Lactate Dehydrogenase Gene Genotypization for Species Identification in a Fish Farm on the River Neretva Margeta, P., Bogut, I
Total Page：16
File Type：pdf, Size：1020Kb
Lactate dehydrogenase gene genotypization for species identification in a fish farm on the river Neretva Margeta, P., Bogut, I., Ivanković, M., Margeta, V. Poljoprivreda/Agriculture ISSN: 1848-8080 (Online) ISSN: 1330-7142 (Print) http://dx.doi.org/10.18047/poljo.21.1.sup.12 Poljoprivredni fakultet u Osijeku, Poljoprivredni institut Osijek Faculty of Agriculture in Osijek, Agricultural Institute Osijek ISSN 1330-7142 UDK: 639.3(497.6) DOI: 10.18047/poljo.21.1.sup.12 LACTATE DEHYDROGENASE GENE GENOTYPIZATION FOR SPECIES IDENTIFICATION IN A FISH FARM ON THE RIVER NERETVA Margeta, P.(1), Bogut, I.(1), Ivanković, M.(2), Margeta, V. (1) Original scientific paper SUMMARY There are severale Salmonid species, found in the river Neretva basin, among which S. trutta and S. obtusirostris. Also, natural hybrids such as S. obtusirostris x S. trutta have been observed. In one fish farm on the river Neretva, S. trutta and S. obtusirostris were decided to breed separately. Parental fishes were separated phenotypicaly on the basis of the morphological signs. PCR-RFLP analysis of the exon 3 to exon 4 part of the lactate dehydrogenase (LDH) C1* gene with restriction endonuclease RsaI was employed to identify the presence of other species repre- sentatives or intercrosses in two groups of juvenille fishes. Using this method, we were able to identify two S. trutta representatives in the S. obtusirostris group. Key-words: Lactate dehydrogenase gene, PCR-RFLP, S. trutta, S. obtusirostris INTRODUCTION has also been practised in the river Neretva and stocking activities have never been well documented. There are severale Salmonid species, found in the river Neretva basin, among which S. trutta (brown Lactate dehydrogenase (LDH) C1* gene containing trout), Salmo marmoratus (marble trout), Salmo obtu- parts of exons 3 and 4 with intermediate intron has been sirostris (softmouth trout) Salmo farioides and Salmo found, firstly in brown trout (Mc Meel et al, Ferguson, dentex. 2001), and after that also in S. obtusirostris (Snoj et al., 2002) proven as an informative genetic marker. Salmo obtusirostris also known as the Adriatic trout, Adriatic salmon, and softmouth trout, is a spe- A mutation in the intron 3 of the (LDH) C1* gene cies of salmonid fish endemic to the rivers of Western (G/C substitution) was connected with the disruption Balkans. It is found naturally in four drainages of the of the RsaI restriction enzyme recognition site, being Adriatic Sea, in Croatia, Bosnia and Herzegovina and specific for S. obtusirostris (Razpet, 2004; Razpet, 2007). Montenegro: the Neretva-Vrljika system, the Jadro, The same mutation was found in Salmo obtusiro- the Morača-Zeta system and the Krka river drainages. stris salonitana and in Salmo obtusirostris oxyrhynchus Morphological different characteristics for different soft- (Odak, 2004). mouth trout populations from different river-systems In one fish farm on the river Neretva, S. trutta and resulted in the description of three putative subspecies: S. obtusirostris were decided to breed separately. Salmo obtusirostris oxyrhynchus from the River Neretva, Parental fishes were separated phenotypically on Bosnia and Herzegovina, Salmo obtusirostris salonitana the basis of the morphological signs. The aim of this from the river Jadro, Croatia, and Salmo obtusirostris work was, based on the LDH genotype, to find inter- krkensis from the River Krka, Croatia. crosses or representatives of the other species in two In the river Neretva basin, natural hybrids such groups of juvenille fishes. In the first group, there should as S. obtusirostris x S. trutta have been observed and reported (Vuković, 1982). The hybridization between autochthonous species was confirmed also in an experi- (1) Ph.D. Polonca Margeta ([email protected]), Ph.D. Ivan Bogut, ment performed in the fish farm located in the river Assist. Prof. Margeta Vladimir – Josip Juraj Strossmayer University of Osijek, Faculty of Agriculture in Osijek, Kralja Petra Svačića 1d, 31000 Buna, a tributary of the river Neretva (Kosorić and Osijek, Croatia, (2) Ph.D. Marko Ivanković - Federal Agromediterranean Vuković, 1969). Introduction of non-native brown trout Institute Mostar, Biskupa Čule 10, 88000 Mostar, Bosnia and Herzegovina PoljoPrivreda 21:2015(1) Supplement, 56-58 Parental fishes were separated phenotypically on the basis of the morphological signs. The aim of this work was, based on the LDH genotype, to find intercrosses or representatives of the other species in two groups of juvenille fishes. In the first group, there should be only representatives of S. trutta, while in the second one only representatives of S. obtusirostris. P.MATERIAL Margeta et al.: LACTATEAND METHODS DEHYDROGENASE GENE GENOTYPIZATION FOR SPECIES ... 