The Role of Tsg101 in the Development of Physiological Cardiac Hypertrophy

and Cardio-Protection from Endotoxin-Induced Cardiac Dysfunction

A dissertation to be submitted to the

Graduate School

of the University of Cincinnati

in partial fulfillment of the requirements for the degree Doctor of Philosophy in the

Department of Pharmacology and Systems Physiology, College of Medicine

By:

Kobina Q. Essandoh

B.A. in Biochemistry from Cornell College, 2011

Advisor and Committee Chair:

Guo-Chang Fan, Ph.D.

Abstract

In this dissertation, the functional role of Tumor susceptibility gene (Tsg101) in the regulation of physiological cardiac hypertrophy and endotoxin-induced cardiac dysfunction was explored. Development of physiological cardiac hypertrophy has primarily been ascribed to the insulin-like growth factor 1 (IGF-1) and its receptor, IGF-1R, and subsequent activation of the Akt pathway. However, regulation of endosome-mediated recycling and degradation of IGF-1R during physiological hypertrophy has not been investigated. Furthermore, cardiac mitochondrial damage and subsequent inflammation are hallmarks of endotoxin-induced myocardial depression.

Activation of the Parkin/PINK1 pathway has been shown to promote autophagy of damaged mitochondria (mitophagy) and protect from endotoxin-induced cardiac dysfunction. Tsg101 has been demonstrated to play diverse roles in the cell including virus budding, cytokinesis, transcriptional regulation, endosomal recycling of receptors and activation of autophagic flux.

Hence, the first goal of this dissertation was to elucidate the role of Tg101 in endosome-mediated recycling of IGF-1R in physiological cardiac remodeling. The second goal of this dissertation was to investigate whether Tsg101 regulates mitophagy and thus contribute to endotoxin-caused myocardial dysfunction.

Firstly, in a physiological hypertrophy model of treadmill-exercised mice, we observed that levels of Tsg101 were dramatically elevated in the heart, compared to sedentary controls. To determine the role of Tsg101 on physiological hypertrophy, we generated a transgenic mouse model with cardiac-specific overexpression of Tsg101. These transgenic (TG) mice exhibited physiological cardiac hypertrophy at 8 weeks, evidenced by significant enhancement of cardiac function without fibrosis, increased total and membrane levels of IGF-1R, as well as Akt activation, compared to wild-types. Mechanistically, we identified that Tsg101 interacted with

FIP3 and IGF-1R, thereby stabilizing the endosomal recycling compartment (ERC) and enhancing recycling of IGF-1R. In vitro, adenovirus-mediated overexpression of Tsg101 in neonatal rat cardiomyocytes resulted in cell hypertrophy, which was blocked by addition of 1) Monensin, an inhibitor of endosomal recycling; 2) Picropodophyllin, an inhibitor of IGF-1R signaling; and 3) siRNA-FIP3. Furthermore, knockdown of Tsg101 in both mice and neonatal cardiomyocytes significantly inhibited the expression of Rab11a and FIP3 and endosomal recycling of IGF-1R, compared to controls. Interestingly, inducible Tsg101-knockdown mice failed to develop cardiac hypertrophy after treadmill training. Additionally, Tsg101-TG were protected from cardiac fibrosis and dysfunction associated with pathological hypertrophy, induced by transverse aortic constriction surgery.

Secondly, Tsg101-TG and -KD mice underwent endotoxin (LPS) treatment (10μg/g) to determine survival, cardiac function, systemic/local inflammation, and activity of mitophagy mediators in the heart. Upon endotoxin challenge, Tsg101-TG mice exhibited decreased mortality, preserved cardiac contractile function, reduced inflammation, enhanced activation of mitophagy in the heart and preservation of mitochondrial structural integrity, compared to control mice. By contrast, endoxin treatment in Tsg101-KD mice exacerbated animal mortality, cardiac dysfunction, inflammation and mitochondrial structural damage. Both co-immunoprecipitation assays and co-immunofluorescence staining showed that Tsg101 was bound to Parkin in the cytosol of myocytes and consequently facilitated translocation of Parkin to the mitochondria.

Altogether, this dissertation demonstrates that Tsg101: a) regulates physiological cardiac hypertrophy through the FIP3-mediated endosomal recycling of IGF-1R; and b) could protect against endotoxin-triggered myocardial injury by promoting Parkin-induced mitophagy.

iii

Acknowledgements

First and foremost, I am extremely grateful to my thesis advisor, Dr. Guo-Chang Fan for being a great mentor during my time in his lab. His guidance and mentorship has provided me with a strong foundation as a scientist. His encouragement in times of difficulty and his enthusiasm when goals and achievements are attained have enabled me in this journey. His dedication to science has had a big effect on my personal and professional development and these values will key as I develop in my research career.

I am very appreciative to my thesis committee members, Drs. Evangelia Kranias, Terry

Kirley, Jack Rubinstein and Charles Caldwell, for the suggestions and criticisms that they provided me in our meetings. The insightful comments and advice have nurtured my critical thinking skills which have been instrumental to the completion of this thesis. Their suggestions and help have shaped my dissertation to the form that it is and I am blessed to have them on my dissertation committee.

I am very thankful to past and present members of the Fan laboratory, Drs. Liwang Yang,

Dongze Qin, Jiangtong Peng, Haitao Gu and Xingjiang Mu for their friendship, encouragement and input into my project. I am especially indebted to Dr. Xiaohong Hong for her mentorship and for teaching me various techniques early on when I joined the Fan lab. I am also very appreciative of Dr. Shan Deng, who dedicated her time and efforts in helping me with experiments.

I would like to show my gratitude to the collaborators whose work enhanced the quality of this dissertation. I would like to thank Ming Jiang and Nathan Robbins of the Rubinstein lab for the hours spent in performing and analyzing echocardiographic data. I am also thankful to the lab of Dr. Yigang Wang for providing and allowing me to utilize their equipment. Especially, I would

iv like to thank Wei Huang, for assisting me with echocardiography and surgical procedures. I would like to extend my appreciation to Dr. Kay-Uwe Wagner for providing our lab with the Tsg101 floxed mice, which has enabled me to complete this thesis.

I am very lucky to have encountered great individuals in Department of Pharmacology and

Systems Physiology. I would like to show my gratitude to Drs. Abdul Matlib, Robert Rapoport and John Maggio for their mentorship and advice during my time in both the Masters’ and Doctoral programs. I would like to appreciate Nancy Thyberg for her kindness, support and for always having an open door in times that I needed help. I am thankful to my classmates and fellow graduate students, Yutian Li, Fawzi Alogaili, George Gardner, Shaimaa Ibrahim for their collaboration and friendship through out this journey.

I am honored to be have been awarded two fellowships during my time in graduate school.

I was honored to be awarded the Albert J. Ryan fellowship that provided support for my research and gave me an opportunity to network with other fellows at our annual meeting. I am also thankful for the American Heart Association Pre-doctoral fellowship which provided stipend support.

Lastly, I would like to thank my family for the support they have provided me over the years.

I would like to thank my parents, Akwasi and Alberta, for the sacrifices they made for me to pursue an education away from home. I owe a tremendous amount of gratitude to them for their patience, love, encouragement and always being there for me. I am very appreciative of my siblings, Kofi,

Jackie and Abeiku, for being my biggest cheerleaders and encouraging me throughout my studies.

Table of Contents Abstract i

Acknowledgements iv

Table of Contents 1

List of Abbreviations 7

List of Figures and Tables 13

Chapter I Introduction 17

Section 1 Role of IGF-1R in Physiological Hypertrophy 17

I.1.A Overview of Cardiac Hypertrophy 17

I.1.B Characteristics of physiological versus pathological cardiac hypertrophy 18

I.1.C Molecular mechanisms involved in cardiac hypertrophy 20

I.1.D IGF-1R/Akt signaling and physiological cardiac hypertrophy 21

I.1.E IGF-1R and endosomal system 23

Section 2 Mitochondrial dysfunction in Septic cardiomyopathy 26

I.2.A Overview of Sepsis 26

I.2.B Septic cardiomyopathy 30

I.2.C Mitochondria dysfunction in septic cardiomyopathy 31

I.2.D Mitophagy/Autophagy in septic cardiomyopathy 34

Section 3 Tumor Susceptibility Gene 101 (Tsg101) 35

I.3.A Discovery, Structure and Expression of Tsg101 35

I.3.B Role of Tsg101 in cancer 37

I.3.C Role of Tsg101 in cell proliferation 39

I.3.D Role of Tsg101 in the ESCRT machinery 40

I.3.E Role of Tsg101 in HIV budding 41

I.3.F Role of Tsg101 in receptor recycling 42

I.3.G Role of Tsg101 in autophagy 43

Section 4 Dissertation Scope and Objectives 44

Chapter II Materials and Methods 47

Section 1 Generation of Mouse Models 47

II.1.A Generation of Tsg101 Transgenic Mice 47

II.1.B Generation of Tsg101-Knockdown Mice 49

Section 2. Exercise-Induced Cardiac Hypertrophy model of Treadmill Training 51

Section 3. Mouse model of endotoxemia 51

Section 4. Determination cardiac contractile function 52

II.4.A In vivo Measurement of cardiac function 52

II.4.B In vitro cardiomyocyte isolation and Measurement of Mechanics 52

Section 5: Cardiac Histology 53

Section 6. Transfection of neonatal rat cardiomyocytes with adenoviruses, siRNA

and plasmids 53

II.6.A Isolation of Neonatal rat cardiomyocytes 53

II.6.B Construction and Transfection of Adenovirus vector Tsg101 54

II.6.C Construction and Transfection of Adenovirus Vector shRNA-Tsg101 54

II.6.D SiRNA and Plasmid Transfection 55

Section 7. Measurement of protein and mRNA expression 55

II.7.A Western Blotting Assays 55

II.7.B qRT-PCR Analysis 56

Section 8. In vitro experiments of various treatments 57

II.8.A Treatment of NRCMs with Monensin and Picropodophyllin 57

II.8.B Treatment of NRCMs MG132 and Cycloheximide 58

Section 9: Determination of protein interaction 59

II.9.A Co-Immunoprecipitation Assays 59

II.9.B Immunofluorescence staining 59

Section 10. Cell Biotinylation-Based Recycling Assays 60

Section 11. Transverse Aortic Constriction (TAC) Surgery 61

Section 12: ELISA assays for Cytokines 62

Section 13. Measurement of mitochondrial structural damage 63

II.13.A Measurement of mitochondrial DNA (mtDNA) 63

II.13.B Mitochondria isolation and quantification of mtROS 63

Section 14. Statistical Analysis 64

Chapter III Results 65

Section 1: Tsg101 regulates physiologic-like cardiac hypertrophy through

FIP3-mediated endosomal recycling of IGF-1R 65

III.1.A Expression profiles of endosome-associated genes in in vivo and in vitro

models of physiological cardiac hypertrophy 65

III.1.B Generation and Characterization of Tsg101-transgenic mouse model 70

III.1.C Overexpression of Tsg101 alters expression of endosome-associated proteins 79

III.1.D Overexpression of Tsg101 promotes IGF-1R recycling and cell growth in

neonatal rat cardiomyocytes 81

III.1.E Tsg101 interacts with FIP3 and IGF-1R 86

III.1.F Inhibition of endosomal recycling by monensin, knockdown of FIP3

and blockade of IGF-1R signaling by Picropodophyllin dampens

Tsg101-induced cell hypertrophy 89

III.1.G Knockdown of Tsg101 inhibits expression of mediators of endosomal

recycling compartment 95

III.1.H Knockdown of Tsg101 inhibits development of physiological hypertrophy 99

III.1.I Knockdown of Tsg101 in neonatal myocytes blocks activity of the

endosomal recycling compartment and inhibits recycling of IGF-1R 103

III.1.J Overexpression of Tsg101 does not promote recycling of EGFR, IR and

β1-AR but knockdown of Tsg101 inhibits recycling of IR and EGFR 106

III.1.K Tsg101 is cardioprotective against pathological cardiac hypertrophy 109

III.1.L Overexpression of Tsg101 inhibits phenylephrine-induced

cardiomyocyte growth 113

Section 2: Tsg101 ameliorates endotoxin-induced cardiac dysfunction through enhancing

Parkin-mediated mitophagy 116

III.2.A Endotoxin activates mitophagy in the mouse heart, together with

upregulation of Tsg101 116

III.2.B Overexpression of Tsg101 improves animal survival and cardiac

function upon endotoxin challenge 118

III.2.C Overexpression of Tsg101 reduces inflammation upon endotoxin challenge 120

III.2.D Overexpression of Tsg101 enhances mitophagy and preserves

mitochondria structural integrity in endotoxin-treated hearts 122

III.2.E Knockdown of Tsg101 exacerbates LPS-triggered animal mortality

and cardiac dysfunction 125

III.2.F Knockdown of Tsg101 exacerbates LPS-triggered inflammation 127

III.2.G Knockdown of Tsg101 diminishes mitophagy and mitochondrial

integrity in LPS-treated hearts 129

III.2.H Tsg101 interacts with and augments the activity of Parkin in

endotoxin-treated hearts 132

Chapter IV Discussion 135

Section 1: Dissertation Summary 135

Section 2: The role of Tsg101 in physiological cardiac hypertrophy 136

IV.2.A Upregulation of Tsg101 levels in exercised-trained hearts 136

IV.2.B Tsg101 promotes endosomal recycling of IGF-1R via ERC 138

IV.2.C Tsg101 enhances physiological cardiac growth and cardiac contractility 140

IV.2.D Tsg101 stabilizes FIP3 and IGF-1R protein levels 142

IV.2.E Tsg101 attenuates pathological cardiac remodeling 144

IV.2.E Future Directions and Limitations 145

Section 3: Role of Tsg101 on Parkin-mediated mitophagy in endotoxin-induced

cardiac dysfunction 147

IV.3.A Autophagy/Mitophagy is activated in septic hearts 147

IV.3.B Tsg101 enhances Parkin activity in endotoxemic hearts 148

IV.3.C Tsg101 preserves mitochondrial structural integrity 151

IV.3.D Tsg101 inhibits endotoxin-induced inflammation, cardiac dysfunction

and mortality 153

IV.3.E Future Directions and Limitations 154

Section 4: Conclusion of dissertation 155

References 157

Appendix: Publications, Abstracts and Awards 195

List of abbreviations

Abbreviation Full name ±dL/dt Maximal rates of cardiomyocyte contraction (+) and relengthening (-)

over time

AATF Apoptosis-antagonizing transcription factor

ACP afterload-adjusted cardiac performance

Ad.GFP adenovirus-expressing green fluorescent protein

Ad.shGFP adenovirus-expressing short hairpin RNA targeted to GFP

Ad.shTsg101 adenovirus-expressing short hairpin RNA targeted to Tsg101

Ad.Tsg101 adenovirus-expressing GFP-fused Tsg101

Akt Protein kinase B

AMPK AMP- activated protein kinase

Ang II angiotensin II

ANP atrial natriuretic peptide

ARIA apoptosis regulator through modulating IAP expression

ATP Adenosine-5'-triphosphate

BAG5 bcl-2-associated athanogene 5

BLOC-1 Biogenesis of lysosome-related organelles complex-1

BNP brain natriuretic peptide

BW body weight

C/EBPβ CCAAT-enhancer-binding protein β

CC coiled coil region

CCL2 coiled-coil forming protein

CHIP carboxyl terminus of Hsp70-interacting protein

CHX cycloheximide

CITED4 CBP/p300-interacting transactivator 4

CKI cyclin/cyclin-dependent kinase (CDK) inhibitor

CLP cecal ligation and puncture

Col I Collagen 1A1

Col III Collagen 3A1

CSQ Calsequestrin

CTRL control

DAMP damage-associated molecular pattern

DLIC-1 dynein light intermediate chain 1

DMSO Dimethyl sulfoxide

Drp1 dynamin-related protein 1

EEA1 early endosome antigen 1

EF Ejection fraction

EGFR epidermal growth factor receptor

ER estrogen receptor

ERC endosomal recycling compartment

ERK extracellular signal-regulated kinase

ERK extracellular signal regulated kinase

ESCRT endosomal recycling complexes required for transport

ET endothelin

FBS fetal bovine serum

FIP3 Rab11-family interacting protein-3

FOXO forkhead box transcription factor

FS Fractional shortening

GAP GTPase-activating proteins

GAPDH glyceraldehyde 3-phosphate dehydrogenase

GEF guanine nucleotide exchange factors

GFP Green fluorescent protein

GPCR G-protein-coupled receptor

GSK3β Glycogen synthase kinase 3β

HEK293 human embryonic kidney cells

HIF-1α hypoxia inducible factor 1α

HIV human immunodeficiency virus

Hrs hepatocyte growth factor-regulated kinase substrate

Hsp Heat shock protein

Hsp heat shock protein

HW heart weight

ICU intensive care units

IGF-1 insulin-like growth factor 1

IGF-1R insulin-like growth factor 1 receptor

IL6 Interleukin 6

IR insulin receptor

JNK c-jun amino-terminal kinase

KD knockdown

LAMP1 lysosomal associated membrane protein 1

LC3 Microtubule-associated proteins 1A/1B light chain 3

LOH loss of heterozygosity

LPS lipopolysaccharide

LTCC L-type calcium channel

MAPK mitogen activated protein kinase

MESNA sodium 2-mercaptoethanesulfonate

Mfn Mitofusin

MPI myocardial performance index mtDNA mitochondrial DNA mTOR mammalian target of rapamycin mtROS mitochondrial reactive oxygen species

MVB multivesicular bodies

Na/K-ATPase sodium potassium ATPase

NCX sodium/calcium exchanger 1

NE noradrenaline

NFAT nuclear factor of activated T cells

NF-κB Nuclear factor kappa-light-chain-enhancer of activated B cells

NO Nitric oxide

NP40 nonyl phenoxypolyethoxylethanol-40

NRCM neonatal rat cardiomyocyte

NRF Nuclear respiratory factor

OPA1 optic atrophy 1

PARL Presenilin associated, rhomboid-like

PCR Polymerase chain reaction

PDGF platelet derived growth factor

PDK1 phosphoinositide-dependent protein kinase 1

PE phenylephrine

PGC1α peroxisome proliferator- activated receptor- γ coactivator 1α

PI3K phosphoinositide-3 kinase

PINK1 PTEN-induced putative kinase 1

PIP3 phosphatidylinositol 3,4,5-trisphosphate

PKG protein kinase G

PLN Phospholamban

PPP Picropodophyllin

PRR proline rich region

Rac1 Rho-family GTPases

RGS2 regulator of G protein signaling 2

RHEB RAS homologue enriched in brain

RME-1 Receptor Mediated Endocytosis-1

RTK receptor tyrosine kinases

RyR Cardiac ryanodine receptor

SB α-helical/steadiness box domain

SERCA2 Sarco(endo)plasmic reticulum Calcium ATPase siFIP3 siRNA targeted at FIP3 siRNA small interfering RNA

SIRS systemic inflammatory response syndrome

SIRT1 Silent information regulator 1

SNX2 sorting nexin 2

SOFA Sequential Organ Failure Assessment

STAT3 Signal transducer and activator of transcription 3

SUMO-1 Small ubiquitin-related modifier 1

T3 thyroid hormone

TAC transverse aortic constriction

Tfam mitochondrial transcription factor A

TfnR transferrin receptor

TG transgenic

Tnf-α Tumor necrosis factor-alpha

Tsg101 Tumor susceptibility gene

Ub ubiquitin

UEV ubiquitin E2 variant domain

VEGF vascular endothelial growth factor

Vps vacuolar protein sorting protein

WGA wheat germ agglutinin

WT wild type

α-MHCp α-myosin heavy chain promoter

β1-AR beta adrenergic receptor

List of Figures and Tables

Figure 1. Diagram showing structural components and major players involved

in the endosomal system 24

Figure. 2. Schematic showing the major structural domains of Tsg101 36

Figure 3. Cardiac-specific Tsg101 transgenic construct 47

Table 1. Primer sequences for Tsg101-TG PCR 48

Table 2. PCR cycle for Tsg101-TG genotyping 48

Figure 4: Schematic showing the generation of cardiac-specific

Tsg101-knockdown (KD) mice 49

Table 3. Primer sequences for flox-Tsg101 PCR 50

Table 4. PCR cycle conditions for flox-Tsg101 genotyping 50

Table 5. Primer sequences for αMHC-Cre PCR 50

Table 6. PCR cycle for αMHC-Cre genotyping 51

Table 7. Primers for qRT-PCR analysis 57

Table 8. Primers for mtDNA quantification 63

Figure 5. Generation of physiological hypertrophy model of treadmill exercise training 67

Figure 6. Expression profile of endosome-associated genes in exercised hearts 68

Figure 7. Expression profile of endosome-associated genes in in vitro

model of physiological hypertrophy 69

Figure 8. Generation of Tsg101-transgenic mouse model 72

Figure 9. Characterization of Tsg101-transgenic mouse model 73

Figure 10. Time-course for development of cardiac hypertrophy in Tsg101-

transgenic hearts 74

Table 9. Echocardiography analysis for wild-type (WT) and transgenic (TG)

lines (D and G) at 8 weeks of age 75

Figure 11. Measurement of cardiomyocyte contractility in Tsg101-transgenic hearts 76

Table 10. Echocardiography analysis for wild-type (WT) and transgenic (TG)

lines (D and G) at 12 months of age 77

Figure 12. Expression of calcium handling proteins in Tsg101-transgenic hearts 78

Figure 13. Expression of endosome-associated genes and IGF-1R/Akt signaling

in Tsg101-transgenic hearts 80

Figure 14. Tsg101 overexpression in neonatal myocytes increases cell size 83

Figure 15. Expression of endosome-associated genes and IGF-1R signaling

in Tsg101-overexpressing cardiomyocytes 84

Figure 16. Tsg101 overexpression enhances recycling of IGF-1R in cardiomyocytes 85

Figure 17. Tsg101 interacts with FIP3 and IGF-1R 87

Figure 18. Overexpression of Tsg101 inhibits degradation of FIP3 88

Figure 19. Inhibition of endosomal recycling by monensin dampens

Tsg101-induced cell hypertrophy 91

Figure 20. Knockdown of FIP3 dampens Tsg101-induced cell hypertrophy 92

Figure 21. Blockade of IGF-1R signaling by Picropodophyllin dampens

Tsg101-induced cell hypertrophy 93

Figure 22. Overexpression of FIP3 mimics Tsg101-induced cardiomyocyte hypertrophy 94

Figure 23. Generation of Tsg101-KD mice 96

Figure 24. Expression of endosome-associated genes and IGF-1R/Akt

signaling in Tsg101-knockdown hearts 97

Figure 25. Knockdown of Tsg101 enhances degradation of FIP3 in the heart 98

Figure 26. Knockdown of Tsg101 in mouse hearts inhibits exercise-induced

cardiac hypertrophy 100

Table 11: Echocardiography analysis in sedentary and treadmill-trained (EXE)

CTRL and knockdown (KD) mice 101

Figure 27. Expression of pathological and fibrotic markers in Tsg101-KD exercised hearts 102

Figure 28. Expression of endosome-associated genes and IGF-1R/Akt signaling

in Tsg101-depleted cardiomyocytes 104

Figure 29. Knockdown of Tsg101 inhibits recycling of IGF-1R in cardiomyocytes 105

Figure 30. Expression of total and plasma membrane β1-AR, EGFR and IR

in Tsg101-overexpressing hearts and cardiomyocytes 107

Figure 31. Expression of total and plasma membrane β1-AR, EGFR and IR in Tsg101-

knockdown hearts and cardiomyocytes 108

Figure 32. Tsg101 levels are unchanged in in vivo model of pathological hypertrophy 110

Figure 33. Overexpression of Tsg101 attenuates pathological cardiac remodeling 111

Table 12. Echocardiography analysis in wild-type (WT) and transgenic (G) mice

subjected to sham and transverse aortic constriction surgery 112

Figure 34. Tsg101 levels are unchanged in in vitro models of pathological hypertrophy 114

Figure 35. Overexpression of Tsg101 blocks phenylephrine-triggered

myocyte hypertrophy 115

Figure 36. Endotoxin treatment enhances mitophagy and expression of Tsg101

in mouse hearts 117

Figure 37. Overexpression of Tsg101 attenuates endotoxin-induced animal mortality

and cardiac dysfunction 119

Figure 38. Overexpression of Tsg101 blocks endotoxin-induced inflammation 121

Figure 39. Overexpression of Tsg101 enhances expression of mitophagy mediators 123

Figure 40. Overexpression of Tsg101 inhibits endotoxin-induced mitochondrial damage 124

Figure 41. Knockdown of Tsg101 aggravates endotoxin-induced animal mortality

and cardiac dysfunction 126

Figure 42. Knockdown of Tsg101 aggravates endotoxin-induced inflammation 128

Figure 43. Knockdown of Tsg101 reduces expression of mitophagy mediators 130

Figure 44. Knockdown of Tsg101 aggravates endotoxin-induced mitochondrial damage 131

Figure 45. Tsg101 interacts with Parkin in cardiomyocytes 133

Figure 46. Tsg101 promotes the activity of Parkin in endotoxin-treated hearts 134

Figure 47. Diagram showing structural components and major players involved in

the Tsg101-mediated endosomal recycling of IGF-1R 147

Figure 48. Scheme depicting Tsg101-mediated protection against endotoxin-induced

cardiac dysfunction 155

Chapter I

Introduction

Section 1. Role of IGF-1R in Physiological Hypertrophy

I.1.A Overview of Cardiac Hypertrophy

The heart supplies oxygen and nutrients to all parts of the human body by pumping blood through blood vessels (1-4). The heart consists of various cell types including cardiomyocytes, fibroblasts, endothelial cells, mast cells, macrophages and vascular smooth muscle cells.

Cardiomyocytes are the heart muscle cells that are composed of sarcomeres, the repeated bundles of myofibrils, which are the basic unit of cardiac contractility. Cardiomyocytes represent about

40-50% of total cells in the heart but make up about 80% of heart mass (1-4). Although some reports have argued to the contrary, there is a consensus that cardiomyocytes lose their ability to proliferate after birth in mammals. Hence, the heart responds to increased preload or afterload by undergoing increase in size and mass due to the increase in wall stress. The enlargement of heart size and mass is termed cardiac hypertrophy. Initiation of cardiac hypertrophy enhances contractility, at least in the early stages, due to addition of new sarcomeres, but may be maladaptive at later stages.

Cardiac hypertrophy is a feature of most types of heart failure (5). On its own, cardiac hypertrophy may lead to myocardial infarction, arrhythmia and sudden death. About 1-3% of people in the developed world suffer from heart failure. The incidence of heart failure increases with age and has been reported that 10% of the population aged above 70 years suffer from heart failure (6,7). There is currently no cure for heart failure and about 40% of patients die within a year of diagnosis and about 60% do not survive past 5 years of diagnosis (8-11). Considering that

17 heart failure is linked with other comorbidities such as obesity and diabetes, there is increasing economic hardship harbored by people suffering from this disorder (12).

On the other hand, the athlete’s heart is a term used to describe the increase in heart mass of highly trained athletes (1). Although adaptations in the athlete heart have been classified as physiological, some reports have suggested possible pathological adaptations, due to reported cases in the media of sudden death of young athletes. Studies have however, debunked this claim and have demonstrated that sudden deaths in young athletes may result from congenital malformations that may not have been clinically undetected (13, 14). Hence, elucidating the underlying molecular mechanisms involved in induction of cardiac hypertrophy may help decipher therapeutic approaches for heart failure and other cardiovascular diseases. Depending on the stimuli and underlying mechanisms, cardiac hypertrophy can be classified into two types: physiological or pathological hypertrophy.

I.1.B Characteristics of physiological versus pathological cardiac hypertrophy

Cardiac hypertrophy is characterized by changes in cardiomyocyte survival, contractility, metabolism and gene expression. Both physiological and pathological hypertrophies are characterized by increased cardiomyocyte cell size. Inducers of pathological hypertrophy include chronic hypertension, aortic stenosis, mitral or aortic regurgitation, myocardial infarction (MI), misfolded- protein storage diseases, genetic cardiomyopathy and diabetes mellitus. On the other hand, physiological cardiac growth is induced by postnatal development, pregnancy, and repetitive endurance exercise (1-4). Pregnancy- and exercise -induced cardiac hypertrophy triggers about a

10–20% increase in heart mass whereas there is about a 2-fold increase in heart mass between birth and adulthood (15-17). Interestingly, development of physiological cardiac hypertrophy (i.e.

18 pregnancy and exercise) can be reversed and physiological cardiac growth has been reported to inhibit the progression of pathological cardiac hypertrophy.

Cardiac contractile function is either normal or enhanced in physiological cardiac hypertrophy, whereas pathological hypertrophy leads to ventricular chamber dilatation with wall thinning, contractile dysfunction, and eventual heart failure and death (18, 19). Although there are no interstitial fibrosis in physiological cardiac hypertrophy, pathological heart remodeling is characterized by perivascular and interstitial fibrosis, increase in levels of type I collagen and cardiomyocyte apoptosis (19). The accumulation of collagen stiffens the ventricular walls, thereby impairing contraction and relaxation. The increase in collagen and extracellular matrix reduces capillary density and angiogenesis and impedes oxygen diffusion in the heart. The combination of cardiac contractile dysfunction and reduced capillary density may bead to myocardial ischemia and heart failure (19).

In addition, levels of fetal genes, atrial natriuretic peptide (ANP); brain natriuretic peptide

(BNP); myosin heavy chain (MYH7) and skeletal muscle α- actin, are increased in pathological hypertrophy while these genes are unchanged or decreased in physiological hypertrophy (20).

Myoblast activation, which is measured by levels of smooth muscle α-actin is enhanced in pathological cardiac remodeling whereas there are no changes observed in physiological cardiac growth (21). In terms of metabolism, the heart mostly utilizes fatty acid oxidation to generate energy and ATP in normal conditions. In fact, fatty acid oxidation provides 60-70% ATP in normal hearts while glucose and lactate metabolism provides the remaining 30% (22). In pathological hypertrophy conditions, the heart switches to glucose metabolism and decreases fatty acid oxidation. The switch ensures that more ATP are produced per molecule of oxygen (23-26). In

19 physiological cardiac hypertrophy, the heart utilizes both fatty acid and glucose metabolism to generate ATP (27).

I.1.C Molecular mechanisms involved in cardiac hypertrophy

The best characterized pathways involved in the activation of pathological cardiac hypertrophy involve G-protein coupled receptors (GPCR). Pathological stimuli such as hypertension increase circulatory factors including angiotensin (Ang) II, endothelin-1 (ET)-1 and noradrenaline (NE) that bind to their corresponding GPCRs (Ang II receptor type 1 (AT1 receptor), endothelin receptors (ETA and ETB) and α1-adrenergic receptors (ARs), and trigger release of

Gαq/11 and activation of downstream effectors, namely mitogen activated protein kinase (MAPK), c-jun amino-terminal kinase (JNK), extracellular signal regulated kinase (ERK) and nuclear factor of activated T cells (NFAT) (1-4, 28-30). Mice with cardiac specific overexpression of Gαq exhibited features of pathological cardiac remodeling such as impaired cardiac contractile function and premature death (31, 32). Conversely, cardiac-specific knockdown of G-protein Gαq/11 in mice inhibited the development of cardiac hypertrophy, when the mice were subjected to pressure- overload (33, 34). More so, mice with cardiac specific overexpression of AngII AT1 receptor developed pathological cardiac hypertrophy and heart failure, which resulted in untimely death

(35). In addition, cardiac-specific transgenic mice overexpressing β1-AR demonstrated increased cardiac contractile performance at a young age but progressed into pathological cardiac remodeling with cardiac dysfunction and heart failure after 16 weeks of age (36).

Molecular pathways in the heart, associated with physiological growth, activate cell survival, increased energy production and efficiency, angiogenesis, activation of antioxidant responses, mitochondrial quality control and cardiomyocyte proliferation and regeneration. Such inducers include insulin growth factor-1 (IGF-1), thyroid hormone (T3), vascular endothelial

20 growth factor (VEGF), nitric oxide (NO), platelet derived growth factor (PDGF) and AMP- activated protein kinase (AMPK) (1-4). T3 induces postnatal hypertrophy by binding to the thyroid hormone receptors, TRα and TRβ. TRα and TRβ act as transcriptional regulators by aiding the switch from MYH7 (β-MHC) to MYH6 (α-MHC) (37). Studies have shown that T3 levels increase after birth (38). T3 also activates the retinoic acid receptor, which promotes transcription of genes that enhance cardiac contractile function such as sarcoplasmic/ endoplasmic reticulum calcium

ATPase 2 (SERCA2), β1-adrenergic receptor and the sodium/calcium exchanger 1 (NCX) (39-

42). Nitric oxide (NO) is involved in exercise-induced cardiac hypertrophy through activation protein kinase G (PKG). PKG then enhances activity of regulator of G protein signaling 2 (RGS2) and RGS4, and blocks GPCR-induced pathological cardiac hypertrophy (43-46). Studies have demonstrated that NO may enhance angiogenesis through increased phosphorylation of endothelial NO synthase (47). VEGF and PDGF are involved in angiogenesis and cell survival during physiological cardiac growth. As such, mice with depletion of VEGF and PDGF have impaired angiogenesis and develop pathological cardiac hypertrophy and heart failure (48, 49).

Lastly, exercise increases AMPK activity which promotes mitochondrial biogenesis during physiological cardiac growth via peroxisome proliferator- activated receptor- γ coactivator 1α

(PGC1α) (50, 51).

I.1.D IGF-1R/Akt signaling and physiological cardiac hypertrophy

The most characterized inducer of physiological cardiac hypertrophy is IGF-1 and its cognate receptor IGF-1R, and eventual activation of the Akt pathway. Studies in exercised athletes have revealed that there are increases in levels of cardiac and serum IGF-1 (52, 53). IGF-1 has also been implicated to play a role in postnatal developmental (54). IGF-1 binds its receptor (IGF-1R) and activates the phosphoinositide-3 kinase (PI3K)–Akt pathway. PI3K is a lipid-associated kinase

21 that initiates the production of phosphatidylinositol 3,4,5-trisphosphate (PIP3). PIP3 is then recruited to the membrane where it activates phosphoinositide-dependent protein kinase 1 (PDK1), phosphorylates and activates Akt (2). Studies have been performed in mouse models to confirm the role of IGF-1/IGF-1R/ PI3K–Akt pathway in physiological hypertrophy.

Mice with cardiac-specific overexpression of IGF-1 under the skeletal α-actin promoter developed physiological-like cardiac hypertrophy with enhanced cardiac systolic function at 10 weeks of age. Interestingly, at 12 months of age, these mice showed signs of fibrosis and cardiac dysfunction, which are symptomatic of pathological cardiac hypertrophy (55). On the other hand, cardiac-specific overexpression of IGF-1R under the α-MHC promoter exhibited features of physiological cardiac growth at both 3 months and 10 months of age. These mice showed increased cardiomyocyte size, no signs of fibrosis and necrosis, enhanced systolic function and increased activation of the PI3K-Akt pathway. Crucially, the IGF-1R transgenic mice did not show changes in expression of MAPK and calcineurin (56). Mice with cardiac-specific knockout of IGF-1R did not develop cardiac hypertrophy after swim exercise training for 5 weeks. Of note, there were no defects in baseline growth phenotype in these IGF-1R knockout mice. In addition, knockdown of insulin receptor (IR), which activates Akt signaling, did not blunt development of cardiac hypertrophy after swim exercise training (57). Hence, IGF-1R rather than IGF-1 is a critical regulator in the process of physiological cardiac hypertrophy.

