Journal of Plant Biology Research 2015, 4(2): 73-82 eISSN: 2233-0275 pISSN: 2233-1980 http://www.inast.org/jpbr.html
REGULAR ARTICLE
Molecular Systematics of some Bulbophyllum species in Peninsular Malaysia based on ITS sequences
Shahla Hosseini1* and Kourosh Dadkhah2 1 Department of Biological Science & Biotechnology University of Kurdistan, Sanandaj, Iran. 2 Department of Statistics, Faculty of Science, University of Kurdistan, Sanandaj, Iran.
ABSTRACT In this article, ITS sequences of 34 species in Bulbophyllum genus were researched. Alignment between ITS sequences from the species was performed, and discovered that average percentage sequence divergence (uncorrected p distance) within Bulbophyllum species was 9.87% and maximum in-group ITS divergence was 13.68% (between B. membranifolium with B. sulcatum). Molecular systematic analysis of ITS was revealed that, 34 species of Bulbophyllum were monophyletic and they were divided into six groups, which is partly inconsistent with the viewpoint of morphological classification of Bulbophyllum in Peninsular Malaysia.
Keywords: Bulbophyllum, Classification, ITS Sequence, Orchidaceae, Peninsular Malaysia
INTRODUCTION epiphytic and they are found in different habitats Bulbophyllum Thou. is the largest genus of ranging from (sub) tropical dry forests to wet subtribe Bulbophyllinae (Schlechter, 1926). More montane cloud forests and most of them are fly than 95% of the species in the subtribe belong in pollinated (Bartareau, 1994; Borba & Semir, 1998; the large genus Bulbophyllum, with more than Nishida et al., 2004; Tan et al., 2002; Teixeira et 2000 species found mostly in Asia (Seidenfaden & al., 2004). Orchids of the genus Bulbophyllum are Wood, 1992). Latest taxonomy (Seidenfaden & one of the important plants in Malaysia in terms of Wood, 1992) described the Bulbophyllum in 17 their abundance, but identification of sections with more than 100 species. However Bulbophyllum at species level still remains a based on this study, the members of this large problem for practising taxonomists. In recent genus have undergone extreme reduction in years, there have been several attempts to delimit number of species in the natural habitat and have orchid species boundaries based on phylogenetic acquired an efficient adaptation to the canopy reconstructions, using chloroplast and nuclear environment. Nevertheless, areas of earlier DNA sequences (Bellstedt et al., 2001; Fisher et collection site were visited for possible sampling. al., 2007; Van Den Berg et al., 2009; Hosseini et However not all the previous collection sites are al., 2012). Although some of these studies have forested areas. At least 50% of the recorded revealed concordance with species defined by collection sites are now palm oil plantation area. classical taxonomy, others have not. To date it has Therefore there is possibility to overthrow of not reported that ITS sequence was applied in the several Bulbophyllum species in Peninsular systematic evolution and sibship of Malaysian Malaysia. Bulbophyllum species are mostly Bulbophyllum. ITS sequence is made up of ITS-1
*Corresponding author: Shahla Hosseini. Corresponding author e-mail: [email protected]
J. Plant Bio. Res. 2015, 4(2): 73-82 and ITS-2, which are respectively genetic area CLUSTAL W (Thompson et al., 1994). The primer between ribosome 18S and 5.8S, ribosome 5.8S part trimmed from first of the each sequences, and 26S (Tian & Li, 2002; Wang & Liu, 2004). because the character base sequence should not be The nucleotide sequences in ITS sequence take on include primer. Then the end of sequences high variability, which can provide rich matched together and the unmatched sequence information for systematic classification, and then trimmed. All sequences have been deposited in conveniently allow people to study genetic Genbank (Table 1). diversity and sibship among population or species. Data Analysis: As a heuristic tool to explore the Recently, ITS is generally used in studies about degree of saturation present in the datasets, we systematic evolution and sibship of plant plotted raw sequence divergence (uncorrected p population