 5631 reductase Msed_0709 aspartate semialdehyde aspartate semialdehyde dehydrogenase (8, 49) dehydrogenase Arcpr_1818 2e-93 (46%) 2e-60 (34%)

Malonic Archaeoglobus fulgidus DSM Nmar_1028 semialdehyde 4304 reductase 3-hydroxyacyl-CoA 3-hydroxybutyryl-CoA Msed _1993 (50) dehydrogenase dehydrogenase AF1206 6e-89 (42%) 7e-47 (39%)

Succinic Pyrobaculum sp. 1860 Nmar_0523 semialdehyde succinic semialdehyde alcohol dehydrogenase reductase Msed_1424 reductase†

(8, 50) P186_0714 6e-46 (31%) 2e-124 (53%) outside Sulfolobales/Thermoproteales: Cucumis sativus predicted succinic semialdehyde dehydrogenase XP_004142661.1 2e-91 (43%)

Acryloyl-CoA Vulcanisaeta moutnovskia 768- Nmar_0523 reductase Msed_1426 28 (51) alcohol dehydrogenase alcohol dehydrogenase VMUT_1233 3e-116 (51%) 6e-34 (26%) The results of the standard BLASTP search with M. sedula proteins as queries are shown.

* Nmar_1586 is the only copy of aspartate semialdehyde dehydrogenase in N. maritimus.

† Succinic semialdehyde reductase in the dicarboxylate/4-hydroxybutyrate cycle in Thermoproteales is highly homologous to the corresponding Sulfolobales protein (7). Table S4. Accession numbers of sequences used for the construction of the phylogenetic trees shown in Fig. 2 and Fig. S4-S11.

Designation in the tree Organism Accession

Tree of 4-hydroxybutyryl-CoA dehydratase (Fig. 2D, Fig. S6)

Cand. Nitrosopumilus koreensis AR1 Candidatus Nitrosopumilus koreensis AR1 YP_006773029.1

Nitrosopumilus maritimus Nitrosopumilus maritimus SCM1 YP_001581541.1

Cand. Nitrosopumilus sp. AR2 Candidatus Nitrosopumilus sp. AR2 YP_006774921.1

Cand. Nitrosopumilus salaria Candidatus Nitrosopumilus salaria BD31 WP_008297788.1

Cand. Nitrosoarchaeum limnia Candidatus Nitrosoarchaeum limnia SFB1 WP_007402375.1

Cand. Nitrosoarchaeum koreensis Candidatus Nitrosoarchaeum koreensis WP_007549554.1 MY1

Cenarchaeum symbiosum Cenarchaeum symbiosum A YP_874977.1

Cand. Nitrososphaera gargensis Candidatus Nitrososphaera gargensis Ga9.2 YP_006864012.1

Plesiocystis pacifica Plesiocystis pacifica SIR-1 WP_006975097.1

Runella slithyformis Runella slithyformis DSM 19594 YP_004654958.1

Patulibacter sp. I11 Patulibacter sp. I11 WP_007577713.1

Alcanivorax hongdengensis Alcanivorax hongdengensis A-11-3 WP_008928424.1

Aureococcus anophagefferens Aureococcus anophagefferens EGB03180.1

Fusobacterium necrophorum Fusobacterium necrophorum subsp. WP_005955843.1 funduliforme ATCC 51357

Thermoanaerobacter siderophilus Thermoanaerobacter siderophilus SR4 WP_006570020.1

Acidaminococcus intestine Acidaminococcus intestini RyC-MR95 YP_004897379.1

Clostridium aminobutyricum Clostridium aminobutyricum DSMZ 2634 1U8V

Porphyromonas gingivalis Porphyromonas gingivalis W83 NP_904967.1

Clostridium kluyveri Clostridium kluyveri DSM 555 YP_001396399.1

Megasphaera elsdenii Megasphaera elsdenii DSM 20460 YP_004765392.1

Treponema vincentii Treponema vincentii ATCC 35580 WP_006188709.1

Archaeoglobus fulgidus-1 Archaeoglobus fulgidus DSM 4304 NP_069169.1

Eubacterium limosum Eubacterium limosum KIST612 YP_003958263.1

Geobacter metallireducens Geobacter metallireducens GS-15 YP_006721174.1

Syntrophus aciditrophicus Syntrophus aciditrophicus SB YP_460766.1

Ignicoccus hospitalis Ignicoccus hospitalis KIN4/I YP_001435184.1

Pyrolobus fumarii Pyrolobus fumarii 1A YP_004781386.1 Metallosphaera cuprina Metallosphaera cuprina Ar-4 YP_004409477.1

Metallosphaera sedula Metallosphaera sedula DSM 5348 YP_001191403.1

Metallosphaera yellowstonensis Metallosphaera yellowstonensis MK1 WP_009069857.1

Sulfolobus acidocaldarius Sulfolobus acidocaldarius DSM 639 YP_256729.1

Acidianus hospitalis Acidianus hospitalis W1 YP_004459205.1

Sulfolobus tokodaii Sulfolobus tokodaii str. 7 NP_377631.1

Sulfolobus islandicus Sulfolobus islandicus M.14.25 YP_002830591.1

Thermoproteus tenax Thermoproteus tenax Kra 1 YP_004892823.1

Thermoproteus uzoniensis Thermoproteus uzoniensis 768-20 YP_004337744.1

Pyrobaculum aerophilum Pyrobaculum aerophilum str. IM2 NP_560189.1

Pyrobaculum oguniense Pyrobaculum oguniense TE7 YP_005259932.1

Pyrobaculum calidifontis Pyrobaculum calidifontis JCM 11548 YP_001056282.1

Pyrobaculum sp. 1860 Pyrobaculum sp. 1860 YP_005084420.1

Pyrobaculum neutrophilum Pyrobaculum neutrophilum V24Sta YP_001793816.1

Pyrobaculum islandicum Pyrobaculum islandicum DSM 4184 YP_929771.1

Clostridium bolteae Clostridium bolteae 90A9 WP_002577044.1

Archaeoglobus fulgidus-3 Archaeoglobus fulgidus DSM 4304 NP_069860.1

Oligotropha carboxidovorans Oligotropha carboxidovorans OM5 YP_002289223.1

Cupriavidus basilensis Cupriavidus basilensis OR16 WP_006158802.1

Leptothrix cholodnii Leptothrix cholodnii SP-6 YP_001792020.1

Polynucleobacter necessaries Polynucleobacter necessarius subsp. YP_001155154.1 asymbioticus QLW-P1DMWA-1

