Investigation of the Microbial Communities Associated with the Octocorals Erythropodium

caribaeorum and Antillogorgia elisabethae, and Identification of Secondary Metabolites

Produced by Octocoral Associated Cultivated Bacteria.

By

Erin Patricia Barbara McCauley

A Thesis

Submitted to the Graduate Faculty

in Partial Fulfillment of the Requirements for a Degree of •

Doctor of Philosophy

Department of Biomedical Sciences

Faculty of Veterinary Medicine

University of Prince Edward Island

Charlottetown, P.E.I.

April 2017

© 2017, McCauley

THESIS/DISSERTATION NON-EXCLUSIVE LICENSE

Family Name: McCauley . Given Name, Middle Name (if applicable): Erin Patricia Barbara

Full Name of University: University of Prince Edward Island .

Faculty, Department, School: Department of Biomedical Sciences, Atlantic Veterinary College

Degree for which Date Degree Awarded: , thesis/dissertation was presented: April 3rd, 2017 Doctor of Philosophy Thesis/dissertation Title: Investigation of the Microbial Communities Associated with the Octocorals Erythropodium caribaeorum and Antillogorgia elisabethae, and Identification of Secondary Metabolites Produced by Octocoral Associated Cultivated Bacteria. *Date of Birth. May 4th, 1983

In consideration of my University making my thesis/dissertation available to interested persons, I, :Erin Patricia McCauley hereby grant a non-exclusive, for the full term of copyright protection, license to my University, The University of Prince Edward Island: to archive, preserve, produce, reproduce, publish, communicate, convert into a,riv format, and to make available in print or online by telecommunication to the public for non-commercial purposes; to sub-license to Library and Archives Canada any of the acts mentioned in paragraph (a).

I undertake to submit my thesis/dissertation, through my University, to Library and Archives Canada. Any abstract submitted with the . thesis/dissertation will be considered to form part of the thesis/dissertation. •

I represent that my thesis/dissertation is my original work, does not infringe any rights of others, including privacy rights, and that I have the right to make the grant conferred by this non-exclusive license.

If third party copyrighted material was included in my thesis/dissertation for which, under the terms of the Copyright Act, written permission from the copyright owners is required I have obtained such permission from the copyright owners to do the acts mentioned in paragraph (a) above for the full term of copyright protection

I retain copyright ownership and moral rights in my thesis/dissertation, and may deal with the copyright in my thesis/dissertation, in any way consistent with rights granted by me to my University in this non-exclusive license.

I further promise to inform any person to whom I may hereafter assign or license my copyright in my thesis/dissertation of the rights granted by me to my University in this non-exclusive license.

Signature Da6ee,

CERTIFICATION OF THESIS WORK

University of Prince Edward Island Atlantic Veterinary College Department of Veterinary Medicine, Biomedical Sciences Charlottetown

We, the undersigned, certify that Erin Patricia Barbara McCauley, candidate for the degree of Doctor of Philosophy (PhD), has presented her thesis with the following title:

Investigation of the Microbial Communities Associated with the Octocorals Erythropodium caribaeorum and Antillogorgia elisabethae, and Identification of Secondary Metabolites Produced by Octocoral Associated Cultivated Bacteria that the thesis is acceptable in form and content, and that a satisfactory knowledge of the field covered by the thesis was demonstrated by the candidate through an oral examination held on April 3rd, 2017.

Examiners:

Dr. Luis Bate (Chair)

Russell Kerr (Supervisor)

Dr. Jason McCallum

Dr. J Trenton McClure

Dr. Julie Laroche (External) 111

Date: pi 121 W17-

111 ABSTRACTS Octocorals are important members of coral reef ecosystems. They are also a prolific source of bioactive secondary metabolites. Over the years there has been a growing body of evidence that suggests that secondary metabolites detected in marine macroorganisms, such as octocorals, are in fact biosynthesised by associated microorganisms. Therefore this research characterized the microbiomes associated with the octocorals Erythropodium caribaeorum and Antillogorgia elisabethae. In addition to the secondary metabolites produced by the cultivatable bacteria associated with these octocorals, as these octocorals are associated with the bioactive secondary metabolites desmethyleleutherobin and pseudopterosins, respectively. Culture—independent studies utilizing 16S small subunit rRNA gene amplicon pyrosequencing were used to characterize the microbiome of E. caribaeorum collected from Florida, USA and San Salvador, The Bahamas at multiple time points. As well as the microbiome of A. elisabethae collected from San Salvador, The Bahamas, and the microbial communities associated with the dinoflagellates and larvae of this octocoral. E. caribaeorum was found to have a very high microbial richness with an average Chaol estimated richness of 1464 ± 707 operational taxonomic units (OTUs) and average Shannon diversity index of 4.26 ± 1.65. The taxonomic class Gammaproteobacteria was a dominant member in all samples and the genus Endozoicomonas accounted for an average of 37.7% ± 30.0% of the total sequence reads. One Endozoicomonas sp. was found to be a stable member of all E. caribaeorum sequence libraries regardless of location or time of collection and accounted for 30.1% of all sequence reads. The microbiome of A. elisabethae from San Salvador was found to have low microbial richness with an average Chao 1 estimated richness of 245 ± 81 and Shannon diversity index of 2.63 ± 0.43. A stable association with the genera Endozoicomonas, Vibrio, and Pseudoalteromonas was observed for the samples used in this research. However when compared to previously reported A. elisabethae microbiomes no stable taxonomic genera were detected. The dinoflagellates and larvae had a different microbial community structure than the overall microbiome, and no stable OTUs were detected across all A. elisabethae sample types. A total of 143 different species of bacteria that spanned across six different taxonomic classes were cultivated from A. elisabethae samples. Three were putatively novel species, two putatively novel genera, and one (RKEM 611) was determined to be a member of a novel family within the order Bdellovibrionales. The names Pseudobacteriovoracaceae for the family and Pseudobacteriovorax antillogorgiicola for the genus and species were formally assigned for this isolate. These cultivated bacteria produced a wide range of previously reported secondary metabolites. In addition to one new metabolite, a long-chain N-acyl L-leucine, that had mild antibiotic activity against MRSA, VRE, and Staphylococcus warneri. This research provided valuable information about the microbial communities associated with these Caribbean octocorals. Furthermore it revealed that these octocorals are an excellent source of unique cultivatable bacteria, as well as known and new secondary metabolites.

iv ACKNOWLEDGEMENTS

Throughout the course of my studies I have had support and guidance from many talented individuals. First and foremost I would like to thank my supervisor Dr. Russell Kerr for all his support and encouragement through out my research. Thank you for giving me the opportunity to become a graduate student in your lab and obtain all the knowledge and skills that came along with that. I am deeply grateful to my research manager Brad Haltli, whose knowledge and guidance were invaluable beyond words. I would like to thank the other research managers and senior scientists Dr. David Overy, Dr. Fabrice Benue, Dr. Malcolm McCulloch, and Dr. Hebelin Correa, for all their guidance and assistance.

I would also like to acknowledge my supervisory committee, Dr. Tarek Saleh, Dr. Spencer Greenwood, Dr. Jason McCallum, and Dr. Rick Cawthorn. Thank you for your interest in my research and for providing feedback throughout my degree. There are several collaborators that I would like to acknowledge. Dr. Jeff Lewis and Beatrice Despres, for their assistance and instruction in using the MALDI-TOF-MS. Maike.Fischer for acquiring the NME data, Patricia Boland for acquiring the UHPLC-HRMS data, Martin Lanteigne for performing the antimicrobial assays, and the other Nautilus employees (Joshua Kelly, Kate McQuillan, Noelle Duncan, Nick McCarville, and Jillian McAuley) for all their assistance.

Thank you to the Biomedical Sciences and Graduate Studies and Research administration staff Debbie Gallant, Suzette Acorn, Sherri Pineau, Rosemary McIver, and Darlene Wakelin without your support nothing would move forward. A huge thank you to the other Kerr Lab graduate students, past and present (Alyssa, Krista, Beth, Stacey, Nadia, Kate, Dave, Becca, Jen, Veronica, Ghada, Amanda S., Amanda T., Logan, Hope, Leon, and Doug), you made the last few years a fun and memorable experience, I have made amazing friends who I will never forget.

Lastly to my family, I could have never done this without your love and support. Thank you to my Mother (Rhonda), Father (Ross), Rick, Auntie Wendy, Casey, Callan, Emma, Camille, Rhonda, Melissa, Robert, Jackie, Dave, Myla, and Emily. You mean the world to me! DEDICATION

To my Father, Mother, and Wendy

vi TABLE OF CONTENTS

Thesis/dissertation non-exclusive license ii Certification of Thesis Work iii Abstract iv Acknowledgements Dedication vi Table of Contents vii List of Tables xi List of Figures xii List of Abbreviations xiv

Chapter 1: Introduction and Objectives of Thesis Research 1 1.1 Octocoral Microbiome 2 1.2 Investigation of Coral Microbiomes 2 1.3 Natural Products 7 1.4 Marine Natural Products 7 1.5 Marine Natural Products from Octocorals 15 1.5.1 Erythropodium caribaeorum and the Eleutherobins 15 1.5.2 Antillogorgia elisabethae and the Pseudopterosins 18 1.6 Microorganisms as a Source of Natural Products 21 1.6.1 Microorganisms as Biosynthetic Producers of Marine Natural Products Isolated from Macroorganisms 21 1.6.2 Octocorals as a Reservoir of Unique Microorganisms 24 1.7 Objectives of Thesis Research 24 1.8 References 28

Chapter 2: Spatial and Temporal Investigation of the Microbiome of the Caribbean octocoral Elythrop. odium caribaeorum 40 2.1 Introduction 41 2.1.1 Rationale for the Investigation of the Microbiome of E. caribaeorum 42 2.1.2 Overall Objective of Study 43 2.2 Material and Methods 43 2.2.1 Sample Collection 43 2.2.2 DNA Extraction and Purification 44 2.2.3 Pyrosequencing and Bioinformatics 45 2.2.4 Phylogenetic analysis 46 2.3 Results and Discussion 46 2.3.1 Alpha- and Beta-Diversity 46 2.3.2 Taxonomic Composition 54 2.3.3 Putative Core Microbiome 58 2.4 Conclusions 64 2.5 References 64

Chapter 3: Culture-Independent Investigation into the Microbiome of Antillogorgia elisabethae from San Salvador, The Bahamas, and the Microbial Communities Associated with the Holobiont, Algal Dinoflagellates, and Larvae 71 3.1 Introduction 72 3.1.1 The Octocoral Antillogorgia elisabethae 72 3.1.2 Algal Dinoflagellate Symbionts of A. elisabethae 73 3.1.3 Larvae of A. elisabethae 74 3.1.4 Rationale for the Investigation of the Microbiome of A. elisabethae for San Salvador and the Microbial Communities Associated with the Larvae and Algal Dinoflagellates Symbiont and Larvae 75 3.1.5 Overall Objective of Study 76 3.2 Materials and Methods 76 3.2.1 Sample Collections and Initial Processing 76 3.2.2 DNA Extraction and Purification 77 3.2.3 Pryosequencing and Bioinformatics 77 3.2.4 Phylogenetic Analysis 78 3.3 Results and Discussion 79 3.3.1 Initial Processing 79 3.3.2 Comparison of Microbial Communities between Holobiont and Surrounding Seawater Samples 82 3.3.2.1 Alpha- and Beta- Diversity 86 3.3.2.2 Taxonomic Composition 86 3.3.3 Comparison to Other Reported A. elisabethae Microbiomes 90 3.3.3.1 Alpha- dnd Beta- Diversity 90 3.3.3.2 Taxonomic Composition 94 3.3.4 Comparison of Holobiont, Dinoflagellate and Larvae Sample 97 3.3.4.1 Alpha- and Beta- Diversity 97 3.3.4.2 Taxonomic Composition 104 3.3.5 San Salvador A. elisabethae Putative Core Microbiome 108 3.4 Conclusions 114 , 3.5 Reference 115

Chapter 4: Culture-Dependent Investigation of the Bacterial Communities Associated with Antillogorgia elisabethae 122 4.1 Introduction 123 4.1.1 Rationale for the Methodology of the Culture-Dependent Study 123 4.1.2 Overall Objective of Study 124 4.2 Materials and Methods 125 4.2.2 Collection of Bacteria from a. elisabethae under Aerobic, Microaerophilic, and Anaerobic Conditions 126 4.2.3 Dereplication of Microbes using MALDI-TOF-MS 127 4.2.4 Genomic DNA extraction and PCR Amplification 128 4.2.5 Sequencing and Phylogenetic Analysis 129 4.2.6 Comparison of Culture-Dependent Library to Culture-Independent Library 129 4.3 Results and Discussion 130 4.3.1 Cultivatable Bacteria for A. elisabethae Holobiont, Dinoflagellates, and Larvae 130 4.3.2 Comparison of Cultured-Dependent and -Independent Bacterial Communities 136 4.3.3 Cultivatable bacteria from A. elisabethae under Aerobic, Microaerophilic, and Anaerobic Conditions 141 4.3.4 Overall Culture-Dependent Bacterial Library 149 4.4 References 181

Chapter 5: Description of Pseudobacteriovorax antillogorgiicola gen. nov., sp. nov., a bacterium isolated from the gorgonian octocoral Antillogorgia elisabethae, belonging to a novel bacterial family, Pseudobacteriovoraceae fam. Nov, within the order Bdellovibrionales 185

5..1 Introduction 186 5.1.1 Bdellovibrio-and-like organisms 186 5.1.2 Overall Objective of Study 187 5.2 Materials and Methods 187 5.2.1 Collection and Bacterial Isolation 187 5.2.2 Phenotypic Experiments 187 5.2.3 Chemotaxonomic Experiments 189 5.2.4 Genotypic Experiments 190 5.3 Results and Discussion 192 5.3.1 Phenotypic and Chemotaxonomic Analysis 192 5.3.2 Genotypic Analysis 196 5.4 Formal Species Description 203 5.4.1 Description of Pseudobacteriovorax gen. nov. 203 5.4.2 Description of Pseudobacteriovorax antillogorgiicola sp. nov. 203 5.4.3 Description of Pseudobacteriovoraceae fam. nov 204 5.5 References 205

Chapter 6: Investigation of Secondary Metabolites Produced by Octocoral-Associated Bacteria . 208 6.1 Introduction 209 6.1.1 Secondary Metabolites from Marine Bacteria 209 6.1.2 Chemical Dereplication 209 6.1.3 Overall Objective of Study 210 6.2 Material and Methods 211 6.2.1 Initial Small-Scale Screening 211 6.2.2 Chemical Dereplication, Data Processing, and PCA 215 6.2.3 Scale-up Fermentations 216 6.2.4 NMR Spectroscopy 216 6.2.5 Marfey's Method 217 6.2.6 Tandem Mass Spectrometry 217 6.3 Results and Discussion 218 6.3.1 Secondary Metabolites from Actinobacteria 218 6.3.2 Secondary Metabolites. from Firmicutes 223 6.3.3 Secondary Metabolites from Proteobacteria 226 6.3.3.1 Pseudoalteromonas sp. RKBH 271 and the Korormicins 231 6.3.3.2 Pseudoalteromonas sp. RKEM 243 and Ulbactins 234 6.3.3.3 Pseudomonas sp. RKEM 545 and the Putisolvins 237 6.3.3.4 Halomonas sp. RKEM 883 and Identification of a New Long-Chain N-Acyl L-Leucine. 241 6.3.4 Screening for the Presence of Pseudopterosins and Eleutherobins 243 6.4 Conclusion 244 6.5 References 245

Chapter 7: Overall Conclusions of Thesis Work and Future Directions of Octocoral Microbiome and Marine Natural Products Research 253 7.1 Summary of Thesis Research 254 7.1.1 Chapter 2: Spatial and Temporal Investigation of the Microbiome of the Caribbean Octocoral Erythropodium caribaeorum 254 7.1.2 Chapter 3: Culture-Independent Investigation into the Microbiome of Antillogorgia elisabethae from San Salvador, The Bahamas, and the Microbial Communities Associated with the Holobiont, Algal Dinoflagellates, and Larvae 255 7.1.3 Chapter 4: Culture-Dependent Investigation of the Bacterial Communities

ix Associated with Antillogorgiq elisabethae 256 7.1.4 Chapter 5: Species Description of Pseudobacteriovorax antillogorgiicola gen. nov., sp. nov., a bacterium isolated from the gorgonian octocoral Antillogorgia elisabethae, belonging to a novel bacterial family, Pseudobacteriovoraceae fam. nov., within the order Bdellovibrionales 257 7.1.5 Chapter 6: Investigation of Secondary Metabolites Produced by Octocoral Associated Bacteria 257 7.1.6 Overall Conclusions of Thesis Research 258 7.2 Future Directions of Thesis Research 259 7.2.1 Octocoral Microbiomes 259 7.2.2 Microbial Marine Natural Products 259 7.3 References 260

Appendix A: Chapter 5 Supplementary Information 266 Appendix B: Chapter 6 — Supplementary Information 271 LIST OF TABLES Table 1.1. Summary of richness and alpha diversity measurements for all reported coral microbiomes investigated using 454 pyrosequencing 4 Table 1.2. Clinically approved marine natural products and marine natural product derivatives. 11 Table 1.3. Marine natural products and derivatives that have entered into the pharmaceutical clinical trial pipeline. 13 Table 2.1. Richness and alpha diversity measurements of Erythropodium caribaeorum microbial communities. 50 Table 2.2. AMOVA comparisons of community structure (Yue and Clayton index). 51 Table 2.3. Summary of OTUs (D=0.03) that comprise the stable OTUs of the E. caribaeorum microbiome 61 Table 3.1. A. elisabethae holobiont (HI-HS), dinoflagellate (D1-D5), larvae (L1-L5), and surrounding seawater (SW1-5W5) collection location, number of sequence reads, and percent coverage for non- normalized data sets 80 Table 3.2. Richness and alpha diversity measurements of A. elisabethae holobiont and surrounding seawater microbial communities. 84 Table 3.3. Richness and alpha diversity calculations of A. elisabethae holobiont, dinoflagellate, larvae, microbial communities. 100 Table 3.4. Summary of OTUs (D=0.03) that comprise the putative San Salvador A. elisabethae core microbiome, as well as the OTUs consistently found in the dinoflagellate and larvae samples 111 Table 4.1. Number of different and unique bacterial species present in culture-dependent libraries. 133 Table 4.2. Cultured bacterial isolates and the culture-dependent and -independent libraries in which they were detected 137 Table 4.3. Recoverability of culture-independent libraries 140 Table 4.4. Cultured isolates from aerobic, microaerophilic, and anaerobic conditions, and the culture- dependent and -independent libraries in which they were detected 145 Table 4.5. Number of different and unique species present in aerobic, microaerophilic, and anaerobic libraries 148 Table 4.6. Taxonomic classification of culture-dependent library 150 Table 5.1. Differential characteristics of strains representing the order Bdellovibrionales. 193 Table 6.1. Fermentation media used in the screening of culture dependent bacterial isolates 213 Table 6.2. Actinobacteria fermentation extracts with unique secondary metabolites 220 Table 6.3. Accurate mass of secondary metabolites produced by Actinobacteria 221 Table 6.4. Firm icutes fermentation extracts with unique secondary metabolites 224 Table 6.5. Accurate mass of secondary metabolites produced by Firmicutes 225 Table 6.6. Proteobacteria fermentation extracts with unique secondary metabolites 228 Table 6.7. Accurate masses of secondary metabolites produced by Proteobacteria 229 Table 6.8. Experimental and reported 1 H (600 MHz) and 13C (150 MHz) NMR data for korormicin A (18) in DMSO-d6 232 Table 6.9. Accurate masses of korormicins produced by Pseudoalteromonas sp. RKEM 271 233 Table 6.10. Experimental and reported 1 H (600 MHz) and 13C (150 MHz) NMR data for ulbactin E (21) in DMSO-d6 235 Table 6.11. Accurate mass of ulbactins produced by Pseudoalteromonas sp. RKBH 245 236 Table 6.12. Accurate masses of putisolvins produced by Pseudomonas sp. RKEM 545 237 Table 6.13. Experimental 1H (600 MHz) and 13C (150 MHz) NMR Data for a long chain N-acyl L-leucine in DMSO-d6 242

xi LIST OF FIGURES

Figure 1.1. Chemical structures of marine natural product inspired drugs currently in use as therapeutic agents. 12 Figure 1.2. The octocoral E. caribaeorum, eleutherobin (7), desmethyleleutherobin (8), and isoeleutherobin (9) 17 Figure 1.3. The octocoral A. elisabethae, pseudopterosins (Ps) A-D (10-13), and methopterosin (14) 20 Figure 1.4. Chemical structure of cyanosafracin B (14) and trabectedin (5). 27 Figure 1.5. Overall workflow for thesis research. 27 Figure 2.1. Rarefaction curves of 14 E. caribaeorum microbiomes. 52 Figure 2.2. Yue and Clayton distance matrix comparison of E. caribaeorum microbial communities 53 Figure 2.3. Class level composition of E. caribaeorum microbiomes. 56 Figure 2.4. Genus level composition of E. caribaeorum microbiomes. 57 Figure 2.5. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of stable OTUs 62 Figure 3.1. Rarefaction curve of all coral-derived and seawater datasets. 81 Figure 3.2. Yue and Clayton distance matrix comparison of A. elisabethae holobiont and surrounding seawater microbial communities 85 Figure 3.3. Class level microbial composition of holobiont and seawater samples 88 Figure 3.4. Genus level microbial composition of holobiont and seawater samples 89 Figure 3.5. A. elisabethae sampling locations 91 Figure 3.6. Observed and chaol estimates richness for all reported A. elisabethae and octocoral microbiomes investigated using 454 pyrosequencing 92 Figure 3.7. Shannon diversity and equitability indices for all reported A. elisabethae and octocoral microbiomes investigated using 454 pyrosequencing 93 Figure 3.8. Class level composition of all reported A. elisabethae microbiome 96 Figure 3.9. Observed and Chaol estimated richness for holobiont, dinoflagellate, and larvae samples.. 101 Figure 3.10. Shannon diversity (H') and equitability (E) indices for holobiont, dinoflagellate, and larvae samples. 102 Figure 3.11. Yue and Clayton distance matrix comparison of A. elisabethae holobiont, dinoflagellate, and Figure 3.12. Class level microbial composition of coral-derived (holobiont, dinoflagellates, and larvae) fractions 106 Figure 3.13. Genus level microbial composition of coral-derived (holobiont, dinoflagellates, and larvae) fractions 107 Figure 4.1. Class level bacterial composition of culture-dependent libraries 134 Figure 4.2. Genus level bacterial composition of culture-dependent libraries 135 Figure 4.3. Class level bacterial composition of aerophilic, microaerophilic, and anaerobic culture- dependent libraries. 143 Figure 4.4. Genus level bacterial composition of aerophilic, microaerophilic, and anaerobic culture- dependent libraries 144 Figure 4.5. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the orders Enterobacteriales and Oceanospirillales. 160 Figure 4.6. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the order Pseudomonadales. 162 Figure 4.7. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the orders Vibrionales and Alteromonadales 164 Figure 4.8. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the order Rhodobacterales 166 Figure 4.9. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the orders Rhizobiales, Sphingomonadales, and Enterobacteriales 168

xii Figure 4.10. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the family Microbacteriaceae. 170 Figure 4.11. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the order Micrococcales. 172 Figure 4.12. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the orders Kineosporiales, Streptomycetals, Corynebacteriales, Geodermatophilales, and Propionibacteriales 174 Figure 4.13. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the genus Bacillus 176 Figure 4.14. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the class Bacilli 178 Figure 4.15. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the family Flammeovirgaceae 180 Figure 5.1. Transmission Electron Micrograph Images of RKEM611 195 Figure 5.2. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences from 46 type strains from within the phylum Proteobacteria 198 Figure 5.3. Neighbor-joining phylogenetic tree based on 17 rpofi gene sequences from Deltaproteobacteria 200 Figure 5.4. Clustal W multiple aligment of the 16S rRNA gene of type strains in the order Bdellovibrionales. 201 Figure 5.5. 16S rRNA secondary structure helicies for represenative bacterial type strains from each family within the order Bdellovibrionales 202 Figure 6.3. Chromatograms of Marfey's analysis for metabolite 25. 243 Figure 6.4. Example of chemical barcode containing pseudopterosin standards 244 LIST OF ABBREVIATIONS

13 C = Carbon NMR 111= Proton NMR ACN = Acetonitrile AMOVA = Analysis of molecular variance ANOVA = Analysis of variance ATCC = American type culture collection BALO = Bdellovibrio-and-like organisms BFM = Bacterial fermentation media Bim = Bimini BLAST = Basic local alignment search tool bp = Base pair Col = Colombia COSY = Correlation spectroscopy D = Dinoflagellates d = Doublet dd = Doublet of doublets ddd = Doublet of doublet of doublets DMSO = Dimethyl sulfoxide DMSP = Dimethylsulfoniopropionate DNA = Deoxyribonucleic acid dR2A = dilute Reasoner's 2A DSMZ (or DSM) = Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH dt = Doublet of triplets E = Shannon equitability index EC = Erythropodium caribaeorum EDTA = Ethylenediaminetetraacetic acid Ele = Eleuthera ELSD = Evaporative-light scattering detector EPS = Exopolyssacharides ESI = Electrospray ionization Et0Ac = Ethyl acetate Et0H = Ethanol FAME = Fatty acid methyl ester - FDA = Food and drug administration FL = Florida G+C mol% = Guanine and cytosine molecular percentage GB = Grand Bahama GBR = Great Barrier Reef

xiv GGPP = Geranylgeranyl pyrophosphate H = Holobiont H' = Shannon diversity index HCI = Hydrochloric acid HMBC = Heteronuclear multiple bond correlation HPLC = High performance liquid chromatography HRMS = High resolution mass spectrometry HSQC = Heteronuclear single quantum correlation Hz = Hertz IC50 = Half maximal inhibitory concentration ID = Identity, L = Larvae m = multiplet m/z = Mass-to-charge ratio MA = Marine agar MALDI-TOF MS = Matrix-assisted laser desorption/ionization-time of flight mass spectrometry MB Marine broth ME = Minimum evolution MEGA = Molecular evolutionary genetics analysis Me0H = Methanol MIS = Microbial Identification System mM = Millimolar MNP = Marine natural products MP = Maximum-parsimony MRSA = Methicilin-resistant Staphylococcus aureus MS-MS = Tandem mass spectrometry Na2HPO4 = Disodium phosphate NaC1 = Sodium chloride NaOH = Sodium hydroxide NCBI = National center for biotechnology information NCCB = Netheralands culture collection of bacteria NGS = Next generation sequencing NJ = Neighbor-joining methods NMR = Nuclear magnetic resonance NP = Natural products OTUs = Operational taxonomic units PCA = Principal component analysis PCR = Polymerase chain reaction PDA = Photodiode array ppm = parts per million q = quartet RDP = Ribosomal database project

XV REF = Reference Rnase = Ribonuclease RP = Reverse-phase rpm = Revolutions per minute rRNA = Ribosomal ribonucleic acids RT = Retention time s = Singlet SCUBA = Self-contained underwater breathing apparatus SDS = Sodium dodecyl sulphate Sest = Chaol estimated species richness SFSW = Sterile filtered seawater Sobs = Observed species richness SS = San Salvador t = triplet TEM = Transmission electron microscopy TOCSY = Total correlated spectroscopy T-RFLP = Terminal restriction fragment length polymorphism UHPLC = Ultra high performance liquid chromatgraphy UPGMA = Unweighted paired group method with arithmetic mean UV = Ultraviolet V = 16S rRNA gene hypervariable region (Chapter 2) V = Volts v/v = Volume per volume VRE = Vancomycin-resistant Enterococcus faecium W = Seawater w/v = Weight per volume

xvi Chapter 1: Introduction and Objectives of Thesis Research

1 1.1 Octocoral Holobiont

Octocorallia is a subclass in the phylum Cnidaria and the class Anthrozoa that represent a diverse group of organisms including over 3000 species. They are sedentary, colonial soft corals whose polyps contain eight tentacles, eight septa with filaments, one siphonoglyph, and their skeletons consist of calcareous spicules with a calcified horny central axis.2 They are abundant in both Pacific and Atlantic reefs, and account for —40% of the known fauna in the Caribbean. Like many marine invertebrates, octocorals are associated with a wide variety of microorganisms including symbiotic algal dinoflagellates, bacteria, archaea, and fungi. Collectively, these along with the coral colonies are referred to as the coral holobiont.3 The microbial component of the holobiont can contribute to the overall coral health 'via any of the following mechanisms: (1)

Cycling of nutrients such as nitrogen, carbon, or sulphur;4'5 (2) protection from pathogenic infection via spatial exclusion,64 and/or through the production of bioactive antimicrobial metabolites;8.12 (3) removal of metabolic waste generated by the coral and/or the Symbiodinium spp.;4'5 and (4) production of quorum sensing molecules that regulate phenotypic behaviours between organisms within the holobiont.13-16 These functions can be so vital that the 'coral probiotic hypothesis' suggests that corals can adapt to changing environmental conditions by altering their microbial community to maximize the health of the overall holobiont.17

1.2 Investigations of Coral Microbiomes

Traditionally, investigation of coral microbiomes was through culture dependent based techniques. However, a vast majority of the microbes present in coral microbiomes are not cultivatable and it has been suggested that less than 1% of the taxonomic diversity is detectable 18 using these techniques. Therefore, over the years culture-independent techniques such as

2 denaturing gradient gel electrophoresis, terminal restriction fragment length polymorphism, and clone libraries were used to identify the microbiomes of corals.7'19-26 However, with the advancement of next generation sequencing (NGS) technologies, such as 454 pyrosequencing, researchers have been able to identify the 'long tail' of low abundance taxa in these microbiomes that were not previously obtainable.27'28 This allowed for in-depth analysis of coral microbiomes that has enabled the following broad conclusions: (1) Coral microbiomes are distinctly different from that of the surrounding seawater;29'3° (2) coral microbiomes are rich in microbial abundance

30 31 as well as taxonomic diversity; ' and (3) even though coral microbiomes are taxonomically diverse, many maintain a core microbiome, a set of specific microbial taxa that form a stable association with a particular coral species.32'33 While overall microbiome membership varies with geographic location or changing environmental factors, the core microbiome remains intact as long as the coral remains healthy.34 Table 1.1 gives an overview of all coral microbiomes that have been investigated using 454 pyrosequencing to date.

3 Table 1.1. Summary of richness and alpha diversity measurements for all reported coral microbiomes investigated using 454 pyrosequencing. All values reported below are from healthy corals. Corals that belong to the subclass Octocorallia (Octocorals) are in bold.

#0TUs Chaol Corals H ' E' Primers; 16S Ref. (Sob,) (5.,) (Sample number) Location rDNA Variable (mean ± standard deviation) Region Montastraea 35 Water Factory site, 27F & 534R; annularis 214 ± 39 321 ± 38 3.63 ± 0.73 (n=4) . Island of Curacao VI - V4

29 Eunicella cavolhd 27F & 338R; 299 ± 270 474 ± 430 2.12 ± 1.37 0.37 ± 0.19 French Mediterranean (n=9) VI - V2

32 Styliphora pistillata 784F& 1061R; 289± 150 585 ± 291 1.44 ± 0.56 Southern Red Sea (n=5) V5 - V6

Pocillopora damicornis 471 ± 60 (n=3)

Acropora millipora 427± 104 (n=3)

Seriatopora hystrix 192 ± 42 36 (n=3) Great Barrier Reef, 63F & 533R; Australia V1 - V3 Sinulariaflexibilis 181 ±41 (n=3)

Sarcophyton sp. (n=3) 80 ± 13

Nephyta sp. 377 (n=1)

Diploria strigosa 378 ± 13 800 ± 153 (n=5) 5.4 ± 0.1 37 Aguja Island, 784F & 1061R; Columbia V5 - V6 Siderasrea siderea 256 ± 7 513 ± 123 4.5 ± 0.1 • (n=5)

Acropora tenuis 234 ± 81 253 ±90.1 (n=6)

Posillopora 38 Ningaloo Reef, 63F & 533R; damicornis 81 ± 40 142 ± 90 Western Australia VI -V3

Tubastrea fazdkneri 319± 121 331 ± 136

Antillogorgia . El Planchon, 39 27F & 534R; elisabethae 184 ±-126 291 ± 159 2.13 ± 0.19 0.46 ± 0.03 Providencia Island, VI —V3 (n=3) Colombia

40 Acropora hemprichii Saudi Arabia, Central 784F & 1061R; 159±30 427±140 (n=9) Red Sea V5 - V6

4 Pocillopora verrucosa - 334 ± 257 545 ± 328 4.54 ± 0.45 (n=3) Astereopora myriophthalma 207 ± 17 372 ± 31 3.71 ± 0.74 41 (n=2) Red Sea, coast of 341F & 685R; Saudi Arabia V3 - V4 Stylophora pistillata 230 374 5.23 (n=1)

Sarcophyton spp. 419 ± 73 735 ± 285 5.48 ± 0.89 (n=3)

42 Acropora millepora Cattle Bay, Trunk 28F &.519R; 37 ± 18 59 ± 33 (n=20) Reef, GBR V 1 — V2 •

Porites lutes 1623 ± 748 3848± 1500 6.29 ± 0.66 (n=3)

30 . Galaxea fascicularis 27F & 534R; 1181 ±463 3537± 1687 5.84± 1.45 South China Sea (n=3) VI — V3

Acropora millepora 523 ± 185 1143 ± 325 5.52 ± 0.29 (n=3)

Montastraea faveolata 50 to 145 76 to 402 5.5 ± 0.5 Caribbean; 43 US Virgin Islands, 27F& 518R; Florida Keys, FL, VI —V2 Ponies asteroides 11 to 85 26 to 225 3.1 ±.1.1 Belize

34 Ctenactis echinata 784F& 106IR; 48.9 ± 8.5 2.14 ± 0.02 Central Red Sea (n=54) V5 - V6

Montastraea faveolata 1553 2925 (n=1)

Montastraeafranksi 2050 4026 (n=I)

Diploria strigosa 1759 3801 (n=1)

31 Acropora palmata Bocas del Toro, 967F & 1046R; 1671 2576 (n=1) Panama V6

Acropora cervicornis 1616 2602 (n=1)

Ponies astreoides 1340 3106 (n=1)

Gorgonia ventalina 1143 2177 (n=1)

Pamamiiricea 44 967F& 1046R; clavata 1069 to 2501 3.2 ± 1.6 Mediterranean Sea V6 (n=5)

45 Platygyra carnosus Hoi Ha Wan Marine 34IF & 926R; 350± 107 5.9 ± 0.4 (n=4) Park, Hong Kong V3 - V5

5 46. Palythoa australiae 27F & 533R; South China Sea (n=3) VI -V3

Eunicea Fusca 45 ± 18 84 ± 31 1.02 ± 0.29 0.27 ± 0.07 Florida, The Bahamas (n=9)

47 Eunicea sp. 27F & 519R; 31 71 0.98 • 0.29 V1 —V2 ' The Bahamas Plexaura sp. 14 36 0.29 0.11 •

Antillogorgia • 48 27F & 51 9R; elisabethae 113 ± 78 298 ± 193 2.48 t 1.25 0.53 ± 0.19 The Bahamas (n=14) VI — V2 Antillognrgia Chapter 515F& 806R; elisabethae 137 ± 34 245 ± 81 2163 ± 0.43 0.54 ± 0.03 The Bahamas 3 V4 (n=5) Abbreviations: GBR = Great Barrier Reef; OTUs = Operational taxonomic units; Chaol = Species richness estimator; H'= Shannon diversity index; E= Shannon equitability index.

6 1.3 Natural Products

Natural products (NP) are secondary metabolites produced by an organism that are not required for the basic sustenance of life, but Offer an evolutionary advantage to the producing organism.49'50 The ecological roles of these secondary metabolites are often enigmatic but can range, from chemical defense against predation, to acting as an antifouling or antibiotic agent, to signalling compounds involved in the organism's survival and fecundity.49'5I-53 In addition to their ecological roles, plant-based NPs have been a part of traditional medicine for thousands of years.54'55 This continues today, as NPs are an essential part of the current healthcare system. In fact, approximately 64% of all approved therapeutic drugs are either naturally derived or 56-58 inspired. The success of NPs and their derivatives as therapeutic agents is largely due to their structural diversity and highly specific biological activity.59 Owing to the high metabolic cost of biosynthesising NPs, these chemicals presumably increase the overall fitness of the organism through evolutionary selection, and therefore have coevolved with some receptor binding capacity that could be put to anthropogenic use.69 Their wide range of pharmacophores with a high degree of stereochemistry makes NPs great candidates not only for pharmaceutical uses, but also cosmeceutical, nutraceutical, and agrochemical applications.

1.4 Marine Natural Products

Secondary metabolites derived from marine organisms, or marine natural products (MNPs) do not have the same significant history or prevalence in the pharmaceutical world as their terrestrial counter parts. This is simply due to the fact that the investigation of the marine environment for bioactive compounds is relatively new compared to the terrestrial environment.

Systematic investigation of the marine environment for novel secondary metabolites only began

7 in the 1970s with the advent of SCUBA equipment.61 However, once MNP research began the marine environment proved to be a rich source of bioactive compounds as from 1977 to 1987 approximately 2,500 new metabolites were reported from a variety of marine origins.57 The number of novel chemical structures continued to grow dramatically, by 2014 there were over

9,200 publications reporting over 24,660 new compounds.62-66 However, despite the number of reported MNPs the oceans are still a relatively untapped resource. They cover over 70% of the

Earth's surface and are predicted to contain as many as 2.2 million different eukaryotic marine species,67 to say nothing of the vast prokaryotic diversity. This high level of biodiversity encompasses a large amount of genetic diversity, which in turn leads to high chemical diversity and the potential for novel MNPs, making the oceans a rich environment for MNP discovery.68,69

Although the field of MNP research is relatively young compared to its terrestrial counterpart, there have been seven therapeutic agents approved for clinical use (Table 1.2), six (1-6) of which are in current use today (Figure 1.1). In addition to the clinically approved MNPs there is one over-the-counter MNP as well as a number more that have entered clinical trials, ten of which are currently progressing through the clinical pipeline (Table 1.3).7071 While this is promising for the field of MNP research and drug discovery, some of these clinical trials have been discontinued over the last few years due to a limited supply of the desired MNP. This "supply issue" is also a common reason that many promising MNPs never enter into the clinical pipeline.

Often MNPs from marine invertebrates account for a small percentage of the overall biomass of the organism.72'73 Therefore large-scale harvesting of the organism proves to be inefficient, not to mention the ecological and environmental impacts that.such harvesting would have on the marine ecosystem. The low yield of MNPs within organisms often means that aquiculture of the

8 organism does not always prove to be a cost effective way to obtain the desired compound.74

Total- and semi-synthesis have proven to be an effective means to obtain MNPs in some cases.75

However, in many cases the structural complexity of the desired MNP can be challenging and generating yields high enough to create a stable source of these compounds can be difficult.76-78

Often an alternative method of obtaining a sustainable supply of certain MNPs is recjuired,for these compounds to proceed through clinical trials. There is a growing body of evidence that in many cases the MNP isolated from marine invertebrates are in fact biosynthesised by an

associated symbiotic microorganism.79-84 This will be discussed in greater detail in a later section

(1.6.1). In cases where microbes are the true producers, the desired MNP could be obtained through fermentation of the producing organism.

While MNPs are a promising source of pharmaceuticals, they have also proved to be an excellent source of cosmeceuticals. For example, Abyssine® (Unipex, New York, USA) which consists of exopolysaccharides (EPS) obtained from a marine Alteromonas sp. extract that has been shown to reduce the expression of a skin stress marker involved in skin reactivity (ICAM-1), and is marketed as a "protectant for reducing irritation in sensitive skin" by "increasing resistance to mechanical and sun aggression."85-88 Seacode® (Lipotec, Barcelona, Spain) which consists of

EPS and glycoproteins obtained from a marine Pseudoalteromonas sp. extract is marketed as a

"marine eraser for aging lines" that "enhances the synthesis of dermal proteins, such as collagen

I, visibly reducing aging signs in the short and long term."89 Dermochlorella De (CODIF,

Britany, France) which consists of oligopeptides obtained from a marine Chlorella sp. extract is marketed to "stimulate synthesis of components of the dermis and dermal-epidermal junction....after 28 days, the skin is firmer and more toned."9°

9 Resilience® (Estee Lauder, New York, USA) which consists of pseudopterosins (10-13) obtained from the extract of the coral Antillogorgia elisabethae, has potent anti-inflammatory activity and will be discussed in greater detail below (1.5.2).7191 These examples only scratch the surface, as there are thousands of different commercially available cosmetic products that contain MNPs obtained from various marine sources.71'92

10

Table 1.2. Clinically approved marine natural products and marine natural product derivatives.

Predicted Collected Compound MNP Bio- Biosynthetic Therapeutic Molecular Clinical Ref. • Source (Trademark) or D* synthetic Class Area Target Status Organism Source

Eribulin Sponge 93-95 FDA/EMEA mesylate D Halichodria B Polyketide Cancer Microtubules (Halavene) okadai Approved

96-98 Ziconotide Marine snail Cysteine Neuropathic MNP N-type Ca FDA/EMEA (Prial0) Conus magus Knot Peptide Pain channel Approved

Brentuximab 99- Sea hare vedotin Cyclic CD30 and FDA/EMEA Dolabella CB Cancer • 101 (SGN-35) Depsipeptide microtubules auricularia Approved (Adcetrise)

102- Cytarabine Sponge DNA FDA/EMEA (Cytosar-U8; D Cryptotethya B Nucleoside Cancer 105 polymerase Approved Depocyt 8) crypta

Discontinued 104,10 Sponge Vidarabine Viral DNA (Previously Cryptotethya B Nucleoside Anti-viral 6 (Vira-A0)* crypta polymerase I FDA/EMEA Approved)

75,79, Tunicate NFtPS- 107- . Trabectedein B Minor groove EMEA Ecteinascidia derived Cancer (Yondelis0) MNP of DNA Approved 109 turbinata Alkaloid

110- Omega-3-acid Triglyceride Omega-3 Hypertri- FDA/EMEA ethylesters Fish MA glyceridemia • synthesizing 112 fatty acids Approved (Lovaza0) enzymes

Abbreviations: MNP = Marine Natural Product; D = Natural product derivative; B = Bacteria; MA = Microalgae; CB = Cyanobacteria *Vidaradine was discontinued as an antiviral drug in 2001, but is still used in the EU for ophthalmological applications

11 NH2 H—Cys—Lys —Gly —Lys LOH pMe Ala—Gly /Cys Lys Cys Asp—Tyr

Cys—Ser—Arg —Leu —Met LysJsThr Gly—Ser

Gly—Ser---Arg--Cys (2) (1) Eribulin mesylate Zic,onotide Halaven0 Prialt®

0 0 OMe 0 OMe 0

(3) Brentuximad vedotin (SGN 35) Adcetris® NH2 HO

NH cAC10 U j Me0 HO,,- H N OH 0 OMe 0 S/ HO ? H H . OAc OH 11

(4) 0 Cytarabine 6H Cytosar-U®; Depocyt® (5) Trabectedein 0 • Yondelis® 0 0

(6) Omega-3-acid ethylesters Lovaza® Figure 1.1. Chemical structures of marine natural product inspired drugs currently in use as therapeutic agents.

12 Table 1.3. Marine natural products and derivatives that have entered into the pharmaceutical clinical trial pipeline. Table derived from data summarized by Gerwick et al." and Martins et al.71.

Predicted Compound MNP or Collected Source Therapeutic Clinical Biosynthetic (Trademark) D* Organism Area Status Source

Iota-carrageenan Red algae Over the MNP Cancer (Carragelosee) Rhodophyceae counter drug Pliditepsin Ascidian MNP Bacterium Cancer Phase III (Aplidinr1) Aplidium albicans PM00104 Sea slug Bacterium Cancer Phase II (Zalypsis Joruna funebris Worm DMXBA GTS-21 Paranemertes Worm Alzheimer's Phase II peregrina Tunicate Lurbinectedin Bacterium Cancer Phase II Ecteinascidia turbinata Glembatumumab Sea hare Cyanobacterium Cancer Phase 11 vedotin CDX-011 Dolabella auricularia Sea hare SGN-75 Cyanobacterium Cancer Phase I Dolabella auricularia Sponge PM060184 MNP Lit hoplocamia Cancer Phase I lit histoides Salinosporamide A Actinomycetes MNP Cancer Phase I Marizomib Salinispora tropica Sea hare ASG-5ME Cyanobacterium Cancer Phase I Dolabella auricularia Bryozoan Cancer/ Bryostatin I MNP Bacterium Phase I/II Bugula neritina Alzheimer's Sea hare Discontinued Soblidotin Cyanobacterium Cancer Dolabella auricularia (Phase III) Sea hare Discontinued Syrithadotin Cyanobacterium Cancer Dolabella auricularia (Phase II) Octocoral Wound Discontinued Methopterosins NP Antillogorgia Bacterium Healing (Phase II) elisabethae Elisidepsin Sea slug Discontinued Bacterium Cancer (Irvalece) Elysia rufescens (Phase II) Maine fungus Discontinued Plinabulin NP1-2358 Cancer Aspergillus sp. (Phase II) Sea hare Discontinued Tasidotin ILX-651 Cyanobacterium Cancer Dolabella auricularia (Phase II)

13 Sponge Discontinued Hemiasterlin MNP Bacterium Cancer Hemiastrella minor (Phase 11) Sea slug Discontinued Kahalalide F MNP Cancer Elysia rufescens (Phase H) Dogphish shark Discontinued Squalamine MNP Cancer Squalus acanthias (Phase II) Hemiasterlin Sponge Discontinued Bacterium Cancer H11-286 Hemiastrella minor (Phase 11) Sponge Discontinued Discoclermolide MNP Cancer Discodermia dissouta (Phase 1) Sponge Discontinued E7389 Bacterium Cancer Halichondria okadai (Phase 1) Spisulosine Marine clam Discontinued MNP Cancer ES-285 Spisula polynyma (Phase 1) Agelasphins Sponge Discontinued Cancer KRN-7000 Age/as mauritianus (Phase I) AE-941 Discontinued MNP Shark cartilage Cancer (Neovastate) (Phase 1) Psammaplin A Sponge Discontinued Cancer NVP-LAQ824 Aplysinella rhax (Phase I) Conotoxin G Marine snail Discontinued MNP Pain CGX-1160 Conus geographus (Phase 1) Abbreviations: MNP = Marine Natural Product; D = Marine natural product derivative

14 1.5 Marine Natural Products from Octocorals

Octocorals are also known as 'soft corals' as they lack the calcareous exoskeleton the reef building scleractinian or 'stony corals' have for physical protection.113'114 Octocorals tend to rely on chemical defenses for protection making them a wonderful source of bioactive MNPs that have a wide range of biological activity ranging from anticancer, antibiotic, anti-inflammatory, antiviral, to antioxidant.115'116 The octocorals that are the driving force behind this thesis research are Erythropodium caribaeorum and Antillogorgia elisabethae, which are associated with the bioactive MNPs the eleutherobins and pseudopterosins, respectively.

1.5.1 Erythropodium caribaeorum and the Eleutherobins

Erythropodium caribaeorum is an octocoral in the suborder Scleraxonia and the family

Anthothelidae that is found in the Caribbean Sea from southern Florida to the Virgin Islands. The colonies grow in a thin firm purplish-grey encrusting morphology over their substrate. The polyps appear hair-like along the surface of the coral when they are extended, and when they are retracted slightly projected star-shaped apertures are visible.2 They are a source of a family cytotoxic diterpene glycosides known as the eleutherobins.117,118 Eleutherobin (Figure 1.2) was initially isolated from a Western Australian Eleutherobia sp. by Lindel et a/.117 Then work by

Andersen and co-workers used a cell ba'sed antimitotic assay coupled with bioassay-guided fractionations to isolate an additional six analogs.118' 119 It was later determined that eleutherobin was not a MNP but an isolation artifact formed by reaction of desmethyleleutherobin with methanol during extraction and purification.120 The MNPs Desmethyleleutherobin (IC50 20nM), and isoeleutherobin (IC50 50nM) (Figure 1.2) are of particular interest due to their antimitotic activity at nanomolar concentrations that have a mechanism of action similar to the well-known

15 cancer drug Taxol® and acts through microtubule stabilization.117'1 "

The eleutherobins are structurally related to other compounds isolated from Eleutherobia sp. and

Sarcodictyon sp. from South Africa and the Mediterranean, bringing into question the true 121,122 biosynthetic source of these compounds. A common microorganism in the microbiomes of

these corals could be the true biosynthetic source and may account for the structural similarity of these compounds.

16 OR3

‘ ,OH

Eleutherobin (7) R1 = CH3, R2 = Ac, R3 = H Desmethyleleutherobin (8) R1 = R3 = H, R2 = Ac Isoeleutherobin (9) R1 = CH3, R2 = H, R3 = Ac

Figure 1.2. The octocoral E. caribaeorum, eleutherobin (7), desmethyleleutherobin (8), and isoeleutherobin (9).

17 1.5.2 Antillogorgia elisabethae and the Pseudopterosins

Antillogorgia elisabethae is an octocoral in the suborder Holaxonia in the family Gorgon iidae and is a dominant octocoral in many Caribbean reef communities.123'124 This coral was previously classified as a member of the Pseudopterogorgia genus but has since been reassigned to the resurrected genus Antillogorgia. 125 Morphologically, they are sea plume in structure and consist of feather-like branches with a central skeleton and closely spaced branchlets that extend from the central skeleton.2 They are the sole source of a family of diterpene glycosides known as the pseudopterosins that were first isolated in 1986 by Look etal. who reported the structures of pseudopterosins A-D126'127 (Figure 1.3). Since then 30 pseudopterosins and 11 seco- pseudopterosins have been identified. These compounds have been identified from A. elisabethae collected from the Bahamas, Bermuda, the Florida Keys, and Colombia.116,128-136

The pseudopterosins attracted commercial attention due to their anti-inflammatory activity that have been shown to be more potent than the clinically used drug indomethacin.126,127,129,137 A simple derivative of pseudopterosin A, methopterosin (Figure 1.3) has successfully completed

Phase I and II of clinical trials as a wound healing agent, but development has been discontinued due to the supply issue.73'92'138 The total synthesis of pseudopterosin A was first reported by

Broka etal. in 1988,139 since then there have been numerous reported syntheses of pseudopterosins and pseudopterosin-like molecules.1.33,140,141 However this has not proven an economically viable option for the sustainable production of pseudopterosins for commercial use, due to the complexity of these compounds only low quantities could be obtained. While the pseudopterosins have not progressed through clinical trials due to the supply issues "natural extracts" of A. elisabethae are currently used in the Resilience® line of skincare products from

Estee Lauder.71'91

18 In addition to anti-inflammatory activity, pseudopterosins have been shown to exhibit a wide

range of bioactivity including anticancer, antiviral, antituberculosis, and antibiotic activity

against Gram positive bacteria. 129,131,134 The mechanism of action is incompletely understood,

but it.is believed to involve competitive binding to adenosine receptors, which belong to the G-

protein coupled receptor class.142'143

The biosynthetic machinery that is involved in pseudopterosin biosynthesis has been detected in

the larvae of A. elisabethae as well as the symbiotic algal dinoflagellates, which bring to question the true biosynthetic producer of these commercially relevant compounds. This will be discussed in greater detail in Chapter 3.

19 \OR3

0 OR2 ORi OR4

PSA (10) RI = R2 = R3 = R4 = H PsB (11) Ri =Ac, R2 = R3 = R4 = H PsC (12) R2 =AC, Ri = R3 = R4 = H PsD (13) R3 =AC, Ri = R2 = R4 = H

Methopterosin (15) R4 =CH3, R1 = R2 = R3 = H

Figure 1.3. The octocoral A. elisabethae, pseudopterosins (Ps) A-D (10-13), and methopterosin (14).

20 1.6 Microorganisms as a Source of Natural Products

Microorganisms from the terrestrial environment are responsible for a vast majority of the

clinically approved natural products on the market to date. Of FDA approved antibacterial agents

69% of them are NPs or NP-derived, and of those 97% originate from a microbial source.58

Although there are no FDA approved MNPs from marine microorganisms, the anti-cancer

compounds Salinosporamide A isolated from the marine actinomycetes Salinispora tropica is

currently in the clinical trial pipeline7I (Table 1.2). Additionally, many of the bioactive MNP

isolated from marine microorganisms that are approved for clinical use are believed to be

biosynthesised by associated microorganisms.80

1.6.1 Microorganisms as Biosynthetic Producers of Marine Natural Products Isolated from

Macroorganisms

Over the years it has long been suspected that many of the MNPs isolated from macroorganisms are in fact biosynthesised by associated microorganisms. Some estimate that as many as 80% of the approved and clinical trial MNPs and MNP-inspired derivatives are biosynthesised by microorganisms."'" Many of the MNPs isolated from macroorganisms are structurally similar to known microbial metabo1ites.81-83 For example, trabectedin which is currently used under the trademark Yondelis®, was originally isolated from the tunicate Ecteinascidia turbinate however it is structurally similar to the Pseudomonas fluorescens metabolite, cyanosafracin B. In fact due to the close structural similarity, cyanosafracin B is used as the starting point for the semi- synthesis of trabectedin for commercial use75'109 (Figure 1.4). Other evidence that suggested microbial symbionts might be the true producers of many MNPs is the fact that many of the macroorganisms have stable core microbiomes. For example, keeping with the trabectedin

.21 theme, the E. turbinate microbiome was dominated by the Gammaproteobacteria, Candidatus

Endoecteinascidia frumentensis in samples collected from both the Mediterranean and the

Caribbean.144 Trabectedin biosynthesis by E. frumentensis was finally confirmed when Rath et al. used metagenomic analysis to confirm presence of 25 genes involved in trabectedin biosynthesis within the E. frumentensis genome.79'145 This is not an isolated incident, microbial biosynthesis has been implicated in many approved and clinical trial MNPs that have a wide

70 80 range of chemical structural diversity ' (Table 1.2, 1.3).

22 HO

NH 0

0 HO S OAc

H N

(14) (5)

Figure 1.4. Chemical structure of cyanosafracin B (14) and trabectedin (5).

23 1.6.2 Octocorals as a Reservoir of Unique Microorganisms

Over the past few years there has been a dramatic rise in the number of novel metabolites being reported from marine microorganisms;53,80,146 and NGS has revealed that the marine environment is a vast resource of untapped taxonomically diverse microorganisms.31'147 Marine invertebrates, such as sponges and corals, act as a reservoir for unique microbes by providing a higher nutrient environment than that of the surrounding seawater; which is why marine invertebrates have proven to be a valuable source of novel cultivatable microorganisms.148-153 Therefore, octocorals are potentially a great source for novel cultivatable microbial diversity. As greater biological diversity has been shown to lead to greater genetic and chemical diversity, microbes cultivated from octocorals may be an excellent source of MNPs.68

1.7 Objectives of Thesis Research

With the advent of NGS technologies in-depth investigation of the microbiomes associated with marine corals has become more accessible. While the microbiomes of reef-building scleractinian corals have been extensively studied using these techniques,303537404243--1 15456 relatively fewer have examined the microbiomes of octocorals even though these corals are dominant members of many reef communities.29'39'44 Therefore, understanding the microbial communities associated with these corals may provide insight into the overall health of the reef communities in which they inhabit. Additionally, octocorals have been shown to be associated with bioactive MNPs and understanding any stable association between these corals and their microbial communities may provide insight into the biosynthetic source of these MNPs. Lastly, octocorals may be a valuable source of cultivatable taxonomically diverse microorganisms that may produce known or novel MNPs.

24 Therefore the hypotheses of this thesis research are: (1) The octocorals E. caribaeorum and A. elisabethae have a stable microbiome, a set of bacteria that form a stable association with the octocoral regardless of geographic location; (2)A. elisabethae is a reservoir for unique cultivatable bacteria; and (3) bacteria cultivated from E. caribaeorum and A. elisabethae will be an excellent source of known and novel 1VINPs. The resulting objectives of this thesis research are as follows: (1) Characterize the culture-independent microbial communities associated with the octocorals E. caribaeorum and A. elisabethae. (2) Characterize the cultivatable bacterial communities associated with A. elisabethae. (3) Identify any known and novel MNPs produced by the cultivated octocoral bacteria.

