DOCSLIB.ORG

Using Fish Brain Biomarkers to Assess the Neurotoxicity of Aspartame Artificial Sweetener

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Using Fish Brain Biomarkers to Assess the Neurotoxicity of Aspartame Artificial Sweetener Journal of the Persian Gulf (Marine Science)/Vol. 9/No. 33/ September 2018/6/35-40 Issue of Second International Conference on Oceanography for West Asia (RCOWA) 2020 Using fish brain biomarkers to assess the neurotoxicity of aspartame artificial sweetener 1 1* 2 Aisan Shirmardani , Aras Rafiee , Babak Moghadasi 1 Department of Biology, Central Tehran Branch, Islamic Azad University, Tehran, Iran 2 Department of Natural Resources, Savadkooh Branch, Islamic Azad University, Savadkooh, Iran Abstract Neurotoxins induce undesirable changes in aquatic organisms. This project assessed the effects of 78.15 g/L aspartame on expression changes of two biomarkers of neurotoxicity (glial fibrillary acidic protein-GFAP and myelin basic protein- MBP) in Cyprinus carpio brain tissue. RNA was extracted from brain tissue. The results of qPCR indicated an increase of 2.5 and 4.2 of MBP and GFAP expression. Elevated levels of these biomarkers suggest the probability of aspartame neurotoxicity. Identifying and monitoring nerve damage using biomarkers can make it easier to diagnose injuries earlier than current methods and provide an opportunity to develop future treatments. © 2018 Published by INIOAS Keywords: Aspartame, Biomarker, Common carp, Neurotoxicity, Gene expression 1. Introduction Downloaded from jpg.inio.ac.ir at 12:28 IRST on Sunday October 3rd 2021 Neurotoxins are able to alter the normal activity of the nervous system and utilization of biomarkers of neurotoxicity enables our efficiency and accuracy of diagnosis (Budny, 2015; Iheanacho et al., 2020). Aspartame is a non-saccharide artificial sweetener that its use has increased significantly due to its low cost and low calorie content (Zafar et al., 2017). This sweetener is broken down to phenylalanine, aspartic acid and methanol during metabolism in the body. Excessive concentrations of phenylalanine reduce the transfer of important amino acids to the brain. Also, methanol metabolites cause depression and other neurological symptoms that eventually lead to brain acidosis and coma (Aziz et al., 2002; Love et al., 2018). Astrocytic glial cells of the central nervous system (CNS) play a vital role in nourishing and supporting neurons in the brain and spinal cord (Sofroniew, 2015). They respond to brain-spinal cord injuries by increasing the glial fibrillary acidic protein (GFAP) rapidly (Liddelow et al., 2017). MBP maintains the proper structure of the myelin sheath and plays an important role in the myelination of nerves. Degradation of the myelin sheath due to neurotoxicity leads to the secretion of related proteins such as MBP, which reduces the function and integrity of the nerve membrane (Vallières et al., 2006; Zhang et al., 2014). Therefore, these two biomarkers are indicative of their * Corresponding Author name: Aras Rafiee E-mail address: [email protected] 35 Rahnemania et al. / Study of ice formation in the Caspian Sea using numerical simulations specific type of neural damage associated with neurotoxicity. The aim of this study was to investigate the effect of aspartame on the expression of MBP and GFAP associated with nervous system toxicity in carp’s brain. 2. Material and methods 2.1. Study Design and grouping the carps 120 juvenile carps weighing approximately 17.6 grams were collected from Mazandaran province and transported to the Pars Biological Research Center laboratory. Fishes were raised and maintained under standard laboratory conditions in tanks containing 150 L of water. After adapting to the conditions, fishes were randomly divided into control (no exposure to aspartame) and experimental (exposure to aspartame) groups. 