Caldisphaera lagunensis Caldisphaera lagunensis DSM 15908 YP_007174268.1

Ferroglobus placidus Ferroglobus placidus DSM 10642 YP_003435352.1

Archaeoglobus fulgidus-2 Archaeoglobus fulgidus DSM 4304 NP_069718.1

Archaeoglobus sulfaticallidus Archaeoglobus sulfaticallidus PM70-1 YP_007907697.1

Gordonia terrae Gordonia terrae NBRC 100016 WP_004020732.1

Rhodococcus opacus Rhodococcus opacus PD630 WP_005245750.1

Vulcanisaeta moutnovskia-2 Vulcanisaeta moutnovskia 768-28 YP_004245951.1

Ferroplasma acidarmanus Ferroplasma acidarmanus WP_009886398.1

Pyrobaculum oguniense Pyrobaculum oguniense TE7 YP_005261293.1

Vulcanisaeta moutnovskia-1 Vulcanisaeta moutnovskia 768-28 YP_004244394.1

Vulcanisaeta distribute Vulcanisaeta distributa DSM 14429 YP_003902633.1

Metallosphaera yellowstonensis Metallosphaera yellowstonensis MK1 WP_009069865.1 Sulfolobus tokodaii Sulfolobus tokodaii str. 7 NP_375911.1

Metallosphaera sedula Metallosphaera sedula DSM 5348 YP_001191305.1

Sulfolobus acidocaldarius Sulfolobus acidocaldarius DSM 639 YP_255748.1

Sulfolobus islandicus Sulfolobus islandicus M.16.4 YP_002913613.1

Sulfolobus solfataricus Sulfolobus solfataricus P2 NP_343847.1

Escherichia coli Escherichia coli C (HpaB) AAR11357.1

Tree of biotin carboxylases (Fig. S7)

Thaumarchaeota Candidatus Nitrosoarchaeum limnia SFB1 WP_007402315.1

Candidatus Nitrosoarchaeum koreensis WP_007549631.1 MY1

Nitrosopumilus maritimus SCM1 YP_001581607.1

Candidatus Nitrosopumilus koreensis AR1 YP_006773094.1

Candidatus Nitrosopumilus salaria BD31 WP_008301048.1

Candidatus Nitrosopumilus sp. AR2 YP_006775007.1

Cenarchaeum symbiosum A YP_876583.1

Candidatus Nitrososphaera gargensis Ga9.2 YP_006860794.1

Aquifex aeolicus VF5 NP_214014.1 NP_214048.1 NP_214146.1

Hydrogenobacter thermophilus TK-6 BAF34937.1 BAF34931.1 BAF34940.1

Sulfolobales Sulfolobus solfataricus P2 NP_343814.1

Sulfolobus islandicus M.16.4 YP_002913574.1

Sulfolobus metallicus LM AAB97084.1

Sulfolobus acidocaldarius DSM 639 YP_254969.1

Acidianus hospitalis W1 YP_004459288.1

Acidianus brierleyi DSM 1651 BAC55867.1

Sulfolobus tokodaii str. 7 NP_376481.1

Metallosphaera yellowstonensis MK1 WP_009073273.1

Metallosphaera cuprina Ar-4 YP_004410512.1

Metallosphaera sedula DSM 5348 YP_001190248.1

Prosthecochloris aestuarii DSM 271 YP_002014994.1

Chlorobium tepidum TLS NP_661063.1

Maribacter sp. HTCC2170 YP_003862153.1

Cytophaga hutchinsonii ATCC 33406 YP_678231.1 Methanocella conradii HZ254 YP_005380041.1

Glycine max chloroplast AAF80469.1

Synechococcus elongatus PCC 7942 AAB88214.1

Nostoc sp. PCC 7120 WP_010995113.1

Rhodobacter sphaeroides 2.4.1 YP_353263.1

YP_001154994.1 Polynucleobacter necessarius subsp. asymbioticus QLW-P1DMWA-1 Pseudomonas aeruginosa PAO1 NP_253535.1

Vibrio cholerae O1 biovar eltor str. N16961 AAF93469.1

P24182.2 Escherichia coli K12 (acetyl-CoA carboxylase) Methanogens Methanosphaerula palustris E1-9c YP_002466080.1

Methanofollis liminatans DSM 4140 WP_004038938.1

Methanoculleus bourgensis MS2 YP_006545596.1

Methanoregula boonei 6A8 YP_001404942.1

Methanolinea tarda NOBI-1 WP_007315206.1

Methanoplanus limicola DSM 2279 WP_004078029.1

Methanospirillum hungatei JF-1 YP_504591.1

Methanocorpusculum labreanum Z YP_001029582.1

Thermoplasmatales archaeon SCGC AB- WP_004558070.1 539-C06

Methanothermococcus thermolithotrophicus WP_018154010.1

Methanococcus maripaludis C6 YP_001548660.1

Methanotorris formicicus Mc-S-70 WP_007043648.1

Methanococcus voltae A3 YP_003708349.1

Methanocaldococcus jannaschii DSM 2661 NP_248224.1

Archaeoglobales Ferroglobus placidus DSM 10642 YP_003434777.1

Archaeoglobus sulfaticallidus PM70-1 YP_007908016.1

Archaeoglobus fulgidus DSM 4304 NP_069058.1

Archaeoglobus veneficus SNP6 YP_004342251.1

Archaeoglobus profundus DSM 5631 YP_003399787.1

Dehalococcoides sp. VS WP_012881478.1

Dehalococcoides sp. CBDB1 YP_307312.1

Dehalococcoides ethenogenes 195 YP_180870.1

Methanogens Methanobacterium formicicum DSM 3637 WP_004030404.1

Methanothermobacter thermautotrophicus NP_277017.1 str. Delta H (pyruvate carboxylase)

