Using Fish Brain Biomarkers to Assess the Neurotoxicity of Aspartame Artificial Sweetener

Journal of the Persian Gulf

(Marine Science)/Vol. 9/No. 33/ September 2018/6/35-40

Issue of Second International Conference on Oceanography for West Asia (RCOWA) 2020

Using fish brain biomarkers to assess the neurotoxicity of aspartame artificial sweetener

1 1* 2 Aisan Shirmardani , Aras Rafiee , Babak Moghadasi

1 Department of Biology, Central Tehran Branch, Islamic Azad University, Tehran, Iran 2 Department of Natural Resources, Savadkooh Branch, Islamic Azad University, Savadkooh, Iran

Abstract

Neurotoxins induce undesirable changes in aquatic organisms. This project assessed the effects of 78.15 g/L aspartame on expression changes of two biomarkers of neurotoxicity (glial fibrillary acidic protein-GFAP and myelin basic protein- MBP) in Cyprinus carpio brain tissue. RNA was extracted from brain tissue. The results of qPCR indicated an increase of 2.5 and 4.2 of MBP and GFAP expression. Elevated levels of these biomarkers suggest the probability of aspartame neurotoxicity. Identifying and monitoring nerve damage using biomarkers can make it easier to diagnose injuries earlier than current methods and provide an opportunity to develop future treatments.

Keywords: Aspartame, Biomarker, Common carp, Neurotoxicity, Gene expression

1. Introduction

Downloaded from jpg.inio.ac.ir at 12:28 IRST on Sunday October 3rd 2021 Neurotoxins are able to alter the normal activity of the nervous system and utilization of biomarkers of neurotoxicity enables our efficiency and accuracy of diagnosis (Budny, 2015; Iheanacho et al., 2020). Aspartame is a non-saccharide artificial sweetener that its use has increased significantly due to its low cost and low calorie content (Zafar et al., 2017). This sweetener is broken down to phenylalanine, aspartic acid and methanol during metabolism in the body. Excessive concentrations of phenylalanine reduce the transfer of important amino acids to the brain. Also, methanol metabolites cause depression and other neurological symptoms that eventually lead to brain acidosis and coma (Aziz et al., 2002; Love et al., 2018). Astrocytic glial cells of the central nervous system (CNS) play a vital role in nourishing and supporting neurons in the brain and spinal cord (Sofroniew, 2015). They respond to brain-spinal cord injuries by increasing the glial fibrillary acidic protein (GFAP) rapidly (Liddelow et al., 2017). MBP maintains the proper structure of the myelin sheath and plays an important role in the myelination of nerves. Degradation of the myelin sheath due to neurotoxicity leads to the secretion of related proteins such as MBP, which reduces the function and integrity of the nerve membrane (Vallières et al., 2006; Zhang et al., 2014). Therefore, these two biomarkers are indicative of their

* Corresponding Author name: Aras Rafiee E-mail address: [email protected]

35 Rahnemania et al. / Study of ice formation in the Caspian Sea using numerical simulations

specific type of neural damage associated with neurotoxicity. The aim of this study was to investigate the effect of aspartame on the expression of MBP and GFAP associated with nervous system toxicity in carp’s brain.

2. Material and methods

2.1. Study Design and grouping the carps

120 juvenile carps weighing approximately 17.6 grams were collected from Mazandaran province and transported to the Pars Biological Research Center laboratory. Fishes were raised and maintained under standard laboratory conditions in tanks containing 150 L of water. After adapting to the conditions, fishes were randomly divided into control (no exposure to aspartame) and experimental (exposure to aspartame) groups.

2.2. Determining the lethal range of aspartame

First, carp fishes in groups of 10 were exposed separately to the aspartame over the concentrations of 150 mg, 250 mg, 500 mg and 1000 mg per 150 L of tap water for 96 hours. Finally, by recording daily losses, a concentration of 125 mg per 150 litters' equivalent to 75.18 g/L of aspartame was selected as IC50. On the seventh day, eight fishes were selected from each tank to study the expression of the MBP and GFAP genes.

