The Role of Lysosomal Acid Lipase in Regulation of the Atp

THE ROLE OF LYSOSOMAL ACID LIPASE IN REGULATION OF THE ATP-

BINDING CASSETTE TRANSPORTER A1, HIGH DENSITY LIPOPROTEIN AND

REVERSE CHOLESTEROL TRANSPORT

Kristin Louise Bowden

B.Sc., Queen’s University, 2005

M.Sc., Dalhousie University, 2008.

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF

THE REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES

(Experimental Medicine)

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

October 2013

The key regulator of initial HDL particle formation by cells is the ATP-binding cassette transporter A1 (ABCA1). ABCA1 expression is regulated primarily by oxysterol dependent activation of the liver X receptor (LXR). We investigated the role of lysosomal cholesterol on

ABCA1 regulation by studying the lysosomal disorder Cholesteryl Ester Storage Disease

(CESD). CESD is caused by genetic mutations in the LIP-A gene that result in only 5% of normal activity of lysosomal acid lipase (LAL), an enzyme that hydrolyzes cholesteryl esters

(CE) and triglycerides on internalized lipoproteins specifically within the lysosome. We hypothesized that the flux of unesterified cholesterol out of the lysosomes from LAL- mediated hydrolysis of LDL cholesteryl esters is a key regulator of cellular ABCA1 expression, HDL formation and reverse cholesterol transport (RCT). We found that primary skin fibroblasts derived from individuals with CESD had impaired upregulation of ABCA1 in response to LDL loading, reduced phospholipid and cholesterol efflux to apoA-I, lower production of 27-hydroxycholesterol (27-OH) production in response to LDL loading and reduced α-HDL particle formation. This defect was recapitulated in normal fibroblasts following treatment with LAL inhibitors, whereas, treatment with conditioned medium from normal fibroblasts containing secreted LAL rescued ABCA1 expression, apoA-I-mediated cholesterol efflux, HDL particle formation and production of 27-OH by CESD cells. We further investigated the role of LAL in RCT from macrophages specifically using an immortalized macrophage cell line created from LAL-deficient mouse peritoneal macrophages (LAL-/-). LAL-/- macrophages exhibited reduced basal and cholesterol-stimulated ABCA1 expression in culture, and reduced ability to support RCT in LAL-/- mice compared to wild-type (LAL+/+) macrophages injected into

LAL+/+ mice. ABCA1 protein expression was reduced in lal-/- mouse liver and mRNA

expression of several LXR-dependent genes involved in reverse cholesterol transport (ABCG1,

ABCG5, ABCG8, CYP7A1, SR-B1) were differentially modulated compared to LAL+/+ controls. These results indicate a critical role of LAL in promoting lysosomal flux of cholesterol for ABCA1 expression, cellular cholesterol efflux and RCT in vivo.

iii

Preface

Chapter 2: LAL deficiency impairs regulation of ABCA1 and formation of HDL in CESD

Kristin Bowden contributed 70% towards all aspects of this work. She contributed 60% towards experiments (Figures 2.3, 2.5, 2.6 and 2.7, 2.9, 2.10, 2.11 and 2.12), completed analysis of the data, and drafted the original version of this manuscript.

Contribution of co-authors:

 Nicolas Bilbey, MSc performed 40% of experiments. This includes Figures 1, 2 and 4.

 Leanne Bilawchuk, BSc and Teddy Chan, MSc provided technical assistance and

performed experiments for supplementary Figure 2.11.

 Emmanuel Boadu, PhD performed the 2-dimensional gel electrophoresis of medium

samples (Figures 2.6 and 2.12).

 Roshni Sidhu, BSc, performed analysis of oxysterol mass by Gas Chromatography / Mass

Spectroscopy of cell and medium samples (Figure 2.8) under supervision of a

collaborator Daniel Ory, PhD.

 Hong Du, PhD, provided expert advice and assisted with revision of the manuscript.

 Gordon Francis, MD, supervised this project and assisted with editing and writing of the

manuscript.

All work was completed under approval of the UBC research ethics board (certificate #H07-

02720 – High Density Lipoprotein Formation).

A version of this work is published: *Bowden KL, *Bilbey NJ, Bilawchuk LM, Boadu E, Sidhu R, Ory DS, Du H, Chan T, Francis GA. (2011) Lysosomal acid lipase deficiency impairs regulation of ABCA1 gene and formation of high density lipoproteins in cholesteryl ester storage disease. J Biol Chem. 286 (35): 30624-35. (*both authors contributed equally to this manuscript)

Chapter 3: LAL promotes Reverse Cholesterol Transport from Macrophages

Kristin Bowden contributed 95% towards all aspects of this work, including all experiments, analysis of data and writing of the original manuscript.

Contribution of co-authors:

 Hejin (Julia) Kong and Teddy Chan, MSc provided technical assistance with some

aspects of animal experiments.

 You-Hai Xu, PhD, performed breeding and husbandry of the LAL knockout mice under

supervision of our collaborator Gregory Grabowski, MD.

 Hong Du, PhD provided immortalized peritoneal macrophage cell lines used for

experiments in Figures 3.1-3.4 and provided scientific advice.

 Gordon Francis, MD, supervised this work and provided assistance with editing of the

manuscript.

Animal work was performed under approval by the UBC Animal Care Committee (Certificate

#A12-0067).

Table of contents

Abstract ...... ii

Preface ...... iv

Table of contents ...... vi

List of tables...... xi

List of figures ...... xii

List of abbreviations ...... xiv

Acknowledgements ...... xvi

Dedication ...... xvii

Chapter 1: Introduction ...... 1

1.1 Overview ...... 1

1.2 Regulation of cellular cholesterol metabolism ...... 2

1.2.1 SREBPs in the regulation of cholesterol homeostasis ...... 3

1.2.2 LDL-receptor mediated uptake of exogenous cholesterol ...... 5

1.2.3 Uptake of modified LDL by scavenger receptors ...... 8

1.3 Reverse cholesterol transport ...... 10

1.3.1 Step 1: Cellular cholesterol efflux and HDL formation...... 12

1.3.2 Step 2: HDL cholesterol esterification ...... 12

1.3.3 Step 3: Uptake of HDL cholesterol and cholesteryl esters by the liver ...... 13

1.3.3.1 HDL remodeling in the plasma ...... 14

1.3.4 Step 4: Hepatobiliary excretion of cholesterol and bile acids ...... 15

1.3.5 The role of the intestine in RCT ...... 15

1.3.6 Macrophage-specific reverse cholesterol transport ...... 16

1.3.7 Regulation of reverse cholesterol transport genes by the liver X receptor ...... 18

1.3.7.1 Enzymatic and non-enzymatic synthesis of oxysterols ...... 19

1.3.7.2 The role of oxysterols in regulation of cholesterol homeostasis...... 20

1.4 ABCA1 and ABCG1 function and regulation ...... 21

1.4.1 ABCA1 transcriptional and post-transcriptional regulation ...... 23

1.4.2 The ABCG1 and its role in RCT...... 24

1.5 Regulation of cholesterol metabolism in Niemann Pick disease type C (NPC) ..... 25

1.6 Lysosomal acid lipase (LAL)...... 26

1.6.1 The history of discovery of LAL ...... 26

1.6.2 The molecular biology of LAL ...... 27

1.6.2.1 Gene regulation of LIPA ...... 28

1.6.3 LAL secretion and uptake ...... 28

1.6.4 LAL enzyme properties ...... 29

1.6.4.1 How LAL activity is measured ...... 30

1.6.4.2 LAL enzyme activity parameters ...... 31

1.6.4.3 Factors that affect LAL enzyme activity...... 32

1.6.4.3.1 Inhibitors ...... 32

1.6.4.3.2 Activators ...... 33

1.6.5 The intracellular role of LAL in LDL cholesterol metabolism ...... 33

1.6.6 LAL and autophagy ...... 37

1.6.7 Human LAL deficiency: Wolman disease and cholesteryl ester storage disease ..... 38

1.6.7.1 The genetics and molecular biology of CESD and WD: The genotype-

phenotype relationship ...... 40

vii

1.6.8 Animal models of LAL deficiency ...... 41

1.6.9 LAL and atherosclerosis ...... 44

1.7 Rationale, hypothesis and specific aims: ...... 50

Chapter 2: LAL deficiency impairs regulation of ABCA1 and formation of HDL in cholesteryl ester storage disease ...... 53

2.1 Summary ...... 53

2.2 Introduction ...... 54

2.3 Materials and methods ...... 56

2.3.1 Materials ...... 56

2.3.2 Preparation of lipoproteins and apolipoprotein A-1 ...... 56

2.3.3 Cell culture ...... 57

2.3.4 Conditioned medium experiments ...... 58

2.3.5 Recombinant human LAL treatment ...... 58

2.3.6 Chloroquine treatment ...... 58

2.3.7 Lentivirus-mediated suppression of LAL ...... 58

2.3.8 Cholesterol and phospholipid efflux ...... 59

2.3.9 Cholesterol mass assay ...... 60

2.3.10 Quantitative real-time PCR analysis of ABCA1 mRNA ...... 60

2.3.11 Western blot analysis of ABCA1 and LAL ...... 61

2.3.12 Two-dimensional gel electrophoresis of HDL particles ...... 61

2.3.13 Statistics ...... 62

2.4 Results ...... 63

2.4.1 Reduced LDL-induced expression of ABCA1 in CESD fibroblasts ...... 63

viii

2.4.2 Reduced phospholipid and LDL-derived cholesterol efflux to apoA-I from CESD

fibroblasts ...... 66

2.4.3 Chloroquine blocks LDL-dependent upregulation of ABCA1 expression and activity

in normal fibroblasts ...... 70

2.4.4 LXR agonist corrects ABCA1 expression but fails to correct apoA-I-mediated

cholesterol efflux in CESD fibroblasts ...... 73

2.4.5 Rescue of ABCA1 expression and apoA-I-dependent cholesterol efflux in CESD

fibroblasts treated with LAL-containing medium...... 75

2.4.6 Impaired HDL particle formation by CESD fibroblasts and correction by treatment

with conditioned medium from normal cells ...... 78

2.4.7 Impaired LDL-induced oxysterol formation in CESD cells and correction by

treatment with conditioned medium from normal cells ...... 80

2.5 Discussion...... 82

2.6 Supplementary data ...... 88

2.6.1 Supplemental figures ...... 88

Chapter 3: LAL promotes reverse cholesterol transport from macrophages ...... 93

3.1 Introduction ...... 93

3.2 Materials and methods ...... 95

3.2.1 Materials ...... 95

3.2.2 Preparation of [3H] cholesteryl-oleate labeled acetylated LDL and isolation of

apolipoprotein A-1from plasma ...... 95

3.2.3 LAL knockout mice ...... 96

3.2.4 Cell culture ...... 96

3.2.5 Tissue homogenization and Western blotting ...... 97

3.2.6 Measurement of acid cholesteryl ester hydrolase activity ...... 97

3.2.7 Quantitative real-time PCR analysis of mRNA ...... 98

3.2.8 Cholesterol efflux assay ...... 99

3.2.9 Macrophage reverse cholesterol transport ...... 100

3.2.10 Statistical analysis ...... 101

3.3 Results ...... 102

3.3.1 ABCA1 expression and cholesterol efflux are impaired in immortalized peritoneal

macrophages that lack LAL ...... 102

3.3.2 Differential tissue-specific expression of RCT genes in LAL knockout mice ...... 107

3.3.3 Macrophage to feces RCT is impaired in LAL deficiency ...... 111

3.4 Discussion...... 114

3.5 Supplementary data ...... 120

3.5.1 Supplemental figures ...... 120

Chapter 4: Concluding remarks ...... 122

4.1 Summary and discussion ...... 122

4.2 Future directions ...... 125

References ...... 128

List of tables

Table 3.1 PCR Primers and Annealing Temperatures Used ...... 99

List of figures

Figure 1.1 Reverse Cholesterol Transport...... 11

Figure 1.2 The role of LAL in the LDL receptor pathway...... 35

Figure 2.1 Reduced expression of ABCA1 in response to LDL loading in CESD fibroblasts. ... 65

Figure 2.2 Reduced phospholipid and cholesterol efflux to apoA-I from CESD fibroblasts...... 68

Figure 2.3 Chloroquine blocks upregulation of ABCA1 in response to LDL loading and apoA-I- mediated cholesterol efflux in normal fibroblasts...... 72

Figure 2.4 LXR agonist upregulates ABCA1 expression but fails to correct apoA-I-specific cholesterol efflux in CESD fibroblasts...... 74

Figure 2.5 Normal conditioned medium rescues ABCA1 expression and apoA-I-mediated cholesterol efflux in CESD fibroblasts...... 77

Figure 2.6 Reduced α-HDL particle formation by CESD fibroblasts is rescued following treatment with normal fibroblast conditioned medium...... 79

Figure 2.7 Reduced 27-hydroxycholesterol mass in CESD cells and correction following treatment with normal fibroblast conditioned medium...... 81

Figure 2.8 Summary of results and proposed mechanism...... 83

Figure 2.9 Average LAL activity of CESD fibroblasts...... 88

Figure 2.10 LAL knockdown by lentivirus delivery of short hairpin RNA reduces LAL expression and activity but does not alter ABCA1 protein expression...... 89

Figure 2.11 Recombinant human LAL rescues ABCA1 expression and apoA-I-mediated cholesterol efflux in CESD fibroblasts...... 90

Figure 2.12 Reduced α-HDL particle formation by CESD fibroblasts is rescued following treatment with recombinant human LAL...... 91

xii

Figure 2.13 27-hydroxycholesterol formation following treatment with recombinant human LAL.

...... 92

Figure 3.1 ABCA1 (A) mRNA and (B) protein are reduced in lal-/- mouse peritoneal macrophages but are partially rescued by rhLAL...... 103

Figure 3.2 ABCG1 but not ApoE or SR-B1 mRNA expression is reduced in LAL-/- macrophages...... 104

Figure 3.3 Rescue of impaired apoA-I-dependent cholesterol efflux in lal-/- macrophages by treatment with rhLAL...... 106

Figure 3.4 Differential RCT gene mRNA expression in LAL+/+ and LAL-/- mouse liver...... 108

Figure 3.5 ABCA1 and ABCG1 tissue-specific protein expression in wild-type and LAL knockout mice...... 110

Figure 3.6 Impaired macrophage reverse cholesterol transport in LAL knockout mice...... 113

Figure 3.7 Investigation of residual CE hydrolysis in LAL-/- macrophages...... 120

Figure 3.8 A comparison of ABCA1 protein expression in mouse liver using different homogenization buffers...... 121

xiii

List of abbreviations

ABCA1: ATP-binding cassette transporter A1 ABCB4: ATP-binding cassette transporter B4 ABCB11: ATP-binding cassette transporter B11/ Bile salt export pump ABCG1: ATP-binding cassette transporter G1 ABCG4: ATP-binding cassette transporter G4 ABCG5: ATP-binding cassette transporter G5 ABCG8: ATP-binding cassette transporter G8 ACAT: acyl-CoA:cholesterol acyltransferase acLDL: acetylated LDL ad-hLAL: adenoviral overexpression of human lysosomal acid lipase aggLDL: aggregated LDL ApoA-I: apolipoprotein A1 ApoB: apolipoprotein B ApoE: apolipoprotein E Ca2+: calcium (ionic) CVD: cardiovascular disease CE: cholesteryl ester CESD: cholesteryl ester storage disease CETP: cholesteryl ester transfer protein CFTR: cystic fibrosis transmembrane receptor CL: cardiolipin CQ: chloroquine Cu2+: copper (ionic) CYP7A1: cytochrome P450 type 7A1 CYP27: cytochrome P450 type 27 FPLC: fast protein liquid chromatography EGFR: epidermal growth factor-like repeats E-LDL: enzymatically modified low density lipoprotein ER: endoplasmic reticulum E8SJM: Exon 8 splice junction mutation FH: familial hypercholesterolemia HDL: high-density lipoprotein HDL-C: high-density lipoprotein cholesterol Hg2+: mercury (ionic) HgCl2: Mercury chloride Hg(NO3)2: Mercury nitrate HMGCR: 3-hydroxy-methylglutaryl-coenzyme A reductase IDL: intermediate-density lipoprotein KCl: potassium chloride Km: Michaelis menton constant LAL: lysosomal acid lipase LCAT: lecithin cholesterol acyl transferase LDL: low-density lipoprotein

xiv

LDL-C: low-density lipoprotein cholesterol LDLR: low density lipoprotein receptor LIPA: gene encoding lysosomal acid lipase LPL: lipoprotein lipase LPS: lipopolysaccharide LXR: liver X receptor LXRE: liver X receptor response element Lyso-PC: lyso-phosphatidylcholine MDR1: multi-drug resistance protein 1 NaCl: sodium chloride NaF: sodium fluoride nCEH: neutral CE hydrolase NBD: nucleotide binding domain NEFA: non-esterified fatty acids NPC: Niemann Pick disease type C NPC1L1: Niemann Pick disease type C1 like protein 1 oxLDL: oxidized LDL PA: phosphatidic acid PC: phosphatidyl choline PCSK9: pro-protein convertase subtilisin kexin type 9 PEST: proline, glutamine, serine, threonine recognition sequence PS: phosphatidyl serine phLAL: LAL produced by clonal reproduction in the species Pitchia pastoris PI: phosphatidyl inositol RCT: reverse cholesterol transport RXR: retinoid X receptor SNP: single nucleotide polymorphism SR: scavenger receptor SR-BI: scavenger receptor B1 SREBP: sterol regulatory element binding protein SSD: sterol-sensing domain TG: triglyceride TICE: trans-intestinal cholesterol export TM: transmembrane UC: unesterified cholesterol WD: Wolman disease VLDL: very low-density lipoprotein Vmax: maximum velocity of reaction Zn2+: zinc (ionic) 4-MUO: 4-methylumbelleriferyl oleate 7(α)-OH: 7-hydroxycholesterol 22(R)-OH: 22-hydroxycholesterol 24(S)-OH: 24-hydroxycholesterol 25,25-OH: 24,25-hydroxycholesterol 25-OH: 25-hydroxycholesterol 27-OH: 27-hydroxycholesterol xv

Acknowledgements

This research would not have been possible without generous funding support from the Heart and Stroke Foundation of Canada, the Canadian Institutes for Health Research (CIHR) and the

Molecular and Cell Biology of Lipids (MCBL) SCOLAR program (sponsored by the CIHR).

I must also acknowledge the generosity of our collaborators Dr. Hong Du and Dr. Gregory

Grabowski for providing us with the macrophage cell lines, LAL knockout mice, and expert advice, which were vital to this work.

My sincerest thanks to the members of my supervisory committee; Drs. Urs Steinbrecher,

Christopher Loewen and John Hill for all your helpful advice and input into this project.

I offer gratitude to my supervisor Dr. Gordon Francis for allowing me the opportunity to carry out my research in this lab, who’s provided me a fantastic environment in which to experiment and to grow as a scientist.

I would also like to thank the members of the Francis lab, past and present; Teddy Chan, Leanne

Bilawchuk, Emmanuel Boadu, Sima Allahverdian, Parveer Pannu, Julia Kong and especially

Nicolas Bilbey who initiated this project. You have been a pleasure to work with, not only as colleagues but as fantastic friends.

xvi

Dedication

I would like to dedicate this thesis to my parents Barry and Gloria and my wonderful husband

James for all of their patience and loving support throughout all the ups and downs of my PhD. I couldn’t have done it without you.

xvii

CHAPTER 1: INTRODUCTION

1.1 Overview

Cardiovascular disease (CVD) is the leading cause of death worldwide (1) and accounts for 29% of all deaths in Canada (2). Heart disease and stroke exact an enormous burden on our healthcare system and our Canadian economy, accounting for 16.9% of all hospitalizations (3) and more than 20 billion dollars annually in physician and hospital costs and lost productivity

(4). Atherosclerosis, or ‘hardening of the arteries’ is a common underlying cause of CVD where deposits of cholesterol accumulate within plaques that form in the artery wall (5). High levels of circulating low-density lipoprotein (LDL) cholesterol put one at higher risk of CVD. The success of statin drugs, which inhibit cholesterol synthesis and increase cellular uptake of LDL cholesterol from plasma, and significantly reduce the risk of CVD, should leave no doubt of the central role of cholesterol in atherosclerosis and CVD (6). One of the hallmarks during the development of atherosclerosis is the accumulation of foam cells within the artery wall where scavenger cells such as macrophages take up modified forms of LDL that have infiltrated the arterial endothelium and are retained in the extracellular matrix. When the balance of removal of cholesterol from cells in the artery wall is less than uptake, excess cholesterol is stored in the form of cholesteryl esters within lipid droplets of foam cells and can lead to the progression of the atherosclerotic plaque. Cellular cholesterol homeostasis is normally tightly controlled within the cells through important regulatory mechanisms discussed in the following section (Section

1.1). A process termed reverse cholesterol transport (RCT) (discussed in section 1.3) is also critical to prevent excess accumulation of cholesterol within peripheral cells. In RCT, excess cholesterol is removed from cells and carried on high density lipoprotein (HDL) particles so that they can be removed from circulation by excretion. The ATP-binding cassette transporters A1

and G1 (ABCA1 and ABCG1) (see section 1.4) perform a critical role in the RCT pathway by mediating the efflux of cholesterol from cells during HDL particle formation (7). The transcriptional regulation of ABCA1 and ABCG1 are under the control of the nuclear transcription factor liver X receptor (LXR) (8,9) which is activated by oxygenated derivatives of cholesterol known as oxysterols (10,11). It is theorized that oxysterols are formed under conditions of excess cholesterol accumulation within the cell (12) which, in turn, activate cholesterol efflux genes such as ABCA1 and ABCG1 to trigger cellular cholesterol removal and promote RCT. However, the intracellular sources of cholesterol that are used to turn on gene expression and which become substrates for efflux are currently unknown. We proposed that lysosomal cholesterol was the major pool of cholesterol responsible. Previous data from our laboratory indicated that ABCA1 regulation and cellular efflux were impaired in the lysosomal storage disorder Niemann Pick disease type C (NPC) (discussed in section 1.5), where the movement of cholesterol out of the late endosomes and lysosomes is blocked, resulting in aberrant HDL particle formation (13). Here, the role of lysosomal acid lipase (LAL - an enzyme which hydrolyzes cholesteryl esters to free cholesterol at acidic pH within lysosomes) (section

1.5) in ABCA1 regulation, HDL metabolism and whole body RCT is explored.

1.2 Regulation of cellular cholesterol metabolism

All eukaryotic cells require cholesterol, a vital structural component that helps maintain membrane permeability, structure and fluidity. Cells can synthesize cholesterol de novo or derive it by uptake of exogenous cholesterol on lipoproteins. However, aside from bile acid and steroid hormone synthesis in specialized cells, most cells cannot catabolize cholesterol. Therefore, it is essential that intracellular levels of cholesterol be tightly regulated in order to prevent cholesterol starvation or excess. The concentration of cholesterol in the cell is tightly controlled through a

feedback mechanism elucidated through the work of Goldstein and Brown and colleagues, whereby the mechanisms of regulation of sterol sensitive genes by the sterol regulatory element binding proteins (SREBPs) has been resolved.

1.2.1 SREBPs in the regulation of cholesterol homeostasis

Two proteins Scap and HMGCR are among cellular proteins that contain sterol-sensing domains (SSD), which allow them to monitor the levels of cholesterol in the endoplasmic reticulum (ER) membrane. Scap acts as an escort protein that senses cholesterol and binds to

SREBP in the ER membrane and can chaperone it from ER to Golgi. The structure of SREBP contains an N-terminal domain with a basic helix-loop-helix motif DNA-binding domain and a

C-terminal regulatory domain and contains two transmembrane domains connected by a central luminal loop. When SREBPs are first synthesized in the ER, they are membrane bound with the

N- and C-terminal segments facing the cytoplasm to form a hairpin-like structure (14). When cholesterol levels in the cell are depleted, the cholesterol content of the ER is also low. Bound to the C-terminal regulatory domain of SREBP through its own C-terminal WD domain (15), Scap reacts to the reduced cholesterol levels in the membrane by causing a conformational change within the SSD of Scap. This conformational change allows Scap to interact with a complex of proteins (including Sar1-GTPase, Sec23 and Sec24), which triggers binding of COPII proteins that allow the Scap-SREBP complex to bud off from the ER membrane and move to the Golgi

(16). Once these vesicles have fused with the Golgi, SREBP is cleaved sequentially by site 1 protease (subtilisin family serine protein), which first cleaves acidic residues within the luminal loop region leaving both halves membrane-bound. Site 2 protease (a zinc metalloprotease) then cleaves within the membrane domain adjacent to N-terminal domain, thus releasing the soluble

N-terminal transcription factor domain so that it can then enter the nucleus and regulate its target genes that work to replenish cellular cholesterol (and fatty acid) levels.

Transcriptional regulation by SREBP is achieved by binding of activated SREBP in the nucleus to target DNA sequences called sterol-regulatory elements (SREs) in the promoter region of these sterol-sensitive genes (17). There are three SREBP isoforms; SREBP1a and

SREBP1c and SREBP2. SREBP1a and 1c are splice variants produced from a common gene while SREBP2 is encoded by a separate gene (17). Each of the SREBPs have different specificities for their target genes; SREBP2 is primarily involved in regulation of cholesterol synthesis genes (such as HMG-CoA reductase, HMG-CoA synthase, farnesyl pyrophosphate synthase and squalene synthase) and expression of the LDL receptor; SREBP1c activates genes primarily for fatty acid synthesis (such as fatty acid synthase and acetyl CoA carboxylase) and desaturation (such as stearoyl CoA desaturase); SREBP1a activates both fatty acid synthesis and cholesterol regulatory genes in a non-specific way (14,18).

When cellular cholesterol levels are in excess, sterols accumulate in the ER membrane.

This triggers a conformational change in the sterol sensing domain (SSD) of Scap that allows it to now interact with a membrane-bound proteins called insulin sensitive genes, or Insigs (19) and sequesters the Scap-SREBP complex away from the COPII budding complex so that it remains in the ER (20). There are two isoforms of Insig: Insig 1 is an SREBP target gene (therefore Insig

1 expression is regulated by cholesterol through SREBP processing) (18), whereas Insig2 is constitutively expressed (21).

HMG CoA reductase (HMGCR), an enzyme that performs the rate-limiting step in cholesterol synthesis, is itself regulated in a sterol-sensitive manner. HMGCR also resides in the

ER membrane and contains a SSD. When excess cholesterol (or lanosterol, a cholesterol

precursor) accumulates in the ER membrane, these sterols cause a conformational change in the

N-terminal transmembrane SSD of HMGCR that allows binding to Insig, which leads to degradation of the HMGCR protein (22). Insig is bound to a complex of ubiquitin-conjugating enzymes (e.g. gp78 ubiquitin ligase, E2 conjugating enzyme Ubc7, VCP ERAD ATPase) that ubiquitinate HMGCR and accelerate its degradation in the proteasome (23). HMGCR mRNA expression is under the control of SREBP (24), which allows HMGCR to be turned on under cholesterol starved conditions, when cholesterol is needed in the cell. Oxysterols have also been shown to inhibit SREBP activation by blocking Scap-mediated transport (16), although by a different mechanism (20). Treatment with either cholesterol or oxysterols can induce a Scap-

Insig complex to form, thus preventing Scap-mediated SREBP transport and cleavage (16).

While cholesterol binds directly to Scap to mediate a conformational change within its SSD, the same was not shown for 25-hydroxycholesterol (25-OH) (20). Therefore, oxysterols must act by another mechanism either directly or indirectly, perhaps through an intermediary protein in order to induce Scap-Insig complex formation (16). Radhakrishnan and colleagues (25) showed that

25-OH and other oxysterols, such as 22(R)-OH, 24(S)-OH, 27-OH and 24,25-epoxycholesterol bind to Insig-2 directly. Through mutational analysis of Insig-2, five critical residues for binding of oxysterols were identified. Importantly, mutations that prevented oxysterol binding also prevented Scap binding to Insig (25). As these studies indicate, oxysterols are intimately involved in regulation of SREBP retention in the ER, and important regulators of gene expression networks in cholesterol homeostasis.

1.2.2 LDL-receptor mediated uptake of exogenous cholesterol

SREBPs also control uptake of exogenous LDL cholesterol through regulation of the

LDL receptor pathway. The LDL receptor (LDLR) is an endocytic transmembrane receptor that

is composed of a short cytoplasmic domain, a single transmembrane domain, an O-linked sugar domain, epidermal growth factor-like repeats (EGFR), Y repeats that contain a YWTD- consensus motif (together, YWTD repeats and flanking EGFR domains form a beta-propeller secondary structure) and a ligand binding domain (26). The pathway by which LDL particles are internalized via the LDLR was also elucidated through the work of Goldstein and Brown, who studied fibroblasts from patients with familial hypercholesterolemia (27). FH homozygotes have

LDL cholesterol levels 6-10 times higher than normal, develop tendinous xanthomas and corneal arcus and have severe atherosclerosis, sometimes causing heart attacks in childhood (28).

Incubation of normal fibroblasts with LDL caused suppression of HMGCR, but in FH fibroblasts

HMGCR activity was 50-100x higher and did not go down with LDL incubation (29). By measuring the uptake of 125I-LDL, it was discovered that LDL uptake was mediated by binding to the LDL receptor, which was defective in FH fibroblasts (30). They subsequently purified the

LDLR from bovine adrenal gland (31), cloned the human cDNA (32) and isolated the LDLR gene (33).

Receptor mediated uptake of LDL occurs in several stages. First LDL binds to its receptor with high affinity (this binding requires apolipoprotein B100), then is taken up by endocytosis via clathrin-coated pits (34), which anchor the NPxY sequence in the cytoplasmic domain of the LDL receptor within the internalized vesicle (35). The endosomes carrying the

LDL bound to the LDLR then fuse with the lysosomes, where the LDL cholesteryl esters (CE) are broken down to unesterified cholesterol (UC) (36). In the relatively acidic environment of the endosomes, the LDLR releases its ligand and the empty receptor recycles back to the plasma membrane (37). Following receptor-mediated uptake of LDL, the UC that is released from the lysosome eventually enters the regulatory pool in the ER, which triggers not only suppression of

HMGCR, and SREBP processing but also promotes cholesterol esterification by activating the enzyme acyl-coA: cholesterol acytransferase (ACAT)(38). ACAT is an integral membrane protein in the rough ER that catalyzes the formation of CE from UC and long chain fatty acids, using coenzyme A and ATP as cofactors (39). It is an allosteric enzyme and it is hypothesized that binding of cholesterol or oxysterols to the enzyme produces a ligand-induced conformational change that brings subunits together from inactive to active form (40,41). Thus, ACAT is regulated largely by the availability of substrate rather than an SREBP-dependent mechanism.

A chaperone protein, proprotein convertase subtilisin kexin type 9 (PCSK9) has been shown to bind to the LDLR and prevent its recycling back to the PM, thereby promoting its degradation in the lysosome (42). PCSK9 reduces the level of LDLR at the cell surface of hepatocytes (43-45). Although PCSK9 is a serine protease, it functions as a chaperone protein to the LDLR independent of its catalytic activity, although, protease activity is required for PCSK9 to undergo auto-catalytic processing of its pro-domain to its mature form (46). Following its synthesis in hepatocytes, PCSK9 is secreted into the circulation where it binds to the EGFR domain of the LDLR and is internalized along with LDL (47). During endocytosis, the acidic pH of the endosomes causes PCSK9 to bind more tightly to the LDLR, which locks it into an open conformation (48). Since the LDLR must adopt a closed conformation in order to recycle back to the plasma membrane, PCSK9 prevents its sorting into recycling endosomes, thus targeting it for proteasomal degradation in the lysosome (42,49). Gain of function mutations in PCSK9 leading as a previously unknown form of FH have been identified in two French families, and subsequently in FH patients in Utah (US), Norway and the UK. Conversely, loss of function mutations in PCSK9 are associated with below normal LDL-C levels and significantly reduced global coronary heart disease risk (42). PCSK9 expression is regulated by SREBP-2, and its

transcription is activated by statins (HMGCR inhibitors) (50,51). Since PCSK9 is co-activated with the LDL receptor, this may reduce the effectiveness of statins at clearing plasma LDL-C.

Altogether, this makes PCSK9 an attractive target for therapy to lower LDL-C beyond what statins can achieve, or in statin-intolerant patients. Currently, several lines of therapies targeting

PCSK9 are being developed and tested in clinical trials: gene silencing using anti-sense oligonucleotides, mimetic peptides of the EGFR of the LDLR to compete for binding, or monoclonal antibodies targeting PCSK9 (42).

The SREBP-2 upregulates LDLR (52). However, cholesterol liberated from LDL via

LDLR-mediated uptake in turn suppresses SREBP and down-regulates expression of the LDLR in a negative feedback loop (18,52). The cholesterol content of the membrane must be held within an appropriate concentration in the membrane that is essential for maintenance of proper membrane fluidity, permeability, as well as to support lipid rafts and integral membrane proteins.

Therefore, through regulation of LDLR, HMGCR, ACAT and PCSK9, SREBP-2 keeps the levels of membrane cholesterol constant despite fluctuations in requirement of cholesterol and supply from exogenous sources.

1.2.3 Uptake of modified LDL by scavenger receptors

Fatty streaks appear during the early stages of atherosclerosis consisting of foamy lipid and cholesterol filled macrophages (53-55) and smooth muscle cells (56,57). In atherosclerosis, the damaged vascular endothelium binds and recruits monocytes to the subendothelial space, where they differentiate into macrophages and take up modified forms of LDL to become foam cells. However, the LDLR does not appear to be important for uptake of lipoprotein cholesterol that leads to foam cell formation (5,58). Scavenger receptors, thus called because of their multiple ligand binding properties, were first identified by Goldstein and Brown when they

recognized that macrophage cells took up modified lipoproteins by a different mechanism other than the LDLR (59). Scavenger receptors mediate the uptake of modified apoB-containing lipoproteins, however, unlike the LDLR, they are not subject to the same feedback regulatory mechanisms and so uptake is uncontrolled. It is now known that a subtype of smooth muscle cells within the atherosclerotic intima can also express scavenger receptors and take up modified lipoproteins to become foam cells (57). SRs can also take up non-lipoprotein ligands such as maleylated-BSA, polyribonucleotides, polysaccharides, anionic phospholipids and it is proposed that these polyanionic ligands bind to positively charged collagenous domain on SRs (60). The binding interaction between modified lipoproteins and scavenger receptors also appears to be ionic in nature. For example, positively-charged lysine residues on the apoB moiety of oxidized

LDL (oxLDL) or acetylated LDL (acLDL) become derivatized by oxidation or acetylation, which neutralizes those residues and increases their net negative charge to allow recognition by the collagen-like domain on scavenger receptors (61). Some of the scavenger receptors most important for uptake of modified lipoproteins are CD36, SR-A and LOX-1 (lectin-like oxLDL receptor), while some more recently identified members include SR-PSOX (CXCL16), FEEL-1

(stabilin-1/CLEVER-1), SREC (scavenger receptor expressed by endothelial cells) and CD163

(62). The class B scavenger receptor CD36 seems to be most important for oxLDL uptake, which comes from the evidence that CD36 knockout mice have a 60-80% reduction in macrophage oxLDL uptake (63). Interestingly, apoE/CD36 double knockout mice also have a 70% reduction in atherosclerosis compared to apoE single knockout mice (64). The scavenger receptor SR-A is also responsible for the majority (~80%) of acLDL uptake and around 50% of oxLDL by macrophages based on genetically modified mouse studies. SR-A knockout mice on an apoE or

LDLR deficient background also have decreased atherosclerosis (65,66). However, knockout of

SR-A, CD36 and apoE together does not abrogate foam cell formation within the lesion (67) , thus calling into question the significance of these transporters for macrophage lipoprotein uptake and the pathogenesis of atherosclerosis.

1.3 Reverse cholesterol transport

The concept of reverse cholesterol transport (RCT) was first introduced by Glomset in

1968 (68), in which he described the involvement of lecithin cholesterol acyl tranferase (LCAT) in a process whereby cholesterol from peripheral cells is returned via HDL to the liver for biliary excretion into feces. The observation was made that cholesterol in peripheral cells was in equilibrium with plasma lipoproteins, however, there was a deficit in the liver owing possibly to the excretion of cholesterol. Extra-hepatic cells can take up lipoprotein cholesterol from plasma or synthesize it de novo. However, most cells (with the exception of steroidogenic cells) cannot catabolize cholesterol. Therefore, the process of RCT is critical to the removal of excess cholesterol from peripheral tissues. This cycle of cholesterol is especially important for the maintenance of the homeostatic balance of cholesterol in the body and is potentially crucial to the prevention of atherosclerosis (69,70). UC is toxic to cells and can cause apoptosis by the unfolded protein response (71). Therefore, the RCT pathway is critical to removal of excess cholesterol from peripheral cells. There are 4 major steps in the RCT pathway (72): 1) cellular cholesterol efflux onto HDL particles, 2) UC on HDL particles are esterified to CE, 3) return of

HDL-CE and cholesterol to the liver, either by direct uptake from HDL or by transfer to apolipoprotein B (apoB)-containing lipoprotein and uptake from LDL via the LDLR, and 4) cholesterol excretion in the bile, either directly, or following conversion to bile acids. The RCT pathway is summarized in Figure 1.1 below. The next section will discuss each of these steps in detail and the different players involved.

Figure 1.1 Reverse Cholesterol Transport.

Within the lysosomes of cells (ovals with dashed line), lysosomal acid lipase (LAL) hydrolyzes LDL cholesteryl esters (CE) following endocytosis mediated by the LDL receptor. Unesterified cholesterol (UC) is removed from the lysosomes by Niemann Pick type C proteins (NPC1). The ATP-binding cassette transporter A1 (ABCA1) mediates the efflux of cellular UC to apolipoprotein A1 (ApoA-I) to form nascent discoidal shaped HDL particles. The UC is esterified to CE by the enzyme lecithin cholesterol acyl transferase (LCAT) to form spherical HDL particles. HDL

UC and CE can be taken up directly to the liver by selective uptake via the scavenger receptor B1 (SR-BI).

Alternatively, the CE on HDL can be transferred to LDL by the action of the cholesteryl ester transfer protein

(CETP) and then LDL UC and CE enter the liver via LDL receptor-mediated uptake. Some of the hepatic UC is then directed towards biliary excretion either directly or indirectly following conversion to bile acids.

1.3.1 Step 1: Cellular cholesterol efflux and HDL formation

The first step in RCT is also the rate-limiting one. Apolipoprotein A-I (apoA-I), the major protein in HDL, is secreted by cells in the liver and intestine (73,74), and enters circulation in a poorly lipidated form. The ATP-binding cassette transporter A1 (ABCA1), a transmembrane protein, promotes the cellular efflux of cholesterol and phospholipids on to apoA-I to form nascent, pre-β HDL particles in the plasma. However, if ABCA1 is not functional or not present to perform this role, poorly lipidated apoA-I is rapidly catabolized in the kidney (75). ABCA1,

ABCG1 and ABCG4 act in a sequential manner (76): ABCA1 first lipidates apoA-I to form nascent HDL particles, and then ABCG1 (and G4 in the brain) can further efflux cholesterol from cells onto HDL particles (77,78). ABCA1 and ABCG1 are further discussed in detail in section 1.4. Scavenger receptor B1 (SR-BI) can also promote cholesterol efflux to mature HDL particles (79), however, its relative role is unclear.