Methanobrevibacter smithii ATCC 35061 YP_001273338.1

Methanosphaera stadtmanae DSM 3091 YP_447945.1

Methanothermus fervidus DSM 2088 YP_004003681.1

Methanosaeta concilii GP6 YP_004383961.1

Methanosarcina mazei Go1 AAM31524.1

Methanohalophilus mahii DSM 5219 YP_003541792.1

Methanococcoides burtonii DSM 6242 YP_567027.1

Methanohalobium evestigatum Z-7303 YP_003726235.1

Methanosalsum zhilinae DSM 4017 YP_004615673.1

Methanomethylovorans hollandica DSM YP_007312567.1 15978

Methanolobus psychrophilus R15 YP_006922504.1

Thermoplasmatales archaeon SCGC AB- WP_008604846.1 540-F20

Homo sapiens (3-methylcrotonyl-CoA AAG50245.1 carboxylase)

Rhodobacter sphaeroides 2.4.1 YP_352246.1

Homo sapiens (propionyl-CoA carboxylase) CAA32763.1

Haloarchaea Natronorubrum tibetense GA33 WP_006091501.1

Haloterrigena turkmenica DSM 5511 YP_003403287.1

Natronolimnobius innermongolicus JCM WP_007257462.1 12255

Natrinema pallidum DSM 3751 WP_006186692.1

Natrinema pellirubrum DSM 15624 YP_007281257.1

Natrialba magadii ATCC 43099 YP_003481208.1

Natronobacterium gregoryi SP2 YP_007176296.1

Halobiforma lacisalsi AJ5 WP_007140552.1

Halopiger xanaduensis SH-6 YP_004597192.1

Natronococcus jeotgali DSM 18795 WP_008426054.1

Halalkalicoccus jeotgali B3 YP_003736572.1

Salinarchaeum sp. Harcht-Bsk1 YP_008054563.1

Halorubrum lacusprofundi ATCC 49239 YP_002567182.1

Halovivax ruber XH-70 YP_007284590.1

halophilic archaeon DL31 YP_004807820.1 Halobacterium sp. NRC-1 NP_280339.1

Natronomonas pharaonis DSM 2160 YP_330913.1

Haladaptatus paucihalophilus DX253 WP_007982627.1

Halosimplex carlsbadense 2-9-1 WP_006883558.1

Halococcus saccharolyticus DSM 5350 WP_006076944.1

Haloarcula californiae ATCC 33799 YP_134794.1

Halomicrobium katesii WP_018258386.1

Halomicrobium mukohataei DSM 12286 YP_003178388.1

Haloferax volcanii DS2 YP_003536505.1

Haloferax mediterranei ATCC 33500 YP_006350160.1

Halogranum salarium B-1 WP_009374947.1

Halosarcina pallida JCM 14848 WP_008382871.1

Halogeometricum borinquense DSM 11551 YP_004036155.1

Haloquadratum walsbyi DSM 16790 YP_658614.1

Halarchaeum acidiphilum WP_020222517.1

Natronorubrum sulfidifaciens JCM 14089 WP_008161545.1

Natronolimnobius innermongolicus JCM WP_007259629.1 12255

Natrialba magadii ATCC 43099 YP_003480254.1

Natronomonas pharaonis DSM 2160 YP_330855.1

Haloarcula marismortui ATCC 43049 YP_138140.1

Haloterrigena limicola JCM 13563 WP_008012613.1

Natrinema pellirubrum DSM 15624 YP_007281624.1

Haloterrigena thermotolerans DSM 11522 WP_006649304.1

Halalkalicoccus jeotgali B3 YP_003735631.1

Natronorubrum tibetense GA33 WP_006089762.1

Natrialba magadii ATCC 43099 YP_003482124.1

Mycobacterium tuberculosis H37Rv NP_217802.1 NP_217017.1 NP_217483.1

Corynebactrerium glutamicum ATCC Q79VI2 13032

Propionibacterium acnes KPA171202 AAT83448.1

Streptomyces coelicolor A3(2) AAD28553.1

Herpetosiphon aurantiacus ATCC 23779 YP_001546967.1 Roseiflexus sp. RS-1 YP_001277908.1

Roseiflexus castenholzii DSM 13941 YP_001434335.1

Chloroflexus aurantiacus J-10-fl YP_001634995.1

Chloroflexus aggregans DSM 9485 YP_002463844.1

Pseudomonas aeruginosa PAO1 NP_249185.1 NP_251581.1 NP_250702.1

Geobacillus thermodenitrificans NG80-2 YP_001125067.1

Staphylococcus aureus (pyruvate 3BG5 carboxylase) Homo sapiens (pyruvate carboxylase) NP_071504.2

Saccharomyces cerevisiae AAA34843.1

Rhizobium etli CFN 42 2QF7

Rhodobacter sphaeroides 2.4.1 YP_352146.1

Homo sapiens NP_942131.1 CAE01470.2

Desulfur/Therm Ignisphaera aggregans DSM 17230 YP_003859693.1 (Desulfurococcales/ Thermoproteales) Thermofilum pendens Hrk 5 YP_919532.1

Hyperthermus butylicus DSM 5456 YP_001013339.1

Desulfurococcus fermentans DSM 16532 YP_006402344.1

Thermosphaera aggregans DSM 11486 YP_003649759.1

Thermogladius cellulolyticus 1633 YP_006363452.1

Staphylothermus marinus F1 YP_001040161.1

Staphylothermus hellenicus DSM 12710 YP_003668698.1

Tree of carboxyl transferases (Fig. S8)

Sulfolobales Metallosphaera cuprina Ar-4 YP_004409447.1

Metallosphaera sedula DSM 5348 YP_001191457.1

Metallosphaera yellowstonensis MK1 WP_009074170.1

Acidianus brierleyi DSM 1651 BAC55869.1

Acidianus hospitalis W1 YP_004459286.1

Sulfolobus metallicus LM AAB97083.1

Sulfolobus acidocaldarius DSM 639 YP_254971.1

Sulfolobus tokodaii str. 7 NP_376479.1

Sulfolobus islandicus M.14.25 YP_002828440.1

Sulfolobus solfataricus P2 NP_343812.1

Desulfurococcales Hyperthermus butylicus DSM 5456 YP_001013337.1 Thermogladius cellulolyticus 1633 YP_006363495.1