2.3. RNA extraction and cDNA synthesis

All parts of the fish brain were isolated. Tissue homogenization and RNA extraction were performed according to the protocol of Cinacolon RNX-Plus Solution extraction kit. After chloroform extraction and adding isopropanol in1:1 ratio for precipitation, RNA was washed with 75% ethanol, and finally dissolved in RNase-free water. Purified RNA was quantified by measuring absorbance at 260/280 nm on a Nanodrop

Downloaded from jpg.inio.ac.ir at 12:28 IRST on Sunday October 3rd 2021 spectrophotometer (Thermo Fisher Scientific, USA) and gel electrophoresis.

2.4. Assessment of gene expression by Real time PCR (qPCR)

Real time PCR reaction was performed to amplify the MBP and GFAP genes according to the protocol of the sinaSYBR blue HS-Qpcr kit. Optimum reaction conditions were obtained with 1-2 μL cDNA, forward and reverse primers (0.5 μL), 12.5 μL SinaSYBR Blue H-qPCR master mix 2x and DEPC-water was added up to 25 μl. Amplifications were performed using the roche thermocycler. GAPDH was used as housekeeping gene. All samples were performed in triplicates, and the cycle threshold value (CT) was determined for further analysis. ΔCt for each gene was calculated by the formula ΔCt test = Ct test – Ct GAPDH and ΔCt control = Ct control – Ct GAPDH. ΔΔCt was measured by ΔΔCt = ΔCt test – ΔCt control. Finally, 2-ΔΔCt was calculated by the formula 2 -(ΔCt test – ΔCt control). The primers were designed using IDT online software and the sequences were as follows: Forward primer (GFAP) CCAGACTTAACCACTGCCCT, Reverse primer (GFAP) TTCGAGCGATACCACTCCTC, Forward primer (MBP) GTGAGCCACTTACTGTTCC, Reverse primer

36 Journal of the Persian Gulf (Marine Science)/Vol. 9/No. 33/ September 2018/6/35-40

(MBP) CCCAGTCCAAATACCTCATC, Forward primer (GAPDH) TCAATGGGGATGTGCGTTCA, Reverse primer (GAPDH) AGGTCACATACACGGTTGCT.

2.5. Statistical analysis

Statistical differences were determined either by Student’s t-test for paired samples or by one-way analysis of variance using PRISM 7.0 (Graphpad Software). P value <0.05 was considered significant.

3. Results

3.1. RNA quality

The extracted RNAs had concentration between 100-400 ng/µl, calculated by nanodrop. RNA quality analysis was determined by agarose gel electrophoresis. The 18S and 28SrRNA bands was representative of good quality RNA (Fig 1). Downloaded from jpg.inio.ac.ir at 12:28 IRST on Sunday October 3rd 2021

Fig. 1: RNA analysis by agarose gel electrophoresis. 28S:18S rRNA ratio of 2:1 is indicated. Smart Ladder 200-1000 bp is shown.

3.2. MBP and GFAP expression in carp’s brain

We have used quantitative real-time PCR in order to investigate the effect of aspartame on the expression level of MBP and GFAP genes of the brain. Figure 2 shows the semi-logarithmic curves of MBP and GFAP amplification. Threshold line is drawn to determine the CTs. Mean CTs in MBP gene was higher than GFAP, which indicates less expression of MBP. Based on the mean of 2-∆∆ CT, MBP and GFAP expression level was significantly higher compared with the healthy control group. The ratio of increase in the expression of MBP and GFAP was significantly increased about ≥ 2.5-fold and ≥ 4.2-fold respectively in comparison with the control group (Fig 3).