or species (Chanderbali et al., 2001; distance) vs. number of transition and transversion Roalson & Friar, 2004; Kazempour Osaloo et al., substitutions for all pairwise comparisons among 2005 ) which all proved that it is feasible to study taxa, for each position. the systematic evolution and sibship of species in Afterward, ITS sequences were analyzed with dicotyledon by ITS sequence. In this article, ITS PAUP* 4.0b10 (Swofford, 2002), and the was used to study and discuss the sibship among Dendrochilum pallideflavens and Dendrobium species of Bulbophyllum in order to provide more rosellum was designated as outgroup. The MP and information for classification of Bulbophyllum on ML analysis included a default heuristic search for molecule level. the most parsimonious and most likelihood trees: starting trees were obtained via stepwise addition. MATERIALS AND METHODS Sequences were added via simple addition with In this article, the experimental materials were one tree held at each step. Branch swapping was fresh leaves of 34 species in Bulbophyllum were performed via tree-bisection-reconnection (TBR). stored at -80 º C for DNA extraction. Origin of Bootstrap support (BP) was calculated by materials and other information were clearly listed bootstrap analysis from 1000 bootstrap replicates in Table 1. and 500 replications in maximum parsimony and DNA Extraction: Total genomic DNA was maximum likelihood analysis respectively. isolated from leaves of Bulbophyllum and two outgroup species of Dendrobium using Wizard ® RESULTS Genomic DNA Purification Kit (Promega) with ITS Gene Sequences and Variations modifications. Yield and purity of genomic DNA Complete ITS sequences (including the 5.8 S was estimated by spectrophotometry at 260nm and coding region) were analysed for 34 Bulbophyllum the integrity of genomic DNA was determined by species plus Dendrobium rosellum and denaturing agarose gel electrophoresis. Dendrochilum pallideflavens as outgroups. PCR Amplification: Two pairs of primers were Lengths of the ITS 1, 5.8 S and ITS 2 regions were used in this study, The Primers 26SE and 17SE of within the range recorded for other flowering Sun et al. (1994) where used for the amplification plants (Baldwin et al., 1995). The lengths of the of the nrITS regions with the following PCR ITS regions (including the 5.8 S coding region) program: an initial 2 min premelt at 94º C and 34 varied from 677 to 678 bp. For all species, ITS 1 cycles of 1 min denaturation at 94º C, 1 min (261 to 262 bp) was longer than ITS 2 (254 to 255) annealing at 50º C and 1 min extension at 72º C bp). In this study the 5.8 S coding region was 160 followed by a final extension for 7 min. For bp long in all species which was slightly shorter sequencing, the primers ITS4 than that in other angiosperms (161 to 164 bp). (TCCTCCGCTTATTGATATGC) and ITS5 The aligned sequences consisted of 678 nucleotide (GGAAGT AAAAGTCGTAACAAGG) (White et sites which 81 characters are constant among all al., 1990) were used. In addition, PCR products taxa, 603 sites were variable and 86 variable were separated by 1.5% agarose gel characters are parsimony-uninformative, and 517 electrophoresis. sites were parsimony informative. The number and Sequence Alignment: The purified DNA was sent percentage of information sites and mutation sites to First Base Laboratory for sequencing. Multiple in ITS sequence of Bulbophyllum are shown in alignments of sequences were performed using Table 2. Average percentage sequence divergence 74
J. Plant Bio. Res. 2015, 4(2): 73-82
Table 1: Plant materials used in this study.