Staphylothermus marinus F1 YP_001041424.1

Thermosphaera aggregans DSM 11486 YP_003649647.1

Desulfurococcus fermentans DSM 16532 YP_006402315.1

Thaumarchaeota Candidatus Nitrososphaera gargensis Ga9.2 YP_006860793.1

Cenarchaeum symbiosum A YP_876582.1

Candidatus Nitrosoarchaeum limnia BG20 WP_010194129.1

Candidatus Nitrosoarchaeum limnia SFB1 WP_007402316.1

Candidatus Nitrosoarchaeum koreensis WP_007549630.1 MY1

Nitrosopumilus maritimus SCM1 YP_001581606.1

Candidatus Nitrosopumilus koreensis AR1 YP_006773093.1

Candidatus Nitrosopumilus salaria BD31 WP_008301102.1

Candidatus Nitrosopumilus sp. AR2 YP_006775006.1

Therm./Desulfuroc./Ferv. Ignisphaera aggregans DSM 17230 YP_003860516.1 (Thermoproteales/ Desulfurococcales/ Fervidicoccales) Thermofilum pendens Hrk 5 YP_919569.1

Fervidicoccus fontis Kam940 YP_005842406.1

Aciduliprofundum boonei T469 YP_003483733.1

Aciduliprofundum sp. MAR08-339 YP_007247212.1

Thermotoga Thermotoga maritima MSB8 NP_228525.1

Streptomyces coelicolor A3(2) NP_630382.1 NP_629669.1

Haloarchaea Haloferax mediterranei ATCC 33500 YP_006350148.1

Haloferax volcanii DS2 YP_003536490.1

Haloquadratum walsbyi C23 YP_005840891.1

Halorubrum lacusprofundi ATCC 49239 YP_002567179.1

Halobacterium sp. NRC-1 NP_280337.1

Halopiger xanaduensis SH-6 YP_004597189.1

Haloterrigena thermotolerans DSM 11522 WP_006181734.1

Natrialba magadii ATCC 43099 YP_003481206.1

Natronomonas pharaonis DSM 2160 YP_330911.1

Halococcus saccharolyticus DSM 5350 WP_006076940.1

Haloarcula hispanica ATCC 33960 YP_004795378.1

Halomicrobium mukohataei DSM 12286 YP_003178386.1 YP_003178100.1 Halococcus saccharolyticus DSM 5350 WP_006077284.1 WP_006076371.1

Haloarcula hispanica ATCC 33960 YP_004796133.1

Oscillochloris trichoides DG6 WP_006561063.1

Pelosinus fermentans JBW45 WP_007957270.1 WP_007952796.1 WP_007959484.1 WP_007955478.1

Megasphaera elsdenii DSM 20460 YP_004766112.1

Thermoanaerobacter tengcongensis MB4 NP_623920.1 NP_622846.1

Clostridium symbiosum WAL-14163 WP_003502616.1

Syntrophobacter fumaroxidans MPOB YP_845350.1

Chloroflexus aurantiacus J-10-fl YP_001636643.1

Propionibacterium acnes HL037PA3 WP_002527993.1 WP_002528590.1

Corynebacterium glutamicum ATCC 13032 NP_599939.1 WP_003863614.1

Mycobacterium tuberculosis H37Rv NP_217797.1 NP_218316.2

Streptomyces coelicolor A3(2) NP_629079.1

Caldiarchaeum Candidatus Caldiarchaeum subterraneum BAJ47572.1

Clostridium symbiosum WAL-14163 WP_004462250.1 WP_003499794.1

Leptospira interrogans str. 2006001854 WP_000678778.1

Archaeoglobus profundus DSM 5631 YP_003400703.1

Mycobacterium tuberculosis H37Rv NP_216763.1

Chloroflexus aurantiacus J-10-fl YP_001637009.1

Propionibacterium acnes HL037PA3 WP_002527042.1

Tree of homologues of large subunit of methylmalonyl-CoA mutase (Fig. S9)

Thaumarchaeota Nitrosopumilus maritimus SCM1 YP_001582288.1

Candidatus Nitrosopumilus koreensis AR1 YP_006773909.1

Candidatus Nitrosopumilus sp. AR2 YP_006775836.1

Candidatus Nitrosopumilus salaria BD31 WP_008299256.1

Candidatus Nitrosoarchaeum koreensis WP_007550754.1 MY1

Candidatus Nitrosoarchaeum limnia WP_010189674.1

Candidatus Nitrosoarchaeum limnia SFB1 WP_007401790.1 Cenarchaeum symbiosum A YP_875414.1