1.3.2 Step 2: HDL cholesterol esterification

Next, the enzyme lecithin cholesterol acyl transferase (LCAT) catalyzes the formation of

CE from UC by obtaining fatty acids from phospholipids or TGs (72,80). Esterification of cholesterol on HDL enriches the neutral lipid core of the particle enlarging it and converting it from a discoidal to spherical shape. LCAT deficiency in mice (81,82) and humans (80) results in lipoprotein abnormalities – very low HDL and HDL that is present in discoidal form and only contains UC and phospholipid, as well as low plasma apoA-I (because poorly lipidated apoA-I is rapidly degraded) (75). Patients with LCAT deficiency or fish eye disease have corneal opacities, anemia, and proteinuria and may suffer from renal failure (68,72,80). Glomset originally proposed that LCAT was a driving force in RCT (68), however, it is now known that active transport (by ABCA1 and ABCG1) is necessary for functional RCT and that passive efflux is not

sufficient (83,84). While LCAT is crucial to the proper functioning of the RCT pathway, its importance in RCT for atherosclerosis is not well understood. Groups within the population that have high LCAT activity also had lower risk of CAD in one study (85) and certain LCAT mutations conferred higher risk of premature atherosclerosis (86,87). Interestingly, it would appear that individuals with heterozygous LCAT deficiency have a more atherogenic lipoprotein profile and more severe atherosclerosis than homozygotes (88). Overexpression of LCAT in rabbits increased HDL and reduced LDL, consistent with reduced atherosclerosis (89). However, mouse studies show conflicting results with regards to atherosclerosis and level of LCAT expression (90-93). Thus, the relative importance of LCAT for protection against atherosclerosis is not yet clear.

1.3.3 Step 3: Uptake of HDL cholesterol and cholesteryl esters by the liver

Following cholesterol esterification by LCAT, CE and remaining UC on HDL particles can be taken up by the liver directly by the scavenger receptor SR-BI. By this mechanism, SR-BI mediates the selective uptake of lipids and cholesterol (in the form of CE or UC) directly from the HDL particle independently of the apolipoprotein A-I component (94,95). With the exception of HDL containing apoE, whole HDL particles are not likely taken up via receptor-mediated uptake (96). Instead, HDL-CE uptake follows a non-endocytic mechanism that is not blocked by endocytosis or receptor-recycling inhibitors, including chloroquine (97). This indicates that CEs derived from selective uptake from HDL follow a non-lysosomal pathway and are not likely to be hydrolyzed by LAL.

An inverse relationship between SR-BI and HDL levels exists. SR-BI knockout mice have increased plasma HDL-cholesterol (HDL-C) because uptake to the liver is reduced (98-

100), whereas overexpression of SR-BI reduces plasma HDL-C (101) but promotes macrophage

RCT when expressed in the liver (102). There is also strong evidence that hepatic SR-BI expression is athero-protective (103-107).

Cholesteryl esters on HDL can also be transferred to apoB-containing lipoproteins in exchange for TG by the cholesteryl ester transfer protein (CETP) (108,109). Following transfer by CETP, CEs on LDL or VLDL can then enter hepatocytes (110) by receptor-mediated uptake by the LDL receptor. In human CETP deficiency, patients have extremely high levels of HDL-C

(111). Mice don’t have CETP, however, overexpression of human CETP decreases plasma HDL-

C levels (112). In humans, most of the CE taken up by the liver (and converted to bile) is first transferred from HDL to apoB-containing lipoproteins (113), suggesting that CETP mediates the primary mode of hepatic uptake in RCT. However, UC on HDL particles seems to be taken up directly by the liver by SR-BI, independently of CETP (114).

1.3.3.1 HDL remodeling in the plasma

HDL particles in plasma can be acted upon by other proteins to alter its content and promote recycling of HDL apolipoproteins so that they can accept more lipid and cholesterol in the first step in RCT. Following CETP-mediated transfer of triglycerides (TG) onto HDL, hepatic lipase on the hepatocyte surface can hydrolyze this TG and regenerate lipid poor apoA-I, or preβ-HDL (115,116). Hydrolysis of HDL-TG by hepatic lipase further stimulates hepatic

HDL-CE uptake (117), mediated by SR-BI (118). Endothelial lipase hydrolyzes phospholipids on the surface of HDL (119), generating poorly lipidated apoA-I which is rapidly catabolized

(120). The phospholipid transfer protein transfers phospholipids from the surface of very low density lipoprotein (VLDL) and chylomicron remnants to HDL (121). It can remodel HDL by transferring phospholipids between different sized HDL particles (122) and plays an important

role in generation of preβ-HDL (123). All of these factors influence the size distribution and functionality of HDL particles that influence the efficiency of RCT.

1.3.4 Step 4: Hepatobiliary excretion of cholesterol and bile acids

Once taken up by the liver, CEs must first be hydrolyzed and UC can be either secreted directly into bile, or indirectly after conversion to bile acids. The classical pathway for bile acid synthesis occurs within hepatocytes, where cholesterol is converted primarily to cholic acid and chenodeoxycholic acid (in humans); the rate limiting enzyme in this conversion is cholesterol

7α-hydroxylase, or cytochrome P450 enzyme 7A1 (CYP7A1) (124). Bile acids are actively secreted from the liver into bile and then released into the intestine following ingestion of a meal, where they act as surfactants to dissolve dietary lipids and proteins for absorption. The majority of bile acids are reabsorbed and recycle in the hepatobiliary circulation, however, a small percentage (~5%) is lost to excretion (125). ABCG5 and ABCG8 work together to actively transport cholesterol across the apical membrane of hepatocytes into bile (126). The bile salt export pump, ABCB11 also actively pumps bile acids across the hepatocyte membrane into the bile canaliculus for bile production (127). There is significant evidence that the pool of HDL- derived cholesterol in the liver is preferentially shunted towards biliary excretion (113,128,129).

1.3.5 The role of the intestine in RCT

The role of the intestine in RCT is increasingly becoming apparent. In addition to hepatocytes, ABCG5 and ABCG8 are also expressed in the intestinal epithelium, where they counteract dietary cholesterol absorption (and biliary cholesterol re-absorption) by transporting cholesterol absorbed in epithelial cells back into the intestinal lumen (130,131). Also, the

Niemann Pick C1-like 1 (NPC1L1) protein, the target of the drug ezetimibe (132), plays a role in

absorption of cholesterol in absorptive enterocytes, which impacts the RCT pathway, affecting whole body cholesterol homeostasis (133).

An alternative pathway for cholesterol excretion has been recently identified in rodents, whereby HDL-cholesterol may be excreted directly into the intestine, which would bypass the classical RCT pathway, by avoiding passage through the liver (134,135). Using bile duct ligation and NPC1L1 overexpression to impair hepatobiliary cholesterol transport, Temel and colleagues

(135) found that fecal sterol excretion from plasma cholesterol was normal, suggesting that cholesterol may be excreted directly from the plasma into the intestine. This alternative pathway was termed trans-intestinal cholesterol excretion (TICE). In another study it was determined that

HDL was not required for TICE (136). In a recent publication (137), TICE was determined to be an active process, requiring the LDLR and ABCB11, which was modulated by treatment with statin or recombinant PCSK9. Nevertheless, Nijstad and colleagues (138) challenge the relevance of the TICE pathway, maintaining that the classical RCT pathway is still required for excretion of cholesterol coming from peripheral tissues. They observed that bile duct ligation or knockout of ABCB4 in mice blocked excretion of radiolabelled cholesterol derived from peripheral cells and that very little HDL-CE is taken up from circulation into the intestine, which was confirmed by the results of Vrins et al (136). Therefore, further studies are needed to resolve this controversy and its relevance to human biology.

1.3.6 Macrophage-specific reverse cholesterol transport

The study of the RCT process has shifted in recent years. Current methods to model reverse cholesterol transport directly from macrophages have been pioneered by the laboratory of

Daniel Rader, where radiolabeled cholesterol tracer is tracked through the RCT pathway ultimately to the feces (139,140). This technique is a more effective method at estimating the

flux of cholesterol through the RCT pathway, rather than measurement of HDL-C levels themselves, since it models RCT in a more dynamic sense. For example, in deficiency of apoA-I, over expression of CETP or SR-BI causes major reductions in RCT without affecting cholesterol efflux (140-142). Similarly, human subjects with natural mutations in apoA-I (ApoA-IMilano) have very low HDL-C, but no excess risk of atherosclerosis (143). Also, the CETP inhibitor torcetrapib, while it significantly increased HDL-C levels, resulted in increased risk of cardiac and other events (144-146). Recently, much of the focus has turned toward the many known anti- atherosclerotic properties of HDL such as the anti-oxidant, anti-inflammatory, anti-thrombotic properties, as well as its dynamic role within the reverse cholesterol transport (RCT) pathway, as opposed to HDL cholesterol levels themselves (115,140,147). The ability of HDL to promote cholesterol efflux from macrophage foam cells, smooth muscle cells and endothelial cells in the arterial wall is central to its anti-atherogenic effects (140,148). Therefore, measurement of RCT from macrophages specifically is relevant to atherosclerosis, since macrophages are the primary cell type that accumulates cholesterol to become foam cells in the artery wall in mouse models of atherosclerosis (114,149).

The roles of several players in macrophage-specific RCT have been investigated using this technique. ABCA1 and ABCG1 macrophage-specific knockout mice have reduced cholesterol efflux to apoA-I and HDL, respectively and have impaired in vivo macrophage RCT

(77,150). Alternatively, macrophage-specific overexpression of ABCA1 in mice increased macrophage RCT (150). Mice fed the synthetic LXR agonist GW3965 also promoted macrophage RCT by upregulation of several genes in the RCT pathway (151). Interestingly, in several instances, changes in macrophage RCT that inversely reflect changes in atherosclerosis severity did not correlate with HDL-C levels (101,152,153). For example, SR-BI overexpression

in the liver enhanced macrophage RCT, despite decreased HDL-C levels (102). In these cases, macrophage RCT may provide a more accurate reflection than HDL-C of the role of a particular gene in the RCT pathway for influencing atherosclerosis susceptibility.

1.3.7 Regulation of reverse cholesterol transport genes by the liver X receptor

The liver X receptor (LXR) belongs to a family of ligand-activated nuclear receptor transcription factors that play a crucial role in the transcriptional regulation of genes in diverse aspects of lipid metabolism, including genes that mediate RCT. Nuclear receptors such as LXRs, peroxisome proliferator activator receptors (PPARs), and farnesoid X receptors (FXRs) function as lipid and sterol sensors, which respond to cellular lipid levels and change gene expression patterns accordingly to protect cells from lipid overload and toxicity (154). The LXR works in concert with the retinoid X receptor (RXR), forming an obligate heterodimer pair (155). The

LXR along with RXR binds to an LXR response element (LXRE), which consists of a direct repeat sequence (DR4) consisting of conserved bases AGGTCA spaced by 4 variable nucleotides within the promoter region of its target genes (155). There are two isoforms of LXR, LXRα and

LXRβ, which are the products of two different genes, and share 78% sequence identity within their ligand binding domains (156). The LXRα isoform is most highly expressed in liver, intestine, kidney, adipose as well as in macrophages (11,155) , whereas the LXRβ has a low level of constitutive expression in most tissues in the body (157). Oxysterols are the natural ligands that activate LXRs, with the strongest activators being 22-OH, 20(S)-OH, 24-OH, 25-OH,

24(S),25-epoxycholesterol and 7α-OH (158-160). Although 27-hydroxycholesterol (27-OH) is not as potent ligand of LXR, it is the most abundant oxysterol in plasma (161), making it a likely important activator of LXR in vivo (10,162). Glucose can also bind to and activate LXRs, indicating that LXR may also be involved in the regulation of glucose metabolism and insulin

signaling (163). Recently it was discovered that desmosterol, a precursor to cholesterol, also activates LXR-mediated gene expression in response to cholesterol loading of macrophages

(164). This was shown to be independent of oxysterol-mediated activation of LXR, when the enzymes responsible for production of the major endogenous ligands 24-OH, 25-OH and 27-OH were knocked out in mice (164). Thus, desmosterol may be an important, previously unknown ligand for LXR.

1.3.7.1 Enzymatic and non-enzymatic synthesis of oxysterols

Oxysterols are derivatives of cholesterol that can be produced enzymatically, or non- enzymatically through free-radical lipid peroxidation such as 7-ketocholesterol, 7(α)-hydroxyl

(7-OH), and 5, 6-epoxides (165,166), or by auto-oxidation (166) and can come from dietary

(167) or intracellular sources in vivo. Non-enzymatically produced oxysterols are also found on oxLDL particles and are thought to contribute to atherosclerosis (58,168-170).

Oxysterols can also be synthesized enzymatically within cells. Some oxysterols such as

7-, 27-, 24- and 25-hydroxycholesterol (7-OH, 27-OH, 24-OH and 25-OH) are produced as intermediates in the initial steps in bile acid synthesis. The most abundant oxysterols 7-OH and

27-OH are produced enzymatically by the cytochrome P450 enzymes CYP7A1 and CYP27 respectively. They are involved in the two main pathways for the initial steps in bile acid synthesis. The enzyme 27-hydroxylase is ubiquitously expressed in most tissues, while 7(α)- hydroxylase expression is liver-specific (165). Mutations in the gene encoding CYP27 result in cerebrotendinous xanthomatosis (171), causing severe neuropathy as a result of accumulation of sterol around the myelin sheaths of neurons (172).

The oxysterol 24-OH is produced enzymatically by the cytochrome P450 enzyme 24- hydroxylase (CYP46) (173) and is expressed specifically in the brain (174). Since the blood

brain barrier limits the exchange of cholesterol from lipoproteins, conversion of cholesterol to

24-OH may facilitate reverse cholesterol transport out of the brain (174). 22-hydroxycholesterol

(22-OH) is thought to be produced enzymatically and is present at low levels in most tissues, although the mammalian 22-hydroxylase has not yet been identified (173). It is especially abundant in steroidogenic tissues where it is used as an intermediate in the production of steroid hormones such as testosterone (175).

The human gene for 25-hydroxylase, encodes a small, polytopic membrane protein that belongs to a group of enzymes containing a non-heme di-iron core with histidine-rich regions within the active site, and is not a member of the cytochrome P450 family (176). 25-OH is produced at low amounts in most tissues, including the lung, heart and kidney (165) and functions as an intermediate for bile acid synthesis, and regulation of cholesterol sensitive genes

(12,177).

1.3.7.2 The role of oxysterols in regulation of cholesterol homeostasis

The ‘oxysterol hypothesis’, first proposed by Kandutsch in 1978 (12), suggests that oxysterols can act like signaling molecules under conditions of excess cellular cholesterol.

Despite their very low abundance (10-5 to 10-6 that of cholesterol), they potently suppress cholesterol synthesis, likely due to their hydrophilic properties which increases solubility, allows oxysterols to move freely throughout cellular compartments (12). In addition to suppression of cholesterol synthesis, during cholesterol overload, oxysterols also activate a host of transcription factors such as LXRs to promote cholesterol efflux and reverse cholesterol transport in order to alleviate cholesterol buildup within cells. Thus, LXRs act as sensors to monitor the oxysterol levels within the cell and translate this into transcriptional regulation of target genes in other lipid metabolism pathways (159). It is now understood that LXRs are involved in the control of a

number of lipid regulatory networks. The LXR target gene network includes genes involved in fatty acid metabolism (by activation of SREBP-1c and target genes fatty acid synthase, acetyl

CoA carboxylase and stearoyl CoA desaturase), and phospholipid and cholesteryl ester transporters (PLTP) (178), cholesterol efflux (ABCA1 and ABCG1), lipoprotein transport and exchange (apo E, apo CI, CII, LPL and CETP), and excretion via bile synthesis (CYP7A1)

(154,179).

Oxysterols can also control LDL cholesterol uptake by upregulating expression of the inducible degrader of the LDL receptor (IDOL). IDOL is an E3 ubiquitin ligase that ubiquitinates the LDL receptor, targeting it for proteasomal degradation (180). The expression of

IDOL is under regulation of LXR (180). LXR induction of IDOL provides another mechanism by which oxysterols can regulate LDL uptake when cellular cholesterol levels are high

(180,181).Thus oxysterols play an important role in signaling cholesterol overload and activation of cellular regulatory measures to control cellular cholesterol homeostasis and promote RCT.

1.4 ABCA1 and ABCG1 function and regulation

ABCA1 is a member of a large superfamily of ATP-binding cassette transporters, comprised of 7 subgroups (A to G) and 51 members, including the cystic fibrosis transmembrane receptor (CFTR) and multi-drug resistance protein (MDR1) (182). Generally, these membrane proteins function by using ATP to pump a variety of substrates unidirectionally across the membrane bilayer (183). The ABCA1 is a membrane protein that transports phospholipids and cholesterol in order to lipidate apolipoproteins for nascent HDL particle formation during the earliest stage of RCT.

Like other ABC proteins, ABCA1 has two transmembrane domains (TM) with 6 membrane-spanning alpha helices each, two nucleotide binding domains (NBD) composed of a

Walker motif and a signature motif, which together utilize the energy from ATP hydrolysis to catalyze conformational changes that allow translocation of the substrate (182,184). There is also a hydrophobic regulatory domain in the loop between TM domains that interacts with the membrane (185). The importance of ABCA1 in the RCT pathway became apparent with the study of Tangier disease and the discovery that mutations in ABCA1 were the underlying cause

(186-189). Tangier disease is a rare autosomal recessive disorder characterized by enlarged yellow-orange tonsils, skin xanthomas, and hepato(spleno)megaly. As well, patients may have ocular manifestations and CE deposits in lymph nodes, thymus, and intestine. Deposits in

Schwann cells lead to peripheral neuropathy in many cases (185,190,191). Tangier patients also have generalized hypolipidemia; homozygotes have a severe deficiency of HDL-C (<10mg/dL), nearly absent plasma apoA-I, low LDL-C (40% of normal) and may develop hypertriglyceridemia (185,192). Tangier heterozygotes have half normal HDL levels and half normal efflux activity from fibroblasts (83), implying that ABCA1 is the rate limiting step in

HDL production for RCT (185). Tangier homozygotes have a 4-fold greater incidence of cardiovascular disease (CVD), although there is significant heterogeneity among patients, and heterozygotes also commonly have a higher incidence of CVD (191,193).

ABCA1 mediates efflux of PLs and UC, in a process that is dependent on the Golgi

(84,194-196) and through its interaction with apolipoproteins such as apoA-I, apoA-II and Apo

C-I, C-II and C-IV (197-201). Notably, Francis et al. demonstrated that Tangier fibroblasts have impaired cholesterol and phospholipid efflux to apoA-I in medium (192). Increased expression of ABCA1 at the cell surface enhances ApoA-I binding (202). ApoA-I interacts directly with the extracellular loops of ABCA1 to enhance its efflux activity (202,203). Similarly, ABCA1 activity can also be increased by phosphorylation of the NBD by casein kinase 2 (204).

Activation of Janus kinase 2 inhibits apoA-I binding to ABCA1 and reduces lipid efflux (205).

However, for the purposes of HDL particle formation, apoA-I binds to high affinity binding sites, or lipid domains in the membrane created by ABCA1 (206).

1.4.1 ABCA1 transcriptional and post-transcriptional regulation

In macrophages and fibroblasts cholesterol loading upregulates ABCA1 expression

(188,207,208) and activates apoA-I dependent efflux (84,196,209,210). Cyclic AMP upregulates

ABCA1 in macrophages, independently of cellular sterol levels (188,199,201,207,210), which it does by activating protein kinase A that phosphorylates the NBDs of ABCA1, increasing its activity (211,212).

The ABCA1 promoter contains an LXRE, and its expression is upregulated in response to

LXR and RXR ligands, oxysterols and retinoic acid respectively (8,9) in a synergistic fashion.

SREBP-2 can suppress ABCA1 transcription by binding directly to an E-box motif in the

ABCA1 promoter (213). Statins can also upregulate LXR-mediated ABCA1 and ABCG1 expression in macrophages by reduced mevalonate production and RhoA signaling, increasing

PPARγ activation and its target gene LXR (214). There are a number of other transcriptional activators and repressors that regulate ABCA1 expression which are nicely reviewed by Schmitz and Langmann in (213).

Due to its rapid turnover rate (a half-life of 1-2 hours) (215), ABCA1 can also be regulated at the level of protein stability. The ABCA1 protein contains an internal sequence rich in proline, glutamic acid, serine and threonine (PEST). Phosphorylation of threonines 1286 and

1315 within the PEST motif targets calpain protease to increase ABCA1 protein degradation.

However, apoA-I binding counters phosphorylation and calpain-mediated degradation, thus increasing the stability of ABCA1 at the plasma membrane (216,217). Also the proteins α1-

syntrophin and Lin7 contain PDZ-domains and can interact with the C-terminal tail region of

ABCA1 to increase its stability, possibly by causing a conformational change that protects

ABCA1 from calpain protease degradation (218). ApoA-I binding to ABCA1 also activates phospholipase C, which hydrolyzes PC to DAG, activating protein kinase C and phosphorylating

ABCA1, increasing its stability (219).

1.4.2 The ABCG1 and its role in RCT

Another member of the ATP-binding cassette transporter family, ABCG1 has also been found to play an important role in cholesterol efflux in RCT. ABCG1, homologous to the

Drosophila white gene, is a half transporter (has only one TM domain and one NBD) that can form homodimers and possibly heterodimers with ABCG4 (220). ABCG1 is upregulated by acLDL cholesterol loading in macrophages, but unlike ABCA1 its protein expression is downregulated following incubation with HDL3 (221) but not by native LDL or free cholesterol

(222). ABCG1 is also upregulated by oxysterol-mediated induction of LXR (179,222,223).

LXR-induced ABCG1 expression increases cholesterol efflux to exogenous HDL3 as an acceptor

(77,150,224), although it can also efflux to LDL, cyclodextrin or phospholipid vesicles

(225,226), and does not require protein interaction at the plasma membrane for efflux. ABCG1 has similar tissue expression pattern to ABCA1 but is present mostly intracellularly in ER and

Golgi compartments (179,221). Exactly how it functions in lipid efflux in these compartments is unknown, however, it is thought to play a role in regulating intracellular cholesterol movement

(227). ABCG1 knockout mice have lipid accumulation in foamy macrophages in many tissues, especially the lung (77). Interestingly, however, neither ABCG1 knockout nor overexpression in mice has any effect on plasma HDL-C or other lipid or lipoprotein levels (228). ABCG1 is also thought to play diverse roles in cholesterol homeostasis during T cell lymphocyte proliferation,

glucose metabolism in pancreatic β-cells and surfactant secretion from type II pneumocytes

(227). The relation of ABCG1 to atherosclerosis is complex. Loss of ABCG1 in the whole body or specifically in macrophages on an atherogenic mouse background (LDLR or ApoE-/-) results in either reduced or mildly increased atherosclerosis depending on the study conditions (229-

234).

1.5 Regulation of cholesterol metabolism in Niemann Pick disease type C (NPC)

Niemann Pick disease type C is a neurodegenerative disease with other clinical manifestations such as hepatomegaly, neonatal liver disease, and, frequently, death in childhood or early adolescence. NPC patients typically have low plasma HDL (13,235). Biochemically,

NPC is characterized by intracellular accumulation of UC, specifically within the late-endosomes and lysosomes (236). Cholesterol accumulated within this compartment is not available for normal cholesterol regulation such as for suppression of cholesterol synthesis by HMGCR and uptake by the LDLR or for upregulation of cholesterol esterification by ACAT (237). Excess lysosomal cholesterol also cannot access intracellular sites for oxysterol synthesis, resulting in reduced activation of liver X receptor (LXR) nuclear receptor and dysregulation of its target genes in NPC (238).

Previous work in our lab has demonstrated that cholesterol-dependent regulation of

ABCA1 and cellular efflux of cholesterol and phospholipids to apoA-I are impaired in NPC1 deficient human fibroblasts as a result of impaired cholesterol trafficking out of the lysosomal compartment (13). However, exogenous addition of oxysterols or synthetic LXR ligand corrects

ABCA1 and ABCG1 expression and cholesterol efflux in NPC1 fibroblasts (239). Larger HDL

(alpha-sized) particles are nearly absent from plasma of NPC patients, however, LXR agonist treatment restores normal HDL particle formation from NPC fibroblasts (239). This work

indicates that cholesterol transport through the lysosomal compartment is important for regulation of ABCA1 for cholesterol efflux and HDL formation. However, it also shows that upregulation of ABCA1 by direct activation of the LXR pathway can overcome this defect and restore normal functioning of lipid and cholesterol efflux for HDL particle formation.

1.6 Lysosomal acid lipase (LAL)

Defects in lysosomal hydrolysis of cholesteryl esters also lead to impaired regulation of

HDL formation, and are the major focus of this thesis. The enzyme lysosomal acid lipase (LAL), the sole hydrolase responsible for breakdown of cholesteryl esters within the lysosomes, is discussed in the following section.

1.6.1 The history of discovery of LAL

One of the earliest descriptions of what would later be termed Wolman Disease was made by Abramov and colleagues (240). They described a case report of a 2 month old girl with adrenal calcification and enlarged liver and spleen, which upon microscopic analysis revealed massive lipid accumulations and foamy histiocyte infiltration in the tissues of the liver, spleen, lymph, adrenals, lungs and small intestine. Histologic staining of lipids showed that much of this accumulation was cholesterol (240). This was later confirmed by Wolman and colleagues in

1961, in another case report of two affected siblings with similar symptoms and pathology (241).

Upon histologic analysis of affected tissues, it was confirmed that the lipid accumulation was a mixture of triglycerides, cholesterol and fatty acids. The adrenals in particular contained 18% of their wet weight as cholesterol, 90% of which was esterified (normal is 3-12%). The authors also remarked at the superficial similarity to Niemann Pick C disease, except for the prevalence of adrenal calcification and little central nervous system involvement, for which previous cases may have been mistaken (241). Separately, Mahadevan and Tappel (242) identified a lipase enzyme

purified from rat liver and kidney that was capable of hydrolyzing triglycerides at acidic pH.

Following subcellular fractionation of rat liver homogenate, they observed a 22-fold increase in lipase activity in the lysosomal fraction, suggesting that it was a lysosomal enzyme (242).

Shortly after, Patrick and Lake (243) made an important discovery linking acid lipase deficiency to the pathology observed in Wolman disease. They studied a case of 3 brothers affected with

Wolman disease, having accumulations of neutral lipid and cholesterol (mainly in the form of triglyceride and cholesteryl ester) in visceral organs, suggesting that it may have been an inherited disease caused by a genetic deficiency. The activity of acid lipase in liver and spleen homogenates at pH 4.2 was absent in Wolman disease samples. Thus, they concluded the cause of Wolman disease was a deficiency of acid lipase enzyme leading to the progressive accumulation of triglycerides and cholesteryl esters in affected tissues (243).

1.6.2 The molecular biology of LAL

The LIPA gene that encodes LAL has been mapped to the human chromosome locus

10q23.2-23.3 (244,245). The gene spans approximately 36 kilobases and contains 10 exons

(246,247). The gene was first cloned in 1991 by Anderson and Sando (244). The resulting cDNA sequence predicts an mRNA product 26-27 kilobases long (244,248). The LIPA gene has a high level of sequence homology and shares structural similarity with human gastric lipase and rat lingual lipase, enzymes involved in the pre-duodenal breakdown of triglycerides (244). However,

LAL is distinct from other neutral lipases such as neutral cholesteryl ester hydrolase (nCEH), lecithin cholesterol acyl transferase (LCAT) and lipoprotein lipase (LPL) (244). The LAL protein contains 372 amino acids preceded by a 27 amino acid signal sequence (248,249). The mature protein contains 3 cysteine residues (Cys227, Cys236 and Cys244) that share conservation with other lipases, suggesting their importance for catalysis (249). The polypeptide sequence also

contains conserved putative glycosylation sites (Asn-X-Ser/Thr) at three critical asparagines

(244). Treatment of cells with tunicamycin produces an inactive form of LAL, suggesting that glycosylation is critical to catalysis within the folded protein (249).

1.6.2.1 Gene regulation of LIPA

The regulation of LIPA gene transcription has not been well characterized to date.

Putative binding sites for Sp1 and AP2 transcription factors and a CAT-box were identified in the promoter region of LIPA (247,250). The pro-atherogenic lipoprotein(a) suppresses LAL mRNA expression in cultured and circulating monocytes (251). The bacterial endotoxin lipopolysaccharide (LPS) also downregulated LAL gene expression at concentrations above 1 ng/ml, although the mechanism is unknown. LAL expression does not, however, appear to be regulated by LDL (251) (and my own personal observations). No LXRE has been identified in the promoter region of the LIPA gene in any of the transcription factor searches (247,250)

(including my own analysis), and the gene is not upregulated by LXR ligands.

1.6.3 LAL secretion and uptake

LAL is synthesized as a pre-protein containing a 27 amino acid signal peptide and a 49 amino acid prodomain (248). LAL can be found in two different isoforms that vary by cell type.

The purified protein from human skin fibroblasts has an apparent molecular weight of 41 kDa for the intracellular form and 49 kDa for the form that is secreted (249,252,253). Human liver contains 41kDa and 56kDa molecular weight isoforms (248). Post-translation, LAL protein in cultured human fibroblasts has a half-life of approximately 12 to 24 hours (253).

According to the ‘secretion recapture hypothesis’, following synthesis, lysosomal enzymes are modified (tagged with a ‘recognition marker’), packaged into vesicles for secretion and can later be internalized from the extracellular fluid and targeted to their site of action in the

lysosomes (254). It is now known that uptake of lysosomal hydrolases and targeting to the lysosomes is mediated by recognition of phosphomannosyl residues on the lysosomal proteins by the mannose-6-phosphate receptor (255-257). Purified LAL enzyme added to the medium corrects hydrolysis activity and CE accumulation in cultured Wolman disease fibroblasts (258).

LAL protein was taken up by endocytosis by saturable kinetics, which could be outcompeted by addition of mannose-6-phosphate to the medium or by a ‘high-uptake’ form of another lysosomal enzyme L-iduronidase, suggesting that uptake was receptor-mediated and that a common receptor is used by several hydrolases. Alkaline phosphate pre-treatment of LAL also blocked uptake, indicating that the receptor recognizes phosphomannosyl residues on the proteins that are required for uptake (258). Further evidence that glycosylation was required for LAL uptake came from the observation that treatment with endo-β-N-acetylglycosaminidase H reduced the 49kDa isoform to 41kDa (253). Endoglycosidase-treated LAL retained enzyme activity in vitro, however, this form could no longer be taken up by cells.

Zschenker and colleagues (259) identified a mutation in the signal peptide of LAL (-5 amino acid position) causing Wolman disease. When the G-5R mutant was expressed in insect cells, enzymes contained in cell lysates had normal catalytic activity, however in medium the activity was 6% of normal, suggesting a defect in secretion. Therefore, it is likely that the signal peptide is important for directing LAL trafficking towards secretory vesicles.

1.6.4 LAL enzyme properties

The enzymatic properties of lysosomal acid lipase (LAL) have been extensively studied in a number of different species and experimental conditions. This acid lipase, enzyme classification number EC 3.1.1.13, belongs to the class of serine hydrolases, with a classical

GXSXG active site motif at serines 153 and 99, although site-directed mutagenesis studies have

shown that only Ser153 is critical to catalysis (249). The LAL protein has limited solubility, with high affinity for membranes. When membrane-bound, only 30% could be released into the soluble fraction (242,260). This has raised the possibility that intracellular LAL may be tightly bound to the lysosomal membrane in vivo (242).

1.6.4.1 How LAL activity is measured

Early assays to measure lipolytic activity of LAL did not discriminate based on substrate since they quantified the release of fatty acids from hydrolysis. The substrate being tested would be dispersed in a pH adjusted citrate-phosphate buffer containing Triton X-100 detergent (242).

Then, following different incubation times at 37°C in the presence of semi-purified enzyme, the free fatty acids released following hydrolysis were extracted into chloroform and quantified using a colorimetric or fluorometric assay (260,261). Later, methods for measuring hydrolysis of radioisotope labeled substrate (e.g. [14C]Tripalmitin or cholesteryl-3-[1-14C] palmitate) were developed. This was a more sensitive assay that allowed for a more specific analysis of enzyme activity for different substrates observed (262). However, these assays still measured the release of fatty acids since the radiolabelled moiety (3H or 14C) was on the acyl chain (263,264). In the early 1980s, a simpler method for measuring LAL hydrolysis activity was determined, where the artificial substrate 4-methylumbelliferyl oleate (4-MUO) was incorporated into phospholipid vesicles in a citrate-taurodeoxycholic acid buffer at acidic pH (265). Upon incubation with cell lysate or tissue homogenate containing LAL, hydrolysis of 4-MUO releases the product 4- methylumbelliferate, which emits fluorescence at a wavelength of 455nm when excited at 355nm

(258,265). This simplified assay allowed for an easy and accurate assessment of LAL activity in multiple samples under different enzyme purification conditions.

1.6.4.2 LAL enzyme activity parameters

The pH optimum of LAL has been studied in a range of species and under multiple different experimental conditions, making it difficult to generalize. In human tissues, LAL activity has been reported to be optimal anywhere from pH3.5 to 6.0. Rat and rabbit LAL activity is optimal at approximately 4.5 to 5.0 (242,252,260,266-268). However, the pH optimum seems to depend on the substrate used and conditions under which the assay was performed. For example, the pH optimum for CE and TG (hydrolysis of radiolabelled substrate) is approximately 3.5 to 4.5 whereas it is slightly higher towards the artificial substrate 4- methylumbelleriferyl oleate (4-MUO), between 4.0 and 5.0 (252,269,270). As well, modification of the assay conditions by addition of detergents such as TritonX-100, bile acids, acidic phospholipids or high salt concentration can cause a shift in the pH optimum (253,260,271).

The specificity of LAL towards various substrates has also been studied in detail. LAL is a carboxyl esterase that can hydrolyze the ester bond to release fatty acids from cholesteryl esters and triglycerides. LAL has 3-4 times greater affinity for TG hydrolysis than for CE (272), and hydrolyzes TG, diacylglycerols and monoacylglycerols in decreasing order of activity

(260,272,273). However, cleavage of monoacylglycerols has been demonstrated for purified rat and rabbit enzyme only, and it cannot be cleaved by human LAL (272,273). Ester bond cleavage occurs most favorably at the sn1(3) position (273) and there is a preference for substrates with medium to long chain fatty acids of 10-18 carbons (242,261), for unsaturated fatty acids over saturated (261), and for cis over trans double bonds (249).

The reaction kinetics of purified LAL from different species and tissue types has been quantified by several groups in the 70s and 80s. The rate of enzymatic activity is shown to be linear from 10 minutes up to 90 minutes and is proportional to enzyme mass over a range of 100-

300 µg protein (260,261,266,274). LAL enzyme is only 30% soluble in water and is most stable when membrane bound or when integrated into lipid vesicles, where the solubility increases to

70% (242,260). The poor solubility of LAL had caused some difficulty during early attempts at purification of the enzyme. As a result, the apparent Km and Vmax of the enzyme differ greatly depending on substrate preparation and tissue type from which the enzyme was purified. A wide range of values of Km for human LAL have been reported, varying between 20 µM to 1.2 mM of substrate concentration (269,270,272). In general, the Km tends to be lower towards the 4-

MUO artificial substrate than for CE or TG (252,270). Similarly, the reported Vmax of the enzyme ranges between 8 nmol/mg*min to 5.4 µmol/mg*min for TG or CE, but is much higher

(up to 290 µmol/mg*min) towards 4-MUO (252,268,275,276).

1.6.4.3 Factors that affect LAL enzyme activity

1.6.4.3.1 Inhibitors

Numerous different activators and inhibitors of LAL have been identified in a number of studies in the literature, however the general properties and types of agents will be summarized here. In general, LAL enzyme activity is inhibited by high salt conditions of greater than 0.2M of salts such as NaCl, KCl, HgCl2, Hg(No3)2, iodoacetate or NaF (242,261,269,270), at lower concentration, by divalent cations such as Ca2+, Cu2+, Hg2+ or Zn2+ (242,252,264,266,268), or by other positively charged molecules such as stearamine (277). LAL has also been shown to be inhibited by acidic phospholipids such as lyso-Phosphatidylcholine (PC), phosphatidylserine

(PS), phosphatidylinositol (PI), cardiolipin (CL) (253,277), while other studies have found that phospholipids such as CL, PS and phosphadidylethanolamine (PE) have the opposite effect by enhancing LAL activity (263,271). Various sulfhydryl reagents have been shown to inhibit enzyme activity, which indicates the presence of a critical cysteine residue at or near the active

site of LAL (261,266,268,276). As well, lysosomotropic drugs such as chloroquine and chlorpromazine have both direct and indirect inhibitory effects on LAL (253,275,278) as well as the hormone progesterone (274). The fungal antibiotic esterastin also possesses potent inhibitory properties against LAL, causing an accumulation of CE in cultured smooth muscle cells 12 times higher than basal levels (279). More recently, a specific and potent inhibitor of LAL activity, termed ‘lalistat’ has been developed. Lalistat contains a thiadiazole carbamate moiety and is closely related to another drug ‘orlistat’ that had previously been shown to inhibit LAL but to a lesser degree (280,281). In fact, although controversial, lalistat has been proposed as a potential therapeutic strategy in the treatment of NPC disease in order to prevent the formation of UC, which is much more cytotoxic to neurons than neutral CEs (282).

1.6.4.3.2 Activators

Among the activators of LAL, detergents such as TritonX-100 or digitonin have been shown to enhance LAL activity in vitro (253,263,276). In accordance with this, the addition of bile acids or salts such as deoxytaurocholate or taurocholate has also been shown increase the activity of LAL, possibly by increasing the accessibility to its hydrophobic substrates in aqueous solution (242,253,277). For this reason, inclusion of the substrate into phospholipid vesicles

(primarily made up of PC) enhances LAL activity, especially when negatively charged or acidic phospholipids such as phosphatidic acid (PA), PS, CL are included (263,268,271,277,278).

1.6.5 The intracellular role of LAL in LDL cholesterol metabolism

A series of events take place during the uptake of exogenous LDL into cells (as reviewed in (283)): 1) LDL binds to the LDLR at the cell surface (255,284), 2) LDL becomes internalized via receptor-mediated endocytosis into clathrin-coated vesicles (285), 3) endocytic vesicles fuse with the lysosomes and the protein and CE components of LDL are hydrolyzed (286,287), 4)

release of UC from lysosomes, 5) a regulatory response to excess intracellular UC takes place which causes the downregulation of HMGCR and LDLR expression (255,284), and stimulation of cholesteryl esterification by ACAT (38,288).This is summarized in Figure 1.2.

Figure 1.2 The role of LAL in the LDL receptor pathway.

LDL binds to the LDL receptor (LDLR) and is internalized via receptor-mediated endocytosis in clathrin-coated vesicles. LDL bound to the LDL receptor is transported to the late endosomes/lysosomes, where LDL is released from the LDL receptor and cholesteryl esters (CE) are broken down to unesterified cholesterol (UC) by lysosomal acid lipase (LAL) at acidic pH. The un-bound LDLR is recycled back to the plasma membrane for re-use. The

Niemann Pick Type C protein 1 (NPC1) transports UC out of the late endosomes and lysosomes where it can be delivered to other parts of the cell such as the ER. Increased cholesterol levels in the ER lead to 1. Suppression of cholesterol synthesis by HMG CoA reductase (HMGCR), 2. Decreased LDL receptor expression, and 3. Enhanced activity of acyl-CoA cholesterol acetyltransferase (ACAT), which esterifies UC to CE for storage in lipid droplets.

(*adapted from Brown and Goldstein (289))

The lysosomes were identified as the site of intracellular storage of CE and TG in LAL deficient fibroblasts (290). Using [3H]cholesteryl linoleate to specifically label cholesteryl esters on LDL particles, Brown and colleagues (287) were able to show that LDL-CEs were degraded intracellularly in parallel with LDL apolipoproteins and then rapidly re-esterified into

[14C]cholesteryl oleate by ACAT. It was also demonstrated that this LDL-CE breakdown takes place in the lysosomes, because hydrolysis was blocked by the lysosomal inhibitor chloroquine and that the optimum pH of activity for this hydrolysis by cell free extracts was approximately 4.