PI3K is a downstream effector of IGF-1R, IR and various GPCRs. Reports have indicated that the catalytic subunit p110α of PI3K is critical for the development of physiological cardiac hypertrophy. Mice with cardiac-specific overexpression of PI3K p110α induced physiological cardiac hypertrophy and were resistant to pathological cardiac remodeling (58). In contrast, overexpression of the dominant negative form of PI3K p110α led to a 17% decrease in heart in

22 mice (59). Knockout of PDK1 in the heart led to reduced heart mass and cardiomyocyte size. The investigators noticed that PDK1-/- mice unexpectedly died between the ages of 5 to 11 weeks.

Echocardiographic analysis revealed that these PDK1-/- mice suffered from heart failure which may have contributed to the untimely death (60).

Furthermore, mice with heart-specific knockout of Akt1 were resistant to swim exercise- induced cardiac hypertrophy but developed pathological cardiac remodeling when subjected to pressure overload model of transverse aortic constriction (TAC) (61). Moreover, Akt1 may regulate physiological cardiac growth by inhibiting the expression of CCAAT-enhancer-binding protein β (C/EBPβ). C/EBPβ inhibits cell proliferation and survival by blocking transcription of genes such PGC1α, transcription factor GATA4, and homeobox protein Nkx-2.5 (62). Hence, exercise in mice enhances activity of PI3K/Akt, downregulates expression of C/EBPβ and upregulates CBP/p300-interacting transactivator 4 (CITED4). Mice with cardiac-specific elevation of CITED4 developed physiological cardiac hypertrophy and were protected from pathological modelling after myocardial infarction insult (63). In all, these studies demonstrate that development of physiological cardiac hypertrophy could be attributed to activation of the IGF-

1/IGF-1R/ PI3K–Akt signaling pathway.

I.1.E IGF-1R and endosomal system

Like other receptor tyrosine kinases (RTK), total IGF-1R levels depend on either de novo synthesis or recycling and degradation through the cellular endosomal system. The endocytic pathway was initially recognized as a mechanism to downregulate plasma membrane receptors such as RTKs and GPCRs (64). Later, studies showed that RTKs or GPCRs might couple to extracellular signal-regulated kinase (ERK)-activating complexes to sustain signals (64, 65).

Usually, both ligand-occupied and unoccupied membrane receptors could be internalized by

23 endocytosis to form early/sorting endosomes, which are targeted for transport to various endosome-associated compartments. Thus, plasma membrane IGF-1R is dynamically altered by a series of endosome-associated steps including endocytosis, sorting, recycling, and exocytosis (66-

68).

The transport of and localization of such endosomal compartments are regulated by small proteins (21-25kDa) called Rab GTPases. These

Rab GTPases may act as motor proteins for trafficking or as a recognition molecule that interacts with the tethering complex at the accepting endosomal compartment. As such, Rab

GTPases can traffic sorting endosomes to various subcellular compartments including late endosomes/lysosomes for degradation, trans-

Golgi network and endosomal recycling compartment (ERC) for recycling to plasma Figure 1. Diagram showing structural components and major players membrane (69, 70). Rab GTPases switch from involved in the endosomal system. active GTP bound form to inactive GDP bound form. The switch from GDP to GTP bound form is catalyzed by guanine nucleotide exchange factors (GEFs). RabGTPases are deactivated by their intrinsic GTPase activity or by GTPase-activating proteins (GAPs). There are over 60 proteins identified, but the major Rab proteins that transport endosomes to various cellular compartments include Rab4, Rab5, Rab7 and Rab11 (Fig. 1). The Rab protein regulate vesicular trafficking with the help of effector proteins that are recruited with their respective Rab protein at the endosomal membrane (69, 70).

Rab5 has been implicated to regulate endocytosis and the maturation of early endosomes to late endosomes (71). With the help of RabGEF1 (Rabex-5) bound to internalized ubiquitinated proteins, Rab5 is recruited to early endosomes, together with its effector proteins [i.e., the early endosome antigen 1(EEA1), vacuolar protein sorting protein (Vps)15 and phosphatidylinositol 3- kinase (PI3K, Vps34)] (72). Therefore, Rab5 can generate a complex at the cytosolic side of the early endosome. This Rab5 complex then provides the driving force to mobilize the early endosome through the microtubules (73-75).

Along the membrane of the early endosome, there are subdomains containing other Rab proteins (e.g., Rab4 and Rab11) as the early endosome matures. Receptors due to be recycled are sorted to the tubular domains and transported to the plasma membrane with the help of Rab4 and

Rab11 (76, 77). Rab4 facilitates the fast recycling of membrane proteins. There is limited information on the precise role of Rab4 and the effector proteins responsible for fast recycling but studies have demonstrated that Rab4 mediates recycling of transferrin receptor with the help of effector protein TBC1D16 (78). Other studies have revealed that Rab4 regulate fast recycling of

β2-ARs (79, 80). An alternative slower method of recycling of membrane proteins is mediated by

Rab11 through the endosomal recycling compartment (ERC). Rab11a binds with effector proteins, particularly family of Rab11- interacting proteins (FIPs), which promote its activities at the ERC.

Most prominent amongst these FIPs is FIP3, which has been demonstrated to provide structural stability to Rab11 and the ERC (Fig. 1) (81, 82).

The early endosomes matures into a late endosome if it is not recycling back to the plasma membrane. The switch from Rab5 to Rab7 regulates the maturation of early endosomes to late endosomes. At present, the most recognized model for this switch involves the conversion of

Rab5-GTP to Rab5-GDP by the recruitment of Rab7 (83). It has also been postulated that the

25 amount of Rab5 declines overtime while Rab7 levels increases, leading to the takeover by Rab7

(84, 85). The late endosome is then transported to the lysosome, with the help of Rab7, to degrade membrane cargo. As the late endosome matures, the endosomal recycling complex required for transport (ESCRT) is recruited to the endosomal membrane to aid in sorting of membrane cargo.

A key member of the ESCRT, tumor susceptibility gene 101 (Tsg101) has been demonstrated to contribute to both degradation and recycling of endosomal cargo. (86).

Indeed, the effects of endosomal processes such as internalization and recycling on IGF-1R signaling has been studied by Romanelli et al. The authors observed that treatment of glial cells with IGF-1 induced internalization of IGF-1R and the receptor was localized with EEA1, suggesting that IGF-1R undergoes endocytosis and is localized at the early endosome after endocytosis. Continual stimulation of glial cells with IGF-1 revealed that IGF-1R was localized with transferrin receptor and Rab11a-positive endosomes, indicating that IGF-1R is recruited to the ERC. Critically, blockade of receptor internalization with dansylcadaverine and inhibition of receptor recycling by monensin diminished Akt phosphorylation. This study suggests that IGF-1R is subjected to the endosomal system and the endosomal system plays a major role in determining the levels and activation of IGF-1R/Akt signaling pathway (84). However, there is a significant gap in our knowledge on the contribution of the endosomal system to physiological cardiac hypertrophy.

Section 2. Mitochondrial dysfunction in Septic cardiomyopathy

I.2.A Overview of Sepsis

Sepsis is a medical condition characterized by a severe systemic inflammatory response and organ failure due to bacterial infection (88, 89). At present, sepsis is the leading cause of death among patients admitted to the intensive care units (ICU), resulting in about 750,000 cases and

270,000 deaths annually in the United States (88, 89). The cost of treating sepsis in the United

States was a staggering $23.7 billion in 2013 (90). It was no until the late 20th century before sepsis was clinically defined because of inadequate treatment options and the short time span between diagnosis and mortality of non-surviving patients.

By 1992, sepsis was defined as a “systemic inflammatory response syndrome (SIRS), severe sepsis or septic shock in terms of both clinical and laboratory abnormalities” by the American

College of Chest Physicians and the Society of Critical Care Medicine (SCCM). Severe sepsis or septic shock was classified as sepsis with the presence of multiple organ dysfunction syndrome, hypoperfusion, or hypotension (91). Clinically, SIRS was characterized by two or more of the following: temperature above 38°C or below 36°C; heart rate above 90 beats per minute; respiratory rate above 20 breaths per minute or partial pressure of arterial carbon dioxide below

32 mmHg; and white blood cell count greater than 12,000/mm3 or less than 4,000/mm3, or the presence of immature neutrophils exceeding 10% (91).

By 2001, the definition of sepsis was slightly revised at a meeting of SCCM, the European

Society of Intensive Care Medicine (ESICM), the American College of Chest Physicians (ACCP), the American Thoracic Society (ATS), and the Surgical Infection Society (SIS) (92). The participants retained the SIRS definitions in which three of four SIRS criteria were obtainable at the bedside without need for laboratory testing, but remarked that septic shock was defined as an acute circulatory failure characterized by persistent arterial hypotension unexplained by other

27 causes. With the advancement of medical research and more understanding of septic pathophysiology, there was the need to revise the previous definitions of sepsis.

At the third meeting of the ESICM and the SCCM in 2016, the participants agreed upon a new definition of sepsis and related clinical criteria, as a “life threatening organ dysfunction caused by a dysregulated host response to infection”. In addition, septic shock was to be defined as the subset of sepsis in which the underlying circulatory and cellular metabolism abnormalities are profound enough to substantially increase mortality. A new criteria was developed to screen for sepsis in the ICU, which was termed the Sequential Organ Failure Assessment (SOFA) score. The

SOFA score evaluates the progression of multiple organ dysfunction by tracking the effects of immediate sepsis therapy on organ failure. The SOFA criteria include: partial pressure of arterial oxygen: fractional inspired oxygen < 300 mmHg; platelets < 100×103/mm3; bilirubin ≥ 2 mg/dL; hypotension requiring vasopressor support; Glasgow Coma Scale score ≤ 12; creatinine ≥ 2 mg/dL, or urine output < 500 mL/day (93). In non-ICU situations, the committee recommended the use qSOFA (‘quick’ SOFA) which relies on the following parameters: altered level of consciousness, defined as a Glasgow Coma Scale score ≤ 13, systolic blood pressure ≤ 100 mmHg and Respiratory rate ≥ 22 rpm (93, 94).

Sepsis can be acquired by both community-acquired and healthcare associated infections.

The common causes of sepsis include pneumonia, accounting for 50% of all cases, intra-abdominal and urinary tract infections (88, 89). The most common gram-negative bacteria implicated in sepsis are Escherichia coli, klebsiella species, and Pseudomonas aeruginosa while Staphylococcus aureus and Streptococcus pneumonia are the most commonly detected gram-positive infections in patient blood cultures (95, 96). Risk factors that predispose patients to sepsis are conditions that are characterized by immunosuppression. Such conditions include the chronic diseases (i.e.

28 acquired immunodeficiency syndrome, chronic obstructive pulmonary disease, and cancer), use of immunosuppressive drugs, genetic predisposition, infants and the elderly (88, 89).

Sepsis-induced mortality has primarily been ascribed to multiple organ dysfunction.

Previous models of multiple organ dysfunction was based on the presumption that the clinical features of sepsis are as a result of the initial pro-inflammatory cytokine storm in response to infection (97). The initial pro-inflammatory stage leads to a later stage of immune suppression where sepsis patients are susceptible to secondary infections (97). Studies have revealed that CD4+ and CD8+ T cells were depleted in the spleen of non-surviving sepsis patients, suggesting impairment of adaptive immune system at this later stage (98, 99). Advancement in sepsis research has indicated that the host response to infection is much more complex and heterogeneous based on individual patient’s sex, age, genetics, site of infection and presence of comorbidities. The mechanism underling multiple organ dysfunction remains ambiguous but impaired oxygen delivery and utilization in organ tissues have been heavily implicated. Factors that contribute to impaired tissue oxygenation include microvascular thrombosis, inflammation, hypotension, and mitochondria dysfunction. Microvascular thrombosis is caused by simultaneous activation of coagulation and impairment of anticoagulant pathways. The neutrophils activated in circulation increase thrombin formation which promotes tissue hypoperfusion (100, 101). In addition, increased inflammation causes endothelial cell death, loss of endothelial cell-to-cell tight junctions and loss of barrier function (100, 101). Furthermore, inflammation can damage mitochondria, which releases damage-associated molecular patterns including mitochondrial DNA and formyl peptides, which can cause further tissue injury (102).

As such, clinical manifestations of sepsis include fever, tachycardia, leukocytosis or leukopenia and tachycardia and tachypnoea. Immediate administration of broad-spectrum

29 antibiotics, to combat the infection and fluid intake, to alleviate hypoperfusion and hypotension, is critical to the survival in sepsis shock patients (103, 104). Patients may also to administered oxygen by endotracheal intubation to increase oxygen delivery to organs (105). Later on, supportive treatment is administered based on features of organ failure to cardiac, respiratory and renal systems. These include mechanical ventilation, continuous hemofiltration and nutritional support (106-108). Hence, the heart plays an important role in recovery from septic shock. Further, patients with cardiac dysfunction exacerbates impaired tissue oxygenation and mitochondrial dysfunction. Actually, clinical studies have indicated that septic patients without heart abnormalities have a 20-30% risk of dying while patients with cardiac dysfunction have a 70-90% chance of mortality (109, 110). Thus, deciphering the mechanisms underlying sepsis-induced cardiac dysfunction may generate therapeutic avenue to increase survival in sepsis patients.

I.2.B Septic cardiomyopathy

Septic cardiomyopathy is believed to occur in 40-50% of septic shock patients (111).

Cardiac dysfunction was first described in septic patients by a study in 1984 by Parker et al. where the investigators observed that septic shock patients showed increased ventricular dilation and diminished left-ventricular ejection fraction (112). This classification of septic cardiomyopathy did not account for the sepsis-induced circulatory dysfunction that contributes to filling pressures and cardiac afterload, which affects cardiac function parameters. In recent times, septic cardiomyopathy is defined as systolic and diastolic dysfunction that is reversible and affects both the left and right ventricles (113-115). Right ventricular dysfunction occurs in septic patients due to the acute respiratory distress syndrome that causes increased pulmonary vascular resistance and eventual dilation of the right ventricle (116, 117). Other parameters such as the myocardial performance index (MPI) and the afterload-adjusted cardiac performance (ACP) have been

30 employed to aid diagnosis of septic cardiomyopathy. The MPI measures the proportion of working cycle of the heart that is utilized in isovolumic activity in times the heart is not actively circulating blood (118). A clinical study concluded that septic patients with low MPI scores (represents better function) survived longer (119). ACP measures the ratio of actual versus predicted cardiac output, adjusted for systemic resistance. In a large cohort of sepsis patients, irregular ACP values was associated with higher 30-day mortality (120, 121). Although determination of cardiac dysfunction in sepsis still relies on echocardiographic parameters, there have been calls to determine diastolic and systolic function by left ventricular pressure-volume conductance catheters.

Like multiple organ dysfunction, the exact mechanism of septic cardiomyopathy remains uncertain but sepsis-triggered myocardial depression has largely been attributed to mitochondrial dysfunction (122). The active outer membrane phospholipid component of gram-negative bacteria, endotoxin (lipopolysaccharide, LPS), has been implicated as a major causative factor for sepsis- induced cardiac mitochondrial dysfunction (123, 124). Endotoxin is able to either bind with plasma membrane receptors such as Toll-like receptors (TRLs) or infiltrate into intracellular spaces, where it can interfere with organelle function (122). Activation of TLRs trigger downstream signaling pathways such NF-κB that promote transcription of pro-inflammatory cytokines (TNF-α and IL-

6), chemokines and adhesion molecules (125). Hence, the infiltration of endotoxin and increased production of inflammatory mediators lead to increased proteolysis, mitochondrial damage, dysregulated nitric oxide, β-adrenoceptor down-regulation and calcium mishandling (126, 127).

I.2.C Mitochondria dysfunction in septic cardiomyopathy

Mitochondria are intracellular organelles responsible for the energy demands of the cell through the production of approximately 6kg ATP daily by oxidative phosphorylation (128). As

31 such, 95-98% of total body oxygen consumption occurs at the mitochondria (129). Besides energy production, mitochondria play a major role in regulation of oxidative stress, cell survival and apoptotic death (130). Given its importance to energy generation and overall cellular homeostasis, there are quality control systems adapted by the cell to preserve mitochondrial function. In general, mitochondrial quality control is maintained by: a) mitochondrial biogenesis, and b) selective autophagy of damaged mitochondria (mitophagy) (131, 132). Currently, it is well recognized that mitochondrial function and quality control are extremely essential for cardiomyocyte contractile function (130-134). Disruption of these processes contribute to the pathophysiology of various cardiovascular disorders (130-134).

Cells generate new mitochondria to replace damaged mitochondria by a process termed mitochondrial biogenesis. Studies have shown that mitochondrial biogenesis is mediated by PGC-

1α and β (PPAR (peroxisome proliferator-activated receptor)-γ coactivator-1 α and β). PGC-1α and β bind to peroxisome proliferator-activated receptors, which activate transcriptional factors,

NRF-1 and -2 (Nuclear respiratory factors 1 and 2) and enhance expression of mitochondrial transcription factor A (Tfam), which initiate transcription of mitochondria DNA and biogenesis of new mitochondria (135).

Besides mitochondrial biogenesis, cellular homeostasis can be restored by selective degradation of damaged mitochondria by autophagy (mitophagy). Damaged mitochondria releases damage-associated molecular patterns (DAMPs) such as mitochondrial DNA (mtDNA) and mitochondrial reactive oxygen species (mtROS), that promote further injury to other cells (130-

134). At present, it is well established that mitophagy is regulated by E3 ubiquitin ligase, Parkin, and mitochondrial serine-threonine kinase, PINK1 (PTEN-induced putative kinase 1) (136-138).

Parkin was initially discovered to be mutated in Parkinson’s disease but was later in discovered to

32 be critical for induction of mitophagy in 2008(136). In normal cellular conditions, Parkin mostly exists in the cytosol while PINK1 exists in the inner membrane of the mitochondria and is cleaved by Presenilin associated, rhomboid-like (PARL) protein and then degraded by mitochondrial peptidases (139-141). When the mitochondria is depolarized, PINK1 is stabilized at the outer membrane of the mitochondria and is able to recruit Parkin from the cytosol to the mitochondria.

Once Parkin arrives at the outer membrane, Parkin recruits autophagy adaptors such as p62/SQSTM1, which initiate degradation of outer mitochondrial membrane proteins of the damaged mitochondria. The autophagy adaptors then recruits microtubule-associated proteins

1A/1B light chain 3 (LC3), which matures and elongates to engulf around the damaged mitochondria to form the autophagosome. The autophagosome is then transported to the lysosome to degrade the damaged mitochondria (136-138).

Of interest, endotoxin-induced mitochondrial impairment has been well reported in human septic patients and septic animal models. Interestingly, the first reported case of mitochondrial impairment in mammalian hearts was observed in a canine model of sepsis, which showed swelling, loss of cristae, cleared matrix, internal vesicles, and rupture of the inner and outer membranes (142). Soriano et al. observed that hematoxylin-eosin staining in heart sections from non-surviving septic patients showed cryptal damage and marked alterations to cristae in mitochondria. The investigators further identified presence of inflammatory cells and collagen disposition in human septic hearts that were not present in normal tissues. (143). Drosatos et al. identified several morphological abnormalities in mitochondria which exhibited loss of cristae, cleared matrix and swelling in hearts of mice treated with endotoxin for 6 and 18 hours. The mitochondria abnormalities correlated with decreased production of ATP in endotoxemic hearts

(144). Tavener and group observed that LPS injection in mice resulted in dysfunctional complex I

33 and II of cardiac mitochondria, which led to reduced production of ATP and cardiac contractile dysfunction (145).

Notwithstanding, therapies targeted to mitochondrial dysfunction in septic patients have not been explored. Regardless, recent studies in mice and rats have demonstrated that activation of mitophagy could greatly rescue LPS-induced cardiac dysfunction (146, 147). Thus, targeting the

Parkin/PINK1 pathway and mitochondrial autophagy (mitophagy) may represent the best outcomes in sepsis.

I.2.D Mitophagy/Autophagy in septic cardiomyopathy

Studies have demonstrated that activation of autophagy may have beneficial effects in animal models of sepsis induced cardiac dysfunction. First of all, there is evidence of induction of autophagy in hearts of mice and rats subjected to models of sepsis. Rats which underwent cecal ligation and puncture (CLP) surgery, a clinically relevant model of sepsis, showed elevated levels of LC3-II/LC3-I, which was linked with inhibition of the mammalian target of rapamycin (mTOR) pathway (148). In the same vein, mice subjected to CLP showed increased formation of autophagosomes and autolysosomes in the heart (149). Hsieh et al. demonstrated that mice, subjected to cecal ligation and puncture (CLP) surgery were protected from sepsis-induced cardiac dysfunction after injection of rapamycin, an inducer of autophagy. Rapamycin treatment also enhanced ATP levels and diminished production of inflammatory mediators, MCP-1 and IL-6

(150). In addition, Zhang et al. showed that administration of melatonin enhanced autophagy in endotoxemic hearts and abrogated endotoxin-induced cardiac dysfunction and apoptosis (151).

The authors observed that melatonin treatment improved cardiac function performance, inhibited cardiomyocyte cell death, and enhanced autophagosome formation in LPS-injected mice. The cardioprotective effects of melatonin were ascribed to upregulation of protein levels of Silent

34 information regulator 1 (SIRT1), which plays a role in cellular processes such as senescence, inflammation, apoptosis and autophagy (151). More so, pharmacological activation of AMPK by

A769662 abrogated the detrimental effects of endotoxin on cardiac function in mice. A769662 treatment improved cardiac function and enhanced the formation of autophagosomes (152).

Studies have suggested that the beneficial effects of autophagy of septic cardiomyopathy may be due to the selective degradation of damaged mitochondria. Piquereau et al. (153) observed baseline cardiac mitochondria abnormalities by knocking down Parkin in mouse hearts. Notably,

Parkin-deficient mice showed multiple cardiac mitochondrial defects and worse cardiac contractile function, compared to wild-type mice when challenged with endotoxin (153). A recent publication has also highlighted the importance of mitophagy to the recovery of cardiac contractile function after endotoxin challenge. Sun et al. (146) genetically promoted autophagy in mouse hearts by overexpressing Beclin-1, an activator of autophagy through its interaction with PI3K.

Overexpression of Beclin-1 improved cardiac function, attenuated inflammatory response, and fibrosis in endotoxin-treated mice. On the other hand, knockdown of Beclin-1 in mouse hearts aggravated endotoxin-induced mortality, cardiac dysfunction and inflammation. Further investigation demonstrated that overexpression of Beclin-1 enhanced activity of Parkin and alleviated the production of mitochondria associated molecular patterns such as mtDNA (146).

Section 3. Tumor Susceptibility Gene 101 (Tsg101)

I.3.A Discovery, Structure and Expression of Tsg101

Tumor susceptibility gene 101, originally discovered in 1995, was first identified in yeast two hybrid screen through its interaction with Stathmin, phosphoprotein implicated in

35 tumorigenesis. That study by Maucuer et al. sought to determine the physiological relevance of

Stathmin through its binding partners. These authors identified Tsg101 as a coiled-coil forming protein (CCL2) that contained an α-helical structure (154). Later, a screen for tumor suppressor genes in NIH3T3 fibroblasts identified Tsg101 after a random insertional mutagenesis experiment

(155). Consequently, the human Tsg101 gene was cloned and was found to contain 390 amino acids. The secondary structure of Figure 2. Schematic showing the major structural domains of Tsg101 Tsg101 is composed of four domains: the N- terminal ubiquitin E2 variant (UEV) domain, a proline rich region (PRR), a coiled coil (CC) region, and a C terminal α-helical/steadiness box (SB) domain (156) (Fig. 2).

The most characterized and researched amongst these domains is the UEV domain. The

UEV domain, which spans 145 amino acids, shares sequence similarity with E2 ubiquitin conjugating enzymes (UBC). Although the UEV domain has the capability to bind ubiquitin, it lacks the cysteine residue at its active site required to catalyze ubiquitin transfer (157-159). Due to its structural differences with E2 Ubiquitin ligases, UEV domain can bind P(T/S)AP-containing peptides such as viral proteins (160). The ability of UEV domain to bind ubiquitin is crucial to the sorting of protein cargo into multivesicular bodies (MVBs)/ late endosomes (161). Interestingly, crystal structures have demonstrated that Tsg101 UEV domain can bind to both ubiquitin and

P(T/S)AP-containing proteins, such that Tsg101 can be involved in a variety of cellular processes simultaneously (161).

The PRR domain spans about 70 amino acids and it consists of 30% proline residues.

Although the PRR domain is less studied compared to UEV domain, it had been found to bind to

CEP55A, a mid-body protein, responsible for cell abscission during cytokinesis (162). The CC

36 region, which was initially identified to interact with Stathmin, has also been found to bind to

Daxx. Daxx is a Fas interacting protein that interacts with Tsg101 in the nucleus and blocks glucocorticoid receptor mediated transcriptional activity (163). Additionally, Tsg101 CC is required to repress transcriptional activity of the estrogen receptor (ER) (164). Lastly, the SB domain has been demonstrated to regulate the levels of Tsg101 in the cell. Tal, a Tsg101-associated ligase, is believed to ubiquitinate several lysine residues in the SB domain to target Tsg101 for proteasomal degradation. Tal may also ubiquitinate lysine residues in the SB domain to aid translocation of Tsg101 from membranic to cytosolic spaces in the cell (165).

Tsg101 is widely expressed across several human and animal organ tissues including testis, heart muscle, kidney, brain, liver and spleen. Tsg101 is ubiquitously expressed in the cell. It is mainly expressed in the cytoplasm but can be found to various membrane spaces and can be observed in the nucleus during the cell cycle (156). Together with its structural domains, the localization of Tsg101 is critical for the diverse roles of Tsg101 in the cell, including tumorigenesis, protein ubiquitination, virus budding, cytokinesis, transcriptional regulation and endosomal sorting and trafficking (86).

I.3.B Role of Tsg101 in cancer

As discussed earlier, Tsg101 was classified as a tumor suppressor during a screen for tumor suppressor genes in NIH3T3 fibroblasts. In the same study, injection of NIH3T3 fibroblasts subcutaneously into Tsg101 knockdown mice induced tumor formation (155). Further studies in human breast cancer patient samples showed intragenic Tsg101 deletions, compared to normal human breast tissues. Interestingly, this study also recognized that Tsg101 was located chromosome 11, subbands p15.1–15.2, which has previously been characterized as a region demonstrating loss of heterozygosity (LOH) in various human cancers (166, 167). However,

37 follow-up studies in large cohorts of human breast subjects debunked the role of Tsg101 as a tumor suppressor. These studies noted that intragenic Tsg101 deletions in breast cancer samples were in fact splice variants of Tsg101 that were also observed in normal human breast tissues. Eventually, the original study identifying Tsg101 as a tumor suppressor was retracted.

Research was also conducted in animal models to elucidate the role of Tsg101 in cancer.

Several studies reported that Tsg101 levels were enhanced in primary human breast carcinomas

(168, 169). Overexpression of Tsg101 in mammary glands enhanced susceptibility for tumor formation in older female mice, although these female mice developed normally throughout their reproductive cycle. These observations were linked to increased phosphorylation of phosphorylation ERK1/2 and Signal transducer and activator of transcription 3 (STAT3), suggesting that Tsg101 may promote tumor formation (170). In support, knockdown of Tsg101 in mouse embryonic fibroblasts and in mammary glands of mice inhibited growth and development, indicating that Tsg101 enhance cell proliferation and survival (171, 172).

Similar conflicting results about the role of Tsg101 in other human cancers have also been reported. A study in 422 human ovarian cancer samples revealed that Tsg101 levels were increased in 70% of the samples compared to normal tissues. Proteomic analysis in human ovarian carcinoma samples demonstrated that upregulation of Tsg101 correlated with increased levels of oncogenic HRAS or KRAS (173, 174). Knockdown Tsg101 in ovarian cancer SKOV-3 cells blocked cell growth, as a result of reduced levels of cell growth mediators, hypoxia inducible factor

1α (HIF-1α) and CBP/p300-interacting transactivator with ED-rich tail 2 (CITED2) (174). Like breast cancer, Tsg101 splice variants found in human ovarian carcinoma samples that were observed in control human ovarian tissues (175). Furthermore, Tsg101 levels were upregulated in

15 lung cancer cell lines and 5 human lung cancer tissue compared to their corresponding controls.

The authors further demonstrated that overexpression of Tsg101 in A549, a lung adenocarcinoma cell line, resulted in cell growth (176). In contrast, Chang et al. observed that Tsg101 levels were decreased in human lung cancer samples, which was linked to increased expression of Notch 3 receptor (177).

I.3.C Role of Tsg101 in cell proliferation

In line with its contribution to cancer progression, various reports have investigated the role of Tsg101 in cell proliferation and survival through regulation of cell cycle mediators. Particularly, several reports have indicated that levels of cell cycle mediators, p53 and p21, increase when

Tsg101 are knockdown in various cell lines (178, 179). Interestingly, Tsg101 has been shown to enhance degradation of p53 with the help of Ubiquitin ligase, MDM2. The authors demonstrated that Tsg101 interacts and stabilizes MDM2, which then ubiquitinates and degrades p53 through the proteasome. Moreover, overexpression of p53 led to decrease in levels of Tsg101 through 26S proteasome-mediated degradation (178, 179).

Krempler et al. showed that downregulation Tsg101 in MEFs resulted in growth arrest and cell death and cell growth was restored after exogenous expression of Tsg101. The authors however concluded that the effects of Tsg101 on cell cycle arrest and cell survival was not dependent on p53 (171). This group extended their studies on the role of Tsg101 in cell proliferation where they observed in another study that Tsg101-mediated effects on cell cycle arrest is dependent on p21CIP1. Tsg101 was shown to interact with and inhibit activation of the promoter of p21CIP1/WAF1 , thereby enhancing cell proliferation (180). As such, knockdown of

Tsg101 in Saos-2 human osteosarcoma cells resulted in increases levels of p21 mRNA and protein and inhibition of cell proliferation (181). Interestingly, knockdown of Tsg101 by siRNA in ovarian

39 cancer cells led to increased levels of p21 mRNA and protein and inhibition of cell growth, cell cycle arrest and apoptosis (182). In conflict with the study discussed above, Oh et al. indicated that

Tsg101 prevented cell proliferation through its interaction with cyclin/cyclin-dependent kinase

(CDK) inhibitor (CKI) and promotes stability of p21 protein in HEK293 cells (183).

I.3.D Role of Tsg101 in the ESCRT machinery

Most recent research has focused on the contribution of Tsg101 as an integral member of the Endosomal Sorting Complex required for Transport (ESCRT) machinery. The ESCRT machinery consists of four complexes (i.e. ESCRT-0, ESCRT-I, ESCRT-II and ESCRT-III), that lead to the formation of multivesicular bodies (MVB)/late endosomes. ESCRT-0 complex contains hepatocyte growth factor-regulated kinase substrate (Hrs , Vps27), STAM (STAM1 and STAM2 isoforms in human), Eps15 and clathrin. This complex recognizes monoubiquitinated proteins on the limiting membrane of late endosomes through the ubiquitin binding domains located in Hrs and STAM (184, 185). ESCRT-I is recruited to the endosomal membrane through the binding of

Hrs with the P(S/T)AP motif on Tsg101 (186). Tsg101 then receives the monoubiquitinated proteins from ESCRT-0 through its UEV domain (187, 188). The ESCRT-1 complex consists of

Tsg101, Vps28, Vps37 and Mvb12. Crystal structures of Tsg101 have revealed that Tsg101 binds to Vps37 and Mvb12 through its CC domain, while the SB domain provides structural stability to the ESCRT-I core. Vps28 initiates binding of ESCRT-I to ESCRT-II by interacting with Vps36 of

ESCRT-II (189, 190). The ESCRT-II complex consists of Vps36, Vps22 and two subunits of

Vps25. Components of ESCRT 0, ESCRT-I and ESCRT-II have ubiquitin-binding domains that transfer and sort monoubiquitinated proteins on the endosomal membrane. On the other hand,

ESCRT-III removes the ubiquitin tags and inward bud sorted proteins into intraluminal vesicles

(ILVs). Vps25 of ESCRT-II binds to Vps20 of ESCRT-III, which leads to the recruitment of

ESCRT-III proteins (191). The initial members of the ESCRT-III recruited are Vps20, CHMP4,

Vps24 and Vps2 in that order. Vps20 aids in the nucleation of CHMP4, which in turn binds to

Vps24 (192). Vps24 is then able to recruit Vps2. The addition of Vps2 brings about the recruitment of Vps4 which generates the scission of the invaginated limiting membrane into ILVs in the lumen

(193). Vps4 also has an AAA-ATPase activity which hydrolyzes ATP and causes the breakup and recycling of ESCRT-III components (194-196). The late endosome/MVB then fuses with the lysosome to degrade the endosomal cargo.

The importance of Tsg101 in biogenesis and maturation of MVB/late endosomes were highlighted by Razi and Futter, where knockdown of Tsg101 by siRNA in HEK293 cells inhibited

MVB formation and led to morphological defects in early endosomes (197).

I.3.E Role of Tsg101 in HIV budding

Related to its role in the ESCRT machinery, Tsg101 plays an important role in assembly and budding of viruses, particularly, HIV. Like ESCRT-0 protein Hrs, HIV viral structural precursor polyprotein (Gag) have been shown to possess the conserved PTAP motif in the p6 domain, thus is able to bind to Tsg101 and be recruited to the endosomal membrane. Actually,

Bouamr et al. have indicated that Hrs may compete with HIV Gag for binding to Tsg101.

Overexpression of the C-terminal fragment of Hrs attenuated efficient production of HIV Gag particles (198). Binding of Tsg101 to HIV gag protein recruits ESCRT-I, ESCRT-II and ESCRT-

III complexes, together with Alix, an ESCRT-associated protein. These complexes, together with

HIV gag proteins are then recruited to the plasma membrane where they form the HIV budding machinery. Through the ESCRT machinery, the HIV is inserted into the plasma membrane and forms a lollipop-shape structure in the membrane. The virus is then released in to extracellular space and the ESCRT components are recycled back into intracellular spaces (156). Knockdown

41 of Tsg101 by siRNA in 293t cells blocked the release of HIV. Further, mutations in the p6 domain of HIV Gag proteins resulted in inhibition of HIV release from cells (199). In addition, overexpression of a Tsg101 truncate containing only the C-terminal portion of Tsg101 inhibited virus budding (200).

Similar to its role in the ESCRT, the release of HIV from cells requires ubiquitination of

HIV Gag proteins. Myers and Allen demonstrated that overexpression of Tsg101 increased ubiquitination of HIV-2 Gag protein and release of HIV from 293t cells (201). Further, overexpression of only the N-terminal domain of Tsg101 blocked the release of virus particles from the cells. Alix possesses a PSAP motif in its PRR domain that can bind to Tsg101. Thus, Alix is recruited to HIV budding sites, where it interacts with Tsg101 and can bind to YPXnL motif in

HIV Gag proteins. Interestingly, the fusion of the catalytic domain of the Herpes Simplex UL36 deubiquitinating enzyme (DUb) onto Tsg101 (DUb-Tsg101) and Alix (DUb-Alix), which diminished ubiquitination of HIV Gag proteins, prevented the release of HIV viruses from cells

(202).

I.3.F Role of Tsg101 in receptor recycling

Tsg101 has been shown to contribute to endosomal recycling of membrane receptors, especially, the epidermal growth factor receptor (EGFR). Rush et al. demonstrated that knockdown of Tsg101 caused accumulation of unliganded EGFR on low-density endosomes. Further, these accumulated EGFRs were associated with LAMP1, signifying that knockdown of Tsg101 recruited EGFR for degradation by lysosomes (203). In support, Lu et al. observed that disruption of the interaction between Tsg101 and Hrs resulted in the accumulation of ubiquitinated EGFR that were not delivered to late endosomes (204). Furthermore, Morris et al. showed that knockout of Tsg101 in mouse embryonic fibroblasts led to reduction in levels of EGFR in the cell (205).

Zhang et al. observed that Tsg101 interacted with Biogenesis of lysosome-related organelles complex-1 (BLOC-1) and sorting nexin 2 (SNX2) to mediate degradation of EGFR in lysosomal compartments (206). Hence Tsg101 plays a crucial role in determining the fate of EGFR, when the receptor is recruited to the late endosomee.