Candidatus Nitrososphaera gargensis Ga9.2 YP_006863082.1

Euryarchaeota Thermococcus kodakarensis KOD1 YP_183562.1

Pyrococcus furiosus DSM 3638 NP_579206.1

Ferroglobus placidus DSM 10642 YP_003436254.1

Archaeoglobus fulgidus DSM 4304 NP_071040.1

Aciduliprofundum boonei T469 WP_008082903.1

Crenarchaeota Vulcanisaeta distributa DSM 14429 YP_003900503.1

Sulfolobus tokodaii str. 7 NP_376440.1

Sulfolobus acidocaldarius N8 YP_007434015.1

Sulfolobus solfataricus P2 NP_343779.1

Sulfolobus islandicus M.14.25 YP_002828403.1

Acidianus hospitalis W1 YP_004459385.1

Metallosphaera yellowstonensis MK1 WP_009071435.1

Metallosphaera sedula DSM 5348 YP_001190737.1

Metallosphaera cuprina Ar-4 YP_004410103.1

Candidatus Methylomirabilis oxyfera YP_003206114.1

Caldilinea aerophila DSM 14535 YP_005441724.1

Sulfobacillus acidophilus TPY YP_004721398.1

Candidatus Chloracidobacterium YP_004861834.1 thermophilum B

Acidobacterium capsulatum ATCC 51196 YP_002754966.1

Ktedonobacter racemifer DSM 44963 WP_007907696.1

Pedobacter heparinus DSM 2366 YP_003093860.1

Streptomyces coelicolor A3(2) NP_629023.1

Streptomyces griseoflavus Tu4000 WP_004926709.1

Streptomyces cattleya NRRL 8057 YP_004913267.1

Kitasatospora setae KM-6054 YP_004904802.1

Salinispora arenicola CNS-205 YP_001535686.1

Thermomicrobium roseum DSM 5159 YP_002522762.1

Oscillochloris trichoides DG6 WP_006562191.1

Thermus aquaticus Y51MC23 WP_003045932.1

Veillonella parvula DSM 2008 YP_003312208.1

Selenomonas sputigena ATCC 35185 YP_004412934.1 Thermosinus carboxydivorans Nor1 WP_007288796.1

Clostridium sticklandii DSM 519 YP_003935968.1

Caldithrix abyssi DSM 13497 WP_006927485.1

Thermoanaerobacter ethanolicus CCSD1 WP_003867698.1

Geobacter metallireducens GS-15 YP_006722206.1

Pelobacter propionicus DSM 2379 YP_900212.1

Anaerobaculum mobile DSM 13181 YP_006444953.1

Thermosipho africanus TCF52B YP_002334003.1

Thermotoga thermarum DSM 5069 YP_004660092.1

Desulfosporosinus orientis DSM 765 YP_004971069.1

Desulfotomaculum kuznetsovii DSM 6115 YP_004516746.1

Heliobacterium modesticaldum Ice1 YP_001679006.1

Ornithinibacillus scapharcae WP_010093162.1

Kyrpidia tusciae DSM 2912 YP_003589180.1

Brevibacillus borstelensis AK1 WP_003387217.1

Natronococcus occultus SP4 YP_007311099.1

Natrialba magadii ATCC 43099 YP_003478707.1

Halobacterium salinarum R1 YP_001688628.1

Haloquadratum walsbyi DSM 16790 YP_658133.1

Haloferax volcanii DS2 YP_003535431.1

Haloarcula marismortui ATCC 43049 YP_135350.1

WP_005489562.1 Halanaerobium saccharolyticum subsp. saccharolyticum DSM 6643 Natrialba magadii ATCC 43099 YP_003478963.1

Natronococcus occultus SP4 YP_007308649.1

Halobacterium salinarum R1 YP_001688767.1

Haloferax volcanii DS2 YP_003534953.1

Haloarcula marismortui ATCC 43049 YP_135919.1

Archaeoglobus fulgidus DSM 4304 NP_071268.1

Ferroglobus placidus DSM 10642 YP_003436004.1

Desulfotomaculum acetoxidans DSM 771 YP_003191373.1

Thermoplasma volcanium GSS1 NP_111291.1

Ferroplasma acidarmanus WP_009887322.1

Aeropyrum pernix K1 NP_148096.1 Acidilobus saccharovorans 345-15 YP_003816513.1

Caldisphaera lagunensis DSM 15908 YP_007174687.1

Sulfobacillus acidophilus TPY YP_004719007.1

Desulfotomaculum kuznetsovii DSM 6115 YP_004516591.1

Schlesneria paludicola WP_010585434.1

Acidobacterium capsulatum ATCC 51196 YP_002753466.1

Candidatus Nitrospira defluvii YP_003798737.1

Thermus aquaticus Y51MC23 WP_003048193.1

Ktedonobacter racemifer DSM 44963 WP_007907729.1

Oscillochloris trichoides DG6 WP_006561078.1

Chloroflexus aurantiacus J-10-fl YP_001635450.1

Tree of 3-hydroxypropionyl-CoA synthetase homologues (Fig. 2A, Fig. S10)

Nitrosopumilus maritimus Nitrosopumilus maritimus SCM1 YP_001582643.1

Candidatus Nitrosopumilus koreensis Candidatus Nitrosopumilus koreensis AR1 YP_006774282.1

Candidatus Nitrosopumilus salaria Candidatus Nitrosopumilus salaria BD31 WP_008297867.1

Candidatus Nitrosopumilus sp. AR2 Candidatus Nitrosopumilus sp. AR2 YP_006776186.1

Candidatus Nitrosoarchaeum limnia Candidatus Nitrosoarchaeum limnia BG20 EPA05076.1

Cenarchaeum symbiosum Cenarchaeum symbiosum A YP_875116.1

Candidatus Nitrososphaera gargensis Candidatus Nitrososphaera gargensis Ga9.2 YP_006862521.1

Desulfococcus oleovorans Desulfococcus oleovorans Hxd3 YP_001528473.1

Methanosaeta thermophila Methanosaeta thermophila PT YP_842985.1

Methanosaeta concilii Methanosaeta concilii GP6 YP_004384148.1

Syntrophus aciditrophicus-1 Syntrophus aciditrophicus SB YP_460839.1

Archaeoglobus fulgidus-1 Archaeoglobus fulgidus DSM 4304 NP_069765.1

Archaeoglobus fulgidus-2 Archaeoglobus fulgidus DSM 4304 NP_070021.1

Archaeoglobus fulgidus-3 Archaeoglobus fulgidus DSM 4304 (aryl- NP_070763.1 CoA synthetase; 9)

Oligotropha carboxidovorans Oligotropha carboxidovorans OM5 YP_002289530.1

Afipia felis Afipia felis ATCC 53690 WP_002716244.1

Bradyrhizobium japonicum Bradyrhizobium japonicum USDA 110 NP_769799.1

Mesorhizobium alhagi Mesorhizobium alhagi CCNWXJ12-2 WP_008835925.1

Methylobacterium nodulans Methylobacterium nodulans ORS 2060 YP_002495263.1

Cupriavidus metallidurans Cupriavidus metallidurans CH34 YP_586496.1

Burkholderia phenoliruptrix Burkholderia phenoliruptrix BR3459a YP_006794172.1 Burkholderia graminis Burkholderia graminis C4D1M WP_006049167.1