Figure 1.5 gives an overview of the workflow of this thesis research. The microbiomes of E. caribaeorum collected at different times and locations were investigated using culture- independent pyrosequencing (Chapter 2). Samples of A. elisabethae were divided into coral derived fractions (holobiont, dinoflagellates, and larvae) that are involved in the health and fecundity of the coral. This will be described in greater detail in Chapter 3. Each coral derived fraction was divided and the samples were used for two different studies; one investigating the bacterial communities associated with the coral derived fractions using culture independent pyrosequencing (Chapter 3), and the other investigating the cultivatable bacteria from these coral derived fractions (Chapter 4). Additionally, an investigation into the cultivatable bacteria from A. elisabethae under aerobic, microaerophilic, and anaerobic conditions was conducted (Chapter 4). .

A formal species description of a bacterium cultivated from A. elisabethae that was determined to be a member of a novel taxonomic family was conducted (Chapter 5). Microorganisms cultivated from A. elisabethae and E. caribaeorum (obtained from another study by Brad Haltli —

( 25 Research Manager, Nautilus Bioscience and Adjunct Faculty, University of Prince Edward

Island) were fermented and screened for the presence of known and novel MNPs (Chapter 6). •

26 Erythropodium Antillogorgia caribaeorum elisabethae Octocoral Collection by SCUBA

555 Cultivation of holobiont bacteria ill< under aerobic, Division into Coral Derived Fractions: 1.28 microaerophilic, RSA and anaerobic Holobiont, Larvae, & Dinoflagellates FllA (Nov 2011) 3311, 5011 .31 MY SOX 9011 3091 conditions (March 2012) E. caribaeorum Culture Independent Microbiome Study (Ch. 2)

Cultured microorganisms obtained from another 1011 2014 300 MS SOS 0111 3111 .011 19011 study by Brad Haltli A. elisabethae Culture Dependent Study (Ch. 4) A. elisabethae Culture Independent Microbiome Study (Ch. 3)

mac-- Description of a novel family, genus, and species of bacteria - r (Ch. 5)

Microbial Fermentation & Marine Natural Product Identification (Ch 6) Figure 1.5. Overall workflow for thesis research.

27 1.8 References

McFadden, C. S.; Sanchez, J. A.; France; S. C. Integr. Comp. Biol. 2010, 50 (3), 389-

410.

Bayer, F. M. The Shallow-water Octocorallia of the West Indian Region: A Manual for

Marine Biologists; Nijhoff: Boston, 1961.

Rosenberg, E.; Koren, 0.; Reshef, L.; Efrony, R.; Zilber-Rosenberg, I. Nat. Rev.

Micro. 2007, 5 (5), 355-362.

Raina, J.-B.; Dinsdale, E. A.; Willis, B. L.; Bourne, D. G. Trends. Microbiol. 2010, 18

(3), 101-108.

Raina, J.-B.; Tapiolas, D.; Willis, B. L.; Bourne, D. G. Appl. Environ. Microb. 2009,

75(11), 3492-3501.

Wegley, L.; Edwards, R.; Rodriguez-Brito, B.; Liu, H.; Rohwer, F. Environ.

Microbiol. 2007, 9 (11), 2707-2719.

Kvennefors, E. C. E.; Sampayo, E.; Ridgway, T.; Barnes, A. C.; Hoegh-Guldberg, 0.

PLoS ONE 2010, 5 (4), e10401—e10414.

Thurber, R. V.; Willner-Hall, D.; Rodriguez-Mueller, B.; Desnues, C.; Edwards, R. A.;

Angly, F.; Dinsdale, E.; Kelly, L.; Rohwer, F. Environ. Microbiol. 2009, 11(8), 2148-

2163.

Riley, M. A.; Gordon, D. M. Trends. Microbiol. 1999, 7 (3), 129-133.

Nissimov, J.; Rosenberg, E.; Munn, C. B. FEMS Microbiol. Lett. 2009, 292 (2), 210-

215.

Ainsworth, T. D.; Thurber, R. V.; Gates, R. D. Trend EcoL Evol. 2010, 25 (4), 233-

240.

28 Kvennefors, E. C. E.; Sampayo, E.; Kerr, C.; Vieira, G.; Roff, G.; Barnes, A. C.

Microb. Ecol. 2012, 63 (3), 605-618.

Ng, W.-L.; Bassler, B. L. Annu. Rev. Genet. 2009, 43 (1), 197-222.

.Golberg, K.; Eltzov, E.; Shnit-Orland, M.; Marks, R. S.; Kushmaro, A. Microb. Ecol.

2011, 61 (4), 783-792.

Skindersoe, M. E.; Ettinger-Epstein, P.; Rasmussen, T. B.; Bjarnsholt, T.; de Nys, R.;

Givskov, M. Mar. BiotechnoL 2008, 10 (1), 56-63.

Dobretsov, S.; Teplitski, M.; Bayer, M.; Gunasekera, S.; Proksch, P.; Paul, V. J.

Biofouling 2011, 27 (8), 893-905.

Reshef, L.; Koren, O.; Loya, Y.; Zilber-Rosenberg, I.; Rosenberg, E. Environ.

MicrobioL 2006, 8 (12), 2068-2073.

Amann, R. I.; Ludwig, W.; Schleifer, K. H. MicrobioL Rev. 1995, 59 (1), 143-169.

Webster, N. S.; Bourne, D. G. FEMS MicrobioL Ecol. 2007, 59 (1), 81-94.

Bourne, D. G.; Iida, Y.; Uthicke, S.; Smith-Keune, C. ISME J2007, 2 (4), 350-363.

Kellogg, C. A.; Lisle, J. T.; Galkiewicz, J. P. AppL Environ. Microb. 2009, 75 (8),

. 2294-2303.

Littman, R. A.; Willis, B. L.; Pfeffer, C.; Bourne, D. G. FEMS MicrobioL Ecol. 2009,

68 (2), 152-163.

Sweet, M. J.; Croquer, A.; Bythell, J. C. Coral Reefs 2010, 30 (1), 39-52.

Sweet, M. J.; Croquer, A.; Bythell, J. C. Coral Reefs 2011, 30 (4), 1121-1133.

Gray, M. A.; Stone, R. P.; McLaughlin, M. R.; Kellogg, C. A. FEMS Microbiol. Ecol.

2011, 76 (1), 109-120.

La Riviere, M.; Garrabou, J.; Bally, M. Rapp. Comm. Int. Mer. Medit. 2010, 39, 769.

29 Amend, A. S..; Seifert, K. A.; Bruns, T. D. Mol. Ecol. 2010, 19 (24), 5555-5565.

Gilbert, J. A.; Dupont, C. L. Annu. Rev. Mar. Sci. 2011, 3, 347-371.

Bayer, T.; Arif, C.; Ferrier-Pages, C.; Zoccola, D.; Aranda, M.; Voolstra, C. R. Mar.

Ecol. Prog. Ser. 2013, 479, 75-84.

Li, J.-W.; Chen, Q.; Zhang, S.; Huang, H.; Yang, J.; Tian, X.-P.; Long, L.-J. PLoS

ONE 2013, 8 (8); e71301.

Sunagawa, S.; Woodley, C. M.; Medina, M. PLoS ONE 2010, 5 (3), e9554.

Bayer, T.; Neave, M. J.; Alsheikh-Hussain, A.; Aranda, M.; Yum, L. K.; Mincer, T.;

Hughen, K.; Apprill, A.; Voolstra, C. R. Appl. Environ. Microb. 2013, 79 (15), 4759-

4762.

Ainsworth, T. D.; Krause, L.; Bridge, T.; Torda, G.; Raina, J.-B.; Zakrzewski, M.;

Gates, R. D.; Padilla-Gamitio, J. L.; Spalding, H. L.; Smith, C.; Woolsey, E. S.;

Bourne, D. G.; Bongaerts, P.; Hoegh-Guldberg, 0.; Leggat, W. ISME J2015, 9 (10),

2261-2274.

Roder, C.; Bayer, T.; Aranda, M.; Kruse, M.; Voolstra, C. R. Mol. Ecol. 2015, 24 (13),

3501-3511.

Barott, K. L.; Rodriguez-Brito, B.; Janougkovec, J.; Marhaver, K. L.; Smith, J. E.;

Keeling, P.; Rohwer, F. L. Environ. Microbiol. 2011, 13 (5), 1192-1204.

Bourne, D. G.; 'Dennis, P. G.; Uthicke, S.; Soo, R. M.; Tyson, G. W.; Webster, N. S.

ISME J2013, 7(7), 1452-1458.

Cardenas, A.; Rodriguez-R, L. M.; Pizarro, V.; Cadavid, L. F.; Arevalo-Ferro, C. ISME

J2012, 6 (3), 502-512.

Ceh, J.; Raina, J.-B.; Soo, R. M.; van Keulen, M.; Bourne, D. G. PLoS ONE 2012, 7

30 (5), e36920.

Correa, H.; Haltli, B.; Duque, C.; Kerr, R. G. Microb. Ecol. 2013, 66 (4), 972-985.

Jessen, C.; Lizcano, J. F. V.; Bayer, T.; Roder, C.; Aranda, M.; Wild, C.; Voolstra, C.

R. PLoS ONE 2013, 8 (4), e62091.

Lee, 0. O.; Yang, J.; Bougouffa, S.; Wang, Y.; Batang, Z.; Tian, R.; Al-Suwailem, A.;

Qian, P.-Y. App!. Environ. Microb. 2012, 78 (20), 7173-7184.

Lema, K. A.; Willis, B. L.; Bourne, D. G. Environ. Mic.robiol. 2014, 16(10), 3345-

3359.

Morrow, K. M.; Moss, A. G.; Chadwick, N. E.; Liles, M. R. App!. Environ. Microb.

2012, 78 (18), 6438-6449.

Vezzulli, L.; Pezzati, E.; Huete-Stauffer, C.; Pruzzo, C.; Cerrano, C. PLoS ONE 2013,

8 (6), e67745.

Ng, J. C. Y.; Chan, Y.; Tun, H. M.; Leung, F. C. C.; Shin, P. K. S.; Chiu, J. M. Y.

Front. Microbiol. 2015, 6, e16887.

Sun, W.; Zhang, F.; He, L.; Li, Z. Microb Ecol 2014, 67 (4), 942-950.

Pike, R. E. A comprehensive analysis of the microbial diversity associated with

Eunicea Fusca and related Plexauridae octocorlas, and the isolation of new natural products from selected associated bacteria, Ph.D. Thesis, University of Prince Edward

Island, Charlottetown, PE, 2013.

Robertson, V.; Haltli, B.; McCauley, E.; Overy, D.; Kerr, R. G. Microorganisms 2016,

4 (3), 1-23.

Wink, M. Phytochemistry 2003, 64 (1), 3-19.*

Firn, R. D.; Jones, C. G. Nat. Prod. Rep. 2003, 20 (4), 382-391.

31 Pawlik, J. R. Chem. Rev. 1993, 93 (5), 1911-1922.

Pawlik, J. R. BioScience 2011, 61 (11), 888-898.

Bandurraga, M. M.; Fenical, W. Tetrahedron 1985, 41 (6), 1057-1065.

Huang, K. C. The pharmacology of Chinese herbs, 2nd ed.; CRC Press LLC: Boca

Raton, Florida, 1999.

Borchardt, J. K. Drug News Perspect. 2002, 15 (3), 187-192.

Newman, D. J.; Cragg, G. M. J. Nat. Prod. 2012, 75 (3), 311-335.

Cragg, G. M.; Newman, D. J. Biochim. Biophys. Acta. 2013, 1830 (6), 3670-3695.

Patridge, E.; Gareiss, P.; Kinch, M. S.; Hoyer, D. Drug Discov. Today 2015, 15 (1),

31-38.

Feher, M.; Schmidt, J. M. J. Chem. Inf Comp. Sci. 2002, 43 (1), 218-227.

• Verdine, G. L. Nature 1996, 384 (6604), 11-13.

Dias, D. A.; Urban, S.; Roessner, U. Metabolites 2012, 2 (2), 303-336.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod.

Rep. 2014, 31 (2), 160-258.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod.

Rep. 2015, 32 (2), 116-211.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod.

Rep. 2016, 33(3), 382-431.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod.

Rep. 2013, 30 (2), 237-323.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod.

Rep. 2012, 29 (2), 144-222.

32 Mora, C.; Tittensor, D. P.; Adl, S.; Simpson, A. G. B.; Worm, B. PLoS BioL 2011, 9

(8), el001127.

Pietra, F. J Chem. Inf. Comp. Sci. 2003, 43 (1), 218-227.

Singh, S. B.; Pelaez, F. In Natural Compounds as Drugs Volume I; Petersen, F.,

Amstutz, R., Eds.; Progress in Drug Research; Birlchauser Basel: Basel, 2008; Vol. 65, pp 141-174.

Gerwick, W. H.; Moore, B. S. Chem. Biol. 2012, 19 (1), 85-98.

Martins, A.; Vieira, H.; Gaspar, H.; Santos, S. Mar. Drugs. 2014, 12 (2), 1066-1101.

Schneider, W. P.; Bundy, G. L.; Lincoln, F. H.; Daniels, E. G.; Pike, J. E. J. Am.

Chem. Soc. 1977, 99 (4), 1222-1232.

Haefner, B. Drug Discov. Today 2003, 8 (12), 536-544.

Leal, M. C.; Madeira, C.; Brandaio, C. A.; Puga, J.; Calado, R. Mole&les 2012, 17 (8),

9842-9854.

Cuevas, C.; Perez, M.; Martin, M. J.; Chicharro, J. L.; Fernandez-Rivas, C.; Flores, M.;

Francesch, A.; Gallego, P.; Zarzuelo, M.; la Calle,. de, F.; Garcia, J.; Polanco, C.;

Rodriguez, I.; Manzanares, I. Org. Lett. 2000, 2 (16), 2454-2458.

Radjasa, 0. K.; Vaske, Y. M.; Navarro, G.; Vervoort, H. C.; Tenney, K.; Linington, R.

G.; Crews, P. Bioorg. Med. Chem. 2011, 19 (22), 6658-6674.

Martinez, E. J.; Corey, E. J..Org. Lett. 2000, 2 (7), 993-996.

Kirschning, A.; Hahn, F. Angew. Chem. InL Ed Engl. 2012, 51 (17), 4012-4022.

Rath, C. M.; Janto, B.; Earl, J.; Ahmed, A.; Hu, F. Z.; Hiller, L.; Dahlgren, M.; Kreft,

R.; Yu, F.; Wolff, J. J.; Kweon, H. K.; Christiansen, M. A.; Hakansson, K.; Williams,

R. M.; Ehrlich, G. D.; Sherman, D. H. ACS Chem. Biol. 2011, 6(11), 1244-1256.

33 Gerwick, W. H.; Fenner, A. M. Microb. EcoL 2013, 65 (4), 800-806.

Schmidt, E. W.; Nelson, J. T.; Rasko, D. A.; Sudek, S.; Eisen, J. A.; Haygood, M. G.;

Ravel, J. P. NatL Acad. Sci. USA 2005, 102 (20), 7315-7320.

Schmidt, E. W. Invertebr. Biol. 2015, 134 (1), 88-102.

Kwan, J. C.; Tianero, M. D. B.; Donia, M. S.; Wyche, T. P.; Bugni, T. S.; Schmidt, E.

W. PLoS ONE 2014, 9 (5), e95850.

Crawford, J. M.; Clardy, J. Chem. Commun. 2011, 47 (27), 7559-7566.

Cambon-Bonavita, M. A.; Raguenes, G.; Jean, J.; Vincent, P.; Guezennec, J. J. AppL

MicrobioL 2002, 93 (2), 310-315.

Weiner, R.; Langille, S.; Quintero, E. J. Ind. Microbiol. 1995, 15 (4), 339-346.

Le Costaouec, T.; Cerantola, S.; Ropartz, D.; Ratiskol, J.; Sinquin, C.; Colliec-Jouault,

S.; Boisset, C. Carbohydr. Polym. 2012, 90 (1), 49-59.

Abyssine, Lucas Meyers Cometics, http://lucasmeyercosmetics.com/en/products/product.php?id=1 (accessed December

10th 2016).

Seacode, Lipotec, https://www.ulprospector.com/en/na/PersonalCare/Detail/2670/223123/SEACODE- marine-ingredient (accessed December 10th 2016).

Dermochlorella D, CODIF, available online http://www.codif- tn.com/en/principesactifs/dermochlorejla-d/ (accessed December 10th 2016).

Fenical, W. Calif Agric. 1997, 51 (4), 45-49.

Kijjoa, A.; Sawangwong, P. Mar. Drugs. 2004, 2 (2), 73-82.

Hirata, Y.;,Uemura, D. Pure Appl. Chem. 1986, 58 (5), 701-710.

34 Aicher, T. D.; Buszek, K. R.; Fang, F. G.; Forsyth, C. J.; Jung, S. H.; Kishi, Y.;

Matelich, M. C.; Scola, P. M.; Spero, D. M.; Yoon, S. K. J. Am. Chem. Soc. 1992, 114

(8), 3162-3164.

Towle, M. J.; Salvato, K. A.; Budrow, J.; Wels, B. F.; Kuznetsov, G.; Aalfs, K. K.;

Welsh, S.; Zheng, W.; Seletsky, B. M.; Palme, M. H.; Habgood, G. J.; Singer, L. A.;

Dipietro, L. V.; Wang, Y.; Chen, J. J.; Quincy, D. A..; Davis, A.; Yoshimatsu, K.;

Kishi, Y.; Yu, M. J.; Littlefield, B. A. Cancer Res. 2001, 61 (3), 1013-1021.

Wallace, M. S. Expert. Rev. Neurother. 2014, 6(10), 1423-1428.

Molinski, T. F.; Dalisay, D. S.; Lievens, S. L.; Saludes, J. P. Nat. Rev. Drug Discov.

2009, 8 (1), 69-85:

McIntosh, J. M.; Cruz, L. J.; Hunkapiller, M. W.; Gray, W. R.; Olivera, B. M. Arch.

Biochem. Biophys. 1982, 218 (1), 329-334.

Pettit, G. R.; Kamano, Y.; Herald, C. L.; Tuinman, A. A.; Boettner, F. E.; Kizu, H.;

Schmidt, J. M.; Baczynskyj, L.; Tomer, K. B.; Bontems, R. J. I Am. Chem. Soc. 1987,

109 (22), 6883-6885.

Luesch, H.; Moore, R. E.; Paul, V. J.; Mooberry, S. L.; Corbett, T. H. J. Nat. Prod.

2001, 64 (7), 907-910.

Senter, P. D.; Sievers, E. L. Nat. Biotechnol. 2012, 30 (7), 631-637.

Lichtman, M. A. Blood Cell MoL Dis. 2013, 50 (2), 119-130.

Chhikara, B. S.; Parang, K. Expert Opin. Drug Del. 2010, 7(12), 1399-1414.

Bergmann, W.; Feeney, R. J. J. Org. Chem. 1951, 16 (6), 981-987.

Kripp, M.; Hofheinz, R.-D. Int. J. Nanomed. 2008, 3 (4), 397-401.

Sagar, S.; Kaur, M.; Minneman, K. P. Mar.. Drugs. 2010, 8 (10), 2619-2638.

35 Rinehart, K. L.; Holt, T. G.; Fregeau, N. L.; Stroh, J. G.; Keifer, P. A.; Sun, F.; Li, L.

H.; Martin, D. G. I Org. Chem. 1990, 55 (15), 4515-4516.

Wright, AE.; Forleo, D. A.; Gunawardana, G. P.; Gunasekera, S. P.; Koehn, F. E.;

McConnell, 0. J. I Org. Chem. 1990, 55 (15), 4508-4512.

Cuevas, C.; Francesch, A. Nat. Prod. Rep. 2009, 26 (3), 322-337.

Glueck, C. J.; Khan, N.; Riaz, M.; Padda, J.; Khan, Z. Lipids Health Dis. 2012, 11,

143-151.

Dayspring, T. D. Int. i Worn. Health 2011, 3,87-97:

Koski, R. R. P. T. 2008, 33 (5), 271-276.

Coll, J. C. Chem. Rev. 1992, 92 (4), 613-631.

Todd, P. A. Biol. Rev. 2008, 83 (3), 315-337.

Berrue, F.; Kerr, R. G. Nat. Prod. Rep. 2009, 26 (5), 681-710.

Benue, F.; McCulloch, M. W. B.; Kerr, R. G. Bioorg. Med. Chem. 2011, 19 (22),

6702-6719.

Linde!, T.; Jensen, P. R.; Fenical, W.; Long, B. H. I Am. Chem. Soc. 1997, 119 (37),

8744-8745.

Cinel, B.; Roberge, M.; Behrisch, H.; van Ofwegen, L.; Castro, C. B.; Andersen, R. J.

Org. Lett. 2000, 2 (3), 257-260.

Roberge, M.; Cinel, B.; Anderson, H. J.; Lim, L.; Jiang, X.; Xu, L.; Bigg, C. M.; Kelly,

M. T.; Andersen, R. J. Cancer Res. 2000, 60 (18), 5052-5058.

Britton, R.; Roberge, M.; Berisch, H.; Andersen, R. J. Tetrahedron Lett. 2001, 42 (16),

2953-2956.

Lin, Y.; Bewley, C. A.; Faulkner, D. J. Tetrahedron 1993, 49 (36), 7977-7984.

36 Ketzinel, S.; Rudi, A.; Schleyer, M.; Benayahu, Y.; Kashman, Y. I Nat. Prod. 1996,

59 (9), 873-875.

Castanaro, J.; Lasker, H. R. Invertebr. Biol. 2003, 122 (4), 299-307.

Smilanslcy, V.; Lasker, H. R. Mar. Biol. 2014, 161 (4), 853-861.

Williams, G. C.; Chen, J.-Y. Zootaxa 2012, 3505, 39-52.

Look, S. A.; Fenical, W.; Matsumoto, G. K.; Clardy, J. J. Org. Chem. 1986, 51 (26),

5140-5145.

Look, S. A.; Fenical, W.; Jacobs, R. S.; Clardy, J. P. Natl. Acad. Sci. USA 1986, 83

(17), 6238-6240.

Look, S. A.; Fenical, W. Tetrahedron 1987, 43 (15), 3363-3370.

Roussis, V.; Wu, Z.; Fenical, W.; Strobel, S. A.; Van Duyne, G. D.; Clardy, J. J. Org.

Chem. 1990, 55 (16), 4916-4922.

Ata, A.; Kerr, R. G.; Moya, C. E.; Jacobs, R. S. Tetrahedron 2003, 59 (23), 4215-

4222.

Rodriguez, I. I.; Shi, Y.-P.; Garcia, 0. J.; Rodriguez, A. D.; Mayer, A. M. S.; Sanchez,

J. A.; Ortega-Barria, E.; Gonzalez, J. J. Nat. Prod. 2004, 67(10), 1672-1680.

Correa, H.; Zorro, P.; Arevalo-Ferro, C.; Puyana, M.; Duque, C. I Chem. EcoL 2012,

38 (9), 1190-1202:

Heckrodt, T. J.; Mulzer, J. Top Curr. Chem. 2005, 244, 1-41.

Correa, H.; Aristizabal, F.; Duque, C.; Kerr, R. G. Mar. Drugs. 2011, 9 (3), 334-344.

Puyana, M.; Narvaez, G.; Paz, A.; Osorno, 0.; Duque, C. J Chem. Ecol. 2004, 30 (6),

1183-1201.

Duque,.C.; Puyana, M.; Castellanos, L.; Arias, A.; Correa, H.; °sonic), 0.; Asai, T.;

37 Hara, N.; Fujimoto, Y. Tetrahedron 2006, 62 (17), 4205-4213.

Mayer, A. M. S.; Jacobson, P. B.; Fenical, W.; Jacobs, R. S.; Glaser, K. B. Life Sci.

1998, 62 (26), 401-407.

Gross, H.; Konig, G. M. Phytochem. Rev. 2006, 5 (1), 115-141.

Broka, C. A.; Chan, S.; Peterson, B. I Org. Chem: 1988, 53 (7), 1584-1586.

Corey, E. J.; Carpino, P. J. Am. Chem. Soc. 1989, 11 (14), 5472-5474.

Harrowven, D. C.; Tyte, M. J. Tetrahedron Lett 2004, 45 (10), 2089-2091.

Zhong, W.; Moya, C.; Jacobs, R. S.; Little, R. D. I Org. Chem. 2008, 73 (18), 7011-

7016.

Berrue, F.; Withers, S. T.; Haltli, B.; Withers, J.; Kerr, R. G. Mar. Drugs. 2011, 9 (12),

369-381.

Perez-Matos, A. E.; Rosado, W.; Govind, N. S. Ant. van Leeuw. 2007, 92 (2), 155-

164.

Schofield, M. M.; Jain, S.; Porat, D.; Dick, G. J.; Sherman, D. H. Environ. Microbiol.

2015, 17 (10),3964-3975.

Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod. Rep. 2013, 30 (2), 237-

323.

Sogin, M. L.; Morrison, H. G.; Huber, J. A.; Welch, D. M.; Huse, S. M.; Neal, P. R.;

Arrieta, J. M.; Herndl, G. J. P. Natl. Acad. Sci. USA 2006, 103 (32), 12115-12120.

Ben-Dov, E.; Ben Yosef, D. Z.; Pavlov, V.; Kushmaro, A. Int. J. Syst. Evol. Microbiol.

2009, 59 (10), 2458-2463.

Nedashkovskaya, 0. I.; Kim, S. B.; Lysenko, A. M.; Frolova, G. M.; Mikhailov, V. V.;

Bae, K. S. Int. i Syst. Evol. Microbiol. 2005, 55 (1), 375-378.

38 Pike, R. E.; Haltli, B.; Kerr, R. G. Int. J. Syst. Evol. Microbiol. 2013, 63 (11), 4294-

4302.

Yang, C.-S.; Chen, M.-H.; Arun, A. B.; Chen, C. A.; Wang, J.-T.; Chen, W.-M. Int. J.

Syst. Evol. Microbiol. 2010, 60 (5), 1158-1162.

Choi, E. J.; Kwon, H. C.; Sohn, Y. C.; Yang, H. 0. Int. J. Syst. Evol. Microbiol. 2010,

60 (4), 938-943.

Chimetto, L. A.; Cleenwerck, I.; Brocchi, M.; Willems, A.; De Vos, P.; Thompson, F.

L. Int. J. Syst. Evol. Microbiol. 2011, 61 (5), 1170-1175.

Ceh, J.; van Keulen, M.; Bourne, D. G. FEMS Microbiol. EcoL 2011, 75 (1), 134-144.

Littman, R. A.; Willis, B. L.; Bourne, D. G. Environ. Microbiol. Rep. 2011, 3 (6), 651-

660.

Lee, 0. 0.; Yang, J.; Bougouffa, S.; Wang, Y.; Batang, Z.; Tian, R.; Al-Suwailem, A.;

Qian, P.-Y. Appl. Environ. Microb. 2012, 78 (20), 7173-7184.

39 Chapter 2: Spatial and Temporal Investigation of the Microbiome of the Caribbean

Octocoral Erythropodium caribaeorum.

McCauley, E. P.; Haltli, B; Correa, H; Kerr, R. G. FEMS Microbiol. Ecol. 2016, 92 (9), fiw147.

This chapter was published in the FEMS Microbial Ecology and was modified to the formatting of this thesis; none of the content was changed

Author contributions: E.McCauley collected and processed the E. caribaeorum samples from The Bahamas locations, aided in the experimental design, performed the pyrosequencing data analysis for all samples, and wrote the manuscript. B.Haltli and H.Correa collected and processed the E. caribaeorum samples from the Florida locations, B. Haltli also aided in the experimental design, data analysis, and editing of the manuscript. R. Kerr wrote the grant supporting the research, aided in the experimental design, and contributed to the editing of the manuscript.

40 2.1 Introduction

The association between marine invertebrates and microorganisms has been extensively studied,

however the role of these microbes is largely unknown.1-3 Shallow water.corals have a well-

documented association with dinoflagellate symbionts of the genus Symbiodinium.4 The colonial coral polyps, along with the Symbiodinium spp., and associated microbial assemblages or microbiomes, make up the coral `holobiont.'1 The microbial component of the holobiont can contribute to overall coral health via several mechanisms such as nutrient cycling (e.g. C, N, and

S)5-11 and infection prevention via spatial exclusion64 or through the production of antimicrobial metabolites.12-14 These functions can be so vital that the 'coral probiotic hypothesis' suggests that corals can adapt to changing environmental conditions by altering their microbial community to maximize the health of the overall holobiont.15

Advances in next generation sequencing (NGS) technology have allowed for in-depth analysis of coral microbiomes.16 These studies have clearly established that corals host taxonomically diverse microbiomes that are distinct from their surroundings.17,18 Even though coral microbiomes are taxonomically diverse, many species maintain a core microbiome, a set of specific microbial taxa that form a stable association with a particular coral species.19'2° While overall microbiome membership varies with geographic location or changing environmental factors, the core microbiome remains intact as long as the coral remains healthy.21

The microbiomes of reef-building scleractinian corals have been extensively studied using modern NGS approaches19,22,23 while relatively few studies have examined the microbiomes of 17,24-28 octocorals. Given that these corals are keystone members of many reef communities,

41 understanding the structure and dynamics of their microbiomes is important to understanding the health of the reef ecosystems which they inhabit.29 Studies investigating octocoral microbiomes have found lower microbial richness and diversity compared to the microbiomes of scleractinian corals:7'24'25 Bacterial diversity associated with octocorals has been shown to be sensitive to anthropogenic disturbance; resulting in increased bacterial diversity and altered community membership compared to octocorals sampled from undisturbed sites.25 All studies that have investigated the microbiome of octocorals using NGS reveal a stable and dominant association with the bacterial class Gammaproteobacteria. The genus Endozoicomonas is frequently encountered as the most abundant Gammaproteobacteria in the microbiomes of healthy octocorals.17'24'27'3° For example, Endozoicomonas spp. accounted for —90% of the microbiome in healthy Paramuricea clavata colonies collected from pristine sites, but were supplanted by other Gammaproteobacteria taxa (e.g. Vibrio spp.) at sites subjected to anthropogenic disturbance.25 This highlights the importance of understanding the microbiome of these ecologically important corals.

2.1.1 Rationale for the Investigation of the Microbiome of E. caribaeorum

This study investigates the microbiome of the octocoral Erythropodium caribaeorum, a coral found in the Caribbean Sea from southern Florida to the Virgin Islands.31 E. caribaeorum is morphologically unique compared to most Caribbean octocorals as it exhibits an encrusting morphology, growing in a stolon or mat over the substrate; as opposed to most other octocoral species which are sea plumes or sea fans. These corals are of specific interest as they are the source of the diterpene natural product, desmethyleleutherobin.32 Desmethyleleutherobin is a cytotoxic compound of pharmaceutical interest due to its ability to cause mitotic arrest through

42 microtubule stabilization at nanomolar concentrations,33'34 a mechanism of action shared with the anticancer drug Taxo10.35'36 The ecological role of desmethylelutherobin is unknown, but it may act as a deterrent to predation, aid E. caribaeorum colonization of crowded reef substrata, or prevent overgrowth of E. caribaeorum by other reef-colonizing organisms.37-4° There is a growing body of evidence that sugge§t that many natural products associated with microorganisms are in fact biosynthesized by associated microorganisms,3'41-43 therefore understanding the microbiome associated with these encrusting corals may provide insight into the biosynthetic source of desmethyleleutherobin.

2.1.2 Overall Objective of Study

In this study we set out to characterize the microbiome of E. caribaeorum utilizing 16S small subunit rRNA gene amplicon 454 pyrosequencing. Samples were collected from two locations at three different time points to investigate geographic and temporal variation of microbial communities, as well as to identify the core microbiome associated with E. caribaeorum. This research serves as a starting point for the further investigation of the microbiome of this pharmaceutically relevant coral.

2.2 Materials and Methods

2.2.1 Sample Collection

Individual E. caribaeorum specimens were collected by SCUBA off the coast of Deerfield

Beach, Florida in June 2009 (26°18.736' N, 80003.583 W, n=3, FL1A-C; 26°18.068' N,

80004.112' W, n=3, FL2A-C) and December 2011 (26°18.736' N, 80°03.583' W, =3, FL3A-

C), and off the coast of San Salvador, The Bahamas in February 2011 (24°03.816' N, 74°

43 32.628' W, n=2, SS1-2; 24°03.090' N, 74°32.391' W, n=3, SS3-5). All samples were collected at depths between 20-30 m using nitrile gloves and a sterile scalpel. For each octocoral collected an approximately 5 cm x 5 cm piece was removed from the surface of the animal to the base in contact with the substratum and placed in sterile WhirlPakTM bags (Nasco8). To preserve tissue

for DNA extractions 2 - 3 g of tissue from each sample was washed three times in 40 mL of sterile filtered seawater (SFSW) (0.2 gm polyethersulfone membrane, Nalgene Rapid FI0wTM) i sterile 50 mL centrifuge tubes to remove loosely associated bacteria. Washed samples were either frozen on dry ice (Florida samples; — -78.5°C) or stored in the vapor phase of liquid - nitrogen (San Salvador samples; < -150°C) in a cryogenic vapor shipper (MVE model XC20/3V,

Chart Industries, Ball Ground, GA, USA) during transport to Canada. Upon arrival in Canada samples were stored at -80°C until processed.

2.2.2 DNA Extraction and Purification

DNA was extracted from the coral tissue using a modified phenol-chloroform extraction as previously described.24 Coral samples (0.5 g) were ground to powder in liquid nitrogen. The power was suspended in DNA lysis buffer (1 mg/ml lysozyme, 50 gg/ml RNase, 9 mg/ml PVP,

0.5% sodium dodecyl sulfate (SDS), 25 mM EDTA, 25 mM Tris-HC1pH 8.0, 0.5 M NaCl) and incubated for 30 min at 37°C. Proteinase K (1 mg/ml) was added to the solution, which was incubated for 2.5 hr at 55°C. Insoluble material was removed by centrifugation (4500 x g, 15 min) and sodium acetate was added to a final concentration of 0.3 M. The supernatant was extracted with a 1:1 ratio of phenol/chloroform/isoamyl alcohol (25:24:1) mixture. Followed by a second extraction with a 1:1 ratio of chloroform/isoamyl alcohol (24:1) mixture. DNA was precipitated from the aqueous layer using a 0.7 volume of isopropanol and pelleted by

44 centrifugation (13,000 x g, 50 min). The DNA pellets were washed with 70% ethanol and re- suspended in buffer (0.1 mM EDTA, 10 mM Tris-HC1, pH 8.0). DNA samples were further purified using the PowerClean® DNA Clean-Up Kit according to manufacturers recommendations (MO BIO Laboratories, Inc. Carlsbad, CA).

2.2.3 Pyrosequencing and Bioinformatics

Bacterial tag-encoded FLX amplicon library construction and 454 pyrosequencing analysis using the 454 GS FLX Titanium system (Roche)44 was performed by Research and Testing

Laboratories (Lubbock, TX). Amplicons were generated using universal 16S rRNA primers 28F

(5 '-GAGTTTGATCNTGGCTCAG-3 )45 and 519R (5'—GAATTACCGCGGCGGCTG-3') 46, which covered V1 and V2 regions of the 16S rRNA. Initial processing of .sff files was performed using mothur v.1.33.3.47 Sequences were quality filtered using the following conditions: minimum average quality of 30 in each 50-bp window, minimum length of 200 bp, zero ambiguous base calls, and homopolymers less than 9 bp. The resulting filtered sequencing reads were aligned using the Silva reference alignment and the alignments were filtered to remove gaps. Chimeras were identified using UCHIME48 and removed. The chimera-free sequences were classified using the mothur Bayesian classifier (80% confidence) which uses the mothur formatted Greengenes dataset.49 Sequences classified as chloroplasts, mitochondria, and unknown were removed from the analysis. The remaining sequences were clustered using the

UCLUST module from QIIME into species level operational taxonomic units (OTUs) with a pairwise identity threshold of 97%.50 All diversity calculations were performed using mothur on datasets subsampled to 2960 sequence reads per sample.47 Alpha-diversity was analyzed using

Shannon diversity and equitability indices. Beta-diversity was assessed by the analysis of

45 molecular variance (AMOVA)51 on a Yue and Clayton distance matrix.52 Beta-diversity trees

were viewed using FigTree version 1.4.2 (Institute of Evolutional Biology, University of

Edinburgh). The "get.coremicrobiome" function of mothur was used to determine the number of

shared OTUs at a relative abundance level > 1%. Community composition graphs were prepared using Microsoft® Excel® for Mac 2011 version 14.5.8. Sequence data have been archived in the

NCBI Short Read Archive under accession number PRJNA304248.

2.2.4 Phylogenetic analysis

Sequence alignments were prepared using MEGA version 6.53 Evolutionary distance matrices were generated using the Jukes-Cantor mode1,54 and phylogenetic histories were inferred using the neighbor-joining method.55 Bootstrap analysis was based on 1000 resampled datasets.56 The final dataset consisted of 287 nucleotide positions. The tree was constructed using Hahella antartica NBRC 102683T (GenBank accession no. NR114177), Kistimonas asteriae KMD 001T

(NR116386), and Akanivorax balearicus MACLO4T (NR043109) as out groups. Sequence data has been archived in the NCBI GenBank Archive under accession numbers KU179036 —

KU179042

2.3 Results and Discussion

2.3.1 Alpha- and Beta-Diversity

Fourteen samples of E. caribaeorum were collected by SCUBA, nine were from Deerfield

Beach, Florida in June 2009 (n=6, FL 1A-C, FL2A-C) and December 2011 (n=3, FL3A-C) and five samples were collected off the coast of San Salvador, The Bahamas in February 2011 (n=5,

SS1-5). Pyrosequencing of 16S rRNA amplicons derived from these samples yielded 66,492

46 sequences averaging 233 bp in length after removal of short (<200 bp), low quality, chimeric and contaminant sequences. Samples contained between 2968 and 9132 sequence reads with an average of 4749 reads per sample. Bacterial diversity calculations were performed at the species level (i.e. OTUs delineated using a 97% sequence identity cutoff) on data sets subsampled to

2960 sequence reads per sample to account for variability in sampling depth. The coverage for all samples ranged from 74.7% (FL1A) to 98.4% (SS3) (86.0 ± 6.7%) [(mean ± standard deviation)] (Table 2.1). These coverage estimates were supported by rarefaction analysis as rarefaction curves for most of the samples approached the plateau of the asymptote (Figure 2.1).

Observed bacterial richness ranged from 64 OTUs (SS3) to 1152 OTUs (FL1A) (662 ± 308

OTUs). The Chaol estimator was used to calculate estimated richness at the species level and ranged from 184 OTUs (SS3) to 2576 OTUs (FL1A) (1464 ± 707 OTUs) (Table 2.1). These richness values are higher than other reported richness estimates for octocorals17'24'25 and closer to reported values for scleractinian corals.22 However, accurate comparisons cannot be made between different corals species due to methodological differences between studies (e.g. analysis based on different 16S rDNA hypervariable regions and/or sequence annotation methods).57

The Shannon diversity (H') index ranged from 0.25 (SS3) to 6.12 (FL3A) (4.26 ± 1.65), and

Shannon equitability (E) index from 0.06 (SS3) to 0.88 (FL3A) (0.65 ± 0.22) (Table 2.1).

Due to non-methodological factors a low number of OTUs were present in Sample SS3, this sample was dominated by one particular OTU (OTU 001) that made up 97.1% of all sequence reads and accounted for the low index values compared to the other samples, which were substantially higher. The high index values calculated for all other E. caribaeorum samples indicated a high level of bacterial diversity is harbored by this octocoral.

47 With the exception of sample SS3, measures of bacterial diversity in E. caribaeorum are higher than those reported for other octocorals17'24'25 but similar to those reported for scleractinian corals.22 The greater richness and diversity observed in E. caribaeorum may in part be due to the encrusting morphology of this octocoral compared to other branching octocorals investigated to date.17'24'25 Sea plumes/fans are attached to the substrate with an erected branched or fan like structure extending outwards whereas E. caribaeorum forms a mat over the surface.31 This close proximity to the substratum may allow for infiltration of stratum-associated microbes into the coral tissue, as well as microbes from the surrounding water column. Conversely, non-encrusting octocorals would obtain the majority of their microbes from the surrounding water column.

To determine if there was any pattern in OTU community structure between E. caribaeorum samples based on time and location of collection, the Yue and Clayton distance indices were calculated. Three major clades were observed in this analysis (Figure 2.2). The top clade contained samples from Florida (both years) and San Salvador. The middle clade contained corals from Florida, which formed sub-clades corresponding to year of collection. The bottom clade consisted of a single sample from The Bahamas (SS5). The microbial communities in the top clade formed a tighter cluster than those in the clades below, indicating a high degree of similarity between the microbial communities in the top clade. Inspection of OTU abundance across all samples revealed that a single OTU (OTU1) was highly abundant (29% to 97% of reads) in all samples in the top clade and substantially less abundant in the other samples (<6%).

Thus, the clustering of microbial communities from samples collected from different sample groups is largely driven by the abundance of this OTU. The distribution of this OTU will be discussed in more detail later.

48 To assess if there was any variation in the community structure of the samples based on location

or time of collection the Yue and Clayton distance matrix was analyzed using AMOVA. Groups were delineated as follows: samples F1A-C and FL2A-C were grouped into Florida 2009 (FLO9), samples FL3A-C into Florida 2011 (FL11), and samples SS1-5 into San Salvador 2011 (SS11).

The employment of AMOVA analysis allowed for the determination of any differentiation in community structure between groups that is statistically significant from differentiation that would arise were the groups pooled together. When comparing the community structure between all three groups there was no statistical significance (AMOVA, p = 0.066) (Table 2.2). However pairwise AMOVA between groups revealed a significant difference in community structure between the FL11 and SS11 samples (AMOVA, p 0.034). This indicates that the taxonomic composition of these E. caribaeorum microbial communities varied in response to factors that vary temporally and by geographic location. However, differentiation was not observed in any other pairwise comparison (Table 2.2). Factors that may drive the structure of E. caribaeorum microbial communities may include changes in water quality, water temperature, or levels of anthropogenic disturbance as has been reported for other corals.25'58 Unfortunately, detailed environmental data was not collected at the time of sampling, thus further research will be required to determine factors that significantly affect the microbiome of E. caribaeorum.

49 Table 2.1. Richness and alpha diversity measurements of Erythropodium caribaeorum

microbial communities. OTUs were calculated using a 97% sequence identity threshold.

Calculations were based on datasets subsampled to 2960 sequence reads per sample.

Shannon Shannon Chaol Richness Coverage Diversity. Equitability Sample Estimated (#0TUs) Index Index (%) Richness (H) (E) FL1A 1152 74.7 2576 6.12 0.87 al FL1B 895 80.9 2113 5.81 0.85 FL1C 578 88.1 1186 4.19 0.66 s-o c) FL2A 742 82.7 2022 4.75 0.72 FL2B 414 91.9 818 3.37 0.56 FL2C 301 92.5 985 2.20 0.39 as - FL3A 1031 78.8 2117 6.08 0.88 FL3B 355 93.8 c,s 569 3.49 0.59 4. FL3C 956 80.0 2010 5.77 0.84 SS1 553 88.6 1188 3.47 0.55 dor SS2 632 88.6 1111 4.30 0.67 lva c)• SS3 64 98.4 184 0.25 0.06

Sa c‘s SS4 724 84.5 1494 4.48 0.68 San SS5 867 80.7 2127 5.31 0.78 Mean 662 86.0 1464 4.26 0.65 SD 308 6.7 707 1.65 0.22

50 Table 2.2. AMOVA comparisons of community structure (Yue and Clayton index). Samples

were grouped by location and time of collection, FL09: Florida 2009; FL11: Florida 2011; SS11:

San Salvador 2011. All data sets were subsampled to 2960 sequence reads per sample prior to calculations.

Yue & Clayton Index Community Structure (AMOVA, p-value) FLO9-FL11-SS1la 0.066 FLO9-FL11 b 0.337 FL11-SS1l b 0.034* FLO9-SS11b 0.062 *Statistically significant aBonferoni-corrected significance level p = 0.017 bSignificance level p = 0.05

51 1800 FL1A 1600 FL1B .0 0 00 FL1C 1400 0 0 0 I FL2A 1200 FL2B 0 1000 FL2C • • • . • FL3A C) 800 • • • • • FL3B 4 600 0 0 FL3C 400 • / SS1

200 41=1, MI= SS2 0 - - IMP 4WD MO SS3 ------

0 2000 4000 6000 8000 10000 4,T:a MaIDO SS4 Number of Sequences — SS5

Figure 2.1. Rarefaction curves of 14 E. caribaeorum microbiomes. Curves prepared using

OTUs identified at a 0.03 distance.

52 SS4

SS2

FL3B

FL2B

SS1

FL2C

SS3

FL2A

FL1A

FLIB

FL3C

FL3A

FL1C

SS5

0.05 Figure 2.2. Yue and Clayton distance matrix comparison of E. caribaeorum microbial communities. All data sets were subsampled to 2960 sequence reads per samples prior to calculations.

53 2.3.2 Taxonomic Composition

The 66,492 sequence reads were classified using the Greengenes classifier with a confidence threshold of 80%. A total of 33 phyla were present across all samples with 12 to 26 phyla present in each sample. The dominant phylum in all samples was Proteobacteria, making up 36.7% to

98.4% of the total population. Other phyla that had a small but consistent presence in all samples were Bacteroidetes (0.3% to 18.7%), Actinobacteria (0.05% to 10.1%), Planctomycetes (0.2% to

4.5%), Chloroflexi (0.03% to 18.3%), Firmicutes (0.01% to 13.7%), and Acidobacteria (0.04% to 6.0%).

Ninety-six classes were present across all samples with 22 to 65 classes present in each sample.

The most abundant class was Gammaproteobacteria. It accounted for greater than one-third of the sequence reads in 10 of the 14 samples and accounted for 10.5% to 97.9% of the sequences across all samples (Figure 2.3). The majority of these sequence reads belonging to the genus • Endozoicomonas (order Oceanospirillaceae, family Hahellaceae), and ranged from 2.9% (SS5) to 97.3% (SS3) of the sequence reads in each a sample (Figure 2.4). The high abundance of this one genus in sample SS3 explains the low richness (Chaol) and diversity levels (H) calculated for this sample. Other classes that were consistently present in all samples were

Alphaproteobacteria (0.4% to 21.1%), Flavobacteria (0.08% to 14.7%), Anaerolineae (0.03% to

7.5%), Acidimicrobiia (0.04% to 6.0%), Deltaproteobacteria (0.1% to 3.8%), Planctomycetacia

.(0.08% to 3.7%), Actinobacteria (0.01% to 3.4%), and Cytophagia (0.2% to 2.3%). Unclassified

OTUs, sequence reads that could not be assigned to a phylum with an 80% confidence threshold, were also prevalent in all the samples ranging from 0.3% to 17.0% of the total population (Figure

2.3 and 2.4).

54 The taxonomic composition of the E caribaeorum microbiome is similar to that reported for other octocorals, which are also dominated by Gammaproteobacteria, and in particular the genus

Endozoicomonas.17' 24' 25 The predominance of Endozoicomonas is not unique to the microbiomes of octocorals, as this genus forms a major component of the microbiomes of scleractinian 19,22,59-63 corals, sponges,64 and many other marine invertebrates.30,65-71

55 100% Ill 1 1 1 1 1 lull 1111111 11111111 IlluluuluIlhl lllllllllllll IlullullIllIl 20% lllllllllllll 10%

0% FL1A FL1B FL1C FL2A FL2B FL2C FL3A FL3B FL3C S S 1 SS2 SS3 S S4 SS5

Gammaproteobacteria Alphaproteobacteria Unclassified Proteobacteria Unclassified Bacteria Flavobacteria Acidimicrobiia Planctomycetia Deltaproteobacteria Clostridia Anaerolineae Unclassified Cytophagia Actinobacteria VHS-B5-50 M Cytophagia Acidobacteria Other Classes

Figure 2.3. Class level composition of E. caribaeorum microbiomes. Sequences were classified with a minimum confidence level of 80%. The "Rare Classes" group consists of classes that comprise <1% of the total sequence reads.

56 100%

90%

80% IIIIIIIIIIIII

70% iiiuiiiiiriiu

60% 111111111111111 11111

50% 11111111111111 11111111111

40% 111111111111111 liii

30% uhuuINIIluuII

20% 11111111111111111111111111111

10% 1111111111111111111111111111

FL1A FL1B FL1C FL2A FL2B FL2C FL3A FL3B FL3C SS1 SS2 SS3 SS4 SS5

Endozoicomonas (Gammaproteobacteria) Unclassified PHOS-HD29 (TA 1 8) Unclassified Bacteria Unclassified Hahellaceae (Gammaproteobacteria) Unclassified Flavobacteriaceae (Flavobacteria) Unclassified Alphaproteobacteria Unclassified Rhizobiales (Alphaproteobacteria) Unclassified JdFBGBact (Acidimicrobiia) Unclassified Pirellulaceae (Planctomycetia) Ruegeria (Alphaproteobacteria) Vibrio (Gammaproteobacteria) Unclassified Alteromonadales (Gammaproteobacteria) Unclassified Piscirickettsiaceae (Alphaproteobacteria) III Other Genera Figure 2.4. Genus level composition of E. caribaeorum microbiomes. Sequences were classified with a minimum confidence level of 80%. Read counts other than the-13 most abundant are summarized in the "Other" category. The class level for each taxa are shown in parentheses.

57 2.3.3 Putative Core Microbiome

Several marine invertebrates have been shown to contain a core microbiome, a set of taxonomically distinct microbes that are a stable presence in the microbiome of the coral regardless of geographic location or environmental factors.17,19,21,24 The existence of core bacterial taxa in complex microbiomes suggests that these taxa carry out vital functions in the holobiont. To assess whether E. caribaeorum possess a core microbiome the distribution of species level OTUs (D = 0.03) with a relative abundance > 1% across all coral samples was determined (Table 2.3). Three OTUs were constantly found in all samples regardless of location or time of collection, but their relative abundance was variable and none were present at a relative abundance > 1% across all samples. The most abundant of the stable OTUs,

Endozoicomonas sp. OTU 001, accounted for 30.1% of all sequence reads, but only accounted for > 1% of the sequence reads in 12 of 14 samples and ranged from 0.7% (FL1B) to 97.1%

(SS3) of the total reads. The other two stable OTUs were an unclassified Alp haproteobacteria

(OTU 007) and an unclassified Gammaproteobacteria (OTU 013), these OTUs accounted for

1.9% and 0.6% of the total sequences reads, respectively.

The phylogenetic relationship of these stable OTUs to type strains as well as closely related uncultured strains identified by BLAST analysis, was explored" (Figure 2.5). Endozoicomonas sp. OTU 001 formed a strongly supported clade (96% bootstrap support) with an uncultured

Spongiobacter sp. clone (DQ889928, 99.4% identity) that was obtained from an E. caribaeorum collected off the coast of Florida in 2006.72 The genus Spongiobacter is not a valid taxonomic classification and sequences that are attributed to this genus show a strong phylogenetic relationship to the genus Endozoicomonas. This clade clustered with an uncultured bacterium

58 clone (JQ609314) that was obtained from the octocoral Antillogorgia elisabethae24 and

Endozoicomonas gorgoniicola PS125 T (JX488685) which was isolated from an unidentified

octocoral belonging to the genus Plexaura collected off the coast of Bimini, The Bahamas.3° It has been suggested that the close relation between Endozoicomonas relatives from different octocoral habitats is the result of an evolutionarily old association between the octocoral hosts and the genus Endozoicomonas."

While Endozoicomonas spp. form significant arid stable associations with a variety of marine invertebrates, their role in the holobiont is still enigmatic. They are hypothesized to aid in the sulfur cycling, in particular the degradation of dimethylsulfoniopropionate (DMSP), an osmolyte that is generated in large amounts by the coral Symbiodinium spp. endosymbionts that inhabit shallow water corals.9'11 Endozoicomonas spp. have also been implemented in the production of antimicrobial compounds, the degradation of complex organic carbon sources, and the conversion and assimilation of nitrate.27'60'73'74 However further research will be required to identify the factors driving the association between E. caribaeorum and Endozoicomonas spp. to determine the role of this stable microbial associate.

The unclassified Alphaproteobacteria (OTU 007) formed a clade with strong 99% bootstrap support with two uncultured bacterial sequences (GU118148, 96.5% identity; GU118248, 96.9% 63 identity) detected in the scleractinian coral Diploria strigosa. The unclassified

Gammaproteobacteria (OTU 013) clustered with 70% bootstrap support with an uncultured

Marinobacter sp. (DQ889901, 98.1% identity), and an uncultured Gammaproteobacterium

(DQ889884, 95.6% identity) obtained from an E. caribaeorum sample from Florida.72 Stable

59 microbial associations with various Alpha- and Gammaproteobacteria, other than

Endozoicomonas, have been observed in many corals.18'23'75'76 For example, Roseobacter and

Marinobacter are associated with juvenile Porites astreoides and transmitted vertically from parent to offspring.77 Additionally, Alagely et al.78 showed that Alphaproteobacteria and

Marinobacter spp. isolated from coral mucus and cultured dinoflagellate Symbiodinium spp. were able to inhibit swarming and biofilm formation of the coral pathogen Serratia marcescens.

Further supporting the hypothesis that members of the coral microbiome aid in protection from unwanted pathogens.15

The detection of these three phylotypes in all E. caribaeorum microbiomes studied regardless of time or location of collection suggest that these corals may maintain core microbiome. However, greater sampling over a larger geographic area and time range would be required to determine if these OTUs are in fact core members of the E. caribaeorum microbiome.

60 Table 2.3. Summary of OTUs (D=0.03) that comprise the stable OTUs of the E. caribaeorum microbiome. The bottom panel displays the taxonomic assignment of the OTUs based on the Greengenes classifier using a confidence threshold of 80%.

OTU % Abundance Sample 001 007 013 FL1A 2.0 5.6 1.2 FIL1B 0.7 4.3 0.1 cd "zs a, FL1C 2.6 1.3 i: C) 0.8 0 C) 4--1 N FL2A 5.9 9.7 . 0.1 FL2B 33.4 0.6 0.2 FL2C 61.2 3.2 0.03 c;s FL3A 0.8 0.6 0.2 "CS o$7: 11 FL3B 30.6 0.03 0.4 .FL3C 4.0 0.3 0.3 SS1 51.6 0.1 0.03 8 -zsc,: S52 35.0 0.8 0.5 8 m cs, SS3 97.1 0.02 ciD cs1 0.1 g S54 29.5 0.3 0.2 c4 SS5 2.9 0.6 3.0 OTU Greengenes Taxonomic Assignment Proteobacteria; Gammaproteobacteria; Oceanospirillales; 001 Hahellaceae; Endozoicomonas

007 Proteobacteria; Alphaproteobacteria; unclassified

013 Proteobacteria; Gammaproteobacteria; unclassified

61

96 Uncultured Endozoicomonas sp. OTU 001 (KU:179036)

67 L Uncultured Spongiobacter sp. clone EC30 (DQ889928)

0.050 I Uncultured bacterium clone PEA02 (J0609314)

Endozoicomonas gorkoniicola PS12591 (iX488685)

59 Endozoico ms.numazttensis HC501 (AB695088)

Endozoiconionas airinae WP7OT (KC878324) 100 9 Endozoicomonas elysicola MKT11OT (AB196667)

Endozoicomonas euniceicola EF212T (TX488684) 9 97 Endozoicomonas montiporae CL-33T (F.134775g)

Dasania marina KOPR1 209021 (NR043175) 60 Uncultured bacterium clone Gven L14 (0U118487)

100 Halioglobus japonicus S1 -36T (NR113277)

70 - Uncultured Gammaproteobacterium clone EC167 (DQ889884) 98 58 ' Uncultured Gammaproteobacterium OTU 013 (KU179038)

98 L Uncultured Marinobacter sp. clone EC109 (DQ889901)

87 Eilatimonas milleporae MD2T (HQ288781) He/lea balneolensis 26111/A02/215r (NR042992)

74 Daegnia caeni K1071 (NR044269) 99 71 Paracoccus homiensis DD-R1 1r (NR043733)

Glycocaulis abyssi MCS 331 (NR108136) 43 Uncultured A/phaproteobacterium OTU 007 (KU179037)

99 - Uncultured bacterium Dstr H23 (GU118148) 97 Uncultured bacterium ristr 020 (GU118248)

Figure 2.5. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of stable

OTUs. Evolutionary distances were computed using Jukes-Cantor method. A total of 287 nt

62 positions were used. Bootstrap values are expressed as a percentage of 1000 replicates; bootstrap values < 50 are not shown. The scale bar represents the number of substitutions per site. The tree was constructed using Hahella antarctica NBRC 102683T (GenBank accession no. NR114177),

Kistimonas asteriae KMD 001T (NR116386), and Akanivorax balearicus MACLO4T

(NR043109) as out groups (not shown).