Uptake via the LDL receptor was also required, given that familial hypercholesterolemia (27) fibroblasts, which lack LDL receptor activity, had no hydrolysis of [3H]cholesteryl linoleate labeled LDL (287). It was later determined that WD and CESD fibroblasts, while having normal breakdown of LDL apolipoproteins, had defective hydrolysis of LDL-CEs , indicating that LAL was the enzyme responsible for hydrolysis of LDL-CE (237). CESD fibroblasts also had reduced suppression of HMGCR upon LDL loading and the total cholesterol content of CESD cells over time was higher than normal fibroblasts (237), which was most likely due to increased de novo cholesterol synthesis. Knowing that lysosomal enzyme deficiencies could be corrected by addition of the missing enzyme to the culture medium (see review (291)), they next tried a similar approach using co-culture of fibroblasts in order to investigate the requirement and sufficiency of LDL receptor and LAL enzyme. When either CESD or WD fibroblasts were incubated in co-culture with FH fibroblasts at varying ratios, the aberrant LDL-CE hydrolysis was rescued in a linear fashion with increasing FH/(CESD or WD) cell ratio (292). Co- incubation of CESD or WD cells in equal proportion to FH cells restored normal suppression of

HMGCR activity and cholesterol re-esterification by ACAT, but was suppressed with increasing proportion of either cell line (292). Therefore, through the elegant work of the laboratory of

Goldstein and Brown, it was elucidated that the lysosome is the site of hydrolysis of CE brought in by LDLR-mediated endocytosis, and that lysosomal LDL-CE hydrolysis by LAL supplies the rest of the cell with free cholesterol, resulting in a regulatory response of the processes that regulate cholesterol synthesis and storage.

1.6.6 LAL and autophagy

Autophagy is a bulk degradative process for clearance of aged proteins or damaged organelles, provides a source of energy during starvation by breakdown of stored substrates and performs a housekeeping function for cell survival as opposed to cell death via apoptosis or necrosis (293), although it shares many of the same effectors and regulators as in apoptosis

(294). Autophagy follows a conserved, multistep process whereby cytoplasmic contents are sequestered within double-membraned vesicles that then fuse with lysosomes in order to deliver their contents for degradation (293): 1) The first step involves initiation of formation of the limiting membrane or, phagophore. 2) The expansion of the limiting membrane is stimulated by production of phosphoinositol-3-phosphate by the signaling molecule phosphoinositol-3 kinase, which helps to recruit autophagy proteins for nucleation of the membrane and creates curvature in the phagophore membrane as it expands (295). 3) The autophagosome membrane fuses with the lysosome, containing digestive hydrolases. 4) The inner membrane of the autophagosome is broken down and its contents are degraded by lysosomal hydrolases. 5) The macromolecules produced by hydrolysis are released into the rest of the cell through pores in the lysosomal membrane created by permeases.

Autophagy plays an important role in lipid and cholesterol metabolism. Singh and colleagues (296) found cytosolic lipid droplets can be taken up into lysosomes by autophagy and degraded by lysosomal hydrolases. Lipid droplets were observed within double-membraned

vesicles within lysosomes. Inhibition of autophagy in Atg5 knockout mouse hepatocytes leads to

TG and cholesterol accumulation, an increased number and size of lipid droplets and reduced breakdown of free fatty acids, whereas induction of autophagy relieved hepatic storage of TG

(296). This process whereby lipid droplet TG and CE are delivered by autophagy to the lysosomes was termed by the authors as “lipophagy”.

The autophagy machinery becomes activated following exposure to modified lipoproteins such as acetylated LDL (acLDL) (297) and after uptake, the acLDL CEs are rapidly hydrolyzed in the lysosomes and then re-esterified by ACAT in the ER and incorporated into lipid droplets

(298-302). LAL is required for hydrolysis of lipid droplet CEs derived from acLDL loading as it was blocked by chloroquine and lalistat (297). Inhibition of LAL or autophagy also significantly reduced efflux of cholesterol from cytosolic lipid droplets to the medium and Atg5-/- mice had impaired macrophage to feces RCT. In addition, a role for the LAL homologue LIPL-4 in autophagy has also been identified in C. elegans and increases life span in these organisms

(303). This indicates the importance of autophagy and LAL-mediated hydrolysis of lipid droplet

CEs for whole body cholesterol metabolism and longevity.

1.6.7 Human LAL deficiency: Wolman disease and cholesteryl ester storage disease

LAL deficiencies, although they contain a spectrum of clinical phenotypes, are generally divided two different diseases, termed Wolman disease (WD) and cholesteryl ester storage disease (CESD) based on the disease severity (304). Wolman disease is characterized by hepatosplenomegaly, adrenal calcification and severe malabsorption and cachexia leading to death before 1 year of life (241,304). In CESD, hepatomegaly is also common and although clinical outcome is highly variable and affected individuals can survive well beyond the 4th decade.

In Wolman disease, the complete inability to hydrolyze CE and TG leads to a buildup of these substrates in enterocytes in the small intestine, malabsorbtion and death by starvation within the first year of life (304-307). Cholesteryl ester storage disease is the name given to a less severe form of LAL deficiency where those affected can survive well into mid life. The clinical presentation of CESD is characterized by accumulations of primarily CE in the liver and spleen, leading to enlargement of the liver and sometimes the spleen, however adrenal calcification is rare (304). The most common manifestations include hepatomegaly and hyperlipidemia. Fatty liver may develop into hepatic fibrosis and cirrhosis in some cases (308), leading to acute or chronic liver failure (304). Hyperlipidemia is also a consistent finding in

CESD patients, which is commonly diagnosed as Type IIb (or Type IIa) familial combined hyperlipidemia with elevated plasma LDL and VLDL (309). Individuals with CESD also often have low plasma HDL cholesterol levels, below the 5th percentile and may be less than 20mg/dL

(~0.5 mmol/L) in some (310-312). In some cases, it was observed that the HDL2 to HDL3 ratio was reversed (10:1 instead of 1:10) (304,313). Hyperlipidemia is not a common finding in WD, although low HDL-C levels have been reported in some patients (314).

The pathology of WD results primarily from accumulations of CE and TG in the liver, spleen, intestine, adrenal glands, lymph nodes, and other tissues. In both WD and CESD, hepatomegaly is a common finding. The liver may be enlarged greater than two-fold the normal size and, upon examination post-mortem, has a yellow-orange colour and greasy appearance.

Neutral lipids such as TG and CE accumulate in the lysosomes of hepatocytes and Kupffer cells, and cholesterol/CE crystal clefts may be evident (304). The livers of WD patients have 2-10 fold higher than normal level of TG and massive CE accumulations of 5 -600-fold normal levels

(315), and 98% of the accumulation is in the form of CE (305). In CESD, CEs are similarly elevated up to 120-350 fold higher than normal, although CE accumulation is predominant with less increase in hepatic TGs as opposed to WD (304). In WD and CESD, Kupffer cells and macrophages in particular contain lipid droplets of TG and CE and free cholesterol (316).

Inflammation may involve infiltration of macrophages, lymphocytes and neutrophils into the periportal spaces and can lead to destruction of tissue causing fibrosis and cirrhosis (317).

1.6.7.1 The genetics and molecular biology of CESD and WD: The genotype-phenotype relationship

Both WD and CESD are autosomal recessive disorders that arise from mutations in the

LIPA gene at the chromosomal locus 10q23.2-q23.3. Evidence that WD and CESD arise from mutations in the same gene (LIPA) include: 1) low LAL activity in both WD and CESD cells

(265), 2) secreted LAL corrects both WD and CESD (253) and 3) co-culture of WD with CESD cells doesn’t correct enzyme activity (292).

A large number of unique disease-causing genetic polymorphisms have been identified along the length of the LIPA gene (304). Although distinction between mutations that lead to either CESD and WD is not always clear cut, in general, genetic mutations that cause WD are commonly insertions, deletions or point mutations that lead to either a premature stop codon or incorrect splicing leading to truncation of the protein. In all cases, WD-causing mutations result in loss or dysfunction of LAL protein, and an absence of LAL activity (304). The mutations most commonly seen in CESD patients are missense mutations that may be homozygous or compound heterozygous with other known CESD or WD polymorphisms, but that result in partial residual

LAL activity. Heterozygous individuals carrying only one mutated LIPA allele have approximately half normal LAL enzyme activity, but are phenotypically normal (313).

Mutations around the exon 8 splice junction (E8SJM) are common in both CESD and

WD, however, the position of the mutation is critical to the outcome: If the mutation is 3 bases before (-3) or 1 base after (+1) the junction site, the protein is not properly spliced and this leads to exon skipping and a truncated, non-functional protein (304,313). However, if the mutation is at the -1 position adjacent to the splice site, there is an allowance (presumably flexibility within the spliceosome) which means that about 5% of the time, mRNA is spliced normally, leaving some ~1-3% functional protein and 5-10% residual activity (246,304,313). This effect has also been observed in other genetic disorders involving splice junction mutations that allows about

3% properly spliced mRNA and some residual enzyme activity (247,318). This mutation, termed

E8SJM-1 (Exon 8 splice junction mutation at position -1 base from the spice site) is the result of a G>A transition at nucleotide 894 in the LAL gene (310) and is the most commonly detected mutation in CESD (304,313).

The reason for the primary accumulation of CE in CESD, and less TG buildup, is due to this small amount of residual enzyme activity in CESD combined with a preference by LAL for

TGs (249,272). Therefore, TGs (and other glycerolipids) are hydrolyzed more rapidly than CEs in CESD cells, leading to a greater accumulation of CE and less TG. This small amount of enzyme activity accounts for the difference in cellular pathology that can mean the difference in survival of CESD patients.

1.6.8 Animal models of LAL deficiency

Due to their ease of manipulation and short life cycle, rodents provide a good model to study the biological effects of LAL deficiency and investigate potential treatment options. A naturally-occurring deficiency of LAL was identified in a colony of Donryu rats with a phenotype similar to Wolman disease (319) resulting from a truncation mutation in the rat LAL

gene (320). Yoshida and Kuriyama first observed hepato(spleno)megaly, swollen enlarged lymph nodes, thickened yellow intestine, weight loss and cachexia in these rats, leading to death within 4 months of birth (319). Lipid droplets within vacuolated hepatocytes and Kupffer cells of the liver, splenic cells and the lamina propria of the small intestine were observed. The livers of

LAL deficient rats contained 13-fold higher CE levels, 3-fold higher cholesterol and 5-fold higher TG than unaffected rats and acidic hydrolysis of radiolabelled TG, CE or 4-MUO in vitro was only 10-20% of normal (321).

Similar to the rat, the murine LAL gene is 2.36 Kb, encoding 397 amino acids and has

79.4% homology to the human gene (322). The tissue and cell-specific expression of LAL mRNA and protein was first characterized in wild-type mice (322) and reflects the organs and tissues most affected in WD. Highest expression of LAL mRNA and protein was observed in the liver, spleen, brain, lung, kidney, duodenum and jejunum of the small intestine and thymus of adult mice. Lymphocytes and macrophages also had strong staining. However, most tissues had a basal level of LAL expression.

The outcome of LAL deficiency in mice has also been studied extensively. LAL deficient mice were generated by targeted disruption of the murine LIP-A gene, which results in an absence of mRNA, protein and complete ablation of LAL activity in all cells (323).

Heterozygotes (LAL+/-) possessed approximately 50-60% normal LAL enzyme activity.

Homozygous LAL knockout mice (LAL-/-) appear and behave normally at birth, with no overt symptoms and are reproductively viable. However, at ages 4-8 weeks, LAL-/- livers were enlarged (2 times the normal size) and yellow-orange in colour and the spleen was also enlarged with a yellowish tinge (323). By 8 months of age, there is dramatic hepato(spleno)megaly, with enlarged livers up to 6 times the normal size, the spleen being on average 4.4X larger than wild-

type (324). Analysis of tissue lipids revealed a massive accumulation of CE and TG that progressed with age. At 6-8 weeks old, the levels of CE and TG levels in the liver were already

32- and 35-fold higher than wild-type liver, respectively (323) and CE levels were increased to

42 times the normal level by 8 months (324). Histologic analysis showed that in 4-8 week old mice most of the hepatic lipid accumulations were detected inside large vacuolated hepatocytes

(323), however, with increasing age there is a shift towards storage in Kupffer cells (~40% by 5 months, ~85% by 8 months) (324). A proliferation assay using PCNA staining confirmed that these lipid-filled cells were proliferating resident Kupffer cells as opposed to monocyte-derived macrophages from circulation (324). The inner cortex of the adrenal gland was filled with lipid and cholesterol crystals, but with no evidence of calcification and the small intestine was also engulfed with lipid, giving it a yellowish, creamy colour. The curious observation was also made that LAL knockout mice have a progressive loss of white and brown adipose tissue with increasing age (324).

As in human WD, no differences in plasma CE or TG levels were observed in mice aged

4-8 weeks (323). However, at 8 months, LAL-/- mice had increases in LDL and VLDL cholesterol and lower than normal HDL cholesterol when lipoproteins were separated by fast protein liquid chromatography (FPLC) or agarose gel electrophoresis, similar to the lipoprotein profiles observed in many CESD patients (317). There is also evidence that HDL particles of

LAL-/- mice may also be smaller than LAL+/+ mice (HDL peak on FPLC is shifted to the right and α-migrating band was lower in LAL-/- mouse plasma) (324). Interestingly, LAL knockout mice also develop a diabetic phenotype, having increased non-esterified fatty acids (NEFA) in plasma and insulin resistance – plasma glucose levels were >6-fold higher than wild-type mice

after glucose challenge. (324). Combined with the absence of subcutaneous adipose tissue, this suggested a syndrome comparable to lipoatrophic diabetes.

The pathological phenotype in LAL deficient mice was ameliorated either by supplementation with purified recombinant human LAL enzyme produced in the yeast strain

Pitchia pastoris (phLAL) (325), or by overexpression of LAL using an adenovirus-mediated delivery system (Ad-hLAL) (326). Restoration of LAL activity in LAL-/- mice with either phLAL or Ad-hLAL relieved TG and CE storage in the liver and other tissues, and decreased the size of the liver and spleen over time. Systemic overexpression of Ad-hLAL restored adipose tissue, even though no localized staining was observed in the skin (326). Although plasma

NEFAs were increased 162% over wild-type levels in LAL-/- mice, levels only increased by 33% in knockout mice supplemented with phLAL (325). Plasma CE and TG levels were also reduced in LAL-/- mice injected with Adv-hLAL compared to saline-injected controls and after 20 days post-injection, mice had a reduction in plasma LDL and IDL cholesterol and increased levels of

HDL cholesterol (326). These findings thus illuminated the potential for enzyme replacement therapy in the treatment of human WD and CESD.

1.6.9 LAL and atherosclerosis

Although the role of LAL in atherosclerosis is not yet defined, there is strong evidence to suggest that LAL plays an important role in the process of atherogenesis. In addition to the apparent hyperlipidemia observed, many cases of premature atherosclerosis have been identified in CESD patients (317,327,328). In one case study, severe lesions in the aorta and femoral arteries were identified in a 51 year old man with CESD (327). Many other similar cases of accelerated atherosclerosis have been described among CESD patients in the literature (329-

332), indicating a potential relationship between LAL deficiency and atherosclerosis. In support

of this, Coates and colleagues (333) discovered low LAL activity in mononuclear leukocytes from non-LAL deficient patients with atherosclerosis.. Compared to age-matched controls, 18% of patients with diagnosed atherosclerosis had LAL activity levels below the 5th percentile, most often in patients with premature atherosclerosis. For example, the lowest LAL enzyme activity was observed in a patient who died of a myocardial infarction at age 50 (333). In another study,

LAL activity was 50% of normal in patients with cerebrovascular disease (334). Hagemenas and colleagues also observed reduced LAL activity levels in patients with hypercholesterolemia

(335), although this differed from Coates’ findings where LAL activity did not correlate with plasma cholesterol levels (333).

A similar relationship between LAL deficiency and atherosclerosis has also been identified in mouse models of the disease. When LAL is knocked out in mice with an ApoE- deficient background (LAL/ApoE double knockout), these mice have much more severe atherosclerosis and more rapid progression than ApoE single knockout mice alone (336,337). In addition, LDLR knockout mice made deficient for LAL (LAL/LDLR double knockout mice) have such severe atherosclerosis that they die within 5 days on a high fat/high cholesterol diet

(336,337). However, when LDLR-/- mice are supplemented with phLAL, which has the type of oligosaccharide glycosylation patterns that target it specifically to macrophage mannose-6- phosphate receptors, atherosclerosis was reduced (336). When mice were injected with phLAL daily for 30 days before lesions had started to develop (after only 1 month on a high fat/high cholesterol diet), the phLAL treated LDLR-/- mice had an absence of lesions compared to non- treated mice, indicating that early lesion development had been prevented. However, in a separate experiment where phLAL treatment was started after established lesions had developed

(after 2 months on a high fat/high cholesterol diet), the lesions either didn’t progress any further,

or showed regression in size (i.e. decreased macrophage content, reduced necrotic core area) compared to untreated mice (336). Another study where LAL was overexpressed in transgenic mice found no difference in plasma or liver lipid metabolism or atherosclerosis after high fat feeding (338). The significance of this result is unclear however, since transgenic mice were on a non-atherogenic background and mice are not normally prone to diet-induced atherosclerosis.

Taken together, studies in animal models of atherosclerosis indicate that LAL-deficiency likely plays a role in atherogenesis that can be remediated by macrophage-specific replenishment of

LAL enzyme activity.

There is also in vivo evidence that LAL may be involved in atherogenesis since the enzyme has been observed to be present in human and animal atherosclerotic lesions. Rabbits can spontaneously develop arterial atherosclerosis when fed a diet that is high in cholesterol.

Cellular CE and UC accumulate in the lysosomes of atherosclerotic aortic cells in cholesterol fed rabbits (339-341) and human aortic smooth muscle cells (342). Indeed, LAL enzyme activity was found to be 2.5 times higher than normal in aorta of cholesterol-fed rabbits in one study

(343) and was 3.5-fold higher in atheromatous arterial cells in another (344). LAL activity has also been detected in human aortic tissue (261). Davis et al. (345) also found LAL activity in human and rabbit atherosclerotic lesions. LAL activity was associated with macrophages in cholesterol-fed rabbit arterial lesions and macrophages within subendothelial fibrous lesions in advanced atherosclerotic plaques in human patient tissues. The LAL activity observed correlated with the amount of CE accumulation in homogenates of rabbit aortic tissue, suggesting that increased LAL activity might be implicated in foam cell formation (345). Alternatively, Takano and Imanaka (346) put forth the alternative hypothesis that an insufficiency of LAL activity in arterial cells is the cause of CE accumulation in atherosclerosis. They suggest that the increased

LAL activity in rabbit atherosclerotic lesions is actually lower than would be expected as compared to other lysosomal enzymes that are dramatically increased in atherosclerosis (such as acid phosphatase, N-acetyl-β-glucosaminidase, β-glucuronidase, β-galactosidase), whereas the relative increase in LAL activity was low. In fact, when lysosomes were specifically isolated from arterial cells, no LAL activity was detected (346), indicating that intracellular, lysosomal

LAL might be insufficient despite increased overall activity in the lesion. The suggested mechanism involves lysosomal membrane destabilization caused by accumulating CE in lysosomes (and reduced UC that stabilizes lysosomal membranes, (347)), that then prevents the fusion of lysosomes with cargo-containing vesicles, thereby not allowing LAL to reach its substrates for hydrolysis (346). Although LAL activity has been associated with atherosclerotic lesions in these studies, it was unclear from these studies whether the activity was associated with cells or the extracellular environment.

There is compelling evidence to suggest that LAL may be secreted from macrophage cells in the artery wall and may enzymatically modify apoB-containing lipoproteins retained in the extracellular matrix, contributing to the atherogenic process. It is known that lipid droplets in atherosclerotic lesions have unusually high concentrations of free cholesterol (348-351). Bahkdi et al. (352) observed that enzymatically modified LDL (E-LDL), that had been treated with trypsin and cholesteryl esterase, when applied to human macrophages in culture was rapidly taken up (much faster than acLDL) and had double the increase in cholesterol esterification by

ACAT. They also showed that most of the E-LDL was taken up via oxidized LDL (oxLDL) receptors and out-competed oxLDL particles for uptake. Prolonged cell-surface contact of aggregated LDL (aggLDL) retained in the extracellular matrix with macrophages in the lesion was observed by Buton and colleagues (353). They found that extracellular aggLDL maintains

extended cell-surface contact with macrophages and becomes enveloped inside invaginations in the plasma membrane. AggLDL CE hydrolysis was 3-7x higher than protein, and the enzymatically-modified lipoproteins did not require the LDL receptor or scavenger receptors for uptake into macrophages. This extracellular hydrolysis was found to be mediated by LAL enzyme, since chloroquine treatment or use of LAL knockout mouse macrophages blocked matrix-retained aggLDL CE hydrolysis (353). The work of Hakala et al. (354) revealed that LAL protein was present extracellularly in human lesions and that the enzyme was released from human macrophages and could hydrolyze LDL in vitro. Histological staining of normal and atherosclerotic human coronary arteries showed that LAL was co-localized with macrophages in the intima, but was not present in normal arteries. However, LAL proteins were mostly present extracellularly within the lesion and staining didn’t overlap with the lysosomal marker LAMP-1 in macrophages. Lysosomal enzyme secretion from macrophages was induced by zymosan A opsonization (zop treatment) and the resulting medium was found to contain large amounts of

LAL enzyme in both the 41 and 49kDa forms. When conditioned medium from secretion- induced macrophages was applied to LDL in vitro, LDL-CE and TG hydrolysis resulted

(creating hydrolase-modified LDL particles, H-LDL), and this also induced fusion of the modified LDL particles (354).

Oxidized LDL has also been shown to inhibit LAL activity in normal cells. Incubation of macrophages with oxLDL, but not acLDL, causes lysosomal CE accumulation (301). Prolonged oxLDL incubation impairs acidification of the lysosomal compartment due to inhibition of the lysosomal V-ATPase proton pump (299). As a result, normal upregulation of ABCA1 in macrophages (i.e. with acLDL incubation) and apoA-I dependent cholesterol efflux is blocked and oxLDL-derived cholesterol is resistant to efflux (302,355). This is relevant in the context of

native atherosclerosis, whereby it may provide a potential mechanism whereby LAL activity may be impaired within macrophages in the artery wall, consequentially leading to lysosomal CE accumulation and contributing to foam cell formation during atherogenesis.

Recent population-based genome-wide association studies (GWAS) have implicated genetic variants of the LIPA gene with risk of coronary artery disease (CAD). A replicated meta- analysis GWAS study of CAD including 21,408 cases and 19,185 controls identified 5 new loci associated with increased CAD incidence including a single nucleotide polymorphisms (SNPs) within the LIPA gene (termed rs1412444) with an odds ratio of 1.09 (P=2.76x10-13) (356). This and a second SNP (rs2246833) within intronic sequences of the LIPA gene were also identified in a second study of CAD risk that included 21,428 cases and 38,361 controls (357). This new

LIPA polymorphism increased susceptibility to CAD with an odds ratio of 1.1 (P=3.7x 10-8). In both studies, SNPs were associated low plasma HDL cholesterol, and impaired endothelial function (as measured by flow-mediated vasodilatation), but not with LDL cholesterol or TG levels in plasma. Unexpectedly, these LIPA variants were strongly associated with increased

LAL mRNA expression in plasma monocytes and in the liver (356,357). This suggested that the mechanism by which these SNPs affect CAD risk is not necessarily by altering hepatic CE and

TG homeostasis and LDL uptake, but must be via some alternate mechanism. It is possible that increased LAL expression might increase UC levels (possibly by increased secretion of LAL and enzymatic modification of retained apoB-containing lipoproteins as discussed in the previous section) during early lesion development, which negatively affects endothelial function during atherogenesis.

Taken together, these studies in mouse and rabbit models of atherosclerosis as well as human data from CESD or WD patients or those with CAD strongly suggest the involvement of

LAL in the development of atherosclerosis and even link genetic variants in the LIPA gene to increased risk of cardiovascular disease. However, what is unclear is whether it is a relative deficiency of LAL or increased expression of LAL that increases atherosclerosis. Further research is clearly needed to understand this complex relationship.

1.7 Rationale, hypothesis and specific aims:

The overarching hypothesis of this dissertation is that the flux of unesterified cholesterol out of the lysosomes from LAL-mediated hydrolysis of LDL cholesteryl esters is a key regulator of cellular ABCA1 expression, HDL formation and reverse cholesterol transport in the body. In order to test this hypothesis the following specific aims were employed: 1) To elucidate the role of LAL in regulation of ABCA1 expression, cholesterol and lipid efflux and HDL particle formation using LAL-deficient human CESD patient-derived skin fibroblasts; 2) To investigate the effects of complete LAL deficiency in macrophage cells on ABCA1 regulation and cholesterol efflux and to determine the impact of macrophage LAL deficiency on macrophage

RCT in vivo.

Aim 1: To elucidate the role of LAL in regulation of ABCA1 expression, cholesterol and lipid efflux and HDL particle formation using LAL-deficient human CESD patient-derived skin fibroblasts

Low HDL cholesterol has been identified as an independent risk factor for cardiovascular disease (358). The ABCA1 mitigates the accumulation of cholesterol in the atherosclerotic lesion as it performs the rate-limiting step in the RCT pathway by removing intracellular cholesterol and phospholipids to apolipoprotein acceptors during initial HDL particle formation

(83,188,359,360). Previous investigations in our lab had shown for the first time that ABCA1 regulation and cholesterol efflux are impaired and that plasma HDL-C levels are low in the

lysosomal cholesterol storage disease Niemann Pick disease type C (13), a neurodegenerative disease biochemically characterized by intracellular accumulation of unesterified cholesterol, specifically within late-endosomes/lysosomes due to mutations in NPC proteins (236), suggesting that the intracellular pool of unesterified cholesterol derived from the lysosomal compartment was the most critical for ABCA1 regulation.

LAL catalyzes the hydrolysis of LDL-derived triacylglycerols (TG) and cholesteryl esters

(CE) specifically in lysosomes. Due to mutations in LAL, enzyme activity in CESD is reduced to approximately 5% of normal (237), resulting in massive accumulation of cholesteryl esters particularly within tissues such as the liver, spleen and adrenal glands (317). The slowed release of UC out of lysosomes due to impaired LAL activity in CESD fibroblasts results in dysregulation of microsomal cholesterol homeostatic mechanisms downstream (237,292). The first aim is focused on cholesteryl ester storage disease (CESD) as a model to understand the impact of impaired lysosomal hydrolysis of LDL-derived CE (and thus, impaired release of UC from lysosomes) on the regulation and function of the ABCA1 pathway. We hypothesized that reduced flux of cholesterol out of late endosomes/lysosomes, due to impaired lysosomal

LDL-CE hydrolysis in CESD primary skin fibroblasts, leads to dysregulation of ABCA1, cholesterol efflux and impaired HDL formation.

Aim 2: To investigate the effects of complete LAL deficiency in macrophage cells on ABCA1 regulation and cholesterol efflux and to determine the impact of macrophage LAL deficiency on macrophage RCT in vivo.

The second aim was to investigate the impacts of LAL deficiency in macrophages on

ABCA1 regulation and to assess the impact of LAL deficiency on RCT from macrophages in vivo. During the initial stages of atherosclerosis, macrophages in the artery wall accumulate

cholesterol and become foam cells. ABCA1 plays a pivotal role in removal of excess cholesterol from macrophage cells, while forming HDL particles in order to promote RCT and prevent atherosclerotic lesion development (148). However, the contribution of different intracellular pools of cholesterol towards regulation of ABCA1 is poorly understood.

It is clear that a major factor in the pathology associated with LAL deficiency, both in humans and mice, involves the massive accumulations of cholesteryl esters in the lysosomes of macrophages in tissues such as the liver, spleen, adrenals and small intestine (317,361). In both

CESD and LAL-deficient mice, hepatomegaly results primarily from lipid accumulation in foamy Kupffer cells, macrophage-like cells in the liver and foamy-macrophage infiltration into other tissues such as the intestine, spleen and lungs is a prominent feature (361,362). LAL deficiency has been shown to enhance atherogenesis in mouse models (337,363), however, supplementation of LDL receptor-deficient mice with macrophage-specific recombinant LAL prevents early lesion formation and drastically reduced the size of pre-existing advanced lesions

(336).

We hypothesized that ABCA1 expression and cellular cholesterol efflux are impaired in

LAL-deficient macrophages, leading ultimately to dysregulation of reverse cholesterol transport in vivo.

CHAPTER 2: LAL DEFICIENCY IMPAIRS REGULATION OF ABCA1

AND FORMATION OF HDL IN CHOLESTERYL ESTER STORAGE

DISEASE

2.1 Summary

ATP-binding cassette transporter A1 (ABCA1) mediates the rate-limiting step in high- density lipoprotein (HDL) particle formation, and its’ expression is regulated primarily by oxysterol dependent activation of the nuclear receptor liver X receptor (LXR). We previously reported that ABCA1 expression and HDL formation are impaired in the lysosomal cholesterol storage disorder Niemann Pick disease type C (NPC), and that plasma HDL-C is low in the majority of NPC patients. Here we show that ABCA1 regulation and activity is also impaired in cholesteryl ester storage disease (CESD), caused by mutations in the LIP-A gene that result in less than 5% of normal lysosomal acid lipase (LAL) activity. Fibroblasts from patients with

CESD showed impaired upregulation of ABCA1 in response to LDL loading, reduced phospholipid and cholesterol efflux to apolipoprotein A-I, and reduced α-HDL particle formation. Treatment of normal fibroblasts with chloroquine to inhibit LAL activity produced the same phenotype of impaired ABCA1 expression and activity as seen in CESD cells. LXR agonist treatment of CESD cells corrected ABCA1 expression, but failed to correct LDL cholesteryl ester hydrolysis and cholesterol efflux to apoA-I. LDL-induced production of 27- hydroxycholesterol was reduced in CESD compared to normal fibroblasts. Treatment with conditioned medium containing LAL from normal fibroblasts rescued ABCA1 expression, apoA-I-mediated cholesterol efflux, HDL particle formation and production of 27- hydroxycholesterol by CESD cells. These results provide further evidence that the rate of 53

release of cholesterol from late endosomes/lysosomes is a critical regulator of ABCA1 expression and activity, and an explanation for the hypoalphalipoproteinemia seen in CESD patients.

2.2 Introduction

High density lipoproteins (HDL) are thought to protect against atherosclerosis for a variety of reasons, including by stimulating reverse cholesterol transport and anti-inflammatory effects (364). The rate-limiting step in HDL particle formation is the lipidation of apolipoprotein

A-I (apoA-I) and other HDL apolipoproteins by the membrane lipid transporter ATP-binding cassette transporter A1 (ABCA1) (7). Expression of ABCA1 is increased at times of increased cell cholesterol content, through oxysterol-dependent activation of the nuclear receptor liver X receptor (LXR) on the promoter region of ABCA1 (8,179). However, the roles of different intracellular sources of cholesterol, including de novo synthesis in the endoplasmic reticulum, late endosomes/lysosomes, and the plasma membrane, that regulate oxysterol production and

ABCA1 expression are poorly understood.

We have previously demonstrated that regulation of ABCA1 is impaired in the lysosomal cholesterol storage disorder Niemann-Pick disease type C (NPC), leading to reduced HDL particle formation by human NPC disease fibroblasts (365). The defect in the lipidation of apoA-I was overcome by addition of an exogenous non-oxysterol ligand for LXR to upregulate

ABCA1, suggesting ABCA1 might be able to mobilize cholesterol from late endosomes/lysosomes even in the presence of NPC1 deficiency (239). We also determined that plasma HDL-C was low in 17/21 NPC disease patients studied (365), further confirmed in a recent report of a larger cohort of NPC1 subjects (366). Low plasma HDL-C in NPC1 disease patients occurs independent of their plasma triglyceride levels (366), further suggesting that

impaired ABCA1 regulation as a consequence of reduced flux of cholesterol out of lysosomes is the cause of the hypoalphalipoproteinemia in this disease.

In the current study we have extended these findings to another lysosomal cholesterol storage disorder, cholesteryl ester storage disease (CESD), caused by deficiency of lysosomal acid lipase (LAL) activity (317). CESD, and its’ more severe form Wolman disease, are caused by autosomal recessive mutations in the LIP-A gene, which encodes for LAL, the sole enzyme responsible for acidic hydrolysis of cholesteryl esters and triglycerides delivered from lipoproteins to lysosomes (237,367). In contrast to Wolman disease, in which complete absence of LAL activity results in death usually in the first 6 months of life, splice mutations of LIP-A that result in the 5-10% residual LAL activity in CESD allows patients to survive usually to adulthood. In addition to hepatosplenomegaly, individuals with CESD exhibit premature atherosclerosis and plasma HDL-C levels that are approximately half normal levels (317). The reason for low HDL-C in CESD has not previously been known. Here we describe impaired regulation of ABCA1 in human CESD fibroblasts, reduced lipid efflux to apoA-I and HDL particle formation, induction of the same defects by inhibition of LAL activity in normal fibroblasts, and correction of ABCA1 expression and HDL particle formation in CESD cells treated with LAL-containing conditioned medium from normal fibroblasts. We also demonstrate impaired oxysterol generation in CESD fibroblasts, as previously shown in NPC1-/- and NPC2-/- fibroblasts (238), and correction of oxysterol formation in CESD cells following incubation with

LAL-containing conditioned medium. Together with our findings in NPC disease, these results provide a likely reason for the low HDL-C in CESD – impaired regulation of ABCA1, and further demonstrate the critical importance of the rate of flux of cholesterol out of lysosomes in the regulation of ABCA1 expression and HDL particle formation.

2.3 Materials and methods

2.3.1 Materials

Cholesteryl oleate, unesterified cholesterol, 1-monooleoyl-rac-glycerol, 1,2-distearoyl- rac-glycerol, triolein, oleic acid, 4-methylumbelliferyl oleate and lentivirus containing shRNA constructs were purchased from Sigma-Aldrich. Phosphatidylcholine, sphingomyelin, LXR agonist TO-901317, chloroquine diphosphate, and fatty acid-free bovine serum albumin (BSA) were purchased from Sigma-Aldrich. Purified oxysterols were purchased from Avanti Polar

Lipids. [Cholesteryl -1, 2, 6, 7-3H] cholesteryl linoleate (60-100 Ci/mmol) was purchased from

American Radiolabeled Chemicals, and [methyl - 3H] choline chloride (66.7 Ci/mmol) from

PerkinElmer. Dulbecco’s modified Eagle’s medium (DMEM) was purchased from BioWhittaker and fetal bovine serum and lipoprotein-deficient serum (LPDS) from Cocalico Biologicals, Inc.

Nitrocellulose membranes, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-

PAGE) reagents, and pre-stained protein molecular mass markers were purchased from Bio-Rad.

PE-SIL G plastic backed flexible plates used for thin-layer chromatography analysis were from

Whatman. Purified recombinant human LAL (rhLAL) was from Shire Human Genetic

Therapies (Lexington, MA).

2.3.2 Preparation of lipoproteins and apolipoprotein A-1

LDL was isolated from pooled plasma from healthy fasting donors by density gradient ultracentrifugation (368). Radiolabeling of LDL with [1,2,6,7-3H]-cholesteryl linoleate was performed as described (369) to a specific activity of 16-44 cpm/ng of LDL protein. Human apo

A-I was purified from human plasma using Q-Sepharose Fast Flow chromatography as previously described (239).

2.3.3 Cell culture

Normal human skin fibroblasts were purchased from the American Type Culture

Collection (Manassas, VA). CESD human skin fibroblasts were obtained via skin biopsy from an adult patient in the Cardiovascular Risk Reduction Clinic, University of Alberta Hospital,

Edmonton, AB, following informed consent (CESD1). Genetic sequencing of CESD1 cells was performed by the laboratory of Dr. Robert Hegele, indicating a heterozygous splice mutation

E8SJM (∆254-277, 934G>A or c.894G>A), which leads to a G-to-A transition at the -1 position of exon 8 of LIPA. Although no previously described LAL mutations could be identified for the second allele, a second CESD mutation is assumed as the patient exhibits a classic histologic phenotype of CESD based on prior liver biopsy. The second CESD human skin fibroblast cell line from an adult patient (CESD2) was generously provided by Dr. John Parks, Wake Forest

University School of Medicine). This patient is a compound heterozygote for the common

E8SJM mutation (c.894G>A), which leads to excision of exon 8, and a CT deletion in exon 4, causing a frame shift and termination signal four codons downstream at codon 137 (c.397-

398delCT; FS 137X) (313).

All cells were grown in monolayers and were used between the 5th and 25th passage. Cell lines were maintained in a humidified incubator at 37ºC and 5% CO2 in DMEM containing 10% fetal bovine serum supplemented with 1% penicillin-streptomycin (Invitrogen) (growth medium). Cells were plated at 40,000/35-mm well or 120,000 cells/60-mm dish and grown to approximately 60% confluence in growth medium. Cells were subsequently grown to 100% confluence in DMEM containing 10% LPDS. Where indicated, cells were then incubated with

DMEM containing 50 μg/ml LDL for 24 h.

2.3.4 Conditioned medium experiments

For conditioned medium experiments, cells grown to confluence as above were incubated an additional 24 h in DMEM containing 5% LPDS. Conditioned medium was then removed from cells, centrifuged to pellet any cells and added back to the indicated cell monolayers for a further 24 h prior to incubation with 50 μg/ml LDL for 24 h, as previously described (292).

2.3.5 Recombinant human LAL treatment

During optimization experiments, a stock solution of 2.9 mg/ml recombinant human LAL in 20mM citrate (pH 5.3) was diluted to final concentrations of 0.15, 0.3, 0.6, 1.2, 2.4 or 6.0

μg/ml in DMEM and added to CD1 and CD2 cell monolayers for 24 hours prior to LDL loading.

Further experiments were performed using a final concentration of 1.2 μg/ml rhLAL.

2.3.6 Chloroquine treatment

Where indicated, cells were pre-treated for 1 h prior to LDL loading with 50 μM chloroquine diphosphate by addition of 5 μl/ml of a 10mM stock solution, made up in DMEM with pH adjusted to 7, directly to the medium and then the same concentration of chloroquine was added in the presence or absence of 50μg/ml LDL for an additional 24 h as previously described (287).

2.3.7 Lentivirus-mediated suppression of LAL

Expression of LAL was suppressed by RNAi. Cells were transduced with lentivirus which expresses each of 5 different short hairpin RNA (shRNA) constructs (Sigma) targeting

LAL mRNA (shLAL1-5), or a non-targeting, scrambled control (shNT) including a GFP tag.

Prior to experiments, GFP fluorescence was detected by broad-field fluorescence microscopy in order to optimize the multiplicity of infection (MOI = #viruses/cell) and estimate the efficiency of infection and number of viruses needed for optimal expression. Briefly, fibroblasts were

grown to approximately 80% confluence in 6 well plates grown in DMEM containing 10% FBS.

Cells were first treated with 8µg/ml of hexadimethine bromide and then infected with the volume of lentivirus stock calculated to reach an MOI of 5 for each of the 5 shRNA constructs.

2.3.8 Cholesterol and phospholipid efflux

Radiolabeling of LDL-derived cellular cholesterol pools was achieved by incubating cells for 24 h with 50 μg/ml [3H]-cholesteryl linoleate-labeled LDL. Cell choline-containing phospholipids were labeled in the presence of 50 μg/ml LDL by addition of 5 μCi/ml [3H]- choline chloride for 24 h (239). Cells were washed two times with PBS and then incubated in

DMEM containing 10 μg/ml apoA-I for 24 hours or the indicated time points. Efflux media were collected and centrifuged at 3,000 rpm for 10 min at 4ºC to remove cell debris. [3H]-cholesterol in the medium was then measured directly for cells labeled with [3H]-cholesteryl linoleate- labeled LDL by liquid scintillation counting. For phospholipid efflux, lipid extraction of medium was performed prior to separation of lipids by thin layer chromatography (370). Cell monolayers were kept on ice and rinsed on ice two times with cold PBS containing 1 mg/ml BSA, two times with cold PBS and stored at -20°C until lipid extraction. Cellular lipids were extracted and separated by thin layer chromatography and assayed for radioactivity as previously described

(371). For LDL-derived cholesterol efflux assays, the radioactivity of cholesteryl esters and unesterified cholesterol spots was measured using unlabeled carrier lipids to identify spots. For phospholipid assays, radiolabeled sphingomyelin and phosphatidylcholine spots were measured.

