DOCSLIB.ORG

Chemoorganotrophic Bacteria Isolated from Biodeteriorated Surfaces in Cave and Catacombs Filomena De Leo1, Agnese Iero1, Gabrielle Zammit2, and Clara E

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chemoorganotrophic Bacteria Isolated from Biodeteriorated Surfaces in Cave and Catacombs Filomena De Leo1, Agnese Iero1, Gabrielle Zammit2, and Clara E International Journal of Speleology 41(2) 125-136 Tampa, FL (USA) July 2012 Available online at scholarcommons.usf.edu/ijs/ & www.ijs.speleo.it International Journal of Speleology Official Journal of Union Internationale de Spéléologie Chemoorganotrophic bacteria isolated from biodeteriorated surfaces in cave and catacombs Filomena De Leo1, Agnese Iero1, Gabrielle Zammit2, and Clara E. Urzì1 Abstract: De Leo F., Iero A., Zammit G. and Urzì C. 2012. Chemoorganotrophic bacteria isolated from biodeteriorated surfaces in cave and catacombs. International Journal of Speleology, 41(2), 125-136 Tampa, FL (USA). ISSN 0392-6672. http://dx.doi.org/10.5038/1827-806X.41.2.1 The main objective of this work was the comparative analysis of a large number of bacterial strains isolated from biodeteriorated surfaces in three different sites, namely the catacombs of St. Callistus in Rome, Italy, the catacombs dedicated to St. Agatha in Ra- bat, Malta and the Cave of Bats in Zuheros, Spain. Our results showed that even considering only culturable chemoorganotrophic bacteria the variability is very high, reflecting the great variety of microhabitats present. Hence any strategies to prevent, control or eliminate the biofilm-embedded microbiota from an archeological surface should take into account a number of considerations as stipulated in our study. Keywords: biofilm; catacombs; caves; chemoorganotrophic bacteria; clustering; 16S rDNA sequencing Received 20 October 2011; Revised 2 January 2012; Accepted 10 January 2012 in most cases, strains that grow in culture can prove INTRODUCTION to be metabolically active microorganisms, if the en- Any study of microbial communities colonizing bi- vironment provides the required conditions. This is odeteriorated surfaces should involve a combination particularly true in the conservation of indoor Cultur- of several analytical techniques such as microscopy, al Heritage monuments where most of the dangerous culture techniques, biochemical tests and molecular microorganisms for the artefact itself (biodeteriogens) tools, which are designed to give complementary re- are those that grow epilithically on the surfaces; they sults. Each individual technique while having its own form a biofilm and cover areas that are the most valu- limitations, contributes the necessary information to able because are sculptured or painted. provide a better understanding of the microbial com- Very often, in fact, stone surfaces are hidden by munity as a whole and its role in the deterioration of unaesthetic colonization due to phototrophic and inorganic and/or organic substrata (Urzì et al., 2003). chemoorganotrophic biofilms (Roldán & Hernández- Culture-based techniques are selective due to the Mariné, 2009), and it is a common practice to treat limited choice of media used for the cultivation of mi- those surfaces with biocides in order to eradicate the croorganisms, and because the viable and culturable biodeteriogens present (Nugari et al., 2009). microflora (VCM) may be restricted to 1 to 5% of the However, biocides commonly applied on valuable whole population (Amann, 2000). However, the cul- surfaces are not always completely successful to erad- ture-based approach offers the possibility to isolate icate the complex community within the biofilm (Sal- and thus analyze a great number of strains (Donachie vadori & Charola, 2011). Thus it is important to study et al.,2007). It is then possible to study the isolated the culturable fraction of microorganisms in order strains, to cluster them into operational taxonomic to test in the laboratory if the chemical compounds units (OTUs), to compare different microbial commu- used are effective against the deteriogenic