63 2.4 Conclusions

This is the first comprehensive investigation of the microbiome of the encrusting octocoral E.

caribaeorum. The data presented here demonstrates that these corals possess very high levels of

microbial taxonomic diversity relative to other reported octocoral microbiomes. They have a

dominant association with the taxonomic class Gammaproteobacteria, in particular the genus

Endozoicomonas. Amid the high microbial diversity there were three stable species-specific

OTUs that were present in all E. caribaeorum samples regardless of geographic and temporal

variation. One of these, Endozoicomonas sp. OTU 001, was highly.abundant and most likely plays an essential role in the biology of the E. caribaeorum holobiont. They may aid in the

biogeochemical cycling of nutrients, or are potentially involved in secondary metabolite production. This data provides a valuable starting point for further investigation into the

microbiome associated with E. caribaeorum and other octocorals in the Caribbean.

2.5 References

Rosenberg, E.; Koren, O.; Reshef, L.; Efi-ony, R.; Zilber-Rosenberg, I. Nat. Rev. Micro.

2007, 5 (5), 355-362.

Webster, N. S.; Taylor, M. W. Environ. Microbiol. 2012, 14 (2), 335-346.

Schmidt, E. W. Invertebr. Biol. 2015, 134 (1), 88-102.

Muscatine, L.; Cernichiari, E. Biol. Bull. 1969, 137 (3), 506-523.

Lesser, M. P.; Falcon, L. I.; Rodriguez-Roman, A.; Enriquez, S.; Hoegh-Guldberg, O.;

Iglesias-Prieto, R. Mar. EcoL Prog. Ser. 2007, 346, 143-152.

Wegley, L.; Edwards, R.; Rodriguez-Brito, B.; Liu, H.; Rohwer, F. Environ. MicrobioL

2007, 9 (11), 2707-2719.

64 Kvennefors, E. C. E.; Sampayo, E.; Ridgway, T.; Barnes, A. C.; Hoegh-Guldberg, 0.

PLoS ONE 2010, 5 (4), e10401.

Thurber, R. y.; Willner-Hall, D.; Rodriguez-Mueller, B.; Desnues, C.; Edwards, R. A.;

Angly, F.; Dinsdale, E.; Kelly, L.; Rohwer, F. Environ. Microbiol: 2009, 11 (8), 2148-

2163.

Raina, J.-B.; Dinsdale, E. A.; Willis, B. L.; Bourne, D. G. Trends Microbiol. 2010, 18

(3), 101-108.

Fiore, C. L.; Jarett, J. K.; Olson, N. D.; Lesser, M. P. Trends Microbiol. 2010, 18 (10),

455-463.

Raina, J.-B.; Tapiolas, D.; Willis, B. L.; Bourne, D. G. Appl. Environ. Microb. 2009, 75

(10,3492-3501.

Riley, M. A.; Gordon, D. M. Trends Microbiol. 1999, 7 (3), 129-133.

Nissimov, J.; Rosenberg, E.; Munn, C. B. FEMS Microbiol. Lett. 2009, 292 (2), 210-

215.

Kvennefors, E. C. E.; Sampayo, E.; Kerr, C.; Vieira, G.; Roff, G.; Barnes, A. C. Microb.

EcoL 2012, 63 (3), 605-618.

Reshef, L.; Koren, O.; Loya, Y.; Zilber-Rosenberg, I.; Rosenberg, E. Environ.

Microbiol. 2006, 8 (12), 2068-2073.

Gilbert, J. A.; Dupont, C. L. Annu. Rev. Mar. Sci. 2011, 3,347-371.

Bayer, T.; Arir, C.; Ferrier-Pages, C.; Zoccola, D.; Aranda, M.; Voolstra, C. R. Mar.

EcoL Prog. Ser. 2013, 479, 75-84.

Li, J.-W.; Chen, Q.; Zhang, S.; Huang, H.; Yang, J.; Tian, X.-P.; Long, L.-J. PLoS ONE

2013, 8 (8), e71301.

65 (19) Bayer, T.; Neave, M. J.; Alsheikh-Hussain, A. Aranda, M.; Yum, L. K.; Mincer, T.;

Hughen, K.; Apprill, A.; Voolstra, C. R. App!. Environ. Microb. 2013, 79 (15), 4759-

4762.

(20) Ainsworth, T. D.; Krause, L.; Bridge, T.; Torda, G.; Raina, J.-B.; Zakrzewski, M.; Gates,

R. D.; Padilla-Gamirlo, J. L.; Spalding, H. L.; Smith, C.; Woolsey, E: S. Bourne, D. G.;

Bongaerts, P.; Hoegh-Guldberg, 0.; Leggat, W. ISME J2015, 9 (10), 2261-2274.

Roder, C.; Bayer, T.; Aranda, M.; Kruse, M.; Voolstra, C. R. MoL Ecol. 2015, 24 (13),

3501-3511. •

Lee, 0. 0.; Yang, J.; Bougouffa, S.; Wang, Y.; Batang, Z.; Tian, R.; Al-Suwailem, A.;

Qian, P.-Y. App!. Environ. Microb. 2012, 78 (20), 7173-7184.

Lema, K. A.; Willis, B. L.; Bourne, D. G. Environ. MicrobioL 2014, 16 (10), 3345-

3359.

Correa, H.; Haltli, B.; Duque, C.; Kerr, R. G. Microb. EcoL 2013, 66 (4), 972-985.

Vezzulli, L.; Pezzati, E.; Huete-Stauffer, C.; Pruzzo, C.; Cerrano, C. PLoS ONE 2013, 8

(6), e67745.

Gray, M. A.; Stone, R. P.; McLaughlin, M. R.; Kellogg, C. A. FEMS Microbiol. Ecol.

2011, 76 (1), 109-120.

La Riviere, M.; Roumagnac, M.; Garrabou, J.; Bally, M. PLoS ONE 2013, 8 (2), e57385.

Ransome, E.; Rowley, S. J.; Thomas, S.; Tait, K.; Munn, C. B. FEMS Microbiol. EcoL

2014, 90 (2), 401 116.

Tunnell, J. W.; Nelson, T. J. American Academy of Underwater Sciences (AAUS),

1989; pp 325-335.

Pike, R. E.; Haltli,'B.; Kerr, R. G. Int. 1 SysL EvoL MicrobioL 2013, 63 (11), 4294-

66

4302.

Bayer, F. M. The Shallow-water Octocorallia of the West Indian Region: A Manual for

Marine Biologists; Nijhoff: Boston, 1961.

Cinel, B.; Roberge, M.; Behrisch, H.; van Ofwegen, L.; Castro, C. B.; Andersen, R. J.

Org. Lett. 2000, 2 (3), 257-260.

Long, B. H.; Carboni, J. M.; Wasserman, A. J.; Cornell, L. A.; Casazza, A. M.; Jensen,

P. R.; Lindel, T.; Fenical, W.; Fairchild, C. R. Cancer Res. 1998, 58 (6), 1111-1115.

Roberge, M.; Cinel, B.; Anderson, H. J.; Lim, L.; Jiang, X.; Xu, L.; Bigg, C. M.; Kelly,

M. T.; Andersen, R. J. Cancer Res. 2000, 60 (18), 5052-5058.

Schiff, P. B.; Fant, J.; Horwitz, S. B. Nature 1979, 277 (5698), 665-667.

Baum, S. G.; Wittner, M.; Nadler, J. P.; Horwitz, S. B.; Dennis, J. E.; Schiff, P. B.;

Tanowitz, H. B. P. Natl. Acad. Sci. USA 1981, 78 (7), 4571-4575.

Pawlik, J. R.; Burch, M. T.; Fenical, W. I Exp. Mar. Biol. Ecol. 1987, 108 (1), 55-66.

Slattery, M.; McClintock, J. B.; Heine, J. N. I Exp. Mar. Biol. Ecol. 1995, 190 (1), 61-

77.

Kelman, D.; Benayahu, Y.; Kashman, Y. I Exp. Mar. Biol. Ecol. 1999, 238 (1), 127-

137.

bang Xuan, B.; Sawall, Y.; Al-Sofyani, A.; Wahl, M. Aquat. Bio. 2015, 23, 129-137.

' (41) Davidson, S. K.; Allen, S. W.; Lim, G. E.; Anderson, C. M.; Haygood, M. G. AppL

Environ. Microb. 2001, 67 (10), 4531-4537.

(42) Johnson, T. A.; Sohn, J.; Vaske, Y. M.; White, K. N.; Cohen, T. L.; Vervoort, H. C.;

Tenney, K.; Valeriote, F. A.; Bjeldanes, L. F.; Crews, P. Bioorgan. Med. Chem. 2012, 20

(14), 4348-4355.

67 Schofield, M. M.; Jain, S.; Porat, D.; Dick, G. J.; Sherman, D. H. Environ. Microbiol.

2015, 17 (10), 3964-3975.

Callaway, T. R.; Dowd, S. E.; Wolcott, R. D.; Sun, Y.; McReynolds, J. L.; Edrington, T.

S.; Byrd, J. A.; Anderson, R. C.; Krueger, N.; Nisbet, D. J. Foul. Science. 2009, 88 (2),

298-302.

Edwards, U.; Rogall, T.; Blocker, H.; Emde, M.; Bottger, E. C. Nucleic Acids Res. 1989,

17 (19), 7843-7853.

Lane, D. J. Nucleic Acid Techniques in Bacterial Systematics; Stackebrandt, E.,

Goodfellow, M., Eds.; Wiley & Sons: Chichester, 1991; pp 115-147.

Schloss, P. D.; Westcott, S. L.; Ryabin, T.; Hall, J. R.; Hartmann, M.; Hollister, E. B.;

Lesniewski, R. A.; Oakley, B. B.; Parks, D. H.; Robinson, C. J.; Sahl, J. W.; Stres, B.;

Thallinger, G. G.; Van Horn, D. J.; Weber, C. F. AppL Environ. Microb. 2009, 75 (23),

7537-7541.

Edgar, R. C. Bioinformatics 2010, 26 (19), 2460-2461.

Wang, Q.; Garrity, G. M.; Tiedje, J. M.; Cole, J. R. Appl. Environ. Microb. 2007, 73

(16), 5261-5267.

Caporaso, J. G.; Bittinger, K.; Bushman, F. D.; DeSantis, T. Z.; Andersen, G. L.; Knight,

R. Bioinformatics 2010, 26 (2), 266-267.

Excoffier, L.; Smouse, P. E.; Quattro, J. M. Genetics 1992, 131 (2), 479-491.

Yue, J. C.; Clayton, M. K. J. Stat Plan. Inference. 2012, 142 (5), 1031-1039.

Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. Mol. Biol. Eva 2013, 30

(12), 2725-2729.

Jukes, T. H.; Cantor, C. R. Evolution of protein molecules; Munro, H. N.,,Ed.; Academic

68 Press: New York, 1969; Vol. 3, pp 21-132.

Saitou, N.; Nei, M. Mol. Biol. EvoL 1987, 4 (4), 406-425.

Felsenstein, J. Evolution 1985, 39 (4), 783.

Guo, F.; Ju, F.; Cai, L.; Zhang, T. PLoS ONE 2013, 8 (10), e76185.

Meyer, J. L.; Paul, V. J.; Teplitski, M. PLoS ONE 2014, 9 (6), e100316.

Bourne, D. G.; Munn, C. B. Environ. Microbiol. 2005, 7 (8), 1162-1174.

Bourne, D. G.; Iida, Y.; Uthicke, S.; Smith-Keune, C. ISME J2007, 2 (4), 350-363.

Hansson, L.; Agis, M.; Maier, C.; Weinbauer, M. G. Mar. EcoL Prog. Ser. 2009, 397,

89-102.

Littman, R. A.; Willis, B. L.; Bourne, D. G. Mar. EcoL Prog. Ser. 2009, 389, 45-59.

Sunagawa, S.; Woodley, C. M.; Medina, M. PLoS ONE 2010, 5 (3), e9554.

, (64) Nishijima, M.; Adachi, K.; Katsuta, A.; Shizuri, Y.; Yamasato, K. ISME J2013, 63 (2),

709-714.

Devine, S. P.; Pelletreau, K. N.; Rumpho, M. E. Biol. Bull. 2012, 223 (1), 138-154.

Martinez-Garcia, M.; Diaz-Valdes, M.; Wanner, G.; Ramos-Espla, A.; Anton, J.

Environ. Microbiol. 2007, 9 (2), 521-534.

Jensen, S.; Duperron, S.; Birkeland, N.-K.; Hovland, M. FEMS Microbiol. Ecol. 2010,.

74 (3), 523-533.

Goffredi, S. K.; Johnson, S. B.; Vrijenhoek, R. C. AppL Environ. Microb..2007, 73 (7),

2314-2323.

Schuett, C.; Doepke, H.; Grathoff, A.; Gedde, M. HelgoL Mar. Res. 2007, 61 (3), 211-

216.

Kurahashi, M.; Yokota, A. Syst. Appl. MicrobioL 2007, 30 (3), 202-206.

69 Du, Z.; Zhang, W.; Xia, H.; Lii, G.; Chen, G. Acta. OceanoL Sin. 2010, 29 (2), 62-69.

Lopez, J. V.; Ranzer, L. K.; Ledger, A.; Schoch, B.; Duckworth, A.; McCarthy, P. J.;

Kerr, R. G. International Coral Reef Symposium: Ft Lauderdale, FL, 2008.

Bourne, D. G.; Garren, M.; Work, T. M.; Rosenberg, E.; Smith, G. W.; Harvell, C. D.

Trends MicrobioL 2009, / 7 (12), 554-562.

Neave, M. J.; Michell, C. T.; Apprill, A.; Voolstra, C. R. Genome Announc. 2014, 2 (4), e00802.

Ceh, J.; van Keulen, M.; Bourne, D. G. FEMS MicrobioL EcoL 2011, 75 (1), 134-144.

Ceh, J.; Raina, J.-B.; Soo, R. M.; van Keulen, M.; Bourne, D. G. PLoS ONE 2012, 7 (5); e36920.

Sharp, K. H.; Distel, D.; Paul, V. J. ISME J2012, 6 (4), 790-801.

Alagely, A.; Krediet, C. J.; Ritchie, K. B.; Teplitski, M. ISME J2011, 5 (10), 1609-

1620.

70 Chapter 3: Culture-Independent Investigation into the Microbiome of Antillogorgia elisabethae from San Salvador, The Bahamas, and the Microbial Communities Associated with the Holobiont, Algal Dinoflagellates, and Larvae

Data from section 3.3.2 was published in Microorganism. Robertson, V.; Haltli, B.; McCauley, E.; Overy, D.; Kerr, R. G. Microorganisms 2016, 4 (3), 23. Information from this publication that relates to this data is discussed in section 3.3.3.

71 3.1 Introduction

3.1.1 The Octocoral Antillogorgia elisabethae

The octoeoral Antillogorgia elisabethae is a purple sea plume that is widely distributed throughout the Caribbean' and is a keystone member of many reef communities.2 It should be noted that this coral was previously classified as Pseudopterogorgia spp. but has since been 3 reassigned to the resurrected genus Antillogorgia. Previous research investigating the microbiome associated with this coral from Providencia Island, Colombia,4 as well as Eleuthera,

Bimini, and Grand Bahama Island, The Bahamas5 have been reported. These investigations revealed that A. elisabethae have moderate microbial richness and diversity compared to other reported octocorals,6'7 and that the taxonomic diversity is highly variable across the locations from which the coral is sampled.

A. elisabethae has been of commercial interest over the last two decades as it is the sole source of the pseudopterosin family of diterpene glycoside marine natural products (MNPs).8-19 These

MNPs have attracted attention due to their anti-inflammatory activity, which has been shown to be more potent than the clinically used indomethacin.8,9,11,20 A simple derivative of pseudopterosin A, methopterosin has successfully completed Phase II clinical trials.21-23

Unfortunately further clinical development has been stalled due in part to the supply issue.

However, their anti-inflammatory properties have made them a valuable component of topical cosmetic products, such as the Resilience® line from Estee Lauder.24'25

72 3.1.2 Algal Dinoflagellate Symbionts of A. elisabethae

A. elisabethae, like many shallow water octocorals, have an obligatory symbiotic relationship with algal dinoflagellates of the genus Symbiodinium that is mutualistic in nature.26 The dinoflagellates reside in the gastroderm of the coral and are responsible for providing translocated photosynthates in the form of sugars and amino acids.27 In exchange, the coral host provides a protected hospitable environment, and inorganic nutrients such as ammonia and phosphate.28'29 Several studies have investigated the association between coral host species and 30,31 specific phylotypes of Symbiodinium spp. In some cases corals will host a number of different Symbiodinium Spp.,32-34 while other coral species will only host a specific strain.35 A elisabethae conform to the latter, and only host the Symbiodinium clade Bl/B18435'36 which it acquires at the juvenile polyp stage of life through horizontal transmission from the surrounding environment.37

The association between marine corals and their algal symbionts is an area of great interest because the breakdown of this association leads to coral bleaching, the expulsion of dinoflagellates from the coral, which can lead to coral mortality.26,38 However, the dinoflagellates associated with A. elisabethae are of additional interest to this study as they have been implicated in pseudopterosin biosynthesis. Work by Mydlarz et al.39 found that pseudopterosins comprised — 5% of the lipid extract of the A. elisabethae holobiont, but —11% of the lipid extract of Symbiodinium sp. cells purified from the holobiont. Additionally, regions of the holobiont that had a greater density of Symbiodinium sp. cells had a greater concentration of pseudopterosins. Furthermore, Symbiodinium sp. cells incubated with 14C-NaHCO3 or 3H- geranylgeranyl pyrophosphate (GGPP), pseudopterosin biosynthetic precursors, yielded

73 radiolabeled pseudopterosins. This suggests that the biosynthetic machinery required for

pseudopterosin biosynthesis is present within the Symbiodinium sp. cells:

3.1.3 Larvae of A. elisabethae

Marine corals reproduce through one of two modes, broadcast or brooding spawning. Broadcast spawning involves the release of a large amount of sperm and eggs into the water column, and

fertilization and development occur outside of the parent coral. Brooding spawning involves

fertilization within the gastrovascular cavity, followed by brooding of the embryos on the surface of the coral colony before release into the water column.4° A. elisabethae reproduce via brooding spawning and spawn on a lunar cycle which takes place within days of the full moon between

November and January.41,42

Studies investigating the microbial communities associated with the early and late life stages of corals have revealed that there is commonly a shift in the microbial composition.43'44 For example, the larvae of Porites astreoides have been shown to have a selected association with

Roseobacter spp. and Marinobacter spp.,45 but Oceanspirillaceae dominate the adult coral colonies.46 Pocillopora meandrina larvae have a selective association with Roseobacter spp. and

Pseudoalteromonas spp., but only members of the Roseobacter clade remain as a dominant 4748 member in the adult coral colonies. Studies revealing both vertical (from parent to offspring)45 and horizontal (from the surrounding environment)43'47 transmission of microorganisms to coral larvae have been reported. The ecological role these microorganisms have in larvae remains unclear, but they are hypothesized to play a part in influencing larval settlement and metamorphosis.49-52

74 The larvae of A. elisabethae of have been implicated in pseudopterosin biosynthesis.53 These

anti-inflammatory compounds made up 730% of the larval lipid extract, as opposed to the —11% observed in the Symbiodinium sp. cell extract, or —5% observed in the holobiont extract.

Furthermore, when the larvae were incubated with the pseudopterosin biosynthetic precursor 3H-

GGPP, 3H-labelled pseudopterosins were produced. Suggesting that like the Symbiodinium sp. cells, the larvae contain the biosynthetic machinery required for pseudopterosin biosynthesis.

However, the larvae do not contain any Symbiodinium sp. cells, as they do not acquire their dinoflagellate symbionts until the juvenile polyp stage of life. This research suggests that • pseudopterosin biosynthesis may not be from the dinoflagellates or larvae but from a microbial origin that is associated with both cell types.

3.1.4 Rationale for the Investigation of the Microbiome of A. elisabethae from San Salvador and the Microbial Communities Associated with the Larvae and Algal Dinoflagellates

Symbiont and Larvae

Investigation of the microbiomes of A. elisabethae from San Salvador, The Bahamas will add to the previous body of research on the microbiomes of this species from Colombia and other regions of The Bahamas. As this coral is a dominant member of many reef communities, understanding the microbiomes of this coral is important to understanding the health of the reef ecosystem in which they inhabit. Additionally, the dinoflagellates and larvae are essential to the health and fecundity of this coral; therefore understanding any microbial associations between them may provide insight into the role of those microorganisms within the coral holobiont. The holobiont, dinoflagellates, and larvae are also of specific interest as they have all been implicated

75 in pseudopterosin biosynthesis and understanding any stable microbial association may provide

insight into the biosynthetic source of these industrially important MNPs.

3.1.5 Overall Objective of Study

The overall objective of this study was to investigate the microbiome of A. elisabethae from San

Salvador, The Bahamas as well as the microbial communities associated with the dinoflagellates

and larvae utilizing next generation 16S small subunit rRNA gene amplicon pyrosequencing.

3.2 Materials and Methods

3.2.1 Sample Collections and Initial Processing

Samples from five A. elisabethae colonies were collected by SUCBA off the coast of San

Salvador, Bahamas in November 2011 during the spawning season from two locations,

Runway10 (24°03.816' N, 74° 32.628' W; n=3) and Cable Crossing (24°03.090' N, 74°32.391'

W; n=2). All samples were collected within a depth of 10— 15m and placed into sterile Whirl-

PakTM bags (Nasco ), and at each collection site —1 L of surrounding seawater was collected into a sterile Nalgene® polypropylene bottle (Nalge Nunc International). The holobiont samples were washed three times in —40 mL of sterile filtered seawater (SFSW) (0.2 pm polyethersulfone membrane, Nalgene Rapid F10wTM) in sterile 50 mL Falcon® centrifuge tubes (50 ml polypropylene, Corning®) to remove loosely associated bacteria. For each sample the larvae were removed from the outer surface of the coral using a sterile scalpel and washed three times with

SFSW to remove any coral tissue; there were —50-100 larvae from each sample. The algal dinoflagellates were obtained using a modified protocol to the one described by Mydlarz et al.39

A portion of the holobiont was homogenized (VWR VDI 25 ULTRA-TURRAX) in SFSW and

76 filtered through sterile cheesecloth to remove any large coral debris. The dinoflagellates were pelleted by centrifugation (250 x g, 5 min) and further purified using a Percoll® gradient of 40% and 80%. The dinoflagellates were collected from the top of the 80% Percoll® layer, the Percoll® gradient was repeated a minimum of six times until <1% impurities were visible under light microscopy. The bacteria present in the surrounding seawater sample were collected onto 0.22 pm Cellulose Acetate filters (Corning). All samples were divided in two with half used for the culture dependent study (Chapter 4) and the other half were flash frozen in a in a cryogenic vapor shipper (MVE model XC20/3V, Chart Industries, Ball Ground, GA, USA) and transported to Canada. Upon arrival in Canada samples were stored at -80°C until processed.

3.2.2 DNA Extraction and Purification

DNA was isolated from the holobiont, larvae, and dinoflagellate samples using the PowerSoil®

DNA Isolation Kit. Holobiont samples (0.5g) were ground into powder in liquid nitrogen prior to kit use. A lml aliquot of a SFSW blank was included in the DNA isolation procedure to account for any contaminations that may arise from the DNA isolation kit or initial processing. DNA from bacteria filtered from the surrounding seawater samples was isolated using the UltraClean®

Water DNA Isolation Kit. DNA samples were further purified using the PowerClean® DNA

Clean-Up Kit. All kits were used according to the manufacturers recommendations (MO BIO

Laboratories, Inc. Carlsbad, CA).

3.2.3 Pyrosequencing and Bioinformatics

Bacterial tag-encoded FLX amplicon library construction and 454 pyrosequencing analysis using the 454 GS FLX Titanium system (Roche)54 was performed by MR DNA (Shallowater, TX).

77 Amplicons were generated using universal 16S rRNA primers 16S515F (5 '-

GTGCCAGCMGCCGCGGTAA-3') and 16S806R (5 '—GACTACCAGGGTATCTAATCC-

3'),55 which covered the V4 variable region of the 16S rRNA gene. Initial processing of .sff files was performed using mothur v.1.33.3.56 Sequences were quality filtered using the following - conditions: minimum average quality of 30 in each 50-bp window, minimum length of 150 bp, zero ambiguous base calls, and homopolymers less than 9 bp. The resulting filtered sequencing reads were aligned using the Silva reference alignment and the alignments were filtered to remove gaps. Chimeras were identified using UCHIME52 and removed. The chimera-free sequences were classified using the mothur Bayesian classifier (80% confidence) which uses the mothur formatted Ribosomal Database Project (RDP) dataset.58 Sequences classified as chloroplasts, mitochondria, and unknown were removed from the analysis. The remainifig sequences were clustered using the UCLUST module from QIIME into operational taxonomic units (OTUs) with a pairwise identity threshold of 97%.59 All diversity calculations were performed using mothur on normalized data sets subsampled to the smallest sample size.56

A/pha-diversity was analyzed using Shannon diversity and equitability indices. Beta-diversity was assessed by the analysis of molecular variance (AMOVA)6° on a Yue and Clayton distance matrix.61 Beta-diversity trees were viewed using FigTree version 1.4.2 (Institute of Evolutionary

Biology, University of Edinburgh). Student t-test, ANOVA calculations, and community composition graphs were prepared using Microsoft® Excel® for Mac 2011 version 14.5.8.

3.2.4 Phylogenetic Analysis

Sequence alignments were prepared using MEGA version 6,62 and phylogenetic histories were inferred using the neighbor-joining methods.63 Evolutionary distance matrices were generated

78 using the Jukes-Cantor mode164 in units of number of base substitutions per site. All positions

containing gaps and missing data were eliminated. Bootstrap analysis was based on 1000

resampled datasets.65

3.3 Results and Discussion

3.3.1 Initial Processing

Samples from five A. elisabethae colonies were collected by SCUBA off the coast of San

Salvador, The Bahamas in November 2011 during the coral's spawning season at two reef locations. Each A. elisabethae specimen was divided into three fractions; the holobiont (H1-H5), larvae (L1-L5), and algal dinoflagellate (D1-D5) fractions. For each collected coral, a surrounding seawater sample was collected adjacent to the coral colony (W1-W5). DNA was extracted from each of the 15 coral derived fractions and the five seawater samples. A SFSW blank was also subjected to the same DNA isolation protocol as the holobiont, dinoflagellate, and larvae samples to control for any contamination introduced during the DNA extraction procedure.

Pyrosequencing of the 16S rRNA genes from these samples generated a total of 78,766 sequences that averaged 231 bp in length after short (<150 bp) and low quality (<30) sequences were removed. Additionally, any overlapping with the SFSW blank control, which contained 40 sequences that consisted of 12 OTUs, was removed. The number of reads varied significantly between samples, ranging from 379 (D3) to 8526 reads per sample (W5) (Table 3.1). The coverage for all samples was sufficient ranging from 95.2% (L5) to 99.4% (H2); any additional coverage would not have uncovered a significant amount of additional diversity. This was further supported by rarefaction analysis in which rarefaction curves for most samples approached an

79 asymptote (Figure 3.1).

Table 3.1. A. elisabethae holobiont (H1-1-15), dinoflagellate (D1-D5), larvae (L1-L5), and

surrounding seawater (SW1-SW5) collection location, number of sequence reads, and percent coverage for non-normalized data sets. OTUs were calculated at a distance of 0.03.

Number Coverage Sample Collection Location Sequences (%) H1 Cable Crossing 3063 97.1 H2 Runway 10 5478 99.4 .—-00 H3 Runway 10 5988 98.9 H4 Runway 10 5168 97.9 H5 Cable Crossing 5950 98.4 D1 Cable Crossing 6596 99.2 o D2 Runway 10 .473 95.8 -5 D3 Runway 10 379 95.8 D4 Runway 10 3097 98.4 D5 Cable Crossing 4596 98.9 Li Cable Crossing 3704 97.9 0 L2 Runway 10 1059 97.4 >ct as L3 Runway 10 525 97.1 ,--i L4 Runway 10 843 99.3 L5 'Cable Crossing 483 95.2 W1 Cable Crossing 3345 97.7 ,.,G.) W2 Runway 10 4247 98.6 W3 Runway 10 7680 98.9 5+ ' W4 Cable Crossing 7566 98.4 W5 Cable Crossing 8526 98.9

80

400 350 ••••

••• 300 or• el/ woo ow ••• ••••

rl ow. •••• ••• ... ------••• 250 .------m• 4,-, . ------_ - . ••• ..- .....0 —..._----- .....-• - 2 200 V „,„, .....NI , ...... as.... Cla) . ,.." 0. 00'. ..„,...... --...... _...... 4 e° , 0 1, 0••••1.• ...... e. .0.0...... " 5,= 150 „.A .14.--.-- ,,--_ ....-- ..... „„,..--.- ...- Z /,' fp* .,•-• .....• / •,• • • ...... 100 /• •. ,..- I/s s e / - 50 0 0 1000 2000 3000 4000 5000 6000 7000 8000 , 9000 Number of Sequences D1 D2 D3 D4 D5 — — H1 —H2 — — H3 — — H4 — — H5 Li L2 L3 L4 — L5 ----- W1 W2 ----- W3 ----- W4 ----- W5

Figure 3.1. Rarefaction curve of all coral-derived and seawater datasets. Curves prepared using OTUs identified at a 0.03 distance.

81 3.3.2 Comparison of Microbial Communities between Holobiont and Surrounding

Seawater Samples

Although it has been well documented that the microbiomes associated with corals are distinct

from the surrounding environment, the microbial communities associated with the holobiont and seawater samples were compared to confirm this observation with the San Salvador A. elisabethae samples in this study.

3.3.2.1 Alpha- and Beta-Diversity

All holobiont and seawater sample analyses were normalized to 3000 sequence reads per sample.

The normalized observed richness (Sobs) for the holobiont samples ranged from 102 OTUs (H2 &

H3) to 176 OTUs (H1) (172 ± 49-0TU5) (mean .± standard deviation) and the Chaol estimated richness (Sest) ranged from 137 OTUs (H2) to 322 OTUs (H4) (274 ± 73 OTUs). The holobiont

Shannon diversity (H') index ranged from 2.13 (H3) to 3.12 (H1) (2.98 ± 0.49), and Shannon equitability (E) index from 0.45 (H4) to 0.65 (H2) (0.58 ± 0.07) (Table 3.2). The seawater samples had slightly higher observed (Sobs = 208 ± 35 OTUs) and estimated richness (Sest = 302

± 59 OTUs) than the holobiont samples. The greater observed richness in the water samples was statistically significant (Student's two-sample t-test, p = 0.006) while the estimated richness was not (t-test, p = 0.121). The Shannon diversity index (H' = 302 ± 59) and equitability index (E =

0.62 ± 0.03) were both slightly higher than that of the holobiont, but only the Shannon diversity index was significantly greater than in the holobiont samples (t-test, p = 0.009). These richness and diversity levels are consistent with previously reported seawater microbial communities.5,6,66-

68

82 To compare the community composition between the holobiont and seawater samples the Yue and Clayton distance index was calculated. The holobiont and seawater samples formed distinct clades (Figure 3.2). Additionally, the seawater samples formed a tighter clade than the holobiont samples, indicating a greater degree of similarity in the seawater microbial communities.

To evaluate the statistical significance of the observed clades the distance matrix were assessed using AMOVA. The holobiont microbial communities differed significantly from the surrounding seawater samples (AMOVA, p = 0.009). This is consistent with other studies of coral microbiomes which have found corals harbor microbial communities distinct from that of the surrounding sea water.6'67-69

83 Table 3.2. Richness and alpha diversity measurements of A. elisabethae holobiont and surrounding seawater microbial communities. OTUs were calculated at a distance of 0.03.

Calculations were based on datasets normalized to 3000 sequence reads per sample.

Chaol Richness Shannon Shannon Estimated Coverage Sample (# OTUs, Diversity Equitability Richness (%) Sobs) (1-11) (E) (Sest) HI 176 306 3.12 0.60 97.1 H2 102 137 2.98 0.65 99.0 H3 102 183 2.13 0.46 98.3 H4 149 322 2.26 0.45 97.1 H5 157 279 2.64 0.52 97.2 Mean 137 245 2.63 0.54 97.8 SD 34 81 0.43 0.09 0.8 W1 196 270 3.19 0.60 97.5 W2 183 242 3.20 0.62 97.9 W3 206 311 3.09 0.58 97.0 W4 268 398 3.75 0.67 96.4 W5 185 290 3.24 0.62 97.6 Mean 208 302 3.29 0.62 97.3 SD 35 59 0.26 0.03 0.6

84 W5

W1

W3

W2

4

H5

H4

H3

H2

H1

0.05

Figure 3.2. Yue and Clayton distance matrix comparison of A. elisabethae holobiont and surrounding seawater microbial communities. All datasets were subsampled to 3000 sequence reads per samples prior to calculations.

85 3.3.2.2 Taxonomic Composition

The 25,647 holobiont sequence reads were classified using the RDP classifier with a confidence threshold of 80%. A total of 13 phyla were pres' ent across all holobiont samples with 7 to 10 phyla present in each sample. The dominant phylum in all holobiont samples was

Proteobacteria, making up 17.8% to 78.5% of the total population in each sample. Other phyla that had a small but consistent presence in all samples were Bacteroidetes (1.4% to 4.1%),

Actinobacteria (0.02% to 1.7%), Firm icutes (0.02% to 0.9%), Cyanobacteria (0.03% to 1.0%),

and Planctomycetes (0.02% to 0.1%). Twenty-one different classes were present across all holobiont samples with 12 to 17 classes present in each sample. The most abundant class was

Gammaproteobacteria, accounting for 17.2% to 73.5% of the total holobiont sequence reads

(Figure 3.3). The dominant classifiable genera within this class that were detected in all samples were Endozoicomonas (9.0% to 21.8%), Vibrio (0.3% to 34.0%), and Pseudoalteromonas (0.9% to 3.4%) (Figure 3.4), all of which have been implicated in the degradation of dimethylsulfoniopropionate (DMSP), an osmolyte that is generated in high abundance by the dinoflagellates in the cora1.70'71 Other classes that had a consistent presence in the holobiont samples were Flavo bacteria (0.9% to 3.8%), Alphaproteobacteria (0.4% to 1.5%),

Actinobacteria (0.3% to 1.5%), Cyanobacteria (0.05% to 1.0%), Clostridia (0.02% to 0.6%), and

Planctomycetacia (0.02% to 0.09%). Unclassified OTUs, sequence reads that could not be assigned to a phylum with an 80% confidence threshold, were also prevalent in all samples ranging from 16.8% to 79.1%._

There were a total of 31,364 seawater sample sequence reads, a total of 13 phyla were present across all samples, with 8 to 10 samples present in each sample. The dominant phylum in all

86 samples was Proteo bacteria, making up 48.8% to 57.0%. Other phyla that had a consistent presence in all water samples were Cyanobacteria (24.9% to 37.5%), Bacteroidetes (4.7% to

8.3%), Verrucomicrobia (1.2% to 3.1%), Actinobacteria (0.6% to 4.4%), Planctomycetes (0.4% to 0.6%), and Firmicutes (0.03% to 0.3%). There were 21 different classes present in all the seawater samples, with 14 to 16 classes in each sample. The two most abundant classes were

Alphaproteobacteria (31.4% to 37.7%) and Cyanobacteria (24.9% to 37.5%) (Figure 3.3). The most abundant classifiable genera within Alphaproteobacteria were Pelagibacter (26.4% to

31.1%) and Erythrobacter (0.04% to 12.2%), while the GpIIa group were the most abundant

Cyanobacteria (29.8% to 38.5%) (Figure 3.4). Other classes that had a consistent presence were

Gammaproteobacteria (7.5% to 11.9%), F/avobacteria (3.8% to 7.3%), Actinobacteria (0.6% to

1.9%), Opitutae (0.9% to 2.7%), Planctomycetacia (0.4% to 0.6%), Verrucomicrobiae (0.07% to

0.5%), and Sphingobacteria (0.06% to 0.2%). This difference in taxonomic composition is consistent with the results of the beta-diversity calculations (Figure 3.2). This taxonomic composition was consistent with other reported seawater samples that were also dominated by

GpIIa and Pelagibacter.6' 67 ' 68 Unclassified OTUs were less prominent than in the holobiont samples and range from 13.7% to 25.7% of the total sequence reads per sample.

87 W5

W4

W3

W2

W1

H5

H4

Hi

0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% Gammaproteobacteria Unclassified Bacteria Alphaproteobacteria Cyanobacteria Flavobacteria Actinobacteria Clostridia Planctomycetacia Unclassified Proteobacteria Bacilli Opitutae Unclassified Bacteroidetes Betaproteobacteria Deltaproteobacteria Verrucomicrobiae Sphingobacteria Rare Classes

Figure 3.3. Class level microbial composition of holobiont and seawater samples. Sequences were classified with a minimum confidence level of 80%. The "Rare Classes" group consists of classes that comprise <1% of the total sequence reads

88 W5

W4

W3

W2

W I

H5

H4

H3

H2

H1

0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% Endozoicomonas spp. (Gammaproteobacteria) Unclassified Bacteria Gplla spp. (Cyanobacteria) Pelagibacter spp. (Alphaproteobacteria) Unclassified Proteobacteria Unclassified Flavobacteriaceae (Bacteroidetes) Vibrio spp. (Gammaproteobacteria) Unclassified Gammaproteobacteria Acinetobacter spp. (Gammaproteobacteria) • Arcobacter spp. (Epsilonproteobacteria) Unclassified Alteromonadales (Gammaproteobacteria) • Pseudoalteromonas spp. (Gammaproteobacteria) Rare Genera

Figure 3.4. Genus level microbial composition of holobiont and seawater samples.

Sequences were classified with a minimum confidence level of 80%. Read counts other than the

12 most abundant are summarized in the "Other" category. The class level for each taxa are shown in parentheses.

89 3.3.3 Comparison to Other Reported A. elisabethae Microbiomes

In order to determine if A. elisabethae has a core microbiome, a set of taxonomically distinct microbes that are a stable presence in the microbiome of the coral regardless of geographic location or environmental factors.4,6,68,72 The San Salvador holobiont microbiomes were compared to previously reported A. elisabethae microbiomes from Providencia Island,

Colombia, as well as Eleuthera, Bimini, and Grand Bahama Island, The Bahamas have been reported4'5'67 (Figure 3.5).

3.3.3.1 Alpha- and Beta-Diversity

The richness values reported for the San Salvador microbiomes were similar to those previously reported for A. elisabethae off the coast of Colombia (Sobs = 184 ± 126 OTUs, Sest = 291 ± 159

OTUs), Eleuthera (Sobs = 73 ± 21 OTUs, Sest = 189 ± 55 OTUs), Bimini (Sobs = 121 ± 88 OTUs,

Sest = 337 ± 203 OTUs), and Grand Bahama Island (Sobs = 96 ± 59 OTUs, Sest = 241 ± 135 4,66 OTU5), and appear within the range of richness values for other reported octocoral microbiomes6'67 (Figure 3.6). However direct comparisons cannot be made between this study and previously reported studies as those microbiomes were analyzed using different 16S rRNA gene hypervariable regions. Analysis of different regions of the 16S rRNA gene can result in different outcomes in terms of diversity and taxonomic composition.73 When observing the

Shannon indices, the San Salvador microbiomes are similar to previously reported values for A. elisabethae collected off the coast of Colombia (H' = 2.13 ± 0.19, E= 0.43 ± 0.03), Eleuthera

(H' = 2.14 ± 0.21, E = 0.50 ± 0.03), Bimini (H' = 2.41 ± 1.45, E = 0.50 ± 0.23), Grand Bahama

Island (H' = 2.29 ± 1.20, E = 0.50 ± 0.20)4566 and within the range reported for other octocoral microbiomes (Figure 3.7).

90

1,7

b±,ca ton "Grand Bahama

'1.F'Ziderdale i10,[vwcrtNIC,

Miami

Bimini

Nassau •

Eleuthera -0-

San Providencia Salvador Island, Colombia

Figure 3.5. A. elisabethae sampling locations. Inset map shows the location of Providencia

Island, approximately 1390 km from Bimini, The Bahamas. Map prepared using Google MapsTM mapping service.

91

2500

2000

1500

1000

500

0

ze ,c_e . C39 . 4C3\s*—C e+ ".\C'/Th t) - e,°..°*- _,,,- C.)/ •NO‘b ,b*, ...q" i'')Y . , ,,,,.• CP e, ot*.

Observed Richness • Chaol Estimated Richness

Figure 3.6. Observed and chaol estimates richness for all reported A. elisabethae and

octocoral microbiomes investigated using 454 pyrosequencing. SS: San Salvador; Col:

Colombia; Ele: Eleuthra; GB: Grand Bahama: Bim: Bimini. Bars represent standard deviation.

References: (a) Correa et al.4; (b) Robertson et al.5; (c) Pike et aL67; (d) McCauley et aL

(Chapter 2) (e) Bayer et aL6

92

6.0

5.0

4.0

H' 3.0 0.6 2.0 0.4 1.0 0.2

0.0 0.0

..„.,-L§ A.e :..., . „,o o.S.1 „<„,,,,-. ' ey ' ,.w' ,00' _-' e, e, ey''''' ,b9 e,' elYIf, c, o.0q> 49" X" Co '2* 2.. cts 'lb 1. Cj e, e,V% V%e, V% , H' •E -

Figure 3.7. Shannon diversity and equitability indices for all reported A. elisabethae and octocoral microbiomes investigated using 454 pyrosequencing. SS: San Salvador; Col:

Colombia; Ele: Eleuthra; GB: Grand Bahama: Bim: Bimini. Bars represent standard deviation.

References: (a) Correa et al.4; (b) Robertson et al.5; (c) Pike et al.67; (d) McCauley et al.

(Chapter 2) (e) Bayer et al.6 .

93 3.3.3.2 Taxonomic Composition

The taxonomic composition of the San Salvador microbiomes from this study had similarities at the higher taxonomic levels to those from Providencia Island, Colombia,4 both were dominated at the class level by Gammaproteobacteria (73.9% to 83.4%) (Figure 3.8). However, there were variations at the lower taxonomic levels, while all A. elisabethae samples had a consistent

Endozoicomonas spp. presence, the major genus in Colombian samples was Pseudomonas spp.

(31.8% to 48.1%); a group not detected in any of the San Salvador samples. As for the genera consistently found in the San Salvador samples, Vibrio spp. was only,detected in two of the three

Colombian samples, and Pseudoalteromonas spp. was not detected in any samples.

Even greater taxonomic variability was observed when comparing the microbiomes associated with A. elisabethae collected off the coast of Eleuthera, Bimini, and Grand Bahama Island, The

Bahamas.5 Unlike the samples from San Salvador and Colombia, there were no observable taxonomic trends based on where they were collected. These microbiomes were dominated either by Gammaproteobacteria (0.3% to 86.0%), Cyanobacteria (0.6% to 54.6%),

Alphaproteobacteria (1.1% to 50.7%), or Flavobacteria (0.0% to 64.3%) (Figure 3.8). At the genus level no classifiable taxa were consistent across all 14 samples. Endozoicomonas spp. were detected in all of the samples collected from Eleuthera, but in only three of the five samples from Bimini, and four of the five samples from Grand Bahama Island. However, closely related bacteria, unclassified bacteria within the order Oceanospirillales, were detected in all samples and accounted for 0.04% to 84.1% of the total sequence reads. .

94 The high level of taxonomic heterogeneity observed among A. elisabethae microbiomes from specimens collected throughout the Caribbean suggests that this coral does not require a stable association with any specific bacterial species for survival. One of the major roles of microorganisms in the coral holobiont is the biogeochemical cycling of nutrients.74 The genes involved in these processes can be found in a variety of origins and are not specific to one taxonomic grOUp.71'75'76 It has been hypothesised that in corals with high microbial taxonomic heterogeneity, such as A. elisabethae, the functional potential of the microorganisms in the holobiont is more important than the taxonomic composition. The microbes in these holobionts most likely adapted to local conditions through horizontal gene transfer.77 Therefore A. elisabethae may not require any one specific taxa of microorganism as was observed in

Erythropodium caribaeorum (Chapter 2), but instead can utilize a wide variety of microbes to accomplish the functions required of the microbiome within the holobiont.

95 Bim5 Bim4 Bim3 Bim2 Biml GB5 GB4 GB3 GB2 GB1 E1e4 E1e3 E1e2 Elel Col C Col B Col A H5 (SS) H4 (SS) H3 (SS) H2 (SS) H1 (SS)

0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% Gammaproteobacteria • Unclassified Bacteria • Cyanobacteria Alphaproteobacteria 11 Flavobacteria • Clostridia Bacilli • Betaproteobacteria • Unclassified Proteobacteria Actinobacteria • Unclassified Bacteriodetes • Planctomycetacia 1. Opitutae • Sphingobacteria • Deinococci Epsilonproteobacteria • Verrucomicrobiae • Fusobacteria Rare Classes

Figure 3.8 - Class level composition of all reported A. elisabethae microbiome. Sequences were classified with a minimum confidence level of 80%. The "Rare Classes" group consists of classes that comprise <1% of the total sequence reads. Bim: Bimini, GB: Grand Bahamas, Ele:

Eleuthera5; Col: Colombia4; H: Holobiont, SS: San Salvador (this study)

96 3.3.4 Comparison of Holobiont, Dinoflagellate and Larvae Samples.

The holobiont, dinoflagellates, and larvae have all been implicated in pseudopterosin biosynthesis, therefore any stable microbial association between these coral derived fractions

may provide insight into the true producer of these bioactive MNPs. Additionally, the dinoflagellates and larvae are vital to the overall health and fecundity of the coral colony, so understanding and stable association may provide insight into the role those microbes play in the coral holobiont.

3.3.4.1 Alpha- and Beta-Diversity

All samples were normalized to 370 sequence reads per sample for comparison to the dinoflagellate and larvae samples that had lower numbers of sequence reads (Table 3.1). This decreased the. diversity calculations for the holobiont samples, as alpha-diversity measurements are highly sensitive to sampling size. The normalized observed richness (Sobs) ranged from 33

OTUs (H3) to 59 OTUs (Hi) (45 ± 8 OTUs) and the Chaol estimated richness (Sea) ranged from

76 OTUs (H3) to 122 OTUs (H1) (100 ± 19 OTUs). These richness values were similar to that of the dinoflagellate (Sobs = 50 ± 5 OTUs, Sest = 76 ± 13 OTUs) and larvae (So = 45 ± 13 OTUs,

S„t 73 ± 30 OTUs) samples (Table 3.3). There was no significance between any of the sample types for the observed (ANOVA, p 70.640) or estimated richness (ANOVA, p = 0.147) (Figure

3.9). The holobiont Shannon indices also decreased with the smaller sampling size (H' = 2.50 ±

0.37, E = 0.66 ± 0.07) and were similar to index values calculated for the dinoflagellates (H' =

2.46 ± 0.24, E = 0.63 ± 0.06) and larvae (H' = 2.36 ± 0.86, E = 0.61 ± 0.19) (Figure 3.10). As with the calculated richness values, there was no significance between the diversity (ANOVA, p

= 0.926) and equitability (ANOVA, p = 0.855) for these sample types.

97 The dinoflagellate and larvae are subsets of the holobiont samples, meaning the microbes detected in the holobiont samples encompass the microbes associated with the dinoflagellates and larvae samples. Therefore it would be expected that the calculated richness and Shannon indices be lower in these samples. Previously imaged octocoral bacteria were — 2 to 41..im in diameter, while dinoflagellates are — 8 to 10iim in diameter, and the larvae — 400-5014im in diameter.78'79 A reduction in these values would also be expected based on the physical size of the dinoflagellates and larvae. Therefore, especially in the dinoflagellate cells, there would only be room for a few bacterial cells. If any specific associations were occurring in the dinoflagellate cells the Shannon indices would be substantially lower than that of the holobiont. Since this is not the case it may be that there is no specific microbial association with the dinoflagellate cells, and the microbes detected in the samples are trace amounts of the holobiont microbes carried over from the holobiont during the purification of the dinoflagellate cells.

To determine if the microbes detected in these samples were in fact a dilution of the holobiont microbiome the overall community compositions were compared using the Yue and Clayton indices. If the dinoflagellate or larvae samples Were a dilution of the holobiont microbiomes remaining after purification of these samples, it would be expected that there would be no statistical difference in the community compositions when subsampled to the same sequencing depth.

When comparing the dinoflagellates to the holobiont, three distinct clades were observed (Figure

3.1 1A), the top clade contained four holobiont samples, the middle clade three dinoflagellate samples, and the bottom clade one holobiont and two dinoflagellate samples. When the distance

98 matrix was accessed using AMOVA the samples were significantly different from each other

(AMOVA, p = 0.03). When comparing the community structure between the holobiont and

larvae samples, two distinct clades were observed one clade contained all the larvae samples and

one holobiont samples, while the other contained the remaining holobiont samples (Figure

3.11B). The groups were significantly different from each other (AMOVA, p = 0.02).

This data suggests that the microbial communities associated with these fractions may not be a dilution of the holobiont microbiome but distinct communities associated with the dinoflagellates and larvae.

99 Table 3.3. Richness and alpha diversity calculations of A. elisabethae holobiont, dinoflagellate, larvae, microbial communities. OTUs were calculated at a distance of 0.03.

Calculations were based on datasets normalized to 370 sequence reads per sample.

Observed Chaol Shannon Shannon Richness Estimated Coverage Sample Diversity Equitability (# OTUs, Richness (%) (H') (E) Sobs) (Sest) H1 59 122 2.95 0.73 91.4 H2 45 80 2.88 0.76 94.6 H3 33 76 2.03 0.58 94.7 H4 43 110 2.13 0.57 92.9 H5 47 114 2.50 0.65 92.6 Average 45 100 2.50 0.66 93.2 SD 8 19 0.37 0.07 1.26 D1 53 73 2.51 0.63 94.5 D2 50 71 2.61 0.67 94.8 D3 47 60 2.72 0.71 95.7 D4 44 84 2.12 0.56 93.5 D5 55 93 2.33 0.58 92.2 Average 50 76 2.46 0.63 94.1 SD 5 13 0.24 0.06 1.3 Li 47 109 2.54 0.66 92.6 L2 58 86 3.15 0.77 94.0 L3 40 55 2.10 0.57 95.5 L4 25 32 1.01 0.31 97.8 L5 52 83 3.00 0.76 94.6 Average 45 73 2.36 0.61 • 94.9 SD 13 30 0.86 0.19 1.9

100

140

120

100

OTUs 80

ber 60 m

Nu 40

20

Holobiont Dinoflagellate Larvae

#0TUs • Chaol

Figure 3.9. Observed and Chaol estimated richness for holobiont, dinoflagellate, and larvae samples. OTUs were calculated at a distance of 0.03. Bars represent standard deviation.

Calculations were based on datasets normalized to 370 sequence reads per sample.

101 4.0 1.4 3.5 1.2 3.0 1.0 2.5 H' 2.0 0.8 1.5 0.6 1.0 0.4 0.5 0.2 I 0.0 0.0 Holobiont Dinotlagellate IiLarvae

H' • E

Figure 3.10. Shannon diversity (H') and equitability (E) indices for holobiont, dinoflagellate, and larvae samples. OTUs were calculated at a distance of 0.03. Bars represent standard deviation. Calculations were based on datasets normalized to 370 sequence reads per sample.

102 A

144

III

D5

DI

04

D2

D3

0.05

LS

111

LI

3

L2

115

4

112

0.05

Figure 3.11. Yue and Clayton distance matrix comparison of A. elisabethae holobiont, dinoflagellate, and larvae microbial communities. Comparison of holobiont and dinoflagellates is shown in dendrogram A and comparison of holobiont and larvae is shown in dendrogram B.

103 3.3.4.2 Taxonomic Composition

There were a total of 15,141 dinoflagellate sample sequence reads, a total of eight phyla were

present across all samples, with four to six present in each sample. The dominant phylum in all

dinoflagellate samples was Proteobacteria, making up 26.9% to 83.8%. Other phyla that had a

consistent presence in all dinoflagellate samples were Bacteroidetes (3.29% to 27.2%),

Actinobacteria (0.8% to 14.5%), and Firmicutes (0.7% to 13.1%). Sixteen classes were detected across all samples with eight to twelve present in each sample. The most abundant class was

Gammaproteobacteria, accounting for 208% to 80.9% of the sequence across all samples

(Figure 3.12). Other classes that were consistently present were Flavobacteria (3.3% to 26.9%),

Actinobacteria (0.8% to 14.5%), Alphaproteobacteria (2.4% to 6.0%), Clostridia (0.09% to

7.1%), and Betaproteobacteria (0.3% to 3.0%). Unclassified OTUs were prevalent and ranged from 5.4% to 25.2% of the sequence reads.

The taxonomic composition of the larvae samples was very similar to the dinoflagellate samples.

There were a total of 6,614 larvae sample sequence reads, a total of six phyla were present across all samples, with four to six present in each samples. The dominant phylum in all samples was

Proteobacteria (21.7% to 89.2%). Other phyla that were consistently present were Bacteroidetes

(0.4% to 30.0%), Actinobacteria (0.6% to 8.2%), and Firmicutes (0.7% to 5.6%). Fifteen classes were present across all samples with seven to eleven classes present in each sample. As with the dinoflagellate samples the dominant microbial class was Gammaproteobacteria ranging from

18.1% to 85.5% of the sequence reads. The other classes that had a consistent presence were

Flavobacteria (0.1% to 30.0%), Alphaproteobacteria (1.4% to 12.1%), Actinobacteria (0.6% to

104 8.2%), and Betaproteobacteria (0.2% to 10.1%) (Figure 3.12). Unclassifiable OTUs ranged from

3.0% to 54.7% of the total sequence reads.

These taxonomic classifications are similar to those observed in the holobiont samples. At the phylum level, all three are all dominated by Proteobacteria and have a consistent presence of

Bacteroidetes and Actinobacteria. At the class level they are dominated by

Gammaproteobacteria and have a consistent presence of Flavobacteria, Alphaproteobacteria, and Actinobacteria. The dominant classifiable genera that were consistently detected in the holobiont samples were Endozoicomonas, Vibrio, and Pseudoalteromonas. All of which were consistently detected in the dinoflagellate samples along with Acinetobacter and Aquimarina

(Figure 3.13). There was a slight shift in composition in the larvae samples from the holobiont samples at the genus level as Acinetobacter, Vibrio, and Aquimarina were consistently present but Endozoicomonas, and Pseudoalteromonas were not.

105 L5

L4

L3

L2

L 1

D5

D4

D3

D2

DI

H5

H4

H3

H2

HI

0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%

Gammaproteobacteria • Unclassified Bacteria • Alphaproteobacteria • Cyanobacteria

Flavobacteria • Actinobacteria • Epsilonproteobacteria • Bacilli

Clostridia • Opitutae • Betaproteobacteria • Bacteroidia

Planctomycetacia • Rare Classes

Figure 3.12. Class level microbial composition of coral-derived (holobiont, dinoflagellates, and larvae) fractions. Sequences were classified with a minimum confidence level of 80%. The

"Rare Classes" group consists of classes that comprise <1% of the total sequence reads..