As described earlier, critical to recycling of receptors to the plasma membrane is the endosomal recycling compartment, of which Rab11-family interacting protein-3 (FIP3) helps shuttle the recycling endosome to the plasma membrane in conjunction with Rab11a (81, 82).

Horgan et al. identified that Tsg101 was bound to FIP3 in HeLa cells (207). This raises the possibility that Tsg101-mediated effects on recycling of EGFR and other membrane receptors may be due to its binding to FIP3 and ERC. Hence, it will be interesting to decipher whether Tsg101 enables endosomal recycling of other membrane receptors such as IGF-1R.

I.3.G Role of Tsg101 in autophagy

The matured late endosome/MVB may fuse with the lysosome or fuse with the autophagosome to generate an intermediate structure called the amphisome, which eventually fuses with lysosome to degrade the contents of the endosome. Considering that Tsg101 is critical to the maturation of the late endosome, several studies have linked Tsg101 to autophagy.

Majumder et al. have shown that Tsg101 contributes to autophagic flux by enhancing the fusion of amphisomes with lysosomes through its interaction with E3 ubiquitin ligase Mahogunin.

Overexpression of Tsg101 rescued autophagic flux in Mahogunin-depleted cells. More so, monoubiquitination of Tsg101 is required for Mahogunin to enhance recruitment of amphisome to lysosome. The authors showed that Mahogunin interacts and ubiquitinates Tsg101 to initiate autolysosome formation (208). Hence, Tsg101 is critical for the formation of the autolysosome.

In addition, studies in various cell lines have indicated that knockdown of Tsg101 leads to accumulation of autophagosomes and inhibition of autophagic flux. Filimonenko et al. demonstrated that depletion of Tsg101 in HeLa cells resulted in accumulation of ubiquitinated proteins and autophagosomes that were in proximity to lysosomes (209). Likewise, Doyotte et al. demonstrated that the siRNA-mediated down regulation of Tsg101 in HeLa cells disrupted the delivery of EGFR to autolysosomes (210). Moreover, Rusten and group observed that mutation of

Tsg101 in Drosophila melanogaster led to blockade of amphisome and autolysosome formation and eventual neuronal cell death (211). These studies suggest the possible contribution of Tsg101 to augmentation of autophagic flux.

Section 4. Dissertation Scope and Objectives

As discussed, Tsg101 has diverse functions in the cell, including cell proliferation and survival, cytokinesis, HIV budding, ubiquitination and endosomal sorting. In addition, Tsg101 may contribute to endosomal recycling of membrane receptors and activation of autophagic flux.

IGF-1R is critical for the development of physiological cardiac hypertrophy. Given the effects of the endosomal system on IGF-1R levels, we would like to investigate whether Tsg101-mediated endosomal recycling contributes IGF-1R signaling in physiological cardiac hypertrophy.

Additionally, mitochondrial damage, leading to cardiac contractile impairment has been reported in human and animal models of sepsis. Activation of selective autophagy of damaged mitochondria

(mitophagy) has been shown to elicit favorable outcomes in animal models of septic cardiomyopathy. Considering the role possible role of Tsg101 in activation of autophagic flux, we would like to determine the role of Tsg101 on mitophagy and whether this contributes to

44 endotoxin-induced cardiac dysfunction. Based on the rationale discussed above, the studies will address two main aims:

Specific Aim 1. Determine the role of Tsg101 in regulation of endosomal recycling of IGF-

1R in physiological cardiac hypertrophy.

Studies in animal models have indicated that IGF-1R, rather that IGF-1, is essential for the development of physiological cardiac hypertrophy. Heart-specific overexpression of IGF-1R resulted in a physiological hypertrophy-like phenotype that was sustained to 10 months. More so, depletion of IGF-1R in mouse hearts inhibited the development of physiological hypertrophy.

Cellular levels of IGF-1R is subjected to the endosomal system, which recycles or degrades the receptor. There are reports that IGF-1R is recycled through the endosomal recycling compartment, which is mediated by Rab11 and its effector protein, FIP3. Studies have demonstrated the Tsg101, a key member of the ESCRT machinery, has been found to interact with ERC member, FIP3, and contribute to the endosomal recycling of EGFR. This raises the possibility that Tsg101 may contribute to endosomal recycling of IGF-1R. Thus, we hypothesize that Tsg101 regulates physiological cardiac hypertrophy through FIP3-mediated endosomal recycling of IGF-1R.

To elucidate the role of Tsg101 in physiological hypertrophy, mice were subjected to treadmill training to induce physiological cardiac growth and the expression of Tsg101 and other endosomal associated genes were determined. Tsg101 was specifically overexpressed in mouse hearts and these mice were characterized by histology, echocardiography and gene expression to determine the phenotype of these mice. Mice with inducible knockdown of Tsg101 in the heart were subjected to exercise training to confirm the role of Tsg101 in cardiac hypertrophy. Lastly,

Tsg101-transgenic mice were subjected to transverse aortic constriction to determine whether

Tsg101 could provide protection against pathological cardiac remodeling.

Specific Aim 2. Determine the role of Tsg101 in endotoxin-induced cardiac dysfunction through regulation of mitophagy.

Cardiac mitochondrial dysfunction and subsequent inflammation are hallmarks of sepsis- induced cardiomyopathy. Endotoxin (LPS), the active membrane component of gram-negative bacteria, has been implicated in mitochondrial function impairment in the heart during sepsis. The

Parkin/PINK1 pathway has recently been identified to activate autophagy of damaged mitochondria (mitophagy), regeneration of mitochondria and protection from LPS-induced cardiac dysfunction. Hence, targeting the Parkin/PINK1 pathway and mitophagy might represent a favorable therapeutic approach to treat septic cardiomyopathy. Tsg101 has been shown to activate autophagy and autophagy flux through its regulation of E3 ubiquitin ligase Mahogunin. It remains to be elucidated if Tsg101 regulates selective autophagy of damaged mitochondria and how that contributes to endotoxin-induced cardiac dysfunction. We hypothesize that overexpression of

Tsg101 may protect against endotoxin-induced cardiac injury by promoting of Parkin-induced autophagic removal of damaged mitochondria.

To elucidate the role of Tsg101 in endotoxemic hearts, mice were challenged with LPS and the expression of Tsg101 and mediators of mitophagy were determined by immunoblotting.

Tsg101-TG and -KD mice were subjected to LPS treatment to determine survival, cardiac function, systemic and cardiac inflammation. Activity of mitophagy mediators and mitochondrial structural integrity in endotoxemic Tsg101-TG and –KD hearts were determined by immunoblotting and levels of mitochondrial DNA (mtDNA), mitochondrial ROS (mtROS) and cardiac myeloperoxidase (MPO).

Chapter II

Materials and Methods

Section 1. Generation of Mouse Models

All mice used in this study were maintained and bred in the Division of Laboratory Animal

Resources at the University of Cincinnati Medical Center. Animal experiments conformed to the

Guidelines for the Care and Use of Laboratory Animals prepared by the National Academy of

Sciences, published by the National Institutes of Health, and approved by the University of

Cincinnati Animal Care and Use Committee.

II.1.A Generation of Tsg101 Transgenic Mice

A 1.176-Kb cDNA fragment of murine Tsg101gene was cloned and inserted downstream of the cardiac-specific α-myosin heavy chain promoter (α-MHCp) (Fig. 3). This DNA vector was submitted to the Transgenic Animal and Genome

Editing Core at Cincinnati Children’s Hospital

Center to generate a transgenic (TG) mouse Fig. 3. Cardiac-specific Tsg101 transgenic model (FVB/n background) with heart-specific construct. overexpression of Tsg101. At 21 days postpartum pups were tail clipped (~3mm) for genotyping to identify the transgene. DNA was extracted from tail using the lysis buffer and Protease Plus

(Biotool.com, B4001), following the manufacturer’s instructions. We performed routine genotyping by polymerase chain reaction (PCR) with the use of an upper primer from the α-MHC promoter and a lower primer from the Tsg101 DNA. The endogenous mouse TSH-β gene was utilized as the internal control. The PCR mix included tail DNA, all primers and 2 x M-PCR OPTI

Mix (Biotool.com) The 2 x M-PCR OPTI Mix contains Taq DNA polymerase, dNTPs and MgCl2.

Western blot analyses of heart tissue were used to determine the expression levels of Tsg101 in TG hearts. The primer sequences are listed in Table 1 and the PCR cycle is listed in Table 2.

Table 1. Primer sequences for Tsg101 TG PCR

Primers Sequence Product Length Upper arm of 5-CACATAGAAGCCTAGCCCACAC-3 α-MHC promoter 300bp Lower arm of 5-CCAATACAGGTTTGAGATCT-3 Tsg101 DNA Upper arm of 5-TCCTCAAAGATGCTC ATTAG-3 TSH-β 400bp Lower arm of 5-GTA ACTCACTCATGCAAAGT-3 TSH-β

Table 2. PCR cycle for Tsg101-TG genotyping

Segment Number of Cycles Temperature Duration

1 1 94oC 5 minutes

94oC 20 seconds

2 35 55oC 30 seconds

72oC 30 seconds

3 1 72oC 5 minutes

II.1.B Generation of Tsg101-Knockdown Mice

The generation of mice having the floxed Tsg101 allele (Tsg101fl/fl) under the 129/SvJ genetic background was generated by Dr. Wagner’s lab and has been discussed previously (172). Mice expressing an inducible Cre recombinase transgene driven by the αMHC promoter (αMHC-MerCreMer) were purchased from Jackson Laboratory (Stock No:

005657). Tsg101fl/fl female mice were crossed with

αMHC-MerCreMer male mice to obtain male Figure 4: Schematic showing the heterozygotes (Tsg101fl/wt : Cre positive), which were generation of cardiac-specific injected at 8 weeks with tamoxifen (Sigma) to induce Tsg101-knockdown (KD) mice. knockdown of Tsg101 in the heart (Fig. 4). Tamoxifen was initially dissolved in ethanol and then in corn oil at 37oC to a stock concentration of 10mg/ml. Mice were injected intraperitoneally at

1mg per day for 5 consecutive days. Control (CTRL) mice were littermates that were either

(Tsg101wt/wt: Cre positive) or (Tsg101fl/wt: Cre negative), but of the same genetic background.

Knockdown of Tsg101 was determined by western blotting of heart samples. Tail DNA was extracted as described above. Genotyping and PCR cycles for flox-Tsg101 genotyping are listed in Table 3 and 4. Genotyping and PCR cycles for αMHC-Cre transgene genotyping are listed in

Table 5 and 6.

Table 3. Primer sequences for flox-Tsg101 PCR

Primers Sequence Product Length Tsg101 flox 5-- AGAGGCTATTCGGCTATGACTG-3 (forward) 400bp Tsg101 flox 5- TTCGTCCAGATCATCCTGATC -3 (reverse) Tsg101 wt 5- GTTCGCTGAAGTAGAGCAGCCAG -3 (forward) 250bp Tsg101 wt 5- CATTTCTGGAGTCCGATGCGCAG -3 (reverse)

Table 4. PCR cycle conditions for flox-Tsg101 genotyping

Segment Number of Cycles Temperature Duration

1 1 94oC 5 minutes

94oC 30 seconds

2 35 58oC 30 seconds

72oC 30 seconds

3 1 94oC 5 minutes

Table 5. Primer sequences for αMHC-Cre PCR

Primers Sequence Product Length Cre transgene 5- ATACCGGAGATCATGCAAGC -3 (forward) 350bp Cre transgene 5- AGGTGGACCTGATCATGGAG -3 (reverse) Internal positive 5- GTTCGCTGAAGTAGAGCAGCCAG -3 (forward) 250bp Internal positive 5- CATTTCTGGAGTCCGATGCGCAG -3 (forward)

Table 6. PCR cycle for αMHC-Cre genotyping

Segment Number of Cycles Temperature Duration

1 1 94oC 4 minutes

94oC 1 minutes

2 34 55oC 1 minutes

72oC 1 minutes

3 1 72oC 10 minutes

Section 2. Exercise-Induced Cardiac Hypertrophy model of Treadmill Training

Male wild-type (WT) mice (7-8 weeks of age) were acclimatized to the Omnipacer treadmill

(Columbus Instruments), for three days as follows, day 1: static treadmill for 5 minutes (min) +

5m/min for 5 min + 10m/min for 5 min; day 2 and 3: 5m/min for 5min + 10m/min for 5 min +

15m/min for 5 min. Following acclimatization, mice underwent intense exercise training at

10m/min for 5 min + increase of 1m/min every minute up to 25 m/min to induce cardiac hypertrophy. Mice were trained daily for 1 hour (h) or until mice were tired and unresponsive to shock stimuli for 10s. Heart samples were collected after 1-week training period. Heart weight to body weight (HW/BW) ratios were also measured.

Section 3. Mouse model of endotoxemia

10-12 week old male mice were injected intraperitoneally (i.p.) with Escherichia coli LPS

(Sigma) at 10μg/g to induce endotoxemia. Mice were injected with PBS as control. The heart tissues were collected at 0 hour (h), 6 h and 24 h for western blotting, qRT-PCR and the

51 quantification of mitochondrial DNA (mtDNA), mitochondria reactive oxygen species (mtROS) and cardiac myeloperoxidase (MPO) levels. Serum was collected at 6 h after LPS injection for

ELISA analysis. Cardiac function was measured in mice by echocardiography at 12 h after endotoxin challenge. Survival analysis after LPS injection was monitored every 6 h up to 5 days.

Section 4. Determination cardiac contractile function

II.4.A In vivo measurement of cardiac function

Cardiac function and remodeling was determined by echocardiography with a Vevo 2100

Ultrasound system (Visualsonics, Toronto, Canada), equipped with a MS400 probe (30-MHz centerline frequency) on 8-week old male TG mice as described previously (212). Briefly, mice underwent anesthesia by isofluorane (1.5-2.0%) and parasternal long axis and short axis images were taken and analyzed with VevoStrain (Vevo 2100, v1.1.1 B1455) software.

II.4.B In vitro cardiomyocyte isolation and measurement of Mechanics

Cardiomyocytes were isolated as previously described (213). Briefly, mice were anesthesized by intraperitoneal injection of Euthasol (200 mg/kg), the heart was excised, and the aorta was cannulated. The cannulated heart was mounted on a Langendorff perfusion apparatus and perfused with Ca-free Tyrode solution (140 mM NaCl, 4 mM KCl, 1 mM MgCl2, 10 mM glucose, and 5 mM HEPES, pH 7.4) at 37°C for 3 min. The perfusion buffer was replaced with the same solution containing liberase blendzyme I (0.25 mg/ml, Roche), and continued for 8–15 min until the heart became flaccid. The atria were removed and the ventricular tissue was teased apart using Pasteur pipettes. The cell suspension was filtered through a 240-μm mesh screen and the cardiomyocytes were allowed to settle by gravity for 15 minutes. Following sedimentation, Ca2+

52 was added sequentially at increasing concentrations to a final concentation of 1 mM. The final cardiomyocyte pellet was re-suspended in 1.8 mM Ca- Tyrode for further analysis. The myocyte suspension was added to a Plexiglas chamber and placed on the stage of an inverted epifluorescence microscope (Nikon Diaphot 200). Myocytes were field stimulated to contract by a Grass S5 stimulator through platinum electrodes placed alongside the bath (0.5 Hz, bipolar pulses with voltages 50% above myocyte voltage threshold), and mechanical parameters were determined using video edge detection. Measurement of mechanical parameters was also performed in the presence of isoproterenol (100 nM). Contractility data was analyzed using IonOptix software.

Section 5: Cardiac histology

Hearts of 8 weeks old mice were excised, fixed in 10% formalin and then embedded in paraffin. Heart sections (5µm in thickness) were produced from tissues and stained with Masson’s

Trichrome 2000TM Kit (American MasterTech, CA) and picrosirius red stain (Thermo Fisher), according to the respective manufacturers’ protocol. To analyze individual cardiomyocyte size, heart sections were stained with Wheat germ agglutinin (WGA). Images were taken under the microscope (Nikon, Inteslight) and the image processing program ImageJ was used to analyze cell sizes. Ratios of HW/BW were measured as determinants of cardiac hypertrophy.

Section 6. Transfection of neonatal rat cardiomyocytes with adenoviruses, siRNA and plasmids

II.6.A Isolation of Neonatal rat cardiomyocytes

Neonatal rat cardiomyocytes (NRCM) were isolated from rat neonates (2-3 days old) using the Worthington Neonatal Cardiomyocytes Isolation System (Worthington Biochemical

Corporation, NJ) according to the manufacturer’s procedures. Briefly, hearts of rat neonates (1–3 days old) were removed after anesthetizing by ice-water bath, and hearts were minced and incubated with trypsin overnight at 4oC. The next day, hearts were incubated in collagenase at 37oC for 45 min and filtered. The resultant suspension was centrifuged at 100 X g and pellet was cultured in DMEM medium supplemented with 2% fetal bovine serum (FBS) and 1% antibiotics (penicillin and streptomycin).

II.6.B Construction and transfection of Adenovirus vector Tsg101

The adenovirus expressing GFP-Tsg101 (Ad.Tsg101) was generously offered by the lab of

Dr. G. Paolo Dotto (Massachusetts General Hospital and Harvard Medical School) and was constructed by inserting full length Tsg101 cDNA into pCMV-shuttle vector, then cloned into an adenoviral backbone plasmid pAdEasy-1. Plated NRCMs in dishes were infected with Ad.Tsg101 at 10 MOI for 1 h. After 1 h transfection, cells were cultured in full DMEM medium (2% FBS and

1% antibiotics) for 48 h. The cells were collected for Western-blotting assays after 48 h culture.

NRCMs transfected with Ad.GFP were used as controls.

II.6.C Construction and Transfection of Adenovirus Vector shRNA-Tsg101

The adenovirus expressing shRNA-Tsg101 (Ad.shTsg101) was constructed by the Vector

Biolabs (Philadelphia, PA). One day after isolation and culturing of NRCMs, cells were infected with Ad.shTsg101 at 5 MOI for 1 h. After 1 h, cells were cultured in full DMEM medium (2%

FBS and 1% antibiotics) for 48 h. The cells were collected for Western-blotting or utilized for recycling assays after 48 h culture. NRCMs transfected with Ad.shGFP were used as controls.

II.6.D SiRNA and Plasmid Transfection

NRCMs were transfected with SiRNA oligonucleotides targeting FIP3 (Sigma,

XM_001062633) with the use of lipofectamime 200(Thermo Fisher) as transfection agent for 72 h. Silencer Select Negative Control (Thermo Fisher Scientific, 4390843) were transfected as control. Plasmid transfection in NRCMs was also aided by lipofectamine 2000 reagent for 72 h. pEF6.mCherry-Tsg101 was a gift from Quan Lu (Addgene plasmid # 38318), GFP-Rab11 WT was a gift from Richard Pagano (Addgene plasmid # 12674), pET28a-FIP3 was a gift from Ron

Vale (Addgene plasmid # 74753).

Section 7. Measurement of protein and mRNA expression

II.7.A Western Blotting Assays

Total proteins were extracted from hearts or cultured NRCMs, according to manufacturer’s instructions, using the NP40 lysis buffer (cOmpleteTM, Mini) supplemented with protease inhibitor cocktail (Roche). Plasma membrane proteins were isolated using the Minute™ Plasma Membrane

Protein Isolation Kit (Invent Biotechnologies), according to the manufacturer’s protocol. Bio-Rad protein assay kit was used to determine protein concentration of samples. Samples (10-100µg) were subjected to SDS-PAGE. After separation in the gel, the protein were transferred onto a nitrocellulose membrane and incubated in blocking buffer (5% non-fat milk) for the 1 h. The membrane is incubated in the primary antibody overnight at 4oC. The next day, the membrane is washed in Tris-buffered saline (TBS, 100mM Tris, 0.9% NaCl, pH 7.4)) and incubated in secondary antibody. After washing in TBS, the protein bands were visualized using

HyGLO chemiluminescent detection reagent (Denville) or SuperSignal™ West Femto Maximum

Sensitivity Substrate (Thermo Fisher).

The dilutions and sources of the primary antibodies used in this study are as follows: rabbit anti-IGF-1R (Sigma, 1:1000); mouse anti-Tsg101 (Santa Cruz, 1:1000); mouse anti-Akt (total Akt)

(Santa Cruz, 1:1000), rabbit anti-pAkt-Ser473 (Santa Cruz, 1:1000); rabbit anti-FIP3 (Santa Cruz,

1:500); rabbit anti-pAkt-Thr308 (Cell Signaling, 1:500); rabbit anti-Rab7 (Cell Signaling, 1:500); rabbit anti-Rab4a (Proteintech, 1:500); rabbit anti-Rab5a (Proteintech, 1:500); rabbit anti-Rab11a

(Proteintech, 1:500); rabbit anti-IR (Cell Signaling, 1:500); rabbit anti-EGFR (Cell Signaling,

1:500); rabbit anti-ANP (Santa Cruz, 1:500), goat anti-BNP(Santa Cruz, 1:1000); goat anti-

Serca2A (Santa Cruz, 1:500); rabbit anti-β1-AR (Abcam, 1:500); rabbit anti-Calsequestrin

(Affinity BioReagents, 1:500); mouse anti-Phospholamban (Upstate Biotechnology, 1:1000); rabbit anti-p-Phospholamban-Ser16 (Upstate Biotechnology, 1:1000); mouse anti-Tsg101 (Santa

Cruz, 1:1000); PINK1 (Cell Signaling, 1:1000); Parkin (Cell Signaling, 1:1000); and LC3 (Cell

Signaling, 1:500). GAPDH (Cell signaling, 1:1000) and Na/K-ATPase (Cell Signaling, 1:1000) were used as loading controls for total and plasma membrane protein levels respectively. Western blot bands were quantified by MultiImage II (AlphaInnotech, USA). The relative target protein levels were normalized to GAPDH for total protein and Na/K-ATPase for plasma membrane protein.

II.7.B qRT-PCR Analysis

Total RNA from heart samples was isolated using the miRNeasy Mini kit (Qiagen). The quality and concentration of RNA was determined by the NanoDrop 2000 system (Thermo Fisher

Scientific). The miScript PCR Starter kit (Qiagen) was used to generate cDNA, following the manufacturer’s protocol. RT-PCR was performed in a total reaction volume of 20ul using SYBR

GreenER qPCR SuperMix (Invitrogen, Carlsbad, CA). Relative fold expression for target genes was calculated by the 2-ΔΔCt method. Below are the primers used:

Table 7. Primers for qRT-PCR analysis

Primer name Sequence

Mouse collagen I TGCCGTGACCTCAAGATGTG (forward) CACAAGCGTGCTGTAGGTGA(reverse) Mouse collagen III GCGGAATTCCTGGACCAAAAGGTGATGCTG(forward)

GCGGGATCCGAGGACCACGTTCCCCATTATG(reverse)

Mouse Rab11a ATGGGCACCCGCGACGACG(forward) TTAGATGTTCTGACAGCACTGCACC(reverse) Mouse IGF-1R GCTTCTGTGAACCCCGAGTATTT(forward) TGGTGATCTTCTCTCGAGCTACCT(reverse) Mouse Rab4a CCATGTCCGAAACCTACGAT(forward) ATGTTCTGGCTCGCTAGCAT(reverse) Mouse Rab5a CTTCAGAGGCAAGCAAGTCC(forward)

TTGTGTGGGTTCGGTAAGGT(reverse)

Mouse FIP3 CCTGTCTGAAGGCCAACATT(forward) TCTCATCCAACAGCTTCTGCT(reverse) Mouse Rab7 TCATTAGGTGTTGCATTTTATCGC(forward) AGGCTTGAATTAGGAACTCGTC(reverse) Rat Rab4a GTGCACTTGGAGCCTGTGTA(forward) ATGTTCCTGGAAACCAGTGC(reverse) Rat Rab5a CTCGTCCTCTGGCTGAGTTT(forward) CTTCAAAGGCAAGCAAGTCC(reverse) Rat Rab11a TTGGCTTGTTCTCAGTGGTG(forward) TTGCAACAAGAAGCATCCAG(reverse)

Rat IGF-1R AAAACCATCGATTCTGTGACG(forward)

GGTTCTTCAGGAAGGACAAGG(reverse) Rat FIP3 CCTGTCTGAAGGCCAACATT(forward) TCTCATCCAACAGCTTCTGCT(reverse) Rat Rab7 TCTTTGTGGCCACTTGTCTG(forward) TACCATGCAGATCTGGGACA(reverse) Mouse TNF-α GCCTCTTCTCATTCCTGCTTG(forward) CTGATGAGAGGGAGGCCATT(reverse) Mouse IL-6 ACGGC CTTCCCTACTTCACA(forward) CATTTCCACGATTTCCCAGA(reverse)

Section 8. In Vitro Experiments of Various Treatments

II.8.A Treatment of NRCMs with Monensin and Picropodophyllin

Monensin (Sigma) was dissolved in DMSO (Fisher Scientific) and then added to DMEM

57 medium (without FBS) to a final concentration of 1 μM and then incubated in NRCMs for 1 h.

Subsequently, cells were transfected with adenoviruses for 1 h and then cultured in full DMEM medium (2% FBS and 1% antibiotics) for a 48-h cell culture. Cells were collected after 48 h for western blotting or fixed and stained with α-actinin antibody for measurement of the cell size, as described above. DMSO-pre-treated NRCMs were used as control conditions.

Picropodophyllin (PPP, Calbiochem) was dissolved in DMSO and then added to DMEM

(without FBS) to a final concentration of 10 μM and then incubated in neonatal myocytes for 1 h.

After 1 h, NRCMs were transfected with Ad,GFP or Ad.Tsg101 for 1 h, and then cultured in full

DMEM medium ((2% FBS and 1% antibiotics) for a 48-h cell culture. Cells were collected after

48 h for western blotting or fixed and stained with α-actinin antibody for measurement of the cell size, as described above. DMSO-pre-treated NRCMs were used as control conditions.

II.8.B Treatment of NRCMs with MG132 and Cycloheximide

NRCMs were transfected with Ad,GFP or Ad.Tsg101 for 1 h, and then cultured in full

DMEM medium (2% FBS and 1% antibiotics) for a 48-h cell culture. After 48 h, MG132 (Thermo

Fisher) was dissolved in DMSO and then added to DMEM (without FBS) to a final concentration of 10 μM and then incubated in neonatal myocytes for 4 h. Cells were collected after 48 h for western blotting, as described above. DMSO-pre-treated NRCMs were used as control conditions.

For CHX treatment, NRCMs were transfected with Ad,GFP or Ad.Tsg101 for 1 h, and then cultured in full DMEM medium (2% FBS and 1% antibiotics) for a 48 h cell culture. After 48 h, cells were starved for 8 h and then incubated with 5 μM CHX, dissolved in DMSO for 4 h. DMSO- pre-treated NRCMs were used as control conditions.

Section 9: Determination of Protein Interaction

II.9.A Co-immunoprecipitation assays

0.5 mg of mouse heart homogenate were solubilized in 1 ml NP40 lysis buffer (with protease inhibitor cocktail), and pre-cleared in 50ul of protein A/G-agarose beads (Santa Cruz) for 1 h at

4oC on a rotary wheel. The mixture was then incubated with 1 μg of corresponding primary antibodies at 4oC overnight on a rotary wheel. Immunoprecipitates were collected and washed 5 times in NP40 lysis buffer. Immunoprecipitates were resolved in 2x Laemmli sample buffer and boiled at 95oC for 5 min. Eluted proteins from the antibody-beads conjugate were subjected to

SDS PAGE.

II.9.B Immunofluorescence staining

NRCMs were seeded in 3.8cm2 culture wells for 48 h. To determine interaction between

Tsg101, FIP3 and IGF-1R, NRCMs were transfected with Ad.Tsg101, and cultured in full DMEM medium (2% FBS and 1% antibiotics) for a 48-h cell culture. After 48 h, cells were washed twice with PBS and fixed with 4% paraformaldehyde (PFA) for 10 min. After fixing, NRCMs underwent permeabilization and blocking in PBS (5% BSA, 0.3% triton) solution for 1 h at room temperature, after which cells were incubated with rabbit anti-FIP3 antibody (Santa Cruz, 1:100 dilution in PBS with 1% BSA) and mouse anti-IGF-1R (Santa Cruz, 1:100 dilution in PBS with 1% BSA) at 4°C overnight. The next day, NRCMs were washed and stained with Alexa Fluor 649 goat anti-mouse

IgG (Invitrogen, 1:500) and Alexa Fluor 564 goat anti-rabbit IgG (Invitrogen, 1:500) at room temperature for 1 h. Cells were examined under confocal microscopy.

To determine interaction between Tsg101 and Parkin NRCMs were treated with 1μg/ml LPS or equivalent volume of PBS for 3 h, followed by addition of the 200nM mitotracker (Cell

Signaling) for 15 min. NRCMs were then washed twice with PBS and fixed with cold methanol for 10 min at -20°C. After fixing, NRCMs underwent permeabilization and blocking in PBS (5%

BSA, 0.3% triton) solution for 1 h at room temperature, after which cells were incubated with mouse anti-Parkin antibody (Cell Signaling, 1:100 dilution in PBS with 1% BSA) and rabbit anti-

Tsg101 (Proteintech, 1:100 dilution in PBS with 1% BSA) at 4°C overnight. The next day, NRCMs were washed and stained with Alexa Fluor 649 goat anti-mouse IgG (Invitrogen, 1:500) and Alexa

Fluor 488 goat anti-rabbit IgG (Invitrogen, 1:500) at room temperature for 1 h. Cells were examined under confocal microscopy.

Section 10. Cell Biotinylation-Based Recycling Assays

Biotinylation recycling assay was conducted based on a procedure published previously, with few modifications (214). This assay relies on the principle that cell surface proteins could be bound to membrane-impermeable biotin and then be internalized and subsequently recycled back at indicated incubation temperatures. The cell impermeable reducing agent, sodium 2- mercaptoethanesulfonate (MESNA) is utilized to cleave recycled biotinylated proteins and the resultant (i.e. intracellular) biotinylated IGF-1R are subjected to affinity purification with streptavidin beads and detection through immunoblot analysis. 48 h after transfection of

Ad.shTsg101 and Ad.GFP in NRCMS, cells were washed three times with cold PBS/1 mM MgCl2/

0.1 mM CaCl2 at 4°C. Cells were then incubated with 0.5 mg/ml sulfosuccinimidyl 2-

(biotinamido)-ethyl-1,3-dithiopropionate (sulfo-NHS-SS-biotin; Thermo) at 4°C for 1 h. After two washes in PBS/1 mM MgCl2/0.1 mM CaCl2/ 25mM glycine to neutralize free biotin, cells were treated with DMEM containing 20ng/ml IGF-1 and returned to 37°C for 15 min to induce internalization and endocytosis of biotinylated receptors. Consequently, NRCMs were taken to

4°C and incubated with cell-impermeable (100 mM) sodium 2-mercaptoethanesulfonate

(MESNA) in 50 mM Tris-Cl, 100 mM NaCl, pH 8.5 (MESNA buffer), to cleave off uninternalized biotinylated receptors. MENSA was quenched by two washes of 5 mg/ml iodoacetamide in PBS.

Cells were then incubated in DMEM containing 20ng/ml IGF-1 and returned to 37°C for 45 min to initiate recycling on internalized biotinylated receptors. Recycled biotinylated receptors were again cleaved with MENSA buffer, which was quenched in 5 mg/ml iodoacetamide. Cells were subsequently collected and subjected to Streptavidin agarose (Pierce) in NP40 lysis buffer overnight. The next day, the streptavidin beads were washed five times in NP40 lysis buffer. The beads were resolved in 2x Laemmli sample buffer and boiled at 70oC for 5 min. Eluted proteins from the streptavidin beads were subjected to SDS PAGE and western blotting for the detection of

IGF-1R expression. For the immunofluorescence recycling assay, NRCMs were starved in serum- free media for 4 h and then treated with 50μg/ml cycloheximide for 1 h to prevent synthesis of new IGF-1R. At 4°C, cells were treated with IGF-1R antibody-biotin conjugate, together with

20ng/ml IGF-1. The preparation of the IGF-1R antibody-biotin conjugate was performed as described previously (215). The cells were then incubated at 37°C to allow internalization of IGF-

1R-biotin for 15 min. Cells were returned to 4°C, where uninternalized IGF-1R-biotin were cleaved with MESNA solution. Cells were then incubated in DMEM/20ng/ml IGF-1 at 37°C to induce recycling of internalized IGF-1R-biotin for 45 min. Cells were subsequently fixed in 4% paraformaldehyde, and incubated in Streptavidin Alexa Fluor 594 Conjugate (Thermo Fisher) at room temperature for 30 min to capture IGF-1R antibody-biotin. Cells were visualized by confocal microscopy.

Section 11. Transverse Aortic Constriction (TAC) Surgery

Transverse Aortic Constriction surgery for pressure overload-induced cardiac hypertrophy was performed as described previously (216). Briefly, WT and TG (G) mice were anesthesized by intraperitoneal injection of ketamine (100 mg/ kg) and xylazine (5 mg/kg). Mice were ventilated with a tidal volume of 0.4 mL oxygen and a respiratory rate of 110 breaths/min using a Model 687

Mouse Ventilator (Harvard Apparatus, Holliston, MA). A small incision was created in the proximal sternum of the left chest to expose heart. Constriction of the aortic arch was performed with a 7-0 silk string tied around a 27-gauge blunt-ended needle. A similar procedure was performed for the sham-operated mice without constriction of the aorta. Doppler analysis was utilized to determine efficient constriction of the aortas, which showed that similar pressure- overload was achieved in all TAC-operated mice.

Section 12: ELISA assays for Cytokines and Myeloperoxidase

Serum TNF-α and IL-6 levels were determined by commercial available kits (Biolegend), according to the manufacturer’s protocols. Briefly, 96-well plates were coated in capture antibody specific for each cytokine, overnight. The next day, serum samples were loaded for 2 h and after a series of washes, the detection antibody is incubated for 1 h. The Avidin-HRP solution is added for 1 h, after which the TMB substrate solution is incubated in the dark for 30 min. A blue color develops from the reaction and it is stopped by stop solution (2N H2SO4) to develop a yellow color, which is read at 450nm on the microplate reader.

Myeloperoxidase (MPO) levels were determined in heart homogenates using commercial

MPO Elisa kit (Abnova), by following the manufacturer’s instructions. Briefly, heart homogenate samples were incubated in MPO antibody-coated plates at 37oC for 90 min. Biotinylated MPO is incubated at 37oC for 90 min, then Avidin-Biotin-Peroxidase Complex (ABC) solution is added to

62 wells for 30 min at 37oC after a series of washes. Next, a TMB color developing reagent is incubated that generates a yellow color which is read at 450nm in a microplate reader.

Section 13. Measurement of mitochondrial structural damage

II.13.A Measurement of mitochondrial DNA (mtDNA)

Total DNA was isolated from heart tissues using the DNeasy Blood and Tissue kit (Qiagen).

The subsequent PCR analysis for quantification of cardiac mtDNA was similar to the qRT-PCR protocols described above. mtDNA was quantified relative to nuclear DNA. Primer sequences for measurement of mtDNA levels are listed below.

Table 8. Primers for mtDNA quantification

Primer name Sequence Mouse cytochrome B GCCACCTTGACCCGATTCTTCGCT(forward) AGGTGAACGATTGCTAGGGCCGCG(reverse) Mouse cytochrome C CACTACCAGTGCTAGCCGCAGGC(forward) TTGGGTCCCCTCCTCCAGCGGGA(reverse) Mouse nuclear 18S CGCGGTTCTATTTTGTTGGTTT(forward) GCGCCGGT CCAAGAATTT(reverse)

II.13.B Mitochondria isolation and quantification of mtROS

Mitochondria fraction was isolated from freshly harvested mouse heart tissue using the

Mitochondria Isolation Kit for Tissue (Thermo Fisher) according to the manufacturer’s protocol.