microflora. nities on the basis of types of cultivable bacteria iso- For this reason, when dealing with a large number lated in term of richness and the frequency of isolates, of strains, it is imperative to use a reliable and easily distribution or relative abundance of types. Further- implemented technique to group the strains into ho- more, cultivation-based techniques in association mogeneous clusters and reduce the amount of work with other complementary molecular techniques give to be carried out to characterize the isolates. a good idea of the “microorganisms in action” because, In this research study a large number of cultiva- ble bacteria isolated from three sites were analyzed 1Department of Life Sciences, “M. Malpighi” University of Messi- through a multi-step approach that included the fre-fre- na, Viale F. Stagno d’Alcontres 31, 98166 Messina, Italy;����� Cor- quency of types of colony, preliminary description of responding author: Clara Urzì ([email protected]) their micro-morphology,������������������������������� clusterization of all the iso- 2Department of Physiology and Biochemistry, University of Mal- lates via ITS-PCR, and the identification of selected ta, Biomedical Sciences Building, Msida, MSD2620, Malta. strains within each cluster. 126 Chemoorganotrophic bacteria isolated from cave and catacombs Cultural analyses MATERIAL AND METHODS For the isolation of chemoorganotrophic mi- Areas of study croorganisms samples were processed as de- Sampling campaigns were carried out in the scribed by Urzì et al. (2010). The following Ocean Cubicle (CSC13), inside the Catacombs of St. agarized media were used: BRII medium (Bunt Callistus (Rome, Italy), in the Cave of Bats (Z1 to Z8) and Rovira, 1955 modified as reported in Urzì close to the village of Zuheros (Córdoba, Southern et al., 2001), SC (Starch Casein KNO3 agar, Spain) in the frame of the research activity carried Kuster & Williams, 1964) and R2A (Reasoner and out during the European project CATS (EVK4-2000- Geldreich, 1985 Oxoid); in all media 0.05% cy- 00028), and in different areas of St. Agatha’s Crypt cloheximide was added to avoid/limit the growth and Catacombs (SA) in Rabat, Malta, during the activ- of unwanted fungal contaminants. Incubation ity carried out in the framework of a COST Action G8 was carried out at 28° C up to one month to allow scientific mission (COST-STSM-G8-1435) (Zammit et slow-growing strains. At the end of incubation al., 2009). time, enumeration of microorganisms as cfu/g In both catacombs the relative humidity (RH) was of sample was carried out and randomly chosen always above 90% while the Mediterranean climate of bacterial strains (10/20 colonies per sample) the areas did not influence the inner temperature of were isolated on Trypticase Soy Agar (TSA, Ox- the catacombs due to their deep location (range 15- oid). The bacterial isolates were maintained on 20°C) (Albertano et al., 2003; Zammit et al., 2009). TSA (Tryptone, Soy Agar) or GYM (Glucose, Yeast The Cave of Bats presented a RH variable from 95 extract, Malt extract, Agar). (inner part of the cave) to 56% (near the exit) and an Bacterial strains were preliminarily charac- average temperature between 8 and 14ºC, depending terized by their macro- and micro-morphology, on the area, at the time of sampling (Urzì et al., 2010). their Gram staining, catalase and oxidase activ- Samples were taken aseptically in correspondence to ity. The strains were then clustered on the basis alterations on rock surface described as black spots, of their ITS profiles. Randomly selected strains green patina, whitish/grey patinas with scalpel and/ belonging to the same profile were identified or adhesive tape as shown in Table 1. through 16S rDNA partial sequencing. Table 1. Samples, modality of sampling type of alteration, surface in three site studied. Presence and/or absence phototrophic organisms was also considered Type of substrate/ Presence of Sampling site Alteration type Sampling modality photototrophs Whitish/grey patina Tufa/Scalpel CSC13a, CSC13b, CSC13c N White