DOCSLIB.ORG

Curvibasidium Rogersii, a New Yeast Species in the Microbotryomycetes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Curvibasidium Rogersii, a New Yeast Species in the Microbotryomycetes North American Fungi Volume 7, Number 12, Pages 1-8 Published December 21, 2012 Curvibasidium rogersii, a new yeast species in the Microbotryomycetes Tyler B. Bourret1, Charles G. Edwards2, Thomas Henick-Kling3, and Dean A. Glawe1,4 1Department of Plant Pathology, Washington State University, Pullman, WA 99164; 2School of Food Science, Washington State University, Pullman, WA 99164; 3School of Food Science, Washington State University, Richland, WA 99354; 4School of Environmental and Forest Sciences, University of Washington, Seattle, WA 98195. Bourret, T. B., C. G. Edwards, T. Henick-Kling, and D. A. Glawe. 2012. Curvibasidium rogersii, a new yeast species in the Microbotryomycetes. North American Fungi 7(12): 1-8. doi: http://dx.doi:10.2509/naf2012.007.012 Corresponding author: D. A. Glawe [email protected]. Accepted for publication December 6, 2012. http://pnwfungi.org Copyright © 2012 Pacific Northwest Fungi Project. All rights reserved. Abstract: Curvibasidium rogersii sp. nov. (Microbotryomycetes, Basidiomycota) is described on the basis of a strain (NRRL Y-48849) isolated from wine grapes (Vitis vinifera) in Washington state (USA). The taxonomic position of the strain was determined through analysis of the ITS region and the D1/D2 domains of the LSU rRNA gene. Physiological and morphological data also are presented. A basidial state was not observed. Key words: anamorphic yeast, enology, Pacific Northwest fungi, viticulture, wine microbiology, yeast systematics, yeast taxonomy 2 Bourret et al. Curvibasidium rogersii. North American Fungi 7(12): 1-8 Introduction: During a survey of yeasts Carbon assimilation tests were performed with 5- occurring on wine grapes (Vitis vinifera L.) in ml of liquid media in polypropylene 17 x 100 mm central Washington state (USA), a strain was test tubes, using 36 carbon sources. Nitrogen isolated that could not be assigned to any assimilation tests of nitrate, L-lysine and described species. Phylogenetic analysis of D1/D2 cadaverine were carried out on agar cultures and large subunit (LSU) and ITS region of nuclear in liquid media. Additional tests of 25 and 30 °C, ribosomal DNA (rDNA) indicated that the strain 0.01% w/v cycloheximide and 10% w/v NaCl is a member of the Curvibasidium clade of class were performed in 5 ml of liquid media. The Microbotryomycetes (Basidiomycota: following strains from the USDA ARS Culture Pucciniomycotina). Herein the fungus is Collection (NRRL) (Peoria, IL, USA) were used to described as a new species of Curvibasidium. calibrate the tests (equivalent CBS strain This paper describes morphological and designations are also listed): Candida oleophila physiological characteristics of this species and (type strain), NRRL Y-2317T = CBS 2219T; results of phylogenetic analyses of the D1/D2 and Candida oleophila, NRRL Y-1880 = CBS 2220; ITS regions. Candida railenensis, NRRL Y-2319 = CBS 2223; Candida saitoana (type strain), NRRL Y-17316T Materials and Methods: The fungus was = CBS 940T; Metschnikowia chrysoperlae (type isolated from a sample consisting of five ‘Riesling’ strain), NRRL Y-27615T = CBS 9803T; (Vitis vinifera L.) grape bunches collected on Rhodotorula nothofagi, NRRL Y-17176T = CBS September 14, 2010 from an experimental 8166T; and Sporobolomyces