Cardiac mitochondrial fraction was then subjected to evaluation of ROS using Amplex™ Red

Hydrogen Peroxide/Peroxidase Assay Kit (Invitrogen), following the manufacturer’s instructions.

Briefly, freshly isolated cardiac mitochondrial fractions and H2O2 standards were added to 96-well plates and incubated with Amplex® Red reagent for 30 min at room temperature, protected from

63 light. After incubation, absorbance is read at 560 nm and H2O2 levels in samples were determine based on standard curve.

Section 14. Statistical Analysis Data were expressed as means ± SD. Significance was determined by Student t test, one- or two-way analysis of variance to determine differences within groups where appropriate. Log-rank test was used to determine statistical significance for survival studies. A P<0.05 was considered statistically significant.

Chapter III

Results

Section 1: Tsg101 regulates physiologic-like cardiac hypertrophy through FIP3-mediated endosomal recycling of IGF-1R

III.1.A Expression profiles of endosome-associated genes in in vivo and in vitro models of physiological cardiac hypertrophy

The endosomal system plays a major role in the regulation of IGF-1R levels through endocytosis, recycling and degradation (Fig. 1) (66-68). Given that IGF-1R is a critical regulator of physiological hypertrophy, we sought to determine the expression profile of endosomal- associated genes during physiological cardiac hypertrophy. Mice were subjected to 1-week intense treadmill training to induce physiological cardiac hypertrophy, as we described previously. There was a significant increase in the ratio of heart weight to body weight (HW/BW) of treadmill-trained mice (Fig. 5A/B), compared to sedentary control, confirming that the model was successfully generated. Moreover, there were no differences in the expression levels of fibrotic markers, Col I and Col III as well as pathological hypertrophy markers, ANP and BNP, in treadmill-trained mice, compared to sedentary control (Fig. 5C-E).

As expected, both total and plasma membrane levels of IGF-1R, as well as phosphorylation of Akt at Ser473 and Thr308, were higher in hearts of exercised-mice than sedentary controls (Fig.

6A/B), which is consistent with previous models of physiological hypertrophy. Protein levels of

Rab5a, Rab7 and Rab11a were significantly elevated by 1.5-fold, 1.3-fold and 1.9-fold, respectively, in exercise-trained mice, compared to controls (Fig. 6A/B). These data suggest that endocytosis, recycling and degradation of endosomes are enhanced in the myocardium during physiological hypertrophy. However, cardiac levels of Rab4a were unchanged in treadmill-trained

65 mice in relation to untrained controls (Fig. 6 A/B). Similar to Rab11a, levels of FIP3, an effector protein of Rab11a, were increased (1.4-fold) in treadmill-trained hearts (Fig. 6 A/B), indicating that recycling of IGF-1R during physiological hypertrophy may be through the ERC. More interestingly, Tsg101 levels were remarkably increased by 3-fold in treadmill-trained hearts (Fig.

6 A/B), which was highest rate of dysregulation amongst all the endosome-associated proteins analyzed in this study. Notwithstanding, treadmill exercise had no effect on mRNA levels of endosomal-associated genes (Fig. 6 C).

In the same vein, treatment of neonatal rat cardiomyocytes (NRCM) with IGF-1 (52, 53), which has been reported to be elevated in exercised humans, resulted in increased cell size and significantly high levels of Tsg101, compared to other endosomal associated proteins (Fig. 7A-C).

Figure 5. Generation of physiological hypertrophy model of treadmill exercise training. (A/B)

Increased ratios of heart weight/body weight (HW/BW) in treadmill-trained mice, compared to sedentary control mice. n=4 for sedentary control mice, n=6 for treadmill-trained mice; *, p<0.05 vs. sedentary control. (C) mRNA levels of Col I and Col III in sedentary and treadmill-trained mice. n=6 for each group; *, p<0.05 vs. sedentary control. (D/E) Western blot and quantification analysis of ANP and BNP in sedentary and treadmill-trained mice. n=6 for each group; *, p<0.05 vs. sedentary control.

Figure 6. Expression profile of endosome-associated genes in exercised hearts. (A/B) Western blots and quantification analysis showing the differential expression of plasma-membrane (PM)

IGF-1R, Akt phosphorylation at Thr308 and Ser473, IGF-1R, Rab5a, Rab4a, Rab7, Rab11a,

Tsg101 and FIP3 in hearts of sedentary control and treadmill trained mice. GAPDH was used as loading control, Na/K-ATPase was used as loading control for plasma membrane protein and Total

Akt was used as loading control for Akt phosphorylation. n=6; *, p<0.05 vs. sedentary control. (C) mRNA levels of IGF-1R, Rab5a, Rab4a, Rab7, Rab11a, FIP3 and Tsg101 in sedentary and treadmill-trained mice. n=6; *, p<0.05 vs. sedentary control.

Figure 7. Expression profile of endosome-associated genes in in vitro model of physiological hypertrophy. (A) Representative images of immunofluorescence staining with α-actinin and quantification of cell cross sectional area in NRCMs treated with vehicle (PBS) or IGF-1

(20ng/ml). Scale bar: 20μm. n=25-30 cells per plates, three plates for each group; *, p<0.05 vs. vehicle. Representative immunoblots (B) and quantitative analyses (C) showing expression of plasma membrane IGF-1R, total IGF-1R, Akt phosphorylation at Ser473, Rab7, Rab4a, Rab11a,

Rab5a, FIP3 and Tsg101 in vehicle or IGF-1 (20ng/ml)-treated NRCMs. GAPDH was loading control for total protein, total Akt was loading control for Akt phosphorylation and Na/K-ATPase was loading control for plasma membrane protein. n=4; *, p<0.05 vs. vehicle.

III.1.B Generation and Characterization of Tsg101-transgenic mouse model

Next, we decided to investigate the in vivo consequence of increased Tsg101 levels on cardiac growth. To this end, we generated a Tsg101 transgenic (TG) mouse model in which Tsg101 was overexpressed under the control of the cardiac-specific ɑ-myosin heavy chain (ɑ-MHC) promoter (Fig. 3). Western blotting analyses in heart samples showed that these transgenic lines overexpressed Tsg101 to 11-fold (Line D) and 4-fold (Line G), compared to WT-hearts (Fig.

8A/B). Immunoblot analyses further demonstrated that Tsg101 was specifically overexpressed in cardiomyocytes but not in cardiac fibroblasts of TG mice (Fig. 8C/D). Immunoblots of other organ tissues in TG showed overexpression of Tsg101 was specifically in the heart (Fig. 8E), signifying successful generation of the model.

Next, we found that both lines of TG mice exhibited features consistent with exercise- induced cardiac hypertrophy but not pathological remodeling based on the following observations.

First, gross and cross-sectional images of TG hearts showed larger hearts compared to WT (Fig.

9A), which was supported by significantly higher ratios of HW/BW and heart weight to tibia length ratio (HW/TL) in TG than in WT (Fig. 9B. Second, wheat germ agglutinin (WGA) staining of heart sections showed that the average cardiomyocyte size was remarkably increased in Tsg101

TG mice by 3.1-fold (Line D) and 2.1-fold (Line G), compared to WT (Fig. 9A/C). Third, TG hearts showed no signs of fibrosis, determined by Masson Trichrome and Picrosirius Red staining of heart sections (Fig. 9A), as well as no alterations in the expression of fibrotic markers, Col I and

Col III (Fig. 9D). Further histological and HW/BW analysis revealed induction of hypertrophy by

P7 in line D, and by P28 in line G (Fig. 10A/B), which was supported by significant and gradual increase in mRNA and protein levels of Tsg101 in TG line G from P2 to P28 (Fig. 10D-E).

Lastly, we observed that cardiac function was enhanced in TG mice, as evidenced by increased ejection fraction (EF) and fractional shortening (FS), compared to WT at 8 weeks (Table

9). Likewise, contractile measurements in isolated adult cardiomyocytes showed augmented cell shortening and rates of contraction and relaxation in TG lines, compared to WT (Fig. 11A-C).

Importantly, cardiac function was preserved into adulthood with significant enhancement of EF and FS in TG lines, compared to WT (Table 10). Consistent with physiological hypertrophy models (1-4), overexpression of Tsg101 augmented expression of sarco/endoplasmic reticulum Ca2+-ATPase 2A (Serca2A), with no effect on other calcium handling proteins,

Calsequestrin and phospholamban, and pathological hypertrophy markers, ANP and BNP (Fig.

12A/B). Overall, these results suggest that overexpression of Tsg101 can induce physiological cardiac growth in mice.

Figure 8. Generation of Tsg101-transgenic mouse model. (A/B) Western blots and quantification showing overexpression of Tsg101 in transgenic mouse hearts. GAPDH was used as loading control. n=6; *, p<0.05 vs. WT. (C) Representative immunoblots showing expression of Tsg101 in cardiomyocytes isolated from WT, TG(D) and TG(G) hearts. α-actinin was cardiomyocyte marker and Periostin was cardiac fibroblasts marker. n=4 for each group. (D)

Representative immunoblots showing expression of Tsg101 in cardiac fibroblasts isolated from

WT, TG(D) and TG(G) hearts. α -actinin was cardiomyocyte marker and Periostin was cardiac fibroblast marker. n=4 for each group. (E) Western blot showing expression of Tsg101 from different organ tissues in WT and TG(D) mice.

Figure 9. Characterization of Tsg101-transgenic mouse model (A) Histological sections of hearts showed cardiac hypertrophy in TG lines, compared to WT mice. n=3 hearts for each group.

Three constitutive sections of each heart were examined (Scale bar: 5mm). Immunostaining of heart sections from WT and TG lines with fluorescent-labeled wheat germ agglutinin (Oregon

Green 488-conjugated WGA, 1:500, Scale bar: 20μm). Representative images of Masson’s

Trichrome (Scale bar: 200μm) and Picrosirius red staining (Scale bar: 100μm) showed no signs of histopathology. Three constitutive sections of each heart were stained. (B) Increased ratios of heart weight/body weight (HW/BW) in Tsg101-TG mice, compared to WT mice. n= 15 for WT, n= 17 for D, n=7 for G; *, p<0.05 vs. WTs. (C) Quantification results for WGA staining of heart sections shown in D. n=6 ; *, p<0.05 vs. WTs. (D) mRNA levels of cardiac fibrosis markers (Col I, Collagen

I; Col III, Collagen III), measured by RT-PCR. n=5; *, p<0.05 vs. WT.

Figure 10. Time-course for development of cardiac hypertrophy in Tsg101-transgenic hearts.

(A) Histological sections of Masson’s Trichrome and Picrosirius red staining in WT and TG mice at P7, P14 and P28. Three constitutive sections of each heart were stained. n=3 for WTs; n=3 for each line of TGs (B) Heart weight to body weight ratio (HW/BW) measurements in WT and TG mice at P7, P14 and P28. n=6 for all groups. *, p<0.05 vs. WT. (C) mRNA levels of Tsg101 in hearts of WT and TG mice at P2, P7, P14 and P28. n=6 for all groups. *, p<0.05 vs. WT. (D/E)

Representative Immunoblots and quantification analysis showing expression of Tsg101 in hearts of WT and TG mice at P2, P7, P14 and P28. n=6 for all groups. *, p<0.05 vs. WT.

Table 9. Echocardiography analysis for wild-type (WT) and transgenic

(TG) lines (D and G) at 8 weeks of age

Figure 11. Measurement of cardiomyocyte contractility in Tsg101-transgenic hearts. (A)

Rates of contraction (+dL/dt), (B) Rates of relaxation, (−dL/dt) and (C) fractional shortening in the absence and presence of 100 nM isoproterenol (ISO). n = 5 hearts/group (15-20 cells/heart). *, p<0.05 vs. WT.

Table 10: Echocardiography analysis for wild-type (WT) and transgenic (TG) lines (D and G) at

12 months of age.

Figure 12. Expression of calcium handling proteins in Tsg101-transgenic hearts. (A/B)

Representative immunoblots and quantification analysis showing expression of ANP, BNP,

Phosphorylation of Phospholamban (PLN) at Ser16, Serca2A and Calsequestrin (CSQ) in hearts of WT and TG mice at 8 weeks. GAPDH was used as loading control. n=6, *, p<0.05 vs. WT.

III.1.C Overexpression of Tsg101 alters expression of endosome-associated proteins

Given that cardiac-specific overexpression of Tsg101 resulted in a phenotype similar to exercise-trained mice, we sought to investigate whether elevation of Tsg101 in the heart would have similar effects on expression of endosome-associated genes. Western-blot analyses showed that protein levels of Rab5a and Rab7 were both significantly elevated in TG hearts compared to

WT (Fig. 13A/B), indicating that elevation of Tsg101 could promote endocytosis and maturation of the early to late endosome in the heart. Rab4a, responsible for fast recycling of the early endosome, was unchanged in TG mice (Fig. 13A/B). Importantly, Rab11a and FIP3, two members of the ERC, were greatly increased in TG hearts, compared to WT (Fig. 13A/B).

As shown in Fig. 13A/C both total and plasma membrane levels of IGF-1R were higher in

TG hearts than in WT. Accordingly, the levels of phosphorylated Akt at sites Thr308 and Ser473 were remarkably increased in TG lines, compared to WT (Fig. 13A/C). As in treadmill-exercised hearts, overexpression of Tsg101 had no effect on mRNA levels of endosomal-associated genes

(Fig. 13D/E). Collectively, these data suggest that overexpression of Tsg101 influences the expression of endosome-associated genes, in a similar pattern to what we observed in treadmill- trained mouse hearts.

Figure 13. Expression of endosome-associated genes and IGF-1R/Akt signaling in Tsg101- transgenic hearts. Representative western blots (A) and quantification results (B/C) of protein levels of Rab5a, Rab4a, Rab7, Rab11a, FIP3, total and plasma membrane IGF-1R and Akt phosphorylation in Tsg101-TG hearts, compared to WT. GAPDH was used as loading control.

Total Akt was loading control for Akt phosphorylation and Na/K-ATPase was loading control for plasma membrane protein. n=6, *, p<0.05 vs. WT. (D) mRNA levels of Tsg101 in hearts of WT and TG mice at 8 weeks. n=6, *, p<0.05 vs. WT. (E) mRNA levels of Rab4a, Rab5a, Rab7, Rab11a,

FIP3 and IGF-1R in hearts of WT and TG mice at 8 weeks. n=6, *, p<0.05 vs. WT.

III.1.D Overexpression of Tsg101 promotes IGF-1R recycling and cell growth in neonatal rat cardiomyocytes

Given that long-term overexpression of Tsg101 in vivo may have compensatory effects that may influence the phenotype of Tsg101 in the mouse heart, we next performed studies using ex vivo cultured neonatal rat cardiomyocytes, a well-controlled experimental setting. Neonatal rat cardiomyocytes (NRCM) were isolated from 2-3-day old neonatal rats, and infected with

Ad.Tsg101 or Ad.GFP for 48 h. Constructs for Ad.Tsg101 and control Ad.GFP are displayed in

Fig. 14A. Visually, Ad.Tsg101-cells were larger than Ad.GFP-cells, and Tsg101 was distributed throughout the cell as punctate structures (Fig. 14B). Western-blotting analysis showed that

Tsg101 was dramatically overexpressed in Ad.Tsg101-infected NRCMs, compared to Ad.GFP- cells (Note: GFP-Tsg101 band was displayed around 82kD) (Fig. 14C). The results of immunostaining with α-actinin antibody further affirmed the increased cell size by 2.3-fold in

Ad.Tsg101-NRCMs, compared to Ad.GFP-cells (Fig. 14D/E).

Most interestingly, Western-blotting assays revealed that protein levels of Rab5a, Rab7,

Rab11a and FIP3 were significantly augmented in Tsg101-infected cells, while Rab4a levels were unchanged, compared to Ad.GFP-cells (Fig. 15A/B). Accordingly, both total and plasma membrane levels of IGF-1R were greatly increased in Ad.Tsg101-cells, accompanied by a remarkable elevation of phosphorylated Akt, in relation to Ad.GFP-cells (Fig. 15A/B). These data indicate that acute overexpression of Tsg101 in neonatal rat cardiomyocytes could activate the endosome-mediated IGF-1R/Akt signaling pathway, leading to cell hypertrophy.

Considering that plasma membrane levels of IGF-1R were elevated in Ad.Tsg101-NRCMs, we next sought to determine whether Tsg101 enhances recycling of IGF-1R by utilizing a cell biotinylation-based recycling assay. We observed that Ad.Tsg101-mediated overexpression of

Tsg101 promoted larger proportion of internalized biotinylated IGF-1R to be recycled back onto the cell surface, compared to Ad.GFP-cells (Fig. 16A-C). Put together, these data indicate that overexpression of Tsg101 in neonatal rat cardiomyocytes could activate the IGF-1R/Akt signaling pathway through increased availability of IGF-1R at the cell membrane, leading to cell hypertrophy.

Figure 14. Tsg101 overexpression in neonatal myocytes increases cell size. (A) Diagrams depicting the recombinant adenoviral vectors, Ad.GFP and Ad.Tsg101. (B) Representative images showing Ad.GFP- or Ad.Tsg101-infected neonatal rat cardiomyocytes (left panel is under bright field; right panel is the same field under fluorescence microscope). Scale bar: 20μm. (C) Western blot showing increased expression of Tsg101 in Ad.Tsg101-cardiomyocytes, compared to

Ad.GFP-cells. (D/E) Measurement of myocyte cross-sectional area in those infected cells (green) which were stained with cardiomyocyte-specific α-actinin antibody (red). Scale bar: 20μm. n=6 plates, 25-30 cells per plate, *, p<0.05 vs. Ad.GFP-infected cells.

Figure 15. Expression of endosome-associated genes and IGF-1R signaling in Tsg101- overexpressing cardiomyocytes. Representative immunoblots (A) and quantitative analyses (B) showing expression of plasma membrane IGF-1R, total IGF-1R, Akt phosphorylation at Ser473,

Rab5a, Rab4a, Rab7, Rab11a and FIP3 in Ad. Tsg101- and Ad.GFP-cells. GAPDH was used as loading control for total protein, total Akt was loading control for Akt phosphorylation and Na/K-

ATPase was loading control for plasma membrane (PM) protein. n=4 for independent experiments;

*, p<0.05 vs. Ad.GFP-cells. (C) mRNA levels of Tsg101 in Ad.GFP and Ad.Tsg101 NRCMs. n=4,

*, p<0.05 vs. Ad.GFP. (D) mRNA levels of Rab4a, Rab5a, Rab7, Rab11a, FIP3 and IGF-1R in

Ad.GFP and Ad.Tsg101 NRCMs. n=4, *, p<0.05 vs. Ad.GFP.

Figure 16. Tsg101 overexpression enhances recycling of IGF-1R in cardiomyocytes.

Representative immunoblots (A) and quantitative analyses (B) of Streptavidin immunoprecipitates

(IP), visualized using an IGF-1R antibody. Whole cell lysates were used as loading controls. Four independent experiments were performed for recycling assays. (*, p<0.001). (C) Representative images of immunofluorescence staining with Streptavidin Alexa Fluor 594 Conjugate after IGF-

1R-biotin was internalized and recycled in Ad.Tsg101- and Ad.GFP-NRCMs. Scale bar: 10μm. n=4 plates, 25-30 cells per plate.

III.1.E Tsg101 interacts with FIP3 and IGF-1R

Tsg101 has recently been shown to interact with FIP3 in HeLa cells (207), but their interaction in cardiomyocytes remains unclear. To this end, we performed co-immunoprecipitation assays in the heart homogenates using antibodies to FIP3, Tsg101, or IGF-1R, respectively. Our results showed that not only did Tsg101 interact with FIP3 in WT hearts but there was enhanced interaction in TGs (Fig. 17A/B). This suggests that Tsg101 binds to FIP3 at the ERC to propel recycling of endosomes. Furthermore, we observed that Tsg101 was also bound to IGF-1R (Fig.

17C/D), suggesting that Tsg101 may function as a bridge to recruit/connect IGF-1R to FIP3- containing recycling endosomes in the heart. To elucidate whether Tsg101, FIP3 and IGF-1R may exist in a complex, we performed co-immunofluorescence staining for FIP3 and IGF-1R in

NRCMs transfected with Ad.Tsg101. Our results showed partial co-localization of Tsg101, FIP3 and IGF-1R (Fig. 17E), suggesting that Tsg101, FIP3 and IGF-1R might exist in a complex.

Inhibition of proteasome-dependent degradation with MG132 resulted in similar levels of

FIP3 in Ad.Tsg101-NRCMs, compared to Ad.GFP-control (Fig. 17A/B). Treatment of Ad.GFP- and Ad.Tsg101-NRCMs with cycloheximide (CHX), which inhibits translation, did not affect stabilization of FIP3 in Ad.Tsg101-cells, although FIP3 levels gradually decreases (Fig. 17C/D).

Most interestingly, immunoprecipitation assays showed decreased ubiquitination of FIP3 in TG compared to WT, signifying reduced degradation of FIP3 in TG (Fig. 17E/F).Hence, these data indicate that Tsg101 stabilizes FIP3 through their interaction and blocks ubiquitin-dependent proteasomal degradation.

Figure 17. Tsg101 interacts with FIP3 and IGF-1R. Co-immunoprecipitations using anti-FIP3

(A) or anti-Tsg101 (B) as primary antibody, showing that the Tsg101/FIP3 association was enhanced in TG (line G) hearts. Co-immunoprecipitations, using anti-Tsg101 (C) or anti-IGF-1R

(D) as primary antibody, demonstrated that the Tsg101/IGF-1R association was enhanced in TG

(line G) hearts. WT and TG heart homogenates were used as input. (E) Representative images showing partial co-localization for FIP3 and IGF-1R in Ad.Tsg101-infected neonatal rat cardiomyocytes (yellow arrows). Similar results were observed in three additional, independent experiments. Scale bar: 20μm.

Figure 18. Overexpression of Tsg101 inhibits degradation of FIP3. (A) Representative western blots and (B) quantification analysis showing expression of FIP3 in Ad.GFP and Ad.Tsg101

NRCMs, treated with either DMSO or MG132 (10μM) for. GAPDH was loading control for total protein. n=4 plates for isolation of total protein; *, p<0.05 vs. DMSO+Ad.GFP; $, p<0.05 vs.

DMSO+Ad.GFP; &, p<0.05 vs. DMSO+Ad.Tsg101. (C) Representative western blots and (D) quantification analysis showing expression of FIP3 in Ad.GFP and Ad.Tsg101 NRCMs, treated with either DMSO or cycloheximide (CHX) (5μM). GAPDH was loading control for total protein. n=4 plates for isolation of total protein; *, p<0.05 vs. DMSO+Ad.GFP; $, p<0.05 vs.

DMSO+Ad.GFP; &, p<0.05 vs. DMSO+Ad.Tsg101. (E) Co-immunoprecipitations using anti-

FIP3 as primary antibody and immunoblotted with anti-Ubiquitin in WT and TG and (F) quantification of representative immunoblot. n= 6 for WT, n=6 for both TG, *, p<0.05 vs. WT.

III.1.F Inhibition of endosomal recycling by monensin, knockdown of FIP3 and blockade of

IGF-1R signaling by Picropodophyllin dampens Tsg101-induced cell hypertrophy

Next, to test whether Tsg101-induced hypertrophy is dependent on the endosome-mediated recycling, we pre-treated neonatal cardiomyocytes with Monensin (1 μM), an inhibitor of endosome recycling (217), followed by infection with Ad.Tsg101 or Ad.GFP. Western-blotting results revealed that Tsg101-triggered activation of IGF-1R/Akt signaling was remarkably blocked by addition of Monensin, as evidenced by reduced plasma membrane levels of IGF-1R and lower levels of phosphorylated Akt in Monensin-treated Tsg101-cells than in vehicle-treated ones (Fig.

19A/B). As a result, immunofluorescence staining with α-actinin antibody showed that Tsg101- induced enlargement of neonatal cardiomyocytes was greatly reduced by treatment with Monensin

(Fig. 19C/D). Hence, endosome-mediated recycling of IGF-1R appears to be an essential for myocyte hypertrophy induced by overexpression of Tsg101.

To determine whether FIP3 is involved in Tsg101-induced hypertrophy, we employed small interference RNA targeted at FIP3 (siFIP3) to knockdown FIP3 expression. Transfection of siFIP3 in combination with Ad.GFP and Ad.Tsg101 resulted in successful downregulation of FIP3 (Fig.

20A/B). Consequently, knockdown of FIP3 blocked the Tsg101-induced cell hypertrophy (Fig.

20C/D).

To investigate whether Tsg101-induced myocyte hypertrophy is triggered by IGF-1R/Akt signaling, we pretreated NRCMs with Picropodophyllin (PPP, 10 μM), a specific inhibitor of IGF-

1R signaling (218), followed by infection with Ad.Tsg101 or Ad.GFP. As shown in Fig. 21A/B, pretreatment of NRCMs with PPP resulted in dramatic inhibition of phosphorylation of Akt.

Consequently, the size of Ad.Tsg101-NRCMs, pretreated with PPP, was reduced in comparison

89 to DMSO-pretreated Ad.Tsg101 cells (Fig. 21C/D). Thus, Tsg101-induced cell hypertrophy could be mediated through the IGF-1R/Akt signaling.

Of interest, while reduction of FIP3 alone did not affect cell size, overexpression of FIP3 through plasmid transfection mimicked Tsg101-induced cardiomyocyte growth, further confirming that Tsg101-triggerred growth is aided by the activity of FIP3 (Fig. 22A/B).

Figure 19. Inhibition of endosomal recycling by monensin dampens Tsg101-induced cell hypertrophy. (A/B) Treatment of neonatal rat cardiomyocytes with Monensin (1μM), 1- h prior to adenovirus infection resulted in reduced plasma membrane levels of IGF-1R. n=4 for independent experiments; *, p<0.05 vs. DMSO pre-treated GFP-cells; $, p<0.05 vs. DMSO pre- treated Ctrl-cells; &, p<0.05 vs. DMSO pre-treated GFP-cells; #, p<0.05 vs. DMSO pre-treated

Tsg101-cells. (C/D) Representative images of immunofluorescence staining with α-actinin and quantification of cell cross sectional area. Scale bar: 20μm. n=4 plates, 25-30 cells per plate, *, p<0.05 vs. DMSO pre-treated GFP-cells; #, p<0.05 vs. DMSO pre-treated Tsg101-cells.

Figure 20. Knockdown of FIP3 dampens Tsg101-induced cell hypertrophy. Representative western blots and quantification for Tsg101 and FIP3 protein levels in Ad.GFP- and Ad.Tsg101-

NRCMs transfected with siCtrl or siFIP3. GAPDH was loading control for total protein. n=4 for independent experiments; *, p<0.05 vs. Ad.GFP+siCtrl; $, p<0.05 vs. Ad.GFP+siCtrl; &, p<0.05 vs. Ad.Tsg101+siCtrl; #, p<0.05 vs. Ad.GFP+siFIP3. (G/H) Representative images of immunofluorescence staining with α-actinin and quantification of cell cross sectional area. Scale bar: 20μm. n=4 plates, 25-30 cells per plate; *, p<0.05 vs. Ad.GFP+siCtrl; #, p<0.05 vs.

Ad.Tsg101+siCtrl.

Figure 21. Blockade of IGF-1R signaling by Picropodophyllin dampens Tsg101-induced cell hypertrophy (A/B) Treatment of neonatal rat cardiomyocytes with Picropodophyllin (10μM), 1 h prior to adenovirus infection significantly inhibited Akt phosphorylation. n=4 plates for isolation of total and plasma membrane protein; *, p<0.05 vs. DMSO pre-treated GFP-cells; $, p<0.05 vs.

DMSO pre-treated Ctrl-cells; &, p<0.05 vs. DMSO pre-treated GFP-cells; #, p<0.05 vs. DMSO pre-treated Tsg101-cells. (C/D) Representative images of immunofluorescence staining with α- actinin and quantification of cell cross sectional area. Scale bar: 20μm. n=25-30 cells per plates, three plates for each group; *, p<0.05 vs. DMSO pre-treated GFP-cells; #, p<0.05 vs. DMSO pre- treated Tsg101-cells.

Figure 22. Overexpression of FIP3 mimics Tsg101-induced cardiomyocyte hypertrophy. (A)

Representative images of showing transfection of pCAG-GFP, pET28a-FIP3, GFP-Rab11WT and mCherry-TSG101 and immunofluorescence staining with α-actinin in NRCMs. Scale bar: 10μm..

Similar results were observed in three additional, independent experiments. (B) Quantification of cell cross sectional area in NRCMs showing transfection with pCAG-GFP, pET28a-FIP3, GFP-

Rab11WT and mCherry-TSG101. n=25-30 cells per plates, three plates for each group; *, p<0.05 vs. pCAG-GFP.

III.1.G Knockdown of Tsg101 inhibits expression of mediators of endosomal recycling compartment

To further investigate the contribution of Tsg101 to physiological cardiac hypertrophy, we initially generated a mouse model with inducible cardiac-specific knockout of Tsg101 under the

Cre/flox system. However, we observed that complete knockout of cardiac Tsg101 in adult mice was lethal within one week after injection of tamoxifen. Indeed, prior work also showed that global knockout of Tsg101 was lethal at the embryonic stage (172). Therefore, we generated an inducible heart-specific Tsg101-knockdown (Tsg101-KD) mouse model (Fig. 4). Western-blot analyses revealed that Tsg101 expression was down-regulated about 50% in such KD mouse hearts (Fig.

23A/B), and this downregulation was specific to cardiomyocytes, but not cardiac fibroblast (Fig.

23C/D).

We next sought to determine the mechanism underlying the effects of cardiac Tsg101 reduction on the development of physiological hypertrophy. As shown in Fig. 24A-C, protein levels of Rab11a and FIP3 were both significantly lower in Tsg101-KD hearts than in CTRL, with no effect on mRNA levels, indicating suppressed activity of the ERC. As a consequence, there were lower levels of total IGF-1R and plasma membrane IGF-1R in Tsg101-KD hearts than in

CTRL (Fig. 24A/B). Accordingly, Akt signaling was inhibited in Tsg101-KD hearts, as evidenced by reduced levels of Akt phosphorylation at sites Thr308 and Ser473, compared to CTRL (Fig.

24A/B). Further, there was increased ubiquitination of FIP3 in Tsg101 knockdown (KD) hearts compared to CTRL, signifying enhanced degradation of FIP3 by knocking down Tsg101 (Fig.

25A/B).

Figure 23. Generation of Tsg101-KD mice. (A/B) Representative western blot and quantification results showing Tsg101 protein levels in Tsg101-KD hearts, compared to CTRL s, n= 6; *, p<0.05 vs CTRL s. GAPDH was used as loading control. (C) Representative immunoblots showing expression of Tsg101 in cardiomyocytes isolated from CTRL and KD hearts. α-actin was cardiomyocyte marker and Periostin was cardiac fibroblasts marker. n=4 for each group. (D)

Representative immunoblots showing expression of Tsg101 in cardiac fibroblasts isolated from

CTRL and KD hearts. α-actin was cardiomyocyte marker and Periostin was cardiac fibroblast marker. n=4 for each group.

Figure 24. Expression of endosome-associated genes and IGF-1R/Akt signaling in Tsg101- knockdown hearts. Representative immunoblots (A) and quantitative analysis (B) showing protein levels of FIP3, Rab11a, total IGF-1R, plasma membrane (PM) IGF-1R, and Akt phosphorylation in Tsg101-KD and CTRL hearts. GAPDH was loading control for total protein, total Akt was loading control for Akt phosphorylation and Na/K-ATPase was loading control for

PM-IGF-1R. n=6; *, p<0.05 vs CTRLs. (C) mRNA levels of Tsg101, Rab11a, FIP3 and IGF-1R in hearts of CTRL and KD mice. n= 6 for CTRL and KD, *, p<0.05 vs CTRL.

Figure 25. Knockdown of Tsg101 enhances degradation of FIP3 in the heart. (A) Co- immunoprecipitations using anti-FIP3 as primary antibody and immunoblotted with anti-Ubiquitin in CTRL and KD hearts and (B) quantification of representative immunoblot. n= 6 for CTRL, n=6 for KD, *, p<0.05 vs. CTRL.

III.1.H Knockdown of Tsg101 inhibits development of physiological hypertrophy

To determine whether Tsg101-KD affects the development of exercise-induced physiological cardiac hypertrophy, we subjected Tsg101-KD and CTRL mice to intense exercise training for 4 weeks. In sedentary conditions, there were similar HW/BW and cardiomyocyte cross-sectional area for Tsg101-KD and CTRL mice (Fig. 26A-C). However, Tsg101-KD mouse hearts failed to respond to exercise stimuli, as evidenced by no differences in HW/BW and cardiomyocyte cross-sectional area, compared to sedentary Tsg101-KD mice (Fig. 26A-C).

Cardiac function parameters, EF and FS, were similar in CTRL and KD, before and after exercise program (Table 11). Interestingly, sedentary Tsg101-KD mice had increased levels of ANP, BNP,

Col I and Col III, compared to sedentary CTRL mice (Fig. 27A-C). When the mice were subjected to exercise, the levels of ANP, BNP, Col I and Col III were reduced significantly in both CTRL and KD hearts (Fig. 27A-C). Taken together, these results indicate that reduction of Tsg101 expression levels could attenuate the development of exercise-induced cardiac growth.

Figure 26. Knockdown of Tsg101 in mouse hearts inhibits exercise-induced cardiac hypertrophy. (A) Whole hearts and histological sections stained with fluorescent-labeled wheat germ agglutinin (Scale bar: 20μm) in sedentary and treadmill-trained (EXE) CTRL and KD mice.

Three constitutive sections of each heart were stained. (B) Heart weight to body weight ratio

(HW/BW) measurements in sedentary and treadmill-trained (EXE) CTRL and KD mice. n=6 for

CTRL-SED, n=5 for KD-SED, n=6 for CTRL-EXE, n=6 for KD-EXE, *, p<0.05 vs CTRL-SED;

#, p<0.05 vs CTRL-EXE. (C) Quantification results for WGA staining of heart sections from shown in E. n=6 hearts for all groups. *, p<0.05 vs CTRL-SED; #, p<0.05 vs CTRL-EXE.

100

Table 11. Echocardiography analysis in sedentary and treadmill-trained (EXE)

CTRL and knockdown (KD) mice

101

Figure 27. Expression of pathological and fibrotic markers in Tsg101-KD exercised hearts.

(A) Representative immunoblots and (B) quantification analysis showing expression of Tsg101,

ANP and BNP in hearts of sedentary (SED) and treadmill-trained (EXE) CTRL and KD mice. n=6 hearts for all groups. *, p<0.05 vs CTRL-SED; $, p<0.05 vs CTRL-SED; &, p<0.05 vs KD-

SED. (C) mRNA levels of Col I and Col III in sedentary and treadmill-trained (EXE) CTRL and

KD. n=6 hearts for all groups. *, p<0.05 vs CTRL-SED; $, p<0.05 vs CTRL-SED; &, p<0.05 vs

KD-SED.

102

III.1.I Knockdown of Tsg101 in neonatal myocytes blocks activity of the endosomal recycling compartment and inhibits recycling of IGF-1R

Similar to Tsg101-KD hearts, protein levels, but not mRNA levels, of endosomal recycling compartment members (Rab11a and FIP3) were reduced in Ad.shTsg101-NRCMs compared to

Ad.shGFP-cells (Fig. 28A-C). Further, total and plasma membrane levels of IGF-1R were diminished in Tsg101-knockdown neonatal myocytes, leading to reduced phosphorylation of Akt

(Fig. 28A/B).

