DOCSLIB.ORG

LRRFIP1 (NM 001137551) Human Untagged Clone Product Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
LRRFIP1 (NM 001137551) Human Untagged Clone Product Data OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC325873 LRRFIP1 (NM_001137551) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: LRRFIP1 (NM_001137551) Human Untagged Clone Tag: Tag Free Symbol: LRRFIP1 Synonyms: FLAP-1; FLAP1; FLIIAP1; GCF-2; GCF2; HUFI-1; TRIP Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001137551, the custom clone sequence may differ by one or more nucleotides ATGACCAGCCCCGCGGCCGCTCAAAGCCGGGAGATCGACTGTTTGAGCCCGGAAGCGCAGAAGCTGGCGG AAGCCCGGCTCGCTGCAAAACGGGCGGCCCGCGCGGAGGCTCGCGAGATCCGCATGAAGGAGCTGGAGCG GCAGCAGAAGGAGGTAGAAGAGAGACCAGAAAAAGATTTTACTGAGAAGGGGTCTCGTAACATGCCGGGC CTGTCTGCAGCCACGCTGGCCTCTCTGGGTGGGACTTCCTCTCGGAGAGGCAGCGGAGACACCTCCATCT CCATCGACACCGAGGCATCCATCAGGGAAATCAAGGACTCTCTAGCAGAAGTTGAAGAGAAATATAAGAA GGCTATGGTTTCCAATGCTCAGCTAGACAATGAAAAGACAAACTTCATGTACCAGGTTGATACCCTAAAA GATATGTTGCTGGAGCTTGAAGAACAGCTGGCTGAATCTAGGCGGCAGTACGAAGAGAAAAACAAAGAAT TTGAAAGGGAAAAACACGCCCACAGTATACTGCAATTTCAGTTTGCTGAAGTCAAGGAGGCCCTGAAGCA AAGAGAGGAAATGCTCGAGAAACATGGAATAATCCTAAATTCAGAAATAGCTACCAATGGAGAGACTTCC GACACCCTCAATAATGTTGGATACCAAGGTCCTACCAAGATGACAAAAGAAGAGTTAAATGCCCTCAAGT CGACAGGGGATGGGACCCTAGATATTAGGTTGAAAAAGCTGGTTGATGAACGGGAATGCTTATTGGAACA GATTAAGAAACTCAAAGGGCAGCTGGAGGAGAGACAGAAGATTGGCAAACTAGACAATCTTCGATCTGAA GATGATGTCTTGGAAAACGGGACAGACATGCATGTAATGGACCTACAAAGGGATGCCAACAGACAGATCA GCGACCTCAAATTTAAACTTGCAAAATCTGAGCAAGAGATAACTGCATTAGAACAAAATGTAATAAGGTT AGAGAGTCAAGTATCACGTTACAAATCAGCGGCTGAAAATGCAGAAAAAATAGAAGATGAACTTAAGGCA GAAAAACGGAAACTCCAAAGAGAGCTCCGCTCTGCATTGGATAAAACAGAAGAGCTCGAGGTGAGCAACG GCCACTTAGTGAAGCGTCTGGAAAAAATGAAAGCAAATCGGAGTGCACTCTTGTCCCAGCAGTAA Restriction Sites: SgfI-MluI ACCN: NM_001137551 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 LRRFIP1 (NM_001137551) Human Untagged Clone – SC325873 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_001137551.1, NP_001131023.1 RefSeq Size: 3599 bp RefSeq ORF: 1185 bp Locus ID: 9208 UniProt ID: B4DPC0 Protein Families: Transcription Factors Gene Summary: Transcriptional repressor which preferentially binds to the GC-rich consensus sequence (5'- AGCCCCCGGCG-3') and may regulate expression of TNF, EGFR and PDGFA. May control smooth muscle cells proliferation following artery injury through PDGFA repression. May also bind double-stranded RNA. Positively regulates Toll-like receptor (TLR) signaling in response to agonist probably by competing with the negative FLII regulator for MYD88-binding. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks three internal coding exons and the 3' terminal exon, but has several additional coding exons near to an alternate 3' terminal exon, compared to variant 3. The resulting isoform (2) lacks two internal segments and has a shorter and distinct C-terminus, compared to isoform 3. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Load more

Recommended publications
  • The Lavender Plumage Colour in Japanese Quail Is
    Bed’hom et al. BMC Genomics 2012, 13:442 http://www.biomedcentral.com/1471-2164/13/442 RESEARCH ARTICLE Open Access The lavender plumage colour in Japanese quail is associated with a complex mutation in the region of MLPH that is related to differences in growth, feed consumption and body temperature Bertrand Bed’hom1, Mohsen Vaez2,5, Jean-Luc Coville1, David Gourichon3, Olivier Chastel4, Sarah Follett2, Terry Burke2 and Francis Minvielle1,6* Abstract Background: The lavender phenotype in quail is a dilution of both eumelanin and phaeomelanin in feathers that produces a blue-grey colour on a wild-type feather pattern background. It has been previously demonstrated by intergeneric hybridization that the lavender mutation in quail is homologous to the same phenotype in chicken, which is caused by a single base-pair change in exon 1 of MLPH. Results: In this study, we have shown that a mutation