37 Rahnemania et al. / Study of ice formation in the Caspian Sea using numerical simulations

Fig. 2: Semi-logarithmic amplification curves of MBP and GFAP

Fig. 3: GFAP and MBP expression data from carp fishes treated with aspartame. The results demonstrated that MBP and GFAP had an elevated expression of ≥ 2.5-fold and ≥ 4.2-fold in treatment group compared

Downloaded from jpg.inio.ac.ir at 12:28 IRST on Sunday October 3rd 2021 with control (*P < 0.05). Bars represent the standard error of the mean.

4. Discussion and conclusion

Neurotoxicity affect adversely on the structure or function of the central or peripheral nervous system (Pellacani and Eleftheriou, 2020). Today, using of new methods to detect the chronic effects of toxins on the genetic and cellular mechanisms of living organisms is very important. Aspartame is commonly used as a sugar substitute in foods and beverages, but high levels of aspartame can act as a neurotoxin and cause side effects such as headache, insomnia, and impaired catecholamine concentrations in some areas of brain (Choudhary and Lee, 2018; Okasha, 2016). Biomarkers are used to diagnose various neurological diseases (Ehrenberg et al., 2020; Mondello et al., 2020). Increased expression of GFAP biomarker protein is directly related to the increase in cerebral astrocyte cells due to nerve cell damage at the site of toxicity of these cells (Borg et al., 2012; Wąsik et al., 2020). A significant

38 Journal of the Persian Gulf (Marine Science)/Vol. 9/No. 33/ September 2018/6/35-40

increase in MBP has also been observed in blood samples from patients with damaged brain parenchyma (Klemens et al., 2019). Therefore, MBP can be a good marker for identifying brain damage (Wąsik et al., 2020). MBP levels of blood in patients with brain injury after 3-0, 4-6 and 9-12 hours of injury were increase about 18%, 44% and 50% of MBP, respectively (Borg et al., 2012). This study was performed for the first time to evaluate the expression of two biomarkers of neurological diseases named GFAP and MBP in the brain tissue of carps treated with aspartame sweetener. We had used carp fishes of northern waters of the country instead of the usual Danio rerio aquarium fish, since carps unlike Danio rerio naturally may be exposed to a variety of toxins and contaminants. The fish were exposed to four different concentrations of aspartame for 3 days and finally 75.18 g of aspartame was selected as IC50. In order to identify the direct effect of aspartame on nerve tissue, RNA was extracted from the fish brain. The results of real time PCR showed a 2.44 and 4.2-fold increase in expression of MBP and GFAP genes, respectively. Elevation of these two proteins in the brain indicates damage of variety nerve cells, especially neuroglia, as well as destruction of the myelin sheath (Roberts et al., 2015). It should be noted that both of these markers are also found in serum and can be used for early diagnosis of many neurological diseases. Therefore, detecting the dysregulation of biomarkers can predict, diagnose and monitor neurotoxicity, which are valuable in early environmental and clinical diagnosis.

Acknowledgements

The authors thank Dr. Nikzad for her technical help and the weekend staff at the Central Tehran Branch, Islamic Azad University.