Amycolatopsis mediterranei Amycolatopsis mediterranei U32 YP_003766745.1

Saccharomonospora marina Saccharomonospora marina XMU15 WP_009155340.1

Nocardiopsis dassonvillei Nocardiopsis dassonvillei DSM 43111 YP_003682023.1

Streptomyces rimosus Streptomyces rimosus subsp. rimosus WP_003985982.1 ATCC 10970

Streptomyces aurantiacus Streptomyces aurantiacus JA 4570 EPH40961.1

Streptomyces griseoflavus Streptomyces griseoflavus Tu4000 WP_004922726.1

Streptomyces coelicolor Streptomyces coelicolor A3(2) NP_630661.1

Syntrophus aciditrophicus-2 Syntrophus aciditrophicus SB YP_462216.1

Desulfobacter postgatei Desulfobacter postgatei 2ac9 WP_004070810.1

Wolinella succinogenes Wolinella succinogenes DSM 1740 NP_907230.1

Thermovibrio ammonificans Thermovibrio ammonificans HB-1 YP_004151981.1

Methanoregula boonei-1 Methanoregula boonei 6A8 YP_001404780.1

Methanospirillum hungatei-1 Methanospirillum hungatei JF-1 YP_502924.1

Methanoplanus limicola-1 Methanoplanus limicola DSM 2279 WP_004077228.1

Methanoplanus limicola-2 Methanoplanus limicola DSM 2279 WP_004076503.1

Methanospirillum hungatei-2 Methanospirillum hungatei JF-1 YP_502045.1

Methanoregula boonei-1 Methanoregula boonei 6A8 YP_001404075.1

Paracoccus denitrificans Paracoccus denitrificans PD1222 YP_918752.1

Starkeya novella Starkeya novella DSM 506 YP_003692320.1

Tree of 4-hydroxybutyryl-CoA synthetase homologues (Fig. 2B, Fig. S11)

Natrinema pallidum Natrinema pallidum DSM 3751 WP_006186605.1

Natronococcus occultus Natronococcus occultus SP4 YP_007309188.1

Haloterrigena limicola Haloterrigena limicola JCM 13563 WP_008010363.1

Natrialba magadii Natrialba magadii ATCC 43099 YP_003481589.1

Halobiforma lacisalsi Halobiforma lacisalsi AJ5 WP_007141936.1

Halococcus saccharolyticus Halococcus saccharolyticus DSM 5350 WP_006076803.1

Halalkalicoccus jeotgali Halalkalicoccus jeotgali B3 YP_003738190.1

Halorubrum californiensis Halorubrum californiensis DSM 19288 WP_008442843.1

Halogeometricum borinquense Halogeometricum borinquense DSM 11551 YP_004037136.1

Haloferax denitrificans Haloferax denitrificans ATCC 35960 WP_004971018.1

Halorhabdus utahensis Halorhabdus utahensis DSM 12940 YP_003131178.1

Halosimplex carlsbadense Halosimplex carlsbadense 2-9-1 WP_006884487.1 Haloarcula hispanica Haloarcula hispanica ATCC 33960 YP_004796120.1

Halomicrobium katesii Halomicrobium katesii WP_018258619.1

Natronomonas moolapensis Natronomonas moolapensis 8.8.11 YP_007487678.1

Kyrpidia tusciae Kyrpidia tusciae DSM 2912 YP_003589016.1

Thermaerobacter marianensis Thermaerobacter marianensis DSM 12885 YP_004101742.1

Sutterella parvirubra Sutterella parvirubra YIT 11816 WP_008542307.1

Roseiflexus castenholzii Roseiflexus castenholzii DSM 13941 YP_001430231.1

Chloroflexus aurantiacus Chloroflexus aurantiacus J-10-fl YP_001637486.1

Oscillochloris trichoides Oscillochloris trichoides DG6 WP_006561970.1

Methanocella conradii Methanocella conradii HZ254 YP_005379605.1

Methanobacterium formicicum Methanobacterium formicicum DSM 3637 WP_004030442.1

Methanohalophilus mahii Methanohalophilus mahii DSM 5219 YP_003542795.1

Methanomethylovorans hollandica Methanomethylovorans hollandica DSM YP_007312380.1 15978

Desulfotomaculum hydrothermale Desulfotomaculum hydrothermale Lam5 WP_008411974.1

Desulfurispora thermophila Desulfurispora thermophila WP_018085852.1

Ammonifex degensii Ammonifex degensii KC4 YP_003239642.1

Methanobrevibacter smithii Methanobrevibacter smithii ATCC 35061 YP_001274044.1

Giardia lamblia Giardia lamblia P15 EFO63922.1

Thermodesulfovibrio yellowstonii Thermodesulfovibrio yellowstonii DSM YP_002249397.1 11347

Thermodesulfobacterium geofontis Thermodesulfobacterium geofontis OPF15 YP_004627663.1

Thermodesulfatator indicus Thermodesulfatator indicus DSM 15286 YP_004625200.1

Thermodesulfobium narugense Thermodesulfobium narugense DSM 14796 YP_004438172.1

Candidatus Kuenenia stuttgartiensis Candidatus Kuenenia stuttgartiensis CAJ73927.1

Desulfovibrio magneticus Desulfovibrio magneticus RS-1 YP_002953381.1

Desulfovibrio hydrothermalis Desulfovibrio hydrothermalis AM13 YP_007325671.1

Desulfovibrio salexigens Desulfovibrio salexigens DSM 2638 YP_002992636.1

Desulfotignum phosphitoxidans Desulfotignum phosphitoxidans DSM WP_006965921.1 13687

Desulfobacula toluolica Desulfobacula toluolica Tol2 YP_006760057.1

Desulfobacterium autotrophicum-1 Desulfobacterium autotrophicum HRM2 YP_002602947.1