To further test the functional role of Tsg101 in the endosomal recycling of IGF-1R in physiological hypertrophy, we employed a cell surface biotinylation recycling assay. In the recycling assay, a higher proportion of internalized biotinylated IGF-1R was recycled back to the plasma membrane in Ad.GFP-cells, whereas in Ad.shTsg101-cells, the knockdown of Tsg101 impeded recycling of biotinylated IGF-1R (Fig. 29A/B). In the immunofluorescence-based recycling assay, a large percentage of IGF-1R-biotin fluorescent signals were observed at the cell periphery in Ad.GFP-NRCMs, while IGF-1R-biotin was visualized in intracellular sites in

Ad.shTsg101-cells (Fig. 29C). Collectively, these data suggest that a fully functional Tsg101 is essential for the efficient recycling of IGF-1R in cardiomyocytes.

103

Figure 28. Expression of endosome-associated genes and IGF-1R/Akt signaling in Tsg101- depleted cardiomyocytes. (A) Representative immunoblots (A) and quantitative analyses (B) showing protein levels of PM-IGF-1R, total IGF-1R, Akt phosphorylation, Rab11a, FIP3 and

Tsg101 in Ad.shTsg101- and Ad.shGFP-NRCMs. GAPDH was loading control for total protein, total Akt was loading control for Akt phosphorylation and Na/K-ATPase was loading control for plasma membrane protein (PM). n=4 for independent experiments; *, p<0.05 vs. Ad.shGFP-cells.

104

Figure 29. Knockdown of Tsg101 inhibits recycling of IGF-1R in cardiomyocytes.

Representative immunoblots (C) and quantitative analyses (D) of Streptavidin immunoprecipitates

(IP), visualized using an IGF-1R antibody. Whole cell lysates were used as loading controls. Four independent experiments were performed for recycling assays. Knockdown of Tsg101 inhibited recycling of IGF-1R, whereas recycling of IGF-1R was uninhibited in Ad.shGFP cells (*, p<0.001). (E) Representative images of immunofluorescence staining with Streptavidin Alexa

Fluor 594 Conjugate after IGF-1R-biotin was internalized and recycled in Ad.shTsg101- and

Ad.shGFP-NRCMs. Scale bar: 5μm. n=4 plates, 25-30 cells per plate.

105

III.1.J Overexpression of Tsg101 does not promote recycling of EGFR, IR and β1-AR but knockdown of Tsg101 inhibits recycling of IR and EGFR

Considering that Tsg101 is critical for the endosomal recycling of IGF-1R, it would be of interest to investigate whether overexpression or knockdown of Tsg101 altered levels of other receptors such as epidermal growth factor receptor (EGFR), insulin receptor (IR) and beta 1 adrenergic receptor (β1-AR). Our results of Western-blotting analysis showed that overexpression of Tsg101 in mouse hearts or in NRCMs did not alter either plasma membrane or total protein levels of IR and β1-AR (Fig. 30A-D). Interestingly, total EGFR were decreased in TG-hearts and

Ad.Tsg101-NRCMs, although plasma membrane levels of EGFR were unchanged (Fig. 30A-D).

However, knockdown of Tsg101 in mouse hearts and in NRCMs resulted in reduced plasma membrane and total protein levels of EGFR and IR (Fig. 31A-D). Total and plasma membrane β1-

AR were unchanged in KD hearts and Ad.shTsg101-cells, compared to WT and Ad.shGFPs, respectively (Fig. 31A-D). In all, these data suggest that the enhancement of endosomal recycling in Tsg101-overexpressing myocytes mostly affects IGF-1R recycling.

106

Figure 30. Expression of total and plasma membrane β1-AR, EGFR and IR in Tsg101- overexpressing hearts and cardiomyocytes. (A) Representative immunoblots and (B) quantitative analyses showing expression of plasma membrane β1-AR, EGFR and IR and total levels of β1-AR, EGFR and IR in WT and TG hearts. GAPDH was loading control for total protein and Na/K-ATPase was loading control for plasma membrane protein. n=6, *, p<0.05 vs. WT. (C)

Representative immunoblots and (D) quantitative analyses showing expression of plasma membrane β1-AR, EGFR and IR and total levels of β1-AR, EGFR and IR in Ad.GFP and

Ad.Tsg101 NRCMs. GAPDH was loading control for total protein and Na/K-ATPase was loading control for plasma membrane protein. n=4 plates for isolation of total and plasma membrane protein; *, p<0.05 vs. Ad.GFP.

107

Figure 31. Expression of total and plasma membrane β1-AR, EGFR and IR in Tsg101- knockdown hearts and cardiomyocytes. (A) Representative immunoblots and (B) quantitative analyses showing expression of plasma membrane β1-AR, EGFR and IR and total levels of β1-

AR, EGFR and IR in WT and KD hearts. GAPDH was loading control for total protein and Na/K-

ATPase was loading control for plasma membrane protein. n=6, *, p<0.05 vs. WT. (C)

Representative immunoblots and (D) quantitative analyses showing expression of plasma membrane β1-AR, EGFR and IR and total levels of β1-AR, EGFR and IR in Ad.GFP and

108

III.1.K Tsg101 is cardio-protective against pathological cardiac hypertrophy

To investigate whether Tsg101 played a role in pathological hypertrophy, we subjected mice to transverse aortic constriction (TAC) surgery for eight weeks. As expected, pathological hypertrophy markers, Col I, Col III, ANP and BNP, were elevated in hearts at 8 weeks post-TAC.

However, Tsg101 levels were unchanged in such TAC-operated hearts (Fig. 32A-C). Consistent with previous findings, TAC-operated WT-mice exhibited a significant increase in 1) ratios of

HW/BW and HW/TL; and 2) the levels of cardiac fibrosis markers (Col I and Col III) and hypertrophy markers (ANP and BNP), as well as a decrease in cardiac function (Fig. 33A-F, Table

12). However, TG-mice were protected from TAC-induced fibrosis and cardiac dysfunction (Fig.

33A-F, Table 12).

109

Figure 32. Tsg101 levels are unchanged in in vivo model of pathological hypertrophy. (A)

Representative immunoblots and (B) quantification analysis showing expression of Tsg101, ANP and BNP in hearts of sham and TAC -operated mice. n=6 for SHAM, n=6 for TAC. *, p<0.05 vs.

SHAM. (C) mRNA levels of Tsg101, Col I and Col III in hearts of sham and TAC operated mice. n=6 for SHAM, n=6 for TAC. *, p<0.05 vs. SHAM.

110

Figure 33. Overexpression of Tsg101 attenuates pathological cardiac remodeling. (A)

Representative immunoblots and (B) quantification analysis showing expression of Tsg101, ANP and BNP in hearts of WT and TG mice subjected to sham or TAC surgery. (C) mRNA levels of

Col I and Col III in WT and TG mice subjected to sham or TAC surgery. n=6 for all groups; *, p<0.05 vs. WT-SHAM; #, p<0.05 vs. WT-TAC. (D) Histological sections of hearts stained with fluorescent-labeled wheat germ agglutinin, Masson’s Trichrome and Picrosirius red staining in

WT and TG (G) mice subjected to sham or TAC surgery. Three constitutive sections of each heart were stained. n=3 for all groups; (E) Heart weight to body weight ratio (HW/BW) measurements in WT and TG(G) mice subjected to sham or TAC surgery. *, p<0.05 vs WT-SHAM; #, p<0.05 vs WT-SHAM. (F) Quantification results for WGA staining of heart sections from shown in D. n=6 for all groups; *, p<0.05 vs WT-SHAM; #, p<0.05 vs WT-SHAM.

111

Table 12. Echocardiography analysis in wild-type (WT) and transgenic (G) mice subjected

to sham and transverse aortic constriction surgery

112

III.1.L Overexpression of Tsg101 inhibits phenylephrine-induced cardiomyocyte growth

Similarly, treatment of NRCMs with angiotensin II (Ang II) and phenylephrine (PE) could induce cell hypertrophy, but did not alter levels of Tsg101 (Fig. 34A-H). Next, we observed that overexpression of Tsg101 could provide protection against PE-induced cell hypertrophy (Fig.

35A-D). Taken together, these data indicate that elevation of Tsg101 in the heart alleviates cardiac fibrosis and dysfunction associated with pathological cardiac hypertrophy.

113

Figure 34. Tsg101 levels are unchanged in in vitro models of pathological hypertrophy. (A/B)

Representative images of immunofluorescence staining with α-actinin and quantification of cell cross sectional area in NRCMs treated with PBS or Angiotensin II (Ang II) (1μM). Scale bar:

20μm. n=25-30 cells per plates, three plates for each group; *, p<0.05 vs. PBS. Representative western blots (C) and quantitative analyses (D) showing expression of Tsg101 and BNP in PBS or

Ang II-treated NRCMs. GAPDH was loading control for total protein; n=4 plates for isolation of total protein; *, p<0.05 vs. PBS. (E/F) Representative images of immunofluorescence staining with

α-actinin and quantification of cell cross sectional area in NRCMs treated with PBS or

Phenylephrine (PE) (10μM). Scale bar: 20μm. n=25-30 cells per plates, three plates for each group;

*, p<0.05 vs. PBS. (C) and quantitative analyses (D) showing expression of Tsg101 and BNP in

PBS or PE-treated NRCMs. GAPDH was loading control for total protein; n=4 plates for isolation of total protein; *, p<0.05 vs. PBS.

114

Figure 35. Overexpression of Tsg101 blocks phenylephrine-triggered myocyte hypertrophy.

(A/B) Representative western blots (C) and quantitative analyses (D) showing expression of

Tsg101 and BNP in Ad.GFP and Ad.Tsg101 NRCMs treated with either PBS or PE (10μM).

GAPDH was loading control for total protein; n=4 plates for isolation of total protein; *, p<0.05 vs. Ad.GFP+PBS; #, p<0.05 vs. Ad.GFP+PE. (C/D) Representative images of immunofluorescence staining with α-actinin and quantification of cell cross sectional area in

Ad.GFP and Ad.Tsg101 NRCMs treated with either PBS or PE (10μM). Scale bar: 20μm. n=25-

30 cells per plates, three plates for each group; *, p<0.05 vs. Ad.GFP+PBS; #, p<0.05 vs.

Ad.GFP+PE. Similar results were observed in three additional, independent experiments.

115

Section 2: Tsg101 ameliorates endotoxin-induced cardiac dysfunction through enhancing

Parkin-mediated mitophagy

III.2.A Endotoxin activates mitophagy in the mouse heart, together with upregulation of

Tsg101

Mitophagy has been demonstrated to play a protective role in the heart during endotoxin challenge (146, 147). Notably, Parkin and PINK1, two major players of mitophagy, are essential for its protection against endotoxin-induced cardiac impairment (146, 153). To determine the expression pattern of mitophagy mediators (i.e., Parkin and PINK1) and autophagic flux marker,

LC3-II, in endotoxemic hearts, LPS was injected i.p. into mice and heart samples were collected after 0 h, 6 h and 24 h for Western-blot analysis. We observed that cardiac LC3-II protein levels were significantly upregulated at both 6 h and 24 h post-injection (Fig. 36A/B), suggesting that treatment of mice with LPS led to increased autophagy flux in the heart. Interestingly, protein levels of Parkin were greatly increased at 6 h but returned to basal levels at 24 h post-LPS injection

(Fig. 36A/C), suggesting early activation of Parkin in endotoxemic hearts. Similar to LC3-II, cardiac protein levels of PINK1 were continuously elevated at both 6 h and 24 h post-LPS injection

(Fig. 36A/D). Considering that previous reports had indicated the possible contribution of Tsg101 to autophagy in cancer cells, we next sought to determine whether Tsg101 proteins levels were dysregulated after endotoxin treatment in the mouse hearts. Immunoblot analysis results showed that Tsg101 protein levels were remarkably increased in mouse hearts at both 6 and 24 h after LPS injection (Fig. 36A/E). These results indicate that Tsg101 may play a role in cardiac response to endotoxin stress and such increase may be linked to Parkin/PINK1-mediated mitophagy.

116

Figure 36. Endotoxin treatment enhances mitophagy and expression of Tsg101 in mouse hearts. Western blots (A) and quantification analysis showing the differential expression of (B)

LC3-II, (C) Parkin, (D) PINK1 and (E) Tsg101 in hearts of mice subjected to endotoxin injection for 0 h, 6 h and 24 h. GAPDH was used as loading control for total protein. *, p<0.05 vs. 0 h.

117

III.2.B Overexpression of Tsg101 improves animal survival and cardiac function upon endotoxin challenge.

To investigate the possible role of Tsg101 in endotoxin-induced cardiac dysfunction (Fig.

2A), we generated a mouse model with cardiac-specific overexpression of Tsg101. Tsg101 transgenic (TG) hearts showed about a 4-fold increase in Tsg101 levels, compared to wild-type

(WT) hearts (Fig. 37B). Given that endotoxin can cause myocardial depression and animal death

(111), we first monitored survival rates in Tsg101-TG mice and WT controls over 5 days after LPS injection. Survival analysis results showed a higher 6 out of 7 TG mice survived after endotoxin challenge, whereas only 3 out of 8 WT mice survived (Fig. 37C). Consistent with previous reports

(111, 112), cardiac function parameters, ejection fraction (EF) and fractional shortening (FS), were significantly decreased in LPS-treated WT mice (Fig. 37D-F). However, cardiac function was preserved in LPS-treated TG mice (Fig. 37D-F).

118

Figure 37. Overexpression of Tsg101 attenuates endotoxin-induced animal mortality and cardiac dysfunction. (A) Diagram showing experimental procedure and biochemical assays for

LPS (10µg/g) treatment in WT and TG mice. (B) Western blots and quantification analysis showing the expression of Tsg101 in hearts of WT and TG mice. GAPDH was used as loading control for total protein. *, p<0.05 vs. WT. (C) Survival curve of WT and TG mice when challenged with LPS (10μg/ul) and monitored over 5 days. n=8 for WT, n=7 for TG, *, p<0.05 vs.

WT. (D-F) Cardiac function in WT and TG mice, subjected to PBS or LPS treatment, was determined by echocardiography; *, #, p<0.05 vs. PBS WT; &, p<0.05 vs. LPS WT.

119

III.2.C Overexpression of Tsg101 reduces inflammation upon endotoxin challenge.

Considering that endotoxin-induced mortality and cardiac dysfunction have been ascribed to the elevation of systemic/local inflammation (111), we next measured the levels of pro- inflammatory cytokines in the sera and cardiac tissues of LPS-injected mice (Fig. 38A). qPCR and

ELISA results showed that cardiac and systemic levels of TNF-α and IL-6 were greatly increased in hearts of LPS-treated WT mice but such increase was significantly attenuated in LPS-treated

TG mice (Fig. 38B-E). Together, these data indicate that overexpression of Tsg101 protects mice against endotoxin-induced death, cardiac dysfunction and inflammation.

120

Figure 38. Overexpression of Tsg101 blocks endotoxin-induced inflammation. (A) Diagram showing experimental procedure and biochemical assays for LPS (10µg/g) treatment in WT and

TG mice. Levels of pro-inflammatory cytokines, (B) TNF-α and (C) IL-6, in WT and TG mice, subjected to PBS or LPS treatment was determined by qRT-PCT. *, p<0.05 vs. PBS WT; #, p<0.05 vs. PBS TG; &, p<0.05 vs. LPS WT. Levels of pro-inflammatory cytokines, (D) TNF-α and (E)

IL-6, in WT and TG mice, subjected to PBS or LPS treatment were measured by ELISA assays.

*, p<0.05 vs. PBS WT; #, p<0.05 vs. PBS TG; &, p<0.05 vs. LPS WT.

121

III.2.D Overexpression of Tsg101 enhances mitophagy and preserves mitochondria structural integrity in endotoxin-treated hearts.

To elucidate whether Tsg101-mediated protection against endotoxemia is associated with mitophagy, we next determined the expression levels of mitophagy regulators, Parkin and PINK1, in LPS-treated mouse hearts (Fig. 39A). Interestingly, we observed that protein levels of Parkin and PINK1 both were significantly increased in Tsg101-TG hearts, compared to WT controls under basal conditions (Fig. 39B-E). As expected, treatment of mice with LPS enhanced expression of Parkin and PINK1 in WT-hearts; however, such increases were more pronounced in

Tsg101-TG hearts upon LPS challenge (Fig. 39B-E). Accordingly, autophagic flux was significantly enhanced in Tsg101-TG hearts, evidenced by higher levels of LC3-II than in WT hearts under basal and LPS conditions (Fig. 39B/F).

Next, we examined whether overexpression of Tsg101 affected the release of mitochondrial

DNA (mtDNA) and reactive oxygen species (mtROS) as indicators of mitochondrial damage during endotoxemia (Fig. 40A). As shown in Fig. 40B-D, levels of mtDNA and mtROS were remarkably less in LPS-TG hearts than LPS-WTs. Further, levels of myeloperoxidase, an enzyme released from infiltrating neutrophils due to cellular oxidative stress, were significantly lower in

LPS-TG hearts, compared to LPS-WT hearts (Fig. 40E). Collectively, these data suggest that

Tsg101-elicited protective effects against endotoxemia may be due to enhanced cardiac mitophagy.

122

Figure 39. Overexpression of Tsg101 enhances expression of mitophagy mediators. (A)

Diagram showing experimental procedure and biochemical assays for LPS (10µg/g) treatment in

WT and TG mice. Western blots (B) and quantification analysis showing the protein expression of (C) Tsg101, (D) Parkin, (E) PINK1 and (F) LC3-II in hearts of WT and TG mice subjected to endotoxin injection for 6 h. GAPDH was used as loading control for total protein. *, #, p<0.05 vs.

PBS WT; &, p<0.05 vs. PBS TG; $, p<0.05 vs. LPS WT.

123

Figure 40. Overexpression of Tsg101 inhibits endotoxin-induced mitochondrial damage. (A) Diagram showing experimental procedure and biochemical assays for LPS (10µg/g) treatment in WT and TG mice. Quantification of mtDNA by RT-PCR using primers targeted to (B) mitochondrial Cytochrome B (CytB) and (C) mitochondrial Cytochrome C (Cyt C) in hearts of

WT and TG mice subjected to endotoxin injection for 6 h. *, p<0.05 vs. PBS WT; #, p<0.05 vs. PBS TG; &, p<0.05 vs. LPS WT. (D) Levels of mitochondrial hydrogen peroxide (ROS) in hearts of WT and TG mice subjected to endotoxin injection for 6 h was measured by Amplex Red assay.

*, p<0.05 vs. PBS WT; #, p<0.05 vs. PBS TG; &, p<0.05 vs. LPS WT. (E) Levels of myeloperoxidase (MPO) in hearts of WT and TG mice subjected to endotoxin injection for 6 h was measured by MPO ELISA kit. *, p<0.05 vs. PBS WT; #, p<0.05 vs. PBS TG; &, p<0.05 vs. LPS WT.

124

III.2.E Knockdown of Tsg101 exacerbates LPS-triggered animal mortality and cardiac dysfunction

To further investigate the role of Tsg101 in endotoxin-induced cardiac injury, we utilized an inducible cardiac-specific Tsg101-knockdown (KD, MerCreMer-Tsg101fl/+) mouse model which underwent LPS challenge (Fig. 41A). Genetic knockdown of Tsg101 in the mouse heart was confirmed by Western-blotting analysis (Fig. 41B). Only 2 out of 8 KD mice survived at 5 days post-LPS injection, whereas 7 out of 10 control (CTRL, Tsg101fl/+) mice survived when challenged with LPS (Fig. 41C). Further, under basal conditions, KD mice exhibited a similar cardiac contractile function as CTRL mice (Fig. 41D-F). However, the degree of LPS-triggered cardiac dysfunction was greater in KD mice than CTRL mice, as evidenced by a significantly larger reduction of ejection fraction (EF) and fraction shortening (FS) in KDs, compared to CTRLs which underwent endotoxemia for 12 h (Fig. 41D-F).

125

Figure 41. Knockdown of Tsg101 aggravates endotoxin-induced animal mortality and cardiac dysfunction. (A) Diagram showing experimental procedure and biochemical assays for

LPS (10µg/g) treatment in control (CTRL, Tsg101fl/+) and Tsg101 knockdown (KD, MerCreMer-

Tsg101fl/+) mice. (B) Western blots and quantification analysis showing the expression of Tsg101 in hearts of CTRL and KD mice. GAPDH was used as loading control for total protein. *, p<0.05 vs. CTRL. (C) Survival curve of CTRL and KD mice when challenged with LPS (10μg/ul) and monitored over 5 days. n=10 for CTRL, n=8 for KD, *, p<0.05 vs. CTRL. (D-F) Cardiac function in CTRL and KD mice, subjected to PBS or LPS treatment, was determined by echocardiography.

*, p<0.05 vs. PBS CTRL; #, p<0.05 vs. PBS KD; &, p<0.05 vs. LPS CTRL.

126

III.2.F Knockdown of Tsg101 exacerbates LPS-triggered inflammation.

Accordingly, there were higher levels of systemic and cardiac pro-inflammatory cytokines, TNF- and IL-6, in LPS-treated KD mice than CTRLs (Fig. 42A-E). Together, these data demonstrate that knockdown of Tsg101 in the heart exaggerates endotoxin-triggered mortality, cardiac dysfunction and inflammation.

127

Figure 42. Knockdown of Tsg101 aggravates endotoxin-induced inflammation. (A) Diagram showing experimental procedure and biochemical assays for LPS (10µg/g) treatment in control

(CTRL, Tsg101fl/+) and Tsg101 knockdown (KD, MerCreMer-Tsg101fl/+) mice. Levels of pro- inflammatory cytokines, (B) TNF-α and (C) IL-6, in CTRL and KD mice, subjected to PBS or

LPS treatment was determined by qRT-PCT. *, p<0.05 vs. PBS CTRL; #, p<0.05 vs. PBS KD; &, p<0.05 vs. LPS CTRL. Levels of pro-inflammatory cytokines, (D) TNF-α and (E) IL-6, in CTRL and KD mice, subjected to PBS or LPS treatment were measured by ELISA assays. *, p<0.05 vs.

PBS CTRL; #, p<0.05 vs. PBS KD; &, p<0.05 vs. LPS CTRL.

128

III.2.G Knockdown of Tsg101 diminishes mitophagy and mitochondrial integrity in LPS- treated hearts.

To determine whether knockdown of Tsg101 affected cardiac mitophagy during endotoxemia, we subjected CTRL and KD mice to LPS treatment for 6 h and collected heart samples for Western blotting (Fig. 43A). Immuno-blot analysis results showed that reduction of

Tsg101 in the heart significantly downregulated expression of Parkin, PINK1 and LC3-II under basal (PBS) conditions (Fig. 43B-F). Administration of LPS elicited compensatory upregulation of PINK1, Parkin and LC3-II expression in CTRL hearts, but such upregulation in these proteins were remarkably attenuated in KD hearts (Fig. 43B-F).

In addition, levels of mtDNA, mtROS and MPO were much higher in LPS-treated KD hearts than CTRL hearts (Fig.44A-E). These data indicate that knockdown of Tsg101 significantly inhibits the activation of mitophagy in the endotoxemic heart.

129

Figure 43. Knockdown of Tsg101 reduces expression of mitophagy mediators. (A) Diagram showing experimental procedure and biochemical assays for LPS (10µg/g) treatment in control

(CTRL, Tsg101fl/+) and Tsg101 knockdown (KD, MerCreMer-Tsg101fl/+) mice. Western blots (B) and quantification analysis showing the protein expression of (C) Tsg101, (D) Parkin, (E) PINK1 and (F) LC3-II in hearts of CTRL and KD mice subjected to endotoxin injection for 6 h. GAPDH was used as loading control for total protein. *, #, p<0.05 vs. PBS CTRL; &, p<0.05 vs. PBS KD;

$, p<0.05 vs. LPS CTRL.

130

Figure 44. Knockdown of Tsg101 aggravates endotoxin-induced mitochondrial damage. (A)

Diagram showing experimental procedure and biochemical assays for LPS (10µg/g) treatment in control (CTRL, Tsg101fl/+) and Tsg101 knockdown (KD, MerCreMer-Tsg101fl/+) mice.

Quantification of mtDNA by RT-PCR using primers targeted to (B) mitochondrial Cytochrome B

(CytB) and (C) mitochondrial Cytochrome C (Cyt C) in hearts of CTRL and KD mice subjected to endotoxin injection for 6 h. *, p<0.05 vs. PBS CTRL; #, p<0.05 vs. PBS KD; &, p<0.05 vs. LPS

WT. (D) Levels of mitochondrial hydrogen peroxide (ROS) in hearts of CTRL and KD mice subjected to endotoxin injection for 6 h was measured by Amplex Red assay. *, p<0.05 vs. PBS

CTRL; #, p<0.05 vs. PBS KD; &, p<0.05 vs. LPS CTRL. (E) Levels of myeloperoxidase (MPO) in hearts of CTRL and KD mice subjected to endotoxin injection for 6 h was measured by MPO

ELISA kit. *, p<0.05 vs. PBS CTRL; #, p<0.05 vs. PBS KD; &, p<0.05 vs. LPS CTRL.

131

III.2.H Tsg101 interacts with and augments the activity of Parkin in endotoxin-treated hearts

To validate that Tsg101 interacted with Parkin, we performed co-immunostaining in isolated neonatal rat cardiomyocytes which were treated with PBS or LPS (1μg/ml) for 3 h. Results of co- immunostaining for mitochondria (mitotracker), Tsg101 and Parkin revealed that a small portion of Tsg101 and Parkin were co-localized with mitochondria in the basal (PBS) condition (Fig. 45).

However, in LPS-treated cardiomyocytes, a large portion of Tsg101 overlapped with Parkin at the mitochondria (Fig. 45). These results indicate that Tsg101 interacts with Parkin, and this association could be enhanced/translocated to the mitochondria after LPS challenge.

To elucidate how Tsg101 regulates cardiac mitophagy during endotoxemia, we performed co-immunoprecipitation assays using antibodies of Tsg101, Parkin and PINK1 in heart homogenates of WT and TG mice subjected to endotoxin challenge for 6 h. Our results showed that not only did Tsg101 bind to Parkin, but this association was further enhanced in both WT and

TG hearts after endotoxin challenge (Fig. 46A/B). Interestingly, Tsg101 did interact with Parkin but did not bind to PINK1 (Fig. 46A/B). As expected, Parkin interacted with PINK1 since such interaction is well known for targeting the damaged mitochondria to autophagosomes and lysosomes (Fig. 46A/B).

132

Figure 45. Tsg101 interacts with Parkin in cardiomyocytes. Immunofluorescence staining for mitochondria (mitotracker), Tsg101 and Parkin in NRCMs treated with either PBS or LPS (1μg/μl) for 3 h. n=6 plates for each group.

133

Figure 46. Tsg101 promotes the activity of Parkin in endotoxin-treated hearts. (A) Co- immunoprecipitation using anti-Tsg101 and immunoblotting for PINK1, Parkin and Tsg101 in hearts of WT and TG mice subjected to PBS or LPS treatment for 6 h. n=4 for WT, n=4 for TG.

(B) Co-immunoprecipitation using anti-Parkin and immunoblotting for PINK1, Parkin and Tsg101 in hearts of WT and TG mice subjected to PBS or LPS treatment for 6 h. n=4 for WT, n=4 for TG.

134

Chapter IV

Discussion

Section 1: Dissertation Summary

In this study, we observed that the expression of Tsg101 was distinctly upregulated in mouse hearts upon treadmill training. As such, cardiac-specific overexpression of Tsg101 resulted in a physiological hypertrophy-like phenotype in mice, evidenced by increases in cardiomyocyte size and cardiac function but without cardiac fibrosis. Further, these Tsg101-transgenic mice showed enhanced endosome-mediated recycling of IGF-1R and Akt phosphorylation. In vitro, adenoviral- mediated overexpression of Tsg101 in neonatal cardiomyocytes induced cell hypertrophy and mimicked our observations in Tsg101 transgenic mice. Blockade of endosome-mediated recycling of IGF-1R with Monensin, an inhibitor of endosome recycling, attenuated the effects of Tsg101 on cell size. Also, the application of Picropodophyllin, to block the IGF-1R/Akt pathway, hampered the effects of Tsg101 on cardiomyocyte hypertrophy. Similarly, knockdown of FIP3, a key member of the endosomal recycling compartment, blunted Tsg101-induced cell hypertrophy.

Intriguingly, mice with heart-specific knockdown of Tsg101 failed to develop physiological hypertrophy after intense exercise training, which was associated with reduced cardiac levels of recycling mediators Rab11a and FIP3, total and plasma membrane IGF-1R, and Akt phosphorylation. Using cell biotinylation recycling assays, we showed that reduction in Tsg101 levels inhibited recycling of Tsg101 in cardiomyocytes. Importantly, Tsg101-transgenic mice were resistant to cardiac dysfunction and fibrosis induced by pathological cardiac hypertrophy.

Together, our data presented in this study define a novel role of Tsg101 as a positive regulator of physiological cardiac hypertrophy through endosome-mediated recycling of IGF-1R.

135

Furthermore, we identified a novel role of Tsg101 in the regulation of mitophagy and endotoxin-induced myocardial depression. We observed that administration of endotoxin in mice augmented the activation of mitophagy and autophagic flux in mouse hearts, which correlated with elevation of Tsg101 protein levels. Cardiac-specific overexpression of Tsg101 in mice alleviated endotoxin-induced mortality, myocardial dysfunction and inflammation. In addition, Tsg101 transgenic hearts exhibited enhanced mitophagy and preservation of mitochondrial integrity. In contrast, LPS-induced mortality, cardiac dysfunction and inflammation were aggravated in mice with cardiac-specific knockdown of Tsg101. Reduction of Tsg101 also caused inhibition of cardiac mitophagy after endotoxin challenge, leading to diminished mitochondrial structural integrity.

Mechanistically, Tsg101 interacted with Parkin in the cytosol in basal conditions but this interaction was further enhanced and consequently, facilitated translocation of Parkin to the mitochondria upon LPS treatment. Together, these findings suggest that Tsg101-mediated protective effects in endotoxemic hearts are associated with enhanced mitophagy.

Section 2: The role of Tsg101 on physiological cardiac hypertrophy

IV.2.A Upregulation of Tsg101 levels in exercised-trained hearts

While Tsg101 was initially discovered as a tumor-associated protein, further studies debunked that claim, which ended with the original article been retracted (153-155). Afterwards, several studies have revealed divergent roles of Tsg101 in cell proliferation and survival, endosomal sorting, virus budding, ubiquitination and cytokinesis. Tsg101 mediates cell proliferation and survival through it’s the regulation of cell cycle mediators such as p53, p21 and

MDM2 (178, 179). Tsg101 plays a role in sorting of membrane protein into multivesticular bodies as part of the endosomal sorting complexes required for transport (ESCRT). Viruses such HIV

136 possess the PTAP motif and are able to bind to Tsg101 and the ESCRT machinery to aid in assembly and release from cells.

In relation to its contribution to the ESCRT machinery, recent studies have linked Tsg101 with trafficking of EGFR for degradation or recycling. For example, Tsg101 interacted with

ESCRT member, hepatocyte growth factor-regulated tyrosine kinase substrate (Hrs), was critical for the recruitment of EGFR to late endosomes and prevent its accumulation in early endosomes

(204). Zhang et al. showed that Tsg101 enhanced the degradation of EGFR in lysosomal compartments by interacting with BLOC-1 and SNX2 (206). What’s more, Rush et al. observed that knockdown of Tsg101 impaired recycling of unliganded EGFR, causing accumulation of

EGFR in low-density endosomes (203). Thus, besides sorting ubiquitinated membrane proteins into endosomal compartments, Tsg101 seems to contribute to trafficking of membrane proteins for either degradation or recycling. In the present study, we characterized the activity of Tsg101 and major players of the endosomal system during physiological cardiac hypertrophy. We observed that levels of Tsg101 were highly increased in hearts of exercise-trained mice (Fig. 6).

Likewise, expression of mediators of physiological cardiac hypertrophy are dysregulated in response to physiological stimuli. C/EBPβ, an inhibitor of Akt signaling, was downregulated in swim exercised mice (61). Yang et al. identified that miR-223 levels were upregulated in hearts of treadmill-trained ice that correlated with increase in IGF-1R protein levels, decrease in C/EBPβ expression and increased phosphorylation of Akt (219). Also, Care et al. observed that suppression of miR-133 was associated with physiological heart growth (220).

As to how exercise regulates Tsg101 expression, research has shown that both serum and cardiac IGF-1 levels increase in response to exercise (52, 53). Continual ligand stimulation of receptors may lead to receptor sensitization. Hence receptors are internalized in order to dissociate

137 from the ligand and are degraded or recycling back to the plasma membrane (64). Studies had indicated that internalization and recycling of the IGF-1R is critical for sustained phosphorylation of Akt (84). Interestingly, exercise did not affect the mRNA levels of all endosomal associated genes, including Tsg101. Thus, modification of expression of these endosome-associated genes during exercise is at the post-translational level. Hence, internalization, recycling and degradative pathways are crucial to the activation of Akt and development of physiological cardiac hypertrophy. Tsg101 represents the ideal protein that links all these endosomal activities. As discussed earlier, Tsg101 plays an important role in determining recycling and degradation of

EGFR. Further, Tsg101 has been shown to be interact with Tal (Tsg101-associated ligase) that regulates receptor endocytosis (165). In our study, levels of Rab5a, Rab7 and Rab11a were enhanced, signifying that receptor internalization (endocytosis), degradation and recycling were activated in mouse exercised hearts. Considering that Tsg101 may contribute to a majority of endosomal processes, it is not surprising to observe a remarkable increase in Tsg101 levels in the heart during exercise.

IV.2.B Tsg101 promotes endosomal recycling of IGF-1R via ERC

It is well established that IGF-1 and its receptor, IGF-1R, are pivotal to the development of cardiac physiological hypertrophy (55-57). To provide balance between activation and inactivation of IGF-1/IGF-1R signaling, IGF-1R is constitutively internalized into the cell to be recycled or degraded (64). Once internalized, the endosomal system regulates whether IGF-1R is degraded or recycled back to the plasma membrane. In spite of its importance to IGF-1/IGF-1R signaling and signal attenuation, the role of the endosomal system in physiological hypertrophy has never been studied thus far.

138

There are two major pathways that regulate recycling of membrane receptors back to the plasma membrane. Receptors may undergo fast recycling in a Rab4a-dependent manner. Research has shown that the majority of membrane receptors are recycled back to the plasma membrane through the endosomal recycling compartment (ERC), which is located at the centrosome or microtubule organizing centers of the cell and regulated by the Rab GTPase Rab11 (81, 82). Rab11 activity is supported by its effector protein FIP3, which provides structural stability to the ERC.

Studies have been conducted to demonstrate the importance of FIP3 to the ERC. Horgan et al. observed that ERC marker proteins Rab-coupling protein (RCP), Rab11, FIP4, Receptor Mediated

Endocytosis-1 (RME-1) and transferrin receptor (TfnR) were not found in the pericentrosomal regions of the cell after knockdown of FIP3 in A431 cells. However, knockdown of FIP3 did not affect the protein levels of these ERC markers, suggesting that FIP3 affected the localization of these markers at the ERC. Furthermore, expression of a FIP3 mutant (Rab11-FIP3 I738E) that cannot bind Rab11, resulted in the localization of the FIP3 mutant and the ERC markers in cytosolic spaces (81). In another study by the same group, FIP3 interacted with Rab11 and dynein light intermediate chain 1 (DLIC-1) in a complex that drives microtubule-based transport.

Overexpression of FIP3 in A431 cells promotes interaction of FIP3 with DLIC-1 and localization of the dynein motor complex at pericentrosomal regions of the cell. Expression of FIP3 mutant

(FIP3 I738E) diminished binding of FIP3 with DLIC-1 and reduced the location of ERC protein

TfnR at the pericentrosomal locations of the cell (221).