2.2. Determining the lethal range of aspartame First, carp fishes in groups of 10 were exposed separately to the aspartame over the concentrations of 150 mg, 250 mg, 500 mg and 1000 mg per 150 L of tap water for 96 hours. Finally, by recording daily losses, a concentration of 125 mg per 150 litters' equivalent to 75.18 g/L of aspartame was selected as IC50. On the seventh day, eight fishes were selected from each tank to study the expression of the MBP and GFAP genes. 2.3. RNA extraction and cDNA synthesis All parts of the fish brain were isolated. Tissue homogenization and RNA extraction were performed according to the protocol of Cinacolon RNX-Plus Solution extraction kit. After chloroform extraction and adding isopropanol in1:1 ratio for precipitation, RNA was washed with 75% ethanol, and finally dissolved in RNase-free water. Purified RNA was quantified by measuring absorbance at 260/280 nm on a Nanodrop Downloaded from jpg.inio.ac.ir at 12:28 IRST on Sunday October 3rd 2021 spectrophotometer (Thermo Fisher Scientific, USA) and gel electrophoresis. 2.4. Assessment of gene expression by Real time PCR (qPCR) Real time PCR reaction was performed to amplify the MBP and GFAP genes according to the protocol of the sinaSYBR blue HS-Qpcr kit. Optimum reaction conditions were obtained with 1-2 μL cDNA, forward and reverse primers (0.5 μL), 12.5 μL SinaSYBR Blue H-qPCR master mix 2x and DEPC-water was added up to 25 μl. Amplifications were performed using the roche thermocycler. GAPDH was used as housekeeping gene. All samples were performed in triplicates, and the cycle threshold value (CT) was determined for further analysis. ΔCt for each gene was calculated by the formula ΔCt test = Ct test – Ct GAPDH and ΔCt control = Ct control – Ct GAPDH. ΔΔCt was measured by ΔΔCt = ΔCt test – ΔCt control. Finally, 2-ΔΔCt was calculated by the formula 2 -(ΔCt test – ΔCt control). The primers were designed using IDT online software and the sequences were as follows: Forward primer (GFAP) CCAGACTTAACCACTGCCCT, Reverse primer (GFAP) TTCGAGCGATACCACTCCTC, Forward primer (MBP) GTGAGCCACTTACTGTTCC, Reverse primer 36 Journal of the Persian Gulf (Marine Science)/Vol. 9/No. 33/ September 2018/6/35-40 (MBP) CCCAGTCCAAATACCTCATC, Forward primer (GAPDH) TCAATGGGGATGTGCGTTCA, Reverse primer (GAPDH) AGGTCACATACACGGTTGCT. 2.5. Statistical analysis Statistical differences were determined either by Student’s t-test for paired samples or by one-way analysis of variance using PRISM 7.0 (Graphpad Software). P value <0.05 was considered significant. 3. Results 3.1. RNA quality The extracted RNAs had concentration between 100-400 ng/µl, calculated by nanodrop. RNA quality analysis was determined by agarose gel electrophoresis. The 18S and 28SrRNA bands was representative of good quality RNA (Fig 1). Downloaded from jpg.inio.ac.ir at 12:28 IRST on Sunday October 3rd 2021 Fig. 1: RNA analysis by agarose gel electrophoresis. 28S:18S rRNA ratio of 2:1 is indicated. Smart Ladder 200-1000 bp is shown. 3.2. MBP and GFAP expression in carp’s brain We have used quantitative real-time PCR in order to investigate the effect of aspartame on the expression level of MBP and GFAP genes of the brain. Figure 2 shows the semi-logarithmic curves of MBP and GFAP amplification. Threshold line is drawn to determine the CTs. Mean CTs in MBP gene was higher than GFAP, which indicates less expression of MBP. Based on the mean of 2-∆∆ CT, MBP and GFAP expression level was significantly higher compared with the healthy control group. The ratio of increase in the expression of MBP and GFAP was significantly increased about ≥ 2.5-fold and ≥ 4.2-fold respectively in comparison with the control group (Fig 3). 