kluyveri-nielii (type vineyard at the Irrigated Agriculture Research strain), NRRL Y-17211T = CBS 7168T. Both the D- and Extension Center (IAREC) near Prosser, glucose assimilation and 25 °C growth tests were Benton County, Washington state, USA. Berries conducted without negative controls. All were chilled on ice until they were macerated. physiology tests were performed in triplicate, and Macerate was streaked onto Wallerstein Labs results were confirmed at least once. nutrient agar (WLNA) (BD, Franklin Lakes, NJ, DNA was extracted using a “FastDNA® Spin Kit” USA) supplemented with 100 mg/L streptomycin (MP Biomedicals, LLC, Solon, OH, USA) sulfate (Sigma-Aldrich Co. LLC, St. Louis, MO, according to the manufacturer’s instructions. USA). The isolation plate was incubated at 20 – PCR to amplify ITS and D1-D3 LSU regions were 22 °C for 5-7 days before culture purification on conducted using the following primer potato dextrose agar (PDA) (BD, Franklin Lakes, combinations ITS1 NJ, USA). (TCCGTAGGTGAACCTGCGG; White et al., 1990) and ITS4 (TCCTCCGCTTATTGATATGC; White et For morphological characterization, NRRL Y- al., 1990); ITS5 48849 was grown on PDA for 7 days at 20 - 22 (GGAAGTAAAAGTCGTAACAAGG; White et al., °C. Morphological features were characterized as 1990) and ITS4; ITS5 and LR3 described in Kurtzman et al. (2011). (CCGTGTTTCAAGACGGG; Vilgalys and Hester, Photomicrographs were obtained using bright- 1990); and NL1 field illumination with a Zeiss Axioskop 40 (GCATATCAATAAGCGGAGGAAAAG; Kurtzman microscope and an Axiocam HRc camera using and Robnett, 1998) and TW14 Axiovision software (Carl Zeiss Microscopy, LLC, (GCTATCCTGAGGGAAACTT; Hamby et al. Thornwood, NY, USA). 1988). 25 μl reactions containing 5.0 μl of DNA template (10.0 ng/μl), 1.0 μl each of forward and Physiology tests were performed using methods reverse primers (4.0 pmol/μl), 4.0 μl of dNTP, adapted from Kurtzman et al. (2011), based on 5.0 μl of 5x GoTaq ® Flexi Buffer (Promega, the methods first outlined by Wickerham (1951). Madison, WI, USA), 1.5 μl at MgCl2 (25 mmol/μl) Bourret et al. Curvibasidium rogersii. North American Fungi 7(12): 1-8 3 (Promega, Madison, WI, USA) and 0.5 μl of as separate partitions during NJ. Model choice GoTaq ® Taq Polymerase (Promega, Madison, was based on Akaike Information Criterion (AIC) WI, USA) were used. PCR cycles consisted of a 4- (Akaike, 1974) rank using the program jModeltest min initial denature at 94 °C, followed by (Posada, 2008; Guindon, 2003). Models are denaturing for 30-sec at 94 °C, annealing for 30 referred to using acronyms in Posada (2009). sec at 54 °C, extension for 1-min at 72 °C and a Support values are presented as percentage final 10 min 72 °C extension. PCR products were bootstrap scores. The scale for the ML tree is visualized using a 1.4% agarose gel and cleaned substitutions per site. Trees were visualized and using ExoSAP-IT (Affymetrix, Inc., Santa Clara, rooted using the program FigTree CA, USA). Products were sequenced using PCR (http://tree.bio.ed.ac.uk/software/figtree/) and primers by ELIM Biopharm (Hayward, CA, USA). annotated using GIMP®. Sequencing was performed with ABI 3730 (Life Technologies, Carlsbad, CA, USA) sequencers Results: The D1/D2 sequence of NRRL Y- using dye terminator methods. Chromatograms 48849 differed by 6 bp from the type strain of the resulting from sequencing reactions were most closely-related species, C. cygneicollum. analyzed using the Chromaseq 1.0 plugin to