106 L5 L4 L3 L2 Li D5 D4 D3 D2 D1 H5 H4 H3

H2 77iMMENN IMINMEMENN H1 Hil.M.IMENOMON

0% 10% 20% 30% 40% 5 0 % 60% 70% 80% 90% 100%

Endozoicomonas spp. (Gammaproteobacteria) Unclassified Bacteria Vibrio spp. (Gammaproteobacteria) Acinetobacter spp. (Gammaproteobacteria) Aquimarina spp. (Flavobacteria) Marinomonas spp. (Gammaproteobacteria) Pseudoalteromonas spp. (Gammaproteobacteria) Corynebacterineae spp. (Actinobacteria) Lactobacillus spp. (Bacilli) Prevotella spp. (Bacteroidia) Anaerococcus spp. (Clostridia) Unclassified Alteromonadales (Gammaproteobacteria) Unclassified Gammaproteobacteria Pelagibacter spp. (Alphaproteobacteria) Unclassified Alteromonadales (Gammaproteobacteria) Diaphorobacter spp. (Gammaproteobacteria) Sphingobium spp. (Betaproteobacteria) Other

Figure 3.13. Genus level microbial composition of coral-derived (holobiont, dinoflagellates,

and larvae) fractions. Sequences were classified with a minimum confidence level of 80%.

Read counts other than the 16 most abundant are summarized in the "Other" category. The class

level for each taxa are shown in parentheses.

107 3.3.5 San Salvador A. elisabethae Putative Core Microbiome

There were no consistent microbial taxa, or core microbiome associated with all reported A. elisabethae (Figure 3.8). However, there were operational taxonomic units (OTUs; D = 0.03) that were consistently found in all San Salvador microbiomes, suggesting that there may be a putative location specific core microbiome associated with these samples. Only OTUs that were present in all holobiont data sets and were absent from all seawater datasets, as well as the blank

SFSW DNA extraction control, were considered. A total of seven OTUs were consistently present in all samples. The most abundant was an Endozoicomonas sp. (OTU 064) that accounted for 16.7% of all of the holobiont sequence reads, ranging from 9.6 % (H1) to 21.6%

(H2) of each sample (Table 3.4). It was also detected in all dinoflagellate samples and four of the five larvae samples. This OTU formed a well supported (95% bootstrap support) clade with two uncultured bacterial clones obtained from marine sponges (HG423525; KF373182; 100% identity) as well as Endozoicomonas euniceicola EF212 (JX488684; 99% identity) which was isolated from the octocoral Eunicea fusca67 (Figure 3.14). Endozoicomonas spp. have been detected in many marine corals and have been hypothesized to aid in the biogeochemical cycling of sulfur, in particular the degradation of DMSP.8° Endozoicomonas spp. have also been implemented in the production of antimicrobial compounds, the degradation of complex organic carbon sources, and the conversion and assimilation of nitrate.81-84

Six other, OTUs constitute the remainder of the putative San Salvador core microbiome. One of which was an uncultured Alphaproteobacteria (OTU 010) that accounted for 8.1% of the total holobiont sequence reads and formed a distinct clade with strong 100% bootstrap support to two uncultured bacterium clones (KP008700, KP008684; 97% identity) obtained from the octocoral

108 CoraIlium rubrum. The remaining OTUs all belong to the class Gammaproteobacteria; a

Psychrosphaera sp. (OTU 015) that accounted for 1.9% of the total sequence reads and formed a distinct clade with an uncultured bacterium clone (JN694817; 99% identity) obtained from the coral Porites astreoides, 45 and the strain Psychrosphaera saromensis SA4-48T85 (AB 545807;

98% identity). A Vibrio sp. (OTU 016) that accounted for 3.6% of the total sequence reads and formed a distinct clade with strong 99% bootstrap support to an uncultured bacterium clone

(FJ202984; 99% identity) obtained from the coral Monastraea faveolata86 and Vibrio sp.

(AB470932; 99% identity) isolated from a coral Montipora sp. A Thalassomonas sp. (OTU 044) that accounted for 0.6% of the total sequence reads and clustered with 98% bootstrap support to a Thalassomonas sp. (FJ463711; 100% identity) isolated from the coral Halocordyle disticha. A

Endozoicomonas sp. (OTU 050) that accounted for 0.4% of the sequence reads, formed a distinct clade with 6 7 °/o bootstrap support with the strain Endozoicomonas gorgoniicola PS125T

(JX488685; 99% identity) isolated from a Plexaura sp.87 Lastly, a Neptunomorias sp. (OTU

0110) that accounted for 0.4% of the sequence reads, and clustered with strong 98% bootstrap support to an uncultured bacterium clone (KP008777; 100% identity) obtained from C. rubrum.

One OTU was detected in all dinoflagellate and larvae samples, Aquimarina sp. (OTU 011), it accounted for 4.5% of all the total sequence reads and clustered with 97% bootstrap support to an Aquimarina sp. isolated from an A. elisabethae collected from The Bahamas66 (KC545299).

This OTU was only detected in three of the five holobiont samples, however Aquimarina spp. were the dominant member of two of the previously reported A. elisabethae microbiomes from

The Bahamas66 and may therefore have a significant role in some holobionts. Also if the dinoflagellate and larvae samples consist of dilute amounts of the holobiont microbiome, then

109 the Aquimarina sp. OTU 014 was present in all samples and simply not detected in the holobiont samples due to being present is such low abundance compared with other dominant sequence reads. The role of Aquimarina spp. in marine invertebrates is unknown, but A. salinaria, a species isolated from the marine environment was shown to demonstrate algicidal activity in co- culture experiments.88 Therefore these microbes may play a role in mediating interactions between the coral and their algal symbionts. The close phylogenetic relationship of all of these

OTUs to other microorganisms detected or isolated from marine corals suggests that these are common members of the coral microbiomes and may play a functional role in the holobiont in which they inhabit.

110 Table 3.4. Summary of OTUs (D=0.03) that comprise the putative San Salvador A.

elisabethae core microbiome, as well as the OTUs consistently found in the dinoflagellate

and larvae samples. The bottom panel displays the taxonomic assignment of the OTUs based on the RDP classifier using a confidence threshold of 80%.

OTU % Abundance Sample 0004 0010 0015 0016 0044 0050 0110 0011 H1 9.6 1.5 5.2 8.4 0.1 0.3 0.2 0.1 H2 21.6 0.3 5.0 11.2 2.3 0.1 0.6 H3 13.3 26.7 0.1 0.1 0.02 0.6 0.02 H4 17.9 0.4 0.3 0.02 0.02 0.2 0.1 1.5 H5 18.0 5.9 0.3 0.2 0.3 1.0 0.1 0.7 Total % 16.7 8.1 1.9 3.6 0.6 0.4 0.2 n/a Holobiont D1 0.8 3.3 0.9 1.1 11.7 D2 1.3 - 0.4 2.2 7.6 D3 5.9 20.9 0.6 1.1 27.1 D4 0.6 - 3.1 1.0 2.1 0.2 4.0 D5 0.7 0.7 34.6 Li 0.9 - 14.7 0.5 0.1 0.1 0.2 4.3 L2 2.2 0.4 - 0.4 0.8 - 29.7 L3 3.8 - 0.2 - 0.6 - 18.2 L4 1.3 - - - 0.1 L5 - - - - - 3.2 Total % Coral 8.8 4.5 2.3 1.9 0.4 0.4 0.1 4.5 Reads OTU Taxonomic Assignment 0004 Proteobacteria; Gammaproteobacteria; Oceanospirillales; Hahellaceae; Endozoicomonas 0010 Proteobacteria; Alphaproteobacteria; unclassified L _ 0015 Proteobacteria; Gammaproteobacteria; Alteromonadales; Pseudoalteromonadaceae; Psychrosphaera 6016 Proteobacteria; Gammaproteobacteria; Virionc21es;. Vibrionaceae; Vibrio

111 0044 Proteobacteria; Gammaproteobacteria; Alteromonadales; Colwelliaceae; Thalassomonas 0050 Proteobacteria; Gammaproteobacteria; Oceanospirillales; Hahellaceae; Endozoicomonas 0110 Proteobacteria; Gammaproteobacteria; Oceanospirillales; Oceanospirillacecie; Neptunomonas 0011 Bacteroidetes; Flavobacteria; Flavobacteriales; Flavobacteriaceae; Aquimarina

112

70j Uncultured bacterium clone Past 086 (JN694817)

54 I Uncultured Gammaproteobacterium clone F11-0X138 (J0579787) — Psychrosphaera saromensis SA4-481 (AB545807)

0.05 51— Uncultured Psychrosphaera sp. clone OTU 0015

99 Uncultured marine bacterium clone 82 UNP5 G2 (GU319518) iPsychrosphaera aestuarii PSC 1011 (JX854537)

77 871 Psychrosphaera haliotis KDW41 (EU930871) Vibrio casei WS 45391 (NR 116870) Vibrio rumoiensis S-1 (NR 024680) too Uncultured bacterium clone SGUS965 (FJ202984) „ Uncultured Vibrio sp. clone OTU 0016 Vibrio sp. r20 (AB470932) Thalassomonas hatiotis NBRC 1042321 (NR 114259) Thalassomonas ganghwensis JC2641T (NR 025717) 99 Thalassomonas loyana CBMAI 7221 (NR 043066) 57 — Uncultured Thalassomonas sp. OTU 0044 57 Thalassomonas sp. HDEP9 (FJ463711) 98 98 Uncultured bacterium clone MAY8C34 (KF179735)

99 1 Neptunomohas concharum LHW37T (NR 118152)

62 Neptunomonas naphthovorans NEIRC 101991T (NR 114018) Uncultured Neptunomonas sp. clone OTU 0110 100 97 Uncultured bacterium clone Cr2-H1 (KP008777) Neptunomonas antarctica S3-221 (NR 116775.1) Uncultured bacterium clone C334/GW1046 (HG423525)

69 Uncultured bacterium clone SPHAL-74 (KF373182) E Uncultured Endozoicomonas sp. clone OTU 0004 Endozoicomonas euniceicola EF2121 (JX488684) 100 Endozoicomonas atn'nee WP7OT (KC878324) Endozoicomonas numazuensis HC501 (AB695088) 57 36 Endozoicimonas elysicola MKT110T (AB196667) 5 Endozoicomonas montiporae CL-331 (FJ347758) 69 Endozoicomonas gorgoniicola PS125T (JX488685) 66 Uncultured Endozoicomonas sp. clone OTU 0050 Methyloceanibacter caenitepidi Gela4T (NR 125465) Novispifillum itersonii NBRC 136151 (NR 113625) Uncultured Alphaproteobacteria clone OTU 0010 1, Uncultured bacterium Crl-C8 (KP008700) 67'— Uncultured o ganism CGOF094 (D0395873), Aquimarina mytili PSC33T (HM998910) Aquimarina intermedia LMG 232041 (AM113977) 100 Aquimarina gracilis PSC321 (HM998909) Aquimarina sp. RKVR24 (JX317743)

97II Uncultured Aquimarina sp. clone OTU 0011 Aquimarina sp. P548-9881 (KC545299)

Figure 3.14 . Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of A. elisabethae holobiont, dinoflagellate, and larvae putative San Salvador core microbiomes.

Evolutionary distances were computed using Jukes-Cantor method. A total of 235 nt positions were used. Bootstrap values are expressed as a percent of 1000 replicates; bootstrap values < 50 are not shown.

113 3.4 Conclusions

This study adds to the body of research on the microbiomes associated with the octocoral A.

elisabethae and is the first report that attempted to investigate microbial communities associated

with the dinoflagellates and larvae of this coral. From this research the following conclusions can be made: (1) The microbial community associated with A. elisabethae were distinct from the surrounding seawater; (2) the most dominant stable microbiome association observed in the San

Salvador samples was with Endozoicomonas spp., Vibrio spp., and Pseudoalteromonas spp.; (3) there were no stable taxonomic groups at the genus level in all reported A. elisaebethae microbiomes, and high taxonomic variability was observed across all samples, suggesting that these corals do not require a stable association with any taxonomic groups for survival; (4) the dinoflagellates and larvae had similar richness, diversity, and taxonomic composition to the holobiont samples; and (5) Seven OTUs were consistently found in all holobiont samples suggesting a putative San Salvador specific core microbiome. However, further sampling would be required in order determine the presence of a site-specific core microbiome.

While there appears to be no microbial communities directly associated with the dinoflagellates of A. elisabethae there may be with their larvae. Further studies investigation the microbial communities associated with the larvae would provide insight into the role these microbes play in the fecundity of this coral. For example, investigation of the larvae before and after they have detached from the parent coral may provide insight into whether the microorganisms are acquired vertically or horizontally. This may also help to understand the true biosynthetic source of pseudopterosins, which still remains unclear.

114 3.5 References

Bayer, F. M. The Shallow-water Octocorallia of the West Indian Region: A Manual for

Marine Biologists; Nijhoff: Boston, 1961.

Tunnell, J. W.; Nelson, T. J. American Academy of Underwater Sciences AAUS),

1989; pp 325-335.

Williams, G. C.; Chen, J.-Y. Zootaxa 2012, 3505, 39-52.

Correa, H.; Haltli, B.; Duque, C.; Kerr, R. G. Microb. Ecol. 2013, 66 (4), 972-985.

Robertson, V.; Haltli, B.; McCauley, E.; Overy, D.; Kerr, R. G. Microorganisms 2016,

4, 2016, 4 (3), 23.

Bayer, T.; Arif, C.; Ferrier-Pages, C.; Zoccola, D.; Aranda, M.; Voolstra, C. R. Mar.

EcoL Prog. Ser. 2013, 479, 75-84.

Vezzulli, L.; Pezzati, E.; Huete-Stauffer, C.; Pruzzo, C.; Cerrano, C. PLoS ONE 2013, 8

(6), e67745.

Look, S. A.; Fenical, W.; Matsumoto, G. K.; Clardy, J. I Org. Chem. 1986, 51 (26),

5140-5145.

Look, S. A.; Fenical, W.; Jacobs, R. S.; Clardy, J. P. Natl. Acad. Sci. USA 1986, 83 (17),

6238-6240.

Look, S. A.; Fenical, W. Tetrahedron 1987, 43 (15), 3363-3370.

Roussis, V.; Wu, Z.; Fenical, W.; Strobel, S. A.; Van Duyne, G. D.; Clardy, J. I Org.

Chem. 1990, 55 (16), 4916-4922.

Ata, A.; Kerr, R. G.; Moya, C. E.; Jacobs, R. S. Tetrahedron 2003, 59 (23), 4215-4222.

Rodriguez, I. L; Shi, Y.-P.; Garcia, 0. J.; Rodriguez, A. D.; Mayer, A. M. S.; Sanchez, J.

A.; Ortega-Barria, E.; Gonzalez, J. J. Nat. Prod. 2004, 67 (10), 1672-1680.

115 Correa, H.; Zorro, P.; Arevalo-Ferro, C.; Puyana, M.; Duque, C. J. Chem. EcoL 2012, 38

(9), 1190-1202.

Heckrodt, T. J.; Mulzer, J. Top. Curr. Chem. 2005, 244, 1-41.

Berrue, F.; McCulloch, M. W. B.; Kerr, R. G. Bioorgan. Med. Chem. 2011, 19 (22),

6702-6719.

Correa, H.; Aristizabal, F.; Duque, C.; Kerr, R. G. Mar. Drugs 2011, 9 (3), 334-344.

Puyana, M.; Narvaez, G.; Paz, A.; Osorno, O.; Duque, C. J. Chem. EcoL 2004, 30 (6),

1183-1201.

Duque, C.; Puyana, M.; Castellanos, L.; Arias, A.; Correa, H.; Osorno, O.; Asai, T.;

Hara, N.; Fujimoto, Y. Tetrahedron 2006, 62 (17), 4205-4213.

Mayer, A. M. S.; Jacobson, P. B.; Fenical, W.; Jacobs, R. S.; Glaser, K. B. Life Sci.

1998, 62 (26), 401-407.

Kijjoa, A.; Sawangwong, P. Mar. Drugs 2004, 2 (2), 73-82.

Gross, H.; Konig, G. M. Phytochem. Rev. 2006, 5 (1), 115-141.

Haefner, B. Drug Discov. Today 2003, 8 (12), 536-544.

Fenical, W. Calif. Agric. 1997, 51 (4), 45-49.

Martins, A.; Vieira, H.; Gaspar, H.; Santos, S. Mar. Drugs 2014, 12 (2), 1066-1101.

Lasker, H. R. Coral Reefs 2003, 22 (1), 23-26.

Davies, P. S. In Plant-Animal Interactions in the Marine Benthos; Johm, D. M.,

Hawkins, S. J., Price, J. H., Eds.; Clarendon Press: Oxford, 1992; pp 511-540.

Miller, D. J.; Yellowlees, D. P. Roy. Soc. Lon. B Rio. 1989, 237 (1286), 109-125.

Whitehead, L. F.; Douglas, A. E. J. Exp. Biol. 2003, 206 (18), 3149-3157.

Rowan, R.; Powers, D. A. Science 1991, 251 (4999), 1348-1351.

116 Rowan, R. J. PhycoL 1998, 34 (3), 407-417.

Rowan, R.; Knowlton, N. P. Natl. Acad. Sci. USA 1995, 92 (7), 2850-2853.

Toller, W. W.; Rowan, R.; Knowlton, N. Biol. Bull. 2001, 201 (3), 360-373.

Toner, W. W.; Rowan, R.; Knowlton, N. Biol. Bull. 2001, 201 (3), 348-359.

(3'5) Santos: S. R.; Shearer, T. L.; Hannes, A. R.; Coffroth, M. A. Mol. EcoL 2004, 13 (2),

459-469.

Santos, S. R.; Gutierrez-Rodriguez, C.; Lasker, H. R.; Coffroth, M. A. Mar. Biol. 2003,

143 (1), 111-120.

Coffroth, M. A.; Santos, S. R.; Goulet, T. L. Mar. Ecol. Prog. Ser. 2001, 222, 85-96.

Rowan, R. Nature 2004, 430 (7001), 742-742.

Mydlarz, L. D.; Jacobs, R. S.; Boehnlein, .T.; Kerr, R. G. Chem. Biol. 2003, /0 (11),

1051-1056.

Benayahu, Y.; Weil, D.; Kleinman, M. Adv. Invert. Repro. 1990, 5, 323-328.

Beiring, E. A.; Lasker, H. R. Mar. EcoL Prog. Ser. 2000, 196, 169-117.

Gutierrez-Rodriguez, C.; Lasker, H. R. Invertebr. Biol. 2004, 123 (1), 54-67.

Sharp, K. H.; Ritchie, K. B.; Schupp, P. J.; Ritson-Williams, R.; Paul, V. J. PLoS ONE

2010, 5 (5), e10898-6.

Ceh, J.; Raina, J.-B.; Soo, R. M.; van Keulen, M.; Bourne, D. G. PLoS ONE 2012, 7 (5),

e36920.

Sharp, K. H.; Distel, D.; Paul, V. J. ISME J2012, 6 (4), 790-801.

Morrow, K. M.; Moss, A. G.; Chadwick, N. E.; Liles, M. R. App!. Environ. Microb.

2012, 78 (18), 6438-6449.

Apprill, A.; Marlow, H. Q.; Martindale, M. Q.; Rappe, M. S. ISME J2009, 3 (6), 685-

117 699.

Apprill, A.; Marlow, H. Q.; Martindale, M. Q.; Rappe, M. S. AppL Environ. Microb.

2012, 78 (20), 7467-7475.

Sharp, K. H.; Sneed, J. M.; Ritchie, K. B.; M.cdaniel, L.; Paul, V. J. Biol. Bull. 2015, 228

(2), 98-107.

Dobretsov,• S.; Qian, P.-Y. J. Exp. Mar. Biol. EcoL 2004, 299 (1), 35-50.

Dobretsov, S.; Abed, R. M. M.; Teplitski, M. Biofouling 2013, 29 (4), 423-441.

Hadfield, M. G. Annu. Rev. Mar. Sci. 2010, 3 (1), 453-470.

Stapleton Mukherjee, M. Diterpene Biosynthesis on Early Ontogenetic Stages in

Pseudopterogorgia elisabethae and Pseudopterogorgia bipinnata. M. Sc. Thesis, Florida

Atlantic University, Boca Raton, FL, 2005.

Callaway, T. R.; Dowd, S. E.; Wolcott, R. D.; Sun, Y.; McReynolds, J. L.; Edrington, T.

S.; Byrd, J. A.; Anderson, R. C.; Krueger, N.; Nisbet, D. J. PouL Science 2009, 88 (2),

298-302.

Gontang, E. A.; Fenical, W.; Jensen, P. R. App!. Environ. Microb. 2007, 73 (10), 3272-

3282.

Schloss, P. D.; Westcott, S. L.; Ryabin, T.; Hall, J. R.; Hartmann, M.; Hollister, E. B.;

Lesniewski, R. A.; Oakley, B. B.; Parks, D. H.; Robinson, C. J.; Sahl, J. W.; Stres, B.;

Thallinger, G. G.; Van Horn, D. J.; Weber, C. F. Appl. Environ. Microb. 2009, 75 (23),

7537-7541.

Edgar, R. C. Bioinformatics 2010, 26 (19), 2460-2461.

Wang, Q.; Garrity, G. M.; Tiedje, J. M.; Cole, J. R. App!. Environ. Microb. 2007, 73

(16), 5261-5267.

118 Caporaso, J. G.; Bittinger, K.; Bushman, F. D.; DeSantis, T. Z.; Andersen, G. L.; Knight,

R. Bioinformatics 2010, 26 (2), 266-267.

Excoffier, L.; Smouse, P. E.; Quattro, J. M. Genetics 1992, 131 (2), 479-491.

Yue, J. C.; Clayton, M. K. I Stat. Plan. Inference 2012,142 (5), 1031-1039.

Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. Mol. Biol. EvoL 2013, 30

(12), 2725-2729.

Saitou, N.; Nei, M. Mol. Biol. Evol. 1987, 4 (4), 406-425.

Jukes, T. H.; Cantor, C. R. Evolution of protein molecules; Munro, H. N., Ed.; Academic

Press: New York, 1969; Vol. 3, pp 21-132.

Felsenstein, J. Evolution 1985, 39 (4), 783.

Robertson, V. Bacterial diversity of the octocoral Pseudopterogorgia elisabethae via culture-dependent and culture-independent methods and screening of selected bacteria for antimicrobial activity. Ph.D. Thesis, University of Prince Edward Island,

Charlottetown, PE, 2013.

Pike, R. E. A comprehensive analysis of the microbial diversity associated with Eunicea

Fusca and related Plexauridae octocorlas, and the isolation of new natural products from selected associated bacteria. Ph.D. Thesis, University of Prince Edward Island

Charlottetown, PE, 2013.

Roder, C.; Bayer, T.; Aranda, M.; Kruse, M.; Voolstra, C. R. Mol Ecol 2015, 24 (13),

3501-3511.

Sunagawa, S.; Woodley, C. M.; Medina, M. PLoS ONE 2010, 5 (3), e9554.

Raina, J.-B.; Tapiolas, D.; Willis, B. L.; Bourne, D. G. AppL Environ. Microb. 2009, 75

(11), 3492-3501.

119 Raina, J.-B.; Dinsdale, E. A.; Willis, B. L.; Bourne, D. G. Trends Microbiol. 2010, 18

(3), 101-108.

Bayer, T.; Neave, M. J.; Alsheikh-Hussain, A.; Aranda, M.; Yum, L. K.; Mincer, T.;

Hughen, K.; Apprill, A.; Voolstra, C. R. App!. Environ. Microb. 2013, 79 (15), 4759-

4762.

Guo, F.; Ju, F.; Cai, L.; Zhang, T. PLoS ONE 2013, 8 (10), e76185.

Rosenberg, E.; Koren, 0.; Reshef, L.; Efrony, R.; Zilber-Rosenberg, I. Nat. Rev. Micro.

2007, 5 (5), 355-362.

Gerwick, W. H.; Moore, B. S. Chem. Biol. 2012, 19 (1), 85-98.

Zhang, Y.; Ling, J.; Yang, Q.; Wen, C.; Yan, Q.; Sun, H.; Van Nostrand, J. D.; Shi, Z.;

Zhou, J.; Dong, J. Sci. Rep. 2015, 5, 16191.

Kelly, L. W.; Williams, G. J.; Barott, K. L.; Carlson, C. A.; Dinsdale, E. A.; Edwards, R.

A.; Haas, A. F.; Haynes, M.; Lim, Y. W.; McDole, T.; Nelson, C. E.; Sala, E.; Sandin, S.

A.; Smith, J. E.; Vermeij, M. J. A.; Youle, M.; Rohwer, F. P. Natl. Acad. Sci. USA 2014,

111 (28), 10227-10232.

Ainsworth, T. D.; Hoegh-Guldberg, 0. Aquat Biol 2009, 4 (3), 289-296.

Ainsworth, T. D.; Fine, M.; Blackall, L. L.; Hoegh-Guldberg, 0. App!. Environ. Microb.

2006, 72 (4), 3016-3020.

Yoch, D. C. App!. Environ. Microb. 2002, 68 (12), 5804-5815.

Neave, M. J.; Michell, C. T. Apprill, A.; Voolstra, C. R. Genome Announc. 2014, 2 (4), e00802.

Bourne, D. G.; Iida, Y.; Uthicke, S.; Smith-Keune, C. ISME J2007, 2 (4), 350-363.

Bourne, D. G.; Garren, M.; Work, T. M.; Rosenberg, E.; Smith, G. W.; Harvell, C. D.

120 Trends Microbiol. 2009, 17 (12), 554-562.

La Riviere, M.; Roumagnac, M.; Garrabou, J.; Bally, M. PLoS ONE 2013, 8 (2),e57385.

Park, S.; Yoshizawa, S.; Hamasaki, K.; Kogure, K.; Yokota, A. I Gen. App!. Microbiol.

2010, 56 (6), 475-480.

Sunagawa, S.; DeSantis, T. Z.; Piceno, Y. M.; Brodie, E. L.; DeSalvo, M. K.; Voolstra,

C. R.; Weil, E.; Andersen, G. L.; Medina, M. ISME J2009, 3 (5), 512-521.

Pike, R. E.; Haltli, B.; Kerr, R. G. Int. J. Syst. Evol. Microbiol. 2013, 63 (11), 4294-

4302.

Chen, W.-M.; Sheu, F.-S.; Sheu, S.-Y. Arch. Microbiol. 2012, 194 (2), 103-112.

121 Chapter 4: Culture-Dependent Investigation of the Bacterial Communities Associated with

Antillogorgia elisabethae

122 4.1 Introduction

Microorganisms are known to be abundant in the seawater surrounding corals and within the coral colony. Various culture-dependent and -independent techniques have been employed to investigate the microbial diversity associated with marine corals .1-5 However the use of culture- dependent techniques has declined over the last decade, as many microorganisms are

`uncultivatable,' or at least have resisted cultivation thus far. It has been suggested that less than

1% of environmental microorganisms can be recovered using standard plating conditions ,6;7 however recoveries ranging from 0.01% to 12.5% have been reported.8-1° With the advancement of next generation sequencing (NGS) technologies most research into the microbial communities associated with marine corals is being performed using culture-independent sequencing techniques."' While these techniques allow for a greater understanding of the microbial taxonomic diversity associated with corals, they do not provide any information about the microorganism's physiology or potential to produce secondary metabolites. Therefore the combination of both culture-dependent ahd -independent methodologies helps to avoid limitations associated with either technique and provides a more thorough understanding of the microorganisms associated with these marine invertebrates.

4.1.1 Rationale for the Methodology of the Culture-Dependent Study

Octocorals have been shown to be a viable source of taxonomically diverse bacteria,""'' however many of these can be difficult to cultivate. Therefore, in order to obtain the greatest cultivatable taxonomic diversity this study employed two different techniques. The first of which was to investigate the bacteria associated with various coral derived fractions. The rationale being that the holobiont hosts a great amount of bacterial diversity and if only the holobiont is

123 being investigated some of that diversity may be outnumbered and overlooked. By investigating

additional coral derived fractions that are subsets of the holobiont, such as the larvae and

dinoflagellates, slower growing or less abundant bacteria may be obtainable. The second

technique was to investigate microaerophilic and anaerobic conditions. Like other marine invertebrates, octocorals have variations in their redox potential generating hypoxic and anoxic areas.17-2° Any bacteria that thrive in those areas may not be cultivatable under aerobic conditions. Therefore, by cultivating bacteria from the holobiont under conditions that are conducive to microaerophilic and anaerobic bacteria, greater bacterial diversity may be obtained.'

A dilution-to-extinction method was used when plating the samples for bacterial cultivation. The rationale being that at the highest dilution series in which growth is still observed, some of the media wells will contain only one bacterial cell per plate. Therefore, any slow growing bacteria present will not be overgrown and live colonies will be obtainable. Additionally, two media types were used in this study, a high nutrient media targeting heterotrophic non-fastidious bacteria, as well as a low nutrient media targeting oligotrophic slow-growing bacteria.

4.1.2 Overall Objective of Study

The overall objective of this study was to isolate and identify a wide diversity of cultivatable bacteria from A. elisabethae. The bacterial isolates were taxonomically identified by sequencing of the 16S rRNA gene and compared to the culture-independent libraries in Chapter 3 to determine the amount of the microbiome recovered by these culture dependent techniques.

124 4.2 Materials and Methods

4.2.1 Collection of Bacteria from Holobiont, Dinoflagellate, and Larvae Fractions

Samples from five A. elisabethae colonies were collected by SUCBA off the coast of San

Salvador, The Bahamas in November 2011 during the coral's spawning season from two locations, Runway10 (24°03.816' N, 740 32.628' W; n=3) and Cable Crossing (24°03.090' N,

74°32.391' W; n=2). All samples were collected within a depth of 10 - 15 m into sterile Whirl-

PakTM bags (Nascoe) and at each collection site —1 L of surrounding seawater was collected into a sterile Nalgene® polypropylene bottle (Nalge Nunc International). The holobiont samples were washed three times with —40mL of sterile filtered seawater (SF SW) (0.2 pm polyethersulfone membrane, Nalgene Rapid FlowTM) in sterile Falcon® centrifuge tubes (50 ml polypropylene, Corning®) to remove loosely associated bacteria. For each sample the larvae were removed from the outer surface of the coral using a sterile scalpel and washed three times to remove any coral tissue, there were — 50-100 larvae from each sample. The algal dinoflagellates were obtained using a modified protocol to the one described by Mydlarz et al.22

A portion of the holobiont was homogenized using a homogenizer (VWR VDI 25 ULTRA-

TURRAX) in SFSW and filtered through sterile cheesecloth to remove any large coral debris.

The dinoflagellates were pelleted by centrifugation (250 x g, 5 min) and further purified using a

Percoll® gradient of 40% and 80%. The dinoflagellates were collected from the top of the 80%

Percoll® layer, the Percoll® gradient was repeated a minimum of six times until <1% impurities were visible under light microscopy. All samples were divided in half, half were used for the culture independent study (Chapter 3) and the other half was used for this study.

125 The holobiont samples were homogenized in SFSW and serial dilutions (10-2 to 10-5) were

prepared in SFSW. Serial dilutions (1 to 10-3) of the purified dinoflagellates and surrounding

seawater samples were prepared in SFSW. Aliquots (10µ1) of each serial dilution were plated

into 48-well plates onto the following media in triplicate: (1) Marine Agar (MA; 2216, BD

Difco), a high-nutrient medium for targeting heterotrophic non-fastidious bacteria, and (2) Dilute

(1/100) R2A Agar (dR2A; 218263, BD Difco), a low nutrient medium for targeting oligotrophic, slow-growing bacteria. Serial dilutions of the larvae were not made. Instead associated cultivatable bacteria were obtained by placing one larva into each well of the MA and dR2A 48- well plates. Plates were incubated at 21°C for up to four months, and any bacteria that were growing were purified as single colonies during that time. All isolated bacteria were grown in

Marine Broth (MB 2216, BD Difco) and preserved at -80°C in 25% (v/v) glycerol (VWR) until needed for further processing

4.2.2 Collection of Bacteria from A. elisabethae under Aerobic, Microaerophilic, and

Anaerobic Conditions

Samples from three A. elisabethae colonies were collected by SUCBA off the coast of San

Salvador, The Bahamas in March 2012 from Runway 10 (24°03.816' N, 74° 32.628' W; n=3) at a depth of —10 m. All samples were collected into sterile WhirlPakTM bags and at each collection site —1 L of surrounding seawater was collected into d sterile Nalgenee polypropylene bottle. The coral samples were washed three times with —40 mL of SFSW in sterile Falcone centrifuge tubes to remove loosely associated bacteria. The coral samples were homogenized and serial dilutions of the homogenate (10-2 to 10-5) and surrounding seawater (1 to 10) were prepared in SFSW. Aliquots (10 µI) of each serial dilution were plated onto 48-well plates of

126 either MA or dR2A. Each media type and serial dilution was placed in triplicate under either aerobic, microaerophilic, or anaerobic conditions. The microaerophilic and anaerobic conditions were achieved using BD GasPakTM Anaerobic Systems (BD Diagnostics). Plates were incubated at 21°C for up to four months and any bacteria that were growing were purified as single colonies during that time. All isolated bacteria were grown in MB and preserved at -80°C in 25% (v/v) glycerol until needed for further processing.

4.2.3 Dereplication of Microbes using MALDI-TOF MS

Bacteria were initially dereplicated based on their protein fingerprints using Matrix-Assisted

Laser Desorption/Ionization — Time of Flight Mass Spectrometry (MALDI-TOF MS) (Microflex

LT, Bruker Daltonics Mass Spectrometer, Leipzig, Germany). Bacterial cells were grown from frozen glycerol stock on MA for 48 ± 2 hours at 30°C, stamped onto a stainless steel target plate, and covered with 1.5µ1 of,matrix solution (0.5% (w/v) a-cyano-4-hydroxycinnamic acid in

50:48:2 acetonitrile:water:trifloroacetic acid solution).23 The protein profile of each bacterium was examined using MALDI-TOF MS equipped with a 50-Hz nitrogen laser. MS analysis was performed in linear, positive ionization mode (laser power 60%; up to 200 shots fired, mass range 2,000-12,000 m/z), and MALDI-TOF MS peak profiles were generated using FlexControl software (Bruker Daltonics). Cluster analysis of the spectra was performed by BioTyper Version

2.0 software package (Bruker Daltonics) using an Unweighted Paired Group Method with

Arithmetic mean (UPGMA), as this method has been shown to be suitable at grouping bacterial isolates at the species leve1.24 The Escherichia coli strain DH15H was used as a control strain in triplicate on each target plate. The distance at which the E. coli DH15H spectra clustered was used as a cut-off in the constructed dendrogram. Bacteria that clustered at a distance greater than

127 the cut-off were deemed different species of bacteria and were taxonomically identified by

sequencing of their 16S rRNA genes.

4.2.4 Genomic DNA extraction and PCR Amplification

MALDI-TOF MS dereplicated bacteria were grown in MB (48 hours, 250 rpm, 30°C). Bacterial cultures were pelleted, the media supernatant discarded, and resuspended in 300 uL of 50/20 TE buffer (50mM Tris-HC1, 20mM EDTA, pH 8.0) supplemented with lysozyme (5mg/m1; Sigma-

Aldrich) for 30 min at 37°C. After which 50 uL of 10% SDS (w/v; EMD Millipore) was added followed by 85 uL of 5 M NaC1 (VWR International). The lysate was extracted with an equal volume of phenol: chloroform solution (1:1, v/v, Fisher Scientific), vortexed for 30 s, then centrifuged for 10 min at 8,000 rpm on a desktop centrifuge (Sorvall Biofuge pico). The aqueous layer was retained and transferred to a fresh tube where the DNA was precipitated by adding 0.5 ml of isopropanol (Sigma-Aldrich). The DNA was pelleted by centrifugation and washed with cold 70% ethanol (Commercial Alcohols), allowed to dry, then re-suspended in deionized water.

Polymerase chain reaction (PCR) amplification of thel6S rRNA gene was achieved using the universal eubacteria 16S rRNA gene primers pA (5'-AGAGTTTGATCCTGGCTCAG-3') and pH (5'-AAGGAGGTGATCCAGCC-3')25 with the following conditions: lx concentration

EconoTage Plus Green 2X Master Mix (Lucigen), 5% DMSO (v/v; Sigma Aldrich), 1 uM of each primer, 20 ng of template DNA. Thermal cycling parameters were as follows: an initial denaturing cycle at 95°C for 3 min, followed by 35 cycles of 95°C for 45 s, 54°C for 1 min, 72°C for 1.5 min, and a final extension of 72°C for 10 min. PCR amplicons were assessed by gel electrophoreses in a 1.0% agarose gel (Fisher Scientific) containing 0.001% ethidium bromide

128 (Sigma Aldrich), at 120V for 30 min (BioRad, Mississauga, ON). PCR products were visualized on a UV transilluminator (BioSpectrume, OptiChemi HR Camera, Upland, CA) and amplicons of the correct size (-1500 bp) were sent for sequencing.

4.2.5 Sequencing and Phylogenetic Analysis

Sequencing was performed by Eurofins MWG Operon (Huntsville, AL, USA), using the 936R primer (5'-GGGGTTATGCCTGAGCAGTTTG-3')26. Sequences were trimmed and assembled using Vector NTI Express (Invitrogen, Life Technologies), and compared to available sequences 27 in the GenBanIc database. Sequence alignments were prepared using MEGA version 6.28

Phylogenetic histories were inferred using the neighbor-joining (NJ) method.29 Evolutionary distance matrices were generated using the Jukes-Cantor method3° and are in units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated.

Bootstrap analysis is based on 1000 resampled datasets.31

4.2.6 Comparison of Culture-Dependent Library to Culture-Independent Library

The 16S rRNA gene sequence data from the culture-dependent libraries was compared to the

454-pyrosequencing culture-independent libraries (Chapter 3) in order to determine the overlap between the two library types. A Local BLAST (NCBI, Bethesda, MD) nucleotide database27 containing representative sequences of each operational taxonomic unit (OTU, D=0.03) was created in BioEdit version 7.2.5. Cultured sequences were search against this local database using the Matrix BLOSUM62 with an Exception value of 1E-100. Cultures with sequence similarity? 99% to sequences in the database were considered 'hits.'

129 4.3 Results and Discussion

4.3.1 Cultivatable Bacteria from A. elisabethae Holobiont, Dinoflagellates, and Larvae

Samples from five of A. elisabethae colonies were collected off the coast of San Salvador, The

Bahamas in November 2011 during the coral's spawning season at two reef locations. Each A. elisabethae specimen was divided into three fractions: the holobiont (H1-H5), larvae (L1-L5), and dinoflagellate (D1-D5) fractions. For each collected coral, a surrounding seawater sample was collected adjacent to the coral colony (W1-W5). Serial dilutions were plated onto 48 well plates of MA and dR2A and all bacteria that grew on those plates over a four month period were isolated resulting in 921 bacterial isolates. Following dereplication using MALDI-TOF MS, with an E. coli strain as an internal s.tandard, there were 273 unique bacterial 'strains'. The 16S rRNA gene of these bacteria was sequenced and they were further dereplicated using 99% sequence similarity as a cut off for unique species,32'33 this resulted in 89 unique bacterial species. Since only 35.2% of the MALDI-TOF MS unique bacterial 'strains' were determined to be unique species based on their 16S rRNA gene sequence, the cut-off for the MALDI-TOF MS dereplication may have been to6 stringent. The cut-off for dereplication varied per analysis and was based on the distance level at which the E. coli control clustered at within the constructed dendrograms. However previous research has shown that the discriminatory power with which

MALDI-TOF MS can differentiate bacteria can vary between genera.24 In some genera it is capable of discriminating to the subspecies or strain level, while in others it can only discriminate to the species level. Since only the species level was required for this research

MALDI-TOF MS proved to be an adequate dereplication tool.

130 The 89 sequences were taxonomically identified based on BLAST analysis27 and the taxonomic

identifications were applied to the original 921 bacterial isolates. The bacteria were grouped into

libraries based on the sample type they originated from. Any overlap between the seawater

library and the coral derived libraries was removed from the latter. The majority of the bacteria isolated regardless of sample origin belonged to the class Gammaproteobacteria, ranging from

44.3% (Seawater) to 63.7% (Larvae) of the total bacteria isolated from each sample type (Figure

4.1). At the genus level most cultivatable bacteria were Vibrio spp., ranging from 15.3%

(Holobiont) to 49.3% (Larvae) of the total culture libraries (Figure 4.2). Other abundant genera from these libraries that were easily cultivated were Pseudoalteromonas spp. (3.8% to 26.7%),

Bacillus spp. (3.1% to 6.0%), and Alteromonas spp. (1.1% to 10.4%). As for the seawater samples, bacteria belonging to the genera Halomonas spp. (9.7%), Pseudoalteromonas spp.

(8.3%), and Psychrobacter spp. (7.8%) were the most cultivatable. The dominant genera in all libraries were fast growing heterotrophic bacteria that easily grow on nutrient rich media, and are therefore commonly found in coral and seawater culture dependent libraries.4'5'34-37

The greatest taxonomic diversity was obtained from the holobiont samples, which after removing sequences that overlapped with the seawater library had 41 different bacterial species (Table

4.1). Thirty of these were 'unique' to the holobiont samples, meaning they were not obtained from any other isolation source. While the holobiont proved to be a valuable source of taxonomic diversity, investigation of the larvae and dinoflagellates also provided unique bacterial species. There were an additional 12 species obtained from the other coral derived fractions that would have not been obtained had only the holobiont been investigated. The

131 seawater samples also proved to be a great source of cultivatable bacteria, providing 19 'unique' species.

132 Table 4.1. Number of different and unique bacterial species present in culture-dependent libraries.

Sample Origin # Different Species # Unique Species Holobiont 41 30 Larvae 20 4 Dinoflagellates 26 8 Seawater 25 19

133 Seawater

Dinoflagellates

Larvae

Holobiont

0% 20% 40% 60% 80% 100% Actinobacteria • Alphaproteobacteria • Bacilli Cytophagia • Deltaproteobacteria • Gammaproteobacteria

Figure 4.1. Class level bacterial composition of culture-dependent libraries. Sequences were classified based on BLAST analysis.

134

Seawater

Dinoflagellates

Larvae

Holobiont

0% 10% 20% 30% 40% 50% 60% 70% • 80% 90% 100%

Acinetobacter spp. Agrococcus spp. Alteromonas spp. Bacillus spp. Bermanella spp. Citreicella spp. Citricoccus spp. Cobetia spp. Cronobacter spp. Dietzia spp. Enterobacter spp. Erythrobacter spp. Ficitibacillus spp. Fulvivirga spp. Geodermatophilus spp. Halomonas spp. Kocuria spp. Kytococcus spp. Marinomonas spp. Microbacterium sp. Micrococcus spp. Nocardioides spp. Oceanobacillus spp. Omithinimicrobium spp. Paenibacillus spp. Pantoea spp. Paracoccus spp. Photobacterium spp. Planococcus spp. Porphyrobacter spp. Pseudoalteromonas spp. Pseudobacteriovorx sp. Pseudomonas spp. Pseudovibrio spp. u Psychrobacter spp. Rhizobium spp. Rhodococcus spp. Ruegeria spp. Saccharospirillaceae spp. Sagittula spp. Sphingomonas spp. Staphylococcus spp. Streptomyces spp. Sulfitobacter spp. Vibrio spp.

Figure 4.2. Genus level bacterial composition of culture-dependent libraries. Sequences were classified based on BLAST analysis.

135 4.3.2 Comparison of Cultured-Dependent and -Independent Bacterial Communities

The cultured bacterial sequences were compared to the sequences from the culture-independent

study (Table 4.2) (Chapter 3). Cultured sequences with? 99% sequence similarity to sequences

in the culture-independent libraries were considered 'hits.' All but 21 of the cultured sequences

were present in the culture-independent libraries. For both the culture-dependent and -

independent data any overlap between the seawater library and the coral derived libraries was

removed from the latter. A total of 3.9% of the holobiont culture independent library was

recovered through cultivation (Table 4.3). The recovery rate was even higher in the larvae and

dinoflagellate libraries, which were 7.5% and 10.0%, respectively. Between the higher recovery

rates and the 12 unique isolates, investigation of the cultivatable bacteria from these coral

derived subsets have thus proven valuable. The highest recovery was obtained from the seawater samples, from which 12.2% of the culture independent library was obtained. While these recovery rates are notable they are still only a small percentage of the actual microbial diversity of these samples. Therefore to truly understand the microbial communities associated with A. elisabethae both culture-dependent and -independent libraries are required.

136 Table 4.2. Cultured bacterial isolates and the culture-dependent and -independent libraries in which they were detected. Bacterial isolates were detected in the culture- dependent libraries either through 16S rRNA gene sequence similarity (> 99%), or MALDI-TOF

MS protein fingerprint similarity. Bacterial isolates were detected in the culture-independent libraries based on local BLAST analysis (299%).

Culture Dependant Culture Independent Library Library H L D L D Acinetobacter sp. Riam 528 Acinetobacter sp. RKEM 532 Acinetobacter sp. RKEM 817 Agrococcus sp. RKEM 917 Alteromonas sp. RKEM 316 Alteromonas sp. RKEM 369 Alteromonas sp. RKEM 717 Alteromonas sp. RKEM 765 Arthrobacter sp. RKEM 332 Bacillus sp. RKEM 266 X Bacillus sp. RKEM 441 Bacillus sp. RKEM 444 Bacillus sp. RKEM 5I3C X Bacillus sp. RKEM 632 Bacillus sp. RKEM 667 Bacillus sp. RKEM 720 Bacillus sp. RKEM 730 Bacillus sp. RKEM 731 X Bacillus sp. RKEM 755 Bacillus sp. RKEM 781B Bacillus sp. RKEM 829B X Bermanella sp. RKEM 777 X Citreicella sp. RKEM 868 Citricoccus sp. RKEM 914 Cobetia sp. RKEM 646 Cronobacter sp. RKEM 537A Cronobacter sp. RKEM 548 X Dietzia sp. RKEM 832 Erythrobacter sp. RKEM 642 Erythrobacter sp. RKEM 937 X X Erythrobacter sp. RKEM 947 X Fictibacillus sp. RKEM 566 X

137 Fulvivirga sp. RKEM 712 Geodermatophilus sp. RKEM 688 X Halomonas sp. RKEM 883 X X X Halomonas sp. RKEM 901 X X X Kocuria sp. RKEM 639 X X X Kytococcus sp. RKEM 512A Marinomonas sp. RKEM 313 Marinomonas sp. RKEM 715 Marinomonas sp. RKEM 924 Microbacterium sp. RKEM 922 Microcogcus sp. RKEM 702 Nocardioides sp. RKEM 944 Oceanobacillus sp. RKEM 81.4 Ornithinimicrobium sp. RKEM 638 Paenibacillus sp. RKEM 768 X Pantoea sp. RKEM 516 Pantoea sp. RKEM 552 Pantoea sp. RKEM 701 Paracoccus sp. RKEM 656 X Paracoccus sp. RKEM 942 Paracoccus sp. RKEM 943 Paracoccus sp. RKEM 946 Planococcus sp. RKEM 918 Porphyrobacter sp. RKEM 933 Pseudoalteromonas sp. RKEM 243 Pseudoalteromonas sp. RKEM 647 Pseudoalteromonas sp. RKEM 660 Pseudoalteromonas sp. RKEM 732 Pseudoalteromonas .sp. RKEM 857 Pseudobacteriovorax antillogorgiicola X RKEM 611 Pseudomonas sp. RKEM 545 Pseudomonas sp. RKEM 824A Pseudomonas sp. RKEM 891 X Pseudovibrio sp. RKEM 536 Psychrobacter sp. RKEM 535 Psychrobacter sp. RKEM 670 Psychrobacter sp. RKEM 879 Psychrobacter sp. RKEM 927 Rhizobium sp. RKEM 870 Rhodococcus sp. RKEM 42 X Rhodococcus sp. RKEM 450 X Rhodococcus sp. RKEM 843

138 Ruegeria sp. RKEM 265 Saccharospirillum sp. RKEM 770 Sagittula sp. RKEM 724B Sphingomonas sp. RKEM 364 Staphylococcus sp. MUM 613 Streptomyces sp. RKEM 774 Sulfitobacter sp. RKEM 910 X Vibrio sp. RKEM 201 Vibrio sp. RKEM 309 Vibrio sp. RKEM 328 Vibrio sp. RKEM 48 Vibrio sp. RKEM 501 Vibrio sp. RKEM 562 Vibrio sp. RKEM 601 Vibrio sp. RKEM 69 Abbreviations — H: holobiont; L: larvae; D. dinoflagellate; W: seawater

139 Table 4.3, Recoverability of culture-independent libraries.

Cultured 16S rRNA gene sequences were detected in the culture-independent libraries based on local BLAST analysis (>99%).

Sample Overlap between libraries (%) Holobiont 3.9 Larvae 7.5 Dinoflagellate 10.0 Seawater 12.2 Average 8.4

140 4.3.3 Cultivatable bacteria from A. elisabethae under Aerobic, Microaerophilic, and

Anaerobic Conditions

Samples from three A. elisabethae colonies were Collected off the coast of San Salvador, The

Bahamas in March 2012. For each sample collected, a surrounding seawater sample was collected adjacent to the coral colony. The coral was homogenized and serial dilutions of the coral and seawater were plated onto 48 well plates of MA and dR2A. The plates were placed under aerobic, microaerophilic, or anaerobic conditions. All bacteria that grew on those plates over a four-month period were isolated, resulting in 736 bacterial isolates. Using MALDI-TOF

MS it was determine that there were 20 isolates that had the same protein fingerprint as 'strains' from the previous collection (Section 4.3.1) (Table 4.4), and 103 'strains' that were not detected in the previous collection. The 16S rRNA gene sequence of the new 103 isolates were sequenced and further dereplicated using 99% sequence similarity as a cut off for unique species.32,33 This resulted in 54 unique bacterial species that had not been obtained in the previous collection.

These 54 sequences as well as and the 20 sequences from the previous study were taxonomically identified based on BLAST analysis27 and the taxonomic identifications were applied to the, original 736 bacterial isolates. Any overlap between isolates cultured from the seawater samples and the holobiont samples were removed from the library of the latter.

Not surprisingly, the greatest diversity was observed under aerobic conditions and decreased with decreasing oxygen concentration. The aerobic holobiont and seawater libraries were dominated by Gammaproteobacteria, as was observed in the previous collection (4.3.1) (Figure

4.3). At the genus level, the holobiont microaerophilic library was dominated by Shewanella spp. (33.3%), a genus that was not obtained in the previous collection. The holobiont anaerobic

141 library only contained Nocardioides spp. (60.0%) and Rhizobium spp. (40.0%) (Figure 4.4). The seawater microaerophilic library was dominated by Microbacterium spp. (30.4%) and Bacillus spp. (26.1%), while the anaerobic library only contained Nocardioides spp. (17.6%), Rhizobium spp. (20.5%), Aeromicrobium spp. (14.7%), and Photobacterium spp. (47.1%). These results-are consistent with previous research investigating cultivatable bacteria from marine invertebrates and surrounding seawater under microaerophilic and anaerobic conditions.18'20'38

Microaerophilic conditions proved to be a very viable source of unique bacteria from the holobiont samples. There were 18 different bacteria that grew under microaerophilic conditions and 16 of them were unique (Table 4.5). Anaerobic conditions were not as successful; only four different species grew under these conditions, none of which were unique. As for the seawater samples, microaerophilic and anaerobic only generated one and two unique sequences, respectively.

142 Anaerobic s.4.) Mircoaerophilic

CD Aerobic

Anaerobic

Mircoaerophilic

Aerobic

0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%

Actinobacteria • Alphaproteobacteria • Bacilli • Gammaproteobacteria

Figure 4.3. Class level bacterial composition of aerophilic, microaerophilic, and anaerobic culture-dependent libraries. Sequences were classified based on BLAST analysis.

143

Anaerobic

Mircoaerophilic

Aerobic

Anaerobic

..o Mircoaerophilic

Aerobic

0% 10% 20% 30% 40% 50% 60% 70% 80% 90% 100%

Aeromicrobium spp. Agrococcus spp. Angustibacter spp. Arthrobacter spp. Aurantimonas spp. Bacillus spp. Brachybacterium spp. Cellulomonas spp. Cellulosimicrobium spp. Citreicella spp. Citricoccus spp. Curtobacterium spp. Enterobacter spp. Erythrobacter spp. Halobacillus spp. Halomonas spp. Janibacter spp. Kocuria spp. Marinomonas spp. Marmoricola spp. Microbacterium spp. Micrococcus spp. Nocardioides spp. Paenibacillus spp. Paracoccus spp. Photobacterium spp. Pseudoalteromonas spp. Pseudomonas spp. Psychrobacter spp. Rhizobium spp. Rhodobacter spp. Rhodococcus spp. Shewanella spp. Terribacillus spp. Vibrio spp.

Figure 4.4. Genus level bacterial composition of aerophilic, microaerophilic, and anaerobic culture-dependent libraries. Sequences were classified based on BLAST analysis.

144 Table 4.4. Cultured isolates from aerobic, microaerophilic, and anaerobic conditions, and the culture-dependent and -independent libraries in which they were detected. Bacterial isolates were detected in the culture-dependent libraries either through 16S rRNA gene sequence similarity (>99%), or MALDI-TOF MS protein fingerprint similarity. Bacterial isolates were detected in the culture-independent libraries based local BLAST analysis (> 97%).

Culture Dependent . Culture Independent Holobiont Seawater H L D w AR MA AN AR MA AN

Aeromicrobium sp. RKEM 1713 X X X X X X X X Agrococcus sp. RKEM 1635 X X X Agrococcus sp. RKEM J685 X X X Agrococcus sp. RKEM 917* X X _Angustibacter sp. RKEM 1664 X

Arthrobacter sp. RKEM 1571 • X X X Arthrobacter sp. RKEM 1637 X X X X X Aurantimonas sp. RKEM 1543 X

Bacillus sp. RKEM 731* X X Bacillus sp. RKEM 1569 X X X X X X Bacillus sp. RKEM 755* X X

Bacillus sp. RKEM 1771 X X X X Bacillus sp. RKEM 829B* X X X X X X X Brachybacterium sp. RKEM 1576 X X Cellulomonas sp. RKEM 1775 X X X Cellulosimicrobium sp. RKEM 1754 X X X Citreicella sp. RKEM 868* X X X X . . X Citricoccus sp. RKEM 914* X X X X X , Curtobacterium sp. RKEM 1515 X X X Curtobacterium sp. RKEM 1741 X X X X X Enterobacter sp. RKEM 1504 X X X X Dythrobacter sp. RKEM 1590 X X X Dythrobacter sp. RKEM 937* X X X X- X _ .. Halobacillus sp. RKEM 1822 X X _ Halomonas sp. RKEM 901* X X X X X Janibacter sp. RKEM 1825 X X Kocuria sp. RKEM 1608 X X X X X MarinOmonas sp. RKEM 715* X X X X Marmorico/a sp. RKEM 1784 X X X X _ Microbacterium sp. RKEM 1514 X X Microbacterium sp. RKEM 1559 X X

145 Microbacterium sp. RKEM 1560 Microbacterium sp. RKEM 1591 X Microbacterium sp. RKEM 1651 Microbacterium sp. RKEM 1661 Microbacterium sp. RKEM 1691 Microbacterium sp. RKEM 1778 Microbacterium sp. RKEM 1786 Microbacterium sp. RKEM 1814 Microbacterium sp. RKEM 1815 Microbacterium sp. RKEM 922* Microbacterium sp. RKEM 1562 Micrococcus sp. RKEM 702* Nocardioides sp. RKEM 1595 Nocardioides sp. RKEM 1695 Nocardioides sp. RKEM 1698 Nocardioides sp. RKEM 1712 Nocardioides sp. RKEM 1764 Nocardioides sp. RKEM 1781 Nocardioides sp. RKEM 944* X Paenibacillus sp. RKEM 1589 X Paracoccus sp. RKEM 1551 X Paracoccus sp. RKEM 1671 X Paracoccus sp. RKEM 1682 X Paracoccus sp. RKEM 942* Paracoccus sp. RKEM 943* Paracoccus sp. RKEM 946* Photobacterium sp. RKEM 1507 Pseudoalteromonas sp. RKEM 243* Pseudoalteromonas sp. RKEM 647* X Pseudoalteromonas sp. RKEM 660* Pseudoalteromonas sp. RKEM 857* X Pseudomonas sp. RKEM 1577 Psychrobacter sp. RKEM 1523 Psychrobacter sp. RKEM 670* X Psychrobacter sp. RKEM 927* X Psychrobacter sp. RKEM 1796 X Rhizobium sp. RKEM 1529 Rhizobium sp. RKEM 1707 X Rhodobacter sp. RKEM 1557 Rhodococcus sp. RKEM 1538 Shewanella sp. RKEM 1626 X Shewanella sp. RKEM 1631 X Streptomycetes sp. RKEM 1715 X

Terribacillus sp. RKEM 1564 X X

146 Vibrio sp. RKEM 562* X Vibrio sp. RKEM 601* X *Bacteria first isolated in previous culture collection Abbreviations — AR: aerobic; MA: microaerophilic; AN: anaerobic; H: holobiont; L: larvae; D: dinoflagellate; W: seawater

147 Table 4.5. Number of different and unique species present in aerobic, microaerophilic, and anaerobic libraries.

Sample Origin # Different Species # Unique Species Holobiont-Aerobic 23 20 Holobiont-Microaerophilic 18 16 Holobiont-Anaerobic 4 0 Seawater-Aerobic 26 13 Seawater-Microaerophilic 10 1 Seawater-Anaerobic 6 2

148 4.3.4 Overall Culture-Dependent Bacterial Library

A total of 143 different species of bacteria were obtained once all culture dependent libraries were combined. They spanned six classes: Gammaproteobacteria (Figures 4.5, 4.6, and 4.8),

Alphaproteobacteria (Figures 4.8 and 4.9), Deltaproteobacteria (Chapter 5), Actinobacteria

(Figures 4.10, 4.11, and 4.12), Bacilli (Figures 4.13 and 4.14) and Cytophagia (Figure 4.15).

