LRRFIP1 (NM 001137551) Human Untagged Clone Product Data

LRRFIP1 (NM 001137551) Human Untagged Clone Product Data

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC325873 LRRFIP1 (NM_001137551) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: LRRFIP1 (NM_001137551) Human Untagged Clone Tag: Tag Free Symbol: LRRFIP1 Synonyms: FLAP-1; FLAP1; FLIIAP1; GCF-2; GCF2; HUFI-1; TRIP Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001137551, the custom clone sequence may differ by one or more nucleotides ATGACCAGCCCCGCGGCCGCTCAAAGCCGGGAGATCGACTGTTTGAGCCCGGAAGCGCAGAAGCTGGCGG AAGCCCGGCTCGCTGCAAAACGGGCGGCCCGCGCGGAGGCTCGCGAGATCCGCATGAAGGAGCTGGAGCG GCAGCAGAAGGAGGTAGAAGAGAGACCAGAAAAAGATTTTACTGAGAAGGGGTCTCGTAACATGCCGGGC CTGTCTGCAGCCACGCTGGCCTCTCTGGGTGGGACTTCCTCTCGGAGAGGCAGCGGAGACACCTCCATCT CCATCGACACCGAGGCATCCATCAGGGAAATCAAGGACTCTCTAGCAGAAGTTGAAGAGAAATATAAGAA GGCTATGGTTTCCAATGCTCAGCTAGACAATGAAAAGACAAACTTCATGTACCAGGTTGATACCCTAAAA GATATGTTGCTGGAGCTTGAAGAACAGCTGGCTGAATCTAGGCGGCAGTACGAAGAGAAAAACAAAGAAT TTGAAAGGGAAAAACACGCCCACAGTATACTGCAATTTCAGTTTGCTGAAGTCAAGGAGGCCCTGAAGCA AAGAGAGGAAATGCTCGAGAAACATGGAATAATCCTAAATTCAGAAATAGCTACCAATGGAGAGACTTCC GACACCCTCAATAATGTTGGATACCAAGGTCCTACCAAGATGACAAAAGAAGAGTTAAATGCCCTCAAGT CGACAGGGGATGGGACCCTAGATATTAGGTTGAAAAAGCTGGTTGATGAACGGGAATGCTTATTGGAACA GATTAAGAAACTCAAAGGGCAGCTGGAGGAGAGACAGAAGATTGGCAAACTAGACAATCTTCGATCTGAA GATGATGTCTTGGAAAACGGGACAGACATGCATGTAATGGACCTACAAAGGGATGCCAACAGACAGATCA GCGACCTCAAATTTAAACTTGCAAAATCTGAGCAAGAGATAACTGCATTAGAACAAAATGTAATAAGGTT AGAGAGTCAAGTATCACGTTACAAATCAGCGGCTGAAAATGCAGAAAAAATAGAAGATGAACTTAAGGCA GAAAAACGGAAACTCCAAAGAGAGCTCCGCTCTGCATTGGATAAAACAGAAGAGCTCGAGGTGAGCAACG GCCACTTAGTGAAGCGTCTGGAAAAAATGAAAGCAAATCGGAGTGCACTCTTGTCCCAGCAGTAA Restriction Sites: SgfI-MluI ACCN: NM_001137551 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 LRRFIP1 (NM_001137551) Human Untagged Clone – SC325873 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_001137551.1, NP_001131023.1 RefSeq Size: 3599 bp RefSeq ORF: 1185 bp Locus ID: 9208 UniProt ID: B4DPC0 Protein Families: Transcription Factors Gene Summary: Transcriptional repressor which preferentially binds to the GC-rich consensus sequence (5'- AGCCCCCGGCG-3') and may regulate expression of TNF, EGFR and PDGFA. May control smooth muscle cells proliferation following artery injury through PDGFA repression. May also bind double-stranded RNA. Positively regulates Toll-like receptor (TLR) signaling in response to agonist probably by competing with the negative FLII regulator for MYD88-binding. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks three internal coding exons and the 3' terminal exon, but has several additional coding exons near to an alternate 3' terminal exon, compared to variant 3. The resulting isoform (2) lacks two internal segments and has a shorter and distinct C-terminus, compared to isoform 3. This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us