of MLPH is also associated with feather colour dilution in quail, but that the mutational event is extremely different. In this species, the lavender phenotype is associated with a non-lethal complex mutation involving three consecutive overlapping chromosomal changes (two inversions and one deletion) that have consequences on the genomic organization of four genes (MLPH and the neighbouring PRLH, RAB17 and LRRFIP1). The deletion of PRLH has no effect on the level of circulating prolactin. Lavender birds have lighter body weight, lower body temperature and increased feed consumption and residual feed intake than wild-type plumage quail, indicating that this complex mutation is affecting the metabolism and the regulation of homeothermy. Conclusions: An extensive overlapping chromosome rearrangement was associated with a non-pathological Mendelian trait and minor, non deleterious effects in the lavender Japanese quail which is a natural knockout for PRLH.
    [Show full text]
  • Downloaded with Ma- Disease D D
    bioRxiv preprint doi: https://doi.org/10.1101/483065; this version posted November 29, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. F1000Research 2016 - DRAFT ARTICLE (PRE-SUBMISSION) Bioinformatics Approach to Identify Diseasome and Co- morbidities Effect of Mitochondrial Dysfunctions on the Progression of Neurological Disorders Md. Shahriare Satu1, Koushik Chandra Howlader2, Tajim Md. Niamat Ullah Akhund3, Fazlul Huq4, Julian M.W. Quinn5, and Mohammad Ali Moni4,5 1Dept. of CSE, Gono Bishwabidyalay, Dhaka, Bangladesh 2Dept. of CSTE, Noakhali Science and Technology University, Noakhali, Bangladesh 3Institute of Information Technology, Jahangirnagar University, Dhaka, Bangladesh 4School of Biomedical Science, Faculty of Medicine and Health, The University of Sydney, Australia 5Bone Biology Division, Garvan Institute of Medical Research, Darlinghurst, NSW, Australia Abstract Mitochondrial dysfunction can cause various neurological diseases. We therefore developed a quantitative framework to explore how mitochondrial dysfunction may influence the progression of Alzheimer’s, Parkinson’s, Hunting- ton’s and Lou Gehrig’s diseases and cerebral palsy through analysis of genes showing altered expression in these conditions. We sought insights about the gene profiles of mitochondrial and associated neurological diseases by investigating gene-disease networks, KEGG pathways, gene ontologies and protein-protein interaction network. Gene disease networks were constructed to connect shared genes which are commonly found between the neurological diseases and Mito- chondrial Dysfunction. We also generated KEGG pathways and gene ontologies to explore functional enrichment among them, and protein-protein interaction networks to identify the shared protein groups of these diseases.
    [Show full text]
  • TNF Expression Noncoding Rnas and LRRFIP1 Regulate
    Noncoding RNAs and LRRFIP1 Regulate TNF Expression Lihua Shi, Li Song, Michael Fitzgerald, Kelly Maurer, Asen Bagashev and Kathleen E. Sullivan This information is current as of September 26, 2021. J Immunol published online 24 February 2014 http://www.jimmunol.org/content/early/2014/02/21/jimmun ol.1302063 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2014/02/21/jimmunol.130206 Material 3.DCSupplemental Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 26, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2014 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published February 24, 2014, doi:10.4049/jimmunol.1302063 The Journal of Immunology Noncoding RNAs and LRRFIP1 Regulate TNF Expression Lihua Shi, Li Song, Michael Fitzgerald, Kelly Maurer, Asen Bagashev,1 and Kathleen E. Sullivan Noncoding RNAs have been implicated in the regulation of expression of numerous genes; however, the mechanism is not fully understood. We identified bidirectional, long noncoding RNAs upstream of the TNF gene using five different methods.