Protein content of cell monolayers was determined by standard Lowry assay using BSA as standard (372).

2.3.9 Cholesterol mass assay

Cells were grown in 6-well plates and loaded with LDL as described above. Following

LDL incubation, cells were washed twice with PBS/1mg/ml FAFA and incubated 24 h in the presence of 10 μg/ml apoA-I. The media fraction was collected and cells were scraped in PBS, collected and homogenized by sonication. Phospholipids from media or cell homogenates were digested using phospholipase C to remove the polar head groups, and samples were vortexed for

2 h at 30ºC. Total lipids were extracted by organic phase extraction with tridecanoin as the internal standard. Samples were derivatized with Sylon BFT (Supelco) and sterols were separated and analyzed by gas chromatography (Agilent Technologies, 6890 Series equipped with a Zebron capillary column (ZB-5, 15 m x 0.32 mm x 0.25 μm) and connected to a flame ionization detector (Zebron, Palo Alto, CA) (373). The separation of cholesterol and cholesteryl esters was identified and their mass calculated using the retention times and mass of the internal standard (239).

2.3.10 Quantitative real-time PCR analysis of ABCA1 mRNA

Total RNA was isolated from fibroblast monolayers using Trizol Reagent extraction

(Invitrogen) and cDNA synthesis was performed as previously described (365). ABCA1 DNA amplification was performed by initial denaturation at 95 ºC for 3 mins. Thereafter, denaturing was at 95 ºC for 20 seconds, annealing at 58 ºC for 20 seconds, and extension at 72 ºC for 40 seconds for at total of 40 cycles (239). SYBR Green (Quanta Biosciences) was used to detect

PCR products in real-time using a Realplex2 Mastercycler thermocycler (Eppendorf). The human housekeeping gene cyclophilin cDNA was amplified using the same conditions. ABCA1 mRNA levels were calculated using the comparative CT method relative to cyclophilin. The following primers were used: human ABCA1, 5’-GAC ATC CTG AAG CCA ATC CTG

(forward), 5’-CCT TGT GGC TGG AGT GTC AGG T (reverse); human cyclophilin, 5’- ACC

CAA AGG GAA CTG CAG CGA GAG C (forward), 5’-CCG CGT CTC CTT TGA GCT GTT

TGC AG (reverse).

2.3.11 Western blot analysis of ABCA1 and LAL

Cells in 60-mm dishes were harvested in 300 μL of lysis buffer containing 20 mM Tris, 5 mM EDTA, 5 mM EGTA, 0.5% Maltoside and 1X Complete Mini Protease Inhibitor (Roche) and homogenized using a glass mortar and Teflon pestle. Samples were then centrifuged at 2500 rpm for 10 mins at 4ºC to pellet nucleic acids. The sample protein concentration was quantified using Biorad reagent (Biorad). Samples to be used for human LAL (hLAL) analysis were boiled for 5 min at 100ºC. Samples used for ABCA1 analysis were not boiled, according to the antibody manufacturer’s guidelines (Calbiochem). Fifteen to thirty micrograms of proteins were separated by a 5% to 15% gradient SDS-PAGE under reducing conditions and transferred to nitrocellulose membrane. Immunoblotting was performed according to standard protocols using polyclonal rabbit anti-human ABCA1 antibody (1:1000 dilution) (Calbiochem), a polyclonal rabbit anti- hLAL antibody (1:2000 dilution, Seven Hills Bioreagents) and a goat anti-rabbit IgG horseradish peroxidase-conjugated secondary antibody (1:10,000 dilution, Sigma). Chemiluminescence was detected using Super Signal West Femto Maximum Sensitivity Substrate (Pierce Protein

Research Products) and the Chemigenius BioImaging System (Syngene).

2.3.12 Two-dimensional gel electrophoresis of HDL particles

In order to characterize apoA-I containing particles generated by normal and CESD fibroblasts, cell monolayers in 35-mm wells were treated as described above for conditioned medium experiments with the exception of the last hour of incubation with apoA-I, when 1 mg/ml FAFA was added to the medium to stabilize HDL particles. Fibroblast-conditioned media

were then centrifuged at 2000 X g for 5 min at 4 ºC to pellet cells and the supernatant concentrated 10-fold by ultracentrifugation (Amicon Ultra-4, MWCO 10,000, Millipore). The concentrated media were stored at -80°C. HDL particles in each of the concentrated apoA-I- conditioned media were separated according to our previously described method (239), with some modifications. Briefly, 25 μl of each sample was separated in the first dimension by 0.75% agarose gel in 50 mM barbital buffer, pH 8.6, at 200 V for 5 h at 6°C. Second dimension electrophoresis was performed with a 5-23% polyacrylamide concave gradient gel at 125 V for

24 h at 6ºC in 0.025 M Tris, 0.192 M glycine buffer, pH 8.3. High molecular weight protein standards (7.1-17.0 nm, Amersham Biosciences) were run on each gel. After electrophoresis, samples were transferred (35 V, 24 h, 4°C) onto nitrocellulose membranes (Trans-blot, Bio-

Rad), stained with Ponceau S to locate the standard proteins and blocked for 1 h in Tris-buffered saline containing 1% Tween 20 (TBS-T) and 10% skim milk at room temperature. ApoA-I- containing particles were detected by immunoblotting with rabbit polyclonal anti-human apoA-I antibody (Calbiochem) and goat-anti-rabbit horseradish conjugated polyclonal secondary antibody (Sigma). Chemiluminescence was detected using chemiluminescent substrate (Pierce).

2.3.13 Statistics

Results were analyzed using Graph-Pad Prism version 5.0 and are presented as the mean

± the standard deviation. Significant differences between experimental groups were determined using the Student’s t test, with the exception of Figures 2.1D, and 2.5C,D,E where two-way analysis of variance was performed and differences between experimental groups were determined using a Bonferroni post-hoc comparison.

2.4 Results

2.4.1 Reduced LDL-induced expression of ABCA1 in CESD fibroblasts

We previously reported impaired regulation of ABCA1 in Niemann Pick C1 (NPC1)- deficient human fibroblasts (365), where the rate of release of unesterified cholesterol out of the late endosome/lysosome compartment is slowed (374,375) and oxysterol generation is reduced

(238). The slowed hydrolysis of LDL and other lipoprotein cholesteryl esters in cholesteryl ester storage disease (CESD), resulting from mutations in lysosomal acid lipase (LAL), also results in reduced cholesterol release from this compartment and impaired cholesterol regulatory responses

(237). We therefore hypothesized this would lead to impaired regulation of ABCA1 expression and activity in CESD cells. Impaired LAL activity was confirmed in skin fibroblasts obtained from two unrelated human CESD patients (CD1, CD2) using an in vitro 4-methylumbelliferyl oleate fluorescence assay (249,258), with CD1 showing 3.86 ± 0.86% and CD2 2.17 ± 0.85% the

LAL activity of normal (NL1) fibroblasts (Supplementary Figure 2.9). To determine ABCA1 expression, normal and CESD fibroblasts were grown the last 40% to confluence in LPDS and then incubated in the absence or presence of 50 μg/ml LDL for 24 hours. Quantitative real-time-

PCR analysis of cellular RNA extracts revealed the fold increase in ABCA1 mRNA expression of CESD fibroblasts in response to LDL loading was reduced to approximately ¼ that in two normal fibroblast cell lines (Figure 2.1A). Basal and LDL-stimulated expression of ABCG1 mRNA were also significantly reduced in both CESD cell lines compared to normal fibroblasts

(Figure 2.1B). In the absence of LDL loading, levels were consistently so low as to be undetectable from CESD2 fibroblasts; LDL loading failed to upregulate ABCG1 mRNA expression to normal levels in either cell line (Figure 2.1B). The increase in ABCA1 protein levels following LDL loading was also blunted in CESD compared to normal fibroblasts

(Figures 2.1C and 2.1D). These results suggest that, as previously seen in human NPC1 disease fibroblasts (239,365), reduced flux of cholesterol out of the late endosome/lysosome compartment in CESD cells also results in impaired transcriptional regulation of ABCA1 and

ABCG1.

A B

* * *

* * nd

C D NL1 NL2 CD1 CD2

LDL: - + - + - + - +

ABCA1 * * PDI

Figure 2.1 Reduced expression of ABCA1 in response to LDL loading in CESD fibroblasts.

Normal (NL1, NL2) and CESD (CD1, CD2) fibroblasts were grown to confluence in DMEM containing 5% LPDS and then incubated in the presence (+) or absence (-) of DMEM containing 50 μg/ml LDL for 24 h. A,B. RNA extracts were analyzed by quantitative real-time PCR using primers targeting human ABCA1, ABCG1 and cyclophilin. Results are the mean fold increase in ABCA1 mRNA with LDL loading corrected for cyclophilin expression ± SD of three replicates, and are representative of 3 experiments with similar results. C. Cells lysates were analyzed by SDS PAGE and western blot using poly-clonal antibodies for human ABCA1 and protein disulfide isomerase (PDI) loading control. D. Western blots were analyzed by densitometry and results expressed as the mean of ABCA1:PDI ratio ± SD for 4 experiments with NL1 –LDL sample ratio set as 1. *, values less than

NL1 or NL2, p < 0.01.

2.4.2 Reduced phospholipid and LDL-derived cholesterol efflux to apoA-I from CESD fibroblasts

Efflux of cellular phospholipids and cholesterol to HDL apolipoproteins to form viable

HDL particles is critically dependent on ABCA1 activity, and is not substituted by any other known cellular mechanism or transporter (7). To determine the functional activity of ABCA1 in

CESD fibroblasts, efflux of radiolabeled phospholipids and LDL-derived cholesterol as well as total cholesterol mass to apoA-I-containing medium was measured. Efflux to apoA-I of cell phosphatidylcholine and sphingomyelin radiolabeled by addition of [3H]-choline during the

LDL-loading phase was significantly reduced in both CESD fibroblast lines when compared to two normal fibroblast lines (Figures 2.2A and B). To specifically measure efflux of cholesterol derived from LDL, cells were loaded with LDL containing [3H]cholesteryl linoleate prior to incubation with apoA-I. Efflux of LDL-derived cholesterol as a percentage of total medium plus cell radiolabel to 10 μg/ml apoA-I over a 48 h period was significantly lower from the two CESD cell lines (7.4 ± 0.67% and 10.3 ± 1.04% from CESD1 and CESD2 cell lines respectively) when compared to the two normal cells lines (23.6 ± 2.70% and 18.8 ± 0.69% from NL1 and NL2 respectively) (Figure 2.2C). The percentage of total medium plus cellular radiolabel in cell cholesteryl esters was persistently higher in CESD cells, consistent with reduced LAL activity and reduced hydrolysis of lysosomal cholesteryl esters over the 48 h time course of the experiment (Figure 2.2D). Radiolabeled unesterified cholesterol was much lower in CESD cells at the start of the apoA-I incubation, but, in contrast to normal cells, rose during the apoA-I incubation as cholesteryl esters were gradually hydrolyzed (Figure 2.2E). The increase in unesterified cholesterol counts is consistent with reduced ABCA1 activity in these cells and reduced efflux to apoA-I compared to normal cells. Differences in cholesterol mass in the

medium and cell cholesteryl ester pools after 24 h incubation with 10 μg/ml apoA-I mirrored changes seen in the radiolabel experiments, with much lower efflux of cholesterol mass to apoA-

I-containing medium and much higher cholesteryl ester levels in CESD compared to normal cells

(Figures 2.2F and 2.2G). Normal and CESD cells had unesterified cholesterol mass ranging between 33.0 ± 3.03 μg/mg (NL1) and 63.4 ± 6.62 μg/mg (CD1) cell protein; taken together, no significant difference could be observed between normal and CESD cells in this parameter

(Figure 2.2H). This result was not unexpected since, as opposed to radiolabeling experiments where the fate of [3H] LDL-cholesteryl esters was measured specifically, the total mass of unesterified cholesterol also includes that from de novo cholesterol synthesis by HMGCR, known to be upregulated in CESD cells (237),and neutral hydrolysis of cytosolic cholesteryl esters (284).

Figure 2.2 Reduced phospholipid and cholesterol efflux to apoA-I from CESD fibroblasts.

Normal (NL1, NL2) and CESD (CD1, CD2) fibroblasts were grown to confluence in DMEM containing 5% LPDS and then in DMEM containing 5 μCi/ml [3H]choline-chloride and 50 μg/ml LDL for 24 h (A,B), 50 μg/ml

[3H]cholesteryl-linoleate LDL (C,D,E), or 50 μg/ml LDL (F,G,H), followed by further incubation with DMEM in the presence (+) or absence (-) of 10 μg/ml apoA-I for 24 h or the indicated time points. The radioactivity of the medium was counted directly by liquid scintillation counting (C) or following lipid extraction (A,B). Medium and cellular lipid extracts were separated by thin layer chromatography and radioactivity was measured in phosphatidylcholine (A) and sphingomyelin (B) spots, or cholesteryl ester (CE, D) and unesterified cholesterol (UC,

E) spots. Total lipids were extracted from medium (F) and cells (G,H) and UC (F,H) and CE mass (G) were determined by gas chromatography and mass spectrometry. Error bars are the standard error of the mean and are

representative of 3 experiments with similar results. *, values less than (A,B,C,E,F) or greater than (D,G) NL1 or

NL2 controls, p < 0.05.

2.4.3 Chloroquine blocks LDL-dependent upregulation of ABCA1 expression and activity in normal fibroblasts

To test whether inhibition of LAL activity impairs ABCA1 expression and activity in normal fibroblasts, cells were exposed to 50 μM chloroquine for 1 h prior to and during LDL loading (237). Chloroquine treatment of normal fibroblasts reduced basal ABCA1 mRNA to nearly zero, and completely blocked the increase in ABCA1 mRNA seen in response to LDL- loading, which was reduced to a greater extent than seen in untreated CESD fibroblasts (Figure

2.3A). The increase in ABCA1 protein in response to LDL loading was also blocked by chloroquine treatment in normal fibroblasts to a similar degree as non-chloroquine treated CESD cells, indicating the importance of lysosomally-derived cholesterol as a regulator of ABCA1 expression (Figure 2.3B). Interestingly, LAL protein levels were also decreased in normal and

CESD fibroblasts following chloroquine treatment (Figure 2.3B), which has been attributed to enhanced secretion of newly synthesized enzyme and/or decreased re-uptake of secreted LAL

(376). Therefore, chloroquine blocks LDL cholesteryl ester hydrolysis not only by inhibition of

LAL activity but also by reduction of overall LAL enzyme level within the cell. Efflux of LDL- derived cholesterol to apoA-I was abolished in normal cells following chloroquine treatment before and during delivery of [3H]cholesteryl linoleate-labeled LDL to cells (Figure 2.3C).

Chloroquine treatment also resulted in accumulation of [3H]cholesteryl esters and reduction of cellular [3H]-unesterified cholesterol in normal fibroblasts, to similar levels as those seen in non- chloroquine-treated CESD cells, confirming the inhibition of LDL-cholesteryl ester hydrolysis by chloroquine (data not shown). In addition, LAL expression was suppressed using RNAi by lentivirus-mediated delivery of short hairpin RNA (shRNA) directed against the LAL transcript.

We were able to achieve significant knockdown of LAL protein expression (~80% reduction) in

normal cells transduced with lentivirus expressing shRNA against LAL (shLAL3 and 4) compared to non-targeting shRNA (shNT) (Supplementary Figure 2.10A). However, LAL activity was only reduced to ~30-40% of normal (compared to only 5-10% residual activity in

CESD fibroblasts) (Supplementary Figure 2.10B) and there was no apparent effect on ABCA1 expression (Supplementary Figure 2.10A). Therefore, the metabolic phenotype of impaired

ABCA1 regulation and cellular cholesterol efflux to apoA-I observed in CESD fibroblasts could be recapitulated by pharmacological inhibition of LAL in normal fibroblasts, indicating that LAL deficiency is the reason for the impaired ABCA1 regulation observed in CESD fibroblasts.

Figure 2.3 Chloroquine blocks upregulation of ABCA1 in response to LDL loading and apoA-I-mediated cholesterol efflux in normal fibroblasts.

Normal (NL1) and CESD (CD1, CD2) fibroblasts were grown to confluence in LPDS. Cells were treated ± 50 μM chloroquine (72) for 1 h prior to and during a 24 h incubation ± 50 μg/ml LDL (A, B) or 50 μg/ml [3H]cholesteryl- linoleate LDL (C). A, cellular RNA extracts were analyzed by quantitative real time-PCR as described in Figure 2.1.

B, cell lysates were collected and analyzed by western blot as described in Figure 2.1. C, radioactivity of the medium and cell lipid extracts was determined as in Figure 2 and results are expressed as the percent of total medium and cell [3H]UC plus cell [3H]CE. Values are the mean ± SD of triplicates and are representative of 3 experiments with similar results. *, values less than non-chloroquine-treated and LDL-loaded NL1 controls, p <

0.05.

2.4.4 LXR agonist corrects ABCA1 expression but fails to correct apoA-I-mediated cholesterol efflux in CESD fibroblasts

We and others have previously reported that treatment with the LXR agonist TO901317 corrects ABCA1 expression and apoA-I-mediated cholesterol efflux (239,377), and reduces lysosomal cholesterol accumulation (239) in NPC1-deficient human fibroblasts. As found in

NPC1-deficient cells, LXR agonist treatment corrected ABCA1 expression in CESD cells to similar (mRNA) or greater (protein) levels than seen in non-LXR agonist-treated normal fibroblasts (Figures 2.4A and 2.4B). Efflux of radiolabeled LDL-derived cholesterol to apoA-I, however, while increased in normal fibroblasts, was not corrected to the same level in CESD fibroblasts compared to untreated normal fibroblasts (Figure 2.4C). These results suggest that although ABCA1 expression can be corrected in CESD fibroblasts, the residual deficiency of

LAL activity is not overcome with this treatment, resulting in a persistent reduction of substrate unesterified cholesterol from late endosomes and lysosomes for ABCA1-mediated cholesterol efflux.

Figure 2.4 LXR agonist upregulates ABCA1 expression but fails to correct apoA-I-specific cholesterol efflux in CESD fibroblasts.

Normal (NL1) and CESD (CD1, CD2) fibroblasts were grown to confluence in DMEM containing 5% LPDS and then incubated with DMEM containing 50 μg/ml LDL (A,B) or 50 μg/ml [3H]cholesteryl-linoleate LDL (C) in the presence (+) or absence (-) of 5 μM TO901317 for 24h. ABCA1 mRNA expression was quantified (A) and cell lysates were analyzed by western blot (B) as described in Figure 2.1. C, following LDL and LXR agonist incubation cells were further incubated with DMEM containing 10 μg/ml apoA-I for 24 hours and cell and radioactivity of the medium and cell lipid extracts was determined as in Figure 2. Results are expressed as the percent of total (medium and cell [3H]UC plus cell [3H]CE); mean ± SD of triplicates and representative of 3 experiments with similar results.

*, values less than non-LXR agonist-treated NL1 cells, p <0.05.

2.4.5 Rescue of ABCA1 expression and apoA-I-dependent cholesterol efflux in CESD fibroblasts treated with LAL-containing medium

Our data indicate that hydrolysis of endocytosed LDL cholesteryl esters by LAL is required for normal regulation of ABCA1 expression and activity, and that the impaired ABCA1 expression and lipid efflux phenotype of CESD cells can be reproduced by inhibiting LAL activity in normal fibroblasts. Restoration of LAL activity would therefore be expected to correct the impaired ABCA1 expression and lipid efflux defects in CESD cells. Functional LAL enzyme is known to be secreted from human fibroblasts, and can be taken up again via the mannose-6 phosphate receptor pathway for specific targeting to late endosomes/lysosomes

(253,258). The Goldstein and Brown laboratory have previously shown that conditioned medium from normal human fibroblasts can rescue the hydrolysis of LDL cholesteryl esters and restore normal cholesterol regulatory responses including suppression of HMG-CoA reductase and stimulation of cholesterol re-esterification in CESD fibroblasts (292). We adapted this method to determine whether we could also rescue ABCA1 expression and lipid efflux in these cells. Normal and CESD fibroblasts were grown to confluence in LPDS, followed by an additional 24 h incubation in medium obtained from a 24 h incubation of normal fibroblasts

(conditioned medium). Cells were then loaded with unlabeled or radiolabeled LDL for 24 h prior to determination of ABCA1 expression and cholesterol efflux to apoA-I. Conditioned medium from normal cells restored the LDL-induced increase in ABCA1 mRNA in CD1 and

CD2 fibroblasts up to the same level seen in conditioned medium-treated normal fibroblasts

(Figure 2.5A). ABCA1 protein levels were also increased in both CESD cell lines in response to

LDL-loading following treatment with conditioned medium (Figure 2.5B). No change was observed in ABCA1 mRNA or protein when CD1 or CD2 fibroblasts were treated with

conditioned medium from either CESD cell line (data not shown). Conditioned-medium treatment also corrected LDL-derived cholesterol efflux to apoA-I in both CESD cell lines by

~3.5-fold when compared to non-treated cells, to levels similar to those seen in normal fibroblasts untreated or treated with conditioned medium (Figure 2.5C). In addition, conditioned medium reduced cell cholesteryl esters and raised cell unesterified cholesterol radiolabel in

CESD cells to levels similar to those found in normal cells with or without conditioned medium treatment (Figures 2. 5D and 2.5E). These results indicate LAL from the conditioned medium was internalized and targeted correctly to late endosomes/lysosomes, to restore LDL cholesteryl ester hydrolysis and cholesterol homeostasis as determined by ABCA1 expression and activity.

Figure 2.5 Normal conditioned medium rescues ABCA1 expression and apoA-I-mediated cholesterol efflux in

CESD fibroblasts.

Normal (NL1) and CESD (CD1, CD2) fibroblasts were grown to confluence in DMEM containing 5% LPDS. Fresh medium was applied for 24 h and the resulting conditioned medium from normal cells or non-conditioned medium was applied as indicated for 24 h. Cell monolayers were then incubated in DMEM with (+) or without (-) 50 μg/ml

LDL (A,B) or 50 μg/ml [3H]cholesteryl-linoleate LDL (C,D,E) for 24 h. ABCA1 mRNA expression was quantified

(A) and cell lysates were analyzed by western blot (B) as described in Figure 2.1. Cells were incubated with 10

μg/ml apoA-I for 24 h and [3H]cholesterol in the medium and cell lipid extracts was determined as in Figure 2.2.

Results indicate the percent of total [3H]cholesterol in the medium (C), cell CE (D) or cell UC (E), mean ± SD of triplicates, and are representative of 3 experiments with similar results. *, values significantly greater (A,C,E) or lower (D) than non-conditioned medium-treated CESD cells, p < 0.05.

2.4.6 Impaired HDL particle formation by CESD fibroblasts and correction by treatment with conditioned medium from normal cells

We previously reported a reduction in generation of α-migrating HDL species in apoA-I efflux medium of NPC-deficient cells, and in the plasma of a patient with NPC disease, using 2- dimensional (2-D) gel electrophoresis of HDL particles (239). We also found a correction of α-

HDL formation following LXR agonist treatment in NPC disease cells (239). In order to correlate our findings of reduced ABCA1 expression and apoA-I-dependent phospholipid and cholesterol efflux from CESD fibroblasts with the reported low plasma HDL-cholesterol concentrations in CESD patients (317), we performed 2D gel analysis of HDL formed in the efflux medium containing 10 μg/ml apoA-I for 24 hours from normal and CESD cells. As seen in NPC1-deficient fibroblasts (239), medium from both CESD cell lines showed normal levels of pre-β HDL but a reduction in formation of α-HDL particle species following incubation with apoA-I (Figure 2.6, CD1 and CD2 –CM). Incubation of CESD cells with conditioned medium from normal fibroblasts to increase LAL activity restored the level of α-HDL produced by CESD cells up to levels similar to those seen in normal cells without CM treatment (Figure 2.6, CD1 and CD2 +CM).

Figure 2.6 Reduced α-HDL particle formation by CESD fibroblasts is rescued following treatment with normal fibroblast conditioned medium.

Fibroblasts were treated as in Figure 2.5 with or without conditioned medium from normal fibroblasts (CM). Efflux medium following a subsequent 24 h incubation with 10 μg/ml apoA-I was concentrated to 1/10 volume and 20 μl of each sample was run in the first dimension on 0.75 % agarose, separated in the second dimension on a 5-23% non-denaturing polyacrylamide gradient gel, and analyzed by western blot using a rabbit polyclonal antibody to human apoA-I. Boxed areas represent α-HDL particles. Blots are representative of 3 experiments with similar results.

2.4.7 Impaired LDL-induced oxysterol formation in CESD cells and correction by treatment with conditioned medium from normal cells

Production of endogenous oxysterols in response to LDL loading is impaired in NPC1- and NPC1-deficient human fibroblasts (238), providing a reason for the impaired regulation of

ABCA1 in NPC disease (365). The reduced flux of unesterified cholesterol out of lysosomes in

CESD, plus the ability of an exogenous LXR agonist to correct ABCA1 expression in these cells

(Figures 2.4A and 2.4B), suggest that endogenous oxysterol generation required for LXR activation and ABCA1 expression is also impaired in CESD. To test this hypothesis we measured the increase in production of 27-hydroxycholesterol, the predominant oxysterol generated (162,378) and key regulator of HMG-CoA reductase (378) and ABCA1 (162) expression in response to LDL loading of fibroblasts, following incubation of CESD cells with

LDL. The increase in combined medium and cellular 27-hydroxycholesterol mass in response to

LDL loading was less in both CESD cell lines when compared to normal fibroblasts (Figure 2.7).

Treatment with conditioned medium from normal cells to provide LAL activity significantly increased production of 27-hydroxycholesterol in both CESD cell lines when compared to non- treated cells, to levels similar to or higher than LDL-loaded normal fibroblasts (Figure 2.7).

These results provide the first demonstration of reduced oxysterol production in CESD fibroblasts, and further evidence that the impaired flux of cholesterol out of lysosomes and the consequent reduction in oxysterol formation is responsible for the impaired regulation of ABCA1 and HDL formation in CESD.

Figure 2.7 Reduced 27-hydroxycholesterol mass in CESD cells and correction following treatment with normal fibroblast conditioned medium.

Normal (NL1) and CESD (CD1,CD2) fibroblasts were treated as in Figure 2.5, either with (+) or without (-) conditioned media (CM). Lipids from cells and media were extracted and the pooled lipid fractions were separated by gas chromatography and the mass of 27-HC quantified as described in Experimental Procedures. Results represent the difference between LDL loading (+LDL) and non-LDL-loaded controls, mean ± SD of triplicates, and are representative of two experiments with similar results. *, values significantly greater than non-CM-treated cells, p < 0.05.

2.5 Discussion

The studies presented here provide several additional lines of evidence that the rate of flux of cholesterol out of lysosomes is a key regulator of ABCA1 expression and activity and therefore HDL particle formation. Human CESD fibroblasts with very low residual activity of

LAL and therefore rate of hydrolysis of cholesteryl esters in late endosome/lysosomes exhibited a marked decrease in LDL-stimulated expression of ABCA1 at the mRNA and protein level, resulting in impaired ABCA1-dependent phospholipid and cholesterol efflux to apoA-I, and reduced production of larger α-HDL particles. Treatment of normal fibroblasts with chloroquine to inhibit LAL activity induced the same defects in LDL-stimulated increases in ABCA1 expression and cholesterol efflux to apoA-I as seen in the CESD cells. Treatment of CESD cells with LAL-containing conditioned medium from normal cells corrected cholesteryl ester hydrolysis, ABCA1 expression, cholesterol efflux to apoA-I, and formation of α-HDL particles to levels similar to those seen in normal fibroblasts. Formation of the key oxysterol regulating

ABCA1 expression in response to LDL loading, 27-hydroxycholesterol, was reduced in CESD fibroblasts and restored upon addition of LAL-containing medium to correct cholesteryl ester hydrolysis. These findings are summarized in Figure 2.8 below. Together with our previous findings using cells from patients with the lysosomal cholesterol storage disorder NPC disease

(239,365), these results demonstrate further the critical role of the rate of flux of cholesterol out of late endosomes/lysosomes in regulating ABCA1 expression and HDL particle formation.

They also provide the first likely explanation for the low plasma HDL-C seen in CESD patients, impaired regulation of ABCA1.

Figure 2.8 Summary of results and proposed mechanism.

Partial lysosomal acid lipase (LAL) deficiency in CESD fibroblasts leads to LDL cholesteryl ester (CE) accumulation in the lysosomes and reduced release of cellular unesterified cholesterol (UC) from this compartment, leading to reduced upregulation of oxysterol production, reduced ABCA1 expression via the LXR pathway.

Ultimately this leads to impairment of ABCA1-mediated cholesterol efflux and HDL alpha particle formation.

In both NPC disease and CESD, previous studies using cultured fibroblasts showed that the reduced rate of release of unesterified cholesterol from late endosomes/lysosomes leads to impaired downregulation of HMG-CoA reductase and LDL receptor activity, and, therefore, inappropriately high levels of de novo cholesterol synthesis and LDL uptake (237,379). Reduced trafficking of unesterified cholesterol to the endoplasmic reticulum also results in reduced levels of cholesterol esterification by acyl-CoA:cholesterol acyltransferase in both diseases (236,237).

At the same time, our previous (239,365) and current work suggests the low rate of cholesterol egress from lysosomes and oxysterol generation in both these diseases results in reduced ABCA1 expression and HDL particle formation. Fibroblasts from NPC and CESD patients, therefore, fail to sense the accumulation of excess cholesterol in late endosomes/lysosomes and to upregulate ABCA1 appropriately in response to cholesterol loading, thereby resulting in impaired HDL formation.

Using the drug chloroquine to inhibit LAL activity, ABCA1 expression and ABCA1- dependent cholesterol efflux were significantly decreased in normal cells (Figure 2.3).

Interestingly however, despite successful knockdown of LAL expression using RNAi by a lentivirus delivery method, which caused significant reduction of LAL protein (to ~20% of normal) in normal fibroblasts, LAL activity was not suppressed enough to cause measurable changes in ABCA1 expression (Supplementary Figure 2.10). This indicates that a threshold of

LAL activity must exist, (between the 5-10% residual activity in CESD fibroblasts and the 35-

40% remaining activity following LAL knockdown by RNAi) in which a sufficient amount of

CE hydrolysis takes place to allow enough lysosomal UC release in order to modulate ABCA1 regulation.

27-hydroxycholesterol has been shown to be the predominant oxysterol formed and primary regulator of both HMGCoA reductase and ABCA1 expression in response to LDL or acetylated LDL loading in human fibroblasts and other cell types (162,378). The reduced generation of 27-hydroxycholesterol in NPC disease (238) and in CESD cells in response to LDL loading found in the current studies is striking also in demonstrating the key role of lysosomally- derived cholesterol in the formation of this key regulatory oxysterol required for ABCA1 expression. Despite increased HMG-CoA reductase activity and de novo cholesterol synthesis in both CESD and NPC disease cells (237,379), newly-synthesized cholesterol is apparently not contributing a significant pool of cholesterol or regulatory oxysterols affecting ABCA1 expression. While synthesis of 24(S),25-epoxycholesterol has been shown to increase coordinately with de novo cholesterol synthesis via HMG-CoA reductase (380), synthesis of this oxysterol is apparently not enough to impact ABCA1 expression in the face of reduced flux of cholesterol out of lysosomes. Further demonstration of the specific and critical role of lysosomally-derived cholesterol in regulating ABCA1 expression was seen in our experiments using chloroquine, where levels of ABCA1 mRNA were reduced to near zero in cells pretreated with lipoprotein-deficient serum or following LDL loading (Figure 2.3A).

Treatment of CESD cells with the non-oxysterol LXR agonist TO-901317 increased

ABCA1 mRNA and protein levels up to either normal or higher levels than those seen in untreated normal fibroblasts (Figures 2.4A,B). In contrast to our previous findings of complete correction of apoA-I-mediated cholesterol efflux and HDL particle formation in NPC1-deficient fibroblasts treated with this LXR agonist (239), however, CESD cells showed a persistent reduction in apoA-I-mediated cholesterol efflux (Figure 2.4C). These results suggest that treatment with this agonist and increased expression of ABCA1 can bypass a deficiency in NPC1

activity to induce mobilization of lysosomal (unesterified) cholesterol, but cannot overcome the deficiency in LAL activity and reduced LDL cholesteryl ester hydrolysis in CESD cells. These results also support the conclusion of previous studies (381,382) that lysosomally-derived cholesterol forms a significant fraction of the substrate pool of cholesterol mobilized by ABCA1 for HDL particle formation.

Our findings that addition of LAL-containing conditioned medium from normal fibroblasts rescued ABCA1 expression and activity (Figure 2.5) are consistent with previous results showing correction of LDL cholesteryl ester hydrolysis and new cholesteryl ester formation as well as suppression of HMG-CoA reductase in similarly-treated human CESD fibroblasts (292). Correction of LDL-derived radiolabeled cholesteryl ester and unesterified cholesterol levels in CESD cells to the same levels as seen in normal fibroblasts (Figures 2.5D,E) indicated LAL in the conditioned medium was targeted to and active in late endosomes/lysosomes of the CESD cells. Correction of LAL activity also resulted in normalization of apoA-I-mediated cholesterol efflux (Figure 2.5C), HDL particle formation

(Figure 2.6), and 27-hydroxycholesterol formation (Figure 2.7) in the CESD cells. While we cannot rule out the possibility that 27-hydroxycholesterol present in the conditioned medium from normal cells had a partial role in this correction, the normalization of radiolabeled cholesteryl ester levels by LAL, which is not known to be an LXR-responsive gene, suggests the primary effect of the conditioned medium was indeed the correction of LAL activity in the

CESD cells. This correction of the regulatory defect in ABCA1 expression and activity by adding back LAL to CESD cells provides further evidence for reduced lysosomal cholesteryl ester hydrolysis and flux of unesterified cholesterol out of the late endosome/lysosome compartment as the reason for impaired ABCA1 regulation and HDL formation in CESD.

In summary, the results presented provide further evidence that the rate of flux of cholesterol out of late endosomes/lysosomes is a critical regulator of the expression of ABCA1 and HDL particle formation, and is not corrected by the increased de novo cholesterol synthesis seen in cells from patients with two different diseases of lysosomal cholesterol storage, cholesteryl ester storage disease and Niemann Pick disease type C. These results also provide the first plausible explanation for the hypoalphalipoproteinemia seen in CESD, impaired regulation of ABCA1. We therefore propose a model for CESD cells where hydrolysis of cholesteryl esters from endocytosed LDL in late endosomes and lysosomes is impaired, there is a reduced rate of unesterified cholesterol release from these compartments to other intracellular sites for regulatory effects including production of 27-hydroxycholesterol, and therefore reduced

LXR-dependent regulation of ABCA1. In addition less unesterified cholesterol is available to join the substrate pool of ABCA1 for new HDL particle formation. Although we did not find an upregulation of ABCA1 expression in normal cells in response to addition of conditioned medium containing LAL, further studies are required to assess the potential role of LAL as a target to increase ABCA1 expression and HDL formation at the cellular and clinical level.

2.6 Supplementary data

2.6.1 Supplemental figures

Figure 2.9 Average LAL activity of CESD fibroblasts.

Normal (NL1) and CESD fibroblasts (CD1 and CD2) were grown to confluence in DMEM containing 5% LPDS.

Cells were harvested from dishes by trypsinization, washed extensively in PBS and redissolved in sterile distilled water. Cells were lysed by sonication and enzyme activity was determined by quantification of fluorescence following hydrolysis of the substrate 4-MUO incorporated into phospholipid vesicles at pH5. LAL activity was calculated as the rate of increase of fluorescence over time and calculated as a percentage of normal controls (NL1).

Error bars are the standard deviation of the mean from 6 separate experiments.

Figure 2.10 LAL knockdown by lentivirus delivery of short hairpin RNA reduces LAL expression and activity but does not alter ABCA1 protein expression.

Normal (NL1) and CESD (CD1 and CD2) were grown to 80% confluence in culture and NL1 cells were infected with lentivirus constructs expressing each of 5 different short hairpin RNA sequences targeting LAL (shLAL #1-5) or a non-targeting scrambled short hairpin sequence (shNT) for 18 hours. Cell samples were collected and analyzed by (A) Western blotting or (B) LAL activity following methods described for Figures 2.1 and 2.8. Once the efficiency of knockdown of LAL was determined (A), the lentivirus shRNA constructs that reduced LAL expression by the most (shLAL3 and shLAL4) were used for further experiments. Results in (A) are representative of 4 separate experiments with similar results. Results in (B) represent the standard deviation of the mean.*, values significantly lower than shNT controls, One-way ANOVA, n=6, p < 0.05.

Figure 2.11 Recombinant human LAL rescues ABCA1 expression and apoA-I-mediated cholesterol efflux in

CESD fibroblasts.

Normal (NL1) and CESD (CD1, CD2) fibroblasts were grown to confluence in DMEM containing 5% LPDS.

Recombinant human LAL (rhLAL) was added to CD1 and CD2 fibroblasts at the concentrations indicated (μg/ml medium) (A) or 1.2 μg/ml rhLAL (B,C,D) for 24 hours. Cell monolayers were then incubated in DMEM with (+) or without (-) 50 μg/ml LDL (A) or 50 μg/ml [3H]cholesteryl-linoleate LDL (B,C,D) for 24 h. ABCA1 protein in cell lysates was analyzed by western blot (A) as described in Figure 2.1. Cells were incubated with 10 μg/ml apoA-I for

24 h and [3H]cholesterol in the medium and cell lipid extracts was determined as in Figure 2.2. Results indicate the percent of total [3H]cholesterol in the medium (B), cell CE (C) or cell UC (D), mean ± SD of triplicates, and are representative of 3 experiments with similar results.*, values significantly greater (B,C) or lower (D) than non- conditioned medium-treated CESD cells, p < 0.05.

Figure 2.12 Reduced α-HDL particle formation by CESD fibroblasts is rescued following treatment with recombinant human LAL.

Fibroblasts were treated as in Supplemental figure 2.11 with or without 1.2 μg/ml recombinant human LAL (rhLAL or no addition, NA). Efflux medium following a subsequent 24 h incubation with 10 μg/ml apoA-I was concentrated to 1/10 volume and 20 μl of each sample was run in the first dimension on 0.75 % agarose and, separated in the second dimension on a 5-23% gradient gel, and analyzed by western blot using a rabbit polyclonal antibody to human apoA-I. Boxed areas represent α-HDL particles. Blots are representative of 2 experiments with similar results.

Figure 2.13 27-hydroxycholesterol formation following treatment with recombinant human LAL.

Normal (NL1) and CESD (CD1,CD2) fibroblasts were treated as in Figure 2.5, either with (+rhLAL) or without treatment with recombinant human LAL. Lipids from cells and media were extracted and the pooled lipid fractions were separated by gas chromatography and the mass of 27-OHcholesterol was quantified as described in

Experimental Procedures. Results represent the difference between LDL-loaded and non-LDL-loaded cells, mean ±

SD of triplicates, and are representative of four experiments with similar results.

CHAPTER 3: LAL PROMOTES REVERSE CHOLESTEROL

TRANSPORT FROM MACROPHAGES

3.1 Introduction

The ATP-binding cassette transporter A1 performs the rate-limiting step in HDL synthesis by removing intracellular cholesterol and phospholipids to apolipoprotein acceptors during initial HDL particle formation (83,188,359,360). ABCA1 is therefore a critical component of the reverse cholesterol transport pathway whereby excess intracellular cholesterol is removed from the cell and transported on HDL to the liver for removal via biliary excretion

(383).