Furthermore, the role of FIP3 in the endosomal trafficking of Rho-family GTPases (Rac1) via the ERC has been investigated. Rho GTPases utilizes the ERC machinery to control cytoskeleton remodeling. Rac1 is localized at Rab11-positive endosomes that situated at pericentrosomal spaces in the cell. Knockdown of FIP3 by siRNA damaged the structural integrity

139 of the ERC and fragmented Rac1 into small vesicles that were dispersed in the cytoplasm of human

T lymphocyte Jurkat cells. Considering the importance of Rac1-mediated cytoskeletom remodeling to T-cell immunological synapse, knockdown of FIP3 in Jurkat cells abrogated T-cell activation and cytokine production (222).

Crucially, previous studies have shown that IGF-1R was bound to Rab11 and TfnR, indicating that IGF-1R is recycled through the ERC (84). In the present study, Tsg101 was found to be bound to FIP3 and IGF-1R (Fig. 17), suggesting that Tsg101 was recruited to the ERC (Fig.

47). This dissertation, for the first time, identifies Tsg101 as a novel modulator of the ERC that contributes to the endosomal recycling of IGF-1R, through interaction with FIP3.

IV.2.C Tsg101 enhances physiological cardiac growth and cardiac contractility

Physiological cardiac hypertrophy is characterized by enlargement of the heart size and mass without interstitial fibrosis. Cardiac contractile function is either normal or enhanced in models of physiological hypertrophy. Overexpression of IGF-1R, the critical factor in the development of physiological hypertrophy, specifically in the heart, enhanced cardiac function that was sustained into old age (56). Likewise, our transgenic mouse model with heart-specific elevation of Tsg101 exhibited physiological heart remodeling with enhanced cardiac function (Fig. 9, Table 9), which was sustained to 12 months of age (Table 10). Research in animal models have elucidated the mechanisms behind IGF-1R/Akt-mediated physiological growth and improvement in cardiac contractile function.

Akt promotes physiological growth through inhibition of forkhead box transcription factor

(FOXO) and Glycogen synthase kinase 3β (GSK3β) pathway and activation of the mTOR pathway. Activation of Akt in the heart promotes cardiomyocyte growth through inhibition of

140

FOXO signaling pathways. Overexpression of FOXO3a prevented growth of rat ventricular myocytes treated with IGF. Conversely, overexpression of constitutively active Akt in myocytes inhibited the FOXO3a pathway and enhanced size of cells (223). Inhibition of FOXO translocation to the nucleus is crucial to myocyte growth because FOXO has been demonstrated to enhance atrophy in skeletal muscles through transcription of “atrogenes” such as MAFbx (223-225). More so, Akt has been shown to promote protein synthesis by inhibiting GSK3β. GSK3β has been demonstrated to inhibit protein synthesis by blocking the activity of the eukaryotic translation initiation factor 2Bε (eIF2Bε). As such, overexpression of GSK3β resulted in blockade of postnatal hypertrophy in mouse hearts, which led to heart failure (226). Akt may also promote growth of cardiomyocytes by activating the mTOR pathway. mTOR is a classical growth and survival pathway across various organ tissues. Akt inhibits tuberous sclerosis complex 1 (TSC1) and TSC2, which activates RAS homologue enriched in brain (RHEB), in turn activates mTOR. Inhibition of mTOR pathway with rapamycin attenuated cardiac hypertrophy induced by overexpression of

Akt1 in mouse hearts (227).

In terms of cardiac function enhancement in models of physiological cardiac hypertrophy, some studies have linked enhanced Akt activation to changes in calcium handling mediators.

Research has shown that Akt may increase cardiac contractility by enhancing calcium influx into the L-type calcium channels (LTCC), increasing expression of SERCA2a and by promoting phosphorylation of phospholamban (PLN). An influx of calcium through the LTCC promotes the release of calcium from the endoplasmic reticulum through the ryanodine receptors (RyR) into intracellular spaces for contraction. The cytosolic calcium is then taken up into the sarcoendoplasmic reticulum via SERCA2a, which is inhibited by PLN. Akt promotes LTCC activity by phosphorylating pore-forming channel subunit Cavβ2. Phosphorylation of Cavβ2

141 promotes stability of Cavα1, which regulates protein degradation of LTCC. As such LTCC protein is stabilized to allow entry of calcium into intracellular spaces (228). Studies in rat cardiomyocytes revealed that Akt regulated SERCA2a levels. Treatment of myocytes with IGF-1 in myocytes increased Akt phosphorylation and SERCA2a protein levels and enhanced contractility of cells.

Expression of a dominant negative Akt abrogated increase in SERCA2a levels in myocytes after

IGF-1 treatment (229). Akt may also affect SERCA2a levels through phosphorylation of PLN. Akt may interact and phosphorylate PLN at Thr17. Hence knockdown of Akt reduced phosphorylation of PLN and diminished calcium uptake by SERCA2a (230).

Likewise, Tsg101-TG showed enhanced activation of the IGF-1R/Akt signaling (Figure 13).

Elevation of Tsg101 in cardiomyocytes mimicked the effects of in vivo overexpression of Tsg101 in mouse hearts (Fig. 15). Of relevance, levels of SERCA2a was enhanced in Tsg101-TG (Fig.12), suggesting that Tsg101-mediated physiological growth and enhancement of cardiac function performance is dependent of IGF-1R/Akt pathway.

IV.2.D Tsg101 stabilizes FIP3 and IGF-1R protein levels

Mechanistically, we identified that Tsg101 interacted with FIP3 in the heart, further confirming that Tsg101 is recruited to endosomal recycling compartments (ERC), providing stability to FIP3 and the ERC complex (Fig. 17). Supportively, protein levels of ERC members

(Rab11a and FIP3) were augmented in Tsg101 transgenic hearts (Fig. 13), whereas levels of

Rab11a and FIP3 were reduced in Tsg101-knockdown hearts (Fig. 24). In addition, Tsg101 may also provide structural stability to the IGF-1R, as we observed an increase of total IGF-1R levels in our Tsg101-overexpressing hearts (Fig. 17), whereas knockdown of Tsg101 decreased total levels of IGF-1R (Fig. 24).

142

The ability of Tsg101 to stabilize protein levels of receptors and membrane proteins have been shown previously. Ismaili et al. showed that Tsg101 stabilized the unliganded form of the glucocorticoid receptor. The authors revealed that the expression of the non-phosphorylated form the GR (S203A/S211A) increased binding of Tsg101 with GR in HeLa cells. In the absence of ligand, overexpression of Tsg101 promoted protein levels of the non-phosphorylated GR.

Conversely, knockdown of Tsg101 decreased levels of non-phosphorylated GR in the cells that were not treated with ligand. The use of MG132 showed the levels of non-phosphorylated GR were restored in Tsg101-depleted cells, suggesting that Tsg101 prevented the proteasomal degradation of GR through its interaction (231).

In the same vein, Tsg101 may regulate androgen receptor-mediated transcription through interaction with Apoptosis-antagonizing transcription factor (AATF). AATF had been demonstrated to activate steroid-receptor-mediated transactivation such as the androgen receptor.

Tsg101 act a co-activator of androgen receptor-mediated transcription with AATF though its ubiquitination function. Tsg101 promotes monoubiquitination of the androgen receptor, which acts as a signal for transactivation of the androgen receptor. The expression of dominant-negative ubiquitin replicated the effects of Tsg101 on androgen receptor and blocked Tsg101-mediated effects on transcactivation, indicating that Tsg101 effects are due to monoubiquitination (232).

More so, Tsg101 blocks the degradation of MDM2 through binding with UEV domain. This interaction blocks binding of ubiquitin to MDM2, and prevents targeting of MDM2 to the proteasome (178).

In this study, we did not observe changes in expression of FIP3 and IGF-1R mRNA, indicating that the increase in FIP3 and IGF-1R levels occurs post-transcriptionally. Like the

143 glucocorticoid receptor, Tsg101 prevented the proteasomal degradation of FIP3. Thus, Tsg101 may interact and stabilize FIP3 and IGF-1R levels and prevent degradation of these targets.

IV.2.E Tsg101 attenuates pathological cardiac remodeling

More significantly, Tsg101 is cardio-protective against pathological cardiac hypertrophy, similar to other activators of physiological cardiac hypertrophy. For example, thyroid hormone

(T3), an initiator of physiological cardiac hypertrophy, could mitigate cardiac dysfunction triggered by aortic banding (233). Overexpression of CITED4, which is upregulated when C/EBPβ are reduced, protected mouse hearts from myocardial infarction-induced pathological remodeling

(63). Likewise, overexpression of Tsg101 alleviated both cardiac fibrosis and cardiac contractile impairment upon TAC surgery (Fig. 33, Table 12). Although we did not perform further experiments to delineate the mechanism underlying the actions of Tsg101 in pathological hypertrophy, we speculate that activation of IGF-1R/Akt signaling may contribute to this phenomenon. As a matter of fact, IGF-1R/Akt signaling pathway has been classified as cardioprotective, with numerous studies reporting the beneficial effects against diabetic cardiomyopathy and myocardial infarction (234-236).

Firstly, cardiac-specific overexpression of IGF-IR protected mice from detrimental effects of diabetic cardiomyopathy. Diabetic cardiomyopathy was induced by streptozotocin (STZ) injection and resulted in increased cardiomyocyte size, collagen deposition, increased expression of pro-fibrotic markers and diastolic dysfunction. Elevation of IGF-1R in mouse hearts promoted

Akt phosphorylation and attenuated cardiac growth and fibrotic gene expression and restored cardiac contractile function (237).

144

Like IGF-1R, Akt has been demonstrated to have cardio-protective effects against various conditions that enhance pathological remodeling. Elevation of the constitutively active Akt mutant

(myr-Akt) in rat cardiomyocytes prevented ischemia-reperfusion-induced cell apoptosis and infarct size and improved cardiac function. The protective effects were linked to increased translocation of Glut4 and glucose uptake into cardiomyocytes during ischemia reperfusion injury

(238). PI3K activation is crucial for Akt phosphorylation and the role of PI3K in cardiac hypertrophy has been established. PI3K activation is regulated by apoptosis regulator through modulating IAP expression (ARIA), a transmembrane protein that upregulates levels of phosphatase and tensin homolog (PTEN), which inhibits PI3K activation. As such, overexpression of ARIA in doxorubicin (DOX)-treated H9c2 cardiac cells promoted cell apoptosis that was associated with decreased activation of PI3K and Akt phosphorylation. On the other hand, mice with cardiac-specific knockdown of ARIA showed enhanced Akt phosphorylation and diminished cardiac fibrosis and cardiomyocyte death when challenged with DOX (239). These studies suggest that the Tsg101-triggered protection against pathological cardiac hypertrophy may be attributed to the IGF-1R/Akt pathway.

IV.2.E Future Directions and Limitations

There are a few limitations to this study. First, Tsg101-mediated recycling through the endosomal system may not be specific for IGF-1R. In this regard, we determined membrane levels of other receptors [i.e., EGFR, insulin receptor (IR) and β-AR] in Tsg101-overexpressing cardiomyocytes, and observed that elevation of Tsg101 in the heart did not promote increased membrane presence of EGFR, IR or β-AR. There was however an effect of knockdown of Tsg101 on recycling of EGFR and IR. As mentioned earlier, knockdown of Tsg101 inhibited recycling of

145

EGFR and endosomes containing EGFR were targeted to lysosomes for degradation (203). We observed in our study that knockdown of Tsg101 reduced total and plasma membrane levels of

EGFR. Nonetheless, we cannot exclude other unidentified membrane receptors that may be affected by Tsg101.

Second, this study did not decipher the possible role of Tsg101 in promoting endocytosis and late endosome/ lysosome trafficking. Notwithstanding, we observed that endocytosis, mediated by Rab5a and degradation, regulated by Rab7 were enhanced in both treadmill-trained and Tsg101-TG hearts. This indicates that activation of endocytosis and degradative pathway may be involved in the development of physiological cardiac growth. Indeed, endocytosis is essential for the sustenance of IGF-1R/Akt signaling (84). Furthermore, stimulation of lysosome-mediated degradation could provide new amino acids as building blocks for protein synthesis to assist the process of physiological heart growth (4). Considering the role of Tsg101 in endosome biogenesis, it is also plausible that increasing number of endosomes in Tsg101-TG provides compensatory effect on other endosome-associated proteins and processes. However, investigation into enhancement of endocytosis and degradative pathways in Tsg101-TG hearts may fall outside the scope and intent of this dissertation.

Lastly, we cannot exclude the possible effects of overexpression and knockdown of Tsg101 on other cellular processes, particularly the ESCRT machinery. Tsg101 is a key member of the

ESCRT machinery and is important for the biogenesis and maturation of MVB/late endosome

(197). It is highly possible that overexpression of Tsg101 may enhance various ESCRT processes.

Besides endosomal sorting of membrane cargo, the ESCRT machinery has been implicated in cell cycle control, transcriptional regulation, cell polarity, control of RNA polymerase and gene

146 silencing (86). For the scope of this manuscript, we focused on the specific role of Tsg101 in endosome-mediated receptor recycling with both loss- and gain-of-function approaches.

Figure 47. Diagram showing structural components and major players involved in the Tsg101- mediated endosomal recycling of IGF-1R.

Section 3: Role of Tsg101 on Parkin-mediated mitophagy in endotoxin-induced cardiac dysfunction

IV.3.A Autophagy/Mitophagy is activated in septic hearts

Accumulating evidence indicates that autophagy and mitophagy is activated in the heart in various models of sepsis. Hsieh et al. observed gradual increase in levels of LC3 up to 24 h in the heart after CLP (150). Similarly, Takahashi et al. observed an increase in LC3-II expression in hearts of mice subjected CLP after 6 h but LC3-II levels returned to basal levels at 24 h (240). In addition, a recent study by Zhang et al. showed that LPS treatment induced the formation of autophagosomes in the myocardium. Treatment of mice with LPS, in combination with melatonin,

147 an activator of autophagy, increased the number of autophagosomes in endotoxemic hearts and abrogated endotoxin-induced cardiac dysfunction and apoptosis (151). As such, is well accepted that general activation of autophagy in the heart could attenuate sepsis-induced cardiac dysfunction

(149-152).

This initial activation of mitophagy may act as an adaptive and compensatory response to mitochondrial and cardiac dysfunction triggered by endotoxin. Although endotoxin could promote mitophagy and autophagic flux, this increase may not be enough to abrogate the effects of LPS- induced cardiac damage. Therefore, in the current study, elevation of Tsg101 in the heart may serve to augment mitophagy in the early stages of endotoxemia, and may further provide continual activation of mitophagy and attenuation of endotoxin-induced cardiac dysfunction in later stages, leading to better survival outcomes (Fig. 48).

These observation are supported by a recent study by Sun et al. demonstrated that overexpression of Beclin-1, an important autophagy initiator, alleviated LPS-induced inflammation and cardiac dysfunction (146). These authors confirmed that the protective effects of overexpression of Beclin-1 in the endotoxemic heart were due to activation of the Parkin/PINK1 pathway. These previous observations consistently suggest that autophagy-mediated cardioprotection against sepsis may largely be due to removal of damaged and dysfunctional mitochondria. Similarly, beneficial effects induced by overexpression of Tsg101 in endotoxemic hearts were associated with the upregulation of Parkin/PINK1 (Fig. 39).

IV.3.B Tsg101 enhances Parkin activity in endotoxemic hearts

Parkin was originally found to be mutated in hereditary Parkinson’s disease patients. Parkin was then found to be an E3 ubiquitin ligase that ubiquitinates and targets protein aggregates for

148 degradation (136). Studies showed that the mutations in Parkin inhibited solubility of Parkin and diminished degradation of protein aggregates (136). The importance of Parkin to mitochondrial dynamics is underlined by studies showing that depletion of Parkin lead to abnormal mitochondrial morphology with swollen cristae (137). This study identifies Tsg101 as a positive regulator of

Parkin, given that Parkin levels are enhanced in Tsg101-TG hearts at basal conditions (Fig. 39).

Other regulators of Parkin include Small ubiquitin-related modifier 1 (SUMO-1), Ataxin-3 and BAG5 (bcl-2-associated athanogene 5). Um et al. demonstrated the Parkin is able to bind to

SUMO-1, both in vitro and in vivo. This association of SUMO-1 increases the self- autoubiquitination capacity of Parkin and enables the translocation of Parkin to the nucleus. Little is known about the nuclear translocation of Parkin but it is possible that the nucleus contains substrates needed to be targeted for degradation by Parkin or may play a role in transcriptional regulation (240). Interestingly, overexpression of SUMO-1 did not increase protein levels of

Parkin, indicating that sumoylation of Parkin affects localization of Parkin.

BAG5 has been demonstrated to interact with Parkin and Hsp70 in a complex, where BAG5 inhibits the chaperone function of Hsp70. BAG5 may also interfere with ubiquitination of protein aggregates such as synphilin when bound to Parkin. Hence, BAG5 has been implicated to play a role in neuronal cell death through inhibition of ligase activity of Parkin. Interestingly, BAG5 levels were increased in an in vivo model of Parkinson’s disease, indicating that BAG5 may play an important role in attenuating the protective effects of Parkin in neurodegenerative diseases

(241). Moreover, BAG5 may inhibit Parkin through binding to carboxyl terminus of Hsp70- interacting protein (CHIP), a co-chaperone with heat shock protein (Hsp) 70 in a complex with

Parkin. In addition, Kalia et al. showed that, besides its chaperone function, CHIP possesses E3 ubiquitin ligase activity and ubiquitinates a-synuclein (a-syn) proteins before oligomerization

149

(242). Another negative regulator of Parkin is Ataxin-3, a polyglutamine repeat protein that deubiquitinates Parkin. Ataxin-3 has ubiquitin-interacting motifs (UIM) that interacts with the Ubl domain of parkin, Deubuiquitination of Parkin enhances the autophagic removal of Parkin and reduces its protein levels in basal conditions. This action of Ataxin-3 has been implicated in the pathology of Machado-Joseph disease (MJD), a neurodegenerative disease that has symptoms similar to Parkinson’s disease (243).

These studies suggest a possible mechanism by which Tsg101 enhances Parkin activity in the heart. Parkin is an E3 ubiquitin ligase that has the capability to self-ubiquitinate and ubiquitinate other proteins (137). Interestingly, it has shown that phosphorylation of ubiquitin residues in Parkin by PINK1 activates Parkin at the outer membrane of the mitochondria (244).

As discussed earlier, Tsg101 has a UEV domain has the ability to bind ubiquitin. Tsg101 uses its

UEV domain to enhance ubiquitination of HIV Gag proteins that facilitates the assembly and release of HIV from cells (201, 202). Hence, Tsg101 may interact with Parkin and enhance ubiquitination of Parkin.

Additionally, Tsg101 may act as a vehicle to shuttle Parkin to the mitochondria where Parkin may attract autophagy mediators (LC3) to transfer damaged mitochondria to the lysosome (Fig.

7). Reports have indicated that PINK1 recruits Parkin to the mitochondrial and phosphorylates

Parkin at the outer membrane of the mitochondria (138). There is however a gap in our knowledge on the mechanism or signal that shuttles Parkin to the mitochondria. In our study, Tsg101 was bound to Parkin in the cytosol in basal conditions (Fig. 45). However, both proteins were bound at the mitochondria after treatment of neonatal rat myocytes with LPS, suggesting that Tsg101 may play a role in the translocation of Parkin (Fig. 48). Although, PINK1 levels were increased at basal conditions, we did not see any evidence of interaction between Tsg101 and PINK1 (Fig. 46).

150

It is plausible that Tsg101 may have an indirect effect on PINK1 through its interaction with

Parkin.

IV.3.C Tsg101 preserves mitochondrial structural integrity

Currently, mitochondrial dysfunction is a hallmark of septic cardiomyopathy (142-144).

Besides the generation/biogenesis of new mitochondria, elimination of damaged mitochondria has been linked with recovery of cardiac function during sepsis in animal models (146, 147). It is well- known that each cardiomyocyte has a large volume of mitochondria and mitochondria are essential for ATP generation. However, there are no therapies that are targeted to eliminate mitochondrial damage in septic patients. In fact, numerous studies have showed that defective mitophagy largely contributes to increased inflammatory response in various organs (245-246). For example, injured mitochondria release various damage-associated molecular patterns (DAMPs, i.e, mtDNA, mtROS) that act to augment inflammation in cells (245, 246). Hence, targeting damaged mitochondria with mitophagy may be critical for eliminating the source of the inflammatory cytokine storm in septic hearts. Indeed, we observed in our study that enhancement of mitophagy by overexpression of Tsg101 diminished the release of mtDNA and mtROS and consequently, reduced inflammatory response in endotoxemic hearts (Fig. 39, Fig. 40).

Another aspect of mitochondrial dynamics during septic cardiomyopathy is mitochondrial fission and fusion which plays an important role in mitochondrial morphology, biogenesis and mitophagy. Mitochondrial fusion, which is the merging of mitochondria, acts to replenish damaged mitochondria and spread ATP across the cell. On the other hand, mitochondrial fission is the process of breaking down damaged mitochondrial for easy removal and degradation. Thus, mitochondrial fission promotes activation of mitophagy whereas fusion inhibits mitophagy.

151

Mitochondrial fusion is controlled by Mitofusins (Mfn1 and Mfn2) and optic atrophy 1 (OPA1) while mitochondrial fission is primarily regulated by dynamin-related protein 1 (Drp1). Hence, fusion and fission affects activation of mitophagy in cells undergoing stress (247). Indeed, mitochondrial fission and fusion have been characterized in hearts of septic animals. Drp1 levels were increased whereas OPA1 were decreased in hearts of mice subjected to CLP surgery, suggesting that there was in imbalance in cardiac mitochondrial fusion and fission (248). Preau et al. observed an increased activation of Drp1 after LPS injection in mice (249). Another study observed that OPA1 levels were increased mildly after injection of low dose LPS in mice (153).

These results, although conflicting, indicates that mitochondrial fusion and fission is activated or inhibited in septic hearts, and mitochondrial dynamics play an important role in septic cardiomyopathy.

Mitochondrial biogenesis is the replacement of mitochondria that has been degraded by mitophagy. Mitochondrial biogenesis is controlled by PGC-1α and β [PPAR (peroxisome proliferator-activated receptor)-γ coactivator-1 α and β] which activate nuclear receptor, PPAR.

Interestingly, in various animal sepsis model, there is decreased expression of PGC-1 and PPAR, signifying the importance of mitochondrial health to recovery from sepsis. These studies also showed that decreased expression of mitochondrial biogenesis mediators coincided with mitochondrial damage and cardiac contractile dysfunction (248, 250-252). Overexpression of

PGC-1β in the heart rescued cardiac function and reduced levels of reactive oxygen species (ROS) in LPS-treated mice (253). Furthermore, the use of rosiglitazone, a PPAR agonist, protected mice from cardiac dysfunction and mortality after injection of LPS. The authors then showed that cardiac-specific overexpression of PPARγ replicated the protective effects of rosiglitazone in septic mice (144).

152

IV.3.D Tsg101 inhibits endotoxin-induced inflammation, cardiac dysfunction and mortality

Sepsis is characterized by a severe cytokine storm where high amounts of pro-inflammatory cytokines can be detected in circulation (97). Previous studies had attributed the sepsis-caused multiple organ failure to the prolonged cytokine storm (97). Research had also identified that the circulating myocardial depressive factor that caused cardiac contractile dysfunction in sepsis patients were the pro-inflammatory cytokines (88, 89). However clinical trials using anti- inflammatory agents (i.e., TNF inhibitors) have largely been unsuccessful in improving the survival rate of sepsis patients (254). Furthermore, therapeutic approaches for septic shock patients provide supportive, rather that tackle the underlying mechanism for organ dysfunction in patients

(103, 110). Currently, sepsis-triggered mitochondrial damage has come to the forefront as the major contributor to multiple organ dysfunction.

Mitochondria generate energy for the cell in the form of ATP through respiration and citric acid cycle. In the heart, ATP is required for contraction and relaxation through processes such as binding of myosin heads to actin and ATP-dependent delivery of calcium to sarcoplasmic reticulum. Beside energy generation, mitochondria is a source of normal physiological levels of reactive oxygen species (ROS) (127). In septic conditions, where oxygen delivery is diminished, cellular oxygen is reduced to hydrogen peroxide (H2O2), which enhances levels of ROS in the cell

(131). Furthermore, mitochondria play a major role in cellular calcium homeostasis. As such, sepsis-induced mitochondrial damage leads to cardiac bioenergetic failure and oxidative stress that impact cardiac contractility and death. Given that the use of anti-inflammatory strategies have not yielded beneficial outcomes, at least clinically, targeting the mitochondrial dysfunction in sepsis

153 needs to be explored. Efficient removal of damaged mitochondrial may be essential for recovery from septic cardiomyopathy.

In the current study, overexpression of Tsg101 enhanced mitophagy and diminished mitochondrial structural damage (Fig. 39, Fig. 40). Enhancement of mitophagy in endotoxemic

Tsg101-TG hearts improved animal survival and cardiac function (Fig. 37). Moreover, enhancement of autophagy reduced the production of pro-inflammatory cytokines (Fig. 38). On the other hand, depletion of Tsg101 in mouse hearts inhibited activation of mitophagy that had detrimental effects on mouse mortality, cardiac dysfunction, and inflammation (Fig. 41, Fig. 42).

IV.3.E Future Directions and Limitations

The use of endotoxemia as a model for sepsis comes with a few disadvantages. The injection of endotoxin is technically easy to perform and it is highly reproducible. Endotoxemia also elicits elevated production of pro-inflammatory cytokines (255). As such, many researchers have argued that the pathophysiology of the LPS model is solely based on the effects of cytokines on organ function. Models such as cecal ligation and puncture surgery mimic the characteristic features of human sepsis and thus represent the most clinically relevant model to study human sepsis in animal model (255). It will be of significant interest to investigate whether Tsg101 plays any role in CLP- induced septic cardiomyopathy. Notwithstanding, evidence suggests endotoxin contributes hugely to mitochondrial dysfunction during sepsis.

Besides elimination of damaged mitochondria, reports have shown that activation of autophagy may protect hearts from endotoxin challenge through elimination of inflammasomes

(256). Inflammasomes are cytosolic complexes consisting of nucleotide-binding oligomerization domain–like receptor with pyrin domain (NLRP)-3, caspase-1 and apoptosis-associated speck-like

154 protein containing a caspase recruitment domain (ASC). The activation of the inflammasome complex by endotoxin enhances caspase-1 activity and triggers cleavage of precursor forms of IL-

1β and IL-18 into mature active cytokines that are secreted as pro-inflammatory cytokines.

Interestingly, inflammasomes may also be receptive to mitochondrial DAMPs to promote production of IL-1β and IL-18 (257). Regardless, investigation into the role of Tsg101 on the inflammasome activation in endotoxemic hearts falls outside the scope of this study, but we cannot eliminate the possibility that Tsg101-mediated protection may partially be ascribed to increased elimination of inflammasome complexes.

Figure 48. Scheme depicting Tsg101-mediated protection against endotoxin-induced cardiac dysfunction.

Section 4: Conclusion of dissertation In conclusion, this dissertion for the first time elucidates a previously unrecognized role of

Tsg101 in positively regulating physiological cardiac hypertrophy. Specifically, elevation of

155 cardiac Tsg101 is able to enhance FIP3 activity at endosomal recycling compartments, thereby stabilizing and driving recycling of IGF-1R to promote activation of the Akt pathway, leading to physiological cardiac growth. This study may provide a better understanding of the role of endosomal recycling in physiological cardiac remodeling and therefore, provide new strategies for the treatment of heart disease. More so, Tsg101 is defined as a new cardioprotective mediator to fight against endotoxemia. Elevation of cardiac Tsg101 is able to augment mitophagy in mouse hearts after LPS challenge, leading to reduced inflammatory response, improved cardiac function and animal survival. This study may provide new strategies for the treatment of endotoxemia and sepsis.

156

References

1. Bernardo BC, Weeks KL, Pretorius L, Mcmullen JR. Molecular distinction between

physiological and pathological cardiac hypertrophy: Experimental findings and therapeutic

strategies. Pharmacology & Therapeutics. 2010;128:191–227.

2. Heineke J, Molkentin JD. Regulation of cardiac hypertrophy by intracellular signalling

pathways. Nature Reviews Molecular Cell Biology. 2006;7:589–600.

3. Maillet M, Berlo JHV, Molkentin JD. Molecular basis of physiological heart growth:

fundamental concepts and new players. Nature Reviews Molecular Cell Biology.

2012;14:38–48.

4. Dorn GW. The Fuzzy Logic of Physiological Cardiac Hypertrophy. Hypertension.

2007;49:962–970.

5. Prognostic Implications of Echocardiographically Determined Left Ventricular Mass in the

Framingham Heart Study. New England Journal of Medicine. 1990;323:1706–1707.

6. Lloyd-Jones D, Adams R, Carnethon M, Simone GD, Ferguson TB, Flegal K, Ford E, Furie

K, Go A, Greenlund K, Haase N, Hailpern S, Ho M, Howard V, Kissela B, Kittner S,

Lackland D, Lisabeth L, Marelli A, Mcdermott M, Meigs J, Mozaffarian D, Nichol G,

Odonnell C, Roger V, Rosamond W, Sacco R, Sorlie P, Stafford R, Steinberger J, Thom T,

Wasserthiel-Smoller S, Wong N, Wylie-Rosett J, Hong Y. Heart Disease and Stroke

Statistics—2009 Update. Circulation. 2009;119:480–486.

157

7. Thom T, Haase N, Rosamond W, Howard VJ, Rumsfeld J, Manolio T, Zheng Z-J, Flegal K,

O’Donnell C, Kittner S, Lloyd-Jones D, Goff DC, Hong Y, Adams R, Friday G, Furie K,

Gorelick P, Kissela B, Marler J, Meigs J, Roger V, Sidney S, Sorlie P, Steinberger J,

Wasserthiel-Smoller S, Wilson M, Wolf P. Heart Disease and Stroke Statistics—2006

Update. Circulation. 2006;113.

8. Barclay S, Momen N, Case-Upton S, Kuhn I, Smith E. End-of-life care conversations with

heart failure patients: a systematic literature review and narrative synthesis. British Journal

of General Practice. 2011;61.

9. McMurray JJ, Pfeffer MA. Heart failure. Lancet. 2005;365:1877–1889.

10. Bleumink GS, Knetsch AM, Sturkenboom MC, Straus SM, Hofman A, Deckers JW,

Witteman JC, Stricker BH. Quantifying the heart failure epidemic: prevalence, incidence rate,

lifetime risk and prognosis of heart failure The Rotterdam Study. Eur Heart J. 2004;25:1614-

1619.

11. Zannad F, Briancon S, Juilliere Y, Mertes P-M, Villemot J-P, Alla F, Virion J-M. Incidence,

clinical and etiologic features, and outcomes of advanced chronic heart failure: the EPICAL

study. Journal of the American College of Cardiology. 1999;33:734–742.

12. Blinderman CD, Homel P, Billings JA, Portenoy RK, Tennstedt SL. Symptom Distress and

Quality of Life in Patients with Advanced Congestive Heart Failure. Journal of Pain and

Symptom Management. 2008;35:594–603.

13. Maron BJ. Sudden death in young athletes. N Engl J Med. 2003;349:1064-1075.

158

14. Maron BJ, Pelliccia A. The Heart of Trained Athletes. Circulation. 2006;114:1633–1644.

15. Schannwell CM, Zimmermann T, Schneppenheim M, Plehn G, Marx R, Strauer BE. Left

Ventricular Hypertrophy and Diastolic Dysfunction in Healthy Pregnant

Women. Cardiology. 2002;97:73–78.

16. Hew KW, Keller KA. Postnatal anatomical and functional development of the heart: A

species comparison. Birth Defects Research Part B: Developmental and Reproductive

Toxicology. 2003;68:309–320.

17. Janz KF, Dawson JD, Mahoney LT. Predicting Heart Growth During Puberty: The Muscatine

Study. Pediatrics. 2000;105:E63

18. Pluim BM, Zwinderman AH, Laarse AVD, Wall EEVD. The Athlete’s Heart. Circulation.

2000;101:336–344.

19. Eckhouse SR, Spinale FG. Changes in the Myocardial Interstitium and Contribution to the

Progression of Heart Failure. Heart Failure Clinics. 2012;8:7–20.

20. Iemitsu M, Miyauchi T, Maeda S, Sakai S, Kobayashi T, Fujii N, Miyazaki H, Matsuda M,

Yamaguchi I. Physiological and pathological cardiac hypertrophy induce different molecular

phenotypes in the rat. American Journal of Physiology-Regulatory, Integrative and

Comparative Physiology. 2001;281: R2029-2036.

21. Wende AR, Oneill BT, Bugger H, Riehle C, Tuinei J, Buchanan J, Tsushima K, Wang L,

Caro P, Guo A, Sloan C, Kim BJ, Wang X, Pereira RO, Mccrory MA, Nye BG, Benavides

GA, Darley-Usmar VM, Shioi T, Weimer BC, Abel ED. Enhanced Cardiac Akt/Protein

159

Kinase B Signaling Contributes to Pathological Cardiac Hypertrophy in Part by Impairing

Mitochondrial Function via Transcriptional Repression of Mitochondrion-Targeted Nuclear

Genes. Molecular and Cellular Biology. 2014;35:831–846.

22. Vusse GJVD, Glatz JF, Stam HC, Reneman RS. Fatty acid homeostasis in the normoxic and

ischemic heart. Physiological Reviews. 1992;72:881–940.

23. Allard MF, Schonekess BO, Henning SL, English DR, Lopaschuk GD. Contribution of

oxidative metabolism and glycolysis to ATP production in hypertrophied hearts. American

Journal of Physiology-Heart and Circulatory Physiology. 1994;267: H742-750

24. Christe ME, Rodgers RL. Altered Glucose and Fatty Acid Oxidation in Hearts of the

Spontaneously Hypertensive Rat. Journal of Molecular and Cellular Cardiology.

1994;26:1371–1375.

25. Dávila-Román VG, Vedala G, Herrero P, Fuentes LDL, Rogers JG, Kelly DP, Gropler RJ.

Altered myocardial fatty acid and glucose metabolism in idiopathic dilated

cardiomyopathy. Journal of the American College of Cardiology. 2002;40:271–277.

26. Bilsen MV, Nieuwenhoven FAV, Vusse GJVD. Metabolic remodelling of the failing heart:

beneficial or detrimental? Cardiovascular Research. 2008;81:420–428.

27. Gertz EW, Wisneski JA, Stanley WC, Neese RA. Myocardial substrate utilization during

exercise in humans. Dual carbon-labeled carbohydrate isotope experiments. Journal of

Clinical Investigation. 1988;82:2017–2025.

160

28. Yamazaki T, Komuro I, Yazaki Y. Role of the renin-angiotensin system in cardiac

hypertrophy. The American Journal of Cardiology. 1999;83:53–57.

29. Yayama K. Up-Regulation of Angiotensin II Type 2 Receptor in Rat Thoracic Aorta by

Pressure-Overload. Journal of Pharmacology and Experimental Therapeutics.

2003;308:736–743.

30. Rapacciuolo A, Esposito G, Caron K, Mao L, Thomas SA, Rockman HA. Important role of

endogenous norepinephrine and epinephrine in the development of in vivo pressure-overload

cardiac hypertrophy. Journal of the American College of Cardiology. 2001;38:876–882.

31. Dangelo DD, Sakata Y, Lorenz JN, Boivin GP, Walsh RA, Liggett SB, Dorn GW. Transgenic

G q overexpression induces cardiac contractile failure in mice. Proceedings of the National

Academy of Sciences. 1997;94:8121–8126.

32. Mende U, Kagen A, Cohen A, Aramburu J, Schoen FJ, Neer EJ. Transient cardiac expression

of constitutively active G q leads to hypertrophy and dilated cardiomyopathy by calcineurin-

dependent and independent pathways. Proceedings of the National Academy of Sciences.

1998;95:13893–13898.