Genbank No. Section Taxon Location Herbarium/ Voucher accession No. 1. Hirtula B. dayanum Gunung Jerai, Malaysia UPM/ B0014 JF428119 2. Hirtula B. hirtulum Fraser Hill, Malaysia UPM/ FAN. FH- 314 JF428126 3. Hirtula B. hirtulum Gunung Belumut, Malaysia UPM/ SH.K-100 JF428127 4. Hirtula B. limbatum Gunung Belumut, Malaysia UPM/ B0054 JF428122 5. Hirtula B. dayanum Gunung Jerai, Malaysia UPM/ SH.K-101 JF428120 6. Cirrhopetalum B. acuminatum Gunung Belumut, Malaysia UPM/ RG 2291 JF428117 7. Cirrhopetalum B. gracillimum Gunung Panti, Malaysia UPM/ B0053 JF428125 8. Cirrhopetalum B. sp1 Genting Highland, Malaysia UPM/ SH.K-102 JF428114 9. Cirrhopetalum B. biflorum Malaysia SZU/OR5791999 EF195919 10. Aphanobulbon B. flavescens Fraser Hill, Malaysia UPM/ FAN. FH- 062 JF428102 11. Aphanobulbon B. mutabile Fraser Hill, Malaysia UPM/ FAN. FH- 105 JF428101 12. Aphanobulbon B. linearifolium Fraser Hill, Malaysia UPM/ FAN. FH- 258 JF428103 13. Aphanobulbon B. odoratum Pahang, Malaysia UPM/ B0056 JF428113 14. Aphanobulbon B. apodum Cameron Highlands, Malaysia UPM/ FAN. FH- 276 JF428121 15. Aphanobulbon B. armeniacum Fraser Hill, Malaysia UPM/ SH.K-105 JF428112 16. Aphanobulbon B. caudatisepalum Fraser Hill, Malaysia UPM/ SH.K-106 JF428108 17. Desmosanthes B. sulcatum Gunung Jerai, Malaysia UPM/ FAN. FH- 304 JF428106 18. Desmosanthes B. sp9 Penang, Malaysia UPM/ SH.K-113 JF428118 19. Sestochilus B. macranthum Cameron Highlands, Malaysia UPM/ FAN. FH- 153 JF428097 20. Sestochilus B. inunctum Gunung Jerai, Malaysia UPM/ SH.K-109 JF428110 21. Sestochilus B. lobbii Cameron Highlands, Malaysia UPM/ FAN. FH- 426 JF428099 22. Sestochilus B. uniflorum Genting Highland, Malaysia UPM/ FAN. FH- 107 JF428098 23. Sestochilus B. patens Gunung Jerai, Malaysia UPM/ B005 JF428100 24. Sestochilus B. pileatum Gunung Belumut, Malaysia UPM/ RG 2281 JF428105 25. Sestochilus B. lasianthum Fraser Hill, Malaysia UPM/ RG 1922 JF428116 26. Sestochilus B. sp7 Gunung Belumut, Malaysia UPM/ SH.K-110 JF428115 27. Sestochilus B. dearei Peninsular Malaysia SZU/OR2271998 EF195924 28. Sestochilus B. membranifolium Cameron Highlands, Malaysia SZU/OR5751998 EF195935 29. Careyana B. lilacinum Gunung Jerai, Malaysia UPM/ B0029 JF428111 30. Epicrianthes B. cheiropetalum Fraser Hill, Malaysia UPM/ B0018 JF428109 31. Polyblepharon B. membranaceum Fraser Hill, Malaysia UPM/ B0024 JF428107 32. Monilibulbus B. ovalifolium Cameron Highlands, Malaysia UPM/ RG 2167 JF428104 33. Monilibulbus B. stormii Cameron Highlands, Malaysia UPM/ B0058 JF428124 34. Ephippium B. restrepia Johor, Malaysia UPM/ B0055 JF428123 35. Aporum D. rosellum Fraser Hill, Malaysia UPM/ D001 JF428129 36. Dendrochilum D. pallideflavens Genting Highland, Malaysia UPM/ OYS 041 JF428128 Malaysia
75
J. Plant Bio. Res. 2015, 4(2): 73-82
Table 2: Number and percentage of variable site and informative site in ITS sequences of Bulbophyllum
ITS-1 ITS-2 5.8 S ITS (including 5.8 S) S)
Number % Number % Number % Number % Variable site 243 91% 242 93% 118 73% 603 88% Informative site 210 79% 202 77% 105 65% 517 76%
(uncorrected p distance) within Bulbophyllum Clade A consisted of species assigned to Sec. species was 9.87%, and maximum in-group ITS Sestochilus. In clade B sections Hirtula and divergence was 13.68% (between B. Ephippium were sister group to Sec. membranifolium with B. sulcatum). Aphanobulbon with high bootstrap value (BP100), The overall transition to transversion (Ti/Tv) ratio even B. apodum was placed inside Sec. Hirtula. was 2.31. Saturation analyses (Griffiths, 1997) Second subclades of B consisted of species were conducted to search for saturated data assigned to Sec. Cirrhopetalum, Sestochilus, partitions as a result of multiple substitutions at Careyana and Hirtula. However, B. stormii and B. single sites. Pairwise sequence divergence was sulcatum were nested in this clade as well. Single compared to pairwise transition and pairwise species of Sec. Careyana (B. lilacinum) appeared transversion divergences at all and third positions as sister to Sec. Cirrhopetalum with 100 % separately for the ITS region. The relationships bootstrap support. Bulbophyllum dayanum was between uncorrected p distance and number of sister to Sec. Cirrhopetalum, Desmosanthes and transition and transversion substitutions of the ITS Careyana with high support (BP100). The close sequences were plotted for all pairwise species relationship of section Cirrhopetalum with other comparisons (including outgroup taxa). If the sections has shown that the member of this section position sites were saturated, we would expect to should not be considered as a separated genus. see a plateau in such a plot, where little or no Clade C contains