37 Rahnemania et al. / Study of ice formation in the Caspian Sea using numerical simulations Fig. 2: Semi-logarithmic amplification curves of MBP and GFAP Fig. 3: GFAP and MBP expression data from carp fishes treated with aspartame. The results demonstrated that MBP and GFAP had an elevated expression of ≥ 2.5-fold and ≥ 4.2-fold in treatment group compared Downloaded from jpg.inio.ac.ir at 12:28 IRST on Sunday October 3rd 2021 with control (*P < 0.05). Bars represent the standard error of the mean. 4. Discussion and conclusion Neurotoxicity affect adversely on the structure or function of the central or peripheral nervous system (Pellacani and Eleftheriou, 2020). Today, using of new methods to detect the chronic effects of toxins on the genetic and cellular mechanisms of living organisms is very important. Aspartame is commonly used as a sugar substitute in foods and beverages, but high levels of aspartame can act as a neurotoxin and cause side effects such as headache, insomnia, and impaired catecholamine concentrations in some areas of brain (Choudhary and Lee, 2018; Okasha, 2016). Biomarkers are used to diagnose various neurological diseases (Ehrenberg et al., 2020; Mondello et al., 2020). Increased expression of GFAP biomarker protein is directly related to the increase in cerebral astrocyte cells due to nerve cell damage at the site of toxicity of these cells (Borg et al., 2012; Wąsik et al., 2020). A significant 38 Journal of the Persian Gulf (Marine Science)/Vol. 9/No. 33/ September 2018/6/35-40 increase in MBP has also been observed in blood samples from patients with damaged brain parenchyma (Klemens et al., 2019). Therefore, MBP can be a good marker for identifying brain damage (Wąsik et al., 2020). MBP levels of blood in patients with brain injury after 3-0, 4-6 and 9-12 hours of injury were increase about 18%, 44% and 50% of MBP, respectively (Borg et al., 2012). This study was performed for the first time to evaluate the expression of two biomarkers of neurological diseases named GFAP and MBP in the brain tissue of carps treated with aspartame sweetener. We had used carp fishes of northern waters of the country instead of the usual Danio rerio aquarium fish, since carps unlike Danio rerio naturally may be exposed to a variety of toxins and contaminants. The fish were exposed to four different concentrations of aspartame for 3 days and finally 75.18 g of aspartame was selected as IC50. In order to identify the direct effect of aspartame on nerve tissue, RNA was extracted from the fish brain.
Load more

Recommended publications
  • Release of Melamine and Formaldehyde from Melamine-Formaldehyde Plastic Kitchenware
    molecules Article Release of Melamine and Formaldehyde from Melamine-Formaldehyde Plastic Kitchenware , Ingo Ebner * y , Steffi Haberer, Stefan Sander, Oliver Kappenstein , Andreas Luch and Torsten Bruhn y Department of Chemical and Product Safety, German Federal Institute for Risk Assessment, Max-Dohrn-Str. 8-10, 10589 Berlin, Germany; [email protected] (S.H.); [email protected] (S.S.); [email protected] (O.K.); [email protected] (A.L.); [email protected] (T.B.) * Correspondence: [email protected]; Tel.: +49-30-18412-27403 These authors contributed equally to this work. y Academic Editor: Roland Franz Received: 26 June 2020; Accepted: 31 July 2020; Published: 10 August 2020 Abstract: The release of melamine and formaldehyde from kitchenware made of melamine resins is still a matter of great concern. To investigate the migration and release behavior of the monomers from melamine-based food contact materials into food simulants and food stuffs, cooking spoons were tested under so-called hot plate conditions at 100 ◦C. Release conditions using the real hot plate conditions with 3% acetic acid were compared with conditions in a conventional migration oven and with a release to deionized water. Furthermore, the kinetics of the release were studied using Arrhenius plots giving an activation energy for the release of melamine of 120 kJ/mol. Finally, a correlation between quality of the resins, specifically the kind of bridges between the monomers, and the release of melamine, was confirmed by CP/MAS 13C-NMR measurements of the melamine kitchenware. Obviously, the ratio of methylene bridges and dimethylene ether bridges connecting the melamine monomers during the curing process can be directly correlated with the amount of the monomers released into food.