ITS sequences from NRRL Y-48849 and the type Mesquite 2.75 (Maddison and Maddison, 2011a; strain of C. cygneicollum differed by 8 bp. In Maddison and Maddison, 2011b), using the phylogenetic analyses (Figs. 2, 3), NRRL Y-48849 programs phred 0.071220.c (Green and Ewing, is well separated from all other members of the 2002) and phrap 1.090518 (Green, 2009) to call Curvibasidium clade which includes several bases, assemble contigs, and assess quality. The species currently classified as Rhodotorula. resulting sequence was deposited in GenBank These results suggest strongly that NRRL Y- (http://www.ncbi.nlm.nih.gov/genbank/) under 48849 represents a distinct, previously the accession JX188232. undescribed species. Physiological tests can be used to separate this species from other members An alignment consisting of both ITS and D1/D2 of the Curvibasidium clade, but the differences sequences from type strains of the are few and may be unreliable with inclusion of Curvibasidium clade was assembled using results additional strains of each species. Consequently, from Sampaio (2011a). Separate ITS and D1/D2 recognition of this species should be based on alignments were constructed from sequences diagnostic gene sequences. In view of the related to NRRL Y-48849 that were identified nucleotide divergence observed between NRRL from BLAST searches of GenBank (Altschul, Y-48849 and other members of the 1990). The ITS sequence used for the type strain Curvibasidium clade, the following new species is of Leucosporidium fasciculatum, CBS 8786T was described. obtained from the CBS database. The type strain of Rhodotorula ingeniosa was included in all alignments and used to root all resulting trees. Curvibasidium rogersii Tyler B. Bourret Sequences were aligned using the rmcoffee mode and Dean A. Glawe sp. nov. of the program T-Coffee (Notredame et al., 2000) Mycobank number: MB802630 and edited manually. Trees were inferred from each alignment using neighbor joining (NJ) and Etymology: Curvibasidium rogersii (ro.gers´i.i. maximum likelihood (ML) methods. MEGA 5.05 N.L. gen. masc. sing. n. rogersii of Rogers, in (Tamura et al., 2011) was used for NJ analysis honor of Professor J. D. Rogers for his and GARLI 2.0 (Zwickl, 2006) for ML. One contributions to fungal systematics). thousand bootstrap replications were used for Cultura in agaro “PDA” post dies septem ad 20- both methods. ITS and D1/D2 loci were analyzed 22C alba aut cremea, butyrosa, semi-nitens et 4 Bourret et al. Curvibasidium rogersii. North American Fungi 7(12): 1-8 marginibus integris. Cellulae ovoideae aut cylindraceae, (2.5-)3.5-7.0 μm x 2.0-3.0(-3.5) μm, per germinationem polarem reproducentes. Hyphae et pseudohyphae non formantur. D- glucosum, D-galactosum, L-sorbosum, D- xylosum, L-arabinosum, D-arabinosum (tarde), cellobiosum, salicinum, ribitolum, xylitolum, D- glucitolum, D-mannitolum, galactitolum, D- glucono-1,5-lactonum, 2-keto-D-gluconas (variabiliter), D-gluconas (variabiliter), acidum succinicum, ethanolum and acidum gallicum assimilantur. D-glucosaminum, D-ribosum, L- Fig. 1. Cells of Curvibasidium rogersii sp. nov. rhamnosum, sucrosum, maltosum, trehalosum, NRRL Y-Y-48849 after 7 days in PDA at 20-22 C. methyl α-D-glucosidum, melibiosum, lactosum, Scale bar = 5 µm. raffinosum, amylum, erythritolum, inositolum, D-acidum glucuronicum, DL-acidum lacticum, acidum citricum et acidum m- and Leucosporidium fasciculatum are shown in hydroxybenzoicum non assimilantur.