B. sp7 as an unknown species additional substitution is detectable with increased appeared as sister to clade A and B with high p distance. Because no such plateaus are seen (Fig. bootstrap support. Bulbophyllum membranaceum 1), we conclude even at 3rd positions, no and B. cheiropetalum formed separate clade (D) saturation was found in the ITS region. Therefore, with BP >90. The parsimony tree ended up with B. we did not exclude characters or employ a ovalifolium in section Monilibulbus. weighting scheme in our parsimony analyses. Maximum likelihood (ML) analysis was also Saturation plots show that the slope of conducted (Fig.3) for ITS molecular data sets. The transversions (G↔T; C↔A) always lay below that TrNef+G substitution model (Base = equal) Rmat of transitions (A↔G; C↔T). This indicated = (1.0000, 5.4010, 1.0000, 1.0000, 3.8905) with transversions occur less frequently than transition. invariable sites (pinvar = 0) and among-site rate heterogeneity (α = 1.1882) was selected using a set Phylogenetic Analysis of ITS of hierarchical likelihood ratio tests (LRTs) Unweighted parsimony analysis resulted in nine implemented in Modeltest. equally parsimonious trees [tree length= 1695, consistency index (CI) = 0.61, retention index (RI) ML tree was congruent with MP tree with some = 0.68, homoplasy index (HI) = 0.38]; the strict exceptions. Nevertheless with moderately low consensus tree is shown in Fig. 2. The percentages bootstrap support (BP74) compared with MP tree, of parsimonious trees in which the associated taxa studied taxa of Bulbophyllum were monophyletic. clustered together were shown next to the Bulbophyllum gracillimum and B. stormii placed branches. contiguous with B. mutabile. In parsimony tree Based on the parsimony tree, studied taxa was Bulbophyllum acuminatum showed close monophyletic, with 100% bootstrap support (Fig. relationship with B. sp1 but they are not parallel in 2). In this tree, four main clades were constructed. ML tree. Relationship between species of
76
J. Plant Bio. Res. 2015, 4(2): 73-82
Figure 1: Number of transition and transversion substitutions vs. the uncorrected p- distance for the ITS gene for all position sites (A) and third position (B).
77
J. Plant Bio. Res. 2015, 4(2): 73-82
Figure 2: The strict consensus tree for ITS region. Bootstrap percentage ≥ 50 are indicated above the nodes. Nodes for the recognized sub-clades are marked with black dot.
78
J. Plant Bio. Res. 2015, 4(2): 73-82
Figure 3: Tree is resulting from maximum likelihood analysis of the ITS gene dataset. Numbers at nodes represent percent recovery in bootstrap analysis (500 replicates). Nodes for the recognized sub-clades are marked with black dot.
79
J. Plant Bio. Res. 2015, 4(2): 73-82
Aphanobulbon was better resolved in parsimony suitable for study on systematic classification of analysis than maximum likelihood. plant among species (Baum et al., 1998; Stanford et al., 2000). In this research, the systematic DISCUSSION classification result based on ITS sequences is ITS sequences of Bulbophyllum partly consistent with the viewpoint of The length of ITS-1 and ITS-2 is highly conserved, morphological based classification, for example, B. and quite same in one population. It was macranthum, B. pileatum, B. lobbii, B. patens, B. discovered, ITS-1 sequences of Angiosperm range uniflorum, B. lasianthum and B. inunctum in Sect. generally from 187bp to 298bp, ITS-2 sequence is Sestochilus were clustered in the same clade. 187bp-252bp, and the length of 5.8S hardly Bulbophyllum linearifolium, B. flavescense, B. changes, 163 or 164bp (Baldwin et al., 1995). In odoratum, B. mutabile, B. caudatisepalum and B. this research, 5.8S from 34 species of armeniacum which belong to Sect. Aphanobulbon Bulbophyllum is composed of 161bp, ITS-1 and were clustered together. Bulbophyllum ITS-2 is composed of 261bp- 263bp or 253bp- acuminatum, B. gracillimum and B. biflorum in 256bp, respectively and the length of ITS Sect. Cirrhopetalum also show near sibship. ML sequences range from 677bp to 678bp, which is analysis was established B. gracillimum with B. consistent with the other studies, and also indicates stormii which is indicating obvious similarity in that Bulbophyllum is the natural taxon in the their genetic composition. Bulbophyllum hirtulum, molecular level. In addition, total content of G+C B. limbatum and B. dayanum in Sect. Hirtula in ITS sequence of Angiosperm varies greatly from cannot longer be supported in the same section. 