    [Show full text]
  • Rapalog-Mediated Repression of Tribbles
    Published OnlineFirst April 3, 2020; DOI: 10.1158/0008-5472.CAN-19-2366 CANCER RESEARCH | MOLECULAR CELL BIOLOGY Rapalog-Mediated Repression of Tribbles Pseudokinase 3 Regulates Pre-mRNA Splicing Bojana Stefanovska1,2,3, Cecile Edith Vicier1,2,3, Thibault Dayris2,4, Vasily Ogryzko5,†, Veronique Scott1,2,3, Ibrahim Bouakka1,2,3, Suzette Delaloge6, Anna Rocca1,2,3, Olivia Le Saux7, Olivier Tredan 7, Thomas Bachelot7, Fabrice Andre1,2,6, and Olivia Fromigue1,2,3 ABSTRACT ◥ Rapalogs have become standard-of-care in patients with induced deregulation of RNA splicing. Conversely, overexpres- metastatic breast, kidney, and neuroendocrine cancers. Never- sion of TRIB3 in a panel of cancer cell lines abolished theless, tumor escape occurs after several months in most the cytotoxic effects of rapalogs. These findings identify TRIB3 patients, highlighting the need to understand mechanisms of as a key component of the spliceosome, whose repression resistance. Using a panel of cancer cell lines, we show that contributes significantly to the mechanism of resistance to rapalogs downregulate the putative protein kinase TRIB3 (trib- rapalog therapy. bles pseudokinase 3). Blood samples of a small cohort of patients with cancer treated with rapalogs confirmed down- Significance: Independent of mTOR signaling, rapalogs induce regulation of TRIB3. Downregulation of TRIB3 was mediated cytoxicity by dysregulating spliceosome function via repression of by LRRFIP1 independently of mTOR and disrupted its inter- TRIB3, the loss of which may, in the long term, contribute to action with the spliceosome, where it participated in rapalog- therapeutic resistance. Introduction development of some derivatives overcame issues related to poor solubility and pharmacokinetics of the original rapamycin molecule.
    [Show full text]
  • "The Genecards Suite: from Gene Data Mining to Disease Genome Sequence Analyses". In: Current Protocols in Bioinformat
    The GeneCards Suite: From Gene Data UNIT 1.30 Mining to Disease Genome Sequence Analyses Gil Stelzer,1,5 Naomi Rosen,1,5 Inbar Plaschkes,1,2 Shahar Zimmerman,1 Michal Twik,1 Simon Fishilevich,1 Tsippi Iny Stein,1 Ron Nudel,1 Iris Lieder,2 Yaron Mazor,2 Sergey Kaplan,2 Dvir Dahary,2,4 David Warshawsky,3 Yaron Guan-Golan,3 Asher Kohn,3 Noa Rappaport,1 Marilyn Safran,1 and Doron Lancet1,6 1Department of Molecular Genetics, Weizmann Institute of Science, Rehovot, Israel 2LifeMap Sciences Ltd., Tel Aviv, Israel 3LifeMap Sciences Inc., Marshfield, Massachusetts 4Toldot Genetics Ltd., Hod Hasharon, Israel 5These authors contributed equally to the paper 6Corresponding author GeneCards, the human gene compendium, enables researchers to effectively navigate and inter-relate the wide universe of human genes, diseases, variants, proteins, cells, and biological pathways. Our recently launched Version 4 has a revamped infrastructure facilitating faster data updates, better-targeted data queries, and friendlier user experience. It also provides a stronger foundation for the GeneCards suite of companion databases and analysis tools. Improved data unification includes gene-disease links via MalaCards and merged biological pathways via PathCards, as well as drug information and proteome expression. VarElect, another suite member, is a phenotype prioritizer for next-generation sequencing, leveraging the GeneCards and MalaCards knowledgebase. It au- tomatically infers direct and indirect scored associations between hundreds or even thousands of variant-containing genes and disease phenotype terms. Var- Elect’s capabilities, either independently or within TGex, our comprehensive variant analysis pipeline, help prepare for the challenge of clinical projects that involve thousands of exome/genome NGS analyses.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Endocrine System Local Gene Expression