Previous work in our lab has shown that ABCA1 regulation and cholesterol efflux are impaired in two lysosomal cholesterol storage disorders: Niemann Pick disease type C

(NPC)(368) and Cholesteryl Ester Storage Disease (CESD) (13,384), both characterized by low levels of plasma HDL cholesterol. NPC is a neurodegenerative disease with other clinical manifestations such as hepatomegaly, neonatal liver disease, and, frequently, death in childhood or early adolescence, and is the result of mutations in either NPC1 or NPC2 proteins which help to remove cholesterol from the lysosomes intracellularly (385). CESD is an autosomal recessive disorder resulting from mutations in the lysosomal acid lipase (LAL) gene. LAL catalyzes the hydrolysis of LDL-derived triacylglycerols (TG) and cholesteryl esters (CE) in lysosomes. Due to mutations in LAL, enzyme activity in CESD is reduced to approximately 5% of normal (237), resulting in massive accumulation of cholesteryl esters particularly within tissues such as the liver, spleen and adrenal glands (317), resulting in hepatosplenomegaly and sometimes leading to premature atherosclerosis (367). In both NPC and CESD, patients typically have low plasma

HDL (13,366), which we’ve demonstrated is most likely due to decreased ABCA1 expression

and activity (13,384). In both diseases, it is thought that excess lysosomal cholesterol also cannot access intracellular sites for oxysterol synthesis, resulting in reduced activation of liver X receptor (LXR) nuclear receptor and dysregulation of its target genes (238).

CESD and LAL-deficient mice, hepatomegaly results primarily from lipid accumulation in foamy Kupffer cells, macrophage-like cells in the liver. Foamy-macrophage infiltration into other tissues such as the intestine, spleen and lungs is a prominent feature (361,362). LAL deficiency has been shown to enhance atherogenesis in mouse models (337,363), while supplementation of LDL receptor-deficient mice with macrophage-specific recombinant LAL prevents early lesion formation and drastically reduced the size of pre-existing lesions (336).

Epidemiological evidence suggests an inverse relationship between plasma HDL cholesterol and atherosclerosis risk (358), however steady-state plasma HDL-C levels themselves aren’t necessarily indicative of the efficiency of HDL in this pathway (144-146).

Recent focus has turned toward the many known anti-atherosclerotic properties of HDL, including its dynamic role within the reverse cholesterol transport (RCT) pathway, as opposed to

HDL-C levels themselves (115,140,147). Current methods to model reverse cholesterol transport directly from macrophages in vivo have been pioneered by the laboratory of Daniel Rader, where radioisotope-labeled cholesterol in macrophages is traced through the RCT pathway ultimately to the feces (139), an effective approach to assess dynamic changes in the whole RCT pathway in vivo.

Here we show that ABCA1 expression and cellular cholesterol efflux are impaired in

LAL-deficient macrophages, leading to dysregulation of reverse cholesterol transport in vitro and in vivo.

3.2 Materials and methods

3.2.1 Materials

Chloroquine diphosphate and 4-methylumbelliferyl oleate were from Sigma.

[Cholesteryl –1,2-3H (N)] cholesteryl oleate was from Perkin Elmer (Waltham, Massachusetts).

DMEM and RPMI 1640 media were from HyClone (Logan, Utah). Fetal bovine serum was from

Cocalico Biologicals, Inc. Nitrocellulose membranes, SDS-PAGE reagents, and pre-stained protein molecular mass markers were purchased from Bio-Rad. Pre-SIL G plastic-backed flexible plates used for thin layer chromatography analysis were from Whatman. Purified recombinant human LAL enzyme (rhLAL) was from Shire (Lexington, MA).

3.2.2 Preparation of [3H] cholesteryl-oleate labeled acetylated LDL and isolation of apolipoprotein A-1from plasma

LDL was isolated from pooled plasma from fasting, healthy donors by gradient density ultracentrifugation (368). Radiolabeling with [3H]cholesteryl oleate was performed as previously described (369), then acetylated according to the methods of Basu et al. (386). Briefly, an equal volume of [3H]cholesteryl-oleate labeled LDL in saline solution (typically 4-5 ml) was mixed with an equal volume of a saturated sodium acetate solution and 1.5µl/mg LDL protein was added in 1µl aliquots over 1 hour, while stirring on ice and then dialyzed extensively in a saline-

EDTA solution. Apolipoprotein A-1 (apoA-I) was purified from human plasma using Q- sepharose Fast Flow chromatography as described (359).

3.2.3 LAL knockout mice

LAL null mice (lal-/-) were generated on a (CF-1, 129Sv genetic background) as previously described (323). Mice were group housed in microisolation under a 12-hour light cycle and fed a chow diet ad libitum with free access to water. Mice of ages between 8 and 12 weeks were shipped from Cincinnatti Children’s Hospital, (Cincinnatti, OH) to the University of

British Columbia (Vancouver, BC) and allowed to acclimatize for 1 week prior to the commencement of experiments. Animals were cared for in accordance with the guidelines of the

US National Institutes of Health and the Canadian Council on Animal Care and all procedures were carried out under protocols approved by the UBC Animal Care Committees.

3.2.4 Cell culture

Mouse immortalized peritoneal macrophage cell lines were created by isolation of cells following peritoneal lavage of mice that were generated by crossing wild-type (lal+/+) or LAL knockout mice (lal-/-) with ImmortoMice (Charles River laboratories), engineered to have temperature-sensitive expression of SV40 large T-antigen under an IFN-γ inducible promoter, using methods described in Castoreno et al. (387). The isolated cells were then grown in monolayer in continuous culture at 33°C and 8% CO2 in RPMI 1640 medium supplemented with

10% fetal bovine serum, antibiotics and 5 units/ml IFN-γ (growth medium) for the first 10 passages only.

Primary dermal fibroblasts were isolated from skin sections from lal+/+ and lal-/- mice grown in DMEM medium supplemented with 20%FBS, antibiotics and anti-fungal reagents during clonal cell growth. The individual colonies of cells isolated were then propagated in

DMEM with 10% FBS and antibiotic, incubated at 37°C and 5% CO2. Cells were used for experiments between passages 3 and 10.

3.2.5 Tissue homogenization and Western blotting

Mouse tissues were collected immediately following euthanasia, flash-frozen in liquid nitrogen and stored until use. Tissues were crushed to a frozen powder using a mortar and pestle cooled in liquid nitrogen and 30-50mg of powdered tissue was homogenized on ice (388) in 0.5 ml lysis buffer containing 20mM Tris, 5mM EDTA, 5mM EGTA, 0.5% maltoside and 1X complete Mini Protease Inhibitor (Roche Applied Science) (384). Macrophages were harvested on ice in 0.25ml lysis buffer and then homogenized using a glass mortar and Teflon pestle. Cell proteins were separated by 7.5% (top half) and 12% (bottom half) SDS-PAGE and transferred to nitrocellulose overnight at 35V. Immunoblotting was performed using polyclonal antibodies against ABCA1 (1:1000 dilution, Novus Biologicals), ABCG1 (1:500 dilution, Novus

Biologicals), LAL (1:1000 dilution, Abcam) and protein disulfide isomerase (PDI) (1:1000 dilution, Enzo Life Sciences) or β-actin (1:1000, Abcam) and anti-rabbit IgG horseradish peroxidase-conjugated secondary antibody (1:10,000 dilution, Sigma), detected using Super

Signal West Femto chemiluminescence substrate (Pierce).

3.2.6 Measurement of acid cholesteryl ester hydrolase activity

Acid CE hydrolase enzyme activity from macrophage cell lysates was quantified using methods previously described (249,265). Cell lysates were prepared by removing cells from dishes in a 0.05% trypsin solution and cells were washed 5 times in PBS and reconstituted in sterile distilled water and sonicated in an ice-water bath for 30 seconds. Cell lysates were centrifuged at 14,000 rpm for 30 seconds in a microcentrifuge to precipitate cell debris, and

supernatants were collected and stored at -80°C until the assay was performed. Protein concentrations were estimated by Lowry assay (372). The substrate mixture was formed by first combining 25 µM (0.011g) of the artificial substrate 4-methylumbelliferyl oleate (4-MUO) with

40 µM (0.031g) L-α-phosphatidylcholine and evaporating carrier solvents under nitrogen gas.

The dried lipids were then reconstituted in 10 ml of 2.4 mM sodium taurodeoxycholate and sonicated at 50 watts for 3-5 minutes to form a dispersion of lipid vesicles. The enzymatic reaction was carried out by combining in a glass test tube 50 µl of the substrate mixture with 400

µl of 0.2 M sodium acetate (pH 5.5) and 5-10 µg of cell lysate in 96 well black-bottom plates and incubated at 37°C. The fluorescence generated by the reaction was quantified (excitation wavelength 335 nm, emission wavelength 455 nm) using a Tecan Safire II plate reader

(Mannedorf, Switzerland) detected at 5 minute intervals over 30 minutes. The rate of the reaction was calculated as the slope of the linear curve of the fluorescence units over time (min).

3.2.7 Quantitative real-time PCR analysis of mRNA

Total RNA was extracted from cell monolayers or frozen powdered frozen liver tissue

(see above) using 1ml TRIzol extraction reagent (Invitrogen), and cDNA libraries were constructed by reverse transcription as previously described (384). DNA amplification was performed following initial denaturation at 95°C for 3 min, 40 cycles of [dentaturation at 95°C for 20 s, annealing at the temperature indicated in Table 1. for 20 s, extension at 72°C for 40 s] using SYBR Green (Quanta Biosciences) used to detect PCR products in real-time using a

Realplex2 Mastercycler thermocycler (Eppendorf). The sequences of primers used are listed in

Table 1. The mRNA levels for genes listed were the mean cycle times, CT, corrected relative to the housekeeping gene m-cyclophilin (m-cyc) and expressed as a ratio relative to untreated controls. For semi-quantitative PCR, amplification of LAL and m-cyc mRNA was performed as 98

in Choi et al. (13) using primers and annealing temperatures described in Table 1. Products were run on a 1.1% agarose gel and detected by GelRed (Biotium, Inc.) nucleic acid stain fluorescence using a GeneFlash (Syngene) detection unit.

Gene Forward (5’→3’) Reverse (5’→3’) Annealing Temperature m-cyc ACCCAAAGGGAACTGCAGCGAGAGC CCGCGTCTCCTTTGAGCTGTTTGCAG 58°C

ABCA1 GACATCCTGAAGCCAATCCTG CCTTGTGGCTCCACTGTCAGGT 58°C

ABCG1 CACCTCGCACATTGGGATCG GCCAGGTAGTAGGCCTTCAG 60.9°C

ACBG5 ACTGGACTGCATGACTGCAA CAAGCATCTCCTCTGGGGTG 54°C

ABCG8 CAAGACTCCTGTGAGCTGGG ACGTCGAGTAGTGAGGCTCT 54°C

CYP7A1 ATGCCCTTTGGATCAGGAGC CAAAATTCCCAAGCCTGCCC 54°C

ApoE CAGCAGATACGCCTGCAGG ACTGGCGCTGCATGTCTTCC 56.2°C

SR-B1 AACAGGGAAGATCGAGCCAG CTCAGAGTAGGCCTGAATGGC 54°C

LAL GCTGGCAGATTCTAGTAACTGGG TGTGGGTCATTCTCAAGGC 58°C

Table 3.1 PCR Primers and Annealing Temperatures Used

3.2.8 Cholesterol efflux assay

A preparation of [3H]cholesteryl oleate – labeled acetylated LDL ([3H]CE – acLDL) was generated by incubation of native LDL with [3H]cholesteryl oleate in the presence of CETP- containing plasma and then acetylated by incubation with concentrated sodium acetate with intermittent addition of acetic anhydride. Macrophage cell monolayers were grown to confluence and incubated with 50 µg/ml [3H]CE – acLDL for 24 hours followed by incubation with 10ug/ml apoA-I in RPMI 1640 medium for a further 24 hours. Medium was removed and centrifuged for

10 minutes at 3000 rpm to precipitate cell debris and [3H]sterol in medium was quantified by liquid scintillation counting. Meanwhile, cell monolayers were washed extensively with cold

PBS, 1mg/ml BSA and PBS on ice and cellular lipids were extracted by Folch extraction as previously described (370). Cellular lipids were separated by thin layer chromatography.

Unesterified cholesterol (UC) and cholesteryl ester (CE) spots were located on plates using unlabeled carrier lipids stained with iodine gas, and radioactivity was quantified by liquid scintillation counting (389) as previously described (371,384). Medium UC and cell UC and CE were calculated as percent of total [3H]sterol (cell + medium).

3.2.9 Macrophage reverse cholesterol transport

Methods to measure macrophage to feces RCT were adapted from (139,151,390). Mice were housed individually in cages with wire mesh floor inserts and were fed ad libitum with free access to water for the duration of the experiment. Three days prior to injection, lal+/+ and lal-/- peritoneal macrophages were seeded in 100mm dishes at 3x106 cells/dish in growth medium and incubated for 2 days. Cells were then incubated in 6ml/well RMPI 1640 medium containing

50µg/ml [3H]CE – acLDL for 24 hours. Prior to injection, cells were gently lifted from dishes using 0.05% trypsin, suspended cells were washed several times in warm PBS. Cells were counted using a hemocytometer, resuspended in warm PBS to 8-12x106 cells/ml and a small aliquot (~50µl) of cells was removed to quantify the specific activity of [3H] by liquid scintillation counting. Cells were drawn into individual 1ml syringes (500 µl cells/syringe) and injected intraperitoneally into mice using 26 gauge needles within 1 hour after collection.

Typically, 6x106 cells containing 7-10x105 counts per minute (CPM) in 0.5ml PBS per mouse was injected.

A blood sample was collected after 24 hours via the facial vein into tubes containing

EDTA and placed immediately on ice. Blood was centrifuged at 1500 x g for 30 min at 4°C and

100

the plasma layer removed (391). Plasma volumes were estimated (~50-100 µl/mouse) and [3H] radioactivity was quantified by LSC. Mice were fasted for 4 hours and at 48 hours post-injection, mice were deeply anesthetized by inhaled isofluorane gas and blood was drawn by cardiac puncture. Plasma was collected as above and an aliquot of 200µl was counted directly by LSC. A second aliquot of 200µl plasma was removed and apoB-containing lipoproteins were precipitated by addition of 400µl precipitation buffer (555µM phosphotungstic acid, 25mM magnesium chloride, pH 2.5) and centrifuged at 14,000 x g for 2 min at 10°C (392) and the supernatant containing HDL was collected for quantification of [3H]sterol by LSC.

Following anesthesia and removal of blood by cardiac puncture, the vasculature of mice were perfused with 20ml of ice-cold saline via the left ventricle of the heart and tissues (liver, spleen, kidney, adrenal gland, small intestine, heart, brain, lung, adipose, testes) were dissected, frozen in liquid nitrogen and stored at -80°C.

Feces were continuously collected from cages over 48 hours and stored at -20°C until assayed. Feces were weighed and soaked at 4°C overnight in distilled water at a ratio of 1ml per

100mg feces. The following day, an equal volume of ethanol was added and feces were homogenized by vortexing vigorously. Triplicate aliquots of 200µl of feces homogenate were quantified for [3H]sterol and [3H]bile acid radioactivity by LSC.

3.2.10 Statistical analysis

Results were analyzed using GraphPad Prism version 5.0 and standard errors of the mean are indicated. A one-way analysis of variance was performed, using Bonferroni post-hoc comparisons to analyze statistical differences between treatment groups.

101

3.3 Results

3.3.1 ABCA1 expression and cholesterol efflux are impaired in immortalized peritoneal macrophages that lack LAL

Macrophage lipid accumulation and foam cell formation in the artery wall is central to the dogma of the process of atherogenesis and, at least in mice, make up the majority of cells in the plaque (393). Alternatively, cholesterol efflux from macrophages, mediated by ABCA1,

ABCG1 and others, is an important process to counter foam cell formation through removal of excess lipids and cholesterol. In order to investigate the role of LAL in ABCA1 regulation in macrophages, immortalized mouse peritoneal macrophage cell lines were created following isolation from wild-type (LAL+/+) and LAL knockout mice (LAL-/-) (387).

We observed significantly lower basal levels of ABCA1 mRNA and protein expression in lal-/- macrophages and little increase after loading with 50 µg/ml acetylated LDL (acLDL) for

24 hours as compared to wild-type macrophages (Figure 3.1). However, when LAL enzyme was replaced by treatment with 5-20 μg of recombinant human LAL (rhLAL), ABCA1 expression was increased (Figure 3.1). The mRNA transcript levels of three other cholesterol efflux genes were also quantified in macrophage cell lines (Figure 3.2). The levels of ABCG1 were significantly reduced in lal-/- macrophages compared to lal+/+, even after acLDL loading, but no significant differences were observed in apolipoprotein E (apoE) or scavenger receptor B1

(SR-B1) in either cell line.

102

Figure 3.1 ABCA1 (A) mRNA and (B) protein are reduced in lal-/- mouse peritoneal macrophages but are partially rescued by rhLAL.

Wild-type (lal+/+) and LAL knockout (lal-/-) mouse immortalized peritoneal macrophage cell lines were grown in culture to confluence and supplemented with (+) or without (-) 50 µg/ml acetylated LDL (acLDL) for 24 hours.

Some dishes of lal-/- cells were also treated with 5, 10 or 20 µg of purified recombinant human LAL protein (from

Shire) during, and 1 hour prior to acLDL loading. (A) ABCA1 mRNA expression was measured by quantitative realtime PCR, corrected for the housekeeping gene m-cyclophilin (m-cyc) and protein levels were resolved by SDS-

PAGE and detected by Western blotting using polyclonal antibodies against ABCA1, LAL or PDI loading control.

Error bars are standard error of the mean from (A) 7 or (C) 5 separate experiments (*p<0.05, One-way ANOVA, significantly different from LAL+/+, unless indicated).

103

Figure 3.2 ABCG1 but not ApoE or SR-B1 mRNA expression is reduced in LAL-/- macrophages.

Macrophages were grown in culture and incubated with or without 50µg/ml acetylated LDL (acLDL) for 24 hours.

Cell lysates were collected and mRNA levels were analyzed by quantitative real-time PCR as in Figure 1A, using primers against ATP-binding cassette transporter G1 (ABCG1), Apolipoprotein E (apoE) or scavenger receptor B1

(SR-B1). Error bars are the standard error of the mean from 5 separate experiments (*p<0.05, significantly different compared to LAL+/+, One-way ANOVA with Bonferroni comparisons).

104

For cholesterol efflux studies, macrophages were loaded with 50 μg/ml acetylated LDL or [3H]cholesteryl oleate-labeled acetylated LDL ([3H]CE-acLDL) for 24 hours and

[3H]cholesteryl ester (CE) and [3H]unesterified cholesterol (UC) counts were quantified in cells and medium following 24 hours incubation with (+) or without (-) 10 μg/ml apolipoprotein A1

(apoA-I). Both non-specific and ABCA1-dependent cholesterol efflux to apoA-I in the medium were significantly impaired and reduced to almost half of wild-type levels in lal-/- cells (Figure

3.3). Alternatively, treatment of lal-/- cells with 10 µg rhLAL was sufficient to restore ABCA1- dependent cholesterol efflux (Figure 3.3A), reflective of the upregulation of ABCA1 in these cells (Figure 3.1). As expected (237), there was an accumulation of [3H]CE and reduced hydrolysis to [3H]UC within the cell (Figure 3.3B and C). However, we were surprised to observe a significant proportion (~40%) of normal CE hydrolysis was still taking place in lal-/- cells. The source of this residual hydrolysis was investigated (Supplemental Figure 3.7).

Briefly, when cells were treated with the lysosomal inhibitor chloroquine, although it caused some inhibition of CE hydrolysis in wild-type cells, it did not further reduce [3H]UC production or increase [3H]CE accumulation in lal-/- macrophages (Supplemental Figure 3.7A). When CE hydrolase activity of macrophage cell lysates was assessed using the artificial substrate 4- methylumbelleriferyl oleate (4-MUO) under acidic conditions (pH 5), approximately 50% normal activity was detected in lal-/- macrophages (Supplemental Figure 3.7B). The absence of

LAL transcript was also confirmed in the lal-/- cells (Supplemental Figure 3.7C).

105

Figure 3.3 Rescue of impaired apoA-I-dependent cholesterol efflux in lal-/- macrophages by treatment with rhLAL.

Immortalized mouse peritoneal macrophages were grown to confluence and loaded with 50 µg/ml [3H]cholesteryl oleate-labeled acetylated LDL ([3H]CE-acLDL) for 24 hours and then washed and incubated in the presence (+ apoA-I) or absence (- apoA-I) of 10µg/ml purified apolipoprotein A-I for 24 hours. A. Medium was removed and

[3H] cholesterol was quantified by LSC. B, C. From cells that were not incubated with apoA-I, cellular lipids were extracted, cellular [3H]cholesteryl esters and [3H]unesterified cholesterol were separated by TLC and counted by

LSC. Measurements are expressed as the percent of total [3H] counts (medium + cell). Error bars are the standard error of the mean from 7 separate experiments (*p<0.05, One-way ANOVA, significantly different from LAL+/+, unless indicated).

106

3.3.2 Differential tissue-specific expression of RCT genes in LAL knockout mice

The liver is an important player in the RCT pathway, both for nascent HDL particle production and for lipoprotein cholesterol uptake, and production of bile for sterol excretion

(72). Expression of several hepatic genes that are involved in RCT was analyzed by quantitative real-time PCR. ABCA1 mRNA expression in the liver was not significantly different between cell lines, nor was SR-B1 (Figure 3.4). Strikingly, ABCG1 transcript levels were approximately

17-fold higher in livers of lal-/- mice compared to wild-type mice. Alternatively, the other LXR- dependent genes ATP-binding cassette transporter G5 and G8 (ABCG5/G8) and cholesterol 7α- hydoxylase (CYP7A1) were significantly reduced in LAL knockout mouse liver (Fig 3.4).

107

Figure 3.4 Differential RCT gene mRNA expression in LAL+/+ and LAL-/- mouse liver.

Differential gene expression in LAL+/+ and LAL-/- mouse liver. Livers were dissected from mice, homogenized, and RNA was extracted. Quantitative real-time PCR was performed using primers against ATP-binding cassette transporters A1, G1, G5, G8, cholesterol 7 alpha hydroxylase (CYP7A1) and scavenger receptor B1 (SR-B1) as described in methods. Error bars are the standard error of the mean (*p<0.05, student T-test, significantly different compared to LAL+/+, n (+/+, -/-) = 6,6.)

108

When the tissue-specific expression of ABCA1 was analyzed in wild-type and LAL knockout mice, we observed a significant reduction in ABCA1 membrane protein levels in the liver, spleen and kidney of lal-/- mice (394), whereas there was little difference in tissues such as the heart, lung or brain (results not shown). The levels of ABCG1 protein were also reduced in lal-/- mice (Figure 3.5C). This disconnect between ABCA1 and ABCG1 mRNA and protein levels in the liver suggests that the differences between lal+/+ and lal-/- mice occur at a post- transcriptional level. We’ve previously reported differences in ABCA1 regulation in LAL deficiency in human cholesteryl ester storage disease skin fibroblasts (384). In order to compare these results to our mouse model, we isolated primary skin fibroblasts from wild-type and LAL knockout mice. Similar to human CESD fibroblasts, we also observe impaired upregulation of

ABCA1 protein levels upon in mouse lal-/- skin fibroblasts with LDL cholesterol loading

(Figure 3.5B).

109

Figure 3.5 ABCA1 and ABCG1 tissue-specific protein expression in wild-type and LAL knockout mice.

A,C. Sections of mouse liver, spleen and kidney were dissected and homogenized. B. Primary dermal fibroblasts were isolated from mouse skin and grown in culture and then treated with (+) or without (-) 50 µg/ml LDL for 24 hours. Membrane and soluble proteins were extracted and resolved by SDS-PAGE and probed by Western blot using antibodies against ABCA1, ABCG1 and β-actin loading control. Results (A and C) are representative of samples taken from 6 LAL+/+ and 6 LAL-/- mice or (B) 3 separate experiments showing similar results.

110

3.3.3 Macrophage to feces RCT is impaired in LAL deficiency

Since these results in macrophages suggested a dysregulation of ABCA1, ABCG1 and other RCT genes in LAL knockout mice, we next set out to investigate the impact LAL deficiency on the RCT pathway in vivo. Using a technique originally developed by the laboratory of Daniel Rader (139), the flux of radio-labeled cholesterol specifically from macrophages can be traced through the RCT pathway to the feces. There is strong evidence that ABCA1 plays an important role in promotion of macrophage to feces RCT using this method (150,395). In order to measure macrophage reverse cholesterol transport in our system, wild-type and LAL knockout mice were injected with immortalized peritoneal macrophages of the same genotype. As has been reported (323,324), the LAL knockout mice had developed significant hepatomegaly (i.e. liver enlargement) and their spleens, kidneys and intestines were also enlarged and had noticeable lipid accumulation as indicated by their yellowish colour. However, the knockout mice and wild-type controls were used between 8 and 12 weeks of age for the study before the age where this pathology typically progresses to illness and death (Gregory Grabowski personal observations). Macrophages grown in monoculture (lal+/+ or lal-/-) that had been loaded with radiolabeled with [3H]CE-acLDL for 24 hours were suspended in saline and injected intraperitoneally into mice of the same genotype. We observed a significant reduction in

[3H]cholesterol in plasma at 24 and 48 hour time points when lal-/- mice were injected with lal-/- macrophages with a similar total level of radioactivity (1.36 ± 0.08% of total [3H] counts injected at 48 hours, n= 30 mice), compared to wild-type mice injected with lal+/+ macrophages (2.43 ±

0.26% of injected, n= 27) (Figure 3.6A). This was reflective of the impaired cholesterol efflux to medium observed in these macrophages in vitro (Figure 3.3A). Over 48 hours, lal-/- mice injected with lal-/- macrophages also had a reduced ability to support RCT to feces (1.55 ±

111

0.35% of total injected) compared to the lal+/+ into lal+/+ group (5.38 ± 0.92% of injected)

(Figure 3.6B). In a third experimental group, lal-/- macrophages were injected into lal+/+ mice to test whether endogenously secreted LAL (253,258,396) in wild-type mice could correct LAL activity in deficient macrophages and whether this would affect macrophage RCT. Indeed, macrophage RCT of [3H]sterol to plasma and feces (2.60 ± 0.46%, n=19) was partially corrected to intermediate levels between LAL+/+ into +/+ and LAL -/- into -/- experimental groups

(Figure 3.6A,B). Just as treatment with purified recombinant rhLAL enzyme could correct acLDL [3H]cholesteryl ester hydrolysis and [3H]cholesterol efflux from macrophages in culture

(Figure 3.3), these results suggested that some endogenous LAL had been taken up, resulting in an improvement of CE hydrolysis, cellular cholesterol (UC) efflux and RCT to feces.

112

Figure 3.6 Impaired macrophage reverse cholesterol transport in LAL knockout mice.

Macrophage reverse cholesterol transport to efflux to plasma (total) (A), plasma lipoproteins (B) and feces (C) is impaired in LAL knockout mice injected with lal-/- macrophages (LAL-/- into -/-) compared to wild-type (LAL+/+ into +/+), but is only partially reduced in LAL+/+ mice injected with lal-/- macrophages (LAL-/- into +/+).

Macrophage cells (lal+/+ or lal-/- ) were loaded with 50 µg/ml [3H]CE-acLDL for 24 hours and injected into LAL+/+ or LAL-/- mice as indicated. Plasma and feces were collected at 24 and 48 hours post-injection and [3H]sterols were extracted and quantified by LSC. (B) From aliquots of plasma taken at 48 hours, ApoB-containing lipoproteins

(LDL, VLDL) were precipitated using a sodium phosphotungstate solution and [3H]sterols were quantified in the

HDL-containing supernatant fraction by LSC. The LDL and VLDL counts were calculated by subtracting from the total plasma [3H]sterols. Error bars are the standard error of the mean (*p<0.05, One-way ANOVA, significantly different compared to LAL+/+ into LAL+/+, n(+/+ into +/+,-/- into +/+, -/- into -/-) =27, 19, 30, respectively).

113

3.4 Discussion

The removal of excess cholesterol by macrophages in the artery wall by efflux is thought to be an important protective mechanism against atherosclerosis through the reverse cholesterol transport pathway (148). However, the contribution of different pools of intracellular cholesterol that the cell uses to regulate gene expression and promote cholesterol efflux and thus RCT are poorly understood. Here we show that when lysosomal cholesterol egress is blocked in LAL deficient macrophages, there is a dysregulation of the cholesterol transporters ABCA1 and

ABCG1 and reduced cholesterol efflux (Figures 3.1and 3.3). These data also demonstrate that this impaired ability of LAL-/- macrophages to release excess intracellular cholesterol significantly diminishes the flux of cholesterol through the RCT pathway to the feces in vivo

(Figure 3.6).

Reduced LAL activity results in reduced flux of cholesterol from the late endosomes and lysosomes (LE/LY), reduced trafficking of cholesterol to intracellular sites necessary for generation of oxysterols necessary to activate LXR, and upregulate genes involved in RCT.

We’ve previously shown reduced regulation of ABCA1 and formation of HDL in fibroblasts from patients with CESD, providing a reason for the low HDL-C seen in CESD (384). This was also confirmed in LAL knockout mouse primary dermal fibroblasts, which also exhibit impaired

LDL-dependent upregulation of ABCA1 (Figure 3.5). Therefore, it is likely that expression of efflux cholesterol genes such as ABCA1, ABCG1 and cholesterol efflux observed in macrophage LAL deficiency (Figures 3.1,2,3) are reduced by a similar mechanism.

We unexpectedly observed a significant residual level of acLDL-CE hydrolysis and apparent LAL activity (Supplemental Figure 3.7B) was taking place, despite the confirmed

114

absence of LAL transcript in LAL-/- macrophages (Supplemental Figure 3.7C), which could not be further inhibited using chloroquine (Supplemental Figure 3.7A). Like LDL, acetylated

LDL particles are taken up by endocytosis and cholesteryl esters are broken down in the lysosomes (59,298). However, Wang and colleagues have shown that LDL and acLDL are trafficked to different endosomal compartments and the cholesterol pools from either LDL or acLDL are functionally distinct (397). It is possible that some acetylated LDL-CE may escape the LAL-containing lysosomes or may be hydrolyzed by neutral hydrolases in other parts of the cell. Alternatively, although LAL is the only known lipase to hydrolyze cholesteryl esters at acidic pH within the cell (258,323), the acidic hydrolysis (at pH 5) of the artificial substrate 4-

MUO by macrophage cell lysates (Supplemental Figure 3.7B) raises the possibility of the existence of another acid CE hydrolase in mouse macrophages.

Despite this residual hydrolysis, however, LAL deficiency has a major impact on ABCA1 and ABCG1 protein expression and significantly reduces cholesterol efflux, meaning that the source of this LAL-independent hydrolysis does not channel cholesterol to the key sites of oxysterol generation to upregulate LXR-dependent genes in the absence of LAL. This is reinforced by the findings of Ouimet et al. (398), indicating that LAL is also essential for hydrolysis of cytoplasmic lipid droplet cholesteryl esters. Therefore, even in the case where CE hydrolysis, and re-esterification by ACAT may occur (292), these CEs would still be returned to the lysosome via autophagy ultimately to be hydrolyzed by LAL (398), which our data suggests is necessary for UC to reach the regulatory pool for LXR activation of ABCA1 (and ABCG1).

The expression of several genes important in the RCT pathway were analyzed in liver homogenates of wild-type and LAL knockout mice. The mRNA levels of the membrane

115

transporters ABCG5 and G8, which play crucial roles in biliary cholesterol export (130), were significantly reduced in LAL-/- liver, as was cholesterol 7-α hydroxylase (CYP7A1), which performs the rate limiting step in bile acid synthesis (Figure 3.4). These genes are known to be

LXR-responsive in normal mouse liver (110,399,400). Therefore, in LAL-/- mice, the reduced release of cholesterol from lysosomal CE hydrolysis may reduce the pool of unesterified cholesterol available to stimulate LXR-dependent expression of these genes in the liver.

Interestingly, ABCG5/G8 and CYP7A1 expression are also reduced in the liver in a mouse model of inflammation where macrophage to feces RCT is shown to be impaired (153). In this regard, inflammation in the LAL knockout mouse (401,402) might indirectly alter gene expression in the liver and negatively impact RCT. The levels of SR-BI transcript were not significantly altered in LAL-/- mouse liver (Figure 3.4). SR-BI has an LXR-response element in its promoter (403) and its expression is increased with LXR agonists in HepG2 cells in vitro

(404). However, SR-BI expression in the liver of mice was not increased by cholesterol feeding

(405) or with the LXR agonist TO901317 (27), suggesting that it is not functionally LXR- responsive in vivo. The transcription factor SREBP also has a dominant negative effect on LXR activation (406) and SREBP activation would be expected to be increased in LAL-deficient cells

(292), therefore SR-BI upregulation by LXR might be suppressed .

Curiously, the mRNA and protein levels of ABCA1 and ABCG1 in the liver don’t seem to correspond. While liver ABCA1 mRNA transcripts are equal between genotypes, and ABCG1 is significantly increased in LAL-/- mice, the levels of ABCA1 and ABCG1 protein are much decreased in LAL knockout mice (Figures 3.4 and 3.5). ABCA1 expression is differentially regulated in different tissues (283) and is not thought to be LXR-dependent in the mouse liver as hepatic ABCA1 levels are not increased in the liver of mice treated with LXR agonists 116

(407,408). Wang and colleagues (390) showed that ABCA1 and ABCG1 mRNA and protein, and cholesterol efflux are low in NPC null mouse macrophages, but increased in primary hepatocytes. This indicates that, unlike in macrophages or fibroblasts, the flux of cholesterol out of the lysosomes does not regulate gene expression of these two transporters in the liver.

However, ABCA1 and ABCG1 protein levels seem to be negatively affected at the post- transcriptional level since their levels are markedly decreased in LAL deficient mouse liver.

Interestingly, the tissues where ABCA1 was lower in LAL-/- mice (liver, spleen, kidney)

(Figure 3.5) also happen to be the tissues where LAL is more highly expressed, and where CE and TG accumulation is most prominent (323,324). Our data (Supplemental Figure 3.8), using a lysis buffer other than maltoside, which is more effective at extracting membrane proteins specifically, shows ABCA1 total protein levels are the same. Therefore it is possible that, although transcriptional regulation seems to be unaffected, the proteins are being degraded at the plasma membrane more rapidly in LAL-/- hepatic cells. LAL knockout mice have insulin resistance and high plasma free fatty acids compared to wild-type mice (324) and unsaturated free fatty acids are known to destabilize ABCA1 protein at the plasma membrane (409) and in

HepG2 cells (410). Also, since whole liver homogenates were used, this would represent a mixed population of cells, including the macrophage-like Kupffer cells. The levels of ABCA1 and

ABCG1 were significantly lower in peripheral macrophages (Figure 3.1 and 3.2). Although

Kupffer cells, normally only make up approximately 10% of the resting population of liver cells

(411,412), there is evidence that the Kupffer cell population is expanded in LAL knockout mice

(324). Therefore, although Kupffer cells normally express ABCA1 and ABCG1 highly

(413,414), it is tempting to speculate that that Kupffer cells of LAL-/- mice would have reduced expression, as in peritoneal macrophages, which might be confounding the results.

117

Ultimately, the absence of LAL in macrophages resulted in reduced macrophage RCT to feces in knockout mice injected with macrophages of the same genotype (Figure 3.6), indicating that lysosomal cholesterol from LAL-mediated cholesteryl ester hydrolysis is not only important for regulating gene expression and cholesterol efflux from macrophages, but is also plays a critical role in the RCT pathway. Similarly, other studies have shown that ABCA1 (and ABCG1) deficiency impairs macrophage RCT (150,395). Therefore, the differences in macrophage RCT observed in LAL knockout mice could be directly related to differences in macrophage ABCA1 and ABCG1 expression and reduced UC available for efflux. LAL-/- mice are reported to have low plasma HDL cholesterol levels and the HDL peaks of FPLC profiles from LAL knockout mice are shifted to the right compared to wild-type mice (324), suggesting smaller particle sizes.

This might be explained by the reduced ABCA1 and ABCG1 levels in several tissues of LAL knockout mice, including the liver (Figure 3.5), since these transporters are important for cholesterol efflux and nascent HDL formation (77,83,185). Indeed, our data that LAL-/- macrophages had reduced cholesterol efflux to plasma of LAL-/- mice (Figure 3.6A) supports this. Adenovirus-mediated expression of LAL in LAL-/- mice increases plasma HDL-C levels compared to uninfected mice (326), providing further evidence that HDL cholesterol levels are related to LAL activity. Similarly, when LAL-/- macrophages were injected into LAL+/+ mice, there was a correction of macrophage RCT (Figure 3.6), consistent with the uptake of endogenous LAL in the peritoneal cavity of wild-type mice by LAL-/- macrophages, suggesting that LAL is sufficient to restore macrophage RCT.

These findings implicate LAL as an important player in the RCT pathway and may have a protective role in prevention of atherogenesis. The association of LAL deficiency with the development and progression of atherosclerosis has been studied both in mice and humans. LAL 118

and apoE double knockout mice have rapidly progressing and severe atherosclerotic lesion development compared to apoE-deficient mice alone and LAL-deficient mice on an LDLR-/- background die of cardiac thrombotic events after only 5 days on a high fat/high cholesterol diet

(337). Conversely, supplementation of LDL receptor-deficient mice with a macrophage-specific form of recombinant human LAL produced in Pitchia pastoris prevented early lesion formation and drastically reduced the size of pre-existing advanced lesions (336). NPC/LDLR double knockout mice have accelerated atherosclerosis on a high fat diet, despite having lower plasma cholesterol levels (415). It is suggested that NPC deficiency impacts macrophage intracellular cholesterol trafficking and homeostasis through LXR since 27-OH production was low, as it is in

CESD fibroblasts (384). Human CESD patients are typically hypercholesterolemic, have low plasma HDL-C (310,312) and increased risk for premature atherosclerosis (317,327). In addition,

CESD is thought to be under-diagnosed in the population and LAL deficiency may be more prevalent among people with low HDL-C and premature cardiovascular disease than previously thought (333,416). Together with the current data, this suggests that lysosomal cholesterol plays a critical role in regulation of lipid and cholesterol transporters for removal of excess cholesterol from peripheral cells, including macrophages, but that this also has a significantly impact on the whole body flux of cholesterol through the RCT pathway.

119

3.5 Supplementary data

3.5.1 Supplemental figures

Figure 3.7 Investigation of residual CE hydrolysis in LAL-/- macrophages.

Macrophages were labeled with [3H]CE-acLDL for 24 hours with cells treated with 50 µM chloroquine for one hour prior to and during [3H]CE-acLDL labelling, and cellular [3H]CE (A) and [3H]UC (B) were analyzed as in figure

2.3. C) Acid CE-hydrolase activity from macrophage cell lysates was measured by fluorescence of cleaved 4-MUO substrate in vitro at pH 5. D) RNA was extracted from macrophages and reverse transcribed to cDNA as in Figure 1.

LAL and m-cyc transcripts were amplified by PCR and separated on 1.1% agarose gels. (A, B) Results are the standard error of the mean from 5 separate experiments (*p<0.05, Two-way ANOVA, significantly different from

LAL+/+). (C) Results are the standard error of the mean (*p<0.05, one-tailed t-test, significantly different from

LAL+/+, n = 4). (D) Results are representative of 2 separate experiments with similar results.

120

Figure 3.8 A comparison of ABCA1 protein expression in mouse liver using different homogenization buffers.