50% in some groups to 75% in paddy rice Bulbophyllum membranaceum and B. (Nickrent & Starr, 1994). In this research, the cheiropetalum can be merging in the same section. content of G+C in ITS sequence is 51.91%- Bulbophyllum ovalifolium and B. stormii were not 63.19%, that in B. gracillimum is the lowest; the found in close branch, which is inconsistent with highest appears in B. sp1. Therefore, the great the viewpoint of morphological based difference of G+C content among species of classification. In brief, molecular systematic of Bulbophyllum indicates that it is feasible to analyze Bulbophyllum is partially different from the systematic classification of plants by ITS viewpoint of traditional classification, however sequence. Usually, ITS sequence has high supports in other aspects, which indicates that the variability and could supply rich systematic evolution in plant morphology and molecular level information. The divergence value of ITS are perhaps not synchronous. Otherwise, although sequences in majority of Angiosperm is the classical viewpoint of Bulbophyllum from 1.2%~10.2% among species, and 9.6%-28.8% Holttum (1964), Seidenfaden and Wood (1992) is among genus, which is appropriate to the study of widely accepted in the present time, but it was systematic classification (Baldwin et al., 1995). based on morphological characters exclusively, Moreover, it was found that higher mutation and therefore, the classification method needs further percentage of information sites in ITS sequence be confirmed by technology of molecular biology would well support the system reconstruction in and molecular evidence. In view of the fact that population when used to study the relationship there is a few studies in systematic classification of among genus or species (Baum et al., 1998; Bulbophyllum on the molecular level, and even has Schwarzbach & Ricklefs, 2000). In this research, been hardly reported through the world, in ITS sequence (including 5.8S) of Bulbophyllum, accordingly, the results in this research with some there are 603 mutation sites, 517 information sites, differences from the traditional classification need the percentage is respectively 88.93% and 76.25% further be validated. and the content of information in ITS-2 is more than in ITS-1. ACKNOWLEDGMENT The above study was made possible through the Systematic Classification of Bulbophyllum generosity of many individuals and agencies. It was found in large number of studies that ITS Firstly we would like to acknowledge the sequence takes on higher variation speed, can Government of Malaysia through the Ministry of provide rich information sites and especially is Higher Education, for the research grants, 80
J. Plant Bio. Res. 2015, 4(2): 73-82
Research University Grant Scheme project number Evidence from the chloroplast and nuclear 05-04-08-0556RU. We would also extend our genomes. Ann. Missouri Bot. 88:104‒134. gratitude to the curator of Singapore Botanical [8] Fischer. G. A, Gravendeel. B, Sieder. A, Garden herbarium (SING), University of Malaya Andriantiana. J, Heiselmayer. P, Cribb. P. Herbarium (KLU), FRIM herbarium (KEP), and J, Smidt E.d.C, Samuel. R and Kiehn. M. Universiti Kebangsaan Malaysia herbarium 2007. Evolution of resupination in (UKMB) for allowing us to study their specimens Malagasy species of Bulbophyllum and other assistance during the study. (Orchidaceae). Mol. Phylogenet. Evol. 45:358‒376. REFERENCES [9] Griffiths. C. S, 1997. Correlation of [1] Baldwin. B. G, Sanderson. M. J, Porter. J. M, Functional Domains and Rates of Wojciechowski. M. F, Campbell. C. S and Nucleotide Substitution in Cytochromeb. Donoghue. M. J. 1995. The ITS region of Mol. Phylogenet. Evol. 7:352‒365. nuclear ribosomal DNA: A valuable source of evidence on angiosperm