Desulfococcus oleovorans Desulfococcus oleovorans Hxd3 YP_001530943.1

Syntrophobacter fumaroxidans Syntrophobacter fumaroxidans MPOB YP_846086.1

Desulfobacterium autotrophicum-2 Desulfobacterium autotrophicum HRM2 YP_002601956.1 Desulfatibacillum alkenivorans Desulfatibacillum alkenivorans AK-01 YP_002430195.1

Magnetococcus marinus Magnetococcus marinus MC-1 YP_865022.1

Caldithrix abyssi Caldithrix abyssi DSM 13497 WP_006929378.1

Pleurocapsa sp. PCC 7327 Pleurocapsa sp. PCC 7327 YP_007081666.1

Entamoeba histolytica Entamoeba histolytica HM-1:IMSS XP_656290.1

Methanocaldococcus vulcanius Methanocaldococcus vulcanius M7 YP_003247654.1

Methanocaldococcus villosus Methanocaldococcus villosus KIN24-T80 WP_004593344.1

Methanotorris formicicus Methanotorris formicicus Mc-S-70 WP_007044454.1

Anaerolinea thermophila Anaerolinea thermophila UNI-1 YP_004174284.1

Aciduliprofundum boonei Aciduliprofundum boonei T469 YP_003482693.1

Candidatus Nitrososphaera gargensis Candidatus Nitrososphaera gargensis Ga9.2 YP_006863240.1

Cenarchaeum symbiosum Cenarchaeum symbiosum A YP_874976.1

Candidatus Nitrosoarchaeum koreensis Candidatus Nitrosoarchaeum koreensis WP_007549553.1 MY1

Candidatus Nitrosoarchaeum limnia Candidatus Nitrosoarchaeum limnia SFB1 WP_007402376.1

Nitrosopumilus maritimus Nitrosopumilus maritimus SCM1 YP_001581540.1

Candidatus Nitrosopumilus salaria Candidatus Nitrosopumilus salaria BD31 WP_008297726.1

Candidatus Nitrosopumilus sp. AR2 Candidatus Nitrosopumilus sp. AR2 YP_006774920.1

Methanomassiliicoccus luminyensis Methanomassiliicoccus luminyensis WP_019176444.1

Archaeoglobus fulgidus Archaeoglobus fulgidus DSM 4304 NP_070039.1

Anaerolinea thermophila-2 Anaerolinea thermophila UNI-1 YP_004174188.1

Tree of 3-hydroxypropionyl-CoA/3-hydroxybutyryl-CoA dehydratase homologues (Fig. 2C, Fig. S12)

Oscillibacter valericigenes Oscillibacter valericigenes Sjm18-20 YP_004881326.1

Anaerotruncus colihominis Anaerotruncus colihominis DSM 17241 WP_006877252.1

Fusobacterium necrophorum Fusobacterium necrophorum D12 WP_005963708.1

Fusobacterium nucleatum Fusobacterium nucleatum ChDC F128 WP_005916775.1

Treponema phagedenis Treponema phagedenis F0421 WP_002701270.1

Allobaculum stercoricanis Allobaculum stercoricanis WP_019892801.1

Eubacterium dolichum Eubacterium dolichum DSM 3991 WP_004800654.1

Clostridium perfringens Clostridium perfringens str. 13 NP_563217.1

Clostridium botulinum Clostridium botulinum B str. Eklund 17B YP_001884608.1

Clostridium kluyveri Clostridium kluyveri DSM 555 YP_001393856.1

Clostridium tetanomorphum Clostridium tetanomorphum GT6 CCF78538.1 Clostridium acetobutylicum Clostridium acetobutylicum ATCC 824 NP_349318.1

Thermobrachium celere Thermobrachium celere DSM 8682 WP_018663532.1

Peptoniphilus indolicus Peptoniphilus indolicus ATCC 29427 WP_004820320.1

Odoribacter splanchnicus Odoribacter splanchnicus DSM 220712 YP_004254321.1

Butyricimonas synergistica Butyricimonas synergistica WP_018337468.1

Clostridium difficile Clostridium difficile 050-P50-2011 WP_003428571.1

Ilyobacter polytropus-1 Ilyobacter polytropus DSM 2926 YP_003966413.1

Ilyobacter polytropus-2 Ilyobacter polytropus DSM 2926 YP_003968999.1

Desulfitobacterium metallireducens Desulfitobacterium metallireducens DSM WP_006715316.1 15288

Porphyromonas endodontalis Porphyromonas endodontalis ATCC 35406 WP_004334307.1

Lactobacillus suebicus Lactobacillus suebicus WP_010621914.1

Pelotomaculum thermopropionicum Pelotomaculum thermopropionicum SI YP_001211065.1

Carboxydothermus hydrogenoformans-1 Carboxydothermus hydrogenoformans Z- YP_360127.1 2901

Thermoanaerobacter tengcongensis Thermoanaerobacter tengcongensis MB4 NP_622216.1

Nitrolancetus hollandicus Nitrolancetus hollandicus Lb WP_008478853.1

Sphaerobacter thermophilus Sphaerobacter thermophilus DSM 20745 YP_003319082.1

Geobacter metallireducens Geobacter metallireducens GS-15 YP_006721034.1

Syntrophothermus lipocalidus Syntrophothermus lipocalidus DSM 12680 YP_003703401.1

Candidatus Nitrososphaera gargensis Candidatus Nitrososphaera gargensis Ga9.2 YP_006862785.1

Cenarchaeum symbiosum Cenarchaeum symbiosum A YP_875115.1

Candidatus Nitrosoarchaeum limnia Candidatus Nitrosoarchaeum limnia SFB1 WP_007402160.1

Candidatus Nitrosopumilus salaria Candidatus Nitrosopumilus salaria BD31 WP_008297871.1

Candidatus Nitrosopumilus sp. AR2 Candidatus Nitrosopumilus sp. AR2 YP_006776185.1

Candidatus Nitrosopumilus koreensis Candidatus Nitrosopumilus koreensis AR1 YP_006774281.1