Livers were dissected from LAL+/+ and LAL-/- mice and tissue sections were homogenized in either buffer A

(20mM Tris, 5mM EDTA, 5mM EGTA, 0.5% maltoside and protease inhibitor) or buffer B (20mM Hepes, 1mM

ETDA, 250mM sucrose, 100mM sodium pyrophosphate, 10mM sodium orthovanadate, 100mM sodium fluoride).

Results are representative of multiple Western blots using tissue homogenates from 6 LAL+/+ mice and 6 LAL-/- mice.

121

CHAPTER 4: CONCLUDING REMARKS

4.1 Summary and discussion

Cardiovascular disease (CVD) is the leading cause of death in adults worldwide (1). While current therapies such as statin drugs and cholesterol absorption inhibitors are effective at lowering LDL-C and reducing the risk of CAD by about 30%, there is still clearly a need for strategies to further reduce morbidity and mortality from this devastating disease. Low levels of high density lipoproteins (HDL) are one of the strongest predictors of risk for CVD (358), however effective methods of increasing HDL formation clinically – shown to markedly reduce atherosclerosis in animal models – are not currently available. An enhanced understanding of the pathways cells use to initiate HDL formation is required to design novel therapies to increase

HDL formation clinically. Among the anti-atherogenic properties of HDL is its ability to reduce cellular cholesterol burden by promoting reverse cholesterol transport from cells within the arterial intima to promote excretion of this essential but potentially toxic molecule (68,148). The membrane transporter ABCA1 plays an essential role in this pathway by mediating the efflux of phospholipids and cholesterol to apolipoprotein acceptors during initial HDL particle formation

(7). It is known that ABCA1 is upregulated in response to cellular cholesterol loading by generation of oxysterols that activate ABCA1 gene transcription through a pathway mediated by

LXR (8,9). However, the intracellular sources of cholesterol that promote ABCA1 regulation and become a substrate for efflux are poorly understood.

In this thesis, we proposed that the flux of cholesterol from the lysosomal compartment was the most important for regulation of ABCA1 expression and cholesterol efflux for HDL particle generation and RCT. Specifically, we set out to understand the role of the enzyme responsible

122

for acidic hydrolysis of cholesteryl esters from LDL taken up via endocytosis on the ABCA1 pathway.

In chapter 2 it was shown that patient-derived fibroblasts from individuals with CESD had significantly reduced basal ABCA1 expression and blunted upregulation with LDL cholesterol loading. This results in impaired ABCA1-mediated phospholipid and cholesterol efflux to apoA-

I, reduced formation of alpha-migrating HDL particles in the medium, which we demonstrated is likely due to impaired generation of oxysterols in response to cholesterol loading which would impact ABCA1 expression via the LXR pathway. We’ve shown that lysosomal acid lipase is both necessary and sufficient for regulation of ABCA1 expression and function by inhibiting

LAL activity in normal cells and re-introducing exogenous LAL using either conditioned medium from normal fibroblasts containing secreted LAL or by addition of purified recombinant human LAL. The effect of LAL deficiency in these studies indicates that lysosomal cholesterol derived from LAL-mediated hydrolysis of LDL-CE is the most critical for regulation of ABCA1 expression and cellular efflux, despite increased endocytosis via the LDL receptor and impaired suppression of de novo cholesterol synthesis reported in CESD fibroblasts (237,287), indicating that the regulatory pool of cholesterol within the cell is not sufficient to promote ABCA1 regulation in conditions of slowed release of lysosomal cholesterol. Significantly, we also demonstrated for the first time that the likely cause of low HDL in CESD patients was due to impaired ABCA1 expression and activity due to impaired intracellular lysosomal LDL-CE hydrolysis.

In chapter 3, the importance of LAL in macrophages and its influence on whole body RCT was investigated. Macrophage foam cells are a prominent feature during atherogenesis and neutral lipid and CE accumulation in Kupffer cells within the liver and foamy macrophage 123

infiltration into tissues is a prominent feature in LAL deficiency in both humans and animal models (361,362). LAL deficiency enhances lesion development in mouse models of atherosclerosis (337,363), however, supplementation of LDL receptor-deficient mice with macrophage-specific recombinant LAL prevents early lesion formation and drastically reduced the size of pre-existing advanced lesions (336). Therefore, we proposed that complete deficiency of LAL in macrophages causing a buildup of modified LDL-derived CE within lysosomes would have a negative impact on the ABCA1 pathway for cholesterol efflux, thus contributing to foam cell formation and ultimately leading to impairment of RCT in the body.

In addition to skin fibroblasts, it was shown that peritoneal macrophages derived from LAL knockout mice had a significant impairment of ABCA1 expression and cholesterol efflux.

Modern techniques to trace the movement of cholesterol from macrophages through the RCT pathway to the feces were employed by injecting normal and LAL deficient macrophages into wild-type and LAL knockout mice, indicating that lysosomal CE hydrolysis by LAL is also critical for RCT from macrophages. This has significance in the context of atherosclerosis, where macrophage foam cells accumulate in the earlier stages of the developing plaque and excess cholesterol from modified LDL uptake must be removed via the RCT pathway in order to maintain cellular cholesterol homeostasis and prevent plaque progression (114).

Ouimet and colleagues (297) importantly showed that LAL is required not only for initial hydrolysis of LDL-CEs but is essential for hydrolysis of cytoplasmic CE stored in lipid droplets, which must return to the lysosomes via autophagy to be hydrolyzed by LAL before cholesterol is available for efflux. This reinforces our current findings and emphasizes the role of LAL and lysosomal cholesterol in ABCA1 regulation and RCT.

124

In summary, with these studies we’ve shown that impaired LAL activity affects HDL cholesterol metabolism in detail at the cellular level and followed up on the effects on whole body RCT in vivo and these principles have been demonstrated in multiple cell types in both human disease and mouse models of LAL deficiency which we believe provides strength to the current research.

4.2 Future directions

Novel screening and treatment options for LAL deficiency syndromes such as enzyme replacement therapy or improved screening methods to detect LAL deficiency in the population are currently being developed and tested clinically. Since CESD is under diagnosed in the general population (416), this is also important as LAL deficiency may be the underlying cause for many individuals currently diagnosed with similar presentation such as non-alcoholic hepatic steatosis, metabolic syndrome or hypoalphalipoproteinemia (416). Given our current findings that LAL deficiency leads to impaired HDL formation and RCT, enhancement of LAL activity or LAL enzyme therapy may help to increase the movement of cholesterol through the lysosomes, which is critical for ABCA1 regulation and cholesterol efflux to prevent buildup of cholesterol in the arteries which causes atherosclerosis and potentially cause premature CVD.

Some limitations of these studies, however, include the use of the species Mus musculus as a model for atherosclerosis and the focus placed on macrophages for the study of RCT in the context of atherosclerosis. Lipoprotein metabolism in mice differs from humans in several ways.

For example, mice carry most of their cholesterol in plasma on HDL particles, while they do not have CETP to mediate transfer of cholesterol to LDL. While macrophages appear to be the major cholesterol-accumulating cell type within lesions of mice made genetically susceptible to atherosclerosis (393), this dogma of macrophage foam cell formation recently being called into

125

question in the context of human atherogenesis. Studies suggest that smooth muscle cells (57) and dendritic cells (417,418) may also play an important role in lesion development and progression in human cardiovascular disease. Therefore, it is important to consider the relevance of applying such animal models to the study of human atherosclerosis and future studies would benefit from study of RCT from other cell types and other animal models as well. While deficiency of LAL has a negative impact on plasma lipoprotein metabolism including HDL formation, RCT and increased atherosclerosis in human CESD and WD and in mouse models, as presented here and in (317,327,328,336,337), it appears that increased LAL activity may also contribute to atherosclerosis. Recent GWAS studies suggest that increased LAL expression is also associated with higher risk of CVD. Evidence that uptake of oxidized or aggregated LDL impairs ABCA1 expression in macrophages (355) suggests that this might be a mechanism for impairment of cellular LAL activity in normal individuals affected by CVD. Also, secreted LAL has been shown to hydrolyze LDL extracellularly (352,354) and enhanced LAL activity (261) as well as enzymatically modified LDL has been detected in human atherosclerotic lesions

(261,354), which may contribute to the buildup of cholesterol in the artery wall, thus contributing to atherogenesis. It is possible that in this context, an increase in LAL activity may become pathogenic. Therefore, it is clear that further investigation into the role of LAL in human atherosclerosis is needed in order to determine the optimal level of LAL activity; the minimum activity to promote lysosomal cholesterol flux for regulation of HDL formation and RCT, or the maximum level of activity that becomes pathogenic in the context of atherosclerosis. Our research suggests that reduction of LAL activity is detrimental as it leads to reduced expression of ABCA1 and reduced HDL-C formation. These findings are consistent with, along with increased LDL-C levels, the increased risk of premature atherosclerosis in CESD (317). While

126

LAL deficiency in the forms of Wolman Disease or CESD may still be relatively rare, it is known that LAL activity in macrophages is reduced in response to exposure to oxidized LDL

(299,301). This suggests that there may be a relative deficiency of LAL activity in the atherosclerotic plaque that may benefit in terms of increasing ABCA1 expression by supplementing LAL or activating its expression as a novel treatment for atherosclerosis. While we did not see further enhancement of ABCA1 expression in LAL+/+ mouse macrophages by adding additional LAL enzyme to the medium, this does not rule out the possibility that such supplementation may benefit cells in the plaque where LAL activity is reduced, and thereby assist with enhancing ABCA1 expression and increasing efflux of cholesterol from these cells.

Future research will be needed to understand the complexity of the role of intracellular LAL vs. extracellular secreted LAL on lipoprotein and cholesterol metabolism in order that therapies may be targeted towards LAL in the interest of promoting RCT and reducing the risk of cardiovascular disease.

127

References

1. Murray, C. J., and Lopez, A. D. (1997) Global mortality, disability, and the contribution of risk factors: Global Burden of Disease Study. Lancet 349, 1436-1442 2. Canada, S. (2011) Mortality, summary list of causes 2008. 3. Canada, P. H. A. o. (2009) Tracking Heart Disease and Stroke in Canada, 2009. . 4. Canada, C. B. o. (2010) The Canadian Heart Health Strategy: Risk Factors and Future Cost Implications Report. 5. Brown, M. S., and Goldstein, J. L. (1983) Lipoprotein metabolism in the macrophage: implications for cholesterol deposition in atherosclerosis. Annual review of biochemistry 52, 223-261 6. Steinberg, D. (2004) Thematic review series: the pathogenesis of atherosclerosis. An interpretive history of the cholesterol controversy: part I. J Lipid Res 45, 1583-1593 7. Oram, J. F., and Heinecke, J. W. (2005) ATP-binding cassette transporter A1: a cell cholesterol exporter that protects against cardiovascular disease. Physiological reviews 85, 1343-1372 8. Costet, P., Luo, Y., Wang, N., and Tall, A. R. (2000) Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J Biol Chem 275, 28240- 28245 9. Schwartz, K., Lawn, R. M., and Wade, D. P. (2000) ABC1 gene expression and ApoA-I- mediated cholesterol efflux are regulated by LXR. Biochem Biophys Res Commun 274, 794-802 10. Chen, W., Chen, G., Head, D. L., Mangelsdorf, D. J., and Russell, D. W. (2007) Enzymatic reduction of oxysterols impairs LXR signaling in cultured cells and the livers of mice. Cell metabolism 5, 73-79 11. Yang, C., McDonald, J. G., Patel, A., Zhang, Y., Umetani, M., Xu, F., Westover, E. J., Covey, D. F., Mangelsdorf, D. J., Cohen, J. C., and Hobbs, H. H. (2006) Sterol intermediates from cholesterol biosynthetic pathway as liver X receptor ligands. J Biol Chem 281, 27816-27826 12. Kandutsch, A. A., Chen, H. W., and Heiniger, H. J. (1978) Biological activity of some oxygenated sterols. Science 201, 498-501 13. Choi, H. Y., Karten, B., Chan, T., Vance, J. E., Greer, W. L., Heidenreich, R. A., Garver, W. S., and Francis, G. A. (2003) Impaired ABCA1-dependent lipid efflux and hypoalphalipoproteinemia in human Niemann-Pick type C disease. J Biol Chem 278, 32569-32577 14. Goldstein, J. L., DeBose-Boyd, R. A., and Brown, M. S. (2006) Protein sensors for membrane sterols. Cell 124, 35-46 15. Sakai, J., Nohturfft, A., Cheng, D., Ho, Y. K., Brown, M. S., and Goldstein, J. L. (1997) Identification of complexes between the COOH-terminal domains of sterol regulatory element-binding proteins (SREBPs) and SREBP cleavage-activating protein. J Biol Chem 272, 20213-20221 16. Sun, L. P., Li, L., Goldstein, J. L., and Brown, M. S. (2005) Insig required for sterol- mediated inhibition of Scap/SREBP binding to COPII proteins in vitro. J Biol Chem 280, 26483-26490

128

17. Yokoyama, C., Wang, X., Briggs, M. R., Admon, A., Wu, J., Hua, X., Goldstein, J. L., and Brown, M. S. (1993) SREBP-1, a basic-helix-loop-helix-leucine zipper protein that controls transcription of the low density lipoprotein receptor gene. Cell 75, 187-197 18. Horton, J. D., Goldstein, J. L., and Brown, M. S. (2002) SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest 109, 1125-1131 19. Yang, T., Espenshade, P. J., Wright, M. E., Yabe, D., Gong, Y., Aebersold, R., Goldstein, J. L., and Brown, M. S. (2002) Crucial step in cholesterol homeostasis: sterols promote binding of SCAP to INSIG-1, a membrane protein that facilitates retention of SREBPs in ER. Cell 110, 489-500 20. Adams, C. M., Reitz, J., De Brabander, J. K., Feramisco, J. D., Li, L., Brown, M. S., and Goldstein, J. L. (2004) Cholesterol and 25-hydroxycholesterol inhibit activation of SREBPs by different mechanisms, both involving SCAP and Insigs. J Biol Chem 279, 52772-52780 21. Yabe, D., Brown, M. S., and Goldstein, J. L. (2002) Insig-2, a second endoplasmic reticulum protein that binds SCAP and blocks export of sterol regulatory element-binding proteins. Proc Natl Acad Sci U S A 99, 12753-12758 22. Song, B. L., Javitt, N. B., and DeBose-Boyd, R. A. (2005) Insig-mediated degradation of HMG CoA reductase stimulated by lanosterol, an intermediate in the synthesis of cholesterol. Cell metabolism 1, 179-189 23. Song, B. L., Sever, N., and DeBose-Boyd, R. A. (2005) Gp78, a membrane-anchored ubiquitin ligase, associates with Insig-1 and couples sterol-regulated ubiquitination to degradation of HMG CoA reductase. Molecular cell 19, 829-840 24. Sever, N., Yang, T., Brown, M. S., Goldstein, J. L., and DeBose-Boyd, R. A. (2003) Accelerated degradation of HMG CoA reductase mediated by binding of insig-1 to its sterol-sensing domain. Molecular cell 11, 25-33 25. Radhakrishnan, A., Ikeda, Y., Kwon, H. J., Brown, M. S., and Goldstein, J. L. (2007) Sterol-regulated transport of SREBPs from endoplasmic reticulum to Golgi: oxysterols block transport by binding to Insig. Proc Natl Acad Sci U S A 104, 6511-6518 26. Jeon, H., Meng, W., Takagi, J., Eck, M. J., Springer, T. A., and Blacklow, S. C. (2001) Implications for familial hypercholesterolemia from the structure of the LDL receptor YWTD-EGF domain pair. Nature structural biology 8, 499-504 27. Grefhorst, A., Oosterveer, M. H., Brufau, G., Boesjes, M., Kuipers, F., and Groen, A. K. (2012) Pharmacological LXR activation reduces presence of SR-B1 in liver membranes contributing to LXR-mediated induction of HDL-cholesterol. Atherosclerosis 222, 382- 389 28. Goldstein, J. L., and Brown, M. S. (2009) The LDL receptor. Arterioscler Thromb Vasc Biol 29, 431-438 29. Goldstein, J. L., and Brown, M. S. (1973) Familial hypercholesterolemia: identification of a defect in the regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity associated with overproduction of cholesterol. Proc Natl Acad Sci U S A 70, 2804-2808 30. Goldstein, J. L., and Brown, M. S. (1974) Binding and degradation of low density lipoproteins by cultured human fibroblasts. Comparison of cells from a normal subject and from a patient with homozygous familial hypercholesterolemia. J Biol Chem 249, 5153-5162 129

31. Schneider, W. J., Beisiegel, U., Goldstein, J. L., and Brown, M. S. (1982) Purification of the low density lipoprotein receptor, an acidic glycoprotein of 164,000 molecular weight. J Biol Chem 257, 2664-2673 32. Yamamoto, T., Davis, C. G., Brown, M. S., Schneider, W. J., Casey, M. L., Goldstein, J. L., and Russell, D. W. (1984) The human LDL receptor: a cysteine-rich protein with multiple Alu sequences in its mRNA. Cell 39, 27-38 33. Sudhof, T. C., Goldstein, J. L., Brown, M. S., and Russell, D. W. (1985) The LDL receptor gene: a mosaic of exons shared with different proteins. Science 228, 815-822 34. Anderson, R. G., Brown, M. S., and Goldstein, J. L. (1977) Role of the coated endocytic vesicle in the uptake of receptor-bound low density lipoprotein in human fibroblasts. Cell 10, 351-364 35. Chen, W. J., Goldstein, J. L., and Brown, M. S. (1990) NPXY, a sequence often found in cytoplasmic tails, is required for coated pit-mediated internalization of the low density lipoprotein receptor. J Biol Chem 265, 3116-3123 36. Brown, M. S., and Goldstein, J. L. (1976) Receptor-mediated control of cholesterol metabolism. Science 191, 150-154 37. Basu, S. K., Goldstein, J. L., Anderson, R. G., and Brown, M. S. (1981) Monensin interrupts the recycling of low density lipoprotein receptors in human fibroblasts. Cell 24, 493-502 38. Goldstein, J. L., Dana, S. E., and Brown, M. S. (1974) Esterification of low density lipoprotein cholesterol in human fibroblasts and its absence in homozygous familial hypercholesterolemia. Proc Natl Acad Sci U S A 71, 4288-4292 39. Chang, T. Y., Chang, C. C., and Cheng, D. (1997) Acyl-coenzyme A:cholesterol acyltransferase. Annual review of biochemistry 66, 613-638 40. Koshland, D. E., Jr., and Neet, K. E. (1968) The catalytic and regulatory properties of enzymes. Annual review of biochemistry 37, 359-410 41. Monod, J., Changeux, J. P., and Jacob, F. (1963) Allosteric proteins and cellular control systems. Journal of molecular biology 6, 306-329 42. Lambert, G., Sjouke, B., Choque, B., Kastelein, J. J., and Hovingh, G. K. (2012) The PCSK9 decade. J Lipid Res 53, 2515-2524 43. Maxwell, K. N., Fisher, E. A., and Breslow, J. L. (2005) Overexpression of PCSK9 accelerates the degradation of the LDLR in a post-endoplasmic reticulum compartment. Proc Natl Acad Sci U S A 102, 2069-2074 44. Park, S. W., Moon, Y. A., and Horton, J. D. (2004) Post-transcriptional regulation of low density lipoprotein receptor protein by proprotein convertase subtilisin/kexin type 9a in mouse liver. J Biol Chem 279, 50630-50638 45. Zhao, Z., Tuakli-Wosornu, Y., Lagace, T. A., Kinch, L., Grishin, N. V., Horton, J. D., Cohen, J. C., and Hobbs, H. H. (2006) Molecular characterization of loss-of-function mutations in PCSK9 and identification of a compound heterozygote. American journal of human genetics 79, 514-523 46. Seidah, N. G., Benjannet, S., Wickham, L., Marcinkiewicz, J., Jasmin, S. B., Stifani, S., Basak, A., Prat, A., and Chretien, M. (2003) The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation. Proc Natl Acad Sci U S A 100, 928-933 47. Lagace, T. A., Curtis, D. E., Garuti, R., McNutt, M. C., Park, S. W., Prather, H. B., Anderson, N. N., Ho, Y. K., Hammer, R. E., and Horton, J. D. (2006) Secreted PCSK9 130

decreases the number of LDL receptors in hepatocytes and in livers of parabiotic mice. J Clin Invest 116, 2995-3005 48. Bottomley, M. J., Cirillo, A., Orsatti, L., Ruggeri, L., Fisher, T. S., Santoro, J. C., Cummings, R. T., Cubbon, R. M., Lo Surdo, P., Calzetta, A., Noto, A., Baysarowich, J., Mattu, M., Talamo, F., De Francesco, R., Sparrow, C. P., Sitlani, A., and Carfi, A. (2009) Structural and biochemical characterization of the wild type PCSK9-EGF(AB) complex and natural familial hypercholesterolemia mutants. J Biol Chem 284, 1313-1323 49. Lo Surdo, P., Bottomley, M. J., Calzetta, A., Settembre, E. C., Cirillo, A., Pandit, S., Ni, Y. G., Hubbard, B., Sitlani, A., and Carfi, A. (2011) Mechanistic implications for LDL receptor degradation from the PCSK9/LDLR structure at neutral pH. EMBO reports 12, 1300-1305 50. Dubuc, G., Chamberland, A., Wassef, H., Davignon, J., Seidah, N. G., Bernier, L., and Prat, A. (2004) Statins upregulate PCSK9, the gene encoding the proprotein convertase neural apoptosis-regulated convertase-1 implicated in familial hypercholesterolemia. Arterioscler Thromb Vasc Biol 24, 1454-1459 51. Horton, J. D., Shah, N. A., Warrington, J. A., Anderson, N. N., Park, S. W., Brown, M. S., and Goldstein, J. L. (2003) Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci U S A 100, 12027-12032 52. Brown, M. S., and Goldstein, J. L. (1999) A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc Natl Acad Sci U S A 96, 11041- 11048 53. Faggiotto, A., and Ross, R. (1984) Studies of hypercholesterolemia in the nonhuman primate. II. Fatty streak conversion to fibrous plaque. Arteriosclerosis 4, 341-356 54. Faggiotto, A., Ross, R., and Harker, L. (1984) Studies of hypercholesterolemia in the nonhuman primate. I. Changes that lead to fatty streak formation. Arteriosclerosis 4, 323- 340 55. Glass, C. K., and Witztum, J. L. (2001) Atherosclerosis. the road ahead. Cell 104, 503- 516 56. Allahverdian, S., and Francis, G. A. (2010) Cholesterol homeostasis and high-density lipoprotein formation in arterial smooth muscle cells. Trends in cardiovascular medicine 20, 96-102 57. Allahverdian, S., Pannu, P. S., and Francis, G. A. (2012) Contribution of monocyte- derived macrophages and smooth muscle cells to arterial foam cell formation. Cardiovascular research 95, 165-172 58. Steinberg, D., Parthasarathy, S., Carew, T. E., Khoo, J. C., and Witztum, J. L. (1989) Beyond cholesterol. Modifications of low-density lipoprotein that increase its atherogenicity. The New England journal of medicine 320, 915-924 59. Goldstein, J. L., Ho, Y. K., Basu, S. K., and Brown, M. S. (1979) Binding site on macrophages that mediates uptake and degradation of acetylated low density lipoprotein, producing massive cholesterol deposition. Proc Natl Acad Sci U S A 76, 333-337 60. Krieger, M., and Herz, J. (1994) Structures and functions of multiligand lipoprotein receptors: macrophage scavenger receptors and LDL receptor-related protein (LRP). Annual review of biochemistry 63, 601-637

131

61. Zhang, H., Yang, Y., and Steinbrecher, U. P. (1993) Structural requirements for the binding of modified proteins to the scavenger receptor of macrophages. J Biol Chem 268, 5535-5542 62. Greaves, D. R., and Gordon, S. (2005) Thematic review series: the immune system and atherogenesis. Recent insights into the biology of macrophage scavenger receptors. J Lipid Res 46, 11-20 63. Febbraio, M., Abumrad, N. A., Hajjar, D. P., Sharma, K., Cheng, W., Pearce, S. F., and Silverstein, R. L. (1999) A null mutation in murine CD36 reveals an important role in fatty acid and lipoprotein metabolism. J Biol Chem 274, 19055-19062 64. Febbraio, M., Podrez, E. A., Smith, J. D., Hajjar, D. P., Hazen, S. L., Hoff, H. F., Sharma, K., and Silverstein, R. L. (2000) Targeted disruption of the class B scavenger receptor CD36 protects against atherosclerotic lesion development in mice. J Clin Invest 105, 1049-1056 65. Babaev, V. R., Gleaves, L. A., Carter, K. J., Suzuki, H., Kodama, T., Fazio, S., and Linton, M. F. (2000) Reduced atherosclerotic lesions in mice deficient for total or macrophage-specific expression of scavenger receptor-A. Arterioscler Thromb Vasc Biol 20, 2593-2599 66. Suzuki, H., Kurihara, Y., Takeya, M., Kamada, N., Kataoka, M., Jishage, K., Ueda, O., Sakaguchi, H., Higashi, T., Suzuki, T., Takashima, Y., Kawabe, Y., Cynshi, O., Wada, Y., Honda, M., Kurihara, H., Aburatani, H., Doi, T., Matsumoto, A., Azuma, S., Noda, T., Toyoda, Y., Itakura, H., Yazaki, Y., Kodama, T., and et al. (1997) A role for macrophage scavenger receptors in atherosclerosis and susceptibility to infection. Nature 386, 292-296 67. Manning-Tobin, J. J., Moore, K. J., Seimon, T. A., Bell, S. A., Sharuk, M., Alvarez-Leite, J. I., de Winther, M. P., Tabas, I., and Freeman, M. W. (2009) Loss of SR-A and CD36 activity reduces atherosclerotic lesion complexity without abrogating foam cell formation in hyperlipidemic mice. Arterioscler Thromb Vasc Biol 29, 19-26 68. Glomset, J. A. (1968) The plasma lecithins:cholesterol acyltransferase reaction. J Lipid Res 9, 155-167 69. Miller, G. J., and Miller, N. E. (1975) Plasma-high-density-lipoprotein concentration and development of ischaemic heart-disease. Lancet 1, 16-19 70. Ross, R., and Glomset, J. A. (1973) Atherosclerosis and the arterial smooth muscle cell: Proliferation of smooth muscle is a key event in the genesis of the lesions of atherosclerosis. Science 180, 1332-1339 71. Tabas, I. (2004) Apoptosis and plaque destabilization in atherosclerosis: the role of macrophage apoptosis induced by cholesterol. Cell death and differentiation 11 Suppl 1, S12-16 72. Hill, S. A., and McQueen, M. J. (1997) Reverse cholesterol transport--a review of the process and its clinical implications. Clinical biochemistry 30, 517-525 73. Green, P. H., Tall, A. R., and Glickman, R. M. (1978) Rat intestine secretes discoid high density lipoprotein. J Clin Invest 61, 528-534 74. Hamilton, R. L., Williams, M. C., Fielding, C. J., and Havel, R. J. (1976) Discoidal bilayer structure of nascent high density lipoproteins from perfused rat liver. J Clin Invest 58, 667-680

132

75. Schaefer, E. J., Blum, C. B., Levy, R. I., Jenkins, L. L., Alaupovic, P., Foster, D. M., and Brewer, H. B., Jr. (1978) Metabolism of high-density lipoprotein apolipoproteins in Tangier disease. The New England journal of medicine 299, 905-910 76. Vaughan, A. M., and Oram, J. F. (2006) ABCA1 and ABCG1 or ABCG4 act sequentially to remove cellular cholesterol and generate cholesterol-rich HDL. J Lipid Res 47, 2433- 2443 77. Kennedy, M. A., Barrera, G. C., Nakamura, K., Baldan, A., Tarr, P., Fishbein, M. C., Frank, J., Francone, O. L., and Edwards, P. A. (2005) ABCG1 has a critical role in mediating cholesterol efflux to HDL and preventing cellular lipid accumulation. Cell metabolism 1, 121-131 78. Wang, N., Lan, D., Chen, W., Matsuura, F., and Tall, A. R. (2004) ATP-binding cassette transporters G1 and G4 mediate cellular cholesterol efflux to high-density lipoproteins. Proc Natl Acad Sci U S A 101, 9774-9779 79. Yancey, P. G., de la Llera-Moya, M., Swarnakar, S., Monzo, P., Klein, S. M., Connelly, M. A., Johnson, W. J., Williams, D. L., and Rothblat, G. H. (2000) High density lipoprotein phospholipid composition is a major determinant of the bi-directional flux and net movement of cellular free cholesterol mediated by scavenger receptor BI. J Biol Chem 275, 36596-36604 80. Kuivenhoven, J. A., Pritchard, H., Hill, J., Frohlich, J., Assmann, G., and Kastelein, J. (1997) The molecular pathology of lecithin:cholesterol acyltransferase (LCAT) deficiency syndromes. J Lipid Res 38, 191-205 81. Ng, D. S., Francone, O. L., Forte, T. M., Zhang, J., Haghpassand, M., and Rubin, E. M. (1997) Disruption of the murine lecithin:cholesterol acyltransferase gene causes impairment of adrenal lipid delivery and up-regulation of scavenger receptor class B type I. J Biol Chem 272, 15777-15781 82. Sakai, N., Vaisman, B. L., Koch, C. A., Hoyt, R. F., Jr., Meyn, S. M., Talley, G. D., Paiz, J. A., Brewer, H. B., Jr., and Santamarina-Fojo, S. (1997) Targeted disruption of the mouse lecithin:cholesterol acyltransferase (LCAT) gene. Generation of a new animal model for human LCAT deficiency. J Biol Chem 272, 7506-7510 83. Brousseau, M. E., Eberhart, G. P., Dupuis, J., Asztalos, B. F., Goldkamp, A. L., Schaefer, E. J., and Freeman, M. W. (2000) Cellular cholesterol efflux in heterozygotes for tangier disease is markedly reduced and correlates with high density lipoprotein cholesterol concentration and particle size. J Lipid Res 41, 1125-1135 84. Mendez, A. J. (1997) Cholesterol efflux mediated by apolipoproteins is an active cellular process distinct from efflux mediated by passive diffusion. J Lipid Res 38, 1807-1821 85. Albers, J. J., Bergelin, R. O., Adolphson, J. L., and Wahl, P. W. (1982) Population-based reference values for lecithin-cholesterol acyltransferase (LCAT). Atherosclerosis 43, 369- 379 86. Kuivenhoven, J. A., Stalenhoef, A. F., Hill, J. S., Demacker, P. N., Errami, A., Kastelein, J. J., and Pritchard, P. H. (1996) Two novel molecular defects in the LCAT gene are associated with fish eye disease. Arterioscler Thromb Vasc Biol 16, 294-303 87. Kuivenhoven, J. A., van Voorst tot Voorst, E. J., Wiebusch, H., Marcovina, S. M., Funke, H., Assmann, G., Pritchard, P. H., and Kastelein, J. J. (1995) A unique genetic and biochemical presentation of fish-eye disease. J Clin Invest 96, 2783-2791

133

88. Ayyobi, A. F., McGladdery, S. H., Chan, S., John Mancini, G. B., Hill, J. S., and Frohlich, J. J. (2004) Lecithin: cholesterol acyltransferase (LCAT) deficiency and risk of vascular disease: 25 year follow-up. Atherosclerosis 177, 361-366 89. Hoeg, J. M., Vaisman, B. L., Demosky, S. J., Jr., Meyn, S. M., Talley, G. D., Hoyt, R. F., Jr., Feldman, S., Berard, A. M., Sakai, N., Wood, D., Brousseau, M. E., Marcovina, S., Brewer, H. B., Jr., and Santamarina-Fojo, S. (1996) Lecithin:cholesterol acyltransferase overexpression generates hyperalpha-lipoproteinemia and a nonatherogenic lipoprotein pattern in transgenic rabbits. J Biol Chem 271, 4396-4402 90. Berard, A. M., Foger, B., Remaley, A., Shamburek, R., Vaisman, B. L., Talley, G., Paigen, B., Hoyt, R. F., Jr., Marcovina, S., Brewer, H. B., Jr., and Santamarina-Fojo, S. (1997) High plasma HDL concentrations associated with enhanced atherosclerosis in transgenic mice overexpressing lecithin-cholesteryl acyltransferase. Nature medicine 3, 744-749 91. Furbee, J. W., Jr., Sawyer, J. K., and Parks, J. S. (2002) Lecithin:cholesterol acyltransferase deficiency increases atherosclerosis in the low density lipoprotein receptor and apolipoprotein E knockout mice. J Biol Chem 277, 3511-3519 92. Lambert, G., Sakai, N., Vaisman, B. L., Neufeld, E. B., Marteyn, B., Chan, C. C., Paigen, B., Lupia, E., Thomas, A., Striker, L. J., Blanchette-Mackie, J., Csako, G., Brady, J. N., Costello, R., Striker, G. E., Remaley, A. T., Brewer, H. B., Jr., and Santamarina-Fojo, S. (2001) Analysis of glomerulosclerosis and atherosclerosis in lecithin cholesterol acyltransferase-deficient mice. J Biol Chem 276, 15090-15098 93. Mehlum, A., Muri, M., Hagve, T. A., Solberg, L. A., and Prydz, H. (1997) Mice overexpressing human lecithin: cholesterol acyltransferase are not protected against diet- induced atherosclerosis. APMIS : acta pathologica, microbiologica, et immunologica Scandinavica 105, 861-868 94. Ji, Y., Wang, N., Ramakrishnan, R., Sehayek, E., Huszar, D., Breslow, J. L., and Tall, A. R. (1999) Hepatic scavenger receptor BI promotes rapid clearance of high density lipoprotein free cholesterol and its transport into bile. J Biol Chem 274, 33398-33402 95. Wang, N., Arai, T., Ji, Y., Rinninger, F., and Tall, A. R. (1998) Liver-specific overexpression of scavenger receptor BI decreases levels of very low density lipoprotein ApoB, low density lipoprotein ApoB, and high density lipoprotein in transgenic mice. J Biol Chem 273, 32920-32926 96. Glass, C., Pittman, R. C., Weinstein, D. B., and Steinberg, D. (1983) Dissociation of tissue uptake of cholesterol ester from that of apoprotein A-I of rat plasma high density lipoprotein: selective delivery of cholesterol ester to liver, adrenal, and gonad. Proc Natl Acad Sci U S A 80, 5435-5439 97. Pittman, R. C., Knecht, T. P., Rosenbaum, M. S., and Taylor, C. A., Jr. (1987) A nonendocytotic mechanism for the selective uptake of high density lipoprotein-associated cholesterol esters. J Biol Chem 262, 2443-2450 98. Brundert, M., Ewert, A., Heeren, J., Behrendt, B., Ramakrishnan, R., Greten, H., Merkel, M., and Rinninger, F. (2005) Scavenger receptor class B type I mediates the selective uptake of high-density lipoprotein-associated cholesteryl ester by the liver in mice. Arterioscler Thromb Vasc Biol 25, 143-148 99. Rigotti, A., Trigatti, B. L., Penman, M., Rayburn, H., Herz, J., and Krieger, M. (1997) A targeted mutation in the murine gene encoding the high density lipoprotein (HDL)

134

receptor scavenger receptor class B type I reveals its key role in HDL metabolism. Proc Natl Acad Sci U S A 94, 12610-12615 100. Varban, M. L., Rinninger, F., Wang, N., Fairchild-Huntress, V., Dunmore, J. H., Fang, Q., Gosselin, M. L., Dixon, K. L., Deeds, J. D., Acton, S. L., Tall, A. R., and Huszar, D. (1998) Targeted mutation reveals a central role for SR-BI in hepatic selective uptake of high density lipoprotein cholesterol. Proc Natl Acad Sci U S A 95, 4619-4624 101. Kozarsky, K. F., Donahee, M. H., Rigotti, A., Iqbal, S. N., Edelman, E. R., and Krieger, M. (1997) Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 387, 414-417 102. Zhang, Y., Da Silva, J. R., Reilly, M., Billheimer, J. T., Rothblat, G. H., and Rader, D. J. (2005) Hepatic expression of scavenger receptor class B type I (SR-BI) is a positive regulator of macrophage reverse cholesterol transport in vivo. J Clin Invest 115, 2870- 2874 103. Arai, T., Wang, N., Bezouevski, M., Welch, C., and Tall, A. R. (1999) Decreased atherosclerosis in heterozygous low density lipoprotein receptor-deficient mice expressing the scavenger receptor BI transgene. J Biol Chem 274, 2366-2371 104. Braun, A., Trigatti, B. L., Post, M. J., Sato, K., Simons, M., Edelberg, J. M., Rosenberg, R. D., Schrenzel, M., and Krieger, M. (2002) Loss of SR-BI expression leads to the early onset of occlusive atherosclerotic coronary artery disease, spontaneous myocardial infarctions, severe cardiac dysfunction, and premature death in apolipoprotein E-deficient mice. Circulation research 90, 270-276 105. Covey, S. D., Krieger, M., Wang, W., Penman, M., and Trigatti, B. L. (2003) Scavenger receptor class B type I-mediated protection against atherosclerosis in LDL receptor- negative mice involves its expression in bone marrow-derived cells. Arterioscler Thromb Vasc Biol 23, 1589-1594 106. Trigatti, B., Rayburn, H., Vinals, M., Braun, A., Miettinen, H., Penman, M., Hertz, M., Schrenzel, M., Amigo, L., Rigotti, A., and Krieger, M. (1999) Influence of the high density lipoprotein receptor SR-BI on reproductive and cardiovascular pathophysiology. Proc Natl Acad Sci U S A 96, 9322-9327 107. Ueda, Y., Gong, E., Royer, L., Cooper, P. N., Francone, O. L., and Rubin, E. M. (2000) Relationship between expression levels and atherogenesis in scavenger receptor class B, type I transgenics. J Biol Chem 275, 20368-20373 108. Barter, P. J., Brewer, H. B., Jr., Chapman, M. J., Hennekens, C. H., Rader, D. J., and Tall, A. R. (2003) Cholesteryl ester transfer protein: a novel target for raising HDL and inhibiting atherosclerosis. Arterioscler Thromb Vasc Biol 23, 160-167 109. Yamashita, S., Hirano, K., Sakai, N., and Matsuzawa, Y. (2000) Molecular biology and pathophysiological aspects of plasma cholesteryl ester transfer protein. Biochim Biophys Acta 1529, 257-275 110. Lehmann, J. M., Kliewer, S. A., Moore, L. B., Smith-Oliver, T. A., Oliver, B. B., Su, J. L., Sundseth, S. S., Winegar, D. A., Blanchard, D. E., Spencer, T. A., and Willson, T. M. (1997) Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J Biol Chem 272, 3137-3140 111. Brown, M. L., Inazu, A., Hesler, C. B., Agellon, L. B., Mann, C., Whitlock, M. E., Marcel, Y. L., Milne, R. W., Koizumi, J., Mabuchi, H., and et al. (1989) Molecular basis of lipid transfer protein deficiency in a family with increased high-density lipoproteins. Nature 342, 448-451 135