References

Aziz, M.H., Agrawal, A.K., Adhami, V.M., Ali, M.M., Baig, M.A., Seth, P.K., (2002). Methanol-induced neurotoxicity in pups exposed during lactation through mother: Role of folic acid. Neurotoxicology and Downloaded from jpg.inio.ac.ir at 12:28 IRST on Sunday October 3rd 2021 teratology 24, 519-527. Borg, K., Bonomo, J., Jauch, E.C., Kupchak, P., Stanton, E.B., Sawadsky, B., (2012). Serum levels of biochemical markers of traumatic brain injury. International Scholarly Research Notices 2012. Budny, J.A., (2015). Book Review: Encyclopedia of Toxicology. SAGE Publications Sage CA: Los Angeles, CA. Choudhary, A.K., Lee, Y.Y., (2018). Neurophysiological symptoms and aspartame: What is the connection? Nutritional neuroscience 21, 306-316. Ehrenberg, A.J., Khatun, A., Coomans, E., Betts, M.J., Capraro, F., Thijssen, E.H., Senkevich, K., Bharucha, T., Jafarpour, M., Young, P.N., (2020). Relevance of biomarkers across different neurodegenerative diseases. Alzheimer's Research & Therapy 12, 1-11. Iheanacho, S.C., Igberi, C., Amadi-Eke, A., Chinonyerem, D., Iheanacho, A., Avwemoya, F., (2020). Biomarkers of neurotoxicity, oxidative stress, hepatotoxicity and lipid peroxidation in Clarias gariepinus exposed to melamine and polyvinyl chloride. Biomarkers 25, 603-610. Klemens, J., Ciurkiewicz, M., Chludzinski, E., Iseringhausen, M., Klotz, D., Pfankuche, V., Ulrich, R., Herder, V., Puff, C., Baumgärtner, W., (2019). Neurotoxic potential of reactive astrocytes in canine distemper

39 Rahnemania et al. / Study of ice formation in the Caspian Sea using numerical simulations

demyelinating leukoencephalitis. Scientific reports 9, 1-16. Liddelow, S.A., Guttenplan, K.A., Clarke, L.E., Bennett, F.C., Bohlen, C.J., Schirmer, L., Bennett, M.L., Münch, A.E., Chung, W.-S., Peterson, T.C., (2017). Neurotoxic reactive astrocytes are induced by activated microglia. Nature 541, 481-487. Love, S., Perry, A., Ironside, J., Budka, H., 2018. Greenfield's Neuropathology-Two Volume Set. CRC Press. Mondello, S., Salama, M.M., Mohamed, W.M., Kobeissy, F.H., (2020). Biomarkers in Neurology. Frontiers in Neurology 11. Okasha, E.F., (2016). Effect of long term-administration of aspartame on the ultrastructure of sciatic nerve. Journal of microscopy and ultrastructure 4, 175-183. Pellacani, C., Eleftheriou, G., (2020). Neurotoxicity of antineoplastic drugs: Mechanisms, susceptibility, and neuroprotective strategies. Advances in Medical Sciences 65, 265-285. Roberts, R.A., Aschner, M., Calligaro, D., Guilarte, T.R., Hanig, J.P., Herr, D.W., Hudzik, T.J., Jeromin, A., Kallman, M.J., Liachenko, S., (2015). Translational biomarkers of neurotoxicity: a health and environmental sciences institute perspective on the way forward. Toxicological Sciences 148, 332-340. Sofroniew, M.V., (2015). Astrocyte barriers to neurotoxic inflammation. Nature Reviews Neuroscience 16, 249- 263. Vallières, N., Berard, J.L., David, S., Lacroix, S., (2006). Systemic injections of lipopolysaccharide accelerates myelin phagocytosis during Wallerian degeneration in the injured mouse spinal cord. Glia 53, 103-113. Wąsik, N., Sokół, B., Hołysz, M., Mańko, W., Juszkat, R., Jagodziński, P.P., Jankowski, R., (2020). Serum myelin basic protein as a marker of brain injury in aneurysmal subarachnoid haemorrhage. Acta Neurochirurgica 162, 545-552. Zafar, T., Naik, Q., Shrivastava, V., (2017). Aspartame: effects and awareness. MOJ Toxicol 3, 23-26. Zhang, Y., Zhang, Y.-j., Zhao, H.-y., Zhai, Q.-l., Zhang, Y., Shen, Y.-f., (2014). The impact of R213 mutation on p53-mediated p21 activity. Biochimie 99, 215-218.

Downloaded from jpg.inio.ac.ir at 12:28 IRST on Sunday October 3rd 2021

Shirmardani et al. / Using fish brain biomarkers to assess the neurotoxicity of aspartame artificial sweetener Journal of the Persian Gulf (Marine Science)/Vol. 9/No. 33/ September 2018/6/35-40