Load more

Recommended publications
  • Fungal Endophytes from the Aerial Tissues of Important Tropical Forage Grasses Brachiaria Spp
    University of Kentucky UKnowledge International Grassland Congress Proceedings XXIII International Grassland Congress Fungal Endophytes from the Aerial Tissues of Important Tropical Forage Grasses Brachiaria spp. in Kenya Sita R. Ghimire International Livestock Research Institute, Kenya Joyce Njuguna International Livestock Research Institute, Kenya Leah Kago International Livestock Research Institute, Kenya Monday Ahonsi International Livestock Research Institute, Kenya Donald Njarui Kenya Agricultural & Livestock Research Organization, Kenya Follow this and additional works at: https://uknowledge.uky.edu/igc Part of the Plant Sciences Commons, and the Soil Science Commons This document is available at https://uknowledge.uky.edu/igc/23/2-2-1/6 The XXIII International Grassland Congress (Sustainable use of Grassland Resources for Forage Production, Biodiversity and Environmental Protection) took place in New Delhi, India from November 20 through November 24, 2015. Proceedings Editors: M. M. Roy, D. R. Malaviya, V. K. Yadav, Tejveer Singh, R. P. Sah, D. Vijay, and A. Radhakrishna Published by Range Management Society of India This Event is brought to you for free and open access by the Plant and Soil Sciences at UKnowledge. It has been accepted for inclusion in International Grassland Congress Proceedings by an authorized administrator of UKnowledge. For more information, please contact [email protected]. Paper ID: 435 Theme: 2. Grassland production and utilization Sub-theme: 2.2. Integration of plant protection to optimise production
    [Show full text]
  • Fungal Evolution: Major Ecological Adaptations and Evolutionary Transitions
    Biol. Rev. (2019), pp. 000–000. 1 doi: 10.1111/brv.12510 Fungal evolution: major ecological adaptations and evolutionary transitions Miguel A. Naranjo-Ortiz1 and Toni Gabaldon´ 1,2,3∗ 1Department of Genomics and Bioinformatics, Centre for Genomic Regulation (CRG), The Barcelona Institute of Science and Technology, Dr. Aiguader 88, Barcelona 08003, Spain 2 Department of Experimental and Health Sciences, Universitat Pompeu Fabra (UPF), 08003 Barcelona, Spain 3ICREA, Pg. Lluís Companys 23, 08010 Barcelona, Spain ABSTRACT Fungi are a highly diverse group of heterotrophic eukaryotes characterized by the absence of phagotrophy and the presence of a chitinous cell wall. While unicellular fungi are far from rare, part of the evolutionary success of the group resides in their ability to grow indefinitely as a cylindrical multinucleated cell (hypha). Armed with these morphological traits and with an extremely high metabolical diversity, fungi have conquered numerous ecological niches and have shaped a whole world of interactions with other living organisms. Herein we survey the main evolutionary and ecological processes that have guided fungal diversity. We will first review the ecology and evolution of the zoosporic lineages and the process of terrestrialization, as one of the major evolutionary transitions in this kingdom. Several plausible scenarios have been proposed for fungal terrestralization and we here propose a new scenario, which considers icy environments as a transitory niche between water and emerged land. We then focus on exploring the main ecological relationships of Fungi with other organisms (other fungi, protozoans, animals and plants), as well as the origin of adaptations to certain specialized ecological niches within the group (lichens, black fungi and yeasts).
    [Show full text]
  • The Flora Mycologica Iberica Project Fungi Occurrence Dataset
    A peer-reviewed open-access journal MycoKeys 15: 59–72 (2016)The Flora Mycologica Iberica Project fungi occurrence dataset 59 doi: 10.3897/mycokeys.15.9765 DATA PAPER MycoKeys http://mycokeys.pensoft.net Launched to accelerate biodiversity research The Flora Mycologica Iberica Project fungi occurrence dataset Francisco Pando1, Margarita Dueñas1, Carlos Lado1, María Teresa Telleria1 1 Real Jardín Botánico-CSIC, Claudio Moyano 1, 28014, Madrid, Spain Corresponding author: Francisco Pando ([email protected]) Academic editor: C. Gueidan | Received 5 July 2016 | Accepted 25 August 2016 | Published 13 September 2016 Citation: Pando F, Dueñas M, Lado C, Telleria MT (2016) The Flora Mycologica Iberica Project fungi occurrence dataset. MycoKeys 15: 59–72. doi: 10.3897/mycokeys.15.9765 Resource citation: Pando F, Dueñas M, Lado C, Telleria MT (2016) Flora Mycologica Iberica Project fungi occurrence dataset. v1.18. Real Jardín Botánico (CSIC). Dataset/Occurrence. http://www.gbif.es/ipt/resource?r=floramicologicaiberi ca&v=1.18, http://doi.org/10.15468/sssx1e Abstract The dataset contains detailed distribution information on several fungal groups. The information has been revised, and in many times compiled, by expert mycologist(s) working on the monographs for the Flora Mycologica Iberica Project (FMI). Records comprise both collection and observational data, obtained from a variety of sources including field work, herbaria, and the literature. The dataset contains 59,235 records, of which 21,393 are georeferenced. These correspond to 2,445 species, grouped in 18 classes. The geographical scope of the dataset is Iberian Peninsula (Continental Portugal and Spain, and Andorra) and Balearic Islands. The complete dataset is available in Darwin Core Archive format via the Global Biodi- versity Information Facility (GBIF).