112. Agellon, L. B., Walsh, A., Hayek, T., Moulin, P., Jiang, X. C., Shelanski, S. A., Breslow, J. L., and Tall, A. R. (1991) Reduced high density lipoprotein cholesterol in human cholesteryl ester transfer protein transgenic mice. J Biol Chem 266, 10796-10801 113. Schwartz, C. C., VandenBroek, J. M., and Cooper, P. S. (2004) Lipoprotein cholesteryl ester production, transfer, and output in vivo in humans. J Lipid Res 45, 1594-1607 114. Cuchel, M., and Rader, D. J. (2006) Macrophage reverse cholesterol transport: key to the regression of atherosclerosis? Circulation 113, 2548-2555 115. Francis, G. A. The complexity of HDL. Biochim Biophys Acta 1801, 1286-1293 116. Thuren, T. (2000) Hepatic lipase and HDL metabolism. Current opinion in lipidology 11, 277-283 117. Kadowaki, H., Patton, G. M., and Robins, S. J. (1992) Metabolism of high density lipoprotein lipids by the rat liver: evidence for participation of hepatic lipase in the uptake of cholesteryl ester. J Lipid Res 33, 1689-1698 118. Thuren, T. Y., King, V. L., Temel, R. E., and Williams, D. L. (1998) Inhibition of rat hepatocyte direct selective HDL cholesterol uptake by hepatic lipase and scavenger receptor SR-B1 antibodies. Circulation 98, 201-201 119. Badellino, K. O., and Rader, D. J. (2004) The role of endothelial lipase in high-density lipoprotein metabolism. Current opinion in cardiology 19, 392-395 120. Maugeais, C., Tietge, U. J., Broedl, U. C., Marchadier, D., Cain, W., McCoy, M. G., Lund-Katz, S., Glick, J. M., and Rader, D. J. (2003) Dose-dependent acceleration of high-density lipoprotein catabolism by endothelial lipase. Circulation 108, 2121-2126 121. Huuskonen, J., Olkkonen, V. M., Jauhiainen, M., and Ehnholm, C. (2001) The impact of phospholipid transfer protein (PLTP) on HDL metabolism. Atherosclerosis 155, 269-281 122. Settasatian, N., Duong, M., Curtiss, L. K., Ehnholm, C., Jauhiainen, M., Huuskonen, J., and Rye, K. A. (2001) The mechanism of the remodeling of high density lipoproteins by phospholipid transfer protein. J Biol Chem 276, 26898-26905 123. von Eckardstein, A., Jauhiainen, M., Huang, Y., Metso, J., Langer, C., Pussinen, P., Wu, S., Ehnholm, C., and Assmann, G. (1996) Phospholipid transfer protein mediated conversion of high density lipoproteins generates pre beta 1-HDL. Biochim Biophys Acta 1301, 255-262 124. Lefebvre, P., Cariou, B., Lien, F., Kuipers, F., and Staels, B. (2009) Role of bile acids and bile acid receptors in metabolic regulation. Physiological reviews 89, 147-191 125. Hylemon, P., Pandak, W., and Vlahcevic, Z. (2001) Regulation of Hepatic Cholesterol Homeostasis. in Liver Biology and Pathobiology (Arias, I. M. ed.), 4th ed. Ed., Lippincott Williams & Wilkins, Philadelphia. pp 126. Wittenburg, H., and Carey, M. C. (2002) Biliary cholesterol secretion by the twinned sterol half-transporters ABCG5 and ABCG8. J Clin Invest 110, 605-609 127. Stieger, B., Meier, Y., and Meier, P. J. (2007) The bile salt export pump. Pflugers Archiv : European journal of physiology 453, 611-620 128. Schwartz, C. C., Berman, M., Vlahcevic, Z. R., Halloran, L. G., Gregory, D. H., and Swell, L. (1978) Multicompartmental analysis of cholesterol metabolism in man. Characterization of the hepatic bile acid and biliary cholesterol precursor sites. J Clin Invest 61, 408-423 129. Schwartz, C. C., Halloran, L. G., Vlahcevic, Z. R., Gregory, D. H., and Swell, L. (1978) Preferential utilization of free cholesterol from high-density lipoproteins for biliary cholesterol secretion in man. Science 200, 62-64 136

130. Yu, L., Hammer, R. E., Li-Hawkins, J., Von Bergmann, K., Lutjohann, D., Cohen, J. C., and Hobbs, H. H. (2002) Disruption of Abcg5 and Abcg8 in mice reveals their crucial role in biliary cholesterol secretion. Proc Natl Acad Sci U S A 99, 16237-16242 131. Yu, L., Li-Hawkins, J., Hammer, R. E., Berge, K. E., Horton, J. D., Cohen, J. C., and Hobbs, H. H. (2002) Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest 110, 671-680 132. Garcia-Calvo, M., Lisnock, J., Bull, H. G., Hawes, B. E., Burnett, D. A., Braun, M. P., Crona, J. H., Davis, H. R., Jr., Dean, D. C., Detmers, P. A., Graziano, M. P., Hughes, M., Macintyre, D. E., Ogawa, A., O'Neill K, A., Iyer, S. P., Shevell, D. E., Smith, M. M., Tang, Y. S., Makarewicz, A. M., Ujjainwalla, F., Altmann, S. W., Chapman, K. T., and Thornberry, N. A. (2005) The target of ezetimibe is Niemann-Pick C1-Like 1 (NPC1L1). Proc Natl Acad Sci U S A 102, 8132-8137 133. Davis, H. R., Jr., Zhu, L. J., Hoos, L. M., Tetzloff, G., Maguire, M., Liu, J., Yao, X., Iyer, S. P., Lam, M. H., Lund, E. G., Detmers, P. A., Graziano, M. P., and Altmann, S. W. (2004) Niemann-Pick C1 Like 1 (NPC1L1) is the intestinal phytosterol and cholesterol transporter and a key modulator of whole-body cholesterol homeostasis. J Biol Chem 279, 33586-33592 134. Groen, A. K., Oude Elferink, R. P., Verkade, H. J., and Kuipers, F. (2004) The ins and outs of reverse cholesterol transport. Annals of medicine 36, 135-145 135. Temel, R. E., Sawyer, J. K., Yu, L., Lord, C., Degirolamo, C., McDaniel, A., Marshall, S., Wang, N., Shah, R., Rudel, L. L., and Brown, J. M. (2010) Biliary sterol secretion is not required for macrophage reverse cholesterol transport. Cell metabolism 12, 96-102 136. Vrins, C. L., Ottenhoff, R., van den Oever, K., de Waart, D. R., Kruyt, J. K., Zhao, Y., van Berkel, T. J., Havekes, L. M., Aerts, J. M., van Eck, M., Rensen, P. C., and Groen, A. K. (2012) Trans-intestinal cholesterol efflux is not mediated through high density lipoprotein. J Lipid Res 53, 2017-2023 137. Le May, C., Berger, J. M., Lespine, A., Pillot, B., Prieur, X., Letessier, E., Hussain, M. M., Collet, X., Cariou, B., and Costet, P. (2013) Transintestinal Cholesterol Excretion Is an Active Metabolic Process Modulated by PCSK9 and Statin Involving ABCB1. Arterioscler Thromb Vasc Biol 33, 1484-1493 138. Nijstad, N., Gautier, T., Briand, F., Rader, D. J., and Tietge, U. J. (2011) Biliary sterol secretion is required for functional in vivo reverse cholesterol transport in mice. Gastroenterology 140, 1043-1051 139. Zhang, Y., Zanotti, I., Reilly, M. P., Glick, J. M., Rothblat, G. H., and Rader, D. J. (2003) Overexpression of apolipoprotein A-I promotes reverse transport of cholesterol from macrophages to feces in vivo. Circulation 108, 661-663 140. deGoma, E. M., deGoma, R. L., and Rader, D. J. (2008) Beyond high-density lipoprotein cholesterol levels evaluating high-density lipoprotein function as influenced by novel therapeutic approaches. Journal of the American College of Cardiology 51, 2199-2211 141. Escola-Gil, J. C., Calpe-Berdiel, L., Palomer, X., Ribas, V., Ordonez-Llanos, J., and Blanco-Vaca, F. (2006) Antiatherogenic role of high-density lipoproteins: insights from genetically engineered-mice. Frontiers in bioscience : a journal and virtual library 11, 1328-1348

137

142. Escola-Gil, J. C., Rotllan, N., Julve, J., and Blanco-Vaca, F. (2009) In vivo macrophage- specific RCT and antioxidant and antiinflammatory HDL activity measurements: New tools for predicting HDL atheroprotection. Atherosclerosis 206, 321-327 143. Franceschini, G., Sirtori, C. R., Capurso, A., 2nd, Weisgraber, K. H., and Mahley, R. W. (1980) A-IMilano apoprotein. Decreased high density lipoprotein cholesterol levels with significant lipoprotein modifications and without clinical atherosclerosis in an Italian family. J Clin Invest 66, 892-900 144. Barter, P. J., Caulfield, M., Eriksson, M., Grundy, S. M., Kastelein, J. J., Komajda, M., Lopez-Sendon, J., Mosca, L., Tardif, J. C., Waters, D. D., Shear, C. L., Revkin, J. H., Buhr, K. A., Fisher, M. R., Tall, A. R., and Brewer, B. (2007) Effects of torcetrapib in patients at high risk for coronary events. The New England journal of medicine 357, 2109-2122 145. Miller, N. E., Thelle, D. S., Forde, O. H., and Mjos, O. D. (1977) The Tromso heart- study. High-density lipoprotein and coronary heart-disease: a prospective case-control study. Lancet 1, 965-968 146. Stampfer, M. J., Sacks, F. M., Salvini, S., Willett, W. C., and Hennekens, C. H. (1991) A prospective study of cholesterol, apolipoproteins, and the risk of myocardial infarction. The New England journal of medicine 325, 373-381 147. Venkatesh, P. K., Caskey, D., and Reddy, P. C. (2008) Therapies to increase high-density lipoprotein cholesterol and their effect on cardiovascular outcomes and regression of atherosclerosis. Am J Med Sci 336, 64-68 148. Tall, A. R. (2008) Cholesterol efflux pathways and other potential mechanisms involved in the athero-protective effect of high density lipoproteins. J Intern Med 263, 256-273 149. Tall, A. R., Wang, N., and Mucksavage, P. (2001) Is it time to modify the reverse cholesterol transport model? J Clin Invest 108, 1273-1275 150. Wang, X., Collins, H. L., Ranalletta, M., Fuki, I. V., Billheimer, J. T., Rothblat, G. H., Tall, A. R., and Rader, D. J. (2007) Macrophage ABCA1 and ABCG1, but not SR-BI, promote macrophage reverse cholesterol transport in vivo. J Clin Invest 117, 2216-2224 151. Naik, S. U., Wang, X., Da Silva, J. S., Jaye, M., Macphee, C. H., Reilly, M. P., Billheimer, J. T., Rothblat, G. H., and Rader, D. J. (2006) Pharmacological activation of liver X receptors promotes reverse cholesterol transport in vivo. Circulation 113, 90-97 152. Moore, R. E., Navab, M., Millar, J. S., Zimetti, F., Hama, S., Rothblat, G. H., and Rader, D. J. (2005) Increased atherosclerosis in mice lacking apolipoprotein A-I attributable to both impaired reverse cholesterol transport and increased inflammation. Circulation research 97, 763-771 153. McGillicuddy, F. C., de la Llera Moya, M., Hinkle, C. C., Joshi, M. R., Chiquoine, E. H., Billheimer, J. T., Rothblat, G. H., and Reilly, M. P. (2009) Inflammation impairs reverse cholesterol transport in vivo. Circulation 119, 1135-1145 154. Chawla, A., Repa, J. J., Evans, R. M., and Mangelsdorf, D. J. (2001) Nuclear receptors and lipid physiology: opening the X-files. Science 294, 1866-1870 155. Willy, P. J., Umesono, K., Ong, E. S., Evans, R. M., Heyman, R. A., and Mangelsdorf, D. J. (1995) LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes & development 9, 1033-1045 156. Farnegardh, M., Bonn, T., Sun, S., Ljunggren, J., Ahola, H., Wilhelmsson, A., Gustafsson, J. A., and Carlquist, M. (2003) The three-dimensional structure of the liver X

138

receptor beta reveals a flexible ligand-binding pocket that can accommodate fundamentally different ligands. J Biol Chem 278, 38821-38828 157. Mangelsdorf, D. J., and Evans, R. M. (1995) The RXR heterodimers and orphan receptors. Cell 83, 841-850 158. Forman, B. M., Ruan, B., Chen, J., Schroepfer, G. J., Jr., and Evans, R. M. (1997) The orphan nuclear receptor LXRalpha is positively and negatively regulated by distinct products of mevalonate metabolism. Proc Natl Acad Sci U S A 94, 10588-10593 159. Janowski, B. A., Willy, P. J., Devi, T. R., Falck, J. R., and Mangelsdorf, D. J. (1996) An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature 383, 728-731 160. Beyea, M. M., Heslop, C. L., Sawyez, C. G., Edwards, J. Y., Markle, J. G., Hegele, R. A., and Huff, M. W. (2007) Selective up-regulation of LXR-regulated genes ABCA1, ABCG1, and APOE in macrophages through increased endogenous synthesis of 24(S),25-epoxycholesterol. J Biol Chem 282, 5207-5216 161. Dzeletovic, S., Breuer, O., Lund, E., and Diczfalusy, U. (1995) Determination of cholesterol oxidation products in human plasma by isotope dilution-mass spectrometry. Anal Biochem 225, 73-80 162. Fu, X., Menke, J. G., Chen, Y., Zhou, G., MacNaul, K. L., Wright, S. D., Sparrow, C. P., and Lund, E. G. (2001) 27-hydroxycholesterol is an endogenous ligand for liver X receptor in cholesterol-loaded cells. J Biol Chem 276, 38378-38387 163. Mitro, N., Mak, P. A., Vargas, L., Godio, C., Hampton, E., Molteni, V., Kreusch, A., and Saez, E. (2007) The nuclear receptor LXR is a glucose sensor. Nature 445, 219-223 164. Spann, N. J., Garmire, L. X., McDonald, J. G., Myers, D. S., Milne, S. B., Shibata, N., Reichart, D., Fox, J. N., Shaked, I., Heudobler, D., Raetz, C. R., Wang, E. W., Kelly, S. L., Sullards, M. C., Murphy, R. C., Merrill, A. H., Jr., Brown, H. A., Dennis, E. A., Li, A. C., Ley, K., Tsimikas, S., Fahy, E., Subramaniam, S., Quehenberger, O., Russell, D. W., and Glass, C. K. (2012) Regulated accumulation of desmosterol integrates macrophage lipid metabolism and inflammatory responses. Cell 151, 138-152 165. Bjorkhem, I., and Diczfalusy, U. (2002) Oxysterols: friends, foes, or just fellow passengers? Arterioscler Thromb Vasc Biol 22, 734-742 166. Olkkonen, V. M., and Lehto, M. (2004) Oxysterols and oxysterol binding proteins: role in lipid metabolism and atherosclerosis. Annals of medicine 36, 562-572 167. Brown, A. J., and Jessup, W. (1999) Oxysterols and atherosclerosis. Atherosclerosis 142, 1-28 168. Leeuwenburgh, C., Hardy, M. M., Hazen, S. L., Wagner, P., Oh-ishi, S., Steinbrecher, U. P., and Heinecke, J. W. (1997) Reactive nitrogen intermediates promote low density lipoprotein oxidation in human atherosclerotic intima. J Biol Chem 272, 1433-1436 169. Steinberg, D. (2009) The LDL modification hypothesis of atherogenesis: an update. J Lipid Res 50 Suppl, S376-381 170. Steinbrecher, U. P. (1987) Oxidation of human low density lipoprotein results in derivatization of lysine residues of apolipoprotein B by lipid peroxide decomposition products. J Biol Chem 262, 3603-3608 171. Bjorkhem, I., Andersson, O., Diczfalusy, U., Sevastik, B., Xiu, R. J., Duan, C., and Lund, E. (1994) Atherosclerosis and sterol 27-hydroxylase: evidence for a role of this enzyme in elimination of cholesterol from human macrophages. Proc Natl Acad Sci U S A 91, 8592-8596 139

172. Panzenboeck, U., Andersson, U., Hansson, M., Sattler, W., Meaney, S., and Bjorkhem, I. (2007) On the mechanism of cerebral accumulation of cholestanol in patients with cerebrotendinous xanthomatosis. J Lipid Res 48, 1167-1174 173. Russell, D. W. (2000) Oxysterol biosynthetic enzymes. Biochim Biophys Acta 1529, 126- 135 174. Bjorkhem, I., Diczfalusy, U., and Lutjohann, D. (1999) Removal of cholesterol from extrahepatic sources by oxidative mechanisms. Current opinion in lipidology 10, 161-165 175. Meikle, A. W., Liu, X. H., and Stringham, J. D. (1991) Extracellular calcium and luteinizing hormone effects on 22-hydroxycholesterol used for testosterone production in mouse Leydig cells. Journal of andrology 12, 148-151 176. Lund, E. G., Kerr, T. A., Sakai, J., Li, W. P., and Russell, D. W. (1998) cDNA cloning of mouse and human cholesterol 25-hydroxylases, polytopic membrane proteins that synthesize a potent oxysterol regulator of lipid metabolism. J Biol Chem 273, 34316- 34327 177. Brown, M. S., and Goldstein, J. L. (1997) The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89, 331-340 178. Repa, J. J., Liang, G., Ou, J., Bashmakov, Y., Lobaccaro, J. M., Shimomura, I., Shan, B., Brown, M. S., Goldstein, J. L., and Mangelsdorf, D. J. (2000) Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta. Genes & development 14, 2819-2830 179. Venkateswaran, A., Laffitte, B. A., Joseph, S. B., Mak, P. A., Wilpitz, D. C., Edwards, P. A., and Tontonoz, P. (2000) Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc Natl Acad Sci U S A 97, 12097-12102 180. Zelcer, N., Hong, C., Boyadjian, R., and Tontonoz, P. (2009) LXR regulates cholesterol uptake through Idol-dependent ubiquitination of the LDL receptor. Science 325, 100-104 181. Zhang, L., Reue, K., Fong, L. G., Young, S. G., and Tontonoz, P. (2012) Feedback regulation of cholesterol uptake by the LXR-IDOL-LDLR axis. Arterioscler Thromb Vasc Biol 32, 2541-2546 182. Dean, M., Hamon, Y., and Chimini, G. (2001) The human ATP-binding cassette (ABC) transporter superfamily. J Lipid Res 42, 1007-1017 183. Pohl, A., Devaux, P. F., and Herrmann, A. (2005) Function of prokaryotic and eukaryotic ABC proteins in lipid transport. Biochim Biophys Acta 1733, 29-52 184. Takahashi, K., Kimura, Y., Nagata, K., Yamamoto, A., Matsuo, M., and Ueda, K. (2005) ABC proteins: key molecules for lipid homeostasis. Medical molecular morphology 38, 2-12 185. Oram, J. F. (2000) Tangier disease and ABCA1. Biochim Biophys Acta 1529, 321-330 186. Bodzioch, M., Orso, E., Klucken, J., Langmann, T., Bottcher, A., Diederich, W., Drobnik, W., Barlage, S., Buchler, C., Porsch-Ozcurumez, M., Kaminski, W. E., Hahmann, H. W., Oette, K., Rothe, G., Aslanidis, C., Lackner, K. J., and Schmitz, G. (1999) The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease. Nature genetics 22, 347-351 187. Brooks-Wilson, A., Marcil, M., Clee, S. M., Zhang, L. H., Roomp, K., van Dam, M., Yu, L., Brewer, C., Collins, J. A., Molhuizen, H. O., Loubser, O., Ouelette, B. F., Fichter, K., Ashbourne-Excoffon, K. J., Sensen, C. W., Scherer, S., Mott, S., Denis, M., Martindale, D., Frohlich, J., Morgan, K., Koop, B., Pimstone, S., Kastelein, J. J., Genest, J., Jr., and

140

Hayden, M. R. (1999) Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nature genetics 22, 336-345 188. Lawn, R. M., Wade, D. P., Garvin, M. R., Wang, X., Schwartz, K., Porter, J. G., Seilhamer, J. J., Vaughan, A. M., and Oram, J. F. (1999) The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway. J Clin Invest 104, R25-31 189. Rust, S., Rosier, M., Funke, H., Real, J., Amoura, Z., Piette, J. C., Deleuze, J. F., Brewer, H. B., Duverger, N., Denefle, P., and Assmann, G. (1999) Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1. Nature genetics 22, 352-355 190. Oram, J. F. (2002) ATP-binding cassette transporter A1 and cholesterol trafficking. Current opinion in lipidology 13, 373-381 191. Serfaty-Lacrosniere, C., Civeira, F., Lanzberg, A., Isaia, P., Berg, J., Janus, E. D., Smith, M. P., Jr., Pritchard, P. H., Frohlich, J., Lees, R. S., and et al. (1994) Homozygous Tangier disease and cardiovascular disease. Atherosclerosis 107, 85-98 192. Francis, G. A., Knopp, R. H., and Oram, J. F. (1995) Defective removal of cellular cholesterol and phospholipids by apolipoprotein A-I in Tangier Disease. J Clin Invest 96, 78-87 193. Schaefer, E. J., Zech, L. A., Schwartz, D. E., and Brewer, H. B., Jr. (1980) Coronary heart disease prevalence and other clinical features in familial high-density lipoprotein deficiency (Tangier disease). Ann Intern Med 93, 261-266 194. Lin, G., and Oram, J. F. (2000) Apolipoprotein binding to protruding membrane domains during removal of excess cellular cholesterol. Atherosclerosis 149, 359-370 195. Mendez, A. J., and Uint, L. (1996) Apolipoprotein-mediated cellular cholesterol and phospholipid efflux depend on a functional Golgi apparatus. J Lipid Res 37, 2510-2524 196. Remaley, A. T., Schumacher, U. K., Stonik, J. A., Farsi, B. D., Nazih, H., and Brewer, H. B., Jr. (1997) Decreased reverse cholesterol transport from Tangier disease fibroblasts. Acceptor specificity and effect of brefeldin on lipid efflux. Arterioscler Thromb Vasc Biol 17, 1813-1821 197. Hara, H., Hara, H., Komaba, A., and Yokoyama, S. (1992) Alpha-helical requirements for free apolipoproteins to generate HDL and to induce cellular lipid efflux. Lipids 27, 302-304 198. Oram, J. F., Brinton, E. A., and Bierman, E. L. (1983) Regulation of high density lipoprotein receptor activity in cultured human skin fibroblasts and human arterial smooth muscle cells. J Clin Invest 72, 1611-1621 199. Oram, J. F., Lawn, R. M., Garvin, M. R., and Wade, D. P. (2000) ABCA1 is the cAMP- inducible apolipoprotein receptor that mediates cholesterol secretion from macrophages. J Biol Chem 275, 34508-34511 200. Savion, N., and Kotev-Emeth, S. (1993) Role of apolipoproteins A-I, A-II and C-I in cholesterol efflux from endothelial and smooth muscle cells. European heart journal 14, 930-935 201. Smith, J. D., Miyata, M., Ginsberg, M., Grigaux, C., Shmookler, E., and Plump, A. S. (1996) Cyclic AMP induces apolipoprotein E binding activity and promotes cholesterol efflux from a macrophage cell line to apolipoprotein acceptors. J Biol Chem 271, 30647- 30655

141

202. Oram, J. F., and Vaughan, A. M. (2000) ABCA1-mediated transport of cellular cholesterol and phospholipids to HDL apolipoproteins. Current opinion in lipidology 11, 253-260 203. Wang, N., Silver, D. L., Costet, P., and Tall, A. R. (2000) Specific binding of ApoA-I, enhanced cholesterol efflux, and altered plasma membrane morphology in cells expressing ABC1. J Biol Chem 275, 33053-33058 204. Roosbeek, S., Peelman, F., Verhee, A., Labeur, C., Caster, H., Lensink, M. F., Cirulli, C., Grooten, J., Cochet, C., Vandekerckhove, J., Amoresano, A., Chimini, G., Tavernier, J., and Rosseneu, M. (2004) Phosphorylation by protein kinase CK2 modulates the activity of the ATP binding cassette A1 transporter. J Biol Chem 279, 37779-37788 205. Tang, C., Vaughan, A. M., Anantharamaiah, G. M., and Oram, J. F. (2006) Janus kinase 2 modulates the lipid-removing but not protein-stabilizing interactions of amphipathic helices with ABCA1. J Lipid Res 47, 107-114 206. Vedhachalam, C., Ghering, A. B., Davidson, W. S., Lund-Katz, S., Rothblat, G. H., and Phillips, M. C. (2007) ABCA1-induced cell surface binding sites for ApoA-I. Arterioscler Thromb Vasc Biol 27, 1603-1609 207. Bortnick, A. E., Rothblat, G. H., Stoudt, G., Hoppe, K. L., Royer, L. J., McNeish, J., and Francone, O. L. (2000) The correlation of ATP-binding cassette 1 mRNA levels with cholesterol efflux from various cell lines. J Biol Chem 275, 28634-28640 208. Orso, E., Broccardo, C., Kaminski, W. E., Bottcher, A., Liebisch, G., Drobnik, W., Gotz, A., Chambenoit, O., Diederich, W., Langmann, T., Spruss, T., Luciani, M. F., Rothe, G., Lackner, K. J., Chimini, G., and Schmitz, G. (2000) Transport of lipids from golgi to plasma membrane is defective in tangier disease patients and Abc1-deficient mice. Nature genetics 24, 192-196 209. Mendez, A. J., Anantharamaiah, G. M., Segrest, J. P., and Oram, J. F. (1994) Synthetic amphipathic helical peptides that mimic apolipoprotein A-I in clearing cellular cholesterol. J Clin Invest 94, 1698-1705 210. Oram, J. F., Mendez, A. J., Lymp, J., Kavanagh, T. J., and Halbert, C. L. (1999) Reduction in apolipoprotein-mediated removal of cellular lipids by immortalization of human fibroblasts and its reversion by cAMP: lack of effect with Tangier disease cells. J Lipid Res 40, 1769-1781 211. Haidar, B., Denis, M., Krimbou, L., Marcil, M., and Genest, J., Jr. (2002) cAMP induces ABCA1 phosphorylation activity and promotes cholesterol efflux from fibroblasts. J Lipid Res 43, 2087-2094 212. See, R. H., Caday-Malcolm, R. A., Singaraja, R. R., Zhou, S., Silverston, A., Huber, M. T., Moran, J., James, E. R., Janoo, R., Savill, J. M., Rigot, V., Zhang, L. H., Wang, M., Chimini, G., Wellington, C. L., Tafuri, S. R., and Hayden, M. R. (2002) Protein kinase A site-specific phosphorylation regulates ATP-binding cassette A1 (ABCA1)-mediated phospholipid efflux. J Biol Chem 277, 41835-41842 213. Schmitz, G., and Langmann, T. (2005) Transcriptional regulatory networks in lipid metabolism control ABCA1 expression. Biochim Biophys Acta 1735, 1-19 214. Argmann, C. A., Edwards, J. Y., Sawyez, C. G., O'Neil, C. H., Hegele, R. A., Pickering, J. G., and Huff, M. W. (2005) Regulation of macrophage cholesterol efflux through hydroxymethylglutaryl-CoA reductase inhibition: a role for RhoA in ABCA1-mediated cholesterol efflux. J Biol Chem 280, 22212-22221

142

215. Wang, Y., and Oram, J. F. (2002) Unsaturated fatty acids inhibit cholesterol efflux from macrophages by increasing degradation of ATP-binding cassette transporter A1. J Biol Chem 277, 5692-5697 216. Martinez, L. O., Agerholm-Larsen, B., Wang, N., Chen, W., and Tall, A. R. (2003) Phosphorylation of a pest sequence in ABCA1 promotes calpain degradation and is reversed by ApoA-I. J Biol Chem 278, 37368-37374 217. Wang, N., Chen, W., Linsel-Nitschke, P., Martinez, L. O., Agerholm-Larsen, B., Silver, D. L., and Tall, A. R. (2003) A PEST sequence in ABCA1 regulates degradation by calpain protease and stabilization of ABCA1 by apoA-I. J Clin Invest 111, 99-107 218. Munehira, Y., Ohnishi, T., Kawamoto, S., Furuya, A., Shitara, K., Imamura, M., Yokota, T., Takeda, S., Amachi, T., Matsuo, M., Kioka, N., and Ueda, K. (2004) Alpha1- syntrophin modulates turnover of ABCA1. J Biol Chem 279, 15091-15095 219. Yamauchi, Y., Hayashi, M., Abe-Dohmae, S., and Yokoyama, S. (2003) Apolipoprotein A-I activates protein kinase C alpha signaling to phosphorylate and stabilize ATP binding cassette transporter A1 for the high density lipoprotein assembly. J Biol Chem 278, 47890-47897 220. Cserepes, J., Szentpetery, Z., Seres, L., Ozvegy-Laczka, C., Langmann, T., Schmitz, G., Glavinas, H., Klein, I., Homolya, L., Varadi, A., Sarkadi, B., and Elkind, N. B. (2004) Functional expression and characterization of the human ABCG1 and ABCG4 proteins: indications for heterodimerization. Biochem Biophys Res Commun 320, 860-867 221. Klucken, J., Buchler, C., Orso, E., Kaminski, W. E., Porsch-Ozcurumez, M., Liebisch, G., Kapinsky, M., Diederich, W., Drobnik, W., Dean, M., Allikmets, R., and Schmitz, G. (2000) ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport. Proc Natl Acad Sci U S A 97, 817- 822 222. Venkateswaran, A., Repa, J. J., Lobaccaro, J. M., Bronson, A., Mangelsdorf, D. J., and Edwards, P. A. (2000) Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. A transcriptional role for specific oxysterols. J Biol Chem 275, 14700-14707 223. Kennedy, M. A., Venkateswaran, A., Tarr, P. T., Xenarios, I., Kudoh, J., Shimizu, N., and Edwards, P. A. (2001) Characterization of the human ABCG1 gene: liver X receptor activates an internal promoter that produces a novel transcript encoding an alternative form of the protein. J Biol Chem 276, 39438-39447 224. Baldan, A., Tarr, P., Vales, C. S., Frank, J., Shimotake, T. K., Hawgood, S., and Edwards, P. A. (2006) Deletion of the transmembrane transporter ABCG1 results in progressive pulmonary lipidosis. J Biol Chem 281, 29401-29410 225. Gelissen, I. C., Harris, M., Rye, K. A., Quinn, C., Brown, A. J., Kockx, M., Cartland, S., Packianathan, M., Kritharides, L., and Jessup, W. (2006) ABCA1 and ABCG1 synergize to mediate cholesterol export to apoA-I. Arterioscler Thromb Vasc Biol 26, 534-540 226. Sankaranarayanan, S., Oram, J. F., Asztalos, B. F., Vaughan, A. M., Lund-Katz, S., Adorni, M. P., Phillips, M. C., and Rothblat, G. H. (2009) Effects of acceptor composition and mechanism of ABCG1-mediated cellular free cholesterol efflux. J Lipid Res 50, 275-284 227. Tarling, E. J. (2013) Expanding roles of ABCG1 and sterol transport. Current opinion in lipidology 24, 138-146

143

228. Burgess, B., Naus, K., Chan, J., Hirsch-Reinshagen, V., Tansley, G., Matzke, L., Chan, B., Wilkinson, A., Fan, J., Donkin, J., Balik, D., Tanaka, T., Ou, G., Dyer, R., Innis, S., McManus, B., Lutjohann, D., and Wellington, C. (2008) Overexpression of human ABCG1 does not affect atherosclerosis in fat-fed ApoE-deficient mice. Arterioscler Thromb Vasc Biol 28, 1731-1737 229. Baldan, A., Pei, L., Lee, R., Tarr, P., Tangirala, R. K., Weinstein, M. M., Frank, J., Li, A. C., Tontonoz, P., and Edwards, P. A. (2006) Impaired development of atherosclerosis in hyperlipidemic Ldlr-/- and ApoE-/- mice transplanted with Abcg1-/- bone marrow. Arterioscler Thromb Vasc Biol 26, 2301-2307 230. Curtiss, L. K. (2006) Is two out of three enough for ABCG1? Arterioscler Thromb Vasc Biol 26, 2175-2177 231. Lammers, B., Out, R., Hildebrand, R. B., Quinn, C. M., Williamson, D., Hoekstra, M., Meurs, I., Van Berkel, T. J., Jessup, W., and Van Eck, M. (2009) Independent protective roles for macrophage Abcg1 and Apoe in the atherosclerotic lesion development. Atherosclerosis 205, 420-426 232. Meurs, I., Lammers, B., Zhao, Y., Out, R., Hildebrand, R. B., Hoekstra, M., Van Berkel, T. J., and Van Eck, M. (2012) The effect of ABCG1 deficiency on atherosclerotic lesion development in LDL receptor knockout mice depends on the stage of atherogenesis. Atherosclerosis 221, 41-47 233. Out, R., Hoekstra, M., Hildebrand, R. B., Kruit, J. K., Meurs, I., Li, Z., Kuipers, F., Van Berkel, T. J., and Van Eck, M. (2006) Macrophage ABCG1 deletion disrupts lipid homeostasis in alveolar macrophages and moderately influences atherosclerotic lesion development in LDL receptor-deficient mice. Arterioscler Thromb Vasc Biol 26, 2295- 2300 234. Ranalletta, M., Wang, N., Han, S., Yvan-Charvet, L., Welch, C., and Tall, A. R. (2006) Decreased atherosclerosis in low-density lipoprotein receptor knockout mice transplanted with Abcg1-/- bone marrow. Arterioscler Thromb Vasc Biol 26, 2308-2315 235. Pittman, R. C., and Steinberg, D. (1984) Sites and mechanisms of uptake and degradation of high density and low density lipoproteins. J Lipid Res 25, 1577-1585 236. Pentchev, P. G., Comly, M. E., Kruth, H. S., Vanier, M. T., Wenger, D. A., Patel, S., and Brady, R. O. (1985) A defect in cholesterol esterification in Niemann-Pick disease (type C) patients. Proc Natl Acad Sci U S A 82, 8247-8251 237. Goldstein, J. L., Dana, S. E., Faust, J. R., Beaudet, A. L., and Brown, M. S. (1975) Role of lysosomal acid lipase in the metabolism of plasma low density lipoprotein. Observations in cultured fibroblasts from a patient with cholesteryl ester storage disease. J Biol Chem 250, 8487-8495 238. Frolov, A., Zielinski, S. E., Crowley, J. R., Dudley-Rucker, N., Schaffer, J. E., and Ory, D. S. (2003) NPC1 and NPC2 regulate cellular cholesterol homeostasis through generation of low density lipoprotein cholesterol-derived oxysterols. J Biol Chem 278, 25517-25525 239. Boadu, E., Choi, H. Y., Lee, D. W., Waddington, E. I., Chan, T., Asztalos, B., Vance, J. E., Chan, A., Castro, G., and Francis, G. A. (2006) Correction of apolipoprotein A-I- mediated lipid efflux and high density lipoprotein particle formation in human Niemann- Pick type C disease fibroblasts. J Biol Chem 281, 37081-37090 240. Abramov, A., Schorr, S., and Wolman, M. (1956) Generalized xanthomatosis with calcified adrenals. AMA J Dis Child 91, 282-286 144

241. Wolman, M., Sterk, V. V., Gatt, S., and Frenkel, M. (1961) Primary familial xanthomatosis with involvement and calcification of the adrenals. Report of two more cases in siblings of a previously described infant. Pediatrics 28, 742-757 242. Mahadevan, S., and Tappel, A. L. (1968) Lysosomal lipases of rat liver and kidney. J Biol Chem 243, 2849-2854 243. Patrick, A. D., and Lake, B. D. (1969) Deficiency of an acid lipase in Wolman's disease. Nature 222, 1067-1068 244. Anderson, R. A., and Sando, G. N. (1991) Cloning and expression of cDNA encoding human lysosomal acid lipase/cholesteryl ester hydrolase. Similarities to gastric and lingual lipases. J Biol Chem 266, 22479-22484 245. Anderson, R. A., Rao, N., Byrum, R. S., Rothschild, C. B., Bowden, D. W., Hayworth, R., and Pettenati, M. (1993) In situ localization of the genetic locus encoding the lysosomal acid lipase/cholesteryl esterase (LIPA) deficient in Wolman disease to chromosome 10q23.2-q23.3. Genomics 15, 245-247 246. Anderson, R. A., Byrum, R. S., Coates, P. M., and Sando, G. N. (1994) Mutations at the lysosomal acid cholesteryl ester hydrolase gene locus in Wolman disease. Proc Natl Acad Sci U S A 91, 2718-2722 247. Aslanidis, C., Klima, H., Lackner, K. J., and Schmitz, G. (1994) Genomic organization of the human lysosomal acid lipase gene (LIPA). Genomics 20, 329-331 248. Ameis, D., Merkel, M., Eckerskorn, C., and Greten, H. (1994) Purification, characterization and molecular cloning of human hepatic lysosomal acid lipase. European journal of biochemistry / FEBS 219, 905-914 249. Sheriff, S., Du, H., and Grabowski, G. A. (1995) Characterization of lysosomal acid lipase by site-directed mutagenesis and heterologous expression. J Biol Chem 270, 27766-27772 250. Ries, S., Buchler, C., Langmann, T., Fehringer, P., Aslanidis, C., and Schmitz, G. (1998) Transcriptional regulation of lysosomal acid lipase in differentiating monocytes is mediated by transcription factors Sp1 and AP-2. J Lipid Res 39, 2125-2134 251. Buechler, C., Ullrich, H., Aslanidis, C., Bared, S. M., Lingenhel, A., Ritter, M., and Schmitz, G. (2003) Lipoprotein (a) downregulates lysosomal acid lipase and induces interleukin-6 in human blood monocytes. Biochim Biophys Acta 1642, 25-31 252. Imanaka, T., Amanuma-Muto, K., Ohkuma, S., and Takano, T. (1984) Characterization of lysosomal acid lipase purified from rabbit liver. J Biochem 96, 1089-1101 253. Sando, G. N., and Rosenbaum, L. M. (1985) Human lysosomal acid lipase/cholesteryl ester hydrolase. Purification and properties of the form secreted by fibroblasts in microcarrier culture. J Biol Chem 260, 15186-15193 254. Neufeld, E. F., Sando, G. N., Garvin, A. J., and Rome, L. H. (1977) The transport of lysosomal enzymes. Journal of supramolecular structure 6, 95-101 255. Brown, M. S., Dana, S. E., and Goldstein, J. L. (1973) Regulation of 3-hydroxy-3- methylglutaryl coenzyme A reductase activity in human fibroblasts by lipoproteins. Proc Natl Acad Sci U S A 70, 2162-2166 256. Kaplan, A., Fischer, D., Achord, D., and Sly, W. (1977) Phosphohexosyl recognition is a general characteristic of pinocytosis of lysosomal glycosidases by human fibroblasts. J Clin Invest 60, 1088-1093