patinas on top of CSC13i, CSC13f Fresco/Adhesive tape Y green biofilm Interface between green CSC13h Fresco/Adhesive Tape Y biofilm and white patina no apparent colonization CSC13d after 6 months from biocide Fresco/Adhesive tape Y treatment CSC13e, Dark Green biofilm Fresco/Adhesive tape Y CSC13g Black spots Tufa/Adhesive tape Y Limestone/Scalpel-Adhesive Z1a Dark grey spots Y tape Limestone/Scalpel-Adhesive Z1b Red spots Y tape Limestone/Scalpel-Adhesive Z3b, Z3c Black alteration Y tape Z2a, Z2b, Z3a, Z4a, Z4b, Z5a, Green patina Limestone/Scalpel-Adhesive Y Z5b, Z5d, Z6a, Z6b, Z7a, Z8a tape SA1, SA14, SA15, SA16, SA20 Reddish spots Limestone/Adhesive tape Y SA2, SA3, SA8, SA9, SA13, Limestone, Plaster/Adhesive Green patina Y SA17, SA18 tape Limestone/Scalpel-Adhesive SA4, SA7, SA19, SA23 Whitish/grey patina N tape SA10, SA12 Dark grey spots Plaster, Fresco/Adhesive tape Y SA6 Yellowish spots Plaster/Adhesive tape N International Journal of Speleology, 41(2), 125-136. Tampa, FL (USA). July 2012 Filomena De Leo, Agnese Iero, Gabrielle Zammit, and Clara E. Urzì 127 Plate 1. Graphic representation of distribution of bacteria isolated from St. Callistus catacombs (a, b), Cave of Bats (c, d), and St. Agatha catacombs (e, f). On the left the different classes of bacteria isolated (a, c and e); on the right are represented the different genera and the respective percentage of isolation (b, d and f). International Journal of Speleology, 41(2), 125-136. Tampa, FL (USA). July 2012 128 Chemoorganotrophic bacteria isolated from cave and catacombs Bacterial strains 180 strains were isolated and considered in this study. In particular, 59 bacterial strains were isolated from biofilm samples taken from the Ocean Cubicle (CSC13), in the St. Callistus Catacombs in Rome, Italy, 87 strains were isolated from 16 samples tak- en from the Cave of Bats in Zuheros, Spain and 34 strains were isolated from 19 samples taken from St. Agatha Crypt and Catacombs in Malta. ITS-PCR Genomic DNA was extracted from all the bacteria, as described by Rainey and co-workers (1996), after growth of the strains on TSA medium for 7 days. Amplification of ITS was carried out using the primer pair F1492 (5’AAGTCGTAACAAGGTAGCCG3’) and R188 (5’GGTACTTAGAGTTTTCAGTTC) (Gurtler & Stanisich, 1996) in a final volume of 50 µl contain- ing 2.5 U of Taq DNA polymerase (Pharmacia Biotech, Italy), 200 mM (each) deoxynucleoside triphosphates (dNTPs), 0.2 mM of each primer in 1X reaction buffer Fig.
Load more

Recommended publications
  • Roma Subterranea
    Roma Subterranea The Catacombs of Late Antique Rome | Marenka Timmermans 0 Illustration front page: After http://www.livescience.com/16318-photos-early-christian-rome-catacombs-artifacts.html 1 Roma Subterranea The Catacombs of Late Antique Rome Marenka Timmermans S0837865 Prof. dr. Sojc Classical Archaeology Leiden University, Faculty of Archaeology Leiden, June 15th, 2012 2 Marenka Timmermans Hogewoerd 141 2311 HK Leiden [email protected] +316-44420389 3 Table of Contents Chapter 1. Introduction 5 1.1 Research goal, methodology and research questions 5 Chapter 2. The origins and further development of the catacombs 7 2.1 Chapter summary 10 Chapter 3. Research performed in the catacombs up to the late 20th century 11 3.1 The 'rediscovery' 11 3.2 Early Catacomb Archaeology 13 3.2.1 Antonio Bosio 13 3.2.2 Giovanni di Rossi 14 3.3 Archaeological research in the late 19th and up to the late 20th century 17 3.4 Chapter conclusion 18 Chapter 4. Modern catacomb research 21 4.1 Demography 21 4.2 Science-based Archaeology 23 4.2.1 Stable isotope analysis 23 4.2.2 Radiocarbon dating 25 4.3 Physical Anthropology 26 4.4 Other sciences in and around the catacombs 27 4.5 Chapter Conclusion 28 Chapter 5. Discussion 31 Chapter 6. Conclusion 37 Summary 39 Samenvatting 41 Bibliography 43 List of Figures 49 List of Tables 51 Appendix I 53 Appendix II 57 3 4 Chapter 1. Introduction The subject of this BA-thesis is the catacombs of Late Antique Rome. The catacombs are formed by large subterranean complexes, consisting of extensive galleries.