The majority of these bacteria had been previously characterized, meaning the isolates had >97%

16S rRNA gene sequence similarity to previously characterized bacterial type species (Table

,4.6).32 However there were four bacteria with < 97% sequence similarity to characterized bacteria and were putatively novel. Three of which, Angustibacter sp. RKEM 1664 (Figure

4.12), Rhizobium sp. RKEM 1529 (Figure 4.9), and Saccharospirillum sp. RKEM 770 (Figure

4.5) formed distinct clades with type strains from their respective genera and therefore could only be novel at the species level. The other, Paracoccus sp. RKEM 946 (Figure 4.8), may be a novel genus and not actually belong to Paracoccus. The RKEM 946 sequence did not cluster with Paracoccus sp. type strains, but remained within the clade of the family Rhodobacteraceae, suggesting that RKEM 946 may belong to a novel genus within the family Rhodobacteraceae.

The isolate Pseudobacteriovorax antillogorgiicola RKEM 611 was determined to belong to a novel family of bacteria, whose formal taxonomic description is detailed in Chapter 5.

149 Table 4.6. Taxonomic classification of culture-dependent library. Sequences were classified based on BLAST analysis. Sequences with <97% identity are highlighted in yellow and < 90% identity are highlighted in red.

Seq. Accession Accession Query Strain Class Length Closest Blast Hit ID Number Number Cover (bp)

Streptomyces sp. Streptomyces KU198832 Actino 838 RKEM_1715 parvulus NR_041119.2 99 99 NBRC 13193

Streptomyces sp. Streptomyces albus KU198759 Actino 843 NR 102949.1 100 99 RKEM_774 J1074

Dietzia sp. Dietzia cinnamea KU198781 Actino 819 NR_042390.1 100 99 RKEM_832 IMMIB

Rhodococcus Rhodococcus sp. KU198776 Actino 820 corynebacterioides NR_119107.1 100 99 RKEM_1538 DSM 20151

Rhodococcus sp. Rhodococcus ruber KU198794 Actino 661 NR_118602.1 100 100 RKEM_42 DSM 43338

Rhodococcus Rhodococcus sp. KU198737 Actino 841 colynebacterioides RKEM_450 NR_119107.1 99 99 DSM 20151

Rhodococcus Rhodococcus sp. KU198844 Actino 819 fascians NR_037021.1 100 100 RKEM_843 CF17 Geodermatophilus Geodermatophilus sp. KU198754 Actino 849 brasiliensis NR_126197.1 RKEM_688 99 99 Tu6233 Angustibacter Angustibacter sp. KU321277 Actino 1421 aerolatus NR_109610.1 RKEM_1664 97 95 7402J-48 Cellulomonas Cellulomonas sp. KU198768 Actino 841 pakistanensis NR_125452.1 97 99 RKEM_1775 NCCP-11 Brachybacterium Brachybacterium sp. KU198817 Actino 825 conglomeratum NR_104689.1 100 99 RKEM_1576 J1015 Kytococcus Kytococcus sp. KU198778 Actino 844 sedentarius NR_074714.1 100 99 RKEM_512A DSM 20547

150

Janibacter sp. Janibacter melonis KU198841 Actino 828 NR 025805.1 100 RICEM_1825 CM2104 99

Ornithinimicrobium Ornithinimicrobium* KU321282 Actino 1500 kibberense NR_043056.1 99 sp. RICEM_638 99 K22-20.

Agrococcus sp. Agrococcus terreus KU198774 Actino 833 NR_116650.1 100 RKEM_1635 DNG5 16S 99

Agrococcus Agrococcus sp. KU198777 Actino 838 jejuensis NR_042551.1 96 RICEM_1685 100 SSW1-48

Agrococcus sp. Agrococcus baldri KU198788 Actino 798 NR 041543.1 . 100 99 RICEM_917 IAM 15147

Curtobacterium Curtobacterium sp. KU198764 Actino 825 luteum NR_026157.1 100 99 RKEM_1515 DSM 20542

Curtobacterium Curtobacterium sp. KU198833 Actino 825 oceanosedimentum NR_104839.1 100 99 RKEM_1741 ATCC 31317

Microbacterium Microbacterium sp. KU198766 Actino 814 testaceum NR_074641.1 100 99 RKEM_1514 StLB037

Microbacterium Microbacterium sp. Kul 98813 Actino 829 yannicii NR_117001.1 100 99 RKEM_1559 G72

Microbacterium Microbacterium sp. KU198814 Actino 815 hatanonis NR_041529.1 100 98 RICEM_1560 FCC-01

Microbacterium Microbacterium sp. KU198815 Actino 796 maritypicum NR_114986.1 100 99 RKEM_I 562 DSM 12512

Microbacterium Microbacterium sp. KU198820 Actino 817 foliorum NR_025368.1 100 99 RKEM_1591 P 333/02

Microbacterium Microbacterium sp. KU198775 Actino 831 arthrosphaerae NR_117046.1 98 100 RKEM_1651 CC-VM-Y

Microbacterium Microbacterium sp. KU198824 Actino 815 flavescens NR_029350.1 100 99 RKEM_1661 401 •

Microbacterium Microbacterium sp. KU198773 Actino 816 flavescens NR_029350.1 100 98 RKEM_1691 401

151 Microbacterium Microbacterium sp. KU198780 Actino 813 testaceum NR_074641.1 100 99 RKEM_1778 StLB037

Microbacterium Microbacterium sp. KU198837 Actino 833 yannicii NR 117001.1 100 98 RKEM_1786 G72

Microbacterium Microbacterium sp. KU198839 Actino 772 testaceum NR_074641.1 100 99 RKEM_1814 StLB037

Microbacterium Microbacterium sp. KU] 98770 Actino 830 testaceum NR_074641.1 100 99 RKEM_1815 StLB037

Microbacterium Microbacterium sp. KU198765 Actino 832 oleivorans NR_042262.1 100 99 RKEM_922 BAS69

Arthrobacter Arthrobacter sp. KU198816 Actino 774 phenanthrenivorans NR_074770.1 99 99 RKEM_1571 Sphe3

Arthrobacter Arthrobacter sp. KU198823 Actino 806 ureafaciens NR_029281.1 100 98 RKEM_1637 NC

Arthrobacter Arthrobacter sp. KU198827 Actino 775 ureafaciens NR_029281.1 99 99 RKEM_1692 NC

Arthrobacter Arthrobacter sp. KU321279 Actino 1306 hum icola NR_041546.1 99 94 RKEM_332 KV-653

Citricoccus Citricoccus sp. KU198786 Actino 844 alkalitolerans NR_025771 .1 100 99 RKEM_914 YIM 70010

Kocuria sp. Kocuria sediminis KU198821 Actino 845 NR_118222.1 100 98 RKEM_1608 FCS-11

Kocuria sp. • Kocuria palustris KU198796 Actino 800 NR_026451.1 100 100 RKEM_639 TAGA27

Micrococcus Micrococcus sp. KU198741 Actino 841 aloeverae NR_134088.1 100 100 RKEM_702 AE-6

Cellulosimicrobium Cellulosimicrobium KU198779 Actino 823 terreum NR_044070.1 100 98 sp. RKEM_1754 DS-61

Aeromicrobium A eromicrobium sp. KU198831 Actino 640 tam lense NR_043791.1 100 99 RKEM_1713 SSW1-57

152 Marmoricola Marmoricola sp. KU198836 Actino 838 korecus NR_116963.1 RKEM_1784 100 97 Sco-A36 Nocardioides Nocardioides sp. KU198828 Actino 728 ganghwensis NR_025776.1 100 RKEM_1695 97 JC2055 Nocardioides Nocardioides sp. KU198829 Actino 803 ganghwensis NR_025776.1 100 RKEKL1698 98 JC2055 Nocardioides Nocardioides sp. KU198830 Actino 836 terrigena NR_044185.1 99 97 RKEM_1712 DS-17

Nocardioides sp. Nocardioides soli KU198834 Actino 813 NR_133797.1 100 99 RKEM_1764 mbc-2

Nocardioides Nocardioides sp. KU198835 Actino 820 aestuarii NR_025777.1 100 99 RKEM_1781 JC2056 Nocardioides Nocardioides sp. KU198791 Actino 821 salarius NR_044419.1 100 99 RKEM_944 J112 Erythrobacter Erythrobacter sp. KU198819 Alpha 736 gaetbuli NR_025818.1 100 98 RKEM_1590 SW-161 Erythrobacter Erythrobacter sp. KU321283 Alpha 1416 westpacificensis NR_132719.1 100 97 RKEM_642 JL2008 Erythrobacter Erythrobacter sp. KU198790 Alpha 740 citreus NR_028741.1 99 99 RKEM_937 RE35F/1 Erythrobacter Erythrobacter sp. KU198793 Alpha 740 vulgaris NR_043136.1 98 100 RKEM_947 022 2-10 Aureimonas Aureimonas sp. KU198811 Alpha 589 altamirensis NR_043764.1 100 99 RKEM_1543 S21B

Rhizobium Rhizobium sp. KU321275 Alpha 1033 cellulosilyticum NR_043985.1 90 96 RKEM_1529 ALA10B2 Rhizobium Rhizobium sp. KU321278 Alpha 1399 cellulosilyticum NR_043985.1 100 98 RKEM_1707 ALA10B2 Rhizobium Rhizobium sp. KU198846 Alpha 589 skierniewicense NR_118035.1 100 99 RKEM_870 Ch 1 1

153 Citreicella sp. Citreicella marina KU198782 Alpha 794 NR_116507.1 100 99 RKEM_868 CK-13-6

Paracoccus sp. Paracoccus caeni KU198769 Alpha 639 NR_108571.1 100 99 RKEM_1551 MJ17

Paracoccus Paracoccus sp. KU198825 Alpha 757 aminovorans NBRC NR_113864.1 100 RKEM_1671 98 16711 Paracoccus Paracoccus sp. KU198826 Alpha 789 chinensis NR_114276.1 99 99 RKEM_1682 NBRC 104937 Paracoccus Paracoccus sp. KU198758 Alpha 619 zeaxanthinifaciens NR_025218.1 100 100 RKEM_656 ATCC 21588

Paracoccus Paracoccus sp. KU198851 Alpha 796 homiensis NR 043733.1 100 98 RKEM_942 DD-R11

Paracoccus Paracoccus sp. KU198852 Alpha 571 stylophorae NR_117275.1 100 100 RKEM_943 KTW-16 Paracoccus Paracoccus sp. KU198731 Alpha 987 siganidrum NR_118463.1 100 96 RKEM_946 M26 Pseudovibrio Pseudovibrio sp. KU321281 Alpha 1458 denitrificans NR_029112.1 97 100 RKEM_536 DN34 Rhodobacter Rhodobacter sp. KU198812 Alpha 790 sphaero ides NR_029215.1 100 RKEM_1557 98 2.4.1

Ruegeria sp. Ruegeria pelagia KU198725 Alpha 755 NR_116522.1 100 100 RKEM_265 NBRC 102038

Sagittula sp. Sagittula marina KU198756 Alpha 731 NR_109096.1 99 98 RKEM_724B F028-2

Sulfitobacter Sulfitobacter sp. KU198849 Alpha 789 delicatus NR_025692.1 100 97 RKEM_910 KMM 3584 Porphyrobacter Dythrobacter sp. KU198783 Alpha 740 sanguineus NR_036841.1 100 97 RKEM_933 A91 Sphingomonas Sphingomonas sp. KU198801 Alpha 557 parapaucimobilis NR_113729.1 100 100 RKEM_364 NBRC 15100

154 Bacillus sp. Bacillus anthracis KU198771 Bacilli 850 NR_074453.1 100 99 RKEM_1569 Ames

Bacillus Bacillus sp. KU198804 Bacilli 611 hwajinpoensis NR_025264.1 100 100 RKEM_1771 SW-72

Bacillus Bacillus sp. KU198732 Bacilli 866 carboniphilus NR_024690.1 98 98 RKEM_266 JCM9731

Bacillus sp. Bacillus idriensis KU198736 Bacilli 869 NR_ 043268.1 97 99 RKEM_441 SMC 4352-2

Bacillus sp. Bacillus tianshenii KU198724 Bacilli 873 NR 133704.1 100 99 RKEM_444 YIM M13235

Bacillus sp. Bacillus circulans KU198802 Bacilli 780 NR_ 112632.1 100 99 RKEM_513C NBRC 13626

Bacillus sp. Bacillus simplex KU198792 Bacilli 788 NR_114919.1 100 99 RKEM_632 LMG 11160

Bacillus sp. Bacillus aryabhattai KU198760 Bacilli 882 NR 115953.1 100 99 RKEM_667 B8W22

Bacillus Bacillus sp. KU198755 Bacilli 850 endophyticus NR_025122.1 100 99 RKEM_720 2DT

Bacillus sp. Bacillus pumilus KU198750 Bacilli 880 NR_074977.1 100 99 RKEM _730 SAFR-032

Bacillus sp. Bacillus niabensis KU198789 Bacilli 855 NR_043334.1 100 98 RKEM_731 4T19

Bacillus sp. Bacillus firmus KU198757 Bacilli 873 NR_118955.1 100 98 RKEM_755 - NCIMB 9366

Bacillus Bacillus sp. KU198806 Bacilli 756 oceanisediminis NR_117285.1 100 98 RKEM_781B H2

Bacillus sp. Bacillus drentensis KU198808 Bacilli 835 NR_118438.1 100 99 RKEM_829B LMG 21831

Fictibacillus Fictib,acillus sp. KU198749 Bacilli 851 phosphorivorans NR_118455.1 100 99 RKEM_566 Ca7

155 Halobacillus Halobacillus sp. KU198840 Bacilli 789 litoralis NR_029304.1 100 98 RKEM_1822 SL-4

Oceanobacillus Oceanobacillus sp. KU198761 Bacilli 794 picturae NR_028952.1 RICEM_814 100 100 R-5321

Terribacillus Terribacillus sp. KU198767 Bacilli 784 saccharophilus NR_041356.1 100 100 RKEM_1564 002-048

Paenibacillus Paenibacillus sp. KU198818 Bacilli 614 illinoisensis NR_113828.1 100 RKEM_1589 99 NBRC 15959

Paenibacillus Paenibacillus sp. KU198730 Bacilli 752 pabuli NR 112164.1 RKEM_768 100 99 JCM 9074

Planococcus Planococcus sp. KU198850 Bacilli 827 rifietoensis NR_025553.1 RKEM_918 100 100 M8

Staphylococcus Staphylococcus sp. KU198822 Bacilli 815 haemolyticus RKEM_1626 NR_074994.1 100 100 JCSC1435

Staphylococcus Staphylococcus sp. KU198751 Bacilli 910 .epidermidis RKEM_613 NR_074995.1 97 99 RP62A

Fulvivirga Fulvivirga sp. Cytoph KU198797 574 imtechensis NR_117079.1 100 97 RKEM_712 agi a AK7

Alteromonas Alteromonas sp. KU] 98735 Gamma 855 macleodii NR_114053.1 RKEM_316 99 99 NBRC 102226

Alteromonas Alteromonas sp. KU198721 Gamma 865 macleodii NR_074797.1 100 RKEM_369 99 107

Alteromonas Alteromonas sp. KU198727 Gamma 854 hispanica NR_043274.1 RKEM_717 99 99 - F-32

Alteromonas Alteromonas sp. KU198803 Gamma 852 australica NR_116737.1 100 RKEM_765 99 I-1 17 1

Pseudoalteromonas Pseudoalteromonas KU198720 Gamma 864 piscicida NR_040946.1 98 100 sp. RKEM_243 IAM 12932

Pseudoalteromonas Pseudoalteromonas KU] 98753 Gamma 854 agarivorans NR_025509.1 100 sp. RKEM_647 99 DSM 14585

156

Pseudoalteromonas Pseudoalteromonas KU198752 Gamma 870 arabiensis NR_l 13220.1 100 100 sp. RKEM_660 k53

Pseudoalteromonas Pseudoalteromonas KU I 98729 Gamma 859 NR I 25458.1 100 99 sp. RKEM_732 shioyasakiensis SE3

Pseudoalteromonas Pseudoalteromonas KU198845 Gamma 817 . lipolytica NR_116629.1 sp. RKEM_857 100 100 LMEB 39

Shewanella sp. Shewanella corallii KU198763 Gamma 795 NR 116537.1 98 99 RKEM_1631 fav-2- j 0-05

Cronobacter Cronobacter sp. KU198745 Gamma 861 zurichensis NR_104924.1 . 99 RKEM_537A 99 LMG 23730

Cronobacter Cronobacter sp. KU198739 Gamma 872 mass iliensis NR_125600.1 100 RKEM_548 98 JC163

Enterobacter Enterobacter sp. KU198762 Gamma 803 cloacae NR_118011.1 100 99 RKEM_1504 DSM 30054

Pantoea sp. Pantoea vagans KU198742 Gamma 870 NR_I 02966.1 100 99 RKEM_516 C9-1

Pantoea sp. Pantoea dispersa KU198747 Gamma 821 NR_116797.1 100 99 RKEM_552 DSM 30073

Pantoea sp. Pantoea stewartii KU198743 Gamma 873 NR_104928.1 100 98 RKEM_701 CIP 104006

Cobetia sp. Cobetia litoralis KU198728 Gamma 863 NR_l 13403.1 99 99 RKEM_646 KMM 3880

Halomonas Halomonas sp. KU321285 Gamma 789 nitroreducens NR_044317.1 • 100 98 RKEM_883 11S

Halomonas Halomohas sp. KU198848 Gamma 841 axialensis NR_027219.1 100 99 RKEM_901 Althfl

Bermanella Bermanella sp. KU198805 Gamma 854 marisrubri NR_042750.1 100 99 RKEM_777 RED65

Marinomonas Marinomonas sp. KU198723 Gamma 859 • communis NR_114051.1 99 99 RKEM_313 NBRC 102224

157 Marinomonas sp. Marinomonas KU198722 Gamma 858 RKEM_715 posidonica NR_074719.1 100 97 IVIA-Po-181 Marinomonas Marinomonas sp. KU321286 Gamma RKEM_924 1308 posidonica NR_074719.1 100 99 IVIA-Po-181 Saccharospirillum Saccharospirillum sp. KU321284 Gamma 1507 impatiens RKEM_770 NR_028953.1 96 96 EL-105

Acinetobacter sp. Acinetobacter pittii KU198726 Gamma 858 NR_117621.1 100 RKEM_528 ATCC 19004 100

Acinetobacter Acinetobacter sp. KU198738 Gamma 857 lwoffii NR_113346.1 RKEM_532 99 97 JCM 6840

Acinetobacter Acinetobacter sp. KU198798 Gamma 858 radioresistens NR_114074.1 99 99 RKEM_817 NBRC 102413

Psychrobacter sp. Psychrobacter celer KU198810 Gamma 856 NR 043225.1 99 99 RKEM_1523 SW-238

Psychrobacter Psychrobacter sp. KU198838 Gamma 823 piscatorii NR_112807.1 100 RKEM_1796 98 T-3-2

Psychrobacter sp. Psychrobacter celer K.U198795 Ciamana 783 NR_043225.1 100 99 RKEM_535 SW-238

Psychrobacter Psychrobacter sp. KU198744 Gamma 860 pacificensis RKEM_670 NR_114238.1 99 99 NBRC 103191 Psychrobacter Psychrobacter sp. KU198847 Gamma 824 marincola NR_025458.1 RKEM_879 100 99 KMM 277 Psychrobacter Psychrobacter sp. KU198787 Gamma 858 nivimaris NR_028948.1 100 100 RKEM_927 88/2-7 Pseudomonas Pseudomonas sp. KU198772 Gamma 637 stutzeri NR_074829.1 100 99 RKEM_1577 A1501 Pseudomonas Pseudomonas sp. KU198746 Gamma 847 putida RKEM_545 NR_074596.1 100 99 KT2440

Pseudomonas Pseudomonas sp. KU198807 Gamma 589 indoloxydans NR_115922.1 100 99 RKEM_824A IPL-1

158 Pseudomonas Pseudomonas sp. KU198785 Gamma 661 indoloxydans NR_115922.1 100 99 RKEM_891 IPL-1 Photobacterium Photobacterium sp. KU198809 Gamma 734 damselae NR_113783.1 100 100 RKEM_1507 NBRC 15633

Vibrio sp. Vibrio pelagius KU198719 Gamma 868 NR_113789.1 99 99 RKEM_201 NBRC 15639

Vibrio Vibrio sp. KU198733 Gamma 733 coralliilyticus NR_117892.1 99 99 RKEM_309 ATCC BAA-450

Vibrio sp. Vibrio alginolyticus KU198734 Gamma 864 NR_122059.1 100 99 RKEM_328 NBRC 15630

Vibrio sinaloensis Vibrio sp. RKEM_48 KU198842 Gamma 818 NR_043858.1 100 99 CAIM 797

Vibrio sp. Vibrio xuii KU198740 Gamma 883 NR_025478.1 98 99 RKEM_501 R-15052

Vibrio sp. Vibrio rotiferianus KU198748 Gamma 766 NR_118091.1 100 99 RKEM_562 LMG 21460

Vibrio sp. Vibrio mediterranei KU198800 Gamma 441 NR_029257.1 100 99 RKEM_601 50

Vibrio tubiashii Vibrio sp. RKEM_69 KU198843 Gamma 790 NR_113791.1 100 100 NBRC 15644

seudobacteriovorax Wfovibrio antillogorgiicola KJ6853 sene

Abbreviations: Actino: Actinobacteria; Alpha: Alphaproteobacteria; Gamma: Gammproteobacteria; Delta: Deltaproteobacteria

159

—20 011111101111Vibrionales

0.02 53.1- Pantoea yagans LMG 241991 (EF688012) - Pantoea sp. RKEM 516 (KU198742) Pantoea allii BD 390T (AY530795) 92 64 Pantoea stewariii DSM30073T (U80208) - Pantoea sp. RKEM 701T (1(U198743) 91 A Pantoea dispersa LMG2603T (DQ504305) 92 L Pantoea sp. RKEM 552 (KU198747) Cronobacter muytjensii E6031 (EF059845) Enterobcicteriales 100 Cronohacter sp. RKEM 537A (KU198745) 91 Cronobacter turicensis LMG 237301 (HQ992947) Cronobacter sp. RKEM 548 (KU198739) 58 Enterobacter sp. RKEM 1504 (KU198762) -Enterobacter hormaechei CIP 1034411 (AJ508302) 55 Enterobacter cloacae DSM 300541 (NR117679) 90 Enterobacter Iudwigii EN-119T (AJ853891) Alteromonadales 79 00--..01111111Pseudomonadales

59 Saccharospirillum aestuarii IMCC44531 (GQ250189) 99 S'accharospirillum salsuginis YIM-Y251 (EF177670) 99 Saccharospirilhtm impatiens EL-1051 (AJ315983) Saccharospirillum sp. RKEM 770 (KU321284) 100 Bermanella marisrubri RED65T (AY136131) Bermanella sp. RKEM 777 (KU198805) 97 Marinonzonas communis LMG 2864T (DQ011528) 73 Marinonzonas sp. RKEM 313 (KU198723) Oceanospirillales Marinomonas ostreistagni JCM 13672T (AB242868) 991 Marinomonas sp. RKEM 715 (KU198722) 52 99 Marinomonas sp. RKEM 924 (KU321286) 7n — Marinomonas dokcionensis DSW I 0-10T (DQ011526) 96 — -`-v- Marinomonas posidonica IVIA-Po-181T.(EU188445) 64 Marizzomonas foliar= IVIA-Po-1551 (EU188444) 90 Marinomonas pontica 46-161 (AY539835) 60 Halomonas sp. RKEM 901 (KU198848) 55, Halomonas aquamarina DSM 30161T (AJ306888) 99 Halomonas meridiana DSM 54251 (AJ306891) 91 Halomonas axialensis AlthfIT (AF212206) Halomonas sp. RKEM 883 (KU321285) Oceanospirillales 100 99 ___ Halomonas nitroreducens 11ST (EF613113) 78 Halomonas yentosae AL 12T (AY268080) T Cabala sp. RKEM 646 (KU198728) 1001 Cobetia amphilecti KMM 15611 (AB646236) 98 Cobetia Morals KMM38801 (AB646234)

Pseudomonadales 90

160 Figure 4.5. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of

bacteria in the orders Enterobacteriales and Oceanospirillales. The tree was constructed using

all Gammaproteobacteria in the culture dependent library and closely related type strains; bacteria from this study are in bold. The tree was rooted using Asticcacaulis solisilvae C6M1-

3ENT (NR 109665.1), Achromobacter aegrifaciens LMG 26852T (NR 117707.1), and

Desulfarculus baarsii DSM 2075 (NR 074919.1) (not shown). Evolutionary distances were computed using the Jukes-Cantor method. A total of 567 nucleotide positions were used.

Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values < 50 are not shown.

161 90 Hbrionales 92 1 91 .4111110lin1erobacteriales 0.02 100

Alteromonadales 79 4 1 Pseudomonas stutzeri ATCC 175881 (AF094748) L Psettdomonas sp. RKEM 1577 (KU198772) Pseudomonas knackmussii B131 (AF039489) Pseudomonas sp. RKEM 824A (KU198807)

— Pseudomonas pseudoalcaligenes LMG 1225T (Z76666) Pseudomonadales 100 _ Pseudomonas sp. RKEM 891 (KU198785) Pseudomonas putida Fl T (D84020) — Lumumeinen56 _— Pseudoinonas montedd CFML 90-601 (AF064458) 59 - Pseudomonas sp. RKEM 545 (KU198746)

Oceanospirdlales 100 Oceanospirdlales

loolAcinetobacter radioresistens DSM69761 (X81666) 58 I Acinetobacter sp. RKEM 817 (KU198798) 97 Acinetobacter venetianus ATCC 310121 (AJ295007) 66 Acinetobacter DSM2403T (X81665)

100 Acinetobacter sp. RKEM 532 (KU198738) Acinelobacter calcoaceticus NCCB 22016T (AJ888983) Acinetobacter pittii LMG 1035T (HQ180184) 100 Acinetobacter sp. RKEM 528 (Kill 98726)

8 [ Psychmbacter submarinus KMM 225T (AJ309940) 90 54 Psychrobacter sp. RKEM 879 (KU198847) Psychrobacter maritinms Pi2-20T (Aj609272) Pseudomonadales 4 [Psychrobacier celer SW-238T (AY842259) L Psychrobacter sp. RKEM 1523 (KU198810) 100 Psychrobacter sp. RKEM 535 (KU198795) Psychrobacter add/au S.114 (AJ539105) Psychrobacter fidvigenes KMM 3954T (AB438958) 65 Psychrobacter sp. RKEM 1796 (KU198838) — 90 Psychrobacter pacificensis IFO 162791 (AB016057) Psychrobacter sp. RKEM 670 (KU198744)

99 Psychrobacter nivimaris 88/2-7T (AJ313425) Psychrobacter piscatorii JCM 15603' (AB453700) 87 Psychrobacter .sp. RKEM 927 (KU198787)

Figure 4.6. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the order Pseudomonadales. The tree was constructed using all

162 Gammaproteobacteria in the culture dependent library and closely related type strains; bacteria from this study are in bold. The tree was rooted using Asticcacaulis solisilvae CGM1-3ENT (NR

109665.1), Achromobacter aegrifaciens LMG 26852T (NR 117707.1), and Desulfarculus baarsii

DSM 2075 (NR 074919.1) (not shown). Evolutionary distances were computed using the Jukes-

Cantor method. A total of 567 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values < 50 are not shown.

163

— Vibrio Xliii R-15052T (AJ316181) - Vibrio sp. RKEM 501 (KU198740) Vibrio probioticus LMG .203621 (AJ345063) Vibrio corallilyticus LMG 209841 (Aj440005) 0.02 83 Vibrio sp. RKEM 309 (KU198733) 1 Vibrio tubiashi ATCC 191 09T (X74725) 961' Vibrio sp. RKEM 69 (KU198843) Vibrio sp. RKEM 48 (KU198842) Vibrio sinaloensis CAIM 797T (DQ451211) Vibrio parahaemolyticus VP23T (AF388386). 571 Vibrio mediterranei CIP103203T (X74710), Vibrionales 99 L Vibrio shilonii AKIT (AF007115) 1 Vibrio .sp. RKEM 328 (KU198734) Vibrio sp. RKEM 562 (K1J198748) 914 751 97 Vibrio alginolyticus ATCC I 7749T (X56576) Vibrio rotiferants LMG 214601 (AJ3161 87) - Vibrio pelagius CECT 42021 (AJ293802) 90 99 Vibrio fortis LMG 21557T (AJ514916) 74 Vibrio sp. RKEM 201 (KU198719) 97 Photobacterium kiognathi ATCC 255211 (X74686) 98 iPhotobacterium damselae K-11. (AB032015) 1001 Photobacterium sp. RKEM 1507T (KU198809) 4110111Enterobacteriales 100 9 Pseudoalteromonas piscicida IAM 129321 (AB090232) 9 Pseudoalteromonas sp. RKEM 243 (KU198720) 0 91 Pseudoalteromonas peptidysin F12-50-Al (AF007286) 100 Pseudoalteromonas sp. RKEM 647 (KU198753) Pseudoafteromonas sp. RKEM 857 (KU198845)

R7 97 — Pseadoakeromonas sp. RKEM 660 (KU198752) 99 Pseudoalteromonas sp. RKEM 732 (KU198729) Shewanella fidelia KMM3582T (AF420312) 97 Shewanella coral/it fay-2-10-051 (FJ041083) 79 100 1 Shewanella sp. RKEM 1631 (KU198763) qg I Alteromonas hispanica F-321 (AY926460) Alteromonadales l Alteromonas hispanica strain F-32T (AY926460) Alteromonas australica HI 7T (FJ595485) 100 Alteromonas tagae 175711 (DQ836765) 55 Alteromonas tagae BCRC 175711 (DQ836765) 58 Alteromonas sp. RKEM 765 (KU198803) Alteromonas sp. RKEM 717 (ICUl 98727) 72 Alteromonas macleodii DSM 60621 (Y18228) 57 Alteromonas marina SW-471 (AF529060) 66 Alteromonas sp. RKEM 316 (KU198735) Alteromonas sp. RKEM 369 (KU198721) 100 Pseudomonadales Oceanospirillales 100 Oceanospirillcdes

90 Pseudomonadales

Figure 4.7. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the orders Vibrionales and Alteromonadales. The tree was constructed using all

164 Gammaproteobacteria in the culture dependent library and closely related type strains; bacteria from this study are in bold. The tree was rooted using Asticcacaulis solisilvae CGM1-3ENT (NR

109665.1), Achromobacter aegrifaciens LMG 26852T (NR 117707.1), and Desulfarculus baarsii

DSM 2075 (NR 074919.1) (not shown): Evolutionary distances were computed using the Jukes-

Cantor method. A total of 567 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values < 50 are not shown.

165 69 Paracoccus sp. RKEM 1671 (KU198825)

81 Paracoccus sp. RKEM 1551 (KU198769) 0.02 Paracoccus aminovorans DM-82 (D32240) Paracoccus huijuniae FLN-7 (EU725799) 60 Paracoccus sp. RKEM 1682 (KU198826) -- Paracoccus limosus NB88 (}1Q336256) Paracoccus chinensis KS-11 (EU660389) Paracoccus alcaliphihts (AY014177)

61 Paracoccus stylophorae KTW-16 (GQ281379) 99 Paracoccus sp. RKEM 943 (KU198852) -57 -- Paracoccus sediminis CMB17 (JX126474) IIParacoccus homiensis DD-R1l (DQ342239) 99 Paracoccus zeaxanthinifaciens ATCC 21588 (AF461158) 74 Paracoccus sp. RKEM 656 (KU198758) , Paracoccus sp. RKEM 942 (KU198851) 54 r Rhodobacter sp. RKEM 1557 (KU198812) { 8 1 1 Rhodobacter sphaeroides 24.1 (X53853) 99 Rhodobacterjohrii JA192 (AM398152) Paracoccus sp. RKEM 946 (KU198731) Rhodobacterales 99 91_ Citreicella sp. RKEM 868 (KU198782) 19._ Citreicella marina CK-13-6 (EU928765) 94 - Citricella thiooxidans CHLG 1 (AY639887) Citreicella aestuarii AD8 (FJ230833) 99 Sulfitobacter delicatus K1V1M 3584T (AY180103) 2- Sulfitobacter brevis Ekho Lake-162 (Y16425) 99 100 — Szdfitobacter marinzis SW-265 (DQ683726) Sulfhobacter sp. RKEM 910 (KU198849)

96 54 Sagittula sp. RKEM 72411 (KU198756) 73 86 Sagitada marina F028-2 (HQ336489) Sagittula stellata E-37 (U58356) 6 Ruegeria marina ZH17 (FJ872535) Ruegeria sp. RKEM 265 (KU198725) 97 Ruegeria pelagia HTCC2662 (DQ916141) 56 100 Ruegeria mobilis NBRC 101030 (ABs255401)

99 Pseudovibrio sp. RKEM 536 (KU321281) Pseudovibrio denitrificans DN34 (AY486423) 82 100 :Pseudovibrio japonicus WSF2 (AB246748) 86 Pseudovibrio axinellae Ad2 (JN167515)

99 Rhizobiales 99 Sphingomonadales 7 91 '11111111Enterobacteriales

Figure 4.8. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the order Rhodobacterales. The tree was constructed using all Alphaproteobacteria in the culture dependent library and closely related type strains; bacteria from this study are in

166 bold. The tree was rooted using Acidiferrobacter thiooxydans DSM2392 (NR_114870.1)

Achromobacter aegrifaciens LMG 26852T (NR 117707.1), and Desulfarculus baarsii DSM 2075

(NR 074919.1) (not shown). Evolutionary distances were computed using the Jukes-Cantor method. A total of 569 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values < 50 are not shown.

167 1 Rhodobacterales 0.02

97{Aureimonas sp. RKEM 1543 (KU198811) 100 Aurantimonas altamirensis S2 1B (DQ372921) — Aurantimonas frigidaquae CW5 (EF373540) Rhizobium sp. RKEM 1707 (KU321278) — Rhizobium rosettiformans W3 (EU781656)

94 Rhizobium sp. RKEM 1529 (KU321275) Rhizobiales

53 Rhizobium celhdosilyticum ALA10B2 (DQ855276) Rhizobium sp. RKEM 870 (KU198846) Rhizobium galegae ATCC 43677 (D11343) 65 Rhizobium skierniewicense Ch 11 (HQ823551) 84 Rhizobium huctudense SO2 (AF025852)

501 Sphingomonas sp. RKEM 364 (KU198801)

99 I- Sphingomonas parapaucimobilis DSM 7463 (D13724) Sphingomonas sanguinis NBRC 13937 (D84529) Sphingomonadales 64 1 Sphingotnonas paucimobihs ATCC 29837 (U37337) Sphingomonas phyllosphaerae FA2 (AY453855) Erythrobacter sp. RKEM 933 (KU198783) Erythrobacter gaetbzeli SW-161 (AY562220) Erythrobacter sp. RKEM 642 (KU321283) Dythrobacter gangjinensis K7-2 (EU428782) EzYthrobacter marinus HWDM-33 (HQ117934) Etythrobacter aquimaris SW-110 (AY461441) — Erythrobacter sp. RKEM 1590 (KU198819) Enterobacteriales 69 jErythrobacter pelagi UST081027-248 (HQ203045) 7 L Erythrobacter flavus SW-46 (AF500004) Etythrobacter citreus RE35F/1 (AF118020) Erythrobacter sp. RKEM 947 (KU198793) I i Etythrobacter sp. RKEM 937 (KU198790) 81 Dythrobacter vzdgaris 022 2-10 (AY706935)

Figure 4.9. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the orders Rhizobiales, Sphingomonadales, and Enterobacteriales. The tree was constructed using all Alphaproteobacteria in the culture dependent library and closely related type strains; bacteria from this study are in bold. The tree was rooted using Acidiferrobacter

168 thiooxydans DSM2392 (NR_114870.1)Achromobacter aegrifaciens LMG 26852T (NR

117707.1), and Desulfarculus baarsii DSM 2075 (NR 074919.1) (not shown). Evolutionary distances were computed using the Jukes-Cantor method. A total of 569 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values <

50 are not shown.

169 Microbacteriani bqr sp. RKEM 1786 (KU198837) JL Microbacterium sp. RKEM 1691 (KU198773) 0 Microbacterium sp. RKEM 1651 (KU198775) 0.02. Microbacterium arthrosphaerae CC-VM-YT (FN870023) 66 Microbacterium sp. RKEM 1661 (KU198824) Microbacteriumflavescens 401 T (Y17232) Microbacterium sp. RKEM 1815 (KU198770) Microbacterium sp. RKEM 1814 (KU198839) Microbacterium sp. RKEM 1778 (KU198780) Microbacterium sp. RKEM 1591 (KU198820) Microbacterium sp: RKEM 1559 (KU198813) Microbacterium testaceum (X77445) - Microbacterium hydrothermale 0704C9-21 (HM222660) Microbacterium resistens DSM 11986T (YI4699) 73 _i 1 Microbacteriu nt sp. RKEM 922 (KU198765) 85 Microbacteriztm oleivorans DSM 160911 (A.1698725) Microbacterium marinum H101T (HQ622524) Microbacterium foliar= DSM 129661 (AJ249780) Microbacteriunt sp. RKEM 1562 (KU198815) 65 1J Microbacterium phyllosphaerae DSM 134681 (AJ277840) Microbacteriaceae 60 Microbacterium maritypicum DSM 125121 (AJ853910) Microbacterium sp. RKEM 1514 (KU198766) 98 - Microbacterium paraoxydans CF361 (AJ491806) 51 Microbacterium sp. RKEM 1560 (KU198814) Micrococcales - Microbacterium thalassium DSM 125111 (AM 181507) 82 - 94 Agrococcus sp. RKEM 1685 (KU198777) 77- Agrococcus jejzzensis SSW148.1 (AM396260) Agrococcus versicolor DSM 198! 2T (AM940157) -99 Agrococcus sp. RKEM 1635 (KU198774) 9 1 Agrococcus terreus DNG5r (FJ423764) , 95 50 Agrococcus lahaulensis K22-21T (DQ156908) - Agrococcus carbonis G41 (GQ504748) 91 Agrococcus citreus IAM 15145T (AB279547) 57 77 ] Agrococcus sp. RKEM 917 (KU198831) 94 Agrococcus baldri 1AM 15147T (A13279548) Curtobacterium citreum (7(77436) Curtobacterium jlaccumfaciens (AJ312209) 98 Curtobacterium sp. RKEM 1741 (KU198833) Curtobacterium sp. RKEM 1515 (KU198764) 69 Curtobacterium luteum (X77437) ----411110Pmmicromonosporaceae 91 8_ 83 Intrasporangiaceae 89 1 Dermacoccaceae 59 99 76 Intrasporangiaceae 99 Dermabacteraceae 99 Micrococcaceae 87 Kineosporiales Strcptomycemles Cotynebacteriales Geodermatophilales . 99 imam Propionibacieriales 99 Figure 4.10. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the family Microbacteriaceae. The tree was constructed using all Actinobacteria in the culture dependent library and closely related type strains; bacteria from this study are in bold.

170 The tree was rooted using Asticcacaulis solisilvae CGM1-3ENT (NR 109665.1), Achromobacter

aegrifaciens LMG 26852T (NR 117707.1), and Desulfarculus baarsii DSM 2075 (NR 074919.1)

(not shown). Evolutionary distances were computed using the Jukes-Cantor method. A total of

620 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000

replicates, bootstrap values < 50 are not shown.

171

95 Microbacteriaceae

I 0.02 6I4 Celhdomonas sp. RKEM 1775 (KU198768) 80 Celhdomonas pakistanensis (AB618146) 63_ Celhdomonas hominis DSM 9581T (X82598) Celhdomonas denverensis W69291 (AY501362) 91 [ Cellulosimicrobium variformis MX5T (AJ298873) Promicromonosporaceae - Celluloshnicrobiu m sp. RKEM 1754 (KU198779) 89 76 1 Cellulosimicrobium terreurn DS-611 (EF076760) 51 Celhdosimicrobizon funkei W61221 (AY501364) 50 Cellulosimicrobium celhdans (X83809) - _ Ornithinimicrobium sp. RKEM 638 (KU321282) Q Ornithinimicrobium kibberense K22-201 ( AY636111) R'7 Intrasporangiaceae Ornithinimicrobiztm pekingense LW6T (DQ512860) Ornithinimicmbium murale 01-G1-0401 (FR874098) Kytocacezzs schroeteri 20001 (AJ297722) — Kytococcus aerolatus 02-S1-019/1T (FM992368) 99 Dermacoccaceae R4 66 {Kytococcus sp. RKEM 512A (KU198778) 78 Kytococcus sedentarius DSM 205471 (NR 026256.1) 72 Janibacter sp. RKEM 1825 (KU198841) Janibacter melonis CM2104T (AY522568) Intrasporangiaceae 99 Jantbacter terrae (AF176948) 55 Janibacter anophelis CCUG 497151 (AY837752) Brachybacterium saurashtrense JG 061 (EU937750) 1 Brachybacterium sp. RKEM 1576 (KU198817) 99 [ Dermabacteraceae Brachybacterium paraconglonzeratum LMG 198611 (AJ415377) 97 Brachybacterium conglomeratum AJ 10151 (AB537169) Micrococcales 58 Arthrobacter sp. RKEM 1692 (KU198827) Arthrobacter sp. RKEM 1637 (KU198823) 95 Arthrobacter ureafaciens ATCC 75621 (X80744) Anhrobacter nicotinovorans ATCC 499191 (X80743) - 79 Arthrobacter histidinolovorans DSM 4201 (X83406) Kocuria sp. RICEM 1608 ((U198821) 99 Kocuria flava HO -9041T (EF60204 Kocuria polaris. CMS76orT (AJ278868) 1Kocuria sp. RICEM 639 (KU198796) 99 Kocuria pahtstris (Y16263) 741Micrococcus up. RKEM 702 (KU198741) _era_ Micrococcus aloeverae AE-6T (KF524364) j Micrococcus yunnanensis YIM 65004T (FJ214355) 87 72 I -74 Micrococcus luteus DSM 200301 (AJ536198) Mierococcaceae Coricoccus zhacaiensis FS241 (EU305672) Chrococcus muralis 4-01 (AJ344143) 99 Citricoccus sp. RKEM 914 (KU198786) 68 CitricoOcus alkalitolerans YIM 700101 (AY376164) 69 Arthrobacter ozyzae (AB279889) Anhrobacter humicola (AB279890) Arthrobacter globifonnis (X80736) ]Arthrobacter sp. RKEM 332 (KU321279) 93 Arthrobacter sp. RKEM 1571 (KU198816) Arthrobacter phenanthrenivorans Sphe3T (AJ49I806) 63 1 Arthrobacter chlorophenolicus (AF102267) 8 Arthrobacter equi IMMIB L-16061 (FN673551) 76 Arthmbacter defluvii 4C I (AIv1409361) Kineosporiales 89 S reptoznycetales 92 91 Cozynebacteriales Geodermatophilales 99 vaialia 71 Propionibacteriales 99

172 Figure 4.11. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the order Micrococcales. The tree was constructed using all Actinobacteria in the culture dependent library and closely related type strains; bacteria from this study are in bold.

The tree was rooted using Asticcacaulis solisilvae CGM1-3ENT (NR 109665.1), Achromobacter aegrifaciens LMG 26852T (NR 117707.1), and Desulfarculus baarsii DSM 2075 (NR 074919.1)

(not shown). Evolutionary distances were computed using the Jukes-Cantor method. A total of

620 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values < 50 are not shown.

173 Microbacteriaceae

Promicmmonosporaceae 1 91 82 0.02 83 Intrasporangiaceae Micrococcales 891 I Dermacoccaceae 99 Intrasporangiaceae 9 41 Der/nObaCteraCeae 76 99 Micrococcaceae 87 Angustibacter sp. RKEM 1664 (KU321277) r— Angustibacter aerolatus 7402J-48' (JQ639056) 89 Kineosporiales 991 r Angustibacter peucedani RS-505 (FM998037) 96 Angustibacter luteus (AB512285) 1 Streptomyces albus DSM 403131 (AJ621602) Streptomyces 92 sp. RKEM 1715 (KU198832) Streptomyces parvzdus NBRC 13193T (AB184326) Streptomycetales 99 - Streptontyces sp. RKEM 774 (KU198759) 74 Streptomyces olivaceus NBRC 3200T (AB184743) Rhodococcus sp. RKEM 1538 (KU198776) Rhodococcus kroppenstedtii K07-23T (AY726605) 90 99 Rhodococcus sp. RKEM 450 (KU198737) Rhodococcus trifolii T8TT (FR714843) 51 Rhodococcus corynebacterioides DSM 20151T (AF430066) 99 50 Rhodococcus etythreus DSM 430661 (X79289) 99J Rhodococcus aetherovorans 10bc3121 (AF447391)

65 Rhodococcus sp. RKEM 42 (1(098794) Cotynebacteriales 76 Rhodococcus niber DSM43338T (X80625) 94 I Rhodococcus sp. RKEM 843 (KU198844) 99 Rhodococcusr fascians DSM 206691 (X79 186) Dietzia mans DSM 43672T (X79290) Dietzia papillomatosis N 1280T (AY643401) 01 98 99 'Dietz/a sp. RKEM 832 (KUI98781) 79 Diet=ia cinnamea IMMIB R1V-3995 (AJ920289) Geodermatophi/us soli (JN033772) Geodermatophilus taihuensis 3-wff-81T (1X294478) 99 Geodermatophilales Geodermutophilus sp. RKEM 688 (KU198754) 89 Geodermatophilus brasiliensis Tu6233T (DQ029102) 71 711r Aeromicrobium tandense sswi-57T (DQ411541) 99 Aeromicrobiumf/avton TYLNT1 (EF133690) Aeromicrobium sp. RKEM 1713 (KU198831) 6 Marmoricola sp. RKEM 1784 (KU198836) 97 Marmoricola aequoreus SST-45T (AM295338) 99 Marmoricola scoriae Sco-DO 1 T (FN386750) Marmoricola korecus Sco-A36T (FN386723) 99r Nocardioides oleivorans DSM 16090T (AJ698724) 97 L Nocardioides ganghwensis JC20551 (AY423718) 95 99 Nocardioides sp. RKEM 1698 (KU198829) Pmpionibacteriales Nocardioides sp. RKEM 1695 (KU198828) Nocardioides sp. RKEM 1712 (KU198830) 99 rocardioides sp. RKEM 944 (KU198791) 69 Nocardioides salarius CL-Z59T (DQ401092) 4 Nocardioides .IKSL-17T (DQ121389) Nocardioides terrigena DS-171 (EF363712) 98[ Nocardioides sp. RKEM 1781 (KU198835) Nocardioides aestuarit JC20561 (AY423719) 63 I Nocardioides sp. RKEM 1764 (KU198834) 99 Nocardioides aquiterrae GW-95 (AF529063)

Figure 4.12. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the orders Kineosporiales, Streptomycetals, Corynebacteriales,

174 Geodermatophilales, and Propionibacteriales. The tree was constructed using all

Actinobacteria in the culture dependent library and closely related type strains; bacteria from this study are in bold. The tree was rooted using Asticcacaulis solisilvae CGM1-3ENT (NR

109665.1), Achromobacter aegrifaciens LMG 26852T (NR 117707.1), and Desulfarculus baarsii

DSM 2075 (NR 074919.1) (not shown). Evolutionary distances were computed using the Jukes-

Cantor method: A total of 620 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values < 50 are not shown.

175 Bacillus horikoshii 1P01SCT (AB043865) 'L Bacillus sp. RKEM 444 (KM 98724) 0.02 ---1 r Bacillus simplex DSM 1321T (AJ439078) 98 L Bacillus sp. RKEM 632 (KU198792)

Bacillus niabensis 4T19T (AY998119)

63 I Bacillus sp. RKEM 731 (KU198789)

96 Bacillus idriensis SMC 4352-2T (AY904033)

Bacillus sp. RKEM 441 (KU198736)

98 !Bacillus pumilus ATCC 7061 T (AY876289)

99 I Bacillus sp. RKEM 730 (KU198750)

Bacillus cereus ATCC 14579T. (NR074540)

100 I Bacillus sp. RKEM 1569 (KU198771)

Bacillus sp. RKEM 829B (KU198808)

100 [Bacillus agabhattai B8W22T (EF114313) Bacillus sp. RKEM 667 (KU198760)

99 Bacillus circulans ATCC 4513T (AY724690)

Bacillus sp. RKEM 513C (KU198802)

50 Bacillus oceanisediminis H2T (GQ292772) Bacillus firmusIAM 12464T (D16268) 87 70 Bacillus sp. RKEM 755 (KU198757) 87 Bacillus sp. RKEM 781B (KU198806)

1001 Bacillus endophyticus LMG 25492T (AF295302) 100 Bacillus sp. RKEM 720 (KU198755) 3E Bacillus carbomphilus JCM 9731T (AB021182) 56 Bacillus sp. RKEM 266 (KU198732)

72 'Bacillus hwajinpoensis SW-72T (AF541966)

100 I Bacillus sp. RKEM 1771 (KU198804)

Bacillus drentensis LMG 21831 T (AJ542506)

Figure 4.13. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the genus Bacillus. The tree was constructed using all Bacillus spp. in the culture dependent library and closely related type strains; bacteria from this study are in bold. The tree was rooted using Alkalibacillus almallahensis SlLM8T (NR 133692.1), Allobacillus halotolerans

176 B3AT (NR 116607.1), and Amphibacillus cookii JWT (NR 108984.1) (not shown). Evolutionary distances were computed using the Jukes-Cantor method. A total of 609 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values <

50 are not shown.

177

91 Halobacillus litoralis (X94558) 0.02 62 I Halobacillus profundi IS4-1b4T (AB189298) 100 L Halobacillus sp. RKEM 1822 (KU198840)

77 — Halobacillus locisalis MSS-155T (AY190534) `lerribacillus halophilus 002-051T (AB243849) Terribacillus saccharophilus 002-0481 (AB243845) Bacillaceae 100 — Terribacilhis goriensis CL-GR16T (DQ519571) 100 - Terribacillus sp. RKEM 1564 (KU198767) Oceanobacillus polygoni SA9T (AB750685) 99r , Ocectnobacillus picturae LMG 194921 (AJ315060) 991 Oceanobacillus sp. RKEM 814 (KU198761) _ — Planococcus citreuS ATCC 14404T (X62172) - — Planococcus plakorlidis MTCC 84911 (JF775504) 100 Planococcaceae 52 Phmococctts rifitiensis M8T (AJ493659) 85 Planococcus sp. RKEM 918 (KU198850) Staphylococcus haemolyticus DM122T (X66100) Q. Staphylococcus sp. RKEM 1626 (KU198822) — Staphylococcus devriesei KS-SP 601 (FJ389206) 72 90 Staphylococcus capitis JCM2420T (L37599) Staphylococcaceae 100 Staphylococcus caprae CCM 35731 (AB009935) 89 Staphylococcus epidermidis .ATCC 149901 (D83363) 70 Staphylococcus sp. RKEM 613 (KU198751) Fictibacillus barbaricus VII-B3-A21 (AJ422145) 7 Fictibacillus nanhaiensis JSM 082006T (0U477780) 99 100 Bacillaceae Fictibacillus phosphorivorans Ca71 (JX258924) 67 Fictibacillus sp. RKEM 566 (KU198749) Paenibacillus tundrae Ab.101DT (EU558284) 65 . Paenibacillus sp. RKEM 768 (KU198730) 100 Paenibacillus pabuli JCM 90741 (AB045094) Paenibacillus amylolyticus HSCC 4341 (D85396) Paenibacillaceae 100 Paenibacillus massiliensis 23010651 (AY323608) - Paenibacillus xylanilyticus XIL14T ( AY427832) 96 69.4 Paenibacillus illinoisensis HSCC309T (AB073192) 73 L Paenibacillus sp. RKEM 1589 (KU198818)

Figure 4.14. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the class Bacilli. The tree was constructed using all Bacilli except the genus Bacillus in the culture dependent library and closely related type strains; bacteria from this study are in bold. The tree was rooted using Asticcacaulis solisilvae CGM1-3ENT (NR 109665.1),

178 Achromobacter aegrifaciens LMG 26852T (NR 117707.1), and Desulfarculus baarsii DSM 2075

(NR 074919.1) (not shown). Evolutionary distances were computed using the Jukes-Cantor method. A total of 612 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values < 50 are not shown.

179 Fulvivirga sp. RKEM 712 (KU198797) 0.01 86 99 Fulvivitga inilechensis AK7T (FR687203)

72 Fulvivitga kasyanovii KMM 6220T (DQ836305)

Fabibacter halotolerans UST030701-097T (DQ080995)

100 Fabibacter pacificus DY53T (KC005305) Flammeovitgaceae

Aureibacter tunicatonun A5Q-118T (AB572584)

Adhaeribacter aerolatus 6515J-31T (NR 117359.1)

Cesiribacter andamanensis AMV16T (FN396961)

100 Cesiribacter roseus 311T (BM775387)

Figure 4.15. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences of bacteria in the family Flammeovirgaceae. The tree was constructed using type strains in the family Flammeovirgaceae, the bacterium from this study is in bold. The tree was rooted using

Algoriphagus alkaliphilus AC-74T (NR 042278.1), Flexithrix dorotheae IFO 15987T

(AB078077), and Mooreia alkaloidigena CNX-216T (NR 126230.1) (not shown). Evolutionary distances were computed using the Jukes-Cantor method. A total of 580 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values <

50 are not shown.

180 4.4 Conclusions

Although only a small percentage of the A. elisabethae microbiome is obtainable under standard

plating conditions, different techniques were employed in this study to increase the

recoverability. From this research the following conclusions can be made: (1) Unique bacterial

isolates can be obtained by investigation of coral derived fractions other than the holobiont,

namely the larvae and dinoflagellates. By determining the cultivatable bacteria associated with

the larvae and dinoflagellates, an additional 12 unique bacteria were obtained that had not been

obtained from the holobiont. (2) Dilution-to-extinction was an effective method for obtaining cultivatable bacteria as high recoverability was observed in all libraries, ranging from 3.9% to

12.2% of the total culture independent libraries. (3) Unique bacterial isolates can be obtained by culturing A. elisabethae samples under microaerophilic and anaerobic conditions. By employing these conditions an additional 54 bacteria were added to the culture dependent library. (4)A. elisabethae is a valuable source of novel cultivatable bacteria. From this study three putatively novel species, one putatively novel genus, and one member of a novel family were obtained.