    [Show full text]
  • A Higher-Level Phylogenetic Classification of the Fungi
    mycological research 111 (2007) 509–547 available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/mycres A higher-level phylogenetic classification of the Fungi David S. HIBBETTa,*, Manfred BINDERa, Joseph F. BISCHOFFb, Meredith BLACKWELLc, Paul F. CANNONd, Ove E. ERIKSSONe, Sabine HUHNDORFf, Timothy JAMESg, Paul M. KIRKd, Robert LU¨ CKINGf, H. THORSTEN LUMBSCHf, Franc¸ois LUTZONIg, P. Brandon MATHENYa, David J. MCLAUGHLINh, Martha J. POWELLi, Scott REDHEAD j, Conrad L. SCHOCHk, Joseph W. SPATAFORAk, Joost A. STALPERSl, Rytas VILGALYSg, M. Catherine AIMEm, Andre´ APTROOTn, Robert BAUERo, Dominik BEGEROWp, Gerald L. BENNYq, Lisa A. CASTLEBURYm, Pedro W. CROUSl, Yu-Cheng DAIr, Walter GAMSl, David M. GEISERs, Gareth W. GRIFFITHt,Ce´cile GUEIDANg, David L. HAWKSWORTHu, Geir HESTMARKv, Kentaro HOSAKAw, Richard A. HUMBERx, Kevin D. HYDEy, Joseph E. IRONSIDEt, Urmas KO˜ LJALGz, Cletus P. KURTZMANaa, Karl-Henrik LARSSONab, Robert LICHTWARDTac, Joyce LONGCOREad, Jolanta MIA˛ DLIKOWSKAg, Andrew MILLERae, Jean-Marc MONCALVOaf, Sharon MOZLEY-STANDRIDGEag, Franz OBERWINKLERo, Erast PARMASTOah, Vale´rie REEBg, Jack D. ROGERSai, Claude ROUXaj, Leif RYVARDENak, Jose´ Paulo SAMPAIOal, Arthur SCHU¨ ßLERam, Junta SUGIYAMAan, R. Greg THORNao, Leif TIBELLap, Wendy A. UNTEREINERaq, Christopher WALKERar, Zheng WANGa, Alex WEIRas, Michael WEISSo, Merlin M. WHITEat, Katarina WINKAe, Yi-Jian YAOau, Ning ZHANGav aBiology Department, Clark University, Worcester, MA 01610, USA bNational Library of Medicine, National Center for Biotechnology Information,
    [Show full text]
  • A Survey of Ballistosporic Phylloplane Yeasts in Baton Rouge, Louisiana
    Louisiana State University LSU Digital Commons LSU Master's Theses Graduate School 2012 A survey of ballistosporic phylloplane yeasts in Baton Rouge, Louisiana Sebastian Albu Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_theses Part of the Plant Sciences Commons Recommended Citation Albu, Sebastian, "A survey of ballistosporic phylloplane yeasts in Baton Rouge, Louisiana" (2012). LSU Master's Theses. 3017. https://digitalcommons.lsu.edu/gradschool_theses/3017 This Thesis is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Master's Theses by an authorized graduate school editor of LSU Digital Commons. For more information, please contact [email protected]. A SURVEY OF BALLISTOSPORIC PHYLLOPLANE YEASTS IN BATON ROUGE, LOUISIANA A Thesis Submitted to the Graduate Faculty of the Louisiana Sate University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Master of Science in The Department of Plant Pathology by Sebastian Albu B.A., University of Pittsburgh, 2001 B.S., Metropolitan University of Denver, 2005 December 2012 Acknowledgments It would not have been possible to write this thesis without the guidance and support of many people. I would like to thank my major professor Dr. M. Catherine Aime for her incredible generosity and for imparting to me some of her vast knowledge and expertise of mycology and phylogenetics. Her unflagging dedication to the field has been an inspiration and continues to motivate me to do my best work.