    [Show full text]
  • Catacomb Free Ebook
    FREECATACOMB EBOOK Madeleine Roux | 352 pages | 14 Jul 2016 | HarperCollins Publishers Inc | 9780062364067 | English | New York, United States Catacomb | Definition of Catacomb by Merriam-Webster Preparation work Catacomb not long after a series of gruesome Saint Innocents -cemetery-quarter basement wall collapses added a sense of urgency to the cemetery-eliminating measure, and fromnightly processions of covered wagons transferred remains from most of Paris' cemeteries to a mine shaft opened near the Rue de la Tombe-Issoire. The ossuary remained largely forgotten until it became a novelty-place for Catacomb and other private events Catacomb the Catacomb 19th century; after further renovations and the construction of accesses Catacomb Place Denfert-Rochereau Catacomb, it was open to public visitation from Catacomb ' earliest burial grounds were to the southern outskirts of Catacomb Roman-era Left Bank Catacomb. Thus, instead of burying its dead away from inhabited areas as usual, the Paris Right Bank settlement began with cemeteries near its Catacomb. The most central of these cemeteries, a Catacomb ground around the 5th-century Notre-Dame-des-Bois church, became the property of the Saint-Opportune parish after the original church was demolished by the 9th-century Norman invasions. When it became its own parish associated with the church of the " Saints Innocents " fromthis burial ground, filling the Catacomb between the present rue Saint-Denisrue de la Ferronnerierue de la Lingerie and the Catacomb BergerCatacomb become the City's principal Catacomb. By the end of the same century " Saints Innocents " was neighbour to the principal Catacomb marketplace Les Halles Catacomb, and already filled to overflowing.
    [Show full text]
  • Into the Deep Naples Short Trip Into the Subterranean City Between Past and Present by Giuseppe
    2 to both touristic valorisation and exploitation. Over time, Into the Deep many underground routes have been opened to the pub- lic becoming more and more popular and visited. In that Naples short trip into the Subterra- regard, the catacombs of San Gennaro and the catacombs nean City between past and present of San Gaudioso are two virtuous examples of cultural tourism developed by a project of recovery of under- by Giuseppe Pace, Roberta Varriale, and Elisa Bellato ground historical sites. They are paleo-Christian burials (ISMed-CNR) restored and managed (Catacombs of San Gaudioso in Located in Southern Italy, Naples has about one million inhabitants, administratively subdivided in 10 districts. It is the third largest municipality by population after Rome and Milan. This city has an ancient history with a stratigraphic dimension. In fact, Naples is characterised by a strong interdependence between the aboveground city and its subsoil, with a history that can be read through a sequence of underground layers. The first layer dates back to the Greek colonisation, when the yellow tuff material was used for aboveground buildings, and the underground was excavated for the burial sites and for water supply management. The second layer dates back to Roman times, when the city grew and the underground accommodated new facilities, such as aqueducts, thermal buildings, and catacombs. During the Middle Age, under- Catacombs of San Gennaro (Naples) Photo: G. Pace ground quarries supplied yellow tuff material for sup- porting the intensive aboveground urban development. Once dismissed, those quarries underneath the buildings were adapted as warehouses for local transformation activities or commercial activities.
    [Show full text]
  • Induction of Secondary Metabolism Across Actinobacterial Genera
    Induction of secondary metabolism across actinobacterial genera A thesis submitted for the award Doctor of Philosophy at Flinders University of South Australia Rio Risandiansyah Department of Medical Biotechnology Faculty of Medicine, Nursing and Health Sciences Flinders University 2016 TABLE OF CONTENTS TABLE OF CONTENTS ............................................................................................ ii TABLE OF FIGURES ............................................................................................. viii LIST OF TABLES .................................................................................................... xii SUMMARY ......................................................................................................... xiii DECLARATION ...................................................................................................... xv ACKNOWLEDGEMENTS ...................................................................................... xvi Chapter 1. Literature review ................................................................................. 1 1.1 Actinobacteria as a source of novel bioactive compounds ......................... 1 1.1.1 Natural product discovery from actinobacteria .................................... 1 1.1.2 The need for new antibiotics ............................................................... 3 1.1.3 Secondary metabolite biosynthetic pathways in actinobacteria ........... 4 1.1.4 Streptomyces genetic potential: cryptic/silent genes ..........................
    [Show full text]
  • The Orante and the Goddess in the Roman Catacombs
    THE ORANTE AND THE GODDESS IN THE ROMAN CATACOMBS Valerie Abrahamsen ABSTRACT The Orante, or Orans, figure, a very common and important symbol in early Christian art, is difficult to interpret. Theories of what she meant to early Christians, especially Roman Christians who buried their dead in the catacombs, range from a representation of the soul of the deceased to a symbol of filial piety. In this article, I will attempt to show that the Orante figure originates with the prehistoric goddess, the all-encom- passing Nature deity worshipped for millennia throughout the Mediterranean world. While many early Christians super- imposed Christian meaning on her, it is likely that other Christians still viewed her in conjunction with the earlier Nature goddess of birth, life, death and rebirth, even as they worshipped God in male form. Introduction he Orante or Orans, generally a female figure with open eyes and upraised hands, is a pervasive symbol in early TChristian art, perhaps “the most important symbol in early Christian art.”1 Found frequently in the late second-century art in the Roman catacombs, as well as in sculpture, her head is almost always covered with a veil, and she wears a tunic. She exists both as a separate symbol and as the main figure in a number of Biblical scenes, but rarely in masculine form with male clothing. Instead, she frequently stands in for male figures in scenes of deliverance—she becomes Noah in the ark, Jonah in the boat and spewed out of the whale, Daniel between the lions, and the three young men in the fiery furnace.