Based on these results, the octocoral A. elisabethae has proven to be an excellent source of cultivatable taxonomically diverse and novel bacteria.

4.4 References

Rohwer, F.; Seguritan, V.; Azam, F.; Knowlton, N. Mar. Ecol. Frog. Ser. 2002, 1-10.

Ceh, J.; van Keulen, M.; Bourne, D. G. FEMS Microbio.l EcoL 2011, 75 (1), 134-144.

Rohwer, F.; Breitbart, M.; Jara, J.; Azam, F.; Knowlton, N. Coral Reefs 2001, 20 (1),

85-91.

Webster, N. S.; Bourne, D. G. FEMS MicrobioL EcoL 2007, 59 (1), 81-94.

181 Bruck, T. B.; Briick, W. M.; Santiago-Vazquez, L. Z.; McCarthy, P. J.; Kerr, R. G. Mar.

Biotechnol. 2007, 9 (5), 561-576.

Kaeberlein, T.; Lewis, K.; Epstein, S. S. Science 2002, 296 (5570), 1127-1129.

Hawksworth, D. L.; Rossman, A. Y. Phyto. 1997, 87 (9), 888-891.

Amann, R. I.; Ludwig, W.; Schleifer, K. H. Micro biol. Rev. 1995, 59 (1), 143-169.

Sobecky, P. A.; Mincer, T. J. Chang, M. C.; Toukdarian, A.; Helinski, D. R. Appl.

Environ. Microb .1998, 64 (8), 2822-2830.

Ward, D. M.; Weller, R.; Bateson, M. M. Nature 1990, 345 (6270), 63-65.

Bayer, T.; Arif, C.; Ferrier-Pages, C.; Zoccola, D.; Aranda, M.; Voolstra, C. R. Mar.

Ecol. Prog. Ser. 2013, 479, 75-84.

Bayer, T.; Neave, M. J.; Alsheikh-Hussain, A.; Aranda, M.; Yum, L. K.; Mincer, T.;

Hughen, K.; Apprill, A.; Voolstra, C. R. Appl. Environ. Microb. 2013, 79 (15), 4759-

4762.

Correa, H.; Haltli, B.; Duque, C.; Kerr, R. G. Microb. EcoL 2013, 66 (4), 972-985.

Ainsworth, T. D.; Krause, L.; Bridge, T.; Torda, G.; Raina, J.-B.; Zakrzewski, M.; Gates,

R. D.; Padilla-Gamilio, J. L.; Spalding, H. L.; Smith, C.; Woolsey, E. S.; Bourne, D. G.;

Bongaerts, P.; Hoegh-Guldberg, 0.; Leggat, W. ISME J2015, 9 (10), 2261-2274.

Vezzulli, L.; Pezzati, E.; Huete-Stauffer, C.; Pruzzo, C.; Cerrano, C. PLoS ONE 2013, 8

(6),, e67745.

Pike, R. E.; Haltli, B.; Kerr, R. G. Int. J. Syst. Evol. Microbiol. 2013, 63 (11), 4294-

4302.

Seibel, B. A. J. Exp. Biol. 2007, 210 (1), 1-11.

Hoffmann, F.; Larsen, 0.; Thiel, V.; Rapp, H. T.; Pape, T.; Michaelis, W.; Reitner,

182 Geomicrobiol. 1 2005, 22 (2), 1-10.

Hoffmann, F.; Larsen, O.; Rapp, H. T.; Osinga, R. Mar. Biol. Res. 2005, 1 (2), 160-163.

Bruck, W. M.; BrUck, T. B.; Self, W. T.; Reed, J. K.; Nitecki, S. S.; McCarthy, P. J.

ISME J2010, 4 (5), 686-699.

Olson, J. B.; Lord, C. C.; McCarthy, P. J. Microb. Ecol. 2000, 40 (2), 139-147.

Mydlarz, L. D.; Jacobs, R. S.; Boehnlein, J.; Kerr, R. G. Chem. Biol. 2003, 10(11),

1051-1056.

Dieckmann, R.; Graeber, I.; Kaesler, I.; Szewzyk, U.; Dohren, von, H. App!. MicrobioL

Biotechnol. 2005, 67 (4), 539-548.

Ghyselinck, J.; Van Hoorde, K.; Hoste, B.; Heylen, K.; De Vos, P. J. Microbiol. Meth.

2011, 86 (3), 327-336.

Edwards, U.; Rogall, T.; Blocker, H.; Emde, M.; Bottger, E. C. Nucleic Acids Re.s 1989,

/7 (19), 7843-7853.

Gontang, E. A.; Fenical, W.; Jensen, P. R. App!. Environ. Microb. 2007, 73 (10), 3272-

3282.

Altschul, S. F.; Madden, T. L.; Schaffer, A. A.; Zhang, J.; Zhang, Z.; Miller, W.;

Lipman, D. J. Nucleic Acids Res. 1997, 25 (17), 3389-3402.

Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MoL Biol. EvoL 2013, 30

(12), 2725-2729.

Saitou, N.; Nei, M. Mo.! Biol. Evol. 1987, 4 (4), 406-425.

Jukes, T. H.; Cantor, C. R. Evolution of protein molecules; Munro:H. N., Ed.; Academic

Press: New York, 1969; Vol. 3, pp 21-132.

Felsenstein; J. Evolution 1985, 39 (4), 783.

183 Janda, J. M.; Abbott, S. L. J. Clin. Microbiol. 2007, 45 (9), 2761-2764.

Kim, M.; Oh, H. S.; Park, S. C.; Chun, J. In. J Syst. EvoL Microbiol. 2014, 64 (2), 346-

351.

Ritchie, K. B. Mar. EcoL Prog. Ser. 2006, 322, 1-14.

Rypien, K. L.; Ward, J. R.; Azam, F. Environ. Microbiol. 2010, 12 (1), 28-39.

Harder, T.; Lau, S. C. K.; Dobretsov, S.; Fang, T. K.; Qian, P.-Y. FEMS Microbiol.

EcoL 2003, 43 (3), 337-347.

Gray, M. A.; Stone, R. P.; McLaughlin, M. R.; Kellogg, C. A. FEMS Microbiol. Ecol.

2011, 76 (1), 109-120.

Olson, M. V.; Stover, C. K.; Pham, X. Q.; Erwin, A. L.; Mizoguchi, S. D.; Warrener, P.;

Hickey, M. J.; Brinkman, F. S. L.; Hufnagle, W. O.; Kowalik, D. J.; Lagrou, M.; Garber,

R. L.; Goltry, L.; Tolentino, E.; Westbrock-Wadman, S.; Yuan, Y.; Brody, L. L.;

Cotilter, S. N.; Folger, K. R.; Kas, A.; Larbig, K.; Lim, R.; Smith, K.; Spencer, D.;

Wong, G. K. S.; Wu, Z.; Paulsen, I. T.; Reizer, J.; Saier, M. H.; Hancock, R. E. W.;

Lory, S. Nature 2000, 406 (6799), 959-964.

184 Chapter 5: Description of Pseudobacteriovorax antillogorgiicola gen. nov., sp. nov., a bacterium isolated from the gorgonian octocoral Antillogorgia elisabethae, belonging to a novel bacterial family, Pseudobacteriovoraceae fam. nov., within the order Bdellovibrionales

McCauley E.P., Haltli B., Kerr R.G., mt. J. Syst Evol. Microbiot 2014, 65, (2), 522-530.

This chapter was published in the International Journal of Systematic and Evolutionary Microbiology and was modified to the formatting of this thesis; none of the content was changed.

Author contributions: E. McCauley isolated the bacterium, aided in the experimental design, performed the experiments and data analysis, and wrote the manuscript. B. Haltli aided in the experimental design, data analysis, and editing of the manuscript. R. Kerr wrote the grant supporting the research, aided in the experimental design and contributed to the editing of the manuscript.

185 5.1 Introduction

5.1.1 Bdellovibrio-and-like organisms

Bdellovibrio-and-like organisms (BALO) are Gram-negative bacteria that prey upon other Gram- negative bacteria. They exhibit a biphasic morphology consisting of a predatory phase and non- predatory phase. During the predatory phase a vibriod morphology with a polar flagellum is observed, and during the non-predatory phase the cellular morphology is highly variable.1'2

These organisms are classified under the order Bdellovibrionales, 3 and apart from their predatory abilities they exhibit few common characteristics. A wide range of isolation sources, NaC1 tolerance, cellular fatty acids, DNA G+C content, and antibiotic susceptibility have been observed. To date six species assigned to four genera and three families have been described.

The family Bdellovibrionaceae is comprised of Bdellovibrio bacteriovorus and Bdellovibrio exovorus. These bacteria were isolated from fresh water and exhibit a DNA G+C content ranging from 46.1 - 51.5 mol%.4-6 The family Bacteriovoracaceae includes Bacteriovorax marinus and

Bacteriovorax litoralis. Bacteriovorax spp. differ from Bdellovibrio spp. in a variety of characteristics.7 The most notable phenotypic difference between the Bacteriovoracaceae and

Bdellovibrionaceae is the requirement of NaC1 for growth by Bacteriovorax spp.8 The most notable genotypic differences are that Bacteriovorax spp. have a lower DNA G+C content (37.7 -

38.3 mol%), and two key variations in their 16S rRNA secondary structure. Helices formed starting at nucleotide positions 195 and 451 (according to Escherichia coli numbering) are substantially longer in Bacteriovorax spp. than the Bdellovibrio spp.9'1° The most recently described family, Peredibacteraceae, contains two species, Peredibacter starrii, and

Bacteriolyticum stolpii.1°' 11 Based on phylogenetic analysis of the 16S rRNA gene this family of bacteria demonstrates a closer association with Bacteriovorax spp. than Bdellovibrio spp.;

186 however, these bacteria do not require NaC1 for growth, and have a higher DNA G+C content

(41.8 - 43.5 mol%) than Bacteriovorax spp.

5.1.2 Overall Objective of Study

The overall objective of this study was to compare the available 'phenotypic, genotypic, and chemotaxonomic data on characterized BALO and propose the addition of a novel family,

Pseudobacteriovoraceae, to accommodate the novel genus and species Pseudobacteriovorax antillogorgiicola for the strain RKEM611.

5.2 Materials and Methods

5.2.1 Collection and Bacterial Isolation

Samples of Antillogorgia elisabethae were collected aseptically at a depth of —10 m by SCUBA off the coast of San Salvador, The Bahamas in November 2011. The samples were treated as described in Chapter 4 Section 4.2.1. Plates were incubated at 21°C and strain RKEM611 was isolated within one week of initial plating. The strain was grown in Marine Broth 2216 (MB;

BD, Difco) for 24 h at 30°C and 250 rpm, and preserved in 25% (v/v) glycerol at -80°C.

5.2.2 Phenotypic Experiments

The Gram reaction was determined using a Gram stain kit (BD Difco). Cell morphology was examined using a phase-contrast microscope (Leica DME; EC3 Microsystems), and transmission electron microscopy (TEM) (Hitachi BioTEM 7500; Nissei-Sangyo). For TEM, cells were fixed with 3% (v/v) glutaraldehyde in SFSW then stained with either 5% (w/v) uranyl acetate in SFSW or 1% (w/v) sodium phosphotungstate in distilled water. Samples were viewed on a Hitachi

1:87 H7500 BIO-Transmission Electron Microscope (Nissei-Sangyo, Rexdale, Ontario) at an acceleration voltage of 80kV. Images were obtained using an ATM XR40 side mount digital camera with Image Capturing Engine Software, Version 600.149 (Advanced Microscopy

Techniques, Danvers, MA, USA).

The optimal pH, salinity, and temperature growth ranges were determined by measuring turbidity

(0D600) of broth cultures using a NanoDrop spectrophotometer (ND-1000; NanoDrop

Technologies). All growth studies were conducted in broth culture medium at 250 rpm for 3 days and performed in triplicate. The optimal pH range was determined in MB using the following buffers: pH 3.0-4.0, glycine/HC1; pH 4.0-8.0, citrate/Na2HPO4; pH 6.0-8.0, phosphate buffer; pH 9.0-11, glycine/Na0H. Growth was tested at intervals of 1.0 pH unit. The pH was adjusted prior to sterilization, and then verified after sterilization prior to inoculation, and again after the growth experiment. The optimal salinity range was determined in NaCl-free MB prepared according to the manufactures recipe (BD, Difco), NaCl was then supplemented into the media at 0, 0.5, and 1-10% (w/v) in increments of 1%. Both optimal salinity and pH growth ranges were determined at 30°C. The optimal temperature was determined in MB at 4, 15, 22,

30, 37, and 45°C. All media used to determine optimal growth conditions were filtered prior to inoculation to remove particulates (0.2 µm polyethersulfone membrane, Nalgene Rapid FlowTm).

A comparison of optimal growth conditions for all characterized BALO is provided in Table 5.1.

Anaerobic and microaerophilic cultivation was tested on MA at 30°C using a gas generating and pouch system (BD GasPak EZ).

188 5.2.3 Chemotaxonomic Experiments

Fatty acid methyl esters (FAME) and respiratory quinones was carried out by the Identification

Services of the DSMZ (Braunschweig, Germany). Biomass for analysis was obtained from cells

in the stationary phase of growth after 48h in MB at 30°C and 250 rpm. DNA G+C content was

determined by HPLC using the method described by Mesbah et a/.12 Predominate FAMEs were

determined by saponification, methylation, and extraction of the biomass using the method by

Miller13 with minor modifications. The FAME mixtures were separated using a Sherlock

Microbial Identification System (MIS) (MIDI, Microbial ID).14 A comparison of DNA G+C and

FAME content of characterized BALO is provided in Table 5.1. Respiratory quinones were

extracted with methanol:hexane, followed by a phase extraction into hexane as described by

Tinda11.15'16

Oxidase and catalase activity was determined using commercially available reagent stains and

droppers (BD, Difco). Enzymatic activity and carbon utilization was determined using API ZYM

(bioMerieux), API NE 20 (bioMerieux), GN2 MicroPlates (Biolog), and API CH (bioMerieux)

kits. The API ZYM strips were read after 4 h at 37°C, the API NE 20 strips and GN2

Micronates were read after 24 h and 48 h at 30°C. For API CH the CHB/E Medium was used

and the strips were read after 24 h and 48 h at 30°C. The tests were performed according to the

manufacturer's recommendations with the exception that the final NaC1 concentration of the

suspension media for the API NE 20, MicroPlate GN2, and API CH kits were adjusted to 2%

(w/v) NaCl.

. Antibiotic susceptibility was determined using a disk diffusion method.17 RKEM611T was grown

in MB for at 30°C and 250 rpm for 24 h after which the optical density of the culture was

standardized to a 0.5 McFarland standard and spread onto MA plates. Disks containing the

189 following antibiotics were tested: methicillin (5 jig), ampicillin (20 jig), kanamycin (30 jig),

novobiocin (30 jig), penicillin G (10 µg), streptomycin (10 jig), nalidixic acid (5 jig), vancomycin (30 µg), neomycin (30 µg), and gentamycin (10 µg). Inhibition zones were observed after 48 h at 30°C and zones > 2 mm were scored as susceptible. A comparison of the antibiotic profiles of characterized BALO is provided in Table 5.1.

Predatory behavior of RKEM611T was assessed using the double-layer agar plaque-forming assay with slight variations to previously described methods.4'18'19 Gram-negative bacteria that were isolated from the same octocoral as RKEM611T, and that belonged to a taxonomic genus that had been previously shown to be capable of infection were used as potential prey.20 All isolates were grown in MB at 30°C and 250 rpm for 24 h. Culture turbidity was measured on a

NanoDrop spectrophotometer (ND-1000; NalioDrop Technologies) and adjusted to an 0D600 between 0.04 — 0.06 (1 mm path length) prior to plating. Three plating techniques were performed all used MA as the bottom layer and saline soft agar as the top layer (0.7% (w/v) agar,

2% (w/v) NaC1). All plating techniques were performed in triplicate. Samples were plated with either potential prey bacteria on the bottom layer and RKEM611T in the top layer, RKEM611T on the bottom layer and potential prey bacteria in the top layer, or equal amount of both

RKEM611T and potential prey bacterial in the top layer. Plates were incubated at 30°C for 14 days and plaque formation assessed every 24 h.

5.2.4 Genotypic Experiments

Analysis of DNA G-FC content was carried out by the Identification Services of the DSMZ. For phylogenetic analysis, genomic DNA was extracted using the UltraClean Microbial DNA

Isolation Kit (MoBio Laboratories, Inc.) from cells grown in MB at 30°C and 250 rpm for 2

190 days. All PCR reaction mixtures consisted of a 1X concentration of EconoTaq PLUS GREEN

2X master mix (Lucigen), 1.0 pM of each primer, 5% (v/v) DMSO, and 40 ng of template DNA.

PCR amplification of the 16S rRNA gene was achieved using the universal eubacterial 16S

rRNA gene primers pA (5'-AGAGTTTGATCCTGGCTCAG-3') and pH (5'-

AAGGAGGTGATCCAGCC-

3').2I These primers, in addition to 530R (5'-GTATTACCGCGGCTGCTG-3')22, 514F (5'-

GTGCCAGCASCCGCGG-3'), 936R (5'-GGGGTTATGCCTGAGCAGTTTG-3'),23 and 1114F

(5'-GCAACGAGCGCAACCC-3')24 were used to sequence the nearly full-length 16S rRNA gene. PCR amplification of a region of the fl-subunit of the RNA polymerase (rpofi) from nucleotide 2073 - 3315 (according to Bacteriovorax marinus SJ numbering) was carried out as previously described.10 Both the forward and reverse primers were used to sequence the rpofi amplicon. Sequencing was performed by Eurofins MWG Operon (Huntsville, AL, USA).

Sequences were trimmed and assembled using Vector NTI Express (Invitrogen, Life

Technologies) (16S rRNA, 1466bp; rbofi, 1135bp), and compared to available sequences in the

GenBank database.25 Multiple sequence alignments were prepared using MEGA version 6.26

Phylogenetic histories were inferred using maximum-parsimony (MP),27 minimum evolution

(ME),28 and neighbor-joining (NJ) methods.29 The topology for all phylogenetic trees generated using the 16S rRNA and rpofi sequences were consistent (Appendix A). Evolutionary distance matrices were generated using the Jukes-Cantor method3° and are in units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated. Bootstrap analysis is based on 1000 resampled datasets.31 The MP trees were obtained using the Subtree-

Pruning-Regrafting algorithm with search level 1 in which the initial trees were obtained by the random addition of sequences. The ME trees were searched using the Close-Neighbor-

191 Interchange algorithm at a search level of 1.32 The final dataset of the 16S rRNA and rpofi sequences consisted of 1150 and 973 nucleotide positions, respectively.

Analysis of 16S rRNA secondary structures were achieved through alignment of BALO 16S rDNA genes to Escherichia coli (J01695.2) using MEGA version 6.26 Computational investigation Of mRNA folding was achieved using MFOLD.33

5.3 Results and Discussion

5.3.1 Phenotypic and Chemotaxonomic Analysis

Phenotypic analysis of RKEM611T revealed characteristics consistent with those of other

BAL01'2 The strain was Gram-negative, an obligate aerobe, and exhibited a biphasic morphology. Cells were either vibriod with a single polar flagella (0.4-0.61im in diameter and

1.0-2.0 lam in length), or filamentous with no flagella (0.4-0.6 pm in diameter and 1.0-25.0 [tm in length) (Figure 5.1). Predatory behavior was observed via the formation of plaques in confluent lawns of Pseudoalteromonas sp. RKEM680 (KJ719255). This activity was observed when

RKEM611T was plated on the bottom layer of the double-layer agar and Pseudoalteromonas sp.

RKEM680 on the top layer. However after subsequent transfers on solid media RKEM611T appeared to lose predatory activity against Pseudoalteromonas sp. RMEK680.1'18 No predatory behavior was observed against any of the other bacteria isolates that were used as potential prey.

While these phenotypic characteristics are common to all BALO, the requirement of NaC1 for growth of RKEM611T aligned this bacterium most closely with the family Bacteriovoracaceae.

192 Table 5.1. Differential characteristics of strains representing the order Bdellovibrionales.

Type strains: 1, Pseudobacteriovorax antillogorgiicola RKEM611; 2, Bacteriovorax marinus

SJT ;8 3, Bacteriovorax litoralis JS5T;8 4, Bacteriolyticum stolpiiUKif ;711 5, Peredibacter starrii

A3.121- ;711 6, Bdellovibrio bacteriovorus 1 0911..158 ±, Positive; —, negative; W, weak positive;

V, variable; ND, no data available; R, resistant; S, susceptible. All results are for the prey independent derivatives of each strain.

1 2 3 4 5 6 Characteristic Na+ required for growth Optimal growth salinity (%,w/v) 1-2 2-3 5 ND ND ND Optimum growth temperature (°C) 30-37 15-30 15-35 15-35 20-30 15-35 DNA G+C content (rnol%) 46.3 37.7 37.8 41.8. 43.5 51.5

C15.1co8cC C16:1c09c C1610)5C C1301S0 Major fatty acids ND ND 13:0 ND C160 C13:0 C130150 C15:1(08C

Enzyme Activities Tested: Alkaline phosphate + + + ND ND + Esterase (C4) W + + ND ND + Esterase lipase (C8) W + + ND ND + Lipase (C4) V — ND ND — Leucine aminopeptidase + + + ND ND + Valine aminopeptidase W + + ND ND — Cystine aminopeptidase W + V ND ND — Trypsin + + ND ND + a-chymotrypsin — ND ND + Acid phosphate + + ND ND + Phosphoamidase + + + ND ND + a-Galactosidase — ND ND f3-Galactosidase — ND ND — 13-Glucuronidase — — — ND ND a-Glucosidase — ND ND — P-Glucosidase — — — ND ND — N-Acetyl-13-glucosaminidase V ND ND a-Mannosidase — ND ND — a-Fucosidase — — ND ND — Antibiotic Sensitivity: Methicillin (5 jig) R R R S S S Ampicillin (20 jig) R R* - R* ND ND S* Kanamycin (30 jig) S S R S S S Novobiocin (30µg) R ND ND ND ND S Penicillin G (10 jig) R ND ND S S R Streptomycin (10 jig) R ND ND S S ND

193 Nalidixic Acid (5 gg) R R V S R R Vancomycin (301,tg) R R R S S V Neomycin (30 fig) S ND ND S S . S Gentamycin (10µg) S ND ND S S S *Antibiotic tested against was ampicillin/sublactam (20 ug)

194

r(b)

( 2 microns

Figure 5.1. Transmission Electron Micrograph Images of RKEM611.

195 5.3.2 Genotypic Analysis

BlastN analysis of the 16S rRNA gene revealed low sequence identity to any taxa within the

order Bdellovibrionales, the highest being Bacteriovorax marinus (82%). Higher sequence

identities were observed between RKEM611T and various taxa within the class

Deltaproteobacteria such as, Geobacter psychrophilus (85%) and Desulfovibrio senezii (83%).

Comparable sequence identities were also observed between taxa within the class

Alpharoteobacteria such as, Neptuniibacter caesariensis (84%) and Psychromonas

macrocephali (83%). Based on the evolutionary distance and phylogenetic relationship computed by the Jukes-Cantor distance model and NJ method RKEM611T clustered within

Deltaproteobacteria and demonstrated a closer association to members within the order

Bdellovibrionales than any other order within Deltaproteobacteria (Figure 5.2). However no• strong association to any family within the order was observed.

10 A previous study by Pineiro et al. examined variations in the rpoB gene of BALO. They found that there was greater nucleotide variation when compared to the 16S rRNA gene, and that this variation allowed for a narrower delineation of phylogenetic groups within BALO. Similar to phylogenetic analysis employing the 16S rRNA gene, analysis of the RKEM611T rpoB gene placed the strain within the Bdellovibrionales but did not reveal a strong association to any family (Figure 5.3).

Alignment and comparison of the secondary structure of BALO 16S rRNA reveals three key variations starting at nucleotide positions 180, 195, and 451 according to E. coli (J01695.2) numbering (Figure 5.4 and Figure 5.5). Members of the family Bdellovibrionaceae have

196 considerably shorter helices than all other BALO starting at nucleotide positions 195 and 451, as previously reported.9 The secondary structure of the RKEM 611T 16S rRNA exhibits similar length in helices at nucleotide positions 195 and 451 as members of the families

Bacteriovoracaceae and Peredibacteracea.• However, it differs from all other BALO by having a substantially shorter helix starting at nucleotide position 180. These variations in secondary structure further demonstrate that RKEM 611T has no strong association with any particular family within the Bdellovibrionales.

197

0.02 56 Alcanivorax borkumensis SK2T (Y12579) 96 Marinobacterium sediminicola CN47T (EU573966) Ectothiorhodospira shaposhnikovii NIT (FR733667) Xanthomonas oryzae YK9T (X95921) 98 Aquaspirillum putridiconchylium ATCC 15279T (AB076000) Thiobacillus aquaesulis DSM 4255T (U58019) 100 Coffimonas fun givorans Ter6T (AJ310394) 67 Methylobacillus glycogenes T-11T (FR733701) Magnetococcus marinus MCA T (NR074371) Acidomonas methanolica MB58T (X77468) 76 Oceanicola granulosus HTCC2516T (AY424896) 68 Caulobacter segnis MBIC2835T (AB023427) 98 63 Shine/la yambaruensis MS4T (AB285481)

100 Bdellovibrio bactetiovorus HD100T (AJ292759) Bdellovibrio exovorus jSST (EF687743) Pseudobacteriovorax antillogorgiicola RKEM611T (KJ685394) r-- Peredibacter starrii A3.12T (AF084852) I 100 Bacteriolyticum stolpii Uki2T (AJ288899I 1g7 Bactenovorax litoralis JS5T (AF084859) 99 Bacteriovorax marinus SJT Vk.F084854) Nautifia profundicola AmHT (AF357197) Thioreductor micantisoll DSM 16661T (AB175498) 100 99 Arcobacter cibanus LMG 219996T (AJ607391) 66 Helicobacter acinonychis 90-119T (M888148)

53 Desulfobacterium autotrophicum DSM 3382T (AF418177) Desulfocapsa sulfoexigens SB164P1T (Y13672) Desulfomicrobium thermophilum P6.2T (AY464939) 98 Desulfovibrio senezii CVLT (AF050100) Desulfacinum infemum BaG1T (L27426) 99 Thermodesulforhabdus norvegicus A8444T (U25627) 53 Desulforhabus amnigenus ASRB1T. (X83274) • 100 Desulfovirga adipica TsuA1T (AJ237605) 64 Desulfobacca acetoxidans ASRB2T (AF002671) Desulfarculus baarsii DSM 2075T (NR041850) Syntrophorhabdus aromaticivorans UIT (AB212873)

95 Jahnella thaxteri PI t4T (GU207876) Nannocystis pusilla Na p29T (FR749907) — Archangium gephyra DSM 2261T (DQ768106) 100 — Cystobacter badius Cb b2T (DQ768108) Myxococcus fulvus ATCC 25199T (DQ768117) Geobacter metaffireducens GS-15T (L07834)

100 _ Geobacter pelophilus Dfr2T (U96918) 72 Pelobacter propionicus DSM 2379T (NR074975)

198 Figure 5.2. Neighbor-joining phylogenetic tree based on 16S rRNA gene sequences from 46

type strains from within the phylum Proteobacteria. Evolutionary distances were computed using the Jukes-Cantor method, a total of 1150 nucleotide positions were used. Bootstrap values are expressed as a percentage of 1000 replicates, bootstrap values < 50% are not shown. Bar, 2 substitutions per 100 base pairs. Brackets indicate the classes Alpha(a)-, Beta (/3)-, Gamma(7)-,

Delta(o), and Epsilon(c)-Proteobacteria. The large black box indicates the order

.Bdellovibrionales. The small grey boxes indicate the families Bacteriovoracaceae (solid line),

Peredibacteraceae (dotted line) and Bdellovibrionaceae (dashed line). The tree was generated using Dinococcus radiodurans MRPT (Y11332), Bacillus subtilis DSM 10T (AJ276351), and

Spirochaeta litoralis DSM 2029T (FR733665) as outgroups (not shown).

199 Bacteriovorax sp. IP (EF536804)

Bacteriovorax sp. MED2 (EF536815)

Bacteriovorax sp. MANZ3 (EF536765) 83 Bacteriovorax sp. MB2 (EF536782) 83 Bacteriovorax sp. 0C3 (EF536786)

Bacteriovorax sp. PS93S (EF536771)

Bacteriovorax sp. MIA2 (EF536791)

Bacteriovorax sp. 008 (EF536797) 100 55 Bacteriovorax sp. HA5 (EF536799)

Bacteriovorax sp. GSL37 (EF536805)

Pseudobacteriovorax antillogoriicola RKEM611 (KM272985)

100 — Bdellovibrio bacteriovorus HD100 (NC005363)

100 Bdellovibrio bacteriovorus Tiberius (NC019567)

Desulfobacterium autotrophicum HRM2 (NC012108)

Geobacter metaffireducens GS-15 (CP000148) 100 Desulfovibrio vulgaris DP4 (NC008751) 0.2 51 62 Geobacter bemidjiensis Bern (NC011146)

Figure 5.3. Neighbor-joining phylogenetic tree based on 17 rpoll gene sequences from

Deltaproteobacteria. Evolutionary distances were computed using the Jukes-Cantor method, a total of 973 nucleotide positions were used. Bootstrap values are expressed as a percentage of

1000 replicates, bootstrap values < 50% are not shown. Bar, 20 substitutions per 100 base pairs.

200 180 221 4 Bd. bacteriovorus HD100T TAAGACCACAGGAGCTGCGGCTCTAGGGGTCAAAGG TTTTTCGC Bd. exovorus JSST TAAGACCACAGGATCTGCGGATCTAGGGGTTAAAGG TTTTTCGC B. stolpii Uki2T TACGAAGCACGGTTTT--AAGACTGTGCTTGAAAGAATGCCTCTGCAT--ATGCATTCGC P. starrii A3.12T TACG TTAGTAA TAAGAAAGTGGGC-GCCGCAAGG--GCTCATGC By. marinus SJT TACGTACTGCAATTTTG-AAAGTAGCAGTAGAAAGAATGCCTCTCCTTGGAAGCATTTAC By. litoralis JS5T TACGCAAAGTGAATTT-GGAAGTAGCTTTGGAAAGAATGCCTCTCCTTGGAAGCATTTAC P. antillogorgiicola RKEM611T TGGTC TCTTCG GAGTAAACGAGGCCTCTACTTGTAAGCTACGGC E. coli TAACGTCGC AAGA CCAAAGAGGGGGACCTTCGGG--CCTCTTGC ***

451 482 4 4 Bd. bacteriovorus HD100 T AACA AA TGA Bd. exovorus JSST AACA AA TGA B. stolpii Uki2T AATGGCAGTTGGTCTAATAGGCCGATTGTTTGA P. starrii A3.12T AATGATTACAGAGCTAATAC-CCTGTAAAGTG4 By. marinus SJT AATGGTGTAGGGTCCAATAGGCCTTACATTTGA By. litoralis JSST AATGGTCATTGTTCTAACAGGGCAGTGATTTGA P. antillogorgiicola RICEM611T AAGGGCGTTTAGTCAAATAGGCTAGACGTCTGA E. coli AAGGG-AGTAAAGTTAATACCTTTGCTCATTGA ** .** ***

Figure 5.4. Clustal W multiple aligment of the 16S rRNA gene of type strains in the order

Bdellovibrionales. Nucleotide positions are based on E. coli numbering (J01695.2)

201

P. antillociorgiicola RKEM61 11. By. marinus SJT B. stolpii Uki2T Bd. bacteriovorus HD1 00T

G , U, A U-A U G b-a' i-.J-i,‘ 6 A sU-G' Y-•"?' A-U Y-9 6-A a-C 44 ik-Y ,G-U . " 6-6 A A 6-6 Q-9 a, a U-C, 94 A-6 A d 0 G Y-'?' 6-6 'C-G' 180 180 Q-9 6-6 d-a , 180 180 4 U-G-G-U-a-a-U-A-A-A U-A-C-G-U-A-G-A-A-A U-A-C-G-A-O-G-A-A-A U-A-A-G-C-A-A-A - ,C-U, C - u • C p . U 11-G ,C-A , A , a-e G A c - Lr 'u-G Li 'A' 0-A C-G a • A d A GII 6-6 C-G a-a G-U 4-Y 6-A ,u, • A-6 6-6 195 P,s.'f's 195 195 , 195 u u 9-Q A-0 • U-A 1 9-Y A-A-A-C-G-G-9 A-A-A-6-6-A-C A-A-A-G-U-G-C A-A-A-G-C-G-C , A A U , A , A A A U sC-G as A 6 A 1:1-6 C-G C-G' .- a-a Y.-4 A-6 G -C d-4 6-A -Q -Q 6-6 . G-U U-G 0-A 4-1;i C.J4 6-6 Y-P:, .9-Y. a-a 9-9 P.'-Y a-6 451 451 U-A, , C-G G-C 451 451 1 9-y AU A-A-U-G-U-U-G-A A-A-U-G-U-U-G-A A-A-C-G-A

Figure 5.5. 16S rRNA secondary structure helicies for represenative bacterial type strains from each family within the order Bdellovibrionales. Nucleotide positions are based on E. coli numbering (J01695.2) between positions 180-221 and 451-482.

202 5.4 Formal Species Description

Based on the phenotypic similarities observed between RKEM611T and other BALO it is clear that the strain is a member of the order Bdellovibrionales. However, based on the phylogen0c distance observed between the 16S rRNA genes and the variations in their secondary structure, the strain represents a member of a novel family. The name Pseudo bacteriovoraceae fam. nov. and Pseudobacteriovorax antillogorgiicola gen. nov., sp. nov., are proposed for this taxon.

5.4.1 Description of Pseudobacteriovorax gen. nov.

Pseudobacteriovorax (Pseu. do. bac. te. ri. o. vo'rax. Gr. adj. pseudes, false; N. L. masc. n.

Bacteriovorax, a bacterial genus name; N. L. masc. n. Pseudobacteriovorax, false

Bacteriovorax) Consists of Gram-negative bacteria that are capable of predation on other Gram- negative bacteria. The description of this genus is the same as that of the type strain and only species in the genus, Pseudobacteriovorax antillogorgiicola.

5.4.2 Description of Pseudobacteriovorax antillogorgiicola sp. nov.

Pseudobacteriovorax antillogorgiicola (an.ti.lo.gor.gi.i'co.la N.L. n. Antillogorgia name of a zoological genus; L. masc. suff. -cola (from L.n. incola) inhabitant; N.L. n. antillogorgiicola, name of a zoological genus; N.L. n. antillogorgiicola, Antillogorgia inhabitant). Cells are Gram- negative, obligate aerobes, which exhibit a biphasic lifestyle. Cells were either vibriod with a single polar flagellum (0.4-0.6 pm in diameter and 1.0-2.0 µm in length), or filamentous with no flagellum (0.4-0.61AM in diameter and 1.0-25.0 pm in length). Colonies are light yellow in colour after 48 h of growth on MA. Optimum growth occurs at 1-2 % (w/v) NaCl, 30-37°C, and pH 6.0-

8.0. Enzymatic activities for catalase, oxidase, alkaline phosphate, esterase (C4), esterase lipase

203 (C8), leucine aminopeptidase, valine aminopeptidase, cystine aminopeptidase, acid phosphate,

and phosphoamidase were detected. Carbon utilization of dextrin, glycogen, Tween 40, Tween

80, and D-galactose was detected. Resistant to the antibiotics methicillin, ampicillin, novobiocin, penicillin G, streptomycin, and vancomycin. Susceptible to kanamycin, neomycin, and

gentamycin. The predominant cellular fatty acids were C16:1 co5c, C16:0, and the major respiratory

quinone was menaquinone MK-6.

100521T, The type strain, RKEM611T (=NCCB =LMG 28452T) was isolated from the octocoral

Antillogorgia elisabethae off the coast of San Salvador, The Bahamas. The DNA G+C content of the type strain is 46.3 mol%

5.4.3 Description of Pseudobacteriovoraceae fam. nov.

Pseudo bacteriovoracaceae (Pseu.do.bac.te.ri.o.vo.ra.ce'ae., N.L. masc. n. Pseudobacteriovorax, a bacterial genus; suff. —aceae, ending to denite a family; N.L. fem. pl. n.

Pseudobacteriovoraceae, the Pseudobacteriovorax family). The description of the family

Pseudobacteriovoracaceae is based on the description of the genus Pseudobacteriovorax from the data of this study. The family consists of Gram-negative, obligate aerobes, which exhibit a• biphasic lifestyle. Secondary structure of the 16S rRNA reveals longer helices starting at nucleotide positions 195 and 451 (according to E. coli numbering), as is observed in the family

Bacteriovoracaceae, but a shorter helix at nucleotide position 180. The type genus is

Pseudobacteriovorax.

204 5.5 References

Seidler, R. J.; Starr, M. P. J. BacterioL 1969, 100 (2), 769-785.

Snyder, A. R.; Williams, H: N.; Baer, M. L.; Walker, K. E.; Stine, 0. C. mt. J. Syst

Evol. Microbiol. 2002, 52 (6), 2089-2094.

Garrity, G. M.; Bell, J. A.; Lilburn, T. In Bergeys Manual of Systematic Bacteriology;

Brenner, N. R., Krieg, J. T., Staley, J. T., Garrity, G. M., Eds.; Springer: New York,

2005; Vol. 2, Chapter 7, pp 1040-1058.

Stolp, H.; Starr, M. P. Ant. van. Leeuw. 1963, 29 (1), 217-248.

Seidler, R. J.; Starr, M. P.; Mandel, M. J. Bacteriol. 1969, 100 (2), 786-790.

Koval, S. F.; Hynes, S. H.; Flannagan, R. S.; Pasternak, Z.; Davidov, Y.; Jurkevitch, E.

Int. J. Syst. Evol. Microbiol. 2013, 63 (1), 146-151.

Baer, M. L.; Ravel, J.; Chun, J.; Hill, R. T.; Williams, H. N. Int. J. Syst Evol. Microbiol.

2000, 50 (1), 219-224.

Baer, M. L.; Ravel, J.; Pifieiro, S. A.; Guether-Borg, D.; Williams, H. N. Int. J. Syst

Evol. Microbiol. 2004, 54 (4), 1011-1016.

Davidov, Y.; Jurkevitch, E. Int. J. Syst Evol. Microbiol. 2004, 54 (5), 1439-1452.

Pitieiro, S. A.; Williams, H. N.; Stine, 0. C. Int. J. Syst Evol. Microbiol. 2008, 58 (5),

1203-1209.

Seideler, R. J.; Mandel, M.; Baptist, J. N. J. BacterioL 1972, 109 (1), 209-217.

Mesbah, M.; Premachandran, Ti.; Whitman, W. B. Int. I Syst Evol. Microbiol. 1989, 39

(2), 159-167.

Miller, L. T. J Clin. Microbiol. 1982, 16 (3), 584-586.

205 Sasser, M. Identification of bacteria by gas chromatography of cellular fatty acids.

MIDI Technical Note 101. Newark, DE: MIDI Inc., 1990.

Tindall, B. J. Syst. Appl. Microbiol. 1990, 13 (2), 128-130.

Tindall, B. J. FEMS Microbiol. Lett. 1990, 66 (3), 199-202.

Bauer, A. W.; Kirby, W. M. M.; Sherris, J. C.; Turck, M. Am. J. Clin. Pathol. 1966, 45'

(4), 493-496.

Marbach, A.; Varon, M.; Shilo, M. Microb. EcoL 1975, 2 (4), 284-295.

Williams, H. N.; Falkler, W. A., Jr. Can. I Microbiol. 2011, 30 (7), 971-974.

Chen, H.; Young, S.; Berhane, T.-K.; Williams, H. N. PLoS ONE 2012, 7 (3), e34174.

Edwards, U.; Rogall, T.; Blocker, H.; Emde, M.; Bottger, E. C. Nucleic Acids Res. 1989,

17 (19), 7843-7853.

Manefield, M.; Whiteley, A. S.; Griffiths, R. I.; Bailey, M. J. Appl. Environ. Microb.

2002, 68 (11), 5367-5373.

Gontang, E. A.; Fenical, W.; Jensen, P. R. Appl. Environ. Microb. 2007, 73 (10), 3272-

3282.

Lane, D. J. Nucleic Acid Techniques in Bacterial Systematics; Stackebrandt, E.,

Goodfellow, M., Eds.; Wiley & Sons: Chichester, 1991; pp 115-147.

Altschul, S. F.; Madden, T. L.; Schaffer, A. A.; Zhang, J.; Zhang, Z.; Miller, W.;

Lipman, D. J. Nucleic Acids Res. 1997, 25 (17), 3389-3402.

Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. Mol. Biol. EvoL 2013, 30

(12), 2725-2729.

Eck, R. V.; Dayhoff, M. 0.1 Med. Chem. 1970, 13 (2), 337-339.

Rzhetsky, A.; Nei, M. Mol. Biol. Evol. 1992, 9 (5), 945-967.

206 Saitou, N.; Nei, M. Mol. Biol. Eva 1987, 4 (4), 406-425.

Jukes, T. H.; Cantor, C. R. Evolution of protein molecules; Munro, H. N., Ed.; Academic

Press: New York, 1969; Vol. 3, pp 21-132.

Felsenstein, J. Evolution 1985, 39 (4), 783.

Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press:

New York, 2000.

Zuker, M. Nucleic Acids Res. 2003, 3/ (13), 3406-3415.

207 Chapter 6: Investigation of Secondary Metabolites Produced by Octocoral-Associated

Bacteria

208 6.1 Introduction

6.1.1 Secondary Metabolites from Marine Bacteria .

Marine bacteria have increasingly become a major focus in marine natural products (MNPs) research, as the rate at which secondary metabolites are being discovered is steadily increasing.1"

8 Marine prokaryotes have developed unique metabolic capabilities that enable them to live in various extreme ocean habitats. Over the course of the last few decades a variety of taxonomically diverse marine bacteria have been isolated that produce a broad range of chemically diverse compounds. While the taxonomic phylum Actinobacteria is by far the most prolific source of secondary metabolites,9-12 novel compounds have also been isolated from phyla such as Proteobacteria, Cyanobacteria, and Firm icutes, as well as various unclassified bacteria.I3-21 The secondary metabolites produced by these bacteria are not only structurally diverse but also exhibit a wide variety of bioactivity, including but not limited to antimicrobial, anticancer, anti-inflammatory, antiparasitic, antiviral, and antioxidant activity.22-29

6.1.2 Chemical Dereplication

Even though the field of bacterial MNP research is rapidly growing and these metabolites continue to be an excellent source of bioactive compounds, finding novel secondary metabolites is becoming increasingly difficult. Many of these compounds are ubiquitous in the marine microbiome and isolation of previously discovered secondary metabolites is common. In order to address this issue, our lab developed a chemical dereplication process,3° which allowed for the identification of unique metabolites in large batches of bacterial fermentations. This method uses a metabolomics approach and combined ultra-high performance liquid chromatography-high resolution mass spectroscopy (UHPLC-HRMS) data from bacterial fermentation extracts with

209 principal component analysis (PCA)31 to identify unique metabolites. This is achieved by growing the bacterial isolates in small-scale liquid fermentations and analysing the extracts from these fermentations using UHPLC-HRMS. The data sets of metabolites are then bucketed based on the m/z ratio and retention time (RT). Metabolites are scored with a 0 or 1 depending on their presence or absence in a particular extract. This bucketed data is than subjected to PCA where bacterial isolates that produce the same metabolites group together, and isolates that produce unique metabolites group separately. The scores plot, which represents a view of the variance between data sets, allows for visualization of this separation. The greater the separation, the greater the difference of the metabolites that a particular strain produces compared to the others.

The loadings plot, which is geometrically related to the scores plot describes the variance observed in the scores plot and is used to identify the buckets (m/z and RT) responsible for the observed separation. By using this method a large amount of bacterial extracts can be screened in an efficient and rigorous manner.

6.1.3 Overall Objective of Study

The overall objective of this study was to ferment and screen the secondary metabolites produced by the bacterial isolates in the culture dependent library (Chapter 4), as well as select isolates from an Erythropodium caribaeorum culture library. All fermentation extracts were subjected to the aforementioned chemical dereplication process in order to identify unique and possible novel secondary metabolites. In addition, as all the bacterial isolates used in this study were obtained from the octocorals Antillogorgia elisabethae and E. caribaeorum and there is a growing body of evidence to suggest that MNPs isolated from macroorganisms are actually biosynthesised by associated microorganisms.

210 All extracts were analysed for the presence of pseudopterosins and eleutherobins to determine if any of the isolates were capable of biosynthesising these pharmaceutically relevant MNPs under

laboratory conditions.

6.2 Materials and Methods

6.2.1 Initial Small-Scale Screening

All bacterial isolates from the culture dependent library (Chapter 4), as well as Pseudomonas spp., Pseudoalteromonas spp., and Ruegeria spp. from a culture dependent library of bacteria isolated from E. caribaeorum (created by Brad Haltli - Research Manager, Nautilus Bioscience and Adjunct Faculty, University of Prince Edward Island) were subjected to small-scale (10 L) fermentations. Bacteria were grown from frozen glycerol stocks on Marine Agar (MA; 2216; BD

Difco). Cultures from MA were inoculated into Marine Broth (MB 2216, BD Difco; 10mL) seed cultures (48 hours, 250 rpm, 30°C), 1% of seed cultures were inoculated into 10mL fermentations using four different media. A list of the media used in this study is summarized in

Table 6.1. Proteobacteria were fermented in BFM1, BFM3, BFM5, and BFM11. Firmicutes and the one Cytophagia were fermented in BFM5, BFM6, BFM7, BFM11. Actinobacteria were fermented in BFM1, BFM3, BFM11, and ISP2. Media blank controls were included in each batch of fermentations.

Fermentations were grown for five days (250 rpm, 30°C), then extracted with Et0Ac (10mL), dried under vacuum, and partitioned between equal volumes of 80% aqueous ACN and hexane.

The ACN layers were dried down, re-suspended in Me0H to a final concentration of 0.5 mg/mL, and analysed using UHPLC-HRMS. UHPLC was performed using a Core-Shell 100 A C18

211 column (Kinetex, 1.7 pm 50 X 2.1 mm; Phenomenex, Torrance, CA, USA) with a linear solvent gradient over 5 min from 5% ACN in H20/0.1% formic acid to 100% ACN/0.1% formic acid followed by 3 min of 100% ACN/0.1% formic acid and an additional 2 min re-equilibration period of 5% ACN in H20/0.1% formic acid at a flow rate of 500tiL/min. Eluent was detected on an Accela Thermo equiped with MS-ELSD-UV detection systems (Thermo Fisher Scientific,

Mississauga, ON, Canada). ESI-MS monitoring (nilz 190-2000) in positive mode was achieved using an LTQ Orbitrap Velos Pro, ELSD on an LT-ELSD Sedex 80, and UV detection on an photodiode array (200-600 nm). The MS was operated under the following conditions: spray voltage, 3.0kV; capillary temperature, 320°C; S-Lens RF voltage, 66.0%; maximum injection time, 500ms; microscans, 3; injection volume, 101.1. The system was controlled by XCalibur

software (Thermo Fisher Scientific). •

212 Table 6.1. Fermentation media used in the screening of culture dependent bacterial isolates. All media were adjusted to a pH of 7.3 ± 0.2. •

Media and Ingredients Amount (g/L) Bacterial Fermentation Medium 1 (BFM1) Dextrin 20 Soluble Starch 20 Beef extract 10 Peptone 5 (1\11-14)2S 04 2 CaCO3 2 Instant ocean 18 Bacterial Fermentation Medium 3 (BFM3) MgSO4*7H20 0.5 KC1 0.5 K2HPO4 3 NaC1 5 Agar 0.4 Glycerol 12 Soy Peptone 5 Instant ocean 18 Bacterial Fermentation Medium 5 (BFMS) Pancreatic Digest of Casein 17 Enzymatic Digest of Soybean Meal 3 Sodium chloride 5 Dipotassium Phosphate 2.5 Dextrose 2.5 Instant ocean 18 Bacterial Fermentation Medium 6 (BFM6) Yeast Extract 5 Tryptone 5 FeC12-4H20 0.04 MnSO4-H20 0.00034 MgSO4-7H20 5 NaC1 .58.44 Instant ocean 18 Bacterial Fermentation Medium 7 (BFM7) K.H2PO4 1

K2HP 04 1

Mg S 04 -7H2 0 0.2

213 FeC13 • 0.05 CaC12-2H20 0.02 NaC1 5 Glucose 2 Yeast Extract 2 Instant ocean 18 Olive Oil** 5 ** Added individually to fermentation tubes/flasks to ensure even distribution Bacterial Fermentation Medium 11 (BFM11) Starch (potato) 10 Yeast Extract 4 Peptone 2 KBr Stock (20 g/L) 5 mL FeSO4-7H20 (8 g/L pH 7) 5 mL Instant ocean 18 International Streptomyces Project (ISP2) Yeast Extract 4 Malt Extract 10 Dextrose 4 Instant Ocean 18

214 6.2.2 Chemical Dereplication, Data Processing, and PCA

The data generated from the UHPLC-HRMS was processed using a modified version of a previously described chemical dereplication process.3° Raw data files were converted to netCDF files through the use of a software module contained within XCalibur. The netCDF files were imported into mzMine 2.2 (VTT Technical Research Centre, Otaniemi, Espoo, Finland) and lists of masses with an intensity value greater than 1.0E5 for each file were generated. Exact masses were built into a chromatogram for continuous detection across scans. Ions were considered part of an isotopic pattern if they were within 0.005 m/z units and 0.3 min. The masses were bucketed based on retention time. Buckets were defined as 0.01 m/z units and 0.2 min. Buckets that were present in the media control files were removed from the bacterial fermentation data files. The remaining buckets were exported into a comma separated value file (.csv) (Microsoft® Excel® for Mac 2011). PCA was achieved using The Unscrambler software (CAMO Software, Oslo,

Norway). Extracts that contained unique secondary metabolites grouped separately on the PC scores plot and the buckets responsible for the observed separation were identified on the PC loadings plot. The accurate mass for the [M+H] adduct of each metabolite in the buckets was determined as some of the bucket m/z values corresponded to the [M+Na], [M+NH3]±, or

[M+2H]2+ adducts. The accurate masses were screened through Antibase 2014 (Wiley-VCH,

Hoboken, NJ, USA) and Scifinder0 (Chemical Abstract Services, Washington, DC, USA) databases to identify those that belonged to previously reported secondary metabolites. Masses 32 33 that were within ± 5ppm of the calculated masses, ' and that had been previously isolated from close taxonomically related bacteria were considered a match. Standards of MNPs, pseudopterosins and eleutherobins, were analyzed on the UHPLC-HRMS and subjected to the same processing. Chemical barcodes were generated that contained the fermentation extract data

215 in addition to the MNP data. These barcodes were used to determine if any of the extracts

contained those MNPs.

6.2.3 Scale-up Fermentations

For metabolites that could not be readily identified by their accurate mass through a database

search, the fermentation of the bacterial isolate responsible was scaled up. The compounds of

interest were purified and analysed by NMR and/or tandem MS. For each scale-up, the bacterial

isolate was grown in six 1L fermentations (5 days, 250 rpm, 30°C), The fermentation broth was extracted using Et0Ac and the extract was fractionated using reverse-phase (RP) flash • chromatography on a CombiFlash® EX Prep (Teledyne, ISCO, Lincoln, NE, USA) equipped with a 43g C18 column (High Performance GOLD, RediSep Rf, Teledyne ISCO) and eluted at

30 mL/min with a linear solvent gradient from 10% Me0H in H20 to 100% Me0H. The fraction containing the metabolites of interest was further purified using RP-HPLC with a Luna 110 A phenyl hexyl column (5 tm, 250 mm x 10 mm, Phenomenex, Torrance, CA, USA) attached to a

Thermo Surveyor containing an ELSD Sedex 55 (Thermo Fisher Scientific).

6.2.4 NMR Spectroscopy

NMR spectra were acquired on a Bruker Avance 111 .600 MHz NMR spectrometer (Bruker,

Biospin Ltd., Milton, ON, Canada). Spectra were analysed using Mestrallova Software v9.1

(Mestrelab Research, Galicia, Spain), chemical shifts (8) were reported in parts per million

(ppm) and are relative to the residual solvent signals for DMSO-d6 (OH 2.50; 6c 39.5). The signal multiplicities are reported with the abbreviations singlet (s), doublet (d), triplet. (t), doublet of

216 triplets (dt), doublet of doublets (dd), doublet of doublets of doublets (ddd), quartet (q) and multiplets (m).

'6.2.5 Marfey's Method

The absolute configuration of leucine in the new long chain N-acyl leucine produced by

Halomonas sp. RKEM 883 was determined using Marfey's method.34 The secondary metabolite in addition to L- and D-leucine standards (Sigma-Aldrich, Oakville, ON, Canada) were hydrolyzed using HC1, then derivatized with N-(2, 4-dinitro-5-fluoropheny1)-L-alaninamide (L-

FDAA; Sigma-Aldrich). The 'reaction mixture was analyzed by UHPLC-HRMS using a Hypersil

Gold 100 A column (Thermo, 1.9 gm C18 50 mm X 2.1 mm). A flow rate of 400 gL/min and a linear gradient of 5% ACN in H20/0.1% formic acid to 40% ACN in H20/0.1% formic acid over

55 mm followed by a rapid increase to 100% ACN/0.1% formic acid over 2 min then held for 3 mm was used. The L-leucine standard eluted at 38.46 mm and the D-leucine at 43.96 mm.

6.2.6. Tandem Mass Spectrometry

Tandem MS spectra were obtained on a Thermo Orbitrap Velos mass spectrometer (Thermo

Fisher Scientific) using a collision-induced dissociation energy of 35V. Spectra were collected between a m/z of 200 and 2000 using XCalibur software.

6.2.7. Bioactivity Screening

The new long chain N-acyl L--leucine was screened for bioactivity as previously described by

Correa et al. 201135 against methicillin-resistant Staphylococcus aureus (MRSA; ATCC 33591), vancomycin-resistant Enterococci faecium (VRE, Ef 379, Wyeth), Staphylococcus warneri

217 (ATCC 17917), Pseudomonas aeruginosa (ATCC 14210), Proteus vulgaris (ATCC 12454),

Candida albicans (ATCC 14035), and Malassezia furfur (ATCC 38593) at concentrations of

7.81 pg/ml, 15.6 jig/ml, 31.3 jig/ml, 62.5 jig/ml, 125 pg/ml, 250 jig/ml, and 500 jig/mi.

6.3 Results and Discussion

All bacteria present in the culture dependent library, as well as select bacteria from a library generated from E. caribaeorum, were fermented in four different media and metabolites were detected using UHPLC-HRMS. The data from each extract was grouped by taxonomic phyla

(Actinobacteria, Firm icutes, and Proteobacteria) and analyzed using the aforementioned chemical dereplication process.3° The bacterial extracts that grouped separately on the scores plot were identified as well as the buckets responsible for the observed separation. The accurate mass for the metabolite in each bucket was determined and screened against natural product databases.

6.3.1 Secondary Metabolites from Actinobacteria

All 49 Actinobacteria in the culture dependant library (Chapter 4) were fermented in ISP2,

BFM3, BFM5 and BFM11, extracted with Et0Ac, and analysed on the UHPLC-HRMS. After processing, a total of 1174 buckets were generated and subjected to PCA. Five of the fermentation extracts formed distinctly separate clusters when comparing the PCs (Table 6.2;

Figures A.1.1-A.1.5). All the metabolites responsible for this clustering were putatively identified by their accurate mass as previously discovered secondary metabolites from

Actinobacteria (Table 6.3; Figure A.2.1-A.2.5).