    Copyright 2008 By Nathan G. Salomonis ii Acknowledgments Publication Reprints The text in chapter 2 of this dissertation contains a reprint of materials as it appears in: Salomonis N, Hanspers K, Zambon AC, Vranizan K, Lawlor SC, Dahlquist KD, Doniger SW, Stuart J, Conklin BR, Pico AR. GenMAPP 2: new features and resources for pathway analysis. BMC Bioinformatics. 2007 Jun 24;8:218. The co-authors listed in this publication co-wrote the manuscript (AP and KH) and provided critical feedback (see detailed contributions at the end of chapter 2). The text in chapter 3 of this dissertation contains a reprint of materials as it appears in: Salomonis N, Cotte N, Zambon AC, Pollard KS, Vranizan K, Doniger SW, Dolganov G, Conklin BR. Identifying genetic networks underlying myometrial transition to labor. Genome Biol. 2005;6(2):R12. Epub 2005 Jan 28. The co-authors listed in this publication developed the hierarchical clustering method (KP), co-designed the study (NC, AZ, BC), provided statistical guidance (KV), co- contributed to GenMAPP 2.0 (SD) and performed quantitative mRNA analyses (GD). The text of this dissertation contains a reproduction of a figure from: Yeo G, Holste D, Kreiman G, Burge CB. Variation in alternative splicing across human tissues. Genome Biol. 2004;5(10):R74. Epub 2004 Sep 13. The reproduction was taken without permission (chapter 1), figure 1.3. iii Personal Acknowledgments The achievements of this doctoral degree are to a large degree possible due to the contribution, feedback and support of many individuals. To all of you that helped, I am extremely grateful for your support.
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • Table S1 Genes with Coefficients of Variation (CV) Ratios (CVGHS/CVSD) in the Upper and Lower 10% of for Expression in Genetic Hypercalciuric Stone-Forming (GHS) And
    Table S1 Genes with coefficients of variation (CV) ratios (CVGHS/CVSD) in the upper and lower 10% of for expression in Genetic Hypercalciuric Stone-forminG (GHS) and Sprague-Dawley (SD) rats, assayed usinG Affymetrix Rat Genome 230 GeneChips. The location of the microsatellite or quantitative trait locus (QTL) position (Loc) in base pairs (bp), gene initiation base pair (BP), chromosomal banding position and RGD or GenBank name are given.Rat Genome Database (RGD) (www.rgd.mcw.edu), GenBank (http://www.ncbi.nlm.nih.gov/Genbank/) and Entrez (http://www.ncbi.nlm.nih.gov/sites/entrez). Variance in gene expression was ranked according to CVGHS/CVSD ratio for all renal (8846 genes, Pctl, Renal) and duodenal genes (9038 genes, Pctl, Duod). Gene Pctl, Pctl, QTL Gene (GenBank) Renal Duod BP GenBank/RGD Description D1Mit95 Riok2 (BG371773) 91.3 52.4 55,897,246 RIO kinase 2 66,832,211 Tmc4 (BF545988) - 93.6 63,582,715 transmembrane channel-like gene family 4 Isoc2b (BM385414) 2.3 - 67,689,183 Isochorismatase domain containing 2b Suv420h2 (AW525235) 69.9 97.3 67,815,980 suppressor of variegation 4-20 homolog 2 (Drosophila) Lilrb4 (BF282961) 95.5 - 69,165,497 leukocyte immunoglobulin-like receptor, subfamily B, member 4 Zbtb45 (BI289556) - 10.0 72,912,203 zinc finger and BTB domain containing 45 Sepw1 (NM_013027) 7.5 - 76,249,869 selenoprotein W, muscle 1 Chmp2a (AW434104) 0.1 86.9 72,889,348 chromatin modifying protein 2a Tmem160 (AWS25031) 97.6 2.2 76,716,254 transmembrane protein Pnmal2 (BI282311) 99.6 - 77,277,341 PNMA-like 2 Dmpk (AI044427) 98.9 7.3 78,449,323 dystrophia myotonica-protein kinase; serine-threonine kinase Vasp (AW520792) 99.3 - 78,621,478 vasodilator-stimulated phosphoprotein Ercc1 (AA892791) 90.6 - 78,711,248 excision repair cross-complementing rodent repair deficiency, complementation G.