    [Show full text]
  • Parisians Find Playground Under the Streets - WSJ
    Parisians Find Playground Under the Streets - WSJ https://www.wsj.com/articles/SB10001424052748704271804... DOW JONES, A NEWS CORP COMPANY Nikkei ▲ 20400.28 0.26% Hang Seng ▼ 28110.33 -0.06% U.S. 10 Yr ▲ 1/32 Yield 2.274% Crude Oil ▲ 50.67 0.24% Yen ▼ 112.47 -0.00% DJIA ▼ 22359.23 -0.24% This copy is for your personal, non-commercial use only. To order presentation-ready copies for distribution to your colleagues, clients or customers visit http://www.djreprints.com. http://www.wsj.com/articles/SB10001424052748704271804575405283969684798 ARTS & ENTERTAINMENT Parisians Find Playground Under the Streets Residents Take to an Underground Network of Tunnels and Caves to Explore City's Past, Paint Murals or Throw a Party Policemen look at a painted wall in Paris's catacombs a 155-mile underground network of tunnels. AGENCE FRANCE-PRESSE/GETTY IMAGES By Don Duncan Updated Aug. 7, 2010 12:01 a.m. ET PARIS—While many Parisians go out on the town on Saturday evenings, a small but growing number go under it. Beneath Paris lies a network of some 155 miles of tunnels known as "the catacombs"—an underground labyrinth that serves as the weekend playground for bands of urban explorers. One recent Saturday, several dozen "cataphiles," as these explorers are known, climbed down an embankment in south Paris to a unused railroad track. After a short walk, they disappear into a hole in the side of a railway tunnel to the catacombs, 65 feet below. "The environment never changes down here," says Riff, 44, a catacombs veteran of 22 years who won't give his full name because he likes to explore areas off- limits to the public.
    [Show full text]
  • Diversity and Distribution of Actinobacteria Associated with Reef Coral Porites Lutea
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Frontiers - Publisher Connector ORIGINAL RESEARCH published: 21 October 2015 doi: 10.3389/fmicb.2015.01094 Diversity and distribution of Actinobacteria associated with reef coral Porites lutea Weiqi Kuang 1, 2 †, Jie Li 1 †, Si Zhang 1 and Lijuan Long 1* 1 CAS Key Laboratory of Tropical Marine Bio-Resources and Ecology, RNAM Center for Marine Microbiology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou, China, 2 College of Earth Science, University of Chinese Academy of Sciences, Beijing, China Actinobacteria is a ubiquitous major group in coral holobiont. The diversity and spatial Edited by: and temporal distribution of actinobacteria have been rarely documented. In this Sheng Qin, study, diversity of actinobacteria associated with mucus, tissue and skeleton of Porites Jiangsu Normal University, China lutea and in the surrounding seawater were examined every 3 months for 1 year on Reviewed by: Syed Gulam Dastager, Luhuitou fringing reef. The population structures of the P.lutea-associated actinobacteria National Collection of Industrial were analyzed using phylogenetic analysis of 16S rRNA gene clone libraries, which Microorganisms Resource Center, demonstrated highly diverse actinobacteria profiles in P. lutea. A total of 25 described India Wei Sun, families and 10 unnamed families were determined in the populations, and 12 genera Shanghai Jiao Tong University, China were firstly detected in corals. The Actinobacteria diversity was significantly different P. Nithyanand, SASTRA University, India between the P. lutea and the surrounding seawater. Only 10 OTUs were shared by *Correspondence: the seawater and coral samples.