    [Show full text]
  • Microplastics Accumulate Fungal Pathogens in Terrestrial Ecosystems
    www.nature.com/scientificreports OPEN Microplastics accumulate fungal pathogens in terrestrial ecosystems Gerasimos Gkoutselis1,5, Stephan Rohrbach2,5, Janno Harjes1, Martin Obst3, Andreas Brachmann4, Marcus A. Horn2* & Gerhard Rambold1* Microplastic (MP) is a pervasive pollutant in nature that is colonised by diverse groups of microbes, including potentially pathogenic species. Fungi have been largely neglected in this context, despite their afnity for plastics and their impact as pathogens. To unravel the role of MP as a carrier of fungal pathogens in terrestrial ecosystems and the immediate human environment, epiplastic mycobiomes from municipal plastic waste from Kenya were deciphered using ITS metabarcoding as well as a comprehensive meta-analysis, and visualised via scanning electron as well as confocal laser scanning microscopy. Metagenomic and microscopic fndings provided complementary evidence that the terrestrial plastisphere is a suitable ecological niche for a variety of fungal organisms, including important animal and plant pathogens, which formed the plastisphere core mycobiome. We show that MPs serve as selective artifcial microhabitats that not only attract distinct fungal communities, but also accumulate certain opportunistic human pathogens, such as cryptococcal and Phoma-like species. Therefore, MP must be regarded a persistent reservoir and potential vector for fungal pathogens in soil environments. Given the increasing amount of plastic waste in terrestrial ecosystems worldwide, this interrelation may have severe consequences for the trans-kingdom and multi-organismal epidemiology of fungal infections on a global scale. Plastic waste, an inevitable and inadvertent marker of the Anthropocene, has become a ubiquitous pollutant in nature1. Plastics can therefore exert negative efects on biota in both, aquatic and terrestrial ecosystems.
    [Show full text]
  • Forest Tree Species Composition and Abiotic Site Conditions Drive Soil Fungal 2 Communities and Functional Groups
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.21.453256; this version posted July 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Forest tree species composition and abiotic site conditions drive soil fungal 2 communities and functional groups 3 Likulunga Emmanuel Likulunga a,b, Carmen Alicia Rivera Pérez a, Dominik Schneider c, 4 Rolf Daniel c, Andrea Polle a,* 5 6 a Forest Botany and Tree Physiology, University of Goettingen, Büsgenweg 2, 37077 7 Göttingen, Germany 8 b Biological Sciences Department, University of Zambia, Great East Road Campus, 9 32379 Lusaka, Zambia 10 c Genomic and Applied Microbiology and Göttingen Genomics Laboratory, University of 11 Göttingen, 37077 Göttingen, Germany 12 13 Corresponding author. 14 E-mail address: [email protected] (A. Polle). 15 Address: Forest Botany and Tree Physiology, Faculty of Forest Sciences, University of 16 Göttingen, Büsgenweg 2, 37077, Göttingen, Germany. 17 18 Key words: Fungal communities, pure and mixed tree stands, symbiotrophs, 19 saprotrophs, soil properties, ITS2 20 21 22 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.21.453256; this version posted July 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • Metsakultuuride Kahjurputukad Kui Seenpatogeenide Levitajad