    [Show full text]
  • WHO Guidelines for Indoor Air Quality : Selected Pollutants
    WHO GUIDELINES FOR INDOOR AIR QUALITY WHO GUIDELINES FOR INDOOR AIR QUALITY: WHO GUIDELINES FOR INDOOR AIR QUALITY: This book presents WHO guidelines for the protection of pub- lic health from risks due to a number of chemicals commonly present in indoor air. The substances considered in this review, i.e. benzene, carbon monoxide, formaldehyde, naphthalene, nitrogen dioxide, polycyclic aromatic hydrocarbons (especially benzo[a]pyrene), radon, trichloroethylene and tetrachloroethyl- ene, have indoor sources, are known in respect of their hazard- ousness to health and are often found indoors in concentrations of health concern. The guidelines are targeted at public health professionals involved in preventing health risks of environmen- SELECTED CHEMICALS SELECTED tal exposures, as well as specialists and authorities involved in the design and use of buildings, indoor materials and products. POLLUTANTS They provide a scientific basis for legally enforceable standards. World Health Organization Regional Offi ce for Europe Scherfi gsvej 8, DK-2100 Copenhagen Ø, Denmark Tel.: +45 39 17 17 17. Fax: +45 39 17 18 18 E-mail: [email protected] Web site: www.euro.who.int WHO guidelines for indoor air quality: selected pollutants The WHO European Centre for Environment and Health, Bonn Office, WHO Regional Office for Europe coordinated the development of these WHO guidelines. Keywords AIR POLLUTION, INDOOR - prevention and control AIR POLLUTANTS - adverse effects ORGANIC CHEMICALS ENVIRONMENTAL EXPOSURE - adverse effects GUIDELINES ISBN 978 92 890 0213 4 Address requests for publications of the WHO Regional Office for Europe to: Publications WHO Regional Office for Europe Scherfigsvej 8 DK-2100 Copenhagen Ø, Denmark Alternatively, complete an online request form for documentation, health information, or for per- mission to quote or translate, on the Regional Office web site (http://www.euro.who.int/pubrequest).
    [Show full text]
  • Annexure Iii
    ANNEXURE III DETAILS OF PRODUCTION AND MANUFACTURING PROCESS 1. RSF Intermediate Manufacturing process: Check and prepare a clean and dry vessel. Remove oxygen from the vessel with nitrogen flushing. Charge the required quantity of Formaldehyde into the clean vessel, followed by Urea and Glyoxal 40% and diethylene glycol. The temperature is increased to 60-80 C under constant stirring. The process is continued for 5-6 hours. Take sample for quality check and if required specifications are not meet, continue reaction further for 1 hour and again check for quality. If specification is reached fill product in containers, to be used for further formulations of finished product. Chemical Reaction Material Balance Input Output Formaldehyde 0.40 RSF Urea 0.20 Reaction Vessel 1.00 Intermediate Glyoxal 0.40 Total 1.00 Total 1.00 Process Flow Diagram M/S. Dystar India Pvt. Ltd., Plot No. 3002/A,GIDC Ankleshwar, Bharuch (GJ) 2. NFF-T Intermediate Manufacturing process: Check and prepare a clean and dry vessel. Remove oxygen from the vessel with nitrogen flushing. Charge the required quantity of glyoxal 40%and water into the clean vessel under constant stirring. Cool the vessel and add N, N-dimethyl urea until homogenous mixture is achieved. The temperature is maintained below ambient temperature and reaction is further continued for 2-4 hours under catalytic concentration of citric acid. Take sample for quality check and if required specifications are not meet, continue reaction further for 1 hour and again check for quality. If specification is reached fill product in containers, to be used for further formulations of finished product.
    [Show full text]
  • Production and Characterization of Melamine-Formaldehyde Moulding
    International Journal of Advanced Academic Research | Sciences, Technology and Engineering | ISSN: 2488-9849 Vol. 6, Issue 2 (February 2020) PRODUCTION AND CHARACTERIZATION OF MELAMINE- FORMALDEHYDE MOULDING POWDER BY BALOGUN, Ayodeji Timothy REG. NO.: 98/6907EH Department of Chemical Engineering, School of Engineering and Engineering Technology, Federal University of Technology Minna, Nigeria. 26 International Journal of Advanced Academic Research | Sciences, Technology and Engineering | ISSN: 2488-9849 Vol. 6, Issue 2 (February 2020) CHAPTER ONE INTRODUCTION Amino resins are product of polymeric reaction of amino compound with aldehyde especially formaldehyde by a series of addition and condensation reaction. The reaction between formaldehyde and amino compound to form methyl derivatives of the later which on heating condenses to form hard, colourless transparent resin, when cured or heat set, the amino resins are more properly called amino plastics. 1.1 Background to the Study Melamine, the amino group in the production of melamine-formaldehyde is manufactured from coal, limestone and air, we do not indeed use coal as an ingredient but coke, its derivatives. It is obtained together with coal gas and coal tar when bituminous coal is heated in a by-product oven. Lime, another important reactant in the production of melamine is obtained by heating limestone in a kiln to liberate carbon dioxide with nitrogen to form calcium cyan amide which on further reaction with water and acid forms cynamide from which dicyandiamide is obtained by treatment with alkaline. Finally, dicyandiamide is heated with ammonia and methanol to produced melamine. Production of formaldehyde involves the reaction of coke with superheated steam to form hydrogen and carbon monoxide when these two gases are heated under high pressure in the presence of chromic oxide and zinc oxide or some other catalyst, methanol is formed.