57 In the fish farm, juvenille fishes were raised in two groups. In the first group, there were juvenille befishes only representativesof S. trutta, and of S. in trutta the, secondwhile in juvenillethe second fishes DNA, of S. 1,5 obtusirostris mM MgCl2, . 0,2Fin mM clips of wereeach takendNTP, from1 µM 21 oneindividuals only representatives from both of groupsS. obtusirostris. (together 42 samples)of andeach stored primer in(Ldhxon4R 96% ethanol. and Ldhxon3F), In the lab, and genomic1U of DNA was isolated from the preserved fin clips usingTaq DNABio Basicpolymerase EZ-10 (Fisher Spin scientific). Column AmplificationAnimal DNA MATERIAL AND METHODS was performed in the thermal cycler (Eppendorf) as Mini-Preps Kit (Bio Basic Canada Inc.), following thedescribed supplier’s before instructions. (Mc Meel et al., 2001). In the fish farm, juvenille fishes were raised in two PCR of the lactate dehydrogenase (LDH) C1* genePCR containing products wereparts cleaved of exons by Rsa3 I andrestriction 4 with groups. In the first group, there were juvenille fishes of intermediate intron has been performed as describendonuclease,ed by Mc Meelwith a etrecognition al. (2001). site gt/ac.Twenty The ampliµl PCR- S. trutta, and in the second juvenille fishes of S. obtu- contained 100 ng of genomic DNA, 1,5 mM MgClfied2, 0,2part mMof the of (LDH) each C1* dNTP, gene 1in µMS. trutta of each contained primer sirostris. Fin clips were taken from 21 individuals from (Ldhxon4R and Ldhxon3F), and 1U of Taq DNA twopolymerase RsaI recognition (Fisher scientific).sites, leading Amplification to three bands was both groups (together 42 samples) and stored in 96% after restriction in the lenght of 74, 135 and 166 bp ethanol.performed In the in lab, the genomic thermal DNA cycler was (isolatedEppendorf from) theas described before (Mc Meel et al., 2001). (genotype NP). On the other hand, PCR product of S. preservedPCR products fin clips wereusing Biocleaved Basic EZ-10by Rsa SpinI restrictionColumn endonuclease, with a recognition site gt/ac. The obtusirostris posessed only one restriction site because Animalamplified DNA partMini-Preps of the Kit (LDH) (Bio Basic C1* Canada gene Inc.), in S.fol -trutta contained two RsaI recognition sites, leading to of the disruption of the second recognition site due to a lowing the supplier’s instructions. three bands after restriction in the lenght of 74, 135G/C and transformation 166 bp (genotype (MP genotype), NP). leadingOn the to other only twohand, PCRPCR product of the lactateof S. dehydrogenaseobtusirostris (LDH)posessed C1* geneonly onebands restriction in the length site becauseof 74 and of300 the bp disruptionafter restriction, of the containingsecond recognition parts of exons site 3 due and to 4 awith G/C intermediate transformation respectively (MP genotype), (Figure 1).leading Products to ofonly restriction two bands reactions in the intronlength has of been 74 andperformed 300 bp as after described restriction, by Mc Meel respectivel et werey (Figure checked 1). on Products the 2% agarose of restriction gel. reactions were al. (2001). Twenty µl PCR contained 100 ng of genomic checked on the 2% agarose gel. S.obtusirostris TGTTACCACGACGATACGAGAGTTCGCCGTCACAGAGTAGTCTGACCGTGGGAGAACAAT 60 CLUSTAL 2.1 multiple sequence alignment S.trutta TGTTACCACGACGATACGAGAGTTCGCCGTCACAGAGTAGTCTGACCGTGGGAGAACAAT 60 ************************************************************ S.obtusirostris TGTTACCACGACGATACGAGAGTTCGCCGTCACAGAGTAGTCTGACCGTGGGAGAACAAT 60 S.obtusirostris CAATCAATGAGAGTACTGTGTATCATTTGTGTCTAGTATTTCTTCAGTAATTTGTCATAT 120 S.trutta TGTTACCACGACGATACGAGAGTTCGCCGTCACAGAGTAGTCTGACCGTGGGAGAACAAT 60 S.trutta CAATCAATGAGAGTACTGTGTATCATTTGT--CTAGTATTTCTTCAGTAATTTGTCATAT 118 ************************************************************ ****************************** **************************** S.obtusirostris CAATCAATGAGAGTACTGTGTATCATTTGTGTCTAGTATTTCTTCAGTAATTTGTCATAT 120 S.obtusirostris CATTAATAGATCTAATGGCAGGACTATTACATGTCAAAGTAGGATTTCAGAAATTGCTTT 180 S.trutta CAATCAATGAGAGTACTGTGTATCATTTGT--CTAGTATTTCTTCAGTAATTTGTCATAT 118 S.trutta CATTAATAGATCTAATGGCAGGACTATTACATGTCAAAGTGGGATTTCAGAAATTGCTTT 178 ****************************** **************************** **************************************** ******************* S.obtusirostris CATTAATAGATCTAATGGCAGGACTATTACATGTCAAAGTAGGATTTCAGAAATTGCTTT 180 S.obtusirostris GAGAAACTTCATTCATACATTTCCCTTTCACCCTTTTCCCCCCCATCTCCCTTTCATACA 240 S.trutta CATTAATAGATCTAATGGCAGGACTATTACATGTCAAAGTGGGATTTCAGAAATTGCTTT 178 S.trutta GAGAAACTTCATTCATACATTTCCCTTTCACCC------CCCCCATCTCCCTTTCATACA 232 **************************************** ******************* ********************************* ********************* S.obtusirostris GAGAAACTTCATTCATACATTTCCCTTTCACCCTTTTCCCCCCCATCTCCCTTTCATACA 240 S.obtusirostris