    [Show full text]
  • Marine Rare Actinomycetes: a Promising Source of Structurally Diverse and Unique Novel Natural Products
    Review Marine Rare Actinomycetes: A Promising Source of Structurally Diverse and Unique Novel Natural Products Ramesh Subramani 1 and Detmer Sipkema 2,* 1 School of Biological and Chemical Sciences, Faculty of Science, Technology & Environment, The University of the South Pacific, Laucala Campus, Private Mail Bag, Suva, Republic of Fiji; [email protected] 2 Laboratory of Microbiology, Wageningen University & Research, Stippeneng 4, 6708 WE Wageningen, The Netherlands * Correspondence: [email protected]; Tel.: +31-317-483113 Received: 7 March 2019; Accepted: 23 April 2019; Published: 26 April 2019 Abstract: Rare actinomycetes are prolific in the marine environment; however, knowledge about their diversity, distribution and biochemistry is limited. Marine rare actinomycetes represent a rather untapped source of chemically diverse secondary metabolites and novel bioactive compounds. In this review, we aim to summarize the present knowledge on the isolation, diversity, distribution and natural product discovery of marine rare actinomycetes reported from mid-2013 to 2017. A total of 97 new species, representing 9 novel genera and belonging to 27 families of marine rare actinomycetes have been reported, with the highest numbers of novel isolates from the families Pseudonocardiaceae, Demequinaceae, Micromonosporaceae and Nocardioidaceae. Additionally, this study reviewed 167 new bioactive compounds produced by 58 different rare actinomycete species representing 24 genera. Most of the compounds produced by the marine rare actinomycetes present antibacterial, antifungal, antiparasitic, anticancer or antimalarial activities. The highest numbers of natural products were derived from the genera Nocardiopsis, Micromonospora, Salinispora and Pseudonocardia. Members of the genus Micromonospora were revealed to be the richest source of chemically diverse and unique bioactive natural products.
    [Show full text]
  • Paris Catacombs
    The Dark Underworld of the Paris Catacombs Underneath the City Hidden beneath the vibrant European city of Paris is an eerie network of old caves and tunnels housing the remains of 6 million people: The Catacombes de Paris. The Paris catacombs date as far back as the 12th century. The tunnels run like arteries, located beneath the city. They stretch as far as 200 miles at a depth of 20 metres (65 feet), equivalent to the size of a five story building. Only a small section of it is open to the public today. The majority of the network has been of-limits since 1955. But even in the area still accessible to tourists there are fascinating remnants of Paris' history. The catacombs have existed since the 12th century, when the mining of limestone quarries to provide bricks for the city's buildings created as a side efect an entire underground city. The tunnels lie mostly under the southern part of the metropolis. It was only during the second half of the 18th century, that the former limestone mines were transformed into burial places. The oldest and most extensive network of tunnels is under the 14th and 15th Arrondissments (districts). After a few buildings collapsed into the forgotten underground cavities in the 18th century, the city began to map The Catacomb Beginnings As Paris grew into its role as a major European hub, it eventually ran into a major problem. By the 17th century, enough people had lived and died in Paris that its cemeteries were overflowing. They were overstufed with graves to the point where corpses, at times, became uncovered.
    [Show full text]
  • ATINER's Conference Paper Series HIS2018-2561
    ATINER CONFERENCE PAPER SERIES No: LNG2014-1176 Athens Institute for Education and Research ATINER ATINER's Conference Paper Series HIS2018-2561 The Macedonian Tomb Façade Formation and its Significant Role and Critical Stage for the Development of Hellenistic and Late Classical Façade Morphology Naif Haddad Professor American University of Madaba Jordan 1 ATINER CONFERENCE PAPER SERIES No: HIS2018-2561 An Introduction to ATINER's Conference Paper Series Conference papers are research/policy papers written and presented by academics at one of ATINER‘s academic events. ATINER‘s association started to publish this conference paper series in 2012. All published conference papers go through an initial peer review aiming at disseminating and improving the ideas expressed in each work. Authors welcome comments. Dr. Gregory T. Papanikos President Athens Institute for Education and Research This paper should be cited as follows: Haddad, N. (2018). "The Macedonian Tomb Façade Formation and its Significant Role and Critical Stage for the Development of Hellenistic and Late Classical Façade Morphology", Athens: ATINER'S Conference Paper Series, No: HIS2018-2561. Athens Institute for Education and Research 8 Valaoritou Street, Kolonaki, 10671 Athens, Greece Tel: + 30 210 3634210 Fax: + 30 210 3634209 Email: [email protected] URL: www.atiner.gr URL Conference Papers Series: www.atiner.gr/papers.htm Printed in Athens, Greece by the Athens Institute for Education and Research. All rights reserved. Reproduction is allowed for non-commercial purposes if the source is fully acknowledged. ISSN: 2241-2891 23/10/2018 2 ATINER CONFERENCE PAPER SERIES No: HIS2018-2561 The Macedonian Tomb Façade Formation and its Significant Role and Critical Stage for the Development of Hellenistic and Late Classical Façade Morphology Naif Haddad Abstract The last thirty-five years, in fact, witnessed significant changes in almost all areas of the study of Hellenistic Macedonian art and architecture, especially in funerary architecture.