33. Akhter SA, Luttrell LM, Rockman HA, Iaccarino G, Lefkowitz RJ, Koch WJ. Targeting the

receptor-Gq interface to inhibit in vivo pressure overload myocardial hypertrophy. Science.

1998;280:574-577.

34. Wettschureck N, Rütten H, Zywietz A, Gehring D, Wilkie TM, Chen J, Chien KR,

Offermanns S. Absence of pressure overload induced myocardial hypertrophy after

161

conditional inactivation of Gαq/Gα11 in cardiomyocytes. Nature Medicine. 2001;7:1236–

1240.

35. Paradis P, Dali-Youcef N, Paradis FW, Thibault G, Nemer M. Overexpression of angiotensin

II type I receptor in cardiomyocytes induces cardiac hypertrophy and

remodeling. Proceedings of the National Academy of Sciences. 2000;97:931–936.

36. Engelhardt S, Hein L, Wiesmann F, Lohse MJ. Progressive hypertrophy and heart failure

in 1-adrenergic receptor transgenic mice. Proceedings of the National Academy of Sciences.

1999;96:7059–7064.

37. Morkin E. Regulation of myosin heavy chain genes in the heart. Circulation. 1993;87:1451–

1460.

38. Stubbe P, Gatz J, Heidemann P, Mühlen A, Hesch R. Thyroxine-Binding Globulin,

Triiodothyronine, Thyroxine and Thyrotropin in Newborn Infants and Children. Hormone

and Metabolic Research. 1978;10:58–61.

39. Belakavadi M, Saunders J, Weisleder N, Raghava PS, Fondell JD. Repression of Cardiac

Phospholamban Gene Expression Is Mediated by Thyroid Hormone Receptor-α1 and

Involves Targeted Covalent Histone Modifications. Endocrinology. 2010;151:2946–2956.

40. Kenessey A, Sullivan EA, Ojamaa K. Nuclear localization of protein kinase C-α induces

thyroid hormone receptor-α1 expression in the cardiomyocyte. American Journal of

Physiology-Heart and Circulatory Physiology. 2006;290: H381-389.

162

41. Kenessey A, Ojamaa K. Thyroid Hormone Stimulates Protein Synthesis in the

Cardiomyocyte by Activating the Akt-mTOR and p70S6KPathways. Journal of Biological

Chemistry. 2006;281:20666–20672.

42. Arsanjani R, Mccarren M, Bahl JJ, Goldman S. Translational potential of thyroid hormone

and its analogs. Journal of Molecular and Cellular Cardiology. 2011;51:506–511.

43. Rainer PP, Kass DA. Old dog, new tricks: novel cardiac targets and stress regulation by

protein kinase G. Cardiovascular Research. 2016;111:154–162.

44. Tamirisa P, Blumer KJ, Muslin AJ. RGS4 Inhibits G-Protein Signaling in

Cardiomyocytes. Circulation. 1999;99:441–447.

45. Rogers JH, Tamirisa P, Kovacs A, Weinheimer C, Courtois M, Blumer KJ, Kelly DP, Muslin

AJ. RGS4 causes increased mortality and reduced cardiac hypertrophy in response to pressure

overload. Journal of Clinical Investigation. 1999;104:567–576.

46. Takimoto E, Koitabashi N, Hsu S, Ketner EA, Zhang M, Nagayama T, Bedja D, Gabrielson

KL, Blanton R, Siderovski DP, Mendelsohn ME, Kass DA. Regulator of G protein signaling

2 mediates cardiac compensation to pressure overload and antihypertrophic effects of PDE5

inhibition in mice. Journal of Clinical Investigation. 2009; 119:408-420.

47. Waard MCD, Haperen RV, Soullié T, Tempel D, Crom RD, Duncker DJ. Beneficial effects

of exercise training after myocardial infarction require full eNOS expression. Journal of

Molecular and Cellular Cardiology. 2010;48:1041–1049.

163

48. Bellomo D, Headrick JP, Silins GU, Paterson CA, Thomas PS, Gartside M, Mould A, Cahill

MM, Tonks ID, Grimmond SM, Townson S, Wells C, Little M, Cummings MC, Hayward

NK, Kay GF. Mice Lacking the Vascular Endothelial Growth Factor-B Gene (Vegfb) Have

Smaller Hearts, Dysfunctional Coronary Vasculature, and Impaired Recovery From Cardiac

Ischemia. Circulation Research. 2000;86: E29-35.

49. Accornero F, Berlo JHV, Benard MJ, Lorenz JN, Carmeliet P, Molkentin JD. Placental

Growth Factor Regulates Cardiac Adaptation and Hypertrophy Through a Paracrine

Mechanism. Circulation Research. 2011;109:272–280.

50. Jager S, Handschin C, St.-Pierre J, Spiegelman BM. AMP-activated protein kinase (AMPK)

action in skeletal muscle via direct phosphorylation of PGC-1 . Proceedings of the National

Academy of Sciences. 2007;104:12017–12022.

51. Narkar VA, Downes M, Yu RT, Embler E, Wang YX, Banayo E, Mihaylova MM, Nelson

MC, Zou Y, Juguilon H, Kang H, Shaw RJ, Evans RM. AMPK and PPARdelta agonists are

exercise mimetics. Cell. 2008;134:405–415.

52. Serneri GGN, Boddi M, Modesti PA, Cecioni I, Coppo M, Padeletti L, Michelucci A, Colella

A, Galanti G. Increased Cardiac Sympathetic Activity and Insulin-Like Growth Factor-I

Formation Are Associated With Physiological Hypertrophy in Athletes. Circulation

Research. 2001;89:977–982.

53. Sutton J, Lazarus L. Growth hormone in exercise: comparison of physiological and

pharmacological stimuli. Journal of Applied Physiology. 1976;41:523–527.

164

54. Baker J, Liu JP, Robertson EJ, Efstratiadis A. Role of insulin-like growth factors in

embryonic and postnatal growth. Cell. 1993;75:73-82.

55. Delaughter MC, Taffet GE, Fiorotto ML, Entman ML, Schwartz RJ. Local insulin-like

growth factor I expression induces physiologic, then pathologic, cardiac hypertrophy in

transgenic mice. The FASEB Journal. 1999;13:1923–1929.

56. Mcmullen JR, Shioi T, Huang W-Y, Zhang L, Tarnavski O, Bisping E, Schinke M, Kong S,

Sherwood MC, Brown J, Riggi L, Kang PM, Izumo S. The Insulin-like Growth Factor 1

Receptor Induces Physiological Heart Growth via the Phosphoinositide 3-Kinase(p110α)

Pathway. Journal of Biological Chemistry. 2003;279:4782–4793.

57. Kim J, Wende AR, Sena S, Theobald HA, Soto J, Sloan C, Wayment BE, Litwin SE,

Holzenberger M, Leroith D, Abel ED. Insulin-Like Growth Factor I Receptor Signaling Is

Required for Exercise-Induced Cardiac Hypertrophy. Molecular Endocrinology.

2008;22:2531–2543.

58. Shioi T, Kang PM, Douglas PS, Hampe J, Yballe CM, Lawitts J, Cantley LC, Izumo S. The

conserved phosphoinositide 3-kinase pathway determines heart size in mice. EMBO J.

2000;19:2537-2548.

59. Mcmullen JR, Shioi T, Zhang L, Tarnavski O, Sherwood MC, Kang PM, Izumo S.

Phosphoinositide 3-kinase(p110 ) plays a critical role for the induction of physiological, but

not pathological, cardiac hypertrophy. Proceedings of the National Academy of Sciences.

2003;100:12355–12360.

165

60. Mora A, Davies AM, Bertrand L, Sharif I, Budas GR, Jovanović S, Mouton V, Kahn CR,

Lucocq JM, Gray GA, Jovanović A, Alessi DR. Deficiency of PDK1 in cardiac muscle results

in heart failure and increased sensitivity to hypoxia. EMBO J. 2003;22:4666-76.

61. DeBosch B, Treskov I, Lupu TS, Weinheimer C, Kovacs A, Courtois M, Muslin AJ. Akt1 is

required for physiological cardiac growth. Circulation. 2006;113:2097-2104.

62. Tsukada J, Yoshida Y, Kominato Y, Auron PE. The CCAAT/enhancer (C/EBP) family of

basic-leucine zipper (bZIP) transcription factors is a multifaceted highly-regulated system for

gene regulation. Cytokine. 2011;54:6–19.

63. Boström P, Mann N, Wu J, Quintero PA, Plovie ER, Panáková D, Gupta RK, Xiao C, Macrae

CA, Rosenzweig A, Spiegelman BM. C/EBPβ Controls Exercise-Induced Cardiac Growth

and Protects against Pathological Cardiac Remodeling. Cell. 2010;143:1072–1083.

64. Watson FL, Heerssen HM, Bhattacharyya A, Klesse L, Lin MZ, Segal RA. Neurotrophins

use the Erk5 pathway to mediate a retrograde survival response. Nature Neuroscience.

2002;5:1017–1017.

65. García-Regalado A, Guzmán-Hernández ML, Ramírez-Rangel I, Robles-Molina E, Balla T,

Vazquez-Prado J, Reyes-Cruz G. G Protein-coupled Receptor-promoted Trafficking of

Gβ1γ2 Leads to AKT Activation at Endosomes via a Mechanism Mediated by Gβ1γ2-Rab11a

Interaction. Mol Biol Cell. 2008; 19:4188-4200.

66. Hicke L. Ubiquitin-dependent internalization and down-regulation of plasma membrane

proteins. The FASEB Journal. 1997;11:1215–1226.

166

67. Hicke L. Gettin’ down with ubiquitin: turning off cell-surface receptors, transporters and

channels. Trends in Cell Biology. 1999;9:107–112.

68. Hicke L. Protein regulation by monoubiquitin. Nature Reviews Molecular Cell Biology.

2001;2:195–201.

69. Stenmark H. Rab GTPases as coordinators of vesicle traffic. Nature Reviews Molecular Cell

Biology. 2009;10:513–525.

70. Bhuin T, Roy JK. Rab proteins: The key regulators of intracellular vesicle

transport. Experimental Cell Research. 2014;328:1–19.

71. Huotari J, Helenius A. Endosome maturation. The EMBO Journal. 2011;30:3481–3500.

72. Mattera R, Bonifacino JS. Ubiquitin binding and conjugation regulate the recruitment of

Rabex-5 to early endosomes. The EMBO Journal. 2008;27:2484–2494.

73. Li G, Dsouza-Schorey C, Barbieri MA, Roberts RL, Klippel A, Williams LT, Stahl PD.

Evidence for phosphatidylinositol 3-kinase as a regulator of endocytosis via activation of

Rab5. Proceedings of the National Academy of Sciences. 1995;92:10207–10211.

74. Christoforidis S, Mcbride HM, Burgoyne RD, Zerial M. The Rab5 effector EEA1 is a core

component of endosome docking. Nature. 1999;397:621–625.

75. Nielsen E, Severin F, Backer JM, Hyman AA, Zerial M. Rab5 regulates motility of early

endosomes on microtubules. Nat Cell Biol. 1999; 1:376-382.

167

76. de Wit H, Lichtenstein Y, Kelly RB, Geuze HJ, Klumperman J, van der Sluijs P. Rab4

regulates formation of synaptic-like microvesicles from early endosomes in PC12 cells. Mol

Biol Cell. 2001; 12:3703-3715.

77. Peden AA, Schonteich E, Chun J, Junutula JR, Scheller RH, Prekeris R. The RCP-Rab11

complex regulates endocytic protein sorting. Mol Biol Cell. 2004; 15:3530-3541.

78. Goueli BS, Powell MB, Finger EC, Pfeffer SR. TBC1D16 is a Rab4A GTPase activating

protein that regulates receptor recycling and EGF receptor signaling. Proceedings of the

National Academy of Sciences. 2012;109:15787–15792.

79. Macia E, Partisani M, Paleotti O, Luton F, Franco M. Arf6 negatively controls the rapid

recycling of the β2 adrenergic receptor. Journal of Cell Science. 2012;125:4026–4035.

80. Odley A, Hahn HS, Lynch RA, Marreez Y, Osinska H, Robbins J, Dorn GW. Regulation of

cardiac contractility by Rab4-modulated 2-adrenergic receptor recycling. Proceedings of the

National Academy of Sciences. 2004;101:7082–7087.

81. Horgan CP, Oleksy A, Zhdanov AV, Lall PY, White IJ, Khan AR, Futter CE, Mccaffrey JG,

Mccaffrey MW. Rab11-FIP3 Is Critical for the Structural Integrity of the Endosomal

Recycling Compartment. Traffic. 2007;8:414–430.

82. Junutula JR, Schonteich E, Wilson GM, Peden AA, Scheller RH, Prekeris R. Molecular

Characterization of Rab11 Interactions with Members of the Family of Rab11-interacting

Proteins. Journal of Biological Chemistry. 2004;279:33430–33437.

168

83. Rink J, Ghigo E, Kalaidzidis Y, Zerial M. Rab Conversion as a Mechanism of Progression

from Early to Late Endosomes. Cell. 2005;122:735–749.

84. Lakadamyali M, Rust MJ, Zhuang X. Ligands for Clathrin-Mediated Endocytosis Are

Differentially Sorted into Distinct Populations of Early Endosomes. Cell. 2006;124:997–

1009.

85. Conte-Zerial PD, Brusch L, Rink JC, Collinet C, Kalaidzidis Y, Zerial M, Deutsch A.

Membrane identity and GTPase cascades regulated by toggle and cut-out

switches. Molecular Systems Biology. 2008;4:206.

86. Slagsvold T, Pattni K, Malerød L, Stenmark H. Endosomal and non-endosomal functions of

ESCRT proteins. Trends in Cell Biology. 2006;16:317–326.

87. Romanelli RJ, LeBeau AP, Fulmer CG, Lazzarino DA, Hochberg A, Wood TL. Insulin-like

growth factor type-I receptor internalization and recycling mediate the sustained

phosphorylation of Akt. J Biol Chem. 2007;282:22513-22524.

88. Lagu T, Rothberg MB, Shieh MS, Pekow PS, Steingrub JS, Lindenauer PK. Hospitalizations,

costs, and outcomes of severe sepsis in the United States 2003 to 2007. Crit Care Med.

2012;40:754-761.

89. Angus DC, Linde-Zwirble WT, Lidicker J, Clermont G, Carcillo J, Pinsky MR.

Epidemiology of severe sepsis in the United States: analysis of incidence, outcome, and

associated costs of care. Crit Care Med. 2001;29:1303-1310.

169

90. Novosad SA, Sapiano MR, Grigg C, Lake J, Robyn M, Dumyati G, Felsen C, Blog D, Dufort

E, Zansky S, Wiedeman K, Avery L, Dantes RB, Jernigan JA, Magill SS, Fiore A, Epstein

L. Vital Signs: Epidemiology of Sepsis: Prevalence of Health Care Factors and Opportunities

for Prevention. MMWR Morbidity and Mortality Weekly Report. 2016;65:864–869.

91. Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, Knaus WA, Schein RM, Sibbald WJ.

Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in

sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest

Physicians/Society of Critical Care Medicine. Chest. 1992;101:1644-1655.

92. Levy MM, Fink MP, Marshall JC, Abraham E, Angus D, Cook D, Cohen J, Opal SM, Vincent

JL, Ramsay G. 2001 SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions

Conference. Crit Care Med. 2003;31:1250-1256.

93. Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M, Bellomo

R, Bernard GR, Chiche JD, Coopersmith CM, Hotchkiss RS, Levy MM, Marshall JC, Martin

GS, Opal SM, Rubenfeld GD, van der Poll T, Vincent JL, Angus DC. The Third International

Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016;315:801-810.

94. Marik PE, Taeb AM. SIRS, qSOFA and new sepsis definition. J Thorac Dis. 2017;9:943–

945.

95. Ranieri VM, Thompson BT, Barie PS, Dhainaut JF, Douglas IS, Finfer S, Gårdlund B,

Marshall JC, Rhodes A, Artigas A, Payen D, Tenhunen J, Al-Khalidi HR, Thompson V, Janes

J, Macias WL, Vangerow B, Williams MD; PROWESS-SHOCK Study Group. Drotrecogin

alfa (activated) in adults with septic shock. N Engl J Med. 2012;366:2055-2064.

170

96. Vincent JL, Rello J, Marshall J, Silva E, Anzueto A, Martin CD, Moreno R, Lipman J,

Gomersall C, Sakr Y, Reinhart K; EPIC II Group of Investigators. International study of the

prevalence and outcomes of infection in intensive care units. JAMA. 2009;302:2323-2329.

97. Bone RC, Grodzin CJ, Balk RA. Sepsis: A New Hypothesis for Pathogenesis of the Disease

Process. Chest. 1997;112:235–243.

98. Hotchkiss RS, Tinsley KW, Swanson PE, Grayson MH, Osborne DF, Wagner TH, Cobb JP,

Coopersmith C, Karl IE. Depletion of dendritic cells, but not macrophages, in patients with

sepsis. J Immunol. 2002;168:2493-2500.

99. Hotchkiss RS, Tinsley KW, Swanson PE, Schmieg RE, Hui JJ, Chang KC, Osborne DF,

Freeman BD, Cobb JP, Buchman TG, Karl IE. Sepsis-Induced Apoptosis Causes Progressive

Profound Depletion of B and CD4 T Lymphocytes in Humans. The Journal of Immunology.

2001;166:6952–6963.

100. Levi M, van der Poll T. Inflammation and coagulation. Crit Care Med. 2010;38:S26-S34.

101. Ruf W. New players in the sepsis-protective activated protein C pathway. Journal of Clinical

Investigation. 2010;120:3084–3087.

102. Zhang Q, Raoof M, Chen Y, Sumi Y, Sursal T, Junger W, Brohi K, Itagaki K, Hauser CJ.

Circulating mitochondrial DAMPs cause inflammatory responses to injury. Nature.

2010;464:104-107.

171

103. Sterling SA, Miller WR, Pryor J, Puskarich MA, Jones AE. The Impact of Timing of

Antibiotics on Outcomes in Severe Sepsis and Septic Shock. Critical Care Medicine.

2015;43:1907–1915.

104. Sivapalan P, Stæhr Jensen JU. Timing of Therapy in Sepsis: Are Early Antibiotics Important

for Prognosis? Critical Care Medicine. 2015;43:2030-2031.

105. Ronco JJ, Fenwick JC, Tweeddale MG. Does Increasing Oxygen Delivery Improve Outcome

In The Critically Ill? No. Critical Care Clinics. 1996;12:645–660.

106. Funk DJ, Jacobsohn E, Kumar A. Role of the venous return in critical illness and shock: part

II-shock and mechanical ventilation. Critical Care Medicine. 2013;41:573-579.

107. Eisner MD, Thompson T, Hudson LD, Luce JM, Hayden D, Schoenfeld D, Matthay MA.

Efficacy of Low Tidal Volume Ventilation in Patients with Different Clinical Risk Factors

for Acute Lung Injury and the Acute Respiratory Distress Syndrome. American Journal of

Respiratory and Critical Care Medicine. 2001;164:231–236.

108. Acute Respiratory Distress Syndrome Network, Brower RG, Matthay MA, Morris A,

Schoenfeld D, Thompson BT, Wheeler A. Ventilation with lower tidal volumes as compared

with traditional tidal volumes for acute lung injury and the acute respiratory distress

syndrome. N Engl J Med. 2000;342:1301-1308.

109. Landesberg G, Gilon D, Meroz Y, Georgieva M, Levin PD, Goodman S, Avidan A, Beeri R,

Weissman C, Jaffe AS, Sprung CL. Diastolic dysfunction and mortality in severe sepsis and

septic shock. European Heart Journal. 2011;33:895–903.

172

110. Havaldar AA. Evaluation of sepsis induced cardiac dysfunction as a predictor of

mortality. Cardiovascular Ultrasound. 2018;16:31

111. Rudiger A, Singer M. Mechanisms of sepsis-induced cardiac dysfunction. Critical Care

Medicine. 2007;35:1599-1608.

112. Parker MM, Shelhamer JH, Bacharach SL, Green MV, Natanson C, Frederick TM, Damske

BA, Parrillo JE. Profound but reversible myocardial depression in patients with septic shock.

Ann Intern Med. 1984;100:483-490.

113. Parker MM, Mccarthy KE, Ognibene FP, Parrillo JE. Right Ventricular Dysfunction and

Dilatation, Similar to Left Ventricular Changes, Characterize the Cardiac Depression of

Septic Shock in Humans. Chest. 1990;97:126–131.

114. Pulido JN, Afessa B, Masaki M, Yuasa T, Gillespie S, Herasevich V, Brown DR, Oh JK.

Clinical Spectrum, Frequency, and Significance of Myocardial Dysfunction in Severe Sepsis

and Septic Shock. Mayo Clinic Proceedings. 2012;87:620–628.

115. Redl G, Germann P, Plattner H, Hammerle A. Right ventricular function in early septic shock

states. Intensive Care Medicine. 1993;19:3–7.

116. Chan CM, Klinger JR. The right ventricle in sepsis. Clin Chest Med. 2008;29:661–676.

117. Dhainaut JF, Lanore JJ, Gournay JMD, Huyghebaert MF, Brunet F, Villemant D, Monsallier

JF. Right ventricular dysfunction in patients with septic shock. Intensive Care Medicine.

1988;14:488–491.

173

118. Tei C, Ling LH, Hodge DO, Bailey KR, Oh JK, Rodeheffer RJ, Tajik AJ, Seward JB. New

index of combined systolic and diastolic myocardial performance: a simple and reproducible

measure of cardiac function--a study in normals and dilated cardiomyopathy. J Cardiol.

1995;26:357-366.

119. Nizamuddin J, Mahmood F, Tung A, Mueller A, Brown SM, Shaefi S, O’Connor M, Talmor

D, Shahul S. Interval Changes in Myocardial Performance Index Predict Outcome in Severe

Sepsis. Journal of Cardiothoracic and Vascular Anesthesia. 2017;31:957–964.

120. Werdan K, Oelke A, Hettwer S, Nuding S, Bubel S, Hoke R, Ruß M, Lautenschläger C,

Mueller-Werdan U, Ebelt H. Septic cardiomyopathy: hemodynamic quantification,

occurrence, and prognostic implications. Clinical Research in Cardiology. 2011;100:661–

668.

121. Wilhelm J, Hettwer S, Schuermann M, Bagger S, Gerhardt F, Mundt S, Muschik S,

Zimmermann J, Bubel S, Amoury M, Kloess T, Finke R, Loppnow H, Mueller-Werdan U,

Ebelt H, Werdan K. Severity of cardiac impairment in the early stage of community-acquired

sepsis determines worse prognosis. Clinical Research in Cardiology. 2013;102:735–744.

122. Liu Y-C, Yu M-M, Shou S-T, Chai Y-F. Sepsis-Induced Cardiomyopathy: Mechanisms and

Treatments. Frontiers in Immunology. 2017;8: 1021.

123. Flesch M, Kilter H, Cremers B, Laufs U, Südkamp M, Ortmann M, Müller FU, Böhm M.

Effects of endotoxin on human myocardial contractility involvement of nitric oxide and

peroxynitrite. Journal of the American College of Cardiology. 1999;33:1062–1070.

174

124. Hobai IA, Aziz K, Buys ES, Brouckaert P, Siwik DA, Colucci WS. Distinct Myocardial

Mechanisms Underlie Cardiac Dysfunction in Endotoxemic Male and Female Mice. Shock.

2016;46:713–722.

125. Foley NM, Wang J, Redmond H, Wang J. Current knowledge and future directions of TLR

and NOD signaling in sepsis. Military Medical Research. 2015;2:1.

126. Haileselassie B, Su E, Pozios I, Niño DF, Liu H, Lu D-Y, Ventoulis I, Fulton WB, Sodhi CP,

Hackam D, O’Rourke B, Abraham T. Myocardial oxidative stress correlates with left

ventricular dysfunction on strain echocardiography in a rodent model of sepsis. Intensive

Care Medicine Experimental. 2017;5:21.

127. Galley H. Oxidative stress and mitochondrial dysfunction in sepsis. British Journal of

Anaesthesia. 2011;107:57–64.

128. Stanley WC, Recchia FA, Lopaschuk GD. Myocardial Substrate Metabolism in the Normal

and Failing Heart. Physiological Reviews. 2005;85:1093–1129.

129. Quinlan CL, Perevoshchikova IV, Hey-Mogensen M, Orr AL, Brand MD. Sites of reactive

oxygen species generation by mitochondria oxidizing different substrates. Redox Biol.

2013;1:304–312.

130. Herst PM, Rowe MR, Carson GM, Berridge MV. Functional Mitochondria in Health and

Disease. Front Endocrinol (Lausanne). 2017;8:296.

131. Suliman HB, Piantadosi CA. Mitochondrial Quality Control as a Therapeutic Target.

Pharmacol Rev. 2016;68:20-48.

175

132. Ni HM, Williams JA, Ding WX. Mitochondrial dynamics and mitochondrial quality control.

Redox Biol. 2015;4:6-13.

133. Chistiakov DA, Shkurat TP, Melnichenko AA, Grechko AV, Orekhov AN. The role of

mitochondrial dysfunction in cardiovascular disease: a brief review. Annals of Medicine.

2017;50:121–127.

134. Siasos G, Tsigkou V, Kosmopoulos M, Theodosiadis D, Simantiris S, Tagkou NM,

Tsimpiktsioglou A, Stampouloglou PK, Oikonomou E, Mourouzis K, Philippou A,

Vavuranakis M, Stefanadis C, Tousoulis D, Papavassiliou AG. Mitochondria and

cardiovascular diseases-from pathophysiology to treatment. Ann Transl Med. 2018;6:256.

135. Yao K, Zhang WW, Yao L, Yang S, Nie W, Huang F. Carvedilol promotes mitochondrial

biogenesis by regulating the PGC-1/TFAM pathway in human umbilical vein endothelial

cells (HUVECs). Biochemical and Biophysical Research Communications. 2016;470:961–

966.

136. Narendra D, Tanaka A, Suen DF, Youle RJ. Parkin is recruited selectively to impaired

mitochondria and promotes their autophagy. J Cell Biol. 2008;183:795-803.

137. Kitada T, Asakawa S, Hattori N, Matsumine H, Yamamura Y, Minoshima S, Yokochi M,

Mizuno Y, Shimizu N. Mutations in the parkin gene cause autosomal recessive juvenile

parkinsonism. Nature. 1998;392:605-608.

138. Valente EM. Hereditary Early-Onset Parkinsons Disease Caused by Mutations in

PINK1. Science. 2004;304:1158–1160.

176

139. Jin SM, Lazarou M, Wang C, Kane LA, Narendra DP, Youle RJ. Mitochondrial membrane

potential regulates PINK1 import and proteolytic destabilization by PARL. The Journal of

Cell Biology. 2010;191:933–942.

140. Deas E, Plun-Favreau H, Gandhi S, Desmond H, Kjaer S, Loh SH, Renton AE, Harvey RJ,

Whitworth AJ, Martins LM, Abramov AY, Wood NW. PINK1 cleavage at position A103 by

the mitochondrial protease PARL. Human Molecular Genetics. 2010;20:867–879.

141. Meissner, C., Lorenz, H., Weihofen, A., Selkoe, D.J., and Lemberg, M.K. (2011). The

mitochondrial intramembrane protease PARL cleaves human Pink1 to regulate Pink1

trafficking. J. Neurochem 117, 856–867.

142. Natanson C, Danner RL, Elin RJ, Hosseini JM, Peart KW, Banks SM, MacVittie TJ, Walker

RI, Parrillo JE. Role of endotoxemia in cardiovascular dysfunction and mortality. Escherichia

coli and Staphylococcus aureus challenges in a canine model of human septic shock. J Clin

Invest. 1989;83:243-251.

143. Soriano FG, Nogueira AC, Caldini EG, Lins MH, Teixeira AC, Cappi SB, Lotufo PA, Bernik

MM, Zsengellér Z, Chen M, Szabó C. Potential role of poly(adenosine 5'-diphosphate-ribose)

polymerase activation in the pathogenesis of myocardial contractile dysfunction associated

with human septic shock. Crit Care Med. 2006;34:1073-1079.

144. Drosatos K, Khan RS, Trent CM, Jiang H, Son NH, Blaner WS, Homma S, Schulze PC,

Goldberg IJ. Peroxisome proliferator-activated receptor-γ activation prevents sepsis-related

cardiac dysfunction and mortality in mice. Circ Heart Fail. 2013;6:550-562.

177

145. Tavener SA, Long EM, Robbins SM, McRae KM, Van Remmen H, Kubes P. Immune cell

Toll-like receptor 4 is required for cardiac myocyte impairment during endotoxemia. Circ

Res. 2004;95:700-707.

146. Sun Y, Yao X, Zhang Q-J, Zhu M, Liu Z-P, Ci B, Xie Y, Carlson D, Rothermel BA, Sun Y,

Levine B, Hill JA, Wolf SE, Minei JP, Zang QS. Beclin-1-Dependent Autophagy Protects

the Heart During Sepsis. Circulation. 2018;138:2247–2262.

147. Hickson-Bick DL, Jones C, Buja LM. Stimulation of mitochondrial biogenesis and

autophagy by lipopolysaccharide in the neonatal rat cardiomyocyte protects against

programmed cell death. Journal of Molecular and Cellular Cardiology. 2008;44:411–418.

148. Wang H, Cui N, Han W, Su L-X, Long Y, Liu D-W. Accelerated Autophagy of Cecal

Ligation and Puncture-Induced Myocardial Dysfunction and Its Correlation with Mammalian

Target of Rapamycin Pathway in Rats. Chinese Medical Journal. 2018;131:1185–1190.

149. Takahashi W, Watanabe E, Fujimura L, Watanabe-Takano H, Yoshidome H, Swanson PE,

Tokuhisa T, Oda S, Hatano M. Kinetics and protective role of autophagy in a mouse cecal

ligation and puncture-induced sepsis. Critical Care. 2013;17.

150. Hsieh C-H, Pai P-Y, Hsueh H-W, Yuan S-S, Hsieh Y-C. Complete Induction of Autophagy

Is Essential for Cardioprotection in Sepsis. Annals of Surgery. 2011;253:1190–1200.

151. Zhang W-X, He B-M, Wu Y, Qiao J-F, Peng Z-Y. Melatonin protects against sepsis-induced

cardiac dysfunction by regulating apoptosis and autophagy via activation of SIRT1 in

mice. Life Sciences. 2019;217:8–15.

178

152. Zhang J, Zhao P, Quan N, Wang L, Chen X, Cates C, Rousselle T, Li J. The endotoxemia

cardiac dysfunction is attenuated by AMPK/mTOR signaling pathway regulating

autophagy. Biochemical and Biophysical Research Communications. 2017;492:520–527.

153. Piquereau J, Godin R, Deschênes S, Bessi VL, Mofarrahi M, Hussain SN, Burelle Y.

Protective role of PARK2/Parkin in sepsis-induced cardiac contractile and mitochondrial

dysfunction. Autophagy. 2013;9:1837-1851.

154. Maucuer A, Camonis JH, Sobel A. Stathmin interaction with a putative kinase and coiled-

coil-forming protein domains. Proceedings of the National Academy of Sciences.

1995;92:3100–3104.

155. Li L, Cohen SN. Tsg101: A Novel Tumor Susceptibility Gene Isolated by Controlled

Homozygous Functional Knockout of Allelic Loci in Mammalian Cells. Cell. 1996;85:319–

329.

156. Chen H, Liu X, Li Z, Zhan P, Clercq ED. TSG101: A Novel Anti-HIV-1 Drug

Target. Current Medicinal Chemistry. 2010;17:750–758.

157. Koonin EV, Abagyan RA. TSG101 may be the prototype of a class of dominant negative

ubiquitin regulators. Nature Genetics. 1997;16:330–331.

158. Ponting CP, Cai YD, Bork P. The breast cancer gene product TSG101: a regulator of

ubiquitination? J Mol Med (Berl). 1997;75:467-469.

159. Sundquist WI, Schubert HL, Kelly BN, Hill GC, Holton JM, Hill CP. Ubiquitin recognition

by the human TSG101 protein. Mol Cell. 2004;13:783-789.

179

160. Ren X, Kloer DP, Kim YC, Ghirlando R, Saidi LF, Hummer G, Hurley JH. Hybrid Structural

Model of the Complete Human ESCRT-0 Complex. Structure. 2009;17:406–416.

161. Pornillos O, Alam SL, Davis DR, Sundquist WI. Structure of the Tsg101 UEV domain in

complex with the PTAP motif of the HIV-1 p6 protein. Nature Structural Biology. 2002;

9:812-817.

162. Lee HH, Elia N, Ghirlando R, Lippincott-Schwartz J, Hurley JH. Midbody Targeting of the

ESCRT Machinery by a Noncanonical Coiled Coil in CEP55. Science. 2008;322:576–580.

163. Muromoto R, Sugiyama K, Yamamoto T, Oritani K, Shimoda K, Matsuda T. Physical and

functional interactions between Daxx and TSG101. Biochemical and Biophysical Research

Communications. 2004;316:827–833.

164. Watanabe M, Yanagi Y, Masuhiro Y, Yano T, Yoshikawa H, Yanagisawa J, Kato S. A

Putative Tumor Suppressor, TSG101, Acts as a Transcriptional Suppressor through Its

Coiled-Coil Domain. Biochemical and Biophysical Research Communications.

1998;245:900–905.

165. Mcdonald B, Martin-Serrano J. Regulation of Tsg101 Expression by the Steadiness Box: A

Role of Tsg101-associated Ligase. Molecular Biology of the Cell. 2008;19:754–763.

166. Li L, Franckea U, Cohen SN. The TSG101 Tumor Susceptibility Gene Is Located in

Chromosome 11 Band p15 and Is Mutated in Human Breast Cancer. Cell. 1998;93:661.

167. Jiang Y, Ou Y, Cheng X. Role of TSG101 in cancer. Frontiers in Bioscience. 2013;18:279.

180

168. Lo Y-F, Chen T-C, Chen S-C, Chao CC-K. Aberrant expression of TSG101 in Taiwan

Chinese breast cancer. Breast Cancer Research and Treatment. 2000;60:259–266.

169. Zhu G, Reynolds L, Crnogorac-Jurcevic T, Gillett CE, Dublin EA, Marshall JF, Barnes D,

Darrigo C, Trappen POV, Lemoine NR, Hart IR. Combination of microdissection and

microarray analysis to identify gene expression changes between differentially located

tumour cells in breast cancer. Oncogene. 2003;22:3742–3748.

170. Oh KB, Stanton MJ, West WW, Todd GL, Wagner K-U. Tsg101 is upregulated in a subset

of invasive human breast cancers and its targeted overexpression in transgenic mice reveals

weak oncogenic properties for mammary cancer initiation. Oncogene. 2007;26:5950–5959.

171. Krempler A, Henry MD, Triplett AA, Wagner K-U. Targeted Deletion of theTsg101Gene

Results in Cell Cycle Arrest at G1/S and p53-independent Cell Death. Journal of Biological

Chemistry. 2002;277:43216–43223.

172. Wagner K-U, Krempler A, Qi Y, Park K, Henry MD, Triplett AA, Riedlinger G, Iii EBR,

Hennighausen L. Tsg101 Is Essential for Cell Growth, Proliferation, and Cell Survival of

Embryonic and Adult Tissues. Molecular and Cellular Biology. 2003;23:150–162.

173. Cheng X, Young TW, Mei FC. Proteomics analyses of ovarian caner using genetically

defined human ovarian cancer models. Frontiers in Bioscience. 2007;12:5166-5174.

174. Young TW, Mei FC, Rosen DG, Yang G, Li N, Liu J, Cheng X. Up-regulation of Tumor

Susceptibility Gene 101 Protein in Ovarian Carcinomas Revealed by Proteomics

Analyses. Molecular & Cellular Proteomics. 2006;6:294–304.