218 Streptomycetes sp. RKEM 1715 in BFM3 produced a family of compounds known as

rhodopeptins, namely rhodopeptin C2 or C3 (la/lb), rhodopeptin C4 (2), and rhodopeptin B5

(3).36-38 These cyclic tetrapeptides were originally isolated from an Actinobacteria in the

Rhodococcus genus and determined to have antifungal activity against Candida albicans and

Cryptococcus neoformans.36-38 Arthrobacter sp. RKEM 1637 produced coproporphyrin III (4)

and zincphyrin (5). when grown in BFM3. While coporoporphyrin III is a ubiquitous

metabolite39'4° the zinc-containing form has only been detected in bacteria. Originally isolated

from a •Streptomyces sp., zincphyrin has been shown to have potent photosensitising activity in addition to acting as a histamine release inhibitor.41'42 Streptomyces sp. RKEM 774 in ISP2 produced nocardamine (6),43 a siderophore that has been isolated from bacteria in the Nocardia,

Pseudomonas, Streptomyces, and Citricoccus genera.43-46 In addition to iron chelation, norcaradamine has been reported to have various biological activity which include antitumor, antifungal, antioxidant, and inducing morphological changed in insect cells:45'47-5° Arthrobacter sp. RKEM 1692 produced concanamycin C (7) and E (8) when grown in ISP2. The concanamycins were previously isolated from Streptomyces spp.51'52 and have been shown to have antiarteriosclerotic activity, in addition to inhibiting the formation of cholesterol esters by inhibiting lysosome and endosome acidification.47' 48 Lastly, Kocuria sp. RKEM 1608 in ISP2 produced kocurin (9),53 a thiazolyl peptide that was originally isolated from a Kocuria sp. and reported to have antibiotic activity against MRSA, B. subtilis, and E. faeciuni

219 Table 6.2 Actinobacteria fermentation extracts with unique secondary metabolites.

A total of 1174 buckets were analysed, and fermentation extracts that grouped separately in the

PCA were identified on the scores plot and the buckets responsible were identified from the corresponding loadings plot.

Buckets Bacterial Isolate - Media Plot (m/z, RT) 496.3849, 4.2 Streptomycetes sp. RKEM 1715 - ISP2 510.4035, 3.3 PC-13/PC-7 524.4160,2.8 655.2772, 3.1 Arthrobacter sp. RKEM 1637 - BFM3 PC-7/PC-1 717.1898, 3.3 Streptomyces sp. RKEM 774 - ISP2 601.3556, 2.0 PC-16/PC-11 845.4975, 3.7 Arthrobacter sp. RKEM 1692 - ISP2 PC-15/PC-1 860.4725, 4.0 Kocuria sp. RKEM 1608 - ISP2 758.1907,3.6 PC-1/PC-5

220 Table 6.3. Accurate mass• of secondary metabolites produced by Actinobacteria.

Metabolites were identified by their accurate mass; a maximum mass difference of ± 5 ppm was

tolerated."'"

Bacterial Molecular IM+111+ [M+111+ A Reported Source Compounds Ref Isolate - Media Formula Exp. Calc. PPm Organism Rhodopeptin C2/C3 C26H 50N 504 496.3849 496:3857 1.61 Streptomycetes (la/b) sp. Riam Rhodopeptin C4 Rhodococcus sp. 36-38 510.4035 510.4014 -4.11 1715 C221152N 504 Rhodopeptin B5 C2814 54N504 524.4160 524.4170 1.91 r--- Coproporphyrin Arthrobacter 655.2772 655.2762 -1.47 III (4) C36F1391\1408 sp. RKEM Streptomyces sp. 41 Zincphyrin 1637 C361-137N408Zn 717.1898 717.1897 -0.17 (5)

Streptomyces 54 Nocardamine (6) C24149N609 601.3556 601.3561 0.85 Streptomyces sp. RKEM 774 sp.

7 Concanamycin C 51.527 Arthrobacter C451125013 823.5178 823.5202 2.91 55 I sp. RKEM ctinoalloteichus sp. Concanamycin E 1692 C4'41122N014 838.4915 838.4947 3.82

Kocuria sp. Kocurin 1515.373 1515.373 53 C69F162N18013S5 -0.33 Kocuria sp. RKEM 1608 (9) 8 3

•

221 NH NH NH HN NH2 NH HN NH 2 NH2

(la) (lb) (2)

NH2

(4) (5)

HO,,. 0 : OH

, OH „jw... 0 OH

.„ „. 0

NI-12

OH NH2

(9)

H2N

222 6.3.2 Secondary Metabolites from Firmicutes

All 22 bacterial isolates in the culture dependant library belonging to the phylum Firm icute were

fermented in BFM3, BFM5, BFM6, BFM7, and BFM11, extracted with Et0Ac and analysed on a UHPLC-HRMS. After processing, a total of 527 buckets were generated and subjected to PCA.

Two of the fermentation extracts formed distinctly separate clusters when comparing the PCs

(Table 6.4; Figures A.1.6 & A.1.7). All the metabolites responsible for this clustering were putatively identified by their accurate mass as previously discovered secondary metabolites from

Firmicutes (Table 6.5; Figures A.2.6 & A.2.7)

The first, Paenibacillus sp. RKEM 768 in BFM5 produced baceridin (10), a cyclic peptide that had been previously isolated from a Bacillus sp. and was shown to have weak cytotoxic and 56 antibacterial activity. The second, Bacillus sp. RKEM 720 in BFM5 produced bacillamide B

(11) and C (12).5758 The bacillamides are a family of alkaloids that were previously isolated from

Bacillus spp. and were reported to have weak algicidal activity against Cochlodinium polykrikoides.58-60,57 ' 59

223 Table 6.4. Firmicutes fermentation extracts with unique secondary metabolites.

A total of 527 buckets were analysed, fermentation extracts that grouped separately in the PCA were identified on the scores plot and the buckets responsible were identified from the corresponding loadings plot.

Buckets Bacterial Isolate - Media PC plot (m/z, RT) Paenibacillus sp. RKEM 768 - BFM5 718.4275, 3.7 PC-6/PC-4 338.0-931, 2.9 Bacillus sp. RKEM 720 - BFM5 PC-3/PC-5 357.1378, 2.5

224 Table 6.5. Accurate mass of secondary metabolites produced by Firmicutes.

Metabolites were identified by their accurate mass; a maximum mass difference of ± 5 ppm was to1erated.32'33

Reported Bacterial Isolate Molecular IM+111+ 1M+111+ Compounds Source Ref -Media Formula Exp. Calc. PPm Organism Paenibacillus sp. Baceridin Bacillus C371i58N706 696.4457 696.4449 1.15 56 RKEM 768 (10) sp. Bacillamide C161118N3028 316.1112 316.1114 -0.63 Bacillus sp. B (11) Bacillus 57, RKEM 720 Bacillamide sp. 58 C18H211\14028 357.1378 357.138 -0.56 C (12)

OH

(10) (12)

225 6.3.3 Secondary Metabolites from Proteobacteria

All 69 bacterial isolates present in the culture dependent library belonging to the phylum

Proteobacteria, in addition to ten bacteria obtained from a culture dependent library built from

E. caribaeorurn were fermented in BFM1, BFM3, BFM5, and BFM11. The fermentations were extracted and analysed using UHPLC-HMRS, after processing a total of 2242 buckets were generated and analyzed using PCA. There were eight different fermentation extracts that grouped separately in the scores plots (Table 6.6; Figure A.1.8-A.1.13). The metabolites responsible for this observed separation could be identified by their accurate masses in four of the fermentation datasets (Table 6.7; Figures A.2.8-A.2.11). The first of which was Pseudoalteromonas sp.

RKBH 282 in BFM5 which produced pseudoalteromone A (13) and B (14), cytotoxic metabolites previously isolated from other Pseudoalteromonas sp. 61'62 The second, Vibrio sp.

RKEM 201 in BFM5 produced bahamamide (15) a cyclic bis-amide previously isolated from an unidentified marine bacterium.63 The third, Acinetobacter sp. RKEM 817 in BFM5 produced andrimid (16), a non-ribosomal peptide-polyketide (NRP-PK) that has been isolated from various Gammaproteobacteria and has been reported to have mild antibiotic activity by inhibiting fatty acid biosynthesis .64-67 The last, Pseudoalteromonas sp. RKBH 271 in BFM5 produced bromoalterochromide A (17). This chromopeptide previously reported from a

Pseudoalteromonas sp. was shown to exhibit mild cytotoxic activity.68 This bacterial isolate produced a different set of metabolites when grown in BFM3, these metabolites in addition to the ones produced by Pseudoalteromonas sp. RKEM 243 in BFM5, Pseudomonas sp. RKEM 545 in

BFM 11, and Halomonas sp. RKEM 883 in BFM5 did not have hits when screened through the natural product databases. This was either due to the metabolite having a novel structure or that it was simply not in the database, as no database is entirely exhaustive. Regardless, all four of the

226 bacterial isolate fermentations were scaled up and the compounds were purified and identified either by NMR or tandem MS.

227

Table 6.6. Proteobacteria fermentation extracts with unique secondary metabolites.

A total of 2242 buckets were analysed by PCA and fermentation extracts that grouped separately on the scores plot were putatively identified. The buckets responsible for that separation were identified from the corresponding loadings plot.

Buckets Bacterial Isolate - Media Plot (m/z, RT)

Halomonas sp. RKEM 883 - BFM11 314.2690, 4.4 PC-4/PC-6 456.2721,4.6 Pseudoalteromonas sp. RKBH 271 - BFM3 442.2564,4.4 PC-2/PC-10 428.2406,4.1 Pseudoalteromonas sp. RKBH 271 - BFM5 846.2902, 3.1 PC-5/PC-7 343.1516, 3.6 Pseudoalteromonas sp. RKBH 282 - BFM.1.1 PC-6/PC-7 277.1775,3.0 380.0556, 3.6 Pseudoalteromonas sp. RKEM 243 - BFM5 PC-1/PC-3 265.0465, 3.5 Pseudomonas sp. RKEM 545 - BFM11 690.9231,4.8 PC-1/PC-4

Vibrio sp. RKEM. 205 - BFM5 357.2513, 4.2 PC-4/PC-5

Acinetobacter sp. RKEM 817 - BFM5 480.2493, 4.5 PC-3/PC-15

228 Table 6.7. Accurate masses of secondary metabolites produced by Proteobacteria.

Metabolites were identified by their accurate mass; a maximum mass difference of± 5 ppm was

tolerated."'"

Bacterial Isolate - Molecular [M+11]+ IM+Hr A Reported Source Compounds Ref Media Formula ' Exp. Calc. PPm Organism (s)

Pseudo- alteromone A ' C 15E12203 321.1697 321.1697 -0.06 Pseudoalteromonas sp. RKBH 282 - Pseudoalteromonas 61,62 sp. BFM 11 Pseudo- alteromone B C18H2505 255.1952 255.1955 -0.78

Vibrio sp. RKEM Bahamamide Unidentified marine C20H351\1,02 335.2696 335.2701 -1.49 63 , 205 - BFM5 (15) bacteria

Acinetobacter sp. Andrimid Vibrio sp. C 1434N305 480.2498 480.2493 64-66 RKEM 817 - BFM5 (16) 27 -1.04 Pseudomonas sp. Enterobacter sp. Pseudoalteromonas Bromo- Pseudoalteromonas 68 sp. RKBH 271 - alterochromide C381-131B rN2011) 844.2916 844.28753 -4.82 BFM5 A(17) sp.

229

0

(14) (13)

(15) (16)

OH H = N OA. 0 0 NH 0 (17) H2N 0

230 6.3.3.1 Pseudoalteromonas sp. RKBH 271 and the Korormicins

Fermentation of Pseudomonas sp. RKEM 271 in BFM3 was scaled up (6L) and the metabolites

were purified using RP-flash chromatography and RP-HPLC. The metabolite with the [M+H] -

of 434.2902 was obtained in the highest abundance (1.2mg) and therefore analysed using NMR.

The 11-1 and 13C chemical shifts obtained from this compound matched those of korormicin A

(18)69-72 (Table 6.8; Figures A.3.1-A.3.3). Once the structure of korormicin A was determined

the other metabolites were readily identified by accurate mass to be the analogs korormicin J

(19) and K (20)73 (Table 6.9). This family of NRP-PKs were initially isolated from

Pseudoaltetromonas spp. and were shown to have moderate antibacterial activity against gram- negative bacteria.69-72

2,31 Table 6.8. Experimental and reported69111 (600 MHz) and 13C (150 MHz) N1VIR data for korormicin A (18) in DMSO-d6.

Experimental Reported Pos. oc, type OH (J, Hz) COSY Oc, type SH (J, Hz) 1 168.4, C 2 125.1,C 3 133.6, CH 7.39, s 133.9, CH 7.26, s 4 87.0, C 5 30.9, CH2 1.76, q (7.1) 116 31.2, CH2 1.74, q (7.3) 6 7.67, CH3 0.76, t (7.1) H5 8.0, CH3 0.74, t (7.3) 7 23.8, CH3 • 1.41, s 24.1, CH3 1.37, s NH 9.90, s 9.83, s l' 170.1,C 43.6, CH2 2.41, dd (5.2, 14.2) H3' 44.0, CH 2.39, dd (5.4, 14.4) 2.61, dd (8.2, 14.2) H3' 2.59, dd (8.1, 14.4) 63.5, CH 4.84, ddd (5.2, 8.2, 13.2) H2', H4' 63.0, CH 4.83, ddd (5.4, 8.1, 9.0) OH 5.09, d (4.4) 4 132.6, CH 5.31, m H3', H5' 132.7, CH 5.30, dd (9.0, 10.9) 5' 128.0, CH 5.94, t (11.0) H4', H6' 128.0, CH 5.92, dd (10.9, 11.2) 6' 127.3, CFI 6.48, dd (11.0, 15.1) H5', H7' 127.6, CH 6.46, dd (11.2, 15.1) 7' 130.6, CH 5.71, dt (7.0, 15.0) H6', H8' 130.9, CH 5.70, dt (6.8, 15.1) 8' 30.6, CH2 2.28, dd (7.0, 13.5) H7', H9' 30.9, CH2 2.26, dd (5.9, 6.8) 54.7, CH 2.92, dt (4.0, 6.2) H8' 55.1, CH 2.90, dt, (4.2, 5.9) 55.7, CH 2.88, dt (4.0, 5.9) H11' 56.0, CH 2.87, dt, (4.2, 6.1) 26.7, CH2 1.48, m H10' 27.2, CH2 1.48, m 25.8, CH2 1.40, m 26.1, CH2 1.38, m 28.6, CH2 1.20 - 1.35 28.92, CH2 1.2 - 1.4, m 28.6, CH2 1.20 - 1.35 28.89, CH2 1.2 - 1.4, m 28.6, CH2 1.20 - 1.35 28.6, CH2 1.2 - 1.4, m 31.0, CH 2 1.24, m 31.2, CH2 1.22, m 21.8, CH2 1.26, m H18' 22.1, CH2 1.24, m 13.62, CH3 0.85, t (7.0) H17' 13.9, CH3 0.83, t (7.1)

232

5' 7'

1' N 0 10' 12' 14' 16' 18' 0 (18)

(20)

Table 6.9. Accurate masses of korormicins produced by Pseudoalteromonas sp. RICEM 271

Metabolites were identified by their accurate mass; a maximum mass difference of ± 5 ppm was tolerated.

Molecular IM+Hr A Compound im+Hr Formula Experimental Calculated PPm

Koromicin A (18) C25H4ON05 434.2902 434.2901 0.23

PKoromicin J (19) C25H42N04 406.2947 406.2952 -1.23

Koromicin K (20) .C241{40N04 420.31.0§ 420.3107 0.48

233 6.3.3.2 Pseudoalteromonas sp. RKEM 243 and Ulbactins

Fermentation of Pseudoalteromonas sp. RKBH 245 in BFM5 was scaled up (6L) and the

metabolites were purified. The metabolite with the [M+H] of 380.0556 was obtained in the highest abundance (3.4 mg) and analyzed by NMR. The structure of this compound was

determined to be that of ulbactin E (21)74 (Table 6.10; Figures A.3.4-A.3.7). Once the structure

of ulbactin E was determined the other compound was identified by accurate mass to be the

analog ulbactin A (22)75 (Table 6.11). The ulbactins are a family of alkaloids that have been

isolated from various bacterial genera including Vibrio, Alteromonas , Pseudomonas, and

Brevibacillus , and have been shown to exhibit mild cytotoxic activity.7476

234 Table 6.10. Experimental and reported74 ill (600 MHz) and 13C (150 MHz) NMR data for ulbactin E (21) in DMSO-d6.

Experimental Reported

Pos. type OH (3, Hz) COSY HMBC Oc, type SH (3, Hz) 1 115.90, C 116.4, C

2 158.46, C 159.3, C Cl, C2, 3 116.89, CH 6.98, m H4 117.4, CH 6.99, d (8.1) C4, C6 Cl, C2, 7.36, ddd (8.1, 7.6, 4 133.68, CH 7.43, m H3,145 • 133.4, CH C3, C5 C6 1.4) C1, C2, 5 119.28, CH 6.95, m H5, H6 119.0, CH 6.88, dd (7.6, 7.6) C4, C6 Cl, C6, 6 130.45, CH 7.43, m 130.9, CH 7.39, dd (7.6, 1.4) C2, C7 7 173.42, C 173.9, C

3.24, dd (11.4, 6.6) C7, C9, 3.42, dd (9.5, 5.4) 8 33.2, CH2 H9 33.9, CH2 3.46, dd (11.4, 8.8) C10 3.45, dd (11.2, 8.5)

C8, 4.87, ddd (8.5, 7.3, 9 80.54, CH 4.94, td (8.6, 6.6) H8, H10 80.8, CH CIO 6.0) C9, 10 60.05, CH 5.42, d (8.4) H9 C11, C15, 60.7, CH 5.76, d (6.0) C16 11 168.44, C 167.9, C HI3, 12 64.61, CH 4.36, dd (6.4, 2.6) C13, C14 71.3, CH 4.04, d (6.4) I:117 3.00, dd (10.4, 6.3) C12, 3.32, d (10.8) 13 39.12, CH2 H12 35.2, CH2 3.29, d (10.3) C14 3.23, dd (10.8, 6.4) C13, 14 65.34, CH 5.35, d (4.6). HI7 73.2, CH 4.62, d (4.5) C15, C16 C10, Cl I, 15 68.69, CH 3.91, dd (11.0, 5.0) H16 69.5, CH 3.83, dd (10.9, 5.4) C14, C16 2.81, dd (11.0, 9.6) C10, C13, 2.97, dd (9.5, 5.4) 16 33.4, CH2 HIS 3.47, CH2 3.08, dd (9.6, 5.0) C14, C15 3.01, dd (10.9, 9.5) H12, NH 3.86, t (4.2) H14

235

H.MBC -- COSY

(21)

Table 6.11. Accurate masses of ulbactins produced by Pseudoalteromonas sp. RKBH 245

Metabolites were identified by their accurate mass; a maximum mass difference of ± 5 ppm was tolerated.

Molecular [M+HI+ [M+H]+ Compound Formula Experimental Calculated ppm

Ulbabtin E (21) C161118N302S3- 380.0556 380.0556 0.00 I Ulbactin A (22) Cl2H13N20S2 265.0465 265.0464 0.38

236 6.3.3.3 Pseudomonas sp. R10EM 545 and the putisolvins

Fermentation of Pseudomonas sp. RKBH 545 in BFM11 was scaled up (6L) and the secondary metabolites were purified using RP-flash chromatography and RP-HPLC. Although there was only one secondary metabolite responsible for the separation of this fermentation extract in the

PCA plots, when scaled up there were two metabolites present. These had [M+H] values of

1380.8376 and 1394.8545 (Figures A.2.14 & A.2.15). Using collision-induced dissociation tandem MS it was determined that these metabolites were putisolvin I and II (Table 6.12; Figure

6.1, 6.2).77 These lipopeptides were previously isolated from a Pseudomons sp. and were

77-79 reported to have biosurfactant activity.

Table 6.12. Accurate masses of putisolvins produced by Pseudomonas sp. RKEM 545

Metabolites were identified by their accurate mass; a maximum mass difference of ± 5 ppm was tolerated.

Molecular [M-1-1-1]+ [M+11]+ A Compound Formula Experimental Calculated ppm

Putisolvin I (23) C65H1 14N13019 1380.8376 1380.8348 2.03 Putisolvin 11 (24) C66H116N13019 1394.8545 1394.8505 2.87

237 OOH

H-2® 0

_ H 0

H2N **0

HO" Chemical Formula: C65H114N13019+ Exact Mess: 1380.8348

Chemical Formula: C66H116N13019+ Exact Mass: 1394.8505

238

i_114(2 r81.4 ril§2. r222. r6.36 Leu - Val i . / \ CH3(CH2)4- Len 1- Glu 1Leu -L Ile Un-" Ser -Val 4-lie -r Ser Ser \ I CH2 f=0 ' 0 -- 4 - - 341 782 4---. 994 881 -H2o: • 863

P2_10ug_FA_1380_MS #1-14 RI: 0., AV: 14 NL: 4.02E4 F: FTMS + p ESI Full ms2 [email protected] [380.00-2000.00] 1169 6710 10

90

80

70

60

50 -113.0829 (Leu) -113.0855 (Leu) -129.0422 (Glu) 40 4 -99.0671 (Val) -131.0938 (Ile) 30 4 4 1040.6288 20 -99.0671 (Val) 863.5189 1022.6182 1151,8605 10 782.4615 814.4624 927.5453 994.6127 881.5286 965.5608 1064.6289 1133.6502 0

750 800 850 900 950 1000 1050 1100 1150 mIz

P2_10ug_FA_1380_MS #1-14 RI: 0., AV: 14 NL: 4.95E3 F: FTMS + p ESI Full ms2 [email protected] [380.00-2000.00] 567.3723 100-- 90-

80

70

60-

50-E 814.4624 454.2888 -87.0317 (Ser) 4C:1 686.4046 30 -113.0835 (Ile) -128.0575 (Girl) 782.4615 764.4512 201" 695.4298

10= 634.3526 747.8772 5493614. 668.3934 420.2937 466_2637 500,3051 581.3626 709.4204 0 1 1 ‘ 1- I 1 1 1 1111 I IC I I fi I 450 500 550 600 650 700 750 800 I m/z

Figure 6.1. Tandem mass spectrum and fragment scheme of putisolvin 1(23).

239

1054 8-)8 613* r - - r i 1183, ,941* 700 „.514.. Leu - Val \ 1I 1 i / CH3(C112)4 - Leu - Glu -Leu -1- lie-'- Gin --L- Ser-'-Val 4-lie -r Ser Ser \ I 70 CH, ----- 0 4 - - 4 - - - - 341 567 4 77g1 994

4454- 695 • 863

P3_10ug_FA_1394_MS2_1410151347: 4 RT: 0.01-0.38 AV: 14 NL: 2.65E4 F: FTMS + p ESI Full ms2 [email protected] [380.00-2000.00] 1183.6859 100 90 80 70 60

50 40 -113.0833 (Leu) -129.0419 (Glu)

30 1054.6440 20 863.5183 1165.6752 10 941.5607 994.6120 881.5282 923.5492 949.6010 1036.6326 1063 6323 1097 8107 1147.6646 850 900 950 1000 1050 1100 1150 1200 m/z

P3_10ug_FA 1394_MS2_1410151342 4 RT: 0.01-0.38 AV 14 NL: 3.49E3 F: FTMS + p ESI Full ms2 1394.84©cid35.00 [380.00-2000.00] 567.3719 100 ,

90. 863.5183

80;7 70-z z -128.0574 (Gin) 607: .41 50 828.4772 z 454.2886 -128.0519 (Gin) -87.0369(Ser) 40- -113.0833 (Ile) 700.4198 876.6721 30 782.4607 z 764.4505 207 810.4667 754.7798 47635 10= 634.3528 723.4359 514.1p0 549.3622 595.3784 1 I 1,682.4086 l 11111111111)111111111111(1 1 111' 1 1 I f' 450 500 550 600 650 700 750 800 850 rn/z

Figure 6.2. Tandem mass spectrum and fragmentation scheme of putisolvin II (24).

240 6.3.3.4 Halomonas sp. RKEM 883 and Identification of a New Long-Chain N-Acyl L-

Leucine.

Fermentation of Halomonas sp. RKEM 883 in BFM5 was scaled up (6L) and 3.4 mg of metabolite 25 with a [M+H] of 314.2690 was obtained. NMR data (Table 6.13) revealed the compound to be a long chain N-acyl L-leucine. Two distinct spin systems were identified by

TOCSY spectra as a leucine and a fatty acid side chain. The leucine residue was assigned by

COSY correlations between NH (6H 7.95) / H-2 (614 4.31); H-2 (43H 4.31)! H-3 OH 1.46); H-3 OH

1.46)! H-4 OH 1.61); H-4 OH 1.61)! H-5 and H-6 OH 0.81 and 6H 0.87); and the HMBC correlations from H-2 to C-1 (6c 175.25). The fatty acid side chain was assigned by COSY correlations between H-2' OH 2.07)! H-3' OH 1.47); H-11' OH 1.26)! H-12' OH 0.85); HMBC correlations from NH (OH 7.95) to C-1' (6c 177.15); and the TOCSY spin system containing H-2'

(OH 2.07)! H-3' OH 1.47); H-11' (OH 1.26)! H-12' (OH 0.85)/six overlapping methylenes (6H 1.20-

1.23). The absolute configuration of leucine was determined using Marfey's method34 to be in the L-conformer (Figure 6.3).

This new secondary metabolite belongs to a family of compounds known as long chain N-acyl amino acids. These metabolites are commonly detected in E-coli-based soil eDI\iA libraries, to date N-acyl tyrosine, phenylalanine, tryptophan, and arginine have been reported.8082 This is the first report of a long chain N-acyl amino atid containing a leucine. These secondary metabolites have been reported to have mild antimicrobial activity. 82'83 Therefore, 25 was screened for antimicrobial activity and found to have very mild activity against MRSA, VRE, and S. warneri but only at a concentration of 500 ig/mi.

241 0 10 12'

(25)

6.13. Experimental 111 (600 MHz) and "C (150 MHz) NMR Data for a long chain N-acyl L- leucine in DMSO-d6.

Pos. C-Shift H-Shift COSY HMBC 1 175.25,C _ 2 51.02, CH 4.21, m NH, H3 Cl, Cl' 3 40.89, CH2 1.46,m H2, H4 H3, H5, 4 24.05, CH 1.61,m H6 5 21.30, CH3 0.82, d (6.5) H4 C3, C4 6 22.94, Cl-I3 0.87, d (6.5) H4 C3, C4 1' 177.15,C . 2' 35.08, CH2 2.07, t (7.1) H3' Cl', C3', C4' 25.22, CH2 1.47, m H2' C2', C4' - 9' 28.36 - 29.01, CH2 1.20 - 1.23, m 31.08, CH2 1.23,m 21.91, CH2 1.26,m H12' C10', C12'

13.80, CH3 , 0.85, t (7.0) H11' C101 , C11' . NH 7.95, d (8.1) H2 Cl'

242

RI: 18.45 - 60.61 38.57 PL: 5.40E5 100— rn/z= 406.13-406.14 F: FTMS {11} + p ESI Full lodcms L-leucine [200.00-2000.001 MS A 50- l_leucine

37.56 IL 40.09 44.05 4624 53.51 43.96 IkIL: 3.86E6 100- 3)46 intz= 406.13-406.14 F: FTMS (1,1) + p ESI Full lodcms (200.00-2000.00) MS 507 L-leucine D-leucine Id_leucine

37.30 )1_39.31 1 45.04 47.79 0 38.46 NL: 1.59E3 100—_ rni-z= 406.13.406.14 F: FTMS {1,1} + p ESI Full ms [200.00-2000.001 MS 507 dem883_03

I I 1 I i I I i I I I I I I 1 1 1 1 1 I I i I I I 1 I I I I j I I I I 1 20 25 30 35 40 45 50 55 60 Time (min)

Figure 6.3. Chromatograms of Marfey's analysis for metabolite 25.

L-FDAA derivative L-leucine (A), L- and D-leucine (B), and metabolite 25 (C) UHPLC

chromatograms.

6.3.4 Screening for the Presence of Pseudopterosins and Eleutherobins

It has long been suspected that secondary metabolites isolated from marine macroorganisms are

in fact biosynthesised by associated microorganisms.22'84 Therefore all the bacterial extracts were

screened for the presence of pseudopterosins and eleutherobins, the MNPs associated with A. elisabethae and E. caribaeorum.85-88 This was achieved by analyzing standards of

pseudopterosins and eleutherobins using UHPLC-HRMS. The datasets were subjected to the

same chemical dereplication process as the bacterial fermentation extracts. After which they were built into chemical barcodes to screen for metabolites with the same m/z and RT, an

example of these barcodes is shown in Figure 6.4. Unfortunately, no pseudopterosins or

eleutherobins were detected under the conditions used in this study in any of the bacterial

isolates. However, the absence of these MNPs from these fermentations does not mean that they

243 are not of microbial origin, or that the bacteria screened in this research do not contain the biosynthetic machinery to produce these metabolites. It simply means that under the fermentation conditions used for this research no pseudopterosins or eleutherobins were detected, and that further research is required to determine the biosynthetic origin of these pharmaceutically relevant MNPs. Pseudopterosinsi

Figure 6.4. Example of chemical barcode containing pseudopterosin standards.

6.4 Conclusion

This study showed that bacterial isolates from octocorals have the potential to produce a broad array of chemically diverse structures with a wide range of biological importance. Using a chemical dereplication process to analyse all of the UHPLC-HRMS data generated from the

244 bacterial fermentations, 24 different known secondary metabolites were putatively identified. In

addition, one new secondary metabolite, a long chain N-acyl L-leucine was discovered.

This study also highlighted the fact that culture conditions are central to secondary metabolite production. For example, Pseudoalteromonas RKEM 271 produced more bromoalterochromide

A in BFM5 and more of the korormicins in BFM3. While both sets of metabolites were detectable in trace amounts in the other culture conditions, specific media components favoured the biosynthesis of these compounds. Therefore this study only scratches the surface of the secondary metabolites capable of being produced by this culture dependent library. Numerous other conditions can be explored in future studies to discover the untapped potential of these bacteria.

While no pseudopterosin or desmethyleleutherobin production was detected in this study, future studies should continue to explore the holobiont of these octocorals. With advancements in metagenomic sequencing and bioinformatic technologies, the true biosynthetic producer of these pharmaceutically important MNPs may be determined.

6.5 References

Blunt, J. W.; Copp, B. R.; Munro, M. Nat. Prod. Rep. 2005, 22 (1), 15-61.

Blunt, J. W.; Copp, B. R.; Munro, M. H. G.; Northcote, P. T.; Prinsep, M. R. Nat. Prod.

Rep. 2006, 23 (1), 26-78.

Blunt, J. W.; Copp, B. R.; Hu, W.-P.; Munro, M. H. G.; Northcote, P. T.; Prinsep, M. R.

245 Nat. Prod. Rep. 2008, 25 (1), 35-94.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod.

Rep. 2016, 33 (3), 382-431.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. prod.

Rep. 2015, 32 (2), 116-211.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod

Rep. 2014, 31 (2), 160-258.

. (7) Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod

Rep. 2012, 29 (2), 144-222.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod

Rep. 2013, 30 (2), 237-323.

Manivasagan, P.; Kang, K.-H.; Sivakumar, K.; Li-Chan, E. C. Y.; Oh, H.-M.; Kim, S.-K.

Environ. Toxic Phar. 2014, 38 (1), 172-188.

Martinez-Garcia, M.; Diaz-Valdes, M.; Wanner, G.; Ramos-Espla„ A.; Ant6n, J.

Environ. MicrobioL 2007, 9 (2), 521-534.

Feling, R. H.; Buchanan, G. O.; Mincer, T. J.; Kauffman, C. A.; Jenser, P. R.; Fenical,

W. Angew. Chem. Int. Ed EngL 2003, 42 (3), 355-357.

Valliappan, K.; Sun, W.; Li, Z. App!. MicrobioL Biotechnol. 2014, 98 (17), 7365-7377.

Burja, A. M.; Banaigs, B.; Abou-Mansour, E.; Burgess, J. G.; Wright, P. C. Tetrahedron

2001, 57 (46), 9347-9377.

Kleigrewe, K.; Gerwick, L.; Sherman, D. H.; Gerwick, W. H. Nat. Prod Rep. 2016, 33

(2), 348-364.

Singh, S. B.; Pelaez, F. In Natural Compounds as Drugs Volume I; Petersen, F.,

246 Amstutz, R., Eds.; Progress in Drug Research; Birkhauser Basel: Basel, 2008; Vol. 65,

Chapter 4, pp 141-174.

Sul, W. J.; Cole, J. R.; Jesus, E. D. C.; Wang, Q.; Farris, R. J.; Fish, J. A.; Tiedje, J. M.

P. Natl. Acad. Sci. USA 2011, 108 (35), 14637-14642.

Desriac, F.; Jegou, C.; Balnois, E.; Brillet, B.; Le Chevalier, P.; Fleury, Y. Mar. Drugs

2013, 11 (10), 3632-3660.

Felder, S.; Dreisigacker, S.; Kehraus, S.; Neu, E.; Bierbaum, G.; Wright, P. R.; Menche,

D.; Schaberle, T. F.; Konig, G. M. Chem. Eur. 1 2013, 19 (28), 9319-9324.

Wenzel, S. C.; Hoffmann, H.; Zhang, J.; Debussche, L.; Haag-Richter, S.; Kurz, M.;

Nardi, F.; Lukat, P.; Kochems, I.; Tietgen, H.; Schummer, D.; Nicolas, J.-P.; Calvet, L.;

Czepczor, V.; Vrignaud, P.; Miihlenweg, A.; Pelzer, S.; Miiller, R.; Bronstrup, M.

Angew. Chem. Int. Ed. EngL 2015, 54 (51), 15560-15564.

Schaberle, T. F.; Goralski, E.; Neu, E.; Erol, 0.; Holz1, G.; Dormann, P.; Bierbaum, G.;

Konig, G. M. Mar. Drugs 2010, 8 (9), 2466-2479.

Tsukimoto, M.; Nagaoka, M.; Shishido, Y.; Fujimoto, J.; Nishisaka, F.; Matsumoto, S.;

Harunari, E.; Imada, C.; Matsuzaki, T. I Nat. Prod. 2011, 74(11), 2329-2331.

Gerwick, W. H.; Fenner, A. M. Microb. EcoL 2013, 65 (4), 800-806.

Gerwick, W. H.; Moore, B. S. Chem. Biol. 2012, 19 (1), 85-98.

Haefner, B. Drug Discov. Today 2003, 8 (12), 536-544.

Fenical, W.; Jensen, P. R. Nat. Chem. Biol. 2006, 2 (12), 666-673.

Gulder, T. A.; Moore, B. S. Curr. Opin. Microbiol. 2009, 12 (3), 252-260.

Jensen, P. R.; Lauro, F. M. Ant. van Leeuw. 2008, 94 (1), 51-62.

Uzair, B.; Mahmood, Z.; Tabassum, S. Bioimpacts. 2011, / (4), 203-211.

247 Bhatnagar, I.; Kim, S.-K. Environ. Toxic. Phar. 2012, 1-32.

Forner, D.; Berme, F.; Correa, H.; Duncan, K.; Kerr, R. G. Anal. Chim. Acta 2013, 805,

70-79.

Hotelling, H. I Educ. Psychol. 1933, 24 (7), 417-441.

Bristow, A.; Webb, K. S. f. Am. Soc. Mass Spectrom. 2003, 14 (10), 1086-1098.

Zubarev, R. A.; Makarov, A. Anal. Chem. 2013.

Marfey, P. Carlsberg Res. Commun. 1984, 49 (6), 591-596.

Correa, H.; Aristizabal,,F.; Duque, C.; Kerr, R. G. Mar. Drugs 2011, 9 (3), 334-344.

Chiba, H.; Agematu, H.; Kaneto, R.; Terasawa, T.; Sakai, K.; Dobashi, K.; Yoshioka, T.

J. Antibiot. 1999, 52 (8), 695-699.

Chiba, H.; Agematu, H.; Dobashi, K.; Yoshioka, T. J. Antibiot. 1999, 52 (8), 700-709.

Chiba, H.; Agematu, H.; Sakai, K.; Dobashi, K.; Yoshioka, T. I Antibiot. 1999, 52 (8),

710-720.

DiNello, R.; Chang, C. K. In The Porphyrins; Elsevier: Cambridge, 1978; pp 289-339.

Drabkin, D. In The Porphyrins; Cambridge, 1978; Chapter 2, pp 29-83.

Toriya, M.; Yaginuma, S.; Murofushi, S.; Ogawa, K.; Muto, N.; Hayashi, M.;

Matsumoto, K. I Antibiot. 1993, 46 (1), 196-200.

Toriya, M.; Yamamoto, M.; Saeki, K.; Fujii, Y.; Matsumoto, K. Biosci. Biotechnol.

Biochem. 2001, 65 (2), 363-370.

Brown, R. F. C.; Buchi, G.; Kellerschierlein, W.; Prelog, V.; Renz, J. Hely. Chim. Acta

1960, 43 (6), 1868-1871.

BeBoer, C.; Dietz, A. I Antibiot. 1976, 29 (11), 1182-1188.

(45) Kalinovskaya, N. I.; Romanenko, L. A.; Irisawa, T.; Ermakova, S. P.; Kalinovsky, A. I.

248 Microbiol. Res. 2011, 166 (8), 654-661.

Meyer, J.-M.; Abdallah, M. J. Gen. MicrobioL 1980, 118, 125-129.

Matsubara, K.; Sakuda, S.; Kondo, T.; Tanaka, M.; Nishimura, T.; Suzuki, A. Biosci.

BiotechnoL Biochem. 1998, 62 (10), 2049-2051.

Challis, G. L. Chembiochem 2005, 6 (4), 601-611.

Shimoni, E.; Ampel, M.; Zahner, H.; Neeman, I. I Am. Oil. Chem. Soc. 1998, 75 (10),

1453-1455.

Zarember, K. A.; Cruz, A. R.; Huang, C.-Y.; Gallin, J. I. Antimicrob. Agents Chemother.

2009, 53 (6), 2654-2656.

Kinashi, H.; Sakaguchi, K.; Higashijima, T.; Miyazawa, T. I Antibiot. 1982, 35 (11),

1618-1620.

Woo, J.-T.; Shinohara, C.; Sakai, K.; Hasumi, K.; Endo, A. I Antibiot. 1992, 45(7),

1108-1116.

Martin, J.; da S Sousa, T.; Crespo, G.; Palomo, S.; Gonzalez, I.; Tormo, J. R.; la Cruz, de, M.; Anderson, M.; Hill, R. T.; Vicente, F.; Genilloud, O.; Reyes, F. Mar. Drugs

2013, 11 (2), 387-398.

Hyi-Seung Lee; Hee Jae Shin; Kyoung Hwa Jong; Tae Sik Kim; Ki-Bong Oh, A.;

Jongheon Shin. I Nat. Prod. 2005, 68 (4), 623-625.

Kinashi, H.; Someno, K.; Sakaguchi, K. J. Antibiot. 1984, 37 (11), 1333-1343.

Niggemann, J.; Bozko, P.; Bruns, N.; Wodtke, A.; Gieseler, M. T.; Thomas, K.; Jahns,

C.; Nimtz, M.; Reupke, I.; Bruser, T.; Auling, G.; Malek, N.; Kalesse, M. Chembiochem

2014, 15 (7), 1021-1029.

Socha, A. M.; Long, R. A.; Rowley, D. C. I Nat. Prod. 2007, 70 (11), 1793-1795.

249 Jin, L.; Ma, W.; Peng, C.; Yin, Y.; Xu, B.; Zhang, F.; Guo, Y.; Li, Z. Process. Biochem.

2011, 46 (5), 1153-1159.

Jeong, S.-Y.; Ishida, K.; Ito, Y.; Okada, S.; Murakami, M. Tetrahedron Lett. 2003, 44

(43), 8005-8007.

Yu, L. L.; Li, Z. Y.; Peng, C. S.; Li, Z. Y.; Guo, Y. W. Helv. Chim. Acta 2009, 92 (3),

607-612.

Chen, Y.-H.; Kuo, J.; Su, J.-H.; Hwang, T.-L.; Chen, Y.-H.; Lee, C.-H.; Weng, C.-F.;

Sung, P.-J. Mar. Drugs 2012, 10 (7), 1566-1571.

Chen, Y.-H.; Lu, M.-C.; Chang, Y.-C.; Hwang, T.-L.; Wang, W.-H.; Weng, C.-F.; Kuo,

J.; Sung, P.-J. Tetrahedron Lett. 2012, 53 (13), 1675-1677.

Boehler, M.; Jensen, P. R.; Fenical, W. Nat Prod Lett 1997, 10 (1), 75-78.

Needham, J.; Kelly, M. T.; Ishige, M.; Andersen, R. J. I Org. Chem. 1994, 59 (8),

2058-2063.

McWhorter, W.; Fredenhagen, A.; Nakanishi, K.; Komura, H. I Chem. Soc. Chem.

Comm. 1989, 299-301.

Fredenhagen, A.; Tamura, S. Y.; Kenny, P. T. M.; Komura, H.; Naya, Y.; Nakanishi, K.;

Nishiyama, K.; Sugiura, M.; Kita, H. I Am. Chem. Soc. 2002, 109 (14), 4409-4411.

Liu, X.; Fortin, P. D.; Walsh, C. T. P. Natl. Acad. Sci. USA 2008, 105 (36), 13321-

13326.

Speitling, M.; Smetanina, O.; Kuznetsova, T.; Lattsch, H. I Antibiot. 2007, 60 (1), 36-

42.

Yoshikawa, K.; Takadera, T.; Adachi, K.; Nishijima, M.; Sano, H: I Antibiot. 1997, 50

(11), 949-953.

250 Yoshikawa, K.; Nakayama, Y.; Hayashi, M.; Unemoto, T.; Mochida, K. J. Antibiot.

1999, 52 (2), 182-185.

Yoshikawa, K.; Adachi, K.; Nishida, F.; Mochida, K..1 Antibiot. 2003, 56 (10), 866-

870.

Uehara, H.; Oishi, T.; Yoshikawa, K.; Mochida, K.; Hirama, M. Tetrahedron Lett. 1999,

40 (49), 8641-8645.

Tebben, J.; Motti, C.; Tapiolas, D.; Thomas-Hall, P.; Harder, T. Mar. Drugs 2014, 12

(5), 2802-2815.

Kikuchi, K.; Yochitaka, C.; Adachi, K.; Nishida, F.; Takadera, T.; Sano, H. Japan

Patent, JPH049492. September 14,1998.

Kikuchi, K.; Chen, C. A.; Adachi, K.; Nishijima, M.; Nishida, F.; Takadera, T.; Sano, H.

Japan Patent, JPH10245377. October 1,1997.

Igarashi, Y.; Asano, D.; Sawamura, M.; In, Y.; Ishida, T.; Imoto, M. Org. Lett. 2016, 18

(7), 1658-1661.

Kuiper, I.; Lagendijk, E. L.; Pickford, R.; Derrick, J. P.; Lamers, G. E. M.; Thomas-

Oates, J. E.; Lugtenberg, B. J. J.; Bloemberg, G. V. Mol. Microbiol. 2003, 51 (1), 97-

113.

Dubern, J. F.; Coppoolse, E. R.; Stiekema, W. J.; Bloemberg, G. V. Microbiology 2008,

154 (7), 2070-2083.

Dubern, J.-F. D. R.; Bloemberg, G. V. FEMS Microbiol. Lett. 2006, 263 (2), 169-175.

Brady, S. F.; Clardy, J. J. Am. Chem. Soc. 2000, 122 (51), 12903-12904.

Brady, S. F.; Clardy, J. Org. Lett. 2005, 7 (17), 3613-3616.

Clardy, J.; Brady, S. F. J. Bacteriol. 2007, 189 (17), 6487-6489.

251 Craig, J. W.; Cherry, M. A.; Brady, S. F. J. Bacteriol. 2011, 193 (20), 5707-5715.

Gerwick, W. H.; Moore, B. S. Chem. Biol. 2012, 19 (1), 85-98.

Look, S. A.; Fenical, W.; Matsumoto, G. K.; Clardy, J. J. Org. Chem. 1986, 51 (26),

5140-5145.

Look, S. A.; Fenical, W.; Jacobs, R. S.; Clardy, J. P. Natl. Acad. Sci. USA 1986, 83 (17),

6238-6240.

Lindel, T.; Jensen, P. R.; Fenical, W.; Long, B. H. I Am. Chem. Soc. 1997, 119 (37),

8744-8745.

Cinel, B.; Roberge, M.; Behrisch, H.; van Ofwegen, L.; Castro, C. B.; Andersen, R. J.

Org. Lett. 2000, 2 (3), 257-260.

252 Chapter 7: Overall Conclusions of Thesis Work and Future Directions of Octocoral

Microbiome and Marine Natural Products Research

253 7.1 Summary of Thesis Research

7.1.1 Chapter 2: Spatial and Temporal Investigation of the Microbiome of the Caribbean

Octocoral Erythropodium caribaeorum

This study characterized the microbiome of the octocoral Erythropodium caribaeorum.1 Samples

were collected from two locations at three different time points to investigate geographic and

temporal variations in microbial communities, as well as to identify any putative core

microbiome. This research found that there were no statistically significant variations in the

microbial community structure between location and time of collection. Additionally, it was

determined that E. caribaeorum possessed a high level of bacterial taxonomic diversity

compared to other reported octocorals. However amid that high diversity the microbiomes had a dominant association with the class Gammaproteobacteria, in particular the genus

Endozoicomonas. Three stable species-specific OTUs were present in all octocoral samples, confirming the hypothesis that there is a stable microbiome association with the octocoral E. caribaeorum. One of these, Endozoicomonas sp. OTU 001, was highly abundant and most likely plays an essential role in the biology of the E. caribaeorum holobiont. The data generated in this study serves as a valuable starting point for future investigations into the microbiome associated with E. caribaeorum and other. octocorals in the Caribbean.

254 7.1.2 Chapter 3: Culture-Independent Investigation into the Microbiome of Antillogorgia elisabethae from San Salvador, The Bahamas, and the Microbial Communities Associated with the Holobiont, Algal Dinoflagellates, and Larvae

This study characterised the microbiome of Antillogorgia elisabethae collected from San

Salvador, The Bahamas in addition to the microbial communities associated with the dinoflagellates and larvae of those samples. The holobiont samples examined in this study had statistically different bacterial community structure from the surrounding seawater and had a stable association with the genera Endozoicomonas, Vibrio, and Pseudoalteromonas. However, when compared to previously reported A. elisabethae holobiont microbiomes there was a high level of taxonomic heterogeneity and no stable taxonomic genera were detected.2 Therefore rejecting the hypothesis that there is a stable microbiome association with the octocoral A. ; elisabethae. This suggests that this coral does not require a stable association with any specific bacterial species for survival.

The dinoflagellate and larval samples were determined to have a statistically different microbial community structure than the holobiont samples from which they.were obtained. However they had similar microbial richness, diversity, and taxonomic composition at the genus level. This data has added to the growing body of research on A. elisabethae microbiomes and was the first to investigate the microbial communities associated with the dinoflagellates and larvae of this pharmaceutically important octocoral.

255 7.1.3 Chapter 4: Culture-Dependent Investigation of the Bacterial Communities Associated

with Antillogorgia elisabethae

This study characterized the cultivatable bacteria from the octocoral A. elisabethae using two

different techniques. The first investigated the taxonomic diversity that could be cultured from

the holobiont, dinoflagellate, and larvae used in Chapter 2. From these samples a total of 89

unique bacterial species were obtained, the majority of which belonged to the class

Gammaproteobacteria. When comparing the culture-dependent libraries to the culture-

independent libraries for the holobiont, dinoflagellates, and larvae the recovery rates were 3.9%,

10.0%, and 7.5% respectively. In addition, 12 bacterial isolates were obtained from the dinoflagellate and larvae samples that were not obtained from the holobiont samples.

The second technique investigated the taxonomic diversity that could be obtained using microaerophilic and anaerobic culturing conditions. A total of 54 unique bacterial strains were obtained that had not been obtained in the previous aerobic culture-dependent library. Between the two culturing techniques used in this study, a total of 143 different species of bacteria were obtained. Of these, three were putatively novel species, two of putatively novel genera, and one bacterial isolate, Pseudo bacteriovorax antillogorgiicola RKEM 611T, confirming the hypothesis that A. elisabethae is a source of novel cultivatable bacteria.

256 7.1.4 Chapter 5: Species Description of Pseudobacteriovorax antillogorgiicola gen. nov., sp.

nov., a bacterium isolated from the gorgonian octocoral Antillogorgia elisabethae, belonging

to a novel bacterial family, Pseudobacteriovoraceae fam. nov., within the order

Bdellovibrionales

This study taxonomically identified bacterial isolate RKEM 611 by comparing all available phenotypic, genotypic, and chemotaxonomic data of the closely related Bdellovibrio-and-like organisms.3 Based on phylogenetic analysis of the 16S rRNA gene, in addition to phenotypic and chemotaxonomic characteristics, RKEM6 11 was determined to belong to a novel family within the order Bdellovibrionales. The names Pseudobacteriovoracaceae for the family and

Pseudobacteriovorax antillogorgiicola for the genus and species were assigned. This research highlighted that octocorals can serve as reservoirs for taxonomically unique bacteria.

7.1.5 Chapter 6: Investigation of Secondary Metabolites Produced by Octocoral Associated

Bacteria

This study investigated the secondary metabolites produced by bacteria from A. elisabethae and

E. caribaeorum culture dependent libraries. A chemical dereplication process was employed to identify unique metabolites in the bacterial fermentation extracts belonging to the same

4-6 taxonomic phylum. The previously reported rhodopeptins, zincphyrin, 7 nocardamine,8

9-11 12 concanamycins, and kocurin were detected in the Actinobacteria fermentation extracts.

Baceridin13 as well as bacillamide14'15 analogs were detected in the Firm icute extracts.

Pseudoalteromones,16'17 bahamamide,18 andrimid,19-21 bromoalterochromide A,22 korormicins,23-26 ulbactins,27-29 and putisolvins3° were detected in the Protoebacteria extracts. Impottantly, a new long-chain N-acyl L-leucine was isolated from Halomonas sp. RKEM 883 and determined to

257 have mild antibiotic activity against MRSA, VRE, and S. warneri. This research highlighted the

diversity of secondary metabolites that can be obtained from octocoral-associated bacteria and

confirmed the hypothesis that bacteria cultivated from A. elisabethae and E. caribaeorum can be a source of known and novel MNPs.

7.1.6 Overall Conclusions of Thesis Research

This thesis research provided valuable information about the microbiomes of E. caribaeorum and A. elisabethae. These Caribbean octocorals are keystone members of many reef 133 communities,3 and understanding the composition of their healthy microbiomes is important to understanding the health of the reef ecosystem in which they inhabit. Additionally A. elisabethae proved to be a unique reservoir of novel cultivatable bacteria as a wide range of taxonomic diversity was obtained. This was highlighted by a bacterial isolate that was determined to belong to an entirely new taxonomic family. Furthermore, the bacteria cultured from the octocorals in this thesis research proved to be an excellent source of secondary metabolites, producing many known compounds with various reported bioactivity, as well as the new long-chain N-acyl L-leucine. Although no pseudopterosin or eleutherobin production was detected through culturing of the octocoral associated bacteria, future metagenome sequencing studies of these octocorals should be employed to determine the true biosynthetic source of these important marine natural products.

258 7.2 Future Directions of Thesis Research

7.2.1 Octocoral Microbiomes

The overall field of microbial ecology, including octocoral microbiomes, has been greatly enhanced over the past few years by metagenomic sequencing. Advancements in high throughput next generation sequencing technologies and bioinformatics have enabled the sequencing of entire microbial genomes in complex environmental samples.34-38 This has allowed for the identification of genes and a better understanding of their function in the environment.39'40 Metagenomic research is particularly attractive in the field of natural products because it provides a means of exploring novel secondary metabolites from bacteria that are known to be present but are difficult to culture.41'42 Furthermore, it allows for the identification of cryptic gene clusters that may not be expressed in cultivatable bacteria under laboratory settings.43'44 Since the genetic information for the biosynthesis of these metabolites is generally clustered on the bacterial genome, it is therefore possible for the gene clusters to be cloned and expressed in a heterologous host to produce these metabolites of interest.45-47 Therefore, the next step with regards to A. elisabethae and E. caribaeorum will be to sequence the metagenome of these octocorals and determine the true biosynthetic origins of pseudopterosins and eleutherobins, respectively.

7.2.2 Microbial Marine Natural Products

Advancements in high throughput screening along with automated purification and identification techniques has allowed the rate at which novel microbial secondary metabolites are being reported to steadily increase of over the last few years.48-53 Furthermore, the rate at which these novel compounds are being discovered does not appear to be subsiding anytime soon,54'55 as only

259 a fraction of the overall marine microbiome has been explored56 and thus the potential for novel chemistry is largely untapped. However, even though the rate at which novel microbial metabolites being reported is increasing, the rate of bioactive metabolites is not. In fact the percentage of secondary metabolites with reported bioactivity has decreased over the last few years.53 This highlights the need for new and innovativi e bioassays to be able to keep pace with the rate at which novel compounds are being discovered. The lack of reported bioactivity does not mean the compounds are inactive and bioactivity is often discovered in future studies.57-59

Therefore further investigation into the bioactive potential of the long chain N-acyl leucine as well as other metabolites from the culture-dependent library is warranted.

The marine microbial community is a massive source of untapped novel chemistry; the bioactive potential of many known secondary metabolites is still waiting to be discovered. Natural products have been, and continue to be, an excellent source of drug leads as these metabolites have co-evolved with biological targets generating a wide range of pharmacophores with a high degree of selectivity. As Cragg and Newman stated in their 2013 natural products review,

"Mother Nature has had three billion years to refine her chemistry and we are only now scratching the surface in exploring Nature's molecular diversity!"6°

7.3 References

McCauley, E. P.; Haltli, B.; Correa, H.; Kerr, R. G. FEMS Microbiol. Ecol. 2016, 92 (9),

fiw147.

Robertson, V.; Haltli, B.; McCauley, E.; Overy, D.; Kerr, R. G. Microorganisms 2016, 4

(3), 1-23.

McCauley, E. P.; Haltli, B.; Kerr, R. G. Int. J. Syst. Evol. Microbiol. 2014, 65 (2), 522-

260 530.

Chiba, H.; Agematu, H.; Kaneto, R.; Terasawa, T.; Sakai, K.; Dobashi, K.; Yoshioka, T.

J. Antibiot. 1999, 52 (8), 695-699.

Chiba, H.; Agematu, H.; Dobashi, K.; Yoshioka, T. J. Antibiot. 1999, 52 (8), 700-709.

Chiba, H.; Agematu, H.; Sakai, K.; Dobashi, K.; Yoshioka, T. J. Antibiot. 1999, 52 (8),

710-720.

Toriya, M.; Yaginuma, S.; Murofushi, S.; Ogawa, K.; Muto, N.; Hayashi, M.;

Matsumoto, K. J. Antibiot. 1993, 46 (1), 196-200.

Hyi-Seung Lee; Hee Jae Shin; Kyoung Hwa Jong; Tae Sik Kim; Ki-Bong Oh, A.;

Jongheon Shin. I Nat. Prod. 2005, 68 (4), 623-625.

Kinashi, H.; Someno, K.; Sakaguchi, K. J. Antibiot. 1984, 37 (11), 1333-1343.

Kinashi, H.; Sakaguchi, K.; Higashijima, T.; Miyazawa, T. J. Antibiot. 1982, 35 (11),

1618-1620.

Woo, J.-T.; Shinohara, C.; Sakai, K.; Hasumi, K.; Endo, A. J. Antibiot. 1992, 45 (7),

1108-1116.

Martin, J.; da S Sousa, T.; Crespo, G.; Palomo, S.; Gonzalez, I.; Tormo, J. R.; la Cruz, de, M.; Anderson, M.; Hill, R. T.; Vicente, F.; Genilloud, O.; Reyes, F. Mar. Drugs.