145

257. Ullrich, K., Mersmann, G., Weber, E., and Von Figura, K. (1978) Evidence for lysosomal enzyme recognition by human fibroblasts via a phosphorylated carbohydrate moiety. The Biochemical journal 170, 643-650 258. Sando, G. N., and Henke, V. L. (1982) Recognition and receptor-mediated endocytosis of the lysosomal acid lipase secreted by cultured human fibroblasts. J Lipid Res 23, 114-123 259. Zschenker, O., Jung, N., Rethmeier, J., Trautwein, S., Hertel, S., Zeigler, M., and Ameis, D. (2001) Characterization of lysosomal acid lipase mutations in the signal peptide and mature polypeptide region causing Wolman disease. J Lipid Res 42, 1033-1040 260. Hayase, K., and Tappel, A. L. (1970) Specificity and other properties of lysosomal lipase of rat liver. J Biol Chem 245, 169-175 261. Hayase, K., and Miller, B. F. (1970) Lipase activity in the human aorta. J Lipid Res 11, 209-219 262. Kaplan, A. (1970) A simple radioactive assay for triglyceride lipase. Anal Biochem 33, 218-225 263. Kariya, M., and Kaplan, A. (1973) Effects of acidic phospholipids, nucleotides, and heparin on the activity of lipase from rat liver lysosomes. J Lipid Res 14, 243-249 264. Rindler-Ludwig, R., Patsch, W., Sailer, S., and Braunsteiner, H. (1977) Characterization and partial purification of acid lipase from human leucocytes. Biochim Biophys Acta 488, 294-304 265. Cortner, J. A., Coates, P. M., Swoboda, E., and Schnatz, J. D. (1976) Genetic variation of lysosomal acid lipase. Pediatric research 10, 927-932 266. Brown, W. J., and Sgoutas, D. S. (1980) Purification of rat liver lysosomal cholesteryl ester hydrolase. Biochim Biophys Acta 617, 305-317 267. Imanaka, T., Muto, K., Ohkuma, S., and Takano, T. (1981) Purification and properties of rabbit liver acid-lipase (4-methylumbelliferyl oleate hydrolase). Biochim Biophys Acta 665, 322-330 268. Lundberg, B., Klemets, R., and Lovgren, T. (1979) Effect of substrate properties on the activity of lysosomal cholesteryl ester hydrolase. Biochim Biophys Acta 572, 492-501 269. Burton, B. K., and Mueller, H. W., Jr. (1980) Purification and properties of human placental acid lipase. Biochim Biophys Acta 618, 449-460 270. Koster, J. F., Vaandrager, H., and van Berkel, T. J. (1980) Study of the hydrolysis of 4- methylumbelliferyl oleate by acid lipase and cholesteryl oleate by acid cholesteryl esterase in human leucocytes, fibroblasts and liver. Biochim Biophys Acta 618, 98-105 271. Teng, M. H., and Kaplan, A. (1974) Purification and properties of rat liver lysosomal lipase. J Biol Chem 249, 1064-1070 272. Warner, T. G., Dambach, L. M., Shin, J. H., and O'Brien, J. S. (1981) Purification of the lysosomal acid lipase from human liver and its role in lysosomal lipid hydrolysis. J Biol Chem 256, 2952-2957 273. Imanaka, T., Yamaguchi, M., Ohkuma, S., and Takano, T. (1985) Positional specificity of lysosomal acid lipase purified from rabbit liver. J Biochem 98, 927-931 274. Gandarias, J. M., Lacort, M., Martinez, M. J., De Nicolas, M. A., and Ochoa, B. (1986) Cholesteryl ester hydrolysis in rat liver lysosomes: different response to female sex hormones. Biochem Med Metab Biol 36, 14-24 275. Slotte, J. P., and Ekman, S. (1986) Synthesis and hydrolysis of cholesteryl esters by isolated rat-liver lysosomes and cell-free extracts of human lung fibroblasts. Biochim Biophys Acta 879, 221-228 146

276. Stokke, K. T. (1972) Subcellular distribution and kinetics of the acid cholesterol esterase in liver. Biochim Biophys Acta 280, 329-335 277. Klemets, R., and Lundberg, B. (1986) Substrate specificity of lysosomal cholesteryl ester hydrolase isolated from rat liver. Lipids 21, 481-485 278. Imanaka, T., Amanuma-Muto, K., Ohkuma, S., and Takano, T. (1983) Effects of phospholipids on lysosomal acid lipase purified from rabbit liver. J Biochem 93, 1517- 1521 279. Imanaka, T., Moriyama, Y., Ecsedi, G. G., Aoyagi, T., Amanuma-Muto, K., Ohkuma, S., and Takano, T. (1983) Esterastin: a potent inhibitor of lysosomal acid lipase. J Biochem 94, 1017-1020 280. Hamilton, J., Jones, I., Srivastava, R., and Galloway, P. (2012) A new method for the measurement of lysosomal acid lipase in dried blood spots using the inhibitor Lalistat 2. Clinica chimica acta; international journal of clinical chemistry 413, 1207-1210 281. Rosenbaum, A. I., Cosner, C. C., Mariani, C. J., Maxfield, F. R., Wiest, O., and Helquist, P. (2010) Thiadiazole carbamates: potent inhibitors of lysosomal acid lipase and potential Niemann-Pick type C disease therapeutics. Journal of medicinal chemistry 53, 5281-5289 282. Rosenbaum, A. I., and Maxfield, F. R. (2011) Niemann-Pick type C disease: molecular mechanisms and potential therapeutic approaches. Journal of neurochemistry 116, 789- 795 283. Goldstein, J. L., and Brown, M. S. (1977) The low-density lipoprotein pathway and its relation to atherosclerosis. Annual review of biochemistry 46, 897-930 284. Brown, M. S., Dana, S. E., and Goldstein, J. L. (1974) Regulation of 3-hydroxy-3- methylglutaryl coenzyme A reductase activity in cultured human fibroblasts. Comparison of cells from a normal subject and from a patient with homozygous familial hypercholesterolemia. J Biol Chem 249, 789-796 285. Pearse, B. M. (1975) Coated vesicles from pig brain: purification and biochemical characterization. Journal of molecular biology 97, 93-98 286. Goldstein, J. L., Brunschede, G. Y., and Brown, M. S. (1975) Inhibition of proteolytic degradation of low density lipoprotein in human fibroblasts by chloroquine, concanavalin A, and Triton WR 1339. J Biol Chem 250, 7854-7862 287. Brown, M. S., Dana, S. E., and Goldstein, J. L. (1975) Receptor-dependent hydrolysis of cholesteryl esters contained in plasma low density lipoprotein. Proc Natl Acad Sci U S A 72, 2925-2929 288. Brown, M. S., Dana, S. E., and Goldstein, J. L. (1975) Cholesterol ester formation in cultured human fibroblasts. Stimulation by oxygenated sterols. J Biol Chem 250, 4025- 4027 289. Brown, M. S., and Goldstein, J. L. (1979) Receptor-mediated endocytosis: insights from the lipoprotein receptor system. Proc Natl Acad Sci U S A 76, 3330-3337 290. Lake, B. D., and Patrick, A. D. (1970) Wolman's disease: deficiency of E600-resistant acid esterase activity with storage of lipids in lysosomes. J Pediatr 76, 262-266 291. Neufeld, E. F., Lim, T. W., and Shapiro, L. J. (1975) Inherited disorders of lysosomal metabolism. Annual review of biochemistry 44, 357-376 292. Brown, M. S., Sobhani, M. K., Brunschede, G. Y., and Goldstein, J. L. (1976) Restoration of a regulatory response to low density lipoprotein in acid lipase-deficient human fibroblasts. J Biol Chem 251, 3277-3286

147

293. Martinet, W., and De Meyer, G. R. (2009) Autophagy in atherosclerosis: a cell survival and death phenomenon with therapeutic potential. Circulation research 104, 304-317 294. Maiuri, M. C., Zalckvar, E., Kimchi, A., and Kroemer, G. (2007) Self-eating and self- killing: crosstalk between autophagy and apoptosis. Nature reviews. Molecular cell biology 8, 741-752 295. Yorimitsu, T., and Klionsky, D. J. (2005) Autophagy: molecular machinery for self- eating. Cell death and differentiation 12 Suppl 2, 1542-1552 296. Singh, R., Kaushik, S., Wang, Y., Xiang, Y., Novak, I., Komatsu, M., Tanaka, K., Cuervo, A. M., and Czaja, M. J. (2009) Autophagy regulates lipid metabolism. Nature 458, 1131-1135 297. Ouimet, M., Franklin, V., Mak, E., Liao, X., Tabas, I., and Marcel, Y. L. (2011) Autophagy regulates cholesterol efflux from macrophage foam cells via lysosomal acid lipase. Cell metabolism 13, 655-667 298. Brown, M. S., Goldstein, J. L., Krieger, M., Ho, Y. K., and Anderson, R. G. (1979) Reversible accumulation of cholesteryl esters in macrophages incubated with acetylated lipoproteins. J Cell Biol 82, 597-613 299. Cox, B. E., Griffin, E. E., Ullery, J. C., and Jerome, W. G. (2007) Effects of cellular cholesterol loading on macrophage foam cell lysosome acidification. J Lipid Res 48, 1012-1021 300. Itabe, H., and Takano, T. (2000) Oxidized low density lipoprotein: the occurrence and metabolism in circulation and in foam cells. Journal of atherosclerosis and thrombosis 7, 123-131 301. Jerome, W. G., Cox, B. E., Griffin, E. E., and Ullery, J. C. (2008) Lysosomal cholesterol accumulation inhibits subsequent hydrolysis of lipoprotein cholesteryl ester. Microsc Microanal 14, 138-149 302. Yancey, P. G., and Jerome, W. G. (1998) Lysosomal sequestration of free and esterified cholesterol from oxidized low density lipoprotein in macrophages of different species. J Lipid Res 39, 1349-1361 303. Lapierre, L. R., Gelino, S., Melendez, A., and Hansen, M. (2011) Autophagy and lipid metabolism coordinately modulate life span in germline-less C. elegans. Current biology : CB 21, 1507-1514 304. Grabowski, G. A., Charnas, L., and Du, H. (2012) Acid lipase deficiencies: The Wolman disease/cholesteryl ester storage disease spectrum. in The Online Metabolic and Molecular Bases of Inherited Disease (Scriver, C. R., Beaudet, A.L., Sly, W.S., and Valle, D. ed., McGraw Hill Inc, New York 305. Crocker, A. C., Vawter, G. F., Neuhauser, E. B., and Rosowsky, A. (1965) Wolman's Disease: Three New Patients with a Recently Described Lipidosis. Pediatrics 35, 627- 640 306. Eto, Y., and Kitagawa, T. (1970) Wolman's disease with hypolipoproteinemia and acanthocytosis: clinical and biochemical observations. J Pediatr 77, 862-867 307. Marshall, W. C., Ockenden, B. G., Fosbrooke, A. S., and Cumings, J. N. (1969) Wolman's disease. A rare lipidosis with adrenal calcification. Archives of disease in childhood 44, 331-341 308. Boldrini, R., Devito, R., Biselli, R., Filocamo, M., and Bosman, C. (2004) Wolman disease and cholesteryl ester storage disease diagnosed by histological and ultrastructural

148

examination of intestinal and liver biopsy. Pathology, research and practice 200, 231- 240 309. Decarlis, S., Agostoni, C., Ferrante, F., Scarlino, S., Riva, E., and Giovannini, M. (2009) Combined hyperlipidaemia as a presenting sign of cholesteryl ester storage disease. Journal of inherited metabolic disease 32 Suppl 1, S11-13 310. Klima, H., Ullrich, K., Aslanidis, C., Fehringer, P., Lackner, K. J., and Schmitz, G. (1993) A splice junction mutation causes deletion of a 72-base exon from the mRNA for lysosomal acid lipase in a patient with cholesteryl ester storage disease. J Clin Invest 92, 2713-2718 311. Kyriakides, E. C., Paul, B., and Balint, J. A. (1972) Lipid accumulation and acid lipase deficiency in fibroblasts from a family with Wolman's disease, and their apparent correction in vitro. The Journal of laboratory and clinical medicine 80, 810-816 312. Tadiboyina, V. T., Liu, D. M., Miskie, B. A., Wang, J., and Hegele, R. A. (2005) Treatment of dyslipidemia with lovastatin and ezetimibe in an adolescent with cholesterol ester storage disease. Lipids Health Dis 4, 26 313. Anderson, R. A., Bryson, G. M., and Parks, J. S. (1999) Lysosomal acid lipase mutations that determine phenotype in Wolman and cholesterol ester storage disease. Mol Genet Metab 68, 333-345 314. Wallis, K., Gross, M., Kohn, R., and Zaidman, J. (1971) A case of Wolman's disease. Helvetica paediatrica acta 26, 98-111 315. Assmann, G., Fredrickson, D. S., Sloan, H. R., Fales, H. M., and Highet, R. J. (1975) Accumulation of oxygenated steryl esters in Wolman's disease. J Lipid Res 16, 28-38 316. Lowden, J. A., Barson, A. J., and Wentworth, P. (1970) Wolman's disease: a microscopic and biochemical study showing accumulation of ceroid and esterified cholesterol. Canadian Medical Association journal 102, 402-405 317. Assmann, G., and Seedorf, U. (2001) Acid lipase deficiency: Wolman disease and cholesteryl ester storage disease. in The Metabolic and Molecular Bases of Inherited Disease, 7th ed. (Scriver, C. R., Beaudet, A.L., Sly, W.S., and Valle, D. ed.), McGraw Hill Inc, New York. pp 3551-3572 318. Krawczak, M., Reiss, J., and Cooper, D. N. (1992) The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Human genetics 90, 41-54 319. Yoshida, H., and Kuriyama, M. (1990) Genetic lipid storage disease with lysosomal acid lipase deficiency in rats. Laboratory animal science 40, 486-489 320. Nakagawa, H., Matsubara, S., Kuriyama, M., Yoshidome, H., Fujiyama, J., Yoshida, H., and Osame, M. (1995) Cloning of rat lysosomal acid lipase cDNA and identification of the mutation in the rat model of Wolman's disease. J Lipid Res 36, 2212-2218 321. Kuriyama, M., Yoshida, H., Suzuki, M., Fujiyama, J., and Igata, A. (1990) Lysosomal acid lipase deficiency in rats: lipid analyses and lipase activities in liver and spleen. J Lipid Res 31, 1605-1612 322. Du, H., Witte, D. P., and Grabowski, G. A. (1996) Tissue and cellular specific expression of murine lysosomal acid lipase mRNA and protein. J Lipid Res 37, 937-949 323. Du, H., Duanmu, M., Witte, D., and Grabowski, G. A. (1998) Targeted disruption of the mouse lysosomal acid lipase gene: long-term survival with massive cholesteryl ester and triglyceride storage. Hum Mol Genet 7, 1347-1354

149

324. Du, H., Heur, M., Duanmu, M., Grabowski, G. A., Hui, D. Y., Witte, D. P., and Mishra, J. (2001) Lysosomal acid lipase-deficient mice: depletion of white and brown fat, severe hepatosplenomegaly, and shortened life span. J Lipid Res 42, 489-500 325. Du, H., Schiavi, S., Levine, M., Mishra, J., Heur, M., and Grabowski, G. A. (2001) Enzyme therapy for lysosomal acid lipase deficiency in the mouse. Hum Mol Genet 10, 1639-1648 326. Du, H., Heur, M., Witte, D. P., Ameis, D., and Grabowski, G. A. (2002) Lysosomal acid lipase deficiency: correction of lipid storage by adenovirus-mediated gene transfer in mice. Hum Gene Ther 13, 1361-1372 327. Elleder, M., Chlumska, A., Hyanek, J., Poupetova, H., Ledvinova, J., Maas, S., and Lohse, P. (2000) Subclinical course of cholesteryl ester storage disease in an adult with hypercholesterolemia, accelerated atherosclerosis, and liver cancer. Journal of hepatology 32, 528-534 328. Sloan, H. R., and Fredrickson, D. S. (1972) Enzyme deficiency in cholesteryl ester storage idisease. J Clin Invest 51, 1923-1926 329. Dincsoy, H. P., Rolfes, D. B., McGraw, C. A., and Schubert, W. K. (1984) Cholesterol ester storage disease and mesenteric lipodystrophy. American journal of clinical pathology 81, 263-269 330. Elleder, M., Ledvinova, J., Cieslar, P., and Kuhn, R. (1990) Subclinical course of cholesterol ester storage disease (CESD) diagnosed in adulthood. Report on two cases with remarks on the nature of the liver storage process. Virchows Archiv. A, Pathological anatomy and histopathology 416, 357-365 331. Gasche, C., Aslanidis, C., Kain, R., Exner, M., Helbich, T., Dejaco, C., Schmitz, G., and Ferenci, P. (1997) A novel variant of lysosomal acid lipase in cholesteryl ester storage disease associated with mild phenotype and improvement on lovastatin. Journal of hepatology 27, 744-750 332. Iverson, S. A., Cairns, S. R., Ward, C. P., and Fensom, A. H. (1997) Asymptomatic cholesteryl ester storage disease in an adult controlled with simvastatin. Annals of clinical biochemistry 34 ( Pt 4), 433-436 333. Coates, P. M., Langer, T., and Cortner, J. A. (1986) Genetic variation of human mononuclear leukocyte lysosomal acid lipase activity. Relationship to atherosclerosis. Atherosclerosis 62, 11-20 334. Yatsu, F. M., Hagemenas, F. C., Manaugh, L. C., and Galambos, T. (1980) Cholesteryl ester hydrolase activity in human symptomatic atherosclerosis. Lipids 15, 1019-1022 335. Hagemenas, F. C., Manaugh, L. C., Illingworth, D. R., Sundberg, E. E., and Yatsu, F. M. (1984) Cholesteryl ester hydrolase activity in mononuclear cells from patients with type II hypercholesterolemia. Atherosclerosis 50, 335-344 336. Du, H., Schiavi, S., Wan, N., Levine, M., Witte, D. P., and Grabowski, G. A. (2004) Reduction of atherosclerotic plaques by lysosomal acid lipase supplementation. Arterioscler Thromb Vasc Biol 24, 147-154 337. Du, H., and Grabowski, G. A. (2004) Lysosomal acid lipase and atherosclerosis. Current opinion in lipidology 15, 539-544 338. Zschenker, O., Illies, T., and Ameis, D. (2006) Overexpression of lysosomal acid lipase and other proteins in atherosclerosis. J Biochem 140, 23-38 339. Peters, T. J. (1975) Lysosomes of the arterial wall. Frontiers of biology 43, 47-73

150

340. Peters, T. J., and De Duve, C. (1974) Lysosomes of the arterial wall. II. Subcellular fractionation of aortic cells from rabbits with experimantal atheroma. Experimental and molecular pathology 20, 228-256 341. Peters, T. J., Muller, M., and De Duve, C. (1972) Lysosomes of the arterial wall. I. Isolation and subcellular fractionation of cells from normal rabbit aorta. The Journal of experimental medicine 136, 1117-1139 342. Coltoff-Schiller, B., Goldfischer, S., Wolinsky, H., and Factor, S. M. (1976) Lipid accumulation in human aortic smooth muscle cell lysosomes. Am J Pathol 83, 39-44 343. Brecher, P., Pyun, H. Y., and Chobanian, A. V. (1977) Effect of atherosclerosis on lysosomal cholesterol esterase activity in rabbit aorta. J Lipid Res 18, 154-163 344. Haley, N. J., Fowler, S., and de Duve, C. (1980) Lysosomal acid cholesteryl esterase activity in normal and lipid-laden aortic cells. J Lipid Res 21, 961-969 345. Davis, H. R., Glagov, S., and Zarins, C. K. (1985) Role of acid lipase in cholesteryl ester accumulation during atherogenesis. Correlation of enzyme activity with acid lipase- containing macrophages in rabbit and human lesions. Atherosclerosis 55, 205-215 346. Takano, H., and Imanaka, K. (1978) Lysosomal acid cholesteryl esterase and atherosclerosis in cholesterol-fed rabbits Acta Hisotchemistry Cytochemistry 11, 323-336 347. De Duve, C., Wattiaux, R., and Wibo, M. (1962) Effects of fat-soluble compounds on lysosomes in vitro. Biochemical pharmacology 9, 97-116 348. Chao, F. F., Amende, L. M., Blanchette-Mackie, E. J., Skarlatos, S. I., Gamble, W., Resau, J. H., Mergner, W. T., and Kruth, H. S. (1988) Unesterified cholesterol-rich lipid particles in atherosclerotic lesions of human and rabbit aortas. Am J Pathol 131, 73-83 349. Kruth, H. S. (1984) Localization of unesterified cholesterol in human atherosclerotic lesions. Demonstration of filipin-positive, oil-red-O-negative particles. Am J Pathol 114, 201-208 350. Kruth, H. S. (1985) Subendothelial accumulation of unesterified cholesterol. An early event in atherosclerotic lesion development. Atherosclerosis 57, 337-341 351. Simionescu, N., Vasile, E., Lupu, F., Popescu, G., and Simionescu, M. (1986) Prelesional events in atherogenesis. Accumulation of extracellular cholesterol-rich liposomes in the arterial intima and cardiac valves of the hyperlipidemic rabbit. Am J Pathol 123, 109-125 352. Bhakdi, S., Dorweiler, B., Kirchmann, R., Torzewski, J., Weise, E., Tranum-Jensen, J., Walev, I., and Wieland, E. (1995) On the pathogenesis of atherosclerosis: enzymatic transformation of human low density lipoprotein to an atherogenic moiety. The Journal of experimental medicine 182, 1959-1971 353. Buton, X., Mamdouh, Z., Ghosh, R., Du, H., Kuriakose, G., Beatini, N., Grabowski, G. A., Maxfield, F. R., and Tabas, I. (1999) Unique cellular events occurring during the initial interaction of macrophages with matrix-retained or methylated aggregated low density lipoprotein (LDL). Prolonged cell-surface contact during which ldl-cholesteryl ester hydrolysis exceeds ldl protein degradation. J Biol Chem 274, 32112-32121 354. Hakala, J. K., Oksjoki, R., Laine, P., Du, H., Grabowski, G. A., Kovanen, P. T., and Pentikainen, M. O. (2003) Lysosomal enzymes are released from cultured human macrophages, hydrolyze LDL in vitro, and are present extracellularly in human atherosclerotic lesions. Arterioscler Thromb Vasc Biol 23, 1430-1436 355. Favari, E., Zimetti, F., Bortnick, A. E., Adorni, M. P., Zanotti, I., Canavesi, M., and Bernini, F. (2005) Impaired ATP-binding cassette transporter A1-mediated sterol efflux from oxidized LDL-loaded macrophages. FEBS letters 579, 6537-6542 151

356. Coronary Artery Disease Genetics, C. (2011) A genome-wide association study in Europeans and South Asians identifies five new loci for coronary artery disease. Nature genetics 43, 339-344 357. Wild, P. S., Zeller, T., Schillert, A., Szymczak, S., Sinning, C. R., Deiseroth, A., Schnabel, R. B., Lubos, E., Keller, T., Eleftheriadis, M. S., Bickel, C., Rupprecht, H. J., Wilde, S., Rossmann, H., Diemert, P., Cupples, L. A., Perret, C., Erdmann, J., Stark, K., Kleber, M. E., Epstein, S. E., Voight, B. F., Kuulasmaa, K., Li, M., Schafer, A. S., Klopp, N., Braund, P. S., Sager, H. B., Demissie, S., Proust, C., Konig, I. R., Wichmann, H. E., Reinhard, W., Hoffmann, M. M., Virtamo, J., Burnett, M. S., Siscovick, D., Wiklund, P. G., Qu, L., El Mokthari, N. E., Thompson, J. R., Peters, A., Smith, A. V., Yon, E., Baumert, J., Hengstenberg, C., Marz, W., Amouyel, P., Devaney, J., Schwartz, S. M., Saarela, O., Mehta, N. N., Rubin, D., Silander, K., Hall, A. S., Ferrieres, J., Harris, T. B., Melander, O., Kee, F., Hakonarson, H., Schrezenmeir, J., Gudnason, V., Elosua, R., Arveiler, D., Evans, A., Rader, D. J., Illig, T., Schreiber, S., Bis, J. C., Altshuler, D., Kavousi, M., Witteman, J. C., Uitterlinden, A. G., Hofman, A., Folsom, A. R., Barbalic, M., Boerwinkle, E., Kathiresan, S., Reilly, M. P., O'Donnell, C. J., Samani, N. J., Schunkert, H., Cambien, F., Lackner, K. J., Tiret, L., Salomaa, V., Munzel, T., Ziegler, A., and Blankenberg, S. (2011) A genome-wide association study identifies LIPA as a susceptibility gene for coronary artery disease. Circulation. Cardiovascular genetics 4, 403-412 358. Gordon, T., Castelli, W. P., Hjortland, M. C., Kannel, W. B., and Dawber, T. R. (1977) High density lipoprotein as a protective factor against coronary heart disease. The Framingham Study. Am J Med 62, 707-714 359. Boadu, E., Bilbey, N. J., and Francis, G. A. (2008) Cellular cholesterol substrate pools for adenosine-triphosphate cassette transporter A1-dependent high-density lipoprotein formation. Current opinion in lipidology 19, 270-276 360. Christiansen-Weber, T. A., Voland, J. R., Wu, Y., Ngo, K., Roland, B. L., Nguyen, S., Peterson, P. A., and Fung-Leung, W. P. (2000) Functional loss of ABCA1 in mice causes severe placental malformation, aberrant lipid distribution, and kidney glomerulonephritis as well as high-density lipoprotein cholesterol deficiency. Am J Pathol 157, 1017-1029 361. Du, H., Cameron, T. L., Garger, S. J., Pogue, G. P., Hamm, L. A., White, E., Hanley, K. M., and Grabowski, G. A. (2008) Wolman disease/cholesteryl ester storage disease: efficacy of plant-produced human lysosomal acid lipase in mice. J Lipid Res 49, 1646- 1657 362. Beaudet, A. L., Ferry, G. D., Nichols, B. L., Jr., and Rosenberg, H. S. (1977) Cholesterol ester storage disease: clinical, biochemical, and pathological studies. J Pediatr 90, 910- 914 363. Wu, D., Sharan, C., Yang, H., Goodwin, J. S., Zhou, L., Grabowski, G. A., Du, H., and Guo, Z. (2007) Apolipoprotein E-deficient lipoproteins induce foam cell formation by downregulation of lysosomal hydrolases in macrophages. J Lipid Res 48, 2571-2578 364. Francis, G. A. (2010) The complexity of HDL. Biochim Biophys Acta 1801, 1286-1293 365. Choi, H. Y., Karten, B., Chan, T., Vance, J. E., Greer, W. L., Heidenreich, R. A., Garver, W. S., and Francis, G. A. (2003) Impaired ABCA1-dependent lipid efflux and hypoalphalipoproteinemia in human Niemann-Pick type C disease. J Biol Chem 278, 32569-32577

152

366. Garver, W. S., Jelinek, D., Meaney, F. J., Flynn, J., Pettit, K. M., Shepherd, G., Heidenreich, R. A., Vockley, C. M., Castro, G., and Francis, G. A. (2010) The National Niemann-Pick Type C1 Disease Database: correlation of lipid profiles, mutations, and biochemical phenotypes. J Lipid Res 51, 406-415 367. Du, H., Sheriff, S., Bezerra, J., Leonova, T., and Grabowski, G. A. (1998) Molecular and enzymatic analyses of lysosomal acid lipase in cholesteryl ester storage disease. Mol Genet Metab 64, 126-134 368. Chung, B. H., Wilkinson, T., Geer, J. C., and Segrest, J. P. (1980) Preparative and quantitative isolation of plasma lipoproteins: rapid, single discontinuous density gradient ultracentrifugation in a vertical rotor. J Lipid Res 21, 284-291 369. Sattler, W., and Stocker, R. (1993) Greater selective uptake by Hep G2 cells of high- density lipoprotein cholesteryl ester hydroperoxides than of unoxidized cholesteryl esters. The Biochemical journal 294 ( Pt 3), 771-778 370. Folch, J., Lees, M., and Sloane Stanley, G. H. (1957) A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226, 497-509 371. Francis, G. A., Oram, J. F., Heinecke, J. W., and Bierman, E. L. (1996) Oxidative tyrosylation of HDL enhances the depletion of cellular cholesteryl esters by a mechanism independent of passive sterol desorption. Biochemistry 35, 15188-15197 372. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193, 265-275 373. Sahoo, D., Trischuk, T. C., Chan, T., Drover, V. A., Ho, S., Chimini, G., Agellon, L. B., Agnihotri, R., Francis, G. A., and Lehner, R. (2004) ABCA1-dependent lipid efflux to apolipoprotein A-I mediates HDL particle formation and decreases VLDL secretion from murine hepatocytes. J Lipid Res 45, 1122-1131 374. Pentchev, P. G., Kruth, H. S., Comly, M. E., Butler, J. D., Vanier, M. T., Wenger, D. A., and Patel, S. (1986) Type C Niemann-Pick disease. A parallel loss of regulatory responses in both the uptake and esterification of low density lipoprotein-derived cholesterol in cultured fibroblasts. J Biol Chem 261, 16775-16780 375. Kruth, H. S., Comly, M. E., Butler, J. D., Vanier, M. T., Fink, J. K., Wenger, D. A., Patel, S., and Pentchev, P. G. (1986) Type C Niemann-Pick disease. Abnormal metabolism of low density lipoprotein in homozygous and heterozygous fibroblasts. J Biol Chem 261, 16769-16774 376. Gonzalez-Noriega, A., Grubb, J. H., Talkad, V., and Sly, W. S. (1980) Chloroquine inhibits lysosomal enzyme pinocytosis and enhances lysosomal enzyme secretion by impairing receptor recycling. J Cell Biol 85, 839-852 377. Langmade, S. J., Gale, S. E., Frolov, A., Mohri, I., Suzuki, K., Mellon, S. H., Walkley, S. U., Covey, D. F., Schaffer, J. E., and Ory, D. S. (2006) Pregnane X receptor (PXR) activation: a mechanism for neuroprotection in a mouse model of Niemann-Pick C disease. Proc Natl Acad Sci U S A 103, 13807-13812 378. Axelson, M., and Larsson, O. (1995) Low density lipoprotein (LDL) cholesterol is converted to 27-hydroxycholesterol in human fibroblasts. Evidence that 27- hydroxycholesterol can be an important intracellular mediator between LDL and the suppression of cholesterol production. J Biol Chem 270, 15102-15110 379. Pentchev, P. G., Comly, M. E., Kruth, H. S., Tokoro, T., Butler, J., Sokol, J., Filling- Katz, M., Quirk, J. M., Marshall, D. C., Patel, S., and et al. (1987) Group C Niemann-

153

Pick disease: faulty regulation of low-density lipoprotein uptake and cholesterol storage in cultured fibroblasts. Faseb J 1, 40-45 380. Wong, J., Quinn, C. M., and Brown, A. J. (2007) Synthesis of the oxysterol, 24(S), 25- epoxycholesterol, parallels cholesterol production and may protect against cellular accumulation of newly-synthesized cholesterol. Lipids Health Dis 6, 10 381. Chen, W., Sun, Y., Welch, C., Gorelik, A., Leventhal, A. R., Tabas, I., and Tall, A. R. (2001) Preferential ATP-binding cassette transporter A1-mediated cholesterol efflux from late endosomes/lysosomes. J Biol Chem 276, 43564-43569 382. Chen, W., Wang, N., and Tall, A. R. (2005) A PEST deletion mutant of ABCA1 shows impaired internalization and defective cholesterol efflux from late endosomes. J Biol Chem 280, 29277-29281 383. Argoff, C. E., Comly, M. E., Blanchette-Mackie, J., Kruth, H. S., Pye, H. T., Goldin, E., Kaneski, C., Vanier, M. T., Brady, R. O., and Pentchev, P. G. (1991) Type C Niemann- Pick disease: cellular uncoupling of cholesterol homeostasis is linked to the severity of disruption in the intracellular transport of exogenously derived cholesterol. Biochimica et Biophysica Acta 1096, 319-327 384. Bowden, K. L., Bilbey, N. J., Bilawchuk, L. M., Boadu, E., Sidhu, R., Ory, D. S., Du, H., Chan, T., and Francis, G. A. (2011) Lysosomal acid lipase deficiency impairs regulation of ABCA1 gene and formation of high density lipoproteins in cholesteryl ester storage disease. J Biol Chem 286, 30624-30635 385. Peake, K. B., and Vance, J. E. (2010) Defective cholesterol trafficking in Niemann-Pick C-deficient cells. FEBS letters 584, 2731-2739 386. Basu, S. K., Goldstein, J. L., Anderson, G. W., and Brown, M. S. (1976) Degradation of cationized low density lipoprotein and regulation of cholesterol metabolism in homozygous familial hypercholesterolemia fibroblasts. Proc Natl Acad Sci U S A 73, 3178-3182 387. Castoreno, A. B., Wang, Y., Stockinger, W., Jarzylo, L. A., Du, H., Pagnon, J. C., Shieh, E. C., and Nohturfft, A. (2005) Transcriptional regulation of phagocytosis-induced membrane biogenesis by sterol regulatory element binding proteins. Proc Natl Acad Sci U S A 102, 13129-13134 388. Lydell, C. P., Chan, A., Wambolt, R. B., Sambandam, N., Parsons, H., Bondy, G. P., Rodrigues, B., Popov, K. M., Harris, R. A., Brownsey, R. W., and Allard, M. F. (2002) Pyruvate dehydrogenase and the regulation of glucose oxidation in hypertrophied rat hearts. Cardiovascular research 53, 841-851 389. von Trotha, K. T., Heun, R., Schmitz, S., Lutjohann, D., Maier, W., and Kolsch, H. (2006) Influence of lysosomal acid lipase polymorphisms on chromosome 10 on the risk of Alzheimer's disease and cholesterol metabolism. Neuroscience letters 402, 262-266 390. Wang, M. D., Franklin, V., Sundaram, M., Kiss, R. S., Ho, K., Gallant, M., and Marcel, Y. L. (2007) Differential regulation of ATP binding cassette protein A1 expression and ApoA-I lipidation by Niemann-Pick type C1 in murine hepatocytes and macrophages. J Biol Chem 282, 22525-22533 391. Marz, W., and Gross, W. (1986) Analysis of plasma lipoproteins by ultracentrifugation in a new fixed angle rotor: evaluation of a phosphotungstic acid/MgCl2 precipitation and a quantitative lipoprotein electrophoresis assay. Clinica chimica acta; international journal of clinical chemistry 160, 1-18

154

392. Assmann, G., Schriewer, H., Schmitz, G., and Hagele, E. O. (1983) Quantification of high-density-lipoprotein cholesterol by precipitation with phosphotungstic acid/MgCl2. Clinical chemistry 29, 2026-2030 393. Breslow, J. L. (1996) Mouse models of atherosclerosis. Science 272, 685-688 394. (!!! INVALID CITATION !!!). 395. Calpe-Berdiel, L., Rotllan, N., Palomer, X., Ribas, V., Blanco-Vaca, F., and Escola-Gil, J. C. (2005) Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice. Biochim Biophys Acta 1738, 6-9 396. Sando, G. N., Ma, G. P., Lindsley, K. A., and Wei, Y. P. (1990) Intercellular transport of lysosomal acid lipase mediates lipoprotein cholesteryl ester metabolism in a human vascular endothelial cell-fibroblast coculture system. Cell Regul 1, 661-674 397. Wang, M. D., Kiss, R. S., Franklin, V., McBride, H. M., Whitman, S. C., and Marcel, Y. L. (2007) Different cellular traffic of LDL-cholesterol and acetylated LDL-cholesterol leads to distinct reverse cholesterol transport pathways. J Lipid Res 48, 633-645 398. Ouimet, M., Wang, M. D., Cadotte, N., Ho, K., and Marcel, Y. L. (2008) Epoxycholesterol impairs cholesteryl ester hydrolysis in macrophage foam cells, resulting in decreased cholesterol efflux. Arterioscler Thromb Vasc Biol 28, 1144-1150 399. Repa, J. J., Berge, K. E., Pomajzl, C., Richardson, J. A., Hobbs, H., and Mangelsdorf, D. J. (2002) Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J Biol Chem 277, 18793-18800 400. Schultz, J. R., Tu, H., Luk, A., Repa, J. J., Medina, J. C., Li, L., Schwendner, S., Wang, S., Thoolen, M., Mangelsdorf, D. J., Lustig, K. D., and Shan, B. (2000) Role of LXRs in control of lipogenesis. Genes & development 14, 2831-2838 401. Lian, X., Yan, C., Yang, L., Xu, Y., and Du, H. (2004) Lysosomal acid lipase deficiency causes respiratory inflammation and destruction in the lung. American journal of physiology. Lung cellular and molecular physiology 286, L801-807 402. Yan, C., Lian, X., Li, Y., Dai, Y., White, A., Qin, Y., Li, H., Hume, D. A., and Du, H. (2006) Macrophage-specific expression of human lysosomal acid lipase corrects inflammation and pathogenic phenotypes in lal-/- mice. Am J Pathol 169, 916-926 403. Malerod, L., Juvet, K., Gjoen, T., and Berg, T. (2002) The expression of scavenger receptor class B, type I (SR-BI) and caveolin-1 in parenchymal and nonparenchymal liver cells. Cell and tissue research 307, 173-180 404. Malerod, L., Juvet, L. K., Hanssen-Bauer, A., Eskild, W., and Berg, T. (2002) Oxysterol- activated LXRalpha/RXR induces hSR-BI-promoter activity in hepatoma cells and preadipocytes. Biochem Biophys Res Commun 299, 916-923 405. Peet, D. J., Turley, S. D., Ma, W., Janowski, B. A., Lobaccaro, J. M., Hammer, R. E., and Mangelsdorf, D. J. (1998) Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell 93, 693-704 406. Rhainds, D., and Brissette, L. (2004) The role of scavenger receptor class B type I (SR- BI) in lipid trafficking. defining the rules for lipid traders. The international journal of biochemistry & cell biology 36, 39-77 407. Brunham, L. R., Kruit, J. K., Pape, T. D., Parks, J. S., Kuipers, F., and Hayden, M. R. (2006) Tissue-specific induction of intestinal ABCA1 expression with a liver X receptor agonist raises plasma HDL cholesterol levels. Circulation research 99, 672-674

155

408. Quinet, E. M., Savio, D. A., Halpern, A. R., Chen, L., Schuster, G. U., Gustafsson, J. A., Basso, M. D., and Nambi, P. (2006) Liver X receptor (LXR)-beta regulation in LXRalpha-deficient mice: implications for therapeutic targeting. Molecular pharmacology 70, 1340-1349 409. Wang, Y., and Oram, J. F. (2005) Unsaturated fatty acids phosphorylate and destabilize ABCA1 through a phospholipase D2 pathway. J Biol Chem 280, 35896-35903 410. Yang, Y., Jiang, Y., Wang, Y., and An, W. (2010) Suppression of ABCA1 by unsaturated fatty acids leads to lipid accumulation in HepG2 cells. Biochimie 92, 958-963 411. Smedsrod, B., De Bleser, P. J., Braet, F., Lovisetti, P., Vanderkerken, K., Wisse, E., and Geerts, A. (1994) Cell biology of liver endothelial and Kupffer cells. Gut 35, 1509-1516 412. Racanelli, V., and Rehermann, B. (2006) The liver as an immunological organ. Hepatology 43, S54-62 413. Hoekstra, M., Kruijt, J. K., Van Eck, M., and Van Berkel, T. J. (2003) Specific gene expression of ATP-binding cassette transporters and nuclear hormone receptors in rat liver parenchymal, endothelial, and Kupffer cells. J Biol Chem 278, 25448-25453 414. Bojanic, D. D., Tarr, P. T., Gale, G. D., Smith, D. J., Bok, D., Chen, B., Nusinowitz, S., Lovgren-Sandblom, A., Bjorkhem, I., and Edwards, P. A. (2010) Differential expression and function of ABCG1 and ABCG4 during development and aging. J Lipid Res 51, 169- 181 415. Zhang, J. R., Coleman, T., Langmade, S. J., Scherrer, D. E., Lane, L., Lanier, M. H., Feng, C., Sands, M. S., Schaffer, J. E., Semenkovich, C. F., and Ory, D. S. (2008) Niemann-Pick C1 protects against atherosclerosis in mice via regulation of macrophage intracellular cholesterol trafficking. J Clin Invest 118, 2281-2290 416. Muntoni, S., Wiebusch, H., Jansen-Rust, M., Rust, S., Seedorf, U., Schulte, H., Berger, K., Funke, H., and Assmann, G. (2007) Prevalence of cholesteryl ester storage disease. Arterioscler Thromb Vasc Biol 27, 1866-1868 417. Erbel, C., Sato, K., Meyer, F. B., Kopecky, S. L., Frye, R. L., Goronzy, J. J., and Weyand, C. M. (2007) Functional profile of activated dendritic cells in unstable atherosclerotic plaque. Basic research in cardiology 102, 123-132 418. Weber, C., Meiler, S., Doring, Y., Koch, M., Drechsler, M., Megens, R. T., Rowinska, Z., Bidzhekov, K., Fecher, C., Ribechini, E., van Zandvoort, M. A., Binder, C. J., Jelinek, I., Hristov, M., Boon, L., Jung, S., Korn, T., Lutz, M. B., Forster, I., Zenke, M., Hieronymus, T., Junt, T., and Zernecke, A. (2011) CCL17-expressing dendritic cells drive atherosclerosis by restraining regulatory T cell homeostasis in mice. J Clin Invest 121, 2898-2910

156