181

175. Carney M, Maxwell G, Lancaster J, Gumbs C, Marks J, Berchuck A, Futreal P. Aberrant

splicing of the TSG101 tumor suppressor gene in human breast and ovarian cancers. Journal

of the Society for Gynecologic Investigation. 1998;5:281–285.

176. Liu F, Yu Y, Jin Y, Fu S. TSG101, identified by screening a cancer cDNA library and soft

agar assay, promotes cell proliferation in human lung cancer. Molecular Biology Reports.

2009;37:2829–2838.

177. Chang J, Lu P, Cai C, Li F, Zhong Z, Zhang D. [The Relationship between TSG101 Protein

and Notch3 Receptor in Lung Cancer.]. Zhongguo Fei Ai Za Zhi. 2009;12:111-116.

178. Li L, Liao J, Ruland J, Mak TW, Cohen SN. A TSG101/MDM2 regulatory loop modulates

MDM2 degradation and MDM2/p53 feedback control. Proceedings of the National Academy

of Sciences. 2001;98:1619–1624.

179. Ruland J, Sirard C, Elia A, Macpherson D, Wakeham A, Li L, Pompa JLDL, Cohen SN, Mak

TW. p53 Accumulation, defective cell proliferation, and early embryonic lethality in mice

lacking tsg101. Proceedings of the National Academy of Sciences. 2001;98:1859–1864.

180. Carstens MJ, Krempler A, Triplett AA, Lohuizen MV, Wagner K-U. Cell Cycle Arrest and

Cell Death Are Controlled by p53-dependent and p53-independent Mechanisms in Tsg101-

deficient Cells. Journal of Biological Chemistry. 2004;279:35984–35994.

181. Lin Y-S, Chen Y-J, Cohen SN, Cheng T-H. Identification of TSG101 Functional Domains

and p21 Loci Required for TSG101-Mediated p21 Gene Regulation. PLoS ONE.

2013;8:e79674.

182

182. Young TW, Rosen DG, Mei FC, Li N, Liu J, Wang X-F, Cheng X. Up-regulation of Tumor

Susceptibility Gene 101 Conveys Poor Prognosis through Suppression of p21 Expression in

Ovarian Cancer. Clinical Cancer Research. 2007;13:3848–3854.

183. Oh H, Mammucari C, Nenci A, Cabodi S, Cohen SN, Dotto GP. Negative regulation of cell

growth and differentiation by TSG101 through association with

p21Cip1/WAF1. Proceedings of the National Academy of Sciences. 2002;99:5430–5435.

184. Stringer DK, Piper RC. A single ubiquitin is sufficient for cargo protein entry into MVBs in

the absence of ESCRT ubiquitination. The Journal of Cell Biology. 2011;192:229–242.

185. Ren J, Kee Y, Huibregtse JM, Piper RC. Hse1, a component of the yeast Hrs-STAM

ubiquitin-sorting complex, associates with ubiquitin peptidases and a ligase to control sorting

efficiency into multivesicular bodies. Mol Biol Cell. 2007;18:324-335.

186. Bilodeau PS, Winistorfer SC, Kearney WR, Robertson AD, Piper RC. Vps27-Hse1 and

ESCRT-I complexes cooperate to increase efficiency of sorting ubiquitinated proteins at the

endosome. J Cell Biol. 2003;163:237-243.

187. Teo H, Veprintsev DB, Williams RL. Structural insights into endosomal sorting complex

required for transport (ESCRT-I) recognition of ubiquitinated proteins. J Biol Chem.

2004;279:28689-28696.

188. Katzmann DJ, Babst M, Emr SD. Ubiquitin-dependent sorting into the multivesicular body

pathway requires the function of a conserved endosomal protein sorting complex, ESCRT-I.

Cell. 2001; 106:145-155.

183

189. Kostelansky MS, Schluter C, Tam YY, Lee S, Ghirlando R, Beach B, Conibear E, Hurley

JH. Molecular architecture and functional model of the complete yeast ESCRT-I

heterotetramer. Cell. 2007;129:485-498.

190. Gill DJ, Teo H, Sun J, Perisic O, Veprintsev DB, Emr SD, Williams RL. Structural insight

into the ESCRT-I/-II link and its role in MVB trafficking. EMBO J. 2007;26:600-612.

191. Im YJ, Wollert T, Boura E, Hurley JH. Structure and function of the ESCRT-II-III interface

in multivesicular body biogenesis. Dev Cell. 2009;17:234-243.

192. Teis D, Saksena S, Emr SD. Ordered assembly of the ESCRT-III complex on endosomes is

required to sequester cargo during MVB formation. Dev Cell. 2008;15:578-589.

193. Wollert T, Wunder C, Lippincott-Schwartz J, Hurley JH. Membrane scission by the ESCRT-

III complex. Nature. 2009;458:172-177.

194. Gonciarz MD, Whitby FG, Eckert DM, Kieffer C, Heroux A, Sundquist WI, Hill CP.

Biochemical and structural studies of yeast Vps4 oligomerization. J Mol Biol. 2008;384:878-

895.

195. Xiao J, Xia H, Yoshino-Koh K, Zhou J, Xu Z. Structural characterization of the ATPase

reaction cycle of endosomal AAA protein Vps4. J Mol Biol. 2007;374:655-670.

196. Scott A, Chung HY, Gonciarz-Swiatek M, Hill GC, Whitby FG, Gaspar J, Holton JM,

Viswanathan R, Ghaffarian S, Hill CP, Sundquist WI. Structural and mechanistic studies of

VPS4 proteins. EMBO J. 2005; 24:3658-3669.

184

197. Razi M, Futter CE. Distinct roles for Tsg101 and Hrs in multivesicular body formation and

inward vesiculation. Mol Biol Cell. 2006;17:3469-3483.

198. Bouamr F, Houck-Loomis BR, De Los Santos M, Casaday RJ, Johnson MC, Goff SP. The

C-terminal portion of the Hrs protein interacts with Tsg101 and interferes with human

immunodeficiency virus type 1 Gag particle production. J Virol. 2007;81:2909-2922.

199. Garrus JE, von Schwedler UK, Pornillos OW, Morham SG, Zavitz KH, Wang HE, Wettstein

DA, Stray KM, Côté M, Rich RL, Myszka DG, Sundquist WI. Tsg101 and the vacuolar

protein sorting pathway are essential for HIV-1 budding. Cell. 2001;107:55-65.

200. Goila-Gaur R, Demirov DG, Orenstein JM, Ono A, Freed EO. Defects in human

immunodeficiency virus budding and endosomal sorting induced by TSG101 overexpression.

J Virol. 2003;77:6507-6519.

201. Myers EL, Allen JF. Tsg101, an inactive homologue of ubiquitin ligase e2, interacts

specifically with human immunodeficiency virus type 2 gag polyprotein and results in

increased levels of ubiquitinated gag. J Virol. 2002;76:11226-11235.

202. Sette P, Nagashima K, Piper RC, Bouamr F. Ubiquitin conjugation to Gag is essential for

ESCRT-mediated HIV-1 budding. Retrovirology. 2013;10:79.

203. Rush JS, Ceresa BP. RAB7 and TSG101 are required for the constitutive recycling of

unliganded EGFRs via distinct mechanisms. Mol Cell Endocrinol. 2013;381:188-197.

185

204. Lu Q, Hope LW, Brasch M, Reinhard C, Cohen SN. TSG101 interaction with HRS mediates

endosomal trafficking and receptor down-regulation. Proc Natl Acad Sci U S A. 2003;

100:7626-7631.

205. Morris CR, Stanton MJ, Manthey KC, Oh KB, Wagner K-U. A Knockout of the Tsg101 Gene

Leads to Decreased Expression of ErbB Receptor Tyrosine Kinases and Induction of

Autophagy Prior to Cell Death. PLoS ONE. 2012;7:e34308.

206. Zhang A, He X, Zhang L, Yang L, Woodman P, Li W. Biogenesis of Lysosome-related

Organelles Complex-1 Subunit 1 (BLOS1) Interacts with Sorting Nexin 2 and the Endosomal

Sorting Complex Required for Transport-I (ESCRT-I) Component TSG101 to Mediate the

Sorting of Epidermal Growth Factor Receptor into Endosomal Compartments. Journal of

Biological Chemistry. 2014;289:29180–29194.

207. Horgan CP, Hanscom SR, Kelly EE, Mccaffrey MW. Tumor Susceptibility Gene 101

(TSG101) Is a Novel Binding-Partner for the Class II Rab11-FIPs. PLoS ONE.

2012;7:e32030.

208. Majumder P, Chakrabarti O. Mahogunin regulates fusion between amphisomes/MVBs and

lysosomes via ubiquitination of TSG101. Cell Death Dis. 2015;6:e1970.

209. Filimonenko M, Stuffers S, Raiborg C, Yamamoto A, Malerød L, Fisher EM, Isaacs A, Brech

A, Stenmark H, Simonsen A. Functional multivesicular bodies are required for autophagic

clearance of protein aggregates associated with neurodegenerative disease. The Journal of

Cell Biology. 2007;179:485–500.

186

210. Doyotte A, Russell MR, Hopkins CR, Woodman PG. Depletion of TSG101 forms a

mammalian “Class E” compartment: a multicisternal early endosome with multiple sorting

defects. J Cell Sci. 2005;118:3003–3017.

211. Rusten TE, Vaccari T, Lindmo K, Rodahl LM, Nezis IP, Sem-Jacobsen C, Wendler F,

Vincent JP, Brech A, Bilder D, Stenmark H. ESCRTs and Fab1 regulate distinct steps of

autophagy. Curr Biol. 2007;17:1817-1825.

212. Rubinstein J, Lasko VM, Koch SE, Singh VP, Carreira V, Robbins N, Patel AR, Jiang M,

Bidwell P, Kranias EG, Jones WK, Lorenz JN. Novel role of transient receptor potential

vanilloid 2 in the regulation of cardiac performance. Am J Physiol Heart Circ Physiol.

2014;306:H574-584.

213. Qian J, Vafiadaki E, Florea SM, Singh VP, Song W, Lam CK, Wang Y, Yuan Q, Pritchard

TJ, Cai W, Haghighi K, Rodriguez P, Wang HS, Sanoudou D, Fan GC, Kranias EG. Small

heat shock protein 20 interacts with protein phosphatase-1 and enhances sarcoplasmic

reticulum calcium cycling. Circ Res. 2011; 108:1429-1438.

214. Oreilly MK, Tian H, Paulson JC. CD22 Is a Recycling Receptor That Can Shuttle Cargo

between the Cell Surface and Endosomal Compartments of B Cells. The Journal of

Immunology. 2010;186:1554–1563.

215. Haugland RP, Bhalgat MK. Preparation of avidin conjugates. Methods Mol Biol. 2008;

418:1–12.

216. deAlmeida AC, van Oort RJ, Wehrens XH. Transverse aortic constriction in mice. J Vis Exp.

2010;38:1729.

187

217. Prasad H, Rao R. The Na+/H+ exchanger NHE6 modulates endosomal pH to control

processing of amyloid precursor protein in a cell culture model of Alzheimer disease. J Biol

Chem. 2015;290:5311-5327.

218. Girnita A, All-Ericsson C, Economou MA, Aström K, Axelson M, Seregard S, Larsson O,

Girnita L. The insulin-like growth factor-I receptor inhibitor picropodophyllin causes tumor

regression and attenuates mechanisms involved in invasion of uveal melanoma cells. Acta

Ophthalmol. 2008;86:26-34.

219. Yang L, Li Y, Wang X, Mu X, Qin D, Huang W, Alshahrani S, Nieman M, Peng J, Essandoh

K, Peng T, Wang Y, Lorenz J, Soleimani M, Zhao ZQ, Fan GC. Overexpression of miR-223

Tips the Balance of Pro- and Anti-hypertrophic Signaling Cascades toward Physiologic

Cardiac Hypertrophy. J Biol Chem. 2016;291:15700-15713.

220. Carè A, Catalucci D, Felicetti F, Bonci D, Addario A, Gallo P, Bang ML, Segnalini P, Gu Y,

Dalton ND, Elia L, Latronico MV, Høydal M, Autore C, Russo MA, Dorn GW 2nd, Ellingsen

O, Ruiz-Lozano P, Peterson KL, Croce CM, Peschle C, Condorelli G. MicroRNA-133

controls cardiac hypertrophy. Nat Med. 2007;13:613-618.

221. Horgan CP, Hanscom SR, Jolly RS, Futter CE, McCaffrey MW. Rab11-FIP3 links the Rab11

GTPase and cytoplasmic dynein to mediate transport to the endosomal-recycling

compartment. J Cell Sci. 2010;123:181-191.

222. Bouchet J, Del Río-Iñiguez I, Lasserre R, Agüera-Gonzalez S, Cuche C, Danckaert A,

McCaffrey MW, Di Bartolo V, Alcover A. Rac1-Rab11-FIP3 regulatory hub coordinates

vesicle traffic with actin remodeling and T-cell activation. EMBO J. 2016;35:1160-1174.

188

223. Skurk C, Izumiya Y, Maatz H, Razeghi P, Shiojima I, Sandri M, Sato K, Zeng L, Schiekofer

S, Pimentel D, Lecker S, Taegtmeyer H, Goldberg AL, Walsh K. The FOXO3a transcription

factor regulates cardiac myocyte size downstream of AKT signaling. J Biol Chem.

2005;280:20814-20823.

224. Gomes MD, Lecker SH, Jagoe RT, Navon A, Goldberg AL. Atrogin-1, a muscle-specific F-

box protein highly expressed during muscle atrophy. Proc Natl Acad Sci U S A.

2001;98:14440-14445.

225. Jagoe RT, Lecker SH, Gomes M, Goldberg AL. Patterns of gene expression in atrophying

skeletal muscles: response to food deprivation. FASEB J. 2002;16:1697-1712.

226. Michael A, Haq S, Chen X, Hsich E, Cui L, Walters B, Shao Z, Bhattacharya K, Kilter H,

Huggins G, Andreucci M, Periasamy M, Solomon RN, Liao R, Patten R, Molkentin JD, Force

T. Glycogen synthase kinase-3beta regulates growth, calcium homeostasis, and diastolic

function in the heart. J Biol Chem. 2004;279:21383-21393.

227. Shioi T, McMullen JR, Kang PM, Douglas PS, Obata T, Franke TF, Cantley LC, Izumo S.

Akt/protein kinase B promotes organ growth in transgenic mice. Mol Cell Biol.

2002;22:2799-2809.

228. Catalucci D, Zhang DH, DeSantiago J, Aimond F, Barbara G, Chemin J, Bonci D, Picht E,

Rusconi F, Dalton ND, Peterson KL, Richard S, Bers DM, Brown JH, Condorelli G. Akt

regulates L-type Ca2+ channel activity by modulating Cavalpha1 protein stability. J Cell

Biol. 2009;184:923-933.

189

229. Kim SJ, Abdellatif M, Koul S, Crystal GJ. Chronic treatment with insulin-like growth factor

I enhances myocyte contraction by upregulation of Akt-SERCA2a signaling pathway. Am J

Physiol Heart Circ Physiol. 2008;295:H130–H135.

230. Catalucci D, Latronico MV, Ceci M, Rusconi F, Young HS, Gallo P, Santonastasi M,

Bellacosa A, Brown JH, Condorelli G. Akt increases sarcoplasmic reticulum Ca2+ cycling

by direct phosphorylation of phospholamban at Thr17. J Biol Chem. 2009;284:28180-28187.

231. Ismaili N, Blind R, Garabedian MJ. Stabilization of the unliganded glucocorticoid receptor

by TSG101. J Biol Chem. 2005;280:11120-11126.

232. Burgdorf S, Leister P, Scheidtmann KH. TSG101 interacts with apoptosis-antagonizing

transcription factor and enhances androgen receptor-mediated transcription by promoting its

monoubiquitination. J Biol Chem. 2004;279:17524-17534.

233. Trivieri MG, Oudit GY, Sah R, Kerfant BG, Sun H, Gramolini AO, Pan Y, Wickenden AD,

Croteau W, Morreale de Escobar G, Pekhletski R, St Germain D, Maclennan DH, Backx PH.

Cardiac-specific elevations in thyroid hormone enhance contractility and prevent pressure

overload-induced cardiac dysfunction. Proc Natl Acad Sci U S A. 2006;103:6043-6048.

234. Troncoso R, Ibarra C, Vicencio JM, Jaimovich E, Lavandero S. New insights into IGF-1

signaling in the heart. Trends Endocrinol Metab. 2014;25:128-137.

235. Abeyrathna P, Su Y. The critical role of Akt in cardiovascular function. Vascul Pharmacol.

2015;74:38–48.

190

236. Chaanine AH, Hajjar RJ. AKT signalling in the failing heart. Eur J Heart Fail. 2011;13:825–

829.

237. Huynh K, McMullen JR, Julius TL, Tan JW, Love JE, Cemerlang N, Kiriazis H, Du XJ,

Ritchie RH. Cardiac-specific IGF-1 receptor transgenic expression protects against cardiac

fibrosis and diastolic dysfunction in a mouse model of diabetic cardiomyopathy. Diabetes.

2010;59:1512-1520.

238. Matsui T, Tao J, del Monte F, Lee KH, Li L, Picard M, Force TL, Franke TF, Hajjar RJ,

Rosenzweig A. Akt activation preserves cardiac function and prevents injury after transient

cardiac ischemia in vivo. Circulation. 2001;104:330-335.

239. Kitamura Y, Koide M, Akakabe Y, Matsuo K, Shimoda Y, Soma Y, Ogata T, Ueyama T,

Matoba S, Yamada H, Ikeda K. Manipulation of cardiac phosphatidylinositol 3-kinase

(PI3K)/Akt signaling by apoptosis regulator through modulating IAP expression (ARIA)

regulates cardiomyocyte death during doxorubicin-induced cardiomyopathy. J Biol Chem.

2014;289:2788-2800.

240. Um JW, Chung KC. Functional modulation of parkin through physical interaction with

SUMO-1. J Neurosci Res. 2006;84:1543-1554.

241. Kalia SK, Lee S, Smith PD, Liu L, Crocker SJ, Thorarinsdottir TE, Glover JR, Fon EA, Park

DS, Lozano AM. BAG5 inhibits parkin and enhances dopaminergic neuron degeneration.

Neuron. 2004;44:931-945.

191

242. Kalia LV, Kalia SK, Chau H, Lozano AM, Hyman BT, McLean PJ. Ubiquitinylation of α-

synuclein by carboxyl terminus Hsp70-interacting protein (CHIP) is regulated by Bcl-2-

associated athanogene 5 (BAG5). PLoS One. 2011;6:e14695.

243. Durcan TM, Fon EA. Mutant ataxin-3 promotes the autophagic degradation of parkin.

Autophagy. 2011;7(2):233-234.

244. Koyano F, Okatsu K, Kosako H, Tamura Y, Go E, Kimura M, Kimura Y, Tsuchiya H,

Yoshihara H, Hirokawa T, Endo T, Fon EA, Trempe JF, Saeki Y, Tanaka K, Matsuda N.

Ubiquitin is phosphorylated by PINK1 to activate parkin. Nature. 2014;510:162-166.

245. Jansen MP, Pulskens WP, Butter LM, Florquin S, Juffermans NP, Roelofs JJ, Leemans JC.

Mitochondrial DNA is Released in Urine of SIRS Patients With Acute Kidney Injury and

Correlates With Severity of Renal Dysfunction. Shock. 2018;49:301–310.

246. Gkikas I, Palikaras K, Tavernarakis N. The Role of Mitophagy in Innate Immunity. Frontiers

in Immunology. 2018;9:1283.

247. Ong S-B, Kalkhoran SB, Hernández-Reséndiz S, Samangouei P, Ong S-G, Hausenloy DJ.

Mitochondrial-Shaping Proteins in Cardiac Health and Disease – the Long and the Short of

It! Cardiovascular Drugs and Therapy. 2017;31:87–107.

248. Sánchez-Villamil JP, D’Annunzio V, Finocchietto P, Holod S, Rebagliati I, Pérez H, Peralta

JG, Gelpi RJ, Poderoso JJ, Carreras MC. Cardiac-specific overexpression of thioredoxin 1

attenuates mitochondrial and myocardial dysfunction in septic mice. The International

Journal of Biochemistry & Cell Biology. 2016;81:323–334.

192

249. Preau S, Delguste F, Yu Y, Remy-Jouet I, Richard V, Saulnier F, Boulanger E, Neviere R.

Endotoxemia Engages the RhoA Kinase Pathway to Impair Cardiac Function By Altering

Cytoskeleton, Mitochondrial Fission, and Autophagy. Antioxidants & Redox Signaling.

2016;24:529–542.

250. Lancel S, Hassoun SM, Favory R, Decoster B, Motterlini R, Neviere R. Carbon Monoxide

Rescues Mice from Lethal Sepsis by Supporting Mitochondrial Energetic Metabolism and

Activating Mitochondrial Biogenesis. Journal of Pharmacology and Experimental

Therapeutics. 2009;329:641–648.

251. Yao X, Carlson D, Sun Y, Ma L, Wolf SE, Minei JP, Zang QS. Mitochondrial ROS Induces

Cardiac Inflammation via a Pathway through mtDNA Damage in a Pneumonia-Related

Sepsis Model. Plos One. 2015;10:e0139416

252. Martin L, Peters C, Schmitz S, Moellmann J, Martincuks A, Heussen N, Lehrke M, Müller-

Newen G, Marx G, Schuerholz T. Soluble Heparan Sulfate in Serum of Septic Shock Patients

Induces Mitochondrial Dysfunction in Murine Cardiomyocytes. Shock. 2015;44:569–577.

253. Siracusano L, Girasole V. Letter by Siracusano and Girasole Regarding Article, “Toll-like

Receptor-Mediated Inflammatory Signaling Reprograms Cardiac Energy Metabolism by

Repressing Peroxisome Proliferator-Activated Receptor γ Coactivator-I

Signaling.” Circulation: Heart Failure. 2011;4:474–482.

254. Russell JA, Walley KR. Update in sepsis 2012. Am J Respir Crit Care Med. 2013;187:1303–

1307.

193

255. Seemann S, Zohles F, Lupp A. Comprehensive comparison of three different animal models

for systemic inflammation. J Biomed Sci. 2017;24:60.

256. Kalbitz M, Fattahi F, Grailer JJ, Jajou L, Malan EA, Zetoune FS, Huber-Lang M, Russell

MW, Ward PA. Complement-induced activation of the cardiac NLRP3 inflammasome in

sepsis. FASEB J. 2016;30:3997-4006.

257. Zhou R, Yazdi AS, Menu P, Tschopp J. A role for mitochondria in NLRP3 inflammasome

activation. Nature. 2011;469:221-225.

194

Appendix: Publications, Abstracts and Awards

Peer-reviewed papers

1. Essandoh K, Fan GC. Role of Extracellular and Intracellular microRNAs In Sepsis. Biochim

Biophys Acta. 2014; 1842(11):2155-2162.

2. Essandoh K, Yang L, Wang X, Huang W, Qin D, Hao J, Wang Y, Zingarelli B, Peng T, Fan

GC. Blockade Of Exosome Generation With GW4869 Dampens The Sepsis-Induced

Inflammation And Cardiac Dysfunction. Biochim Biophys Acta. 2015; 1852(11):2362-71.

3. Wang X, Gu H, Qin D, Yang L, Huang W, Essandoh K, Wang Y, Caldwell CC, Peng T,

Zingarelli B, Fan GC. Exosomal miR-223 Contributes to Mesenchymal Stem Cell-Elicited

Cardioprotection in Polymicrobial Sepsis. Sci Rep. 2015; 5:13721.

4. Essandoh K, Li Y, Huo J, Fan GC. MiRNA-Mediated Macrophage Polarization and its

Potential Role in the Regulation of Inflammatory Response. Shock. 2016; 46(2):122-31.

5. Yang L, Li Y, Wang X, Mu X, Qin D, Huang W, Alshahrani S, Nieman M, Peng J, Essandoh

K, Peng T, Wang Y, Lorenz J, Soleimani M, Zhao ZQ, Fan GC. Overexpression of miR-223

Tips the Balance of Pro- and Anti-hypertrophic Signaling Cascades toward Physiologic

Cardiac Hypertrophy. J Biol Chem. 2016; 291(30):15700-13.

6. Wang X, Gu H, Huang W, Peng J, Li Y, Yang L, Qin D, Essandoh K, Wang Y, Peng T, Fan

GC. Hsp20-Mediated Activation of Exosome Biogenesis in Cardiomyocytes Improves

Cardiac Function and Angiogenesis in Diabetic Mice. Diabetes. 2016; 65(10):3111-28.

195

7. Qin D, Wang X, Li Y, Yang L, Wang R, Peng J, Essandoh K, Mu X, Peng T, Han Q, Yu

KJ, Fan GC. MicroRNA-223-5p and -3p Cooperatively Suppress Necroptosis in

Ischemic/Reperfused Hearts. J Biol Chem. 2016; 291(38):20247-59.

8. Mu X, Wang X, Huang W, Wang RT, Essandoh K, Li Y, Pugh AM, Peng J, Deng S, Wang

Y, Caldwell CC, Peng T, Yu KJ, Fan GC. Circulating Exosomes Isolated from Septic Mice

Induce Cardiovascular Hyperpermeability Through Promoting Podosome Cluster Formation.

Shock. 2018;49(4):429-441.

9. Liu GS, Zhu H, Cai WF, Wang X, Jiang M, Essandoh K, Vafiadaki E, Haghighi K, Lam CK,

Gardner G, Adly G, Nicolaou P, Sanoudou D, Liang Q, Rubinstein J, Fan GC, Kranias EG.

Regulation of BECN1-mediated autophagy by HSPB6: insights from a human HSPB6-S10F

mutant. Autophagy. 2018;14(1):80-97.

10. Peng J, Li Y, Wang X, Deng S, Holland J, Yates E, Chen J, Gu H, Essandoh K, Mu X, Wang

B, McNamara RK, Peng T, Jegga AG, Liu T, Nakamura T, Huang K, Perez-Tilve D, Fan GC.

An Hsp20-FBXO4 Axis Regulates Adipocyte Function through Modulating PPARγ

Ubiquitination. Cell Rep. 2018;23(12):3607-3620.

11. Essandoh K, Wang X, Deng S, Jiang M, Mu X, Peng J, Li Y, Wang R, Peng T, Rubinstein

J, Wagner KW, Yu KJ, Fan GC. Tsg101 positively regulates physiologic-like cardiac

hypertrophy through FIP3-mediated endosome recycling of IGF-1R. FASEB J. 2019 (In

press).

12. Li Y, Deng S, Peng J, Wang X, Essandoh K, Mu X, Peng T, Meng ZX, Fan GC. MicroRNA-

223 is essential for maintaining functional β-cell mass during diabetes through inhibiting both

196

FOXO1 and SOX6 pathways. J Biol Chem. 2019 (In press)

Book Chapters

1. Essandoh K, Fan GC. Insights into the Mechanism of Exosome Formation and Secretion. In

the Book, “Mesenchymal Stem Cell Derived Exosomes: The Potential for Translational

Nanomedicine”. 2015, Waltham: Academic Press, Elsevier.

Conference Abstracts

1. Wang X, Huang W, Essandoh K, Liu G, Yang Y, Wang Y, Caldwell CC, Zingarelli B, Fan

GC. MiR- 223 is essential for mesenchymal stem cell-elicited cardio-protection in

polymicrobial sepsis. Shock, 2014. Presented at 37th Annual Conference on Shock, Charlotte,

NC, June 06-10, 2014.

2. Wang X, Qin D, Essandoh K, Huang W, Yang L, Gu H, Millard RW, Yang Y, Wang Y, Fan

GC. Blockade of Exosome Secretion Attenuates Inflammatory Cytokines, mitigates Cardiac

Dysfunction, and reduces Mortality in Polymicrobial Sepsis. Circulation, 2014. Presented at

American Heart Association Scientific Sessions, Chicago, IL, Nov 16 to Nov 18, 2014.

3. Essandoh K, Yang L, Huang W, Wang X, Qin D, Wang Y, Fan GC. Blockade Of Exosome

Release With GW4869 Dampens Sepsis-Induced Inflammation And Cardiac Dysfunction.

Shock, 2015. Presented at 38th Annual Conference on Shock, Denver, CO, June 06-09, 2015.

4. Essandoh K, Yang L, Wang X, Huang W, Qin D, Hao J, Wang Y, Zingarelli B, Peng T, Fan

GC. Blockade of exosome generation with GW4869 dampens the sepsis-induced

inflammation and cardiac dysfunction. Presented at 2015 meeting of National Directors of

197

Graduate Studies (NDOGS), Cincinnati OH, July 10 to July 12, 2015.

5. Mu X, Wang X, Essandoh K, Li Y, Qin D, Peng J, G Fan GC. Septic Exosomes Induce

Cardiac Vascular Hyperpermeability Through Increased Generation Of Podosomes In

Endothelial Cells. Shock, 2016. Presented at 39th Annual Conference on Shock, Austin, TX,

June 11 to June 14, 2016.

6. Essandoh K, Wang X, Jiang M, Mu X, Peng J, Li Y, Deng S, Salem E, Rubinstein J, Fan

GC. Tsg101 regulates RAB11FIP3-mediated Recycling of IGF-1R in Physiological Cardiac

Hypertrophy. Presented at the 37th Annual University of Cincinnati College of Medicine

Graduate Student Research Forum, Cincinnati OH, November 21, 2016.

7. Essandoh K, Wang X, Jiang M, Mu X, Peng J, Li Y, Deng S, Salem E, Rubinstein J, Fan

GC. Tsg101 Regulates Rab11FIP3-Mediated Endosomal Recycling of IGF-1R in

Physiological Cardiac Hypertrophy. The FASEB Journal, 2017. Presented at the Experimental

Biology Conference, Chicago, IL, April 22 to April 26, 2017.

8. Li Y, Peng J, Deng S, Wang X, Kuhel D, Cash J, Essandoh K, Mu X, Salem E, Hui D, Fan

GC. Knockout Of miR-223 Induces Beta-Cell Dysfunction Through Activation Of The Foxo1

Signaling Pathway. The FASEB Journal, 2017. Presented at the Experimental Biology

Conference, Chicago, IL, April 22 to April 26, 2017.

9. Mu X, Wang X, Li Y, Essandoh K, Peng J, Deng S, Salem ESB, Fan GC. Septic Exosomes

Induce Leukocyte Adhesion Through Transferring Exosomal ROS To Endothelial Cells.

Shock, 2017. Presented at 40th Annual Conference on Shock, Fort Lauderdale, FL, June 03-

06, 2017.

198

10. Essandoh K, Wang X, Mu X, Peng J, Li Y, Deng S, Gardner G, Jiang M, Kranias E,

Rubinstein J, Fan GC. Tumor Susceptibility Gene 101 positively regulates Physiological

Cardiac Hypertrophy by Promoting Endosomal Recycling of IGF-1R. Presented at the 38th

Annual University of Cincinnati College of Medicine Graduate Student Research Forum,

Cincinnati OH, October 05, 2017.

11. Essandoh K, Wang X, Jiang M, Mu X, Peng J, Li Y, Deng S, Rubinstein J, Fan GC. Tumor

Susceptibility Gene 101 positively regulates Physiological Cardiac Hypertrophy by

Promoting Endosomal Recycling of IGF-1R. Circulation. 2017. Presented at the American

Heart Association Scientific Sessions Anaheim, CA, November 11-15, 2017.

12. Deng S, Wang X, Essandoh K, Li Y, Peng J, Mu X, Huang K, Fan GC. Tsg101 Regulates

the P62-Keap1-Nrf2 Axis in Cardiomyocytes to Protect Against Cardiac

Ischemia/Reperfusion Injury. Circulation. 2017. Presented at the American Heart Association

Scientific Sessions Anaheim, CA, November 11-15, 2017.

13. Li Y, Deng S, Wang X, Robbins N, Mu X, Essandoh K, Rubinstein J, Fan GC. Regulatory

Role of Sectm1a in Macrophages to Treat Diabetes-Induced Cardiac Dysfunction. The FASEB

Journal, 2018. Presented at the Experimental Biology Conference, San Diego, CA, April 21

to April 25, 2018.

14. Li Y, Deng S, Wang X, Robbins N, Mu X, Essandoh K, Rubinstein J, Fan GC. Sectm1a

Deficiency Aggravates Endotoxin-Induced Inflammation And Myocardial Dysfunction Via

Augmenting IKBA Phosphorylation. Shock, 2018. Presented at 41st Annual Conference on

Shock, Scottsdale, AZ, June 09-12, 2018.

199

15. Mu X, Wang X, Fan H, Li Y, Deng S, Essandoh K, Fan GC. Sectm1a Is Critical For

Macrophage Phagocytosis During Polymicrobial Sepsis In Mice. Shock, 2018. Presented at

41st Annual Conference on Shock, Scottsdale, AZ, June 09-12, 2018.

16. Mu X, Wang X, Li Y, Deng S, Essandoh K, Fan GC. Sectm1a Attenuates Sepsis-Induced

Impairment Of Tissue-Resident Macrophage Self-Renewal Capacity In Mice. Shock, 2018.

Presented at 41st Annual Conference on Shock, Scottsdale, AZ, June 09-12, 2018.

17. Essandoh K, Wang X, Deng S, Robbins N, Huang W, Mu X, Peng J, Li Y, Wang Y,

Rubinstein J, Fan GC. Tumor Susceptibility Gene 101 Promotes Physiological Cardiac

Growth and Attenuates Pathological Cardiac Remodeling. Presented at the 33rd Meeting of

the Ohio Physiological Society, Cincinnati OH, September 28-29, 2018.

18. Essandoh K, Wang X, Deng S, Robbins N, Huang W, Mu X, Peng J, Li Y, Wang Y,

Rubinstein J, Fan GC. Tumor Susceptibility Gene 101 Promotes Physiological Cardiac

Growth and Attenuates Pathological Cardiac Remodeling. Presented at the 39th Annual

University of Cincinnati College of Medicine Graduate Student Research Forum, Cincinnati

OH, October 25, 2018.

19. Essandoh K, Deng S, Wang X, Mu X, Li Y, Fan GC. Tsg101 Ameliorates Endotoxin-Induced

Cardiac Dysfunction Through Enhancing p62/Parkin-Mediated Mitophagy. Circulation.

2018. Presented at the American Heart Association Scientific Sessions Chicago, IL,

November 10-12, 2018.

20. Essandoh K, Wang X, Deng S, Robbins N, Huang W, Mu X, Peng J, Li Y, Wang Y,

Rubinstein J, Fan GC. Tumor Susceptibility Gene 101 Promotes Physiological Cardiac

200

Growth and Attenuates Pathological Cardiac Remodeling. Circulation. 2018. Presented at the

American Heart Association Scientific Sessions Chicago, IL, November 10-12, 2018.

21. Deng S, Wang X, Essandoh K, Li Y, Peng J, Mu X, Huang K, Fan GC.Tsg101 Protects the

Heart Against Ischemia/Reperfusion Injury Through Aggregation of P62 and Activation of

NRF2 Signaling. Circulation. 2018. Presented at the American Heart Association Scientific

Sessions Chicago, IL, November 10-12, 2018.

22. Li Y, Deng S, Wang X, Robbins N, Mu X, Essandoh K, Adams D, Rubinstein J, Fan GC.

Secreted and Transmembrane 1a Regulates Macrophage Polarization and Diabetes-Induced

Cardiac Dysfunction. Circulation. 2018. Presented at the American Heart Association

Scientific Sessions Chicago, IL, November 10-12, 2018.

Honors/Awards

1. Albert J Ryan Fellowship, University of Cincinnati, 2016-2018.

2. Honorable mention, Graduate Student Research Forum, University of Cincinnati, 2016.

3. American Heart Association Predoctoral Fellowship, 2018-2020.

4. Honorable mention, Graduate Student Research Forum, University of Cincinnati, 2018.

201