    TARTU ÜLIKOOL LOODUS- JA TÄPPISTEADUSTE VALDKOND MOLEKULAAR- JA RAKUBIOLOOGIA INSTITUUT ÖKOLOOGIA JA MAATEADUSTE INSTITUUT MÜKOLOOGIA ÕPPETOOL Riho Remmelgas Metsakultuuride kahjurputukad kui seenpatogeenide levitajad Magistritöö geenitehnoloogia erialal Maht 30 EAP Juhendajad vanemteadur Leho Tedersoo dotsent Rein Drenkhan Tartu 2016 Metsakultuuride kahjurputukad kui seenpatogeenide levitajad. Varem tehtud teadustöödes on leitud, et erinevat liiki ürasklased (Scolydinae) levitavad mitmeid olulisi puittaimede seenpatogeene. Tunduvalt vähem on seenpatogeenide levitajatena uuritud männikärsakaid (Hylobius sp.). Kasutades kaasaegseid bioinformaatilisi meetodeid, määrati seenekooslused nii putukkahjurite kui ka puittaimede proovidest. Seenekooslused määrati seente rDNA ITS2 järjestuste alusel. Töö tulemusena määrati kahjurputukate proovidest puidusinetust põhjustavaid seenpatogeene nagu Ophiostoma sp., Ceratocystis sp. ja Pesotum sp., juuremädanikku põhjustavaid külmaseeni (Armillaria sp.) ja juurepessu (Heterobasidion spp.), ning taimede seenpatogeene nagu Neonectria sp., Phoma herbarium, Peniophora limitata, Pyrenochaeta cava ja Phaeoacremonium hungaricum. Märksõnad Männikärsakad; Ürasklased; Okaspuutaimed; ITS2 järjestused; Illumina MiSeq sekvenaator; Bioinformaatiline töötlus; Ophiostoma sp.; Ceratocystis sp.; Armillaria sp.; Heterobasidion spp. B110- Bioinformaatika, meditsiiniinformaatika, biomatemaatika, biomeetria; B230- Mikrobioloogia, bakterioloogia, viroloogia, mükoloogia; B250- Entomoloogia, taimede parasitoloogia. Pathogenic
    [Show full text]
  • Systema Naturae. the Classification of Living Organisms
    Systema Naturae. The classification of living organisms. c Alexey B. Shipunov v. 5.601 (June 26, 2007) Preface Most of researches agree that kingdom-level classification of living things needs the special rules and principles. Two approaches are possible: (a) tree- based, Hennigian approach will look for main dichotomies inside so-called “Tree of Life”; and (b) space-based, Linnaean approach will look for the key differences inside “Natural System” multidimensional “cloud”. Despite of clear advantages of tree-like approach (easy to develop rules and algorithms; trees are self-explaining), in many cases the space-based approach is still prefer- able, because it let us to summarize any kinds of taxonomically related da- ta and to compare different classifications quite easily. This approach also lead us to four-kingdom classification, but with different groups: Monera, Protista, Vegetabilia and Animalia, which represent different steps of in- creased complexity of living things, from simple prokaryotic cell to compound Nature Precedings : doi:10.1038/npre.2007.241.2 Posted 16 Aug 2007 eukaryotic cell and further to tissue/organ cell systems. The classification Only recent taxa. Viruses are not included. Abbreviations: incertae sedis (i.s.); pro parte (p.p.); sensu lato (s.l.); sedis mutabilis (sed.m.); sedis possi- bilis (sed.poss.); sensu stricto (s.str.); status mutabilis (stat.m.); quotes for “environmental” groups; asterisk for paraphyletic* taxa. 1 Regnum Monera Superphylum Archebacteria Phylum 1. Archebacteria Classis 1(1). Euryarcheota 1 2(2). Nanoarchaeota 3(3). Crenarchaeota 2 Superphylum Bacteria 3 Phylum 2. Firmicutes 4 Classis 1(4). Thermotogae sed.m. 2(5).