Nitrosopumilus maritimus Nitrosopumilus maritimus SCM1 YP_001582642.1

Megasphaera elsdenii Megasphaera elsdenii DSM 20460 YP_004765512.1

Anaeroglobus geminatus-1 Anaeroglobus geminatus F0357 WP_006789041.1

Anaeroglobus geminatus-2 Anaeroglobus geminatus F0357 WP_006790871.1

Megasphaera elsdenii Megasphaera elsdenii DSM 20460 YP_004766497.1

Syntrophomonas wolfei-1 Syntrophomonas wolfei subsp. wolfei str. YP_754696.1 Goettingen

Syntrophomonas wolfei-2 Syntrophomonas wolfei subsp. wolfei str. YP_753482.1 Goettingen Zymophilus raffinosivorans Zymophilus raffinosivorans WP_019552737.1

Desulfotomaculum kuznetsovii Desulfotomaculum kuznetsovii DSM 6115 YP_004516212.1

Desulfosporosinus youngiae Desulfosporosinus youngiae DSM 17734 WP_007785321.1

Carboxydothermus hydrogenoformans-2 Carboxydothermus hydrogenoformans Z- YP_360429.1 2901

Geopsychrobacter electrodiphilus Geopsychrobacter electrodiphilus WP_020677771.1

Dethiobacter alkaliphilus Dethiobacter alkaliphilus AHT 1 WP_008519125.1

Pelosinus fermentans-1 Pelosinus fermentans JBW45 WP_007957186.1

Pelosinus fermentans-2 Pelosinus fermentans JBW45 WP_007957159.1

Acetonema longum Acetonema longum DSM 6540 WP_004099937.1

Thermosinus carboxydivorans Thermosinus carboxydivorans Nor1 WP_007288948.1

Eremococcus coleocola WP_006418998.1 Eremococcus coleocola ACS-139-V-Col8 Carnobacterium sp. AT7 Carnobacterium sp. AT7 WP_007721919.1

Tree of 3-hydroxybutyryl-CoA dehydrogenase homologues (Fig. S13)

Sulfolobus solfataricus-1 Sulfolobus solfataricus P2 NP_343855.1

Sulfolobus islandicus-1 Sulfolobus islandicus M.16.4 YP_002913622.1

Sulfolobus acidocaldarius-1 Sulfolobus acidocaldarius DSM 639 YP_255754.1

Sulfolobus acidocaldarius-2 Sulfolobus acidocaldarius DSM 639 YP_255779.1

Sulfolobus solfataricus-2* Sulfolobus solfataricus P2 NP_344188.1

Sulfolobus islandicus-2* Sulfolobus islandicus M.16.4 YP_002915706.1

Caldisphaera lagunensis Caldisphaera lagunensis DSM 15908 YP_007174718.1

Acidilobus saccharovorans Acidilobus saccharovorans 345-15 YP_003816467.1

Archaeoglobus sulfaticallidus-1 Archaeoglobus sulfaticallidus PM70-1 YP_007906167.1

Caldivirga maquilingensis Caldivirga maquilingensis IC-167 YP_001540173.1

Candidatus Caldiarchaeum subterraneum Candidatus Caldiarchaeum subterraneum BAJ47153.1 BAJ49086.1 BAJ50004.1 BAJ46931.1

Pyrobaculum oguniense-1* Pyrobaculum oguniense TE7 YP_005261310.1

Pyrobaculum oguniense-2* Pyrobaculum oguniense TE7 YP_005259982.1

Vulcanisaeta moutnovskia Vulcanisaeta moutnovskia 768-28 YP_004245082.1

Vulcanisaeta distributa Vulcanisaeta distributa DSM 14429 YP_003900718.1

Candidatus Korarchaeum cryptofilum Candidatus Korarchaeum cryptofilum YP_001736557.1 OPF8

Candidatus Nitrososphaera gargensis* Candidatus Nitrososphaera gargensis Ga9.2 YP_006861994.1

Cenarchaeum symbiosum* Cenarchaeum symbiosum A YP_875352.1 Candidatus Nitrosoarchaeum limnia* Candidatus Nitrosoarchaeum limnia BG20 WP_010195448.1

Candidatus Nitrosopumilus sp. AR2* Candidatus Nitrosopumilus sp. AR2 YP_006775956.1

Candidatus Nitrosopumilus salaria* Candidatus Nitrosopumilus salaria BD31 WP_008299135.1

Candidatus Nitrosopumilus koreensis* Candidatus Nitrosopumilus koreensis AR1 YP_006773973.1

Nitrosopumilus maritimus* Nitrosopumilus maritimus SCM1 YP_001582362.1

Ferroglobus placidus Ferroglobus placidus DSM 10642 YP_003435472.1

Salinarchaeum sp. Harcht-Bsk1 Salinarchaeum sp. Harcht-Bsk1 YP_008055722.1

Haloferax volcanii Haloferax volcanii DS2 YP_003536827.1

Haloferax mediterranei Haloferax mediterranei ATCC 33500 YP_006350489.1

Halogranum salarium Halogranum salarium B-1 WP_009367452.1

Halosarcina pallida Halosarcina pallida JCM 14848 WP_008383180.1

Haladaptatus paucihalophilus Haladaptatus paucihalophilus DX253 WP_007977580.1

Natronomonas pharaonis Natronomonas pharaonis DSM 2160 YP_330890.1

Natronorubrum bangense Natronorubrum bangense JCM 10635 WP_006066628.1

Halobiforma lacisalsi Halobiforma lacisalsi AJ5 WP_007140654.1

Natrialba magadii Natrialba magadii ATCC 43099 YP_003481221.1

Natrinema pellirubrum Natrinema pellirubrum DSM 15624 YP_007281335.1

Natronococcus jeotgali Natronococcus jeotgali DSM 18795 WP_008426253.1

Natronolimnobius innermongolicus Natronolimnobius innermongolicus JCM WP_007258257.1 12255

Haloterrigena turkmenica Haloterrigena turkmenica DSM 5511 YP_003402485.1

Archaeoglobus sulfaticallidus-2 Archaeoglobus sulfaticallidus PM70-1 YP_007907413.1

Mycobacterium tuberculosis Mycobacterium tuberculosis H37Rv NP_214982.1 (Rv0468) (validated 3-hydroxybutyryl-CoA dehydrogenase; 48)