    [Show full text]
  • Proposed Minimal Standards for Describing New Genera and Species of the Suborder Micrococcineae
    International Journal of Systematic and Evolutionary Microbiology (2009), 59, 1823–1849 DOI 10.1099/ijs.0.012971-0 Proposed minimal standards for describing new genera and species of the suborder Micrococcineae Peter Schumann,1 Peter Ka¨mpfer,2 Hans-Ju¨rgen Busse 3 and Lyudmila I. Evtushenko4 for the Subcommittee on the Taxonomy of the Suborder Micrococcineae of the International Committee on Systematics of Prokaryotes Correspondence 1DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Inhoffenstraße 7B, P. Schumann 38124 Braunschweig, Germany [email protected] 2Institut fu¨r Angewandte Mikrobiologie, Justus-Liebig-Universita¨t, 35392 Giessen, Germany 3Institut fu¨r Bakteriologie, Mykologie und Hygiene, Veterina¨rmedizinische Universita¨t, A-1210 Wien, Austria 4All-Russian Collection of Microorganisms (VKM), G. K. Skryabin Institute of Biochemistry and Physiology of Microorganisms, RAS, Pushchino, Moscow Region 142290, Russia The Subcommittee on the Taxonomy of the Suborder Micrococcineae of the International Committee on Systematics of Prokaryotes has agreed on minimal standards for describing new genera and species of the suborder Micrococcineae. The minimal standards are intended to provide bacteriologists involved in the taxonomy of members of the suborder Micrococcineae with a set of essential requirements for the description of new taxa. In addition to sequence data comparisons of 16S rRNA genes or other appropriate conservative genes, phenotypic and genotypic criteria are compiled which are considered essential for the comprehensive characterization of new members of the suborder Micrococcineae. Additional features are recommended for the characterization and differentiation of genera and species with validly published names. INTRODUCTION Aureobacterium and Rothia/Stomatococcus) and one pair of homotypic synonyms (Pseudoclavibacter/Zimmer- The suborder Micrococcineae was established by mannella) (Table 1 and http://www.the-icsp.org/taxa/ Stackebrandt et al.
    [Show full text]
  • Pathogenic and Opportunistic Microorganisms in Caves
    International Journal of Speleology 39 (1) 15-24 Bologna (Italy) January 2010 Available online at www.ijs.speleo.it International Journal of Speleology Official Journal of Union Internationale de Spéléologie Pathogenic and opportunistic microorganisms in caves Valme Jurado, Leonila Laiz, Veronica Rodriguez-Nava1, Patrick Boiron1, Bernardo Hermosin, Sergio Sanchez-Moral2, Cesareo Saiz-Jimenez Abstract: Jurado V., Laiz L., Rodriguez-Nava V., Boiron P., Hermosin H., Sanchez-Moral S. and Saiz-Jimenez C. 2010. Pathogenic and opportunistic microorganisms in caves. International Journal of Speleology, 39 (1), 15-24. Bologna (Italy). ISSN 0392-6672. With today’s leisure tourism, the frequency of visits to many caves makes it necessary to know about possible potentially pathogenic microorganisms in caves, determine their reservoirs, and inform the public about the consequences of such visits. Our data reveal that caves could be a potential danger to visitors because of the presence of opportunistic microorganisms, whose existence and possible development in humans is currently unknown. Keywords: Caves, bacteria, fungi, virus, opportunistic pathogens Received 26 Oktober 2009; Revised 28 November 2009; Accepted 9 December 2009. INTRODUCTION or have lowered defences. Unfortunately, information Europe is an exceptional continent for its on this topic is not well known, and visitors remain abundance and variety of subterranean karstic forms unaware. Determining the extent of the potential comprising the natural geological heritage. Many of danger is of great interest ― not only scientific, but them are Protected Sites, and today many countries also medical and social. Our data reveal that caves have programmes for the protection of caves and could be a potential danger to visitors, because of geodiversity.
    [Show full text]