    [Show full text]
  • Supplementary Materials For
    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2019 Supplementary materials for: Fungal community analysis in the seawater of the Mariana Trench as estimated by Illumina HiSeq Zhi-Peng Wang b, †, Zeng-Zhi Liu c, †, Yi-Lin Wang d, Wang-Hua Bi c, Lu Liu c, Hai-Ying Wang b, Yuan Zheng b, Lin-Lin Zhang e, Shu-Gang Hu e, Shan-Shan Xu c, *, Peng Zhang a, * 1 Tobacco Research Institute, Chinese Academy of Agricultural Sciences, Qingdao, 266101, China 2 Key Laboratory of Sustainable Development of Polar Fishery, Ministry of Agriculture and Rural Affairs, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao, 266071, China 3 School of Medicine and Pharmacy, Ocean University of China, Qingdao, 266003, China. 4 College of Science, China University of Petroleum, Qingdao, Shandong 266580, China. 5 College of Chemistry & Environmental Engineering, Shandong University of Science & Technology, Qingdao, 266510, China. a These authors contributed equally to this work *Authors to whom correspondence should be addressed Supplementary Table S1. Read counts of OTUs in different sampled sites. OTUs M1.1 M1.2 M1.3 M1.4 M3.1 M3.2 M3.4 M4.2 M4.3 M4.4 M7.1 M7.2 M7.3 Total number OTU1 13714 398 5405 671 11604 3286 3452 349 3560 2537 383 2629 3203 51204 OTU2 6477 2203 2188 1048 2225 1722 235 1270 2564 5258 7149 7131 3606 43089 OTU3 165 39 13084 37 81 7 11 11 2 176 289 4 2102 16021 OTU4 642 4347 439 514 638 191 170 179 0 1969 570 678 0 10348 OTU5 28 13 4806 7 44 151 10 620 3
    [Show full text]
  • Antibiotic Resistant Bacteria and Commensal Fungi Are Common 2 and Conserved in the Mosquito Microbiome 3 4 Josephine Hyde1, Courtney Gorham1, Doug E
    bioRxiv preprint doi: https://doi.org/10.1101/670802; this version posted June 13, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Antibiotic resistant bacteria and commensal fungi are common 2 and conserved in the mosquito microbiome 3 4 Josephine Hyde1, Courtney Gorham1, Doug E. Brackney1,2, Blaire Steven1* 5 6 1Department of Environmental Sciences, Connecticut Agricultural Experiment Station, 7 New Haven, CT, USA 8 9 2Center for Vector Biology and Zoonotic Diseases, Connecticut Agricultural Experiment 10 Station, New Haven, CT, USA 11 12 13 14 *Corresponding author 15 E-mail: [email protected] 16 17 18 19 20 21 22 23 24 25 26 Short title: Antibiotic resistant bacteria in mosquitoes 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 1 bioRxiv preprint doi: https://doi.org/10.1101/670802; this version posted June 13, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 46 Abstract 47 The emerging and increasing prevalence of bacterial antibiotic resistance is a 48 significant public health challenge. To begin to tackle this problem, it will be critical to 49 not only understand the origins of this resistance but also document environmental 50 reservoirs of antibiotic resistance.
    [Show full text]
  • Eighteen New Oleaginous Yeast Species
    J Ind Microbiol Biotechnol (2016) 43:887–900 DOI 10.1007/s10295-016-1765-3 BIOENERGY/BIOFUELS/BIOCHEMICALS Eighteen new oleaginous yeast species Luis A. Garay1 · Irnayuli R. Sitepu1,2 · Tomas Cajka3 · Idelia Chandra1 · Sandy Shi1 · Ting Lin1 · J. Bruce German4 · Oliver Fiehn3,5 · Kyria L. Boundy‑Mills1 Received: 15 February 2016 / Accepted: 28 March 2016 / Published online: 12 April 2016 © Society for Industrial Microbiology and Biotechnology 2016 Abstract Of 1600 known species of yeasts, about 70 are species were not previously reported to be oleaginous. Tria- known to be oleaginous, defined as being able to accu- cylglycerol profiles were suitable for biodiesel production. mulate over 20 % intracellular lipids. These yeasts have These results greatly expand the number of known oleagi- value for fundamental and applied research. A survey of nous yeast species, and reveal the wealth of natural diver- yeasts from the Phaff Yeast Culture Collection, University sity of triacylglycerol profiles within wild-type oleaginous of California Davis was performed to identify additional Basidiomycetes. oleaginous species within the Basidiomycota phylum. Fifty-nine strains belonging to 34 species were grown in Keywords Oleaginous yeast · Triacylglycerol · lipid inducing media, and total cell mass, lipid yield and Basidiomycete · Intracellular lipid · Biodiesel triacylglycerol profiles were determined. Thirty-two spe- cies accumulated at least 20 % lipid and 25 species accu- mulated over 40 % lipid by dry weight. Eighteen of these Introduction The term oleaginous is used to describe microorganisms L. A. Garay, I. R. Sitepu and T. Cajka contributed equally to the capable of accumulating at least 20 % intracellular oil realization of the manuscript and are co-first authors.
    [Show full text]