    [Show full text]
  • Functional Genomic Analysis of Oligodendrocyte Differentiation
    The Journal of Neuroscience, October 25, 2006 • 26(43):10967–10983 • 10967 Development/Plasticity/Repair Functional Genomic Analysis of Oligodendrocyte Differentiation Jason C. Dugas,1 Yu Chuan Tai,3 Terence P. Speed,2,5 John Ngai,4,5 and Ben A. Barres1 1Department of Neurobiology, Stanford University School of Medicine, Stanford, California 94305, and 2Department of Statistics, 3Program in Biostatistics, 4Department of Molecular and Cell Biology and Helen Wills Neuroscience Institute, and 5Functional Genomics Laboratory, University of California, Berkeley, California 94720 To better understand the molecular mechanisms governing oligodendrocyte (OL) differentiation, we have used gene profiling to quan- titatively analyze gene expression in synchronously differentiating OLs generated from pure oligodendrocyte precursor cells in vitro.By comparing gene expression in these OLs to OLs generated in vivo, we discovered that the program of OL differentiation can progress normally in the absence of heterologous cell–cell interactions. In addition, we found that OL differentiation was unexpectedly prolonged and occurred in at least two sequential stages, each characterized by changes in distinct complements of transcription factors and myelin proteins. By disrupting the normal dynamic expression patterns of transcription factors regulated during OL differentiation, we dem- onstrated that these sequential stages of gene expression can be independently controlled. We also uncovered several genes previously uncharacterized in OLs that encode transmembrane, secreted, and cytoskeletal proteins that are as highly upregulated as myelin genes during OL differentiation. Last, by comparing genomic loci associated with inherited increased risk of multiple sclerosis (MS) to genes regulated during OL differentiation, we identified several new positional candidate genes that may contribute to MS susceptibility.
    [Show full text]
  • A Network Inference Approach to Understanding Musculoskeletal
    A NETWORK INFERENCE APPROACH TO UNDERSTANDING MUSCULOSKELETAL DISORDERS by NIL TURAN A thesis submitted to The University of Birmingham for the degree of Doctor of Philosophy College of Life and Environmental Sciences School of Biosciences The University of Birmingham June 2013 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Musculoskeletal disorders are among the most important health problem affecting the quality of life and contributing to a high burden on healthcare systems worldwide. Understanding the molecular mechanisms underlying these disorders is crucial for the development of efficient treatments. In this thesis, musculoskeletal disorders including muscle wasting, bone loss and cartilage deformation have been studied using systems biology approaches. Muscle wasting occurring as a systemic effect in COPD patients has been investigated with an integrative network inference approach. This work has lead to a model describing the relationship between muscle molecular and physiological response to training and systemic inflammatory mediators. This model has shown for the first time that oxygen dependent changes in the expression of epigenetic modifiers and not chronic inflammation may be causally linked to muscle dysfunction.
    [Show full text]
  • T-, B-And NK-Lymphoid, but Not Myeloid Cells Arise from Human
    Leukemia (2007) 21, 311–319 & 2007 Nature Publishing Group All rights reserved 0887-6924/07 $30.00 www.nature.com/leu ORIGINAL ARTICLE T-, B- and NK-lymphoid, but not myeloid cells arise from human CD34 þ CD38ÀCD7 þ common lymphoid progenitors expressing lymphoid-specific genes I Hoebeke1,3, M De Smedt1, F Stolz1,4, K Pike-Overzet2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium and 2Department of Immunology, Erasmus University Medical Center, Rotterdam, The Netherlands Hematopoietic stem cells in the bone marrow (BM) give rise to share a direct common progenitor either, as CLPs were not all blood cells. According to the classic model of hematopoi- found in the fetal liver.5 Instead, fetal B and T cells would esis, the differentiation paths leading to the myeloid and develop through B/myeloid and T/myeloid intermediates. lymphoid lineages segregate early. A candidate ‘common 6 lymphoid progenitor’ (CLP) has been isolated from The first report of a human CLP came from Galy et al. who À þ CD34 þ CD38À human cord blood cells based on CD7 expres- showed that a subpopulation of adult and fetal BM Lin CD34 sion. Here, we confirm the B- and NK-differentiation potential of cells expressing the early B- and T-cell marker CD10 is not þ À þ CD34 CD38 CD7 cells and show in addition that this capable of generating monocytic, granulocytic, erythroid or population has strong capacity to differentiate into T cells. As megakaryocytic cells, but can differentiate into dendritic cells, CD34 þ CD38ÀCD7 þ cells are virtually devoid of myeloid B, T and NK cells.
    [Show full text]