    [Show full text]
  • Scientific Documentation
    Scientific Documentation A1378, Aspartame, Powder, NF Not appropriate for regulatory submission. Please visit www.spectrumchemical.com or contact Tech Services for the most up‐to‐date information contained in this information package. Spectrum Chemical Mfg Corp 769 Jersey Avenue New Brunswick, NJ 08901 Phone 732.214.1300 Ver4.05 27.July.2020 A1378, Aspartame, Powder, NF Table of Contents Product Specification Certificate of Analysis Sample(s) Safety Data Sheet (SDS) Certification of Current Good Manufacturing Practices (cGMP) Manufacturing Process Flowchart Source Statement BSE/TSE Statement Allergen Statement EU Fragrance Allergen Statement GMO Statement Melamine Statement Nitrosamine Statement Animal Testing Statement Organic Compliance Statement Shelf Life Statement Other Chemicals Statement Elemental Impurities Statement Residual Solvents Statement General Label Information – Sample Label General Lot Numbering System Guidance Specification for Aspartame, Powder, NF (A1378) Item Number A1378 Item Aspartame, Powder, NF CAS Number 22839-47-0 Molecular Formula C14H18N2O5 Molecular Weight 294.31 MDL Number Synonyms APM ; N-L-alpha-Aspartyl-L-phenylalanine 1-Methyl Ester Test Specification Min Max ASSAY (DRIED BASIS) 98.0 102.0 % TRANSMITTANCE @430 nm 0.95 SPECIFIC ROTATION [a]D +14.5 to +16.5° LOSS ON DRYING 4.5 % RESIDUE ON IGNITION 0.2 % ELEMENTAL IMPURITIES: LEAD AS REPORTED CADMIUM (Cd) AS REPORTED ARSENIC (As) AS REPORTED MERCURY (Hg) AS REPORTED 5-BENZY-3,6-DIOXO-2-PIPERAZINEACETIC ACID 1.5 % CHROMATOGRAPHIC PURITY
    [Show full text]
  • Chemical Contaminates of Meat and Meat Products Which Threaten Human Health Isam T
    Chemical Contaminates of Meat and Meat Products which Threaten Human Health Isam T. Kadim Department of Animal and Veterinary Sciences, College of Agricultural and Marine Sciences, Sultan Qaboos University, PO Box 34 Al-Khoud, Muscat, Sultanate of Oman ABSTRACT The priorities, which concern meat and meat products consumption today, are food safety issues and meat quality. Humans around the world are exposed to chemical contaminants during their life time. Among the thousands of existing contaminates, some are persistent and remain in the environment for years. The variation in measurable levels depends mainly on the fact that some are synthesized as industrial products, whereas others are released accidentally, as by-products, or given to animals as growth promoters or as prophylactic or therapeutic agents. The measurement of these contaminants requires a complex procedure including sample extraction, sample clean-up, and physico-chemical analysis after chromatographic separation. Contaminants such as organochlorine pesticides, heavy metals, microbes, melamine, hormones, antibiotic, and other feed additives are often measured in various types of matrices during food safety programs, environmental monitoring, and epidemiological studies. Serious health problems including cancer, kidney diseases, disarray and other diseases in humans might be related to food contaminates. According to the World Health Organization (WHO), 1.8 million people died from diarrhea related diseases in 2005. Children and developing fetuses are generally at greater risk from exposure to different chemicals. A great number of these cases might be attributed to contaminate found on food. More than 90% of human exposure to harmful materials is due to consumption of contaminated food items such as meat, milk and dairy products, as well as fish and derived products.