phylogeny. Ann. [10] Holttum. R. E, 1964. A revised Flora of Missouri Bot. 82:247‒277. Malaya. Government Printing Office. Singapore. [2] Bartareau. T, 1994. Pollination of Bulbophyllum macphersonii Rupp by a midge [11] Hosseini. S, Go. R, Dadkhah. K and fly (Forcipomyia sauteri). The Orchadian. Ainuddin Nuruddin. A. 2012. Studies on 11:255‒258. maturase K sequences and systematic classification of Bulbophyllum in [3] Baum. D. A, Small. R and Wendel. J. F. Peninsular Malaysia. PAKISTAN. J. BOT. 1998. Biogeography and floral evolution 44:2047‒2054. of Baobabs as inferred from multiple data sets. Syst. Biol. 47:181‒207. [12] Hosseini. S. 2011. Morphological and molecular systematics of Bulbophyllum [4] Bellstedt. D. U, Linder. H. P and Harley. Thou, in Peninsular Malaysia. PhD thesis, E. H. 2001. Phylogenetic relationships in Universiti Putra Malaysia. Disa based on non-coding trnL-trnF chloroplast sequences: evidence of [13] Nickrent. D. L and Starr. E. M. 1994. High numerous repeat regions. Am. J. Bot. rates of nucleotide substitution on nuclear 88:2088‒2100. small-subunit (18S) rDNA from holoparasitic flowering plants. Mol. [5] Borba. E. L and Semir. J. 1998. Wind- Phylogenet. Evol. 39:62‒70. assisted fly pollination in three Bulbophyllum (Orchidaceae) species [14] Nishida. R, Tan. K. H, Wee. S. L, Hee. A. occurring in the Brazilian campos K. W and Toong. Y. C. 2004. rupestres. Lindleyana 13:203‒218. Phenylpropanoids in the fragrance of the fruit fly orchid, Bulbophyllum cheiri, and [6] Van den Berg. C, Wesley. E. H. Dressler. their relationship to the pollinator, R. L, Whitten. W. M, Soto-Arenas. M. A Bactrocera papayae. Biochem. Sys. Ecol. & Chase. M. W. 2009. A phylogenetic 32:245‒252. study of Laeliinae (Orchidaceae) based on combined nuclear and plastid DNA [15] Roalson. E. H and Friar. E. A. 2004. sequences. Ann. Bot. 104:417‒430. Phylogenetic relationships and biogeografic patterns in North American [7] Chanderbali. A. S, Werff. H. V. d and members of Carex section Acrocystis Renner. S. S. 2001. Phylogeny and using nrDNA ITS and ETS sequence data. historical biogeography of Lauraceae: Plant. Syst. Evol. 243:175‒187. 81
J. Plant Bio. Res. 2015, 4(2): 73-82
weighting, position specific gap penalties [16] Schwarzbach. A. E and Ricklefs. R. E. and weight matrix choice. Nucleic. Acids. 2000. Systematic affinities of Res. 22:4673‒4680. Rhizophoraceae and Anisophylleaceae, and intergeneric relationships within [25] Tian, X and Li. D. Z. 2002. Application of Rhizophoraceae based on chloroplast DNA Sequences in Plant Phylogenetic DNA and morphology. Am. J. Bot. Study. Acta Bot. 24:170‒184. 87:547‒564. [26] Wang. Y. J and Liu. J. Q. 2004. A [17] Schlechter. R, 1926. Das System der preliminary investigation on the phylogeny Orchidaceae. Notizblatt des Botanischen of Saussurea based on chloroplast DNA Gartens und Museums zu Berlin-Dahlem trnL-F sequences. Acta Phytotax. Sin. 9:563‒591. 42:136‒153.
[18] Seidenfaden. G and Wood. J. J. 1992. The [27] White. T. J, Bruns. T, Lee. S and Taylor. J. Orchids of Peninsular Malaysia and 1990. Amplification and direct sequencing Singapore. Fredensborg, Olsen. of fungal ribosomal RNA genes for phylogenetics. Academic Press, San [19] Stanford. A. M, Harden. R and Parks. C. Diego, California, USA. R. 2000. Phylogeny and biogeography of Jugland based on matK and ITS sequence data. Am. J. Bot. 87:872-882.
[20] Sun. Y, Skinnder. D. Z, Liang. G. H and Hulbert. S. H. 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theor. Appl. Genet. 89:26‒32.
[21] Swofford. D. L, 2002. PAUP*. Phylogenetic analysis using parsimony (* and other methods). Version 4.0b10. Sinauer Associates, Sunderland, Massachussets, USA.
[22] Tan. K. H, Nishida. R and Toong. Y. C. 2002. Floral synomone of a wild orchid, Bulbophyllum cheiri, lures Bactrocera fruit flies for pollination. J. Chem. Ecol. 28:1161‒1172.
[23] Teixeira. S. P, Borba. E. L and Semir. J. 2004. Lip Anatomy and its Implications for the Pollination Mechanisms of Bulbophyllum Species (Orchidaceae). Ann. Bot. 93:499‒505.
[24] Thompson. J. D, Gibson. T. J and Higgins. D. G. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence 82