    [Show full text]
  • Pharmaceutical Components at Risk for Melamine Contamination
    Guidance for Industry Pharmaceutical Components at Risk for Melamine Contamination U.S. Department of Health and Human Services Food and Drug Administration Center for Drug Evaluation and Research (CDER) Center for Veterinary Medicine (CVM) August 2009 Current Good Manufacturing Practice (CGMP) Contains Nonbinding Recommendations Guidance for Industry Pharmaceutical Components at Risk for Melamine Contamination Additional copies are available from: Office of Communications Division of Drug Information, WO51, Room 2201 Center for Drug Evaluation and Research Food and Drug Administration 10903 New Hampshire Ave. Silver Spring, MD 20993 Phone: 301-796-3400; Fax: 301-847-8714 [email protected] http://www.fda.gov/Drugs/GuidanceComplianceRegulatoryInformation/Guidances/default.htm and/or Communications Staff, HFV-12 Center for Veterinary Medicine Food and Drug Administration 7519 Standish Place Rockville, MD 20855 Phone: 240-276-9300 http://www.fda.gov/AnimalVeterinary/GuidanceComplianceEnforcement/GuidanceforIndustry/default.htm U.S. Department of Health and Human Services Food and Drug Administration Center for Drug Evaluation and Research (CDER) Center for Veterinary Medicine (CVM) August 2009 Current Good Manufacturing Practice (CGMP) Contains Nonbinding Recommendations TABLE OF CONTENTS I. INTRODUCTION............................................................................................................. 1 II. BACKGROUND ..............................................................................................................
    [Show full text]
  • LC Paper No. CB(2)1128/19-20(05)
    LC Paper No. CB(2)1128/19-20(05) For discussion on 9 June 2020 LegCo Panel on Food Safety and Environmental Hygiene Results of the Study on Pet Food Products in Hong Kong PURPOSE This paper briefs Members on the results of the Study on Pet Food Products in Hong Kong (the Study). BACKGROUND 2. At present, the supply and use of fodder for food-production animals is subject to control under the Public Health (Animal and Birds) (Chemical Residues) Regulation (Cap. 139N). Pet food in general is not subject to regulation in Hong Kong in respect of its production, import or distribution. Commercial pet food 1 is largely imported from places outside Hong Kong and we are not aware of any major production of pet food locally. 3. In order to assess whether and the extent to which the safety of pet food in Hong Kong is a concern, the Agriculture, Fisheries and Conservation Department (AFCD) commissioned a study in October 2017 by engaging a contractor to collect and test a total of 360 pet food products that were commonly available in the market of Hong Kong. The Study was completed in February 2020. The final report of the Study is available at AFCD’s website2. The details of the Study and the test results are summarised in the following paragraphs – 1 Commercial pet food is usually pre-packaged/processed food available in the market for pet consumption, which may be available in the form of dry food, wet food, semi-moist food, freeze-dried food and frozen food.
    [Show full text]
  • Lancaster Laboratories Melamine Testing Method Offers Greater Sensitivity and Specificity
    Lancaster Laboratories Melamine Testing Method offers greater sensitivity and specificity LANCASTER, Pa. (November 6, 2009) - Lancaster Laboratories, part of Thermo Fisher Scientific, today announced a new method for detecting melamine in pharmaceutical products that uses LC/MS/MS to provide greater sensitivity and specificity over other techniques. Lancaster Laboratories’ new method meets the Food and Drug Administration’s August 2009 guidance, entitled Pharmaceutical Components at Risk for Melamine Contamination, which identifies raw materials that are considered high‐risk for melamine contamination and recommends monitoring of these raw materials for the presence of melamine prior to release into production. Melamine is used in the manufacture of a variety of products, including resin based products (countertops, glues, housewares,etc), cleaning products and industrial cleaners. Melamine has a low acute toxicity and is not readily metabolized.Cyanuric acid, which also has a low acute toxicity, is a structural analogue of melamine and is used in the manufacture of herbicides, dyes, resins and antimicrobial agents. It is also used as a stabilizer and disinfectant in swimming pools and as a component of feed grade biuret (a ruminant feed additive). The combined presence of melamine and cyanuric acid leads to the formation of melamine cyanurate. This compound has low solubility which can lead to the formation of crystals in the kidneys, a condition known to cause renal failure, kidney toxicity and, in some subjects, death. Two recent incidents led the FDA to assess the potential impact of melamine in pharmaceutical products. First, in 2007, numerous deaths and illnesses in both cats and dogs led investigators to discover melamine in both wheat gluten and rice protein used as a pet food thickener.
    [Show full text]
  • Final Report on the “Pet Food Testing Exercise in Hong Kong” for the Agriculture, Fisheries and Conservation Department
    Final report on the pet food testing exercise in Hong Kong (Ref: AFCD/IQ/TS/01/17) Final Report on the “Pet Food Testing Exercise in Hong Kong” for the Agriculture, Fisheries and Conservation Department (Ref: AFCD/IQ/TS/01/17) Prepared by: Eurofins Food Testing Hong Kong Limited Prepared by Eurofins Food Testing Hong Kong Limited for AFCD Page 1 of 72 Final report on the pet food testing exercise in Hong Kong (Ref: AFCD/IQ/TS/01/17) Table of contents 1. Introduction ..................................................................................................... 3 2. Objective .......................................................................................................... 3 3. Methodology .................................................................................................... 3 3.1 Market survey on pet food products sold in Hong Kong ................ 3 3.2 Allocation and selection of pet food samples for analysis .............. 5 4. Scope and methodology of testing ................................................................. 8 4.1 Scope of testing ............................................................................... 8 4.2 Methodology of testing and reporting limits of substances ............. 9 5. Test results of the exercise .............................................................................. 9 5.1 Salmonella ........................................................................................ 9 5.2 Escherichia coli (including O157) ..................................................
    [Show full text]
  • Raising the Bar
    Raising the Bar Choosing Healthy Snack Bars versus Gimmicky Junk Food A REPORT BY THE CORNUCOPIA INSTITUTE | DEC 2017 The Cornucopia Institute wishes to thank the foundations that support our research and the thousands of family farmers and organic advocates who fund this work with their generous donations. The Cornucopia Institute is chartered as a tax-exempt public charity focusing on research and education. Cornucopia aims to empower organic producers, consumers, and wholesale buyers to make discerning marketplace decisions, protecting the credibility of the organic food and farming movement and the value it delivers to society. The Cornucopia Institute P.O. Box 126 Cornucopia, WI 54827 608-425-2000 voice 866-861-2214 fax [email protected] www.cornucopia.org Report design and layout: Draft Horse Studio | drafthorsestudio.com All photos: Adobe Stock. Copyright © 2017, The Cornucopia Institute Contents Executive Summary .............................................................. 1 Major Findings ......................................................................................................... 1 How to find the healthiest snack bars for you and your family ..................................................................... 2 Look for the USDA Organic Label .................................................... 4 Avoid the “Made with” Organic Ingredients Label ........................................ 5 Non-GMO Label ................................................................. 6 Ingredients to Avoid in “Natural” Products
    [Show full text]
  • Stabilized Malathion Microcapsule Formulations
    (19) & (11) EP 2 090 171 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 19.08.2009 Bulletin 2009/34 A01N 57/12 (2006.01) A01N 25/28 (2006.01) (21) Application number: 08101318.7 (22) Date of filing: 06.02.2008 (84) Designated Contracting States: (72) Inventors: AT BE BG CH CY CZ DE DK EE ES FI FR GB GR • Pedersen, Morten HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT DK-7620, LEMVIG (DK) RO SE SI SK TR • Laursen, Peter C. Designated Extension States: DK-7620, LEMVIG (DK) AL BA MK RS (74) Representative: Rasmussen, Torben Ravn et al (71) Applicant: Cheminova A/S Internationalt Patent-Bureau A/S 7620 Lemvig (DK) Rigensgade 11 1316 Copenhagen K (DK) (54) Stabilized malathion microcapsule formulations (57) The present invention provides stabilized Also disclosed is the use of such formulations for the malathion microcapsule formulations comprising an control of insects and protection of crops against such aqueous suspension of a malathion solution encapsulat- insects. ed within a polymeric shell material. The malathion so- lution comprises malathion and one or more solvents. EP 2 090 171 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 090 171 A1 Description Introduction 5 [0001] The present invention relates to microcapsule formulations comprising an aqueous suspension of a malathion solution encapsulated within a polymeric shell material and to the use of such formulations for the control of undesired insects and protection of crops against such insects. Background of the invention 10 [0002] Malathion is a well known organophosphate insecticide often used in the form of solutions in organic solvent.
    [Show full text]