2013, 11 (2), 387-398.

Niggemann, J.; Bozko, P.; Bruns, N.; Wodtke, A.; Gieseler, M. T.; Thomas, K.; Jahns,

C.; Nimtz, M.; Reupke, I.; BrUser, T.; Auling, G.; Malek, N.; Kalesse, M. Chembiochem

2014, 15 (7), 1021-1029.

Socha, A. M.; Long, R. A.; Rowley, Li. C. J. Nat. Prod. 2007, 70 (11), 1793-1795.

Jin, L.; Ma, W.; Peng, C.; Yin, Y.; Xu, B.; Zhang, F.; Guo, Y.; Li, Z. Process Biochem.

261 2011, 46 (5), 1153-1159.

Chen, Y.-H.; Lu, M.-C.; Chang, Y.-C.; Hwang, T.-L.; Wang, W.-H.; Weng, C.-F.; Kuo,

J.; Sung, P.-J. Tetrahedron Lett. 2012, 53 (13), 1675-1677.

Chen, Y.-H.; Kuo, J.; Su, J.-H.; Hwang, T.-L.; Chen, Y.-H.; Lee; C.-H.; Weng, C.-F.;

Sung, P.-J. Mar. Drugs 2012, 10 (7), 1566-1571.

Boehler, M.; Jensen, P. R.; Fenical, W. Nat. Prod. Lett. 1997, 10 (1), 75-78.

Needham, J.; Kelly, M. T.; Ishige, M.; Andersen, R. J. J. Org. Chem. 1994, 59 (8),

2058-2063.

McWhorter, W.; Fredenhagen, A.; Nakanishi, K.; Komura, H. J. Chem. Soc. Chem.

Comm. 1989, 299-301.

Fredenhagen, A.; Tamura, S. Y.; Kenny, P. T. M.; Komura, H.; Naya, Y.; Nakanishi, K.;

Nishiyama, K.; Sugiura, M.; Kita, H. J Am. Chem. Soc. 2002, 109 (14), 4409-4411.

Speitling, M.; Smetanina, O.; Kuznetsova, T.; Lattsch, H. J Antibiot 2007, 60 (1), 36-42.

(23) Yoshikawa, K.; Takadera, T.; Adachi, K.; Nishijima, M.; Sano, H. J. Antibiot 1997, 50

(11), 949-953.

Yoshikawa, K.; Nakayama, Y.; Hayashi, M.; Unemoto, T.; Mochida, K. J. Antibiot

1999, 52 (2), 182-185.

Yoshikawa, K.; Adachi, K.; Nishida, F.; Mochida, K. J. Antibiot 2003, 56 (10), 866-

870.

Uehara, H.; Oishi, T.; Yoshikawa, K.; Mochida, K.; Hirama, M. Tetrahedron Lett. 1999,

40 (49), 8641-8645.

Kikuchi, K.; Chen, C. A.; Adachi, K.; Nishijima, M.; Nishida, F.; Takadera, T.; Sano, H.

Japan Patent, JPH049492. October 1,1997.

262 Kikuchi, K.; Yochitaka, C.; Adachi, K.; Nishida, F.; Takadera, T.; Sano, H. Japan

Patent, JPH10245377 September 14,1998.

Igarashi, Y.; Asano, D.; Sawamura, M.; In, Y.; Ishida, T.; Imoto, M. Org. Lett. 2016, 18

(7), 1658-1661.

Kuiper, I.; Lagendijk, E. L.; Pickford, R.; Derrick, J. P.; Lamers, G. E. M.; Thomas-

Oates, J. E.; Lugtenberg, B. J. J.; Bloemberg, G. V. Mol. Microbiol. 2003, 51 (1), 97-

113.

Tunnell, J. W.; Nelson, T. J. American Academy of Underwater Sciences (AAUS),

1989; pp 325-335.

Tanner, J. E.; Hughes, T. P.; Connell, J. H. Ecology 1994, 75 (8), 2204.

Moberg, F.; Folke, C. EcoL Econ. 1999, 29 (2), 215-233.

Hiraoka, S.; Yang, C.-C.; Iwasaki, W. Microbes. Environ. 2016, 3/ (3), 204-212.

Tseng, C.-H.; Tang, S.-L. Int. J. MoL Sci. 2014, 15 (5), 8878-8892.

Trindade, M.; van Zyl, L. J.; Navarro-Fernandez, J.; Abd Elrazak, A. Front. Microbiol.

2015, 6 (e78992), 890.

Gilbert, J. A.; Dupont, C. L. Annu. Rev. Mar. Sci. 2011, 3, 347-371.

Thomas, T.; Gilbert, J.; Meyer, F. Microb. Inform. Exp. 2012, 2 (1), 3.

Kelly, L. W.; Williams, GA.; Barott, K. L.; Carlson, C. A.; Dinsdale, E. A.; Edwards, R.

A.; Haas, A. F.; Haynes, M.; Lim, Y. W.; McDole, T.; Nelson, C. E.; Sala, E.; Sandin, S.

A.; Smith, J. E.; Vermeij, M. J. A.; Youle, M.; Rohwer, F. P. Natl. Acad. Sci. USA 2014,

111 (28), 10227-10232.

Sunagawa, S.; Coelho, L. P.; Chaffron, S.; Kultima, J. R.; Labadie, K.; Salazar, G.;

Djahanschiri, B.; Zeller, G.; Mende, D. R.; Alberti, A.; Cornejo-Castillo, F. M.; Costea,

263 P. I.; Cruaud, C.; d'Ovidio, F.; Engelen, S.; Ferrera, I.; Gasol, J. M.; Guidi, L.;

Hildebrand, F.; Kokoszka, F.; Lepoivre, C.; Lima-Mendez, G.; Poulain, J.; Poulos, B. T.;

Royo-Llonch, M.; Sarmento, H.; Vieira-Silva, S.; Dimier, C.; Picheral, M.; Searson, S.;

Kandels-Lewis, S.; coordinators, T. O.; de Vargas, C.; Gorsky, G.; Grimsley, N.;

Hingamp, P.; Iudicone, D.; Jaillon, O.; Not, F.; Ogata, H.; Pesant, S.; Speich, S.;

Stemmann, L.; Sullivan, M. B.; Weissenbach, J.; Wincker, P.; Karsenti, E.; Raes, J.;

Acinas, S. G.; Bork, P.; Boss, E.; Bowler, C.; Follows, M.; Karp-Boss, L.; Krzic, U.;

Reynaud, E. G.; Sardet, C.; Sieracki, M.; Velayoudon, D. Science 2015, 348 (6237),

1261359.

Banik, J. J.; Brady, S. F. Curr. Opin. MicrobioL 2010, 13 (5), 603-609.

Reddy, B. V. B.; Milshteyn, A.; Charlop-Powers, Z.; Brady, S. F. Chem. Biol. 2014, 21

(8), 1023-1033.

Wilson, M. C.; Piel, J. Chem. Biol. 2013, 20 (5), 636-647.

Rutledge, P. J.; Challis, G. L. Nat. Rev. Micro biol. 2015, 13 (8), 509-523.

Yamanaka, K.; Reynolds, K. A.; Kersten, R. D.; Ryan, K. S.; Gonzalez, D. J.; Nizet, V.;

Dorrestein, P. C.; Moore, B. S. P. NatL Acad. Sci. USA 2014, 111 (5), 1957-1962.

Li, Y.; Li, Z.; Yamanaka K.; Xu, Y.; Zhang, W.; Vlamakis, H.; Kolter, R.; Moore, B.

S.; Qian, P.-Y. Sci. Rep. 2015, 5, 9383.

Bonet, B.; Teufel, R.; Cri.isemann, M.; Ziemert, N.; Moore, B. S. I Nat. Prod. 2014.

Henrich, C. J.; Beutler, J. A. Nat. Prod. Rep. 2013, 30 (10), 1.284-1298.

Yang, J. Y.; Sanchez, L. M.; Rath, C. M.; Liu, X.; Boudreau, P. D.; Bruns, N.; Glukhov,

E.; Wodtke, A.; de Felicio, R.; Fenner, A.; Wong, W. R.; Linington, R. G.; Zhang, L.;

Debonsi, H. M.; Gerwick, W. H.; Dorrestein, P. C. J Nat Prod 2013, 76 (9), 1686-1699.

264 Robinette, S. L.; Briischweiler, R.; Schroeder, E C.; Edison, A. S. Acc. Chem. Res.

2012, 45 (2), 288-297.

Johnston, C. W.; Skinnider, M. A.; Wyatt, M. A.; Li, X.; Ranieri, M. R. M.; Yang, L.;

Zechel, D. L.; Bin Ma; Magarvey, N. A. Nat. Commun. 2015, 6, 8421.

Bucar, F.; Wube, A.; Schmid, M. Nat. Prod. Rep. 2013, 30 (4), 525-545.

Hu, Y.; Chen, J.; Hu, G.; Yu, J.; Zhu, X.; Lin, Y.; Chen, S.; Yuan, J. Mar. Drugs 2015,

13 (1), 202-221.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod.

Rep. 2016, 33 (3), 382-431.

Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod.

Rep. 2015, 32 (2), 116-211.

Mora, C.; Tittensor, D. P.; Adl, S.; Simpson, A. G. B.; Worm, B. PLoS Biol 2011, 9 (8), e1001127.

Harvey, A. Drug Discov. Today 2000, 5 (7), 294-300.

Dong, G.; Wang, S.; Miao, Z.; Yao, J.; Zhang, Y.; Guo, Z.; Zhang, W.; Sheng, C. J.

Med. Chem. 2012, 55 (17), 7593-7613.

Cragg, G. M.; Grothaus, P. G.; Newman, D. J. J. Nat. Prod. 2014, 77 (3), 703-723.

Cragg, G. M.; Newman, D. J. Biochim. Biophys. Acta. 2013, 1830 (6), 3670-3695.

265 Appendix A: Chapter 5— Supplementary Information

266 Aquaspifillum putridiconchylium ATCC 152791 (AB076000) Thiobacillus aquaesulis DSM 42551 (U58019) 100 Collimonas fungivorans Ter6T (A.T3I0394)

Methylobacillus glycogenes. T-I1T (FR733701) Xanthomonas oryzaeYK9T (X9592I) Ectothiorhodospira shaposhnikoviiNiT (FR33667) 94 58 Alcanivorax borkumensis SK2T (Y12579) 57 Marinobamerium sediminicola CN47T (EU573966) Escherichia colt (101695.2) Nautilia profitndicola AmHT (AF357197)

00 Thioreductor mica ntisoli DSM16661T (AB175498) 96 ,Arcobacter cibarius LMG 21996' (AJ607391) 98 Helicobacter acinonychis 90-119T 0.488148) Magnetococcus marinus MC-51. (NR074371) Acidomonas methanolicus MB58T (A.1310394) Dinococcus radiodurans MRPT (NR074975) Spirochaeta litoralis DSM2029T (FR733665)

Pseudobacteriovorax antillogorgiicola Rla111611T (K1985394) Peredibacter statrii A3.12T (AF084852)

100 Bacteriolyticum stolpii Uki2T (A1288899) 67 Bacteriovorax mannus SJT (AF084854) 88 Bacteriovorax litoralis JS5T (AF084859) Oceanicola granulosus HTCC2516T (AY424896)

94 Caulobacter segnis MBIC2S351 (AB023427) 69 Shinella yambaruensis MS4T (AB285481) Bdellovibrio exovonts JSST (EF687743) 100 Bdellovibrio bacteriovonts HD 100' (A1292759)

Desulfobacterium autotrophicum DSM 3382' (AF418177) 72 Desulfocapsa sulfoexigens SB164P IT (Y13672)

Desulfomicrobium thermophilum P6.2T (AY464939) 98 Desulfovibrio CVLT (AF050100)

72 Desulfacinum infernum BalphaG1T (L27426) 95 Thermodesulforhabdus norvegicus A8444T (122627) Desulforha bus amnigenus ASRB iT (2(83274) 62 99 Desulfovirga adiPica 'MUM T (A1237605) 65 Desulfobacca acetoxidans ASRB2T (AF002671) Desulfarculus baarsii DSM 20751 (NR041850)

61 Geobacter pelophilus Dfr21:(U96918) Pelobacter propionicus DSM 2379' (NR074975) Geobacter metallireducens GS-15T (L07834)

85 Jahnella thaxteri PI t41 (GU207876) Nannotystis pusilla Na p29T (FR749907) Cystobacter badius Cb b2T (DQ768103)

100 Archangium gephyra DSM 2261' (DQ768106) 77 Myxococcus fithnts ATCC 25199' (DQ768117)

5)nittvphorhabdus aromaticivorans UIT (AB2I2873) Bacillus sidnilis DSMIOT (A1276351) Figure A.1. Maximum-parsimony phylogenetic tree based on 16S rRNA gene sequences from type strains from with the phylum Proteobacteria.

267 00 Desulforhabus amnigenus A SRB1T (X83274) 55 Desztlfovirga adipica TsuAlT (A.1237605) 100 Desulfacinum infernum BalphaGlr (L27426) 59 Thermodesulforhabdus norvegicns A8444T (U2627) Desulfobacca acetoxidans ASRB2T (AF002671) 76 Desulfatruhts baarsit DSM 20751 (NR041850) Syntrophorhabdus anamaticivorans UIT (AB212873)

98 Jahnella thaxteri P1841 (GU207876) Nannocystis pusilla Na p291 (FR749907)

Mprococcus films ATCC 25199T (DQ768117). 95 100 Archangium gephyra DSM 22611 (DQ768106) 87 Cystobacter badius Cb b21 (DQ768108)

Geobacter metallireducens GS-15T (L07834)

100 Geobacter pelophilus DEr2T (U96918) 87 Pelobacter propionicus DSM 23791 (NR074975)

00 Bdellovibrio bacteriovonts HD 1001 (A1292759) Bdellovibrio erovorus 'SST (EF687743)

56 Peredibacter starrii A3.121 (AF084852)

100 Bacteriolyticum stolpii Uki2T (A1288899) 98 Bacteriovorax litoralis IS51 (AF084859) 00 Bacteriovorax marinus Sr (AF084854)

Pseutiobacteriovorax antillogorgiicola RKEM611T (1(3985394) Magnetococcus marinus MC-1T (NR074371)

76 Arcobacter cibarius LMG 219961 (A1607391) 00 Helicobacter acinonychis 90-1191 (MSS148) 100 Thioreductor micantisoli DSM 166611 (AB175498) Nautilia profitndicola AmHT (AF357197) 93 Alcanivorax borkumensis SKIT (Y12579) 76 60 Marinobacterizim sediminicola CN471 (EU573966) Ectothiorhodospira shaposhnikovii NIT (FR33667) Escherichia colt I6S rRNA (101695.2) 100 Xanthomonas otyzae Y1{9T (X95921)

54 Aquaspirillum putridiconchylium ATCC 15279T (AB076000) 100 Thiobacillus aquaesulis DSM 42551 (U58019) 8 Collimonas fimgivorans Ter6T (A1310394) 56 Methylobacillus glycogenes T-11T (FR733701)

76 Bacillus subtilis DSM I OT ( AJ276351) 91 Dinococcus radiodurans MRPT (NR074975) Spirochaeta litoralis DSM20291 (FR733665) Acidomonas methanolicus MB581 (A1310394)

Oceanicola gran:do:us HTCC2516T (AY424896)

99 Caulobacter segnis MBIC2835T (AB023427) 68 Shine/la yambantensis MS4T (AB28548I) Bacteriovorax sp. MB2 (EF536782) 85 Bacteriovorax sp. 0C3 (EF536786) Bacteriovorax sp. PS93S (EF536771) Bacteriovorax sp. HAS (EF536799)

68 Bacteriovorax sp. MIA2 (EF536791) Bacteriovorax sp. 008 (EF536797) 73 Bacteriovorax sp. MANZ3 (EF536765) 62 Bacteriovorax sp. IP (EF536804) Bacteriovorax sp. MED2 (EF536815)

100 Bdellovibrio bactedovorus HD100 (NC005363) 7 Bdellovibrio bactedovonts Tiberius (NC019567) Psendobacteriovorax antillogoriicola RIaM611 (101272985)

100 Desulfobacterium outotrophicum HRM2 (NC012108) Destqovibrio vulgaris DP4 (NC008751) 00

88 Geobacter bemidjiensis Bern (NC011146) 100 Geobacter metallireducens GS-15 (CP00148) Bacteriovorax sp. GSL37 (EF536805)

Figure A.3. Maximum-parsimony phylogenetic tree based on 17 rpofl gene sequences from the class Deltaproteobacteria.

269 Bacteriovorax sp. MB2 (EF536782) 7 Bacteriovorax sp. PS93S (FF536771) Bacteriovorax sp. 0C3 (FF536786) Bacteriovorax sp. 1-lA5 (EF536799) 76 _II 6 Bacteriovorax sp. MIA2 (EF536791) 67 Bacteriovorax sp. 008 (FF536797) 2 Bacteriovorax sp. MANZ3 (FF536765) 64 77 Bacteriovorax sp. EP (FF536804) Bacteriovorax sp. MED2 (FF536815) 00 Bacteriovorax sp. GSL37 (FF536805) Pseridobacteriovorax antillogorikola RETM611T (1CM212985) 63 loo [ Bdellovibrio bacteriovorus BD100 (NC005363) Bdellovibiio bacteriovorus Tiberius (NC019567) Desulfovibrio vulgaris DP4 (NC008751) Geobacter bentidjiensis Bern (NC011146)

46_ Desulfobacterium autotrophicum HRM2 (NC012108) 34 Geobacter metallireducens GS-15 (CP00148)

0.2 Figure A.4. Minimum-evolution phylogenetic tree based on 17 rpo gene sequences from the class Deltaproteobacteria.

270 Appendix B: Chapter 6 - Supplementary Information

271 B.1. Principal Component Analysis - Scores and Loadings Plots

Scores

0. PC-7 (3%)

Loadings

496.38 926

510.40 1 524 416032 758.190736 2'.408113 • 267.? • o.i 9630 • 5.075829

472434 717 1R SAIMMIRil. S 261 123 86 2 887 • .2651114 1231b C6°1178 320. igiNAKOP dI 655:177235 • • 327.12 789 860.472422 845.497621

-0.3

-0.3 -02 -0.1 0 0.1 0.2 0.3 PC-7 (3%)

Figure B.1.1. Scores and loadings plots highlighting the production of the rhodopeptins.

272 Scores

-1 1 PC-1 (11%)

Loadings

-0.2 -0.1 0 0.1 02 0.3 PC-1 (11%)

Figure B.1.2. Scores and loadings plots highlighting the production of coproporphyrin III and zincphyrin.

273

Scores 1.4 1637 BFK43 1.2 774 J3FM3#1 • 1692_13FM3 1 1_BFM3 • 0.8 1754_BFM3 • 1775_BFM3 0.6 • • 1741_BFM3 0.4 • 832 • 9751 72_13F11111 0.2 • • 1 o . • SF2 608 _ISP2_ -••+7:10., IA.': • ' M1 1

• • • 1 8_BFN13 843 BFM3S1 - • 1781_13FM3S • • -1 1698_13Hk/13S 1715_BF11•13 •

-2 0 1 2 PC-11 (2%)

Loadings 0.3 267.110603 •

0.2 601.355923 79E 4%23.337452 ?'& 77235 • 0.1 285.07 776 329.080883 22 5

CO - 292.108%. 1 - 7.t.••• 4g412 5241. • '327.122789 211.086887 50915 • 515.141)2!. .1 445157,644.195 -0.1 • 233311101165 • 623t38040 215.070019 • • 545?-107V58 • • • -0.2 • 496.344926 213.159983 • 758.190736 • -0.3 -0.4 -0.3 -0.2 -0.1 0 01 0:2 0.3 PC-11 (2%)

Figure B.1.3. Scores and loadings plots highlighting the production of nocardamine.

274 Scores

1fi42_ISP2Is •

1715_BFM11 OF2W/43 774_BFM3X24_1045 171501SP2 • 1571_BF M11 • 1571_ 170§5.P&MT.15_BF14602 RF_Kd -7 MT -13FM11 174/F t 698-iff 6111 4 1715 1§9,82- • jBF BFMll 1 • 951 BFM 512AattM • • 1652_BFM11 1784 ISA • 1741_Eir M3- • 917_BFM11 •

-a -1 0 1 2 PC-1 (11%)

Loadings

845.497615 209.1

265.1 1092 860.472422 845 497621 • • 23 496.3849284.416032 a • 510.40 758.190736 265.

71 245.1285881.08 110603 • 2 229.10148 21 327.122789 329.080883 • 6.45 060178 4,333. 560.394915 • •

-0.2

-0.5 -0.4 -0.3 -0.2 -0.1 0.1 PC-1 (11%)

Figure B.1.4. Scores and loadings plots highlighting the production of concanamycin C and E.

275 1608_ISP2_ • 1 1 63§8. I kitile1324if •• Ita - • EiFF:f-fOnt 1PEW _ •

94451116g-'0i 47. 917 EFt" t1E1 EF!"11 f4r.(5, 1153_EF M11 • 41111 BF M5 •

-3 -2 1 4 PC-5 (4%)

Loadings 758.190736 845497621 • 0.1 • 601 348.27 211.086887 • • 717.18 • • 02 655.277235 .08258229.101486 • 265.06 • • 245.128566 29Z20131M311132 • • 0 0- -0.2 - 496.384926 327.1227 60.472422 • • 329.08088f45.497615

-0.3 • • 267.110603 • 283.105436 261.1;3458 -0.4 • •

-0.5 -0 -0.4 -0.3 -0.2 -0.1 0:1 PC-5 (4%)

Figure B.1.5. Scores and loadings plots highlighting the production of kocurin

276 Score; 7 68_BFM5 6 •

5

4 E660 BFM3A 3 E 4_1062ABFM3A 2 5E78% bFM11 1 E660....BFrvi074_BMF1A JEWI.411 E674_BFM5A 057 • 0 • E732 BFM5A E732_41611.1% 0- - EQ7131f6.3.1A. me /1 43F Mil • • -2 E243 BFM5A -3 • E243_BMF5A 13271 _BF M3A • • -4

-5 O_BFM5A -8 •

-7 -4 -3 -2 0 1 2 3 4 5 6 PC-6 (5%)

Loadings

718.427531 0 1 107002 • 225.07 3 2E5.045239 3

4E8 29$2 082879 5 "1 *916 • 120 21% 351.089 _

254.ZM r. • 22'" 6 214056111 le • •

-0.1 0 0.1 0.2 PC-6 (5%)

Figure B.1.6. Scores and loadings plots highlighting the production of baceridin.

277 4

3 • E732 FM,Wilf" 2 • 10160_8F M1 B E720_6FM5A 6271_4M1/113FM5A • • tEpIlA 62 8213F M5A

E674_BFW . 16FM3A E768_6F M5 E660_6F M5A • E. • •

-2 •

GL. -3- E243_BMF5A

-4 •

-5 •

-6 •

-7 • 3_EFM5A E243_BFM3A • •

-6 -4 -3 -2 -1 0 1 PC-5 (6%)

Loadings

361 234970

338.0931V7.127654 • ::,e2tfigW6431 339.253W•lit3213 2075.1

-0.1 C, 1 PC-5 (6%)

Figure B.1.7. Scores and loadings plots highlighting the production of bacillamide B and C.

278 Scores

2C5jek •

297h B M5 8 667_8 755 B1F 11_ 282_BF • 271_BF •

883_BF M11_

-2

-3

-5 -4 -3 -2 -1 0 1 2 4 5 6 PC-4 (6%)

Loadings

2, 2 7.224696, ouu.923165 362 .a366C6 1. -,4 • 197.12/62 "frAtil .ig!: • 67 8,r4 0.1 250. li?IttfIli2 "1 235figithegA1692171 0257022 2 • • • 27 058844 1 86 292,t.8I2 •

314.269051 •

-0.2 • 412 11 0.1 PC-4 (6%)

Figure B.1.8. Scores and loadings plots highlighting the production of long-chain N-acyl-L- leucine.

279 Scores

3 xgroC55— 2 ne_5f t.,*5 831_ 1 81 883 13FL1 545 BFM1124324fp 0 - • 205 BFM5 - • — 720_B -1 •

-2

-3

-4

-5 271_BFM3

-6 •

-3 -1 0 1 2 3 PC-2 (7%)

Loadings

0.3

354M1611112 347.100W8 0.2 • 325.205072 • 347.219342 • 311.138739 339.184347 19 64

197.128720 345.1M 361.10c16A ' . • 0527 410.257022 •

-02 -

-03 -0.2 -0.1 0 0.1 0.2 0.3 PC-2 (7%)

Figure B.1.9. Scores and loadings plots highlighting the production of korormicins.

280 Scores

3

2

2 4 7 PC-5 (6%)

Loadings

0.1 • 673.502173 339 289321 6A§§7116457 562556ak 3.355608 • , ea A43.527658 347.219342 • • 809.535373 23.1.0M 250.1122. • 4• 8 E .,693.436 373.281868 224448 195 062 • 443714 38 0 • 249.064665 .1,0fidt.r .276802 • 71 315 314,261051 • 1189.588435 ....2. 0 -0.1 32%211416 ' lb . 84,18Z/16 •

0 0:1 0.2 PC-5 (6%)

Figure B.1.10. Scores and loadings plots highlighting the production of bromoalterochromide A.

281

CL

2 PC-5 (6%)

Loadings

gilgilinaril D 1 1 • 673.502173

339.289321 6frs§97itt457 5525f24646TIMM 3.355608 • • 513. 14143-527658 347.219342 • 231. 50.1 •

.ko3.4m 37).281868 .224448 195.061. • 443714 38JJ1.uJ17C 0 4, 249.064665 31.276802 • 7 321 0 4671 • 449.589495 20 84,118q716 3A, 2114• •

-01 0.1 02 PC-5 (6%)

Figure B.1.11. Scores and loadings plots highlighting the production of pseudoalteromone A and

B.

282 • Scores 3 •

2 - 282 BFM1f 71_Bg 883_3FM11_ - - • 545_BFM11_ • 0 • 2$3t...13F1645 -1 • •

-2 -

-6 243_BFM5B -7 - • -8 243 _BF M5A •

-14 -12 -10 -13 -6 -4 -2 0 2 PC-1 (20%)

Loadings

379.281868 52e, 319.224 96 367

363.236239 8844 • FL1111114231FiliR 42 lb* 7 UT. 22 249

547. 403M.20051114700 23255.065286 • • • Ag8 211111189 380.055624 • •

-at PC-1 (20%)

Figure B.1.12. Scores and loadings plots highlighting the production of ulbactin A and D.

283

Scores 12

12

6 •

C 0 - a —61X, -2 271 BFrr:E• •

_E.

-6

-1E -10 -5 0 5 PC-1 (20%)

Loadings

C.2 10.257022 • 3 262181 §Stg7 44 0, 1 , 2 800722 7 elle9223firtK 1 -5286 •

• jralsti.•74. • ". • - • a. 197.128720 319.2244V 665 • 529 • 379.281868 1 •

-0.2

-02 0 0:1 PC-1 (20%)

Figure B.1.11. Scores and loadings plots highlighting the production of putisolvin I.

284

Scores 4

3 •

2 •

0 •

?-2 205_5FM5_ • -3

-4 • 883 J3FM11_ -5 • •

-8 •

-7 •

-8

-6 -5 -4 -3 -2 1 2 3 PC-5(6% :

Loadings 0.2 - 410.257022 • 394.262181 'SWIMS WAS 0.1 *3.040722 a

2 130 .495.388979 380 o 0 1.240104 •

N.502173 2011 1 woo • 319..224444bb%7S.517817 357.2513 52%350457 • 5946S1 • • -0.1 • •• sasmia.281868

-0.2 -0.2 -0.1 0 0.1 0.2 PC-5 (6%)

Figure B.1.12. Scores and loadings plots highlighting the production of bahamamide.

285

- 1 2 - 1 0 -6 -4 0 1: PG-317%)

Loadings

480.279836 • 706.453521 •

239.t k've.:•* 2- • hT/14;itt:,41 •.:, 0.1 • ge:40§1151 $ 309 249.064665 307 t,. 11.284t7Q AMMR114 '58.064 51 etT.298.1434 23 • ( 251.022827 •

373.147003 432.23 • 4101263412125 271.060223 394/081 • 7152 *Bell% 1/097131141666 -0.1 • 255.065286 292.108112 • •

-0.1 0 0.1 PC-3 (7%)

Figure B.1.13. Scores and loadings plots highlighting the production of andrimid.

286 B.2. Ultra High Performance Liquid Chromatography—High Resolution Mass Spectroscopy

Data

287

RT: 0.00 - 10.01 1.96 NL: 3.77E4 A Total Scan PDA 1715_6 FM3 20000- 2.31 5.98 6.43 7.09 7.59 8.29 8.61 0.37 12 0 100- NL: 1.18E6 TIC F: FTMS (1,1) •p ESI Full lock ms 50: 9.76 (200.00-2000.00) MS 1715_BFM3

0 4.09 NL: 5.74E1 0.50 2.09 03 2.46 2.53 4.01.1 5.0_9_ 5.37 6.36 7.12 7.70 8.31 apCIrdCh. 1 AID 40 9.93 931 cAlrd i 15 _BFM3 20-

o- 1111111111111I1[11 2 3 4 5 6 7 8 9 10 Time (min)

1715_BFM3 #1228 RT: 4.1 1 1715_BFM3 #977 RT: 3.30 1715 BFM3 #840 RT: 2.84 T: FTMS {1,1} + p ESI Full lock ms [ T: FTMS {1,1} + p ES! Full lock ms [ T: FTMS {1,1} + p ESI Full lock ms[ ... 10 496.3849 100-7 52.41604 [M+Hr

80 807

60 60 L.-

4 407 301,1412 663 4551 371.1014 582 207 , 4272 0 .1. r 7,-5599 200 400 600 200 400 600 500 m/z m/z m/z

)\)-NF f° HN NH NH3 NH

NH HN Chemical Formula: C2E1-10504. HN 0 Exact Mass: 496.3857 NH3 (la) 0 Chemical Formula: C281-isoNs04` Chemical Formula: CnHssN5O4° Exact Mass: 524.4170 Exact Mass: 510.4014 (2) (3)

\,--NH

HN NH e 0 Chemical Formula. C2,0.1404. Exact Mass. 496.3857 (lb) Figure B.2.1. (A) UBPLC-HRMS chromatogram of Streptomycetes sp. RKEM 1715 in ISP2 and mass spectra of (B) rhodopeptin C2/C3 (la/lb), (C) rhodopeptin C4 (2), (D) rhodopeptin B5 (3).

288

RT: 0.00-10.01 2.90 NL: 1.16E5 A 100500 Total Scan PDA 1637_8FM 3 50000-: 2.24 2.73 \. ,..,_3.37 4.61 5.27 5.85 6.16 7.23 7.54 8.65 8 88

311 108 311 NL: 2.49E6 TIC F: FTIIS (1,1) + p 3.13 ESI Full lock ms 1.78 1. [200.00-2000.00j MS 92 1.87 3.19 354 4.43 1637_B FM 3 5.7 6.44 7.14 8.08 819 NL: 1.13E2 100- ND Card Ch. 1 A() card 1637_BFM3 1.7_4_2_;3 6 IL___63.38 4.78, _5:13 ...58L6.422.0 12. .,..1.2 50- i .910

0 111111111111111111111111IIIIII1 111111 1 2 3 4 5 7 B 9 Time (min)

1637 BFM3 #905 RT: 3.06 AV: 1 1637 BFM3 #989 RT: 3.34 AV: 1 T: FTMS 0,1} + p ESI Full lock ms [ T: FTMS 01} + p ESI Full lock ms [ 6552772 717.1898 100- 100- _ [%F- Hr C) e tm+Hr 2 80: 80: co

danc -o n 60= 60: 782.4630 Abu 40: ve ti la 20= a) 20 Re 328 1418 754 4308 1031.8457 , 500 1000 500 1000 miz mtz

Chemtcal Formula: C36H39N4081' Chemical Formula: C36H3TN.$08Zn' Exact Mass: 655.2762 Exact Mass: 717.1897

(4) ,(5)

Figure B.2.2. (A) UHPLC-HRMS chromatogram of Arthrobacter sp. RKEM 1637 in BFM3 and mass spectra of (B) coproporphyrin III (4) and (C) zincphyrin (5).

289

A

RT: 0.00-10.01 1.92 L: 3.87E4 Total Scan PDA 774_ISP2 3 20000- 0.37 3.48 1.60 4.60 5.76 612 7.18 7.0 8.34 8.65 1.47

100- 3.02 3.04 3.05 N L: 1.33E6 TIC F: FTMS(1.1) + P 2. 3 3.10 E SI Full lock ms 50- 2.77 [200.00-2000.00] MS 1.83 2_21 315 3-64 4.49 4.94 5.15 6.37 6.64 710 8.59 9.54 774_ISP2 0 0.49 NL: 6.24E1 3.30 3.65 4.49 5.14 5.76 6.09 6.74 ND Card Ch. 1 ND 0,61 2.01 2.05 7.56 8.15 9.00 9,29 card 774_ISP2

o - 1 1 1114 111 11 1 111 11 1111 1 1 14 4 1 1111 11 111 111111111.1 1 2 3 4 5 6 7 8 9 10 Time (min)

B 774 ISP2 #608 RT: 2.05 AV: 1 NL: T: FTMS {1,1} + p ESI Full lock ms [ 601 3559 100- [M+H] 2 80-7 o c- -0 - 623 3374 S 601- [Ni+Nar

w 40- .77; NW N 20- 0H cc Chemical Formula: C271149N609 4 Exact Mass: 601.3556 600 620 640 miz (6)

Figure B.2.3. (A) UHPLC-HRMS chromatogram of Streptomyces sp. RKEM 774 and ISP2 and mass spectra of (B) nocardamine (6).

290

RT: 0.00- 10.01 314 ML 7.8:1E4 3.30 Thal Scan FDA A lea2 ISP2 3 93030 1 2.13 227 2.97 396 4.87 f e.32 e 34 714 7.e7 812 s.ee 0. 39 o.4e 0. 33 0: 233 030 oz 210_0.2j...3 1 33 333 0.33 0.00 3.00 0.33 030 0.30 8.8e 0 2.23 ML: 5.100 1.90 2.89 717.19 1001 2.94 TIC F: FTIAS {1,1 +p 211J4 3E3.23 80047 483 C 31 7.E3 8,22„, 8.8 4 ESI FuU lock ms 413.27 41127 301.14 41'4' 41327 :200.00-2000.001 MS eo 1582 ISP2 0 3.52 NIL: 728E1 0.00 3.27 AD Card Ch. 1 AD 0.55 240 3.12 0.00 le3 .4.W 5.55 5.95 e.E7 7 8.13 903 as4 card /e92 isp2 0.00 0.00 0.03 0.00 0.33 303 0.00 3.00 0.00 3.03 00

1111 1 1111 11111111111111111111111111111111111111 1 2 3 4 5 C 7 8 9 10 Time (min)

1692_ISP2 #1102 RT: 3.73 AV: 1 1692_ISP2 #1169 RT: 3.95 AV: 1 T: FTMS {1,1} + p ESI Full lock ... B T: FTMS (1,1) + p ESI Full lock ... 1007 860.4724 a) - 845 4976 100-_- L.) [M+Nar [M-Na] a) - 80=_ o - cco 80-7 c -o - jaz 60-E. c 60 < _ .ci - w 40 [M+H] EM-Hr •ro 40-7: 823 5178 838 4915 z• 20-7 co ft _ 76 20 0-: 1 1 I II i i I I I I 800 850 0 1 1 1 i 11111 i 800 850 900 mlz M/Z

0 C OH2 J.L. OH 0 NH3 OH

Chemical Formula: C4511750, 3- Exact Mass: 823.5202 Chemical Formula: C44F172N014+ Exact Mass: 838.4947 (7) (8)

Figure B.2.4. (A) UHPLC-HRMS chromatogram of Arthrobacter sp. RKEM 1692 in ISP2 and mass spectra of (B) concanamycin C (7) and (C) concanamycin E (8).

291

A

RT: 0.00 - 10.01 2.25 24 NL: 1.99E4 Total Scan PDA 5 18 5 53 5 98 e ei 7.18 7.1 8.398 et 2 11 13 1e08_ISP2 10000 3 37 4.47_ 1.92 33 943

1.82 251 NL: 5.3eE5 100- 1 7,5 2.03 1 25 1 51 4.42 5:2e 829 TIC F: FTMS {1.1} +p ESI e 30 e 48 e e4 7 95 8 55 952 Full lock ms 50 - 1200.00-2000.001 MS le08_,ISP2

0.51 NL 4 85E1 3 4.93 .5.57 5.95 e.43 7.01 7.83_ 8.17 8,99 9.24 1.8_4 2.1_27 AC Cara CI, 1 AD card A 40 1.538_1SP2 20 0 1 2 3 4 5 6 7 8 9 10 Time (min)

1608_1 SP2 #1059 RT: 3.58 AV: 1 T: FTMS {1,1} + p ESI Full lock ... 758.1907 100— [M4.2q2- 80 dance 60= [M+Hr Abun 40: 1515 3738 tive la 207 1011.0302 Re 0=. , 1000 1500 NH2 rniz

,‘ 0 HN

Chemical Formula: Ce9H67N18013S5+ Exact Mass: 1515.3733

Figure B.2.5. (A) UHPLC-HRMS chromatogram of Kocuria sp. RKEM 1608 in IPS2 and mass spectra of (B) kocurin (9),

292

RT: 0.00-10.01 0 la N.: 3.43E4 A Total Scar PCA RKE1175.3_5m SEP82_ct9 2 '4 52 3.22 2 42 2 5k433 4•82 f.4__.!..a 0 3.0508 10D-z ' TIC F: FTMS{1.1} +p ESI Fun 24 "- lock ms [1 90.03-2000.00I MS 50- RKE1.1758 SEP8.2_c19 4: 2.31 1-78 373 4.40 r.• • 5.92 9.72 0- :43 KL: 459E2 400 AU Carl Cr 1 AD cart Fttc.SM753_5rr ELEP322-1S 200- .24 2;3 2 32 2 7: 4.55 5.57 533 0-44 733 737 22: 22,9 27 0: 114111 III 111111 1 ilull 2 3 4 5 7 8 9 10 Time (min)

RKEM768_5m_BEP82_d9 #1139 RI: T: FTMS {1,1} + p ESI Full lock ... 718 4275 100: [M+Nar NH c 80: = 60= 696.4455 IM-Hr 0 40-- CO 120e, 20: 0- I 1 I I 1 1 Chemical Formula: C37H58N706+ 700 720 Exact Mass: 696.4443 rri/z (10)

Figure B.2.6. (A) UHPLC-HRMS chromatogram of Paenibacillus sp. RKEM 768 in BFM5 and mass spectra of (B) baceridin (10).

293

RT: 0.00 - 10.01 A 3.33 Mt.: 9.86E4 2.67 Total Scan PDA RKEM720_5m_BEP82 _if 50000= 22 3,38 1,17 1.67 2. 2,21 4.50 6.39 6.80 6.07 e se 8.21 st 9.21 3.20 ML: 3.47E6 1007 2.36 TIC F: FTN1S {1.1} p ESI Full 1.83 2.84 1.32 - lock ms1190.00-2000.001 MS 50: e.25 7.12 RKEM720_5m_13EP82 370 3.81 4.42 6.66 08 ML' 4.56E2 dico= AD Card Ch 1 AD card

RKEN1720_5m_BEP82_ff 2.03 3.17 1.33 7.10740 3..67 3.93 g.18 5.ee ell 8,13 9.00 9,31

1111111111111111111111/1111111111111111 1 2 3 4 5 6 7 8 9 10 Time (rnin)

RKEM720_5m_BEP82 #845 RT: RKEM720_5m_BEP82 J5 #786 RT: T: FT MS (1.1) + p ESI Full ock T: FTMS {1,1} + o ESI Full lock ... 316.1112 338.0931 357.1378 100- 100- [m+Hr (7, 8077-. c 80=_ c - tm-Hr -0 = 60= ;k3 - a) 40- > 40- 20- 1.--Z 20= cc x 3 52 ]2 811 371 1625 354.0677 0 • .1i. Ii Ii 0 I ?I r 1' I 11iI-% 300 320 340 340 360 m/z rniz

OH

HN 0 Chemical Formula: C16H18N302S+ Chemical Formula: C18H2IN402S+ Exact Mass: 316.1114 Exact Mass: 357.1380 (12)

Figure B.2.7. (A) UHPLC-HRMS chromatogram of Bacillus sp. RKEM 720 in BFM5 and mass spectra of (B) bacillaide B (11) and (C) bacillamide C (12).

294

RT: 0.00-10.01 0.38 NL: 3.47E4 A Totai Soar PEIA E282_13FMt 1E1 20000- 3.48 4.92 5.36 59L6.25 0.87 7.83 8.12 8e1 ea 2 2 32e 1-‘1 NL: 1.2096 100: T IC F: FT MS {1.1} + p ESI 2.95 Full lock ms 2.07 50- 0.74 1200.00-2000.001 MS •••a••••1 13282_13FM11 0 - 0.47 NI.: 4.86E1 42 2.04 2 2! 3.6, 4.24 495 5.08 ,,f, 604 7 le 2,,m 8.99 9.28 40- ,VDCartt 1 AD ca B282...EFM .1 20;

0 1 2 3 4 5 6 7 8 9 10 Time (mm)

B282_BRA 118 A872 RT: 2.95 AV: 1 [3282_8FM 118 #1078 RT: 3.64 AV: T: FTIVIS {1,1} +,p ESI Full lock ms [ 277.1774 T: FTMS {1,1} p ESI Full lock ... 100- 343.1516 [M+Nar 100- a; [M+Nar cco 80 danc 60-7, .0= 60 Abun 40: ce 40 twe la 20= pd+Fq. [NI+Hr Re 20 n=255.1952 268.9390 321.1697 366.2274 u 0 ' 4. r 260 270 280 300 350 rNz

0 OH OH2

Chemical Formula: C15H2203+ Exact Mass: 255.1955 Chemical Formula: CI8H2505+ (13) Exact Mass: 321.1697 (14)

Figure B.2.8. (A) UHPLC-HRMS chromatogram of Pseudoalteromonas sp. RKBH 282 in

BFM11 and mass spectra of (B) pseudoalteromone A (13) and (C) pseudoalteromone B (14).

295 A RT: 0.00- 10.01 3.3.8 NL: 5.32E4 222 Total Scan PDA 40000 RKEM205_5m_BEF82_b9 121 7 20000 293 3 92 557 55.2 758 821 85.7 _ 1 0 2.05 NL: 2.89E6 1007 1.82 3.35 TIC F: FTNIS {1.1} p ESI Full 1.33 lock ms [190.00-2000.001 MS 4.21 50: ate RKEM205_5m_BEP82_b9 2.41 3 45 422 5.37 tki e.14 e Sf 790 8.52 9.75 0 - 0 48 _ NL: 7.5eE2 AD Card Ch 1 AD card 500- RKEM235_5m_BEP82_b9 2.02 1 1.33 2.3e 3,89422 5.05 5.43 e.3o eta 7.88 8.49 9.01 0 11111111111111j11111TT1111111111IIII111 it '''I 11.11 1 2 3 4 5 C 7 8 9 10 Time Orlin)

RKEM205 5m_BEP82 b9 #1249 RT: T: FTMS {Illp +ESI -Full lock ... 0 357_2513 100 335.2696 [NP-Nar. (.3 fl55H2 c 80 0 -0 [m+H] HN 60 w 40 CD 20 cc 373 2252 Chemical Formula: C20H35N202+ 0 Exact Mass: 335.2693 350 m/z (15)

Figure B.2.9. (A) UHPLC-HRMS chromatogram of Vibrio sp. RKBH 205 in BFM5 and mass spectra of (B) bahamamide (15).

296 RT: 0.00 -10.01 A NI.: 2.50E4 20000 Total Scan FDA RKE1.1817EEFE.2_a5 z 22 5,09 5.49, 5.90 5.37 7.3" 5.52 10000 4.Z9 9.7.2 0 Mi.: 3.15E5 100: 85 TIC F: FT1.4 S (1,11 + p ESI Fug 1.34 lockms 90.00-2000.001 US 50 RKEIA 817_5m_SEP82_a5 7.08 7 i7 0.68 2.,514 3 .01 3.73 4.52 5.04 549 5.49 42 9.79 0 - C 48 ML: 5.12E2 A.,10 Card Ch. 1 AD card • 400 RKE1A817_5m_SEP82_a5 200 2.43 5' 443 502 5.4! 5 33 7.05 795 99 9 3!

0 1111111111111111111 1 2 3 4 5 5 7 8 9 10 Time (min)

RKEM817_5m_BEP82_a5 #1174 RT: T: FTM S (1,1} + p ESI Full lock ... NH 480.2498 100 0 a) c.) c 80 0 H2 60 502.2298 co 40 [M+Nar 0 20 51_9.1357 0 450 500 550 Chemical Formula: C27H0305+ miz Exact Mass: 480.2493 (16)

Figure B.2.10. (A) UHPLC-HRMS chromatogram of Acinetobacter sp. RKBH 817 in BFM5 and mass spectra of (B) andrimid (16).

297 RT: 0.00 - 10.01 A 2 07 ML 8.81E4 Total Scan PDA 13271_BFM513 50000- 3 27 8.40 5.72 e.03 e.74 7.e2 8.33 8 e1 - • 9 0 2.08 ML: 108E8 1007 TIC F: FTMS {1A} p ESI 1.87 Full Int* ms 50: 1.43 [200.00-2000.00j MS 3.20 4.31 4'58 0.97 78 2 se 5.09 8.79 7.20 8.17 8.7e 9.47 B271_13FM5B o - 2.04 ML. 2 47E2 = 4 200- AD Card Ch. 1 AC atm = 047 1 84 13271_BFM5B 5 1 37 320 In 100: I _ 2.98 - 4.27 e.oe 5.49 e.34 e.97 7.4e 8.50 8.99 9.39

III I PP I I PI 0 1 2 3 4 5 8 7 8 9 10 Time (min)

B271 STAR 6958 RI': 324 AV 1 N.: 7.4AE4 B FTAS(11) +p ES. Full bac ms[200.00-2003.00) 846 CC 100 OH &is Zie 0 90 0 H so [M+Hr H3N.r.„. N N IS 70 0 0 2• 60 NH H 50 40 30 -AL 0 H2N 0 20 10 515 Z;S: 0 .r e Chemical Formula: C38H51B11•17010+ 835 PAO 845 850 855 Exact Mass: 844.2875 rmz (17)

Figure B.2.11. (A) UHPLC-HRMS chromatogram of Pseudoalteromonas sp. RKBH 271 in

BFM5 and mass spectra of (B) bromoalterochromide A (17).

298

0.00 - 10.01 NL: 2.88E4 Total Scan PDA 4.43 R 20000 7. 37 2.45 3.07 13271_13F1.1 38 4.20 5.4 _ 54p 8.34 7.05 77 _ 1.P 8.81 10c00, 9.21 2 2.17 o 4.59 NL: 1.54E8 100- TICF: FT1.1S {1A} + pESI 4.37 4.78 Full foams 50 .91 3.85 4.10 [200.00-2000 .001 MS 028 1.84 2.95 - 4 99 5.87 8.41 7.52 8.44 9.43 9.71 8271_13F1.138 0 NL: 4.83E1 e 9.18 49 1 - 24' 02_ 4 .33 4 4.75 5.e8 5.,23 7 2 8.55 9.01 40- AiD Carl Ch. 1 ArD cad 0 8271_8F1.4 38 20

1 2 3 4 5 6 7 B 9 10 Time (min)

8271 BRAM #1356 RT: 4.58 AV: 1 B271_BRI3B #1287 RT: 4.35 AV: 1 T: FTMS {1,1} + p ESI Full lock ms [ 8271_BFM38 #1219 RT: 4.12 AV: 1 T: FTMS {1.1) + p ESI Full lock ... 456.2721 T: FTMS {1,1) +p E SI Full lock ... 100 442.2554 100 - 428.2406 [11.1-Na]." 100 - •C.1 80 cu [M+Nar [114+Nar cco g 80: 8 17 c 80 : - co 60 C -ci .0 60= C = 60: 40 .o < co 40 = 40 :._ > 20- 451.3170 :;..-. CC [M-431- co - um+Hr cp 20 w 20 - 440.2773 = 420._3109 430.9133 0 1 11r,,,,,;, il l cc 7 406.2947 421..3295 I 440 450 460 0 I- I I - r 'r 0 1 I ' • I I I I it • 420 440 400 420

miz miz

.11 "'OH H2

Chemical Formula: C251-142N04* Exact Mass: 420 3108 (19) OH 0

Chemical Formula. C251-1005* Exact Mass 434,2901 Chemical Formula: C24H004- Exact Mass: 406 2952 (18) (20)

Figure B.2.12. (A) UHPLC-HRMS chromatogram of Pseudoalteromonas sp. RKBH 271 in

BFM3 and mass spectra mass spectra of (B) korormicin A (18), (C) korormicin J (19), and (D) korormicin K (20).

299

RT: 0.00-10.01 0.39 NL: 5.43E4 A a0000- \i ,,, Tout Scan PDA Fosmkg24:1_7 I m_B EF81 _012 R4°'''''.20„.„ .42 ' ','', : -: .. .,. .: ',.- • '5'. 7 . : 7 72 8.39 9., 0 -Jim- 102 - -82 TIC F. FTVS(1.1) 4- 5 651P...., 2 52 5.04 i 20 1.31 ?..- ' o•L'icrresr.1.90.00-2000.00] 1,15 50 4 4: .! 44 e..2y, ' .2 93 ' E -.7. PX.E1024 3_111,_BEF81_c12

0 a.„ N... 3 24E2 f. 23 300- AC Car.. A 1 AD D3tra

2.C 2 2 27 ..I-, 1-1 . ,- . , . , , , , , . . ,,,,, , ,,,, 4 . . I • I 0 1 2 3 4 5 7 8 10 Time (le)

RICE M 243_5m_BEP81_c9 41063 RT: RKEM243_5m_BEP81_c9 41036 RT: B T: FTMS (1,1) + p ESI Full lodc ... C T: FTIA S (1,1) + p ES! Full lock ... 380.0556 265.0465 100.:-. 100 Em-i-Hr [M-f-Hr 80= 2 _ co2 so=- ii -. 60Z 60 - - 40 4. 40 > 273.1675 381.„0586 11 1. 20 20 _ I 1 330545 CC 231.0589 301.1412 0 1`77. j . / I ' 'I 380 250 300 m/z m/z

0 OH2 0

N H N N H S TiXK D Chemical Formula: C1eH18N302S3+ Chemical Formula: C121113N20S2+ Exact Mass 380 0556 Exact Mass: 265.0464

(21) (22)

Figure B.2.13. UHPLC-HRMS chromatogram of Pseudoalteromonas sp. RKBH 243 in BFM5 and mass spectra of (B) ulbactin E (21) and (C) ulbactin A (22).

300 RI': 0.00-10.01 A 4.68 NL: 3.44E4 Total Soar PCA Peak 2 R20030- 5.72 510 5,98 7.91 7.76 S.39 8.56 = 4.51 0.36 169 2.24 2 • 82J-111- 9.31 0 100- NL:3.25E7 TICF:F1A1S(1.1} +o ESI Fuli ockins 50- 1192.00-2000X] US Peak 2 0.75 1.08 2.35 2.5.5 325 42/ 5.99 5.28 890 7.9.3 8.34 8.86 9.4e 0 .80 12E3 . 1000- ACCao Cr • AC:an. Peak 2 500- 0.50 0.2.3 1.92 2.48 2.80 3.3 4.55 L28 5.94 7 02 7.-E.5 5.76 9.03 9.31 11111111111111111111111111111111111111111111111111 1 2 3 4 5 6 7 8 9 10 Time (rain)

Peak 2 *1433 RT: 4.84 AV: 1 NL: 5.03E8 T: FTMS {1.1} + p ESI Full lock ms [190.00-2000.00) 690.9231 100 [N.1+21-112+ 90 80

70

d ance 60 1380 8378 50 [m+Hr Abun e iv

t 40 la

Re 30

20

10 L,814.4701 1169 e841 low 1500 Intz

OH

HO"'

Chemical Formula: C65H114N130 19+ Exact Mass: 1380.8348 (23)

Figure B.2.14. UHPLC-HRMS and mass spectra of putisolvin 1(23).

301 A RT: 0.00-10.01 435 M.. 2.53E4 5.7 Too 5:a, PDA Peak 3 20000 P 13 7.19 7./1_8.52 &et 4. 310030 2 si • 9 0 N.:135E7 100 TIC F: F71.430,1} + p ESI Full lockms 50 90.00-2000.001 US Peak 3 ' .24 221 2.37 3.59 4.44 41'2 5.39 7 329 8,73 9.39 0 It: 110E3 WOO ACCael Ch. 1 AO card Peak 3 2 500 :..!: 9.05 . . 4 .:1 o 9 10 Time (min)

Peak 3 *1490 RI: 5.04 /by: 1 NL: 2.41E6 T: FTN1S {1.1} + p ESI Full lock ms 1190.00-2000.001 697.9325

90! 80. 701.

:; 50= - 1394 8545 -1 40= [M+Hr

202'

828.4891 1281.773e

1000 1500 rniz

0

0

Chemical Formula: C66H116N13019+ Exact Mass: 1394.8505 (24)

Figure B.2.15. UHPLC-HRMS and mass spectra of putisolvin 11 (24).

302

A RI: 0.00- 10.01 NL: 180E4 8.2z 8 51 15000- .5.41 f S4 e 43 714 7.72 Total Scan PDA 0.27 4 42 AP_Omg_hl 11 883B 10000- 2 89 2 11 2 17 8.91 = 5000-

'42 NIL: 1-58E5 loo: TIC F: FTNIS {1,1} p ESI 158 182 20' Full lock ms 1200.00-2000.001 50: 22 5_47 5- 48 C.97 8.28 8.70 9.74 ILIS AP_Omg_11411_8836

0 - S 4_ Mt_ 525E1 0.49 1.81 1.99 2.91 3.40 4.29 4. 39 5.32 90 s" Toe 7.95 9.02 9.20 AD card Ch 1 ke card AP_Orng_1‘111 8838

i III1 ,11.,,,Iiiiiiiiiilliiii..ii 1 1111 1 1Iiii 0 1 2 3 4 5 5 7 8 9 10 Time (min)

AP_Omg_M 11_883B #1306 RT: 4.41 T: FTMS {1,1} + p ESI Full lock 314.2690 [m-Hr

3362508 [M+Nar

Chemical Formula: C18H36NO3+ 348 2533 Exact Mass: 314.2690 0 -1 1— I I/ 5 '1 tr ...rut (25) 300 350 miz

Figure B.2.16. UHPLC-HRMS chromatogram of Halomonas sp. RKBH 883 in BFM11 and mass spectra of compound (25).

303 A.3 Nuclear Magnetic Resonance Spectroscopy Data

2015j107_EMC.2.1.1r tube434 B271_M3_434 11'- 13' -3800000 PROTON2D_CK DMSO {CABruker\TopSpin3.1) kerr 25 1-11-1 -3600000

-3400000

-3200000

-3000000 5' T 7 0 a'- 8' 18 -2800000 15' 3, 13' 7' -2600000 N 1 'OH 0 12 14 16 2 18' -2400000

-2200000

-2000000 6 -1800000

-1600000

-1400000

-1200000

-1000000 5 -800000 -600000 NH 8' 9' -400000 > 5'7' 4' 3' 2' 2' 6 -200000

-0

—200000

18.0 9.5 9.0 8.5 8.0 7.5 7.0 6:5 6:0 4:5 4.0 3.5 3.0 25 2:0 1.5 1.0 0:5 5if (PPrnr)

Figure B.3.1. IfiNMR (600MHz, DMSO-d6) spectrum of korormicin A (18).

304

2015j107_EMC.4.1.2rr 1u434 B271 M3_434 HSQC_ADIA_dk_02rnr15 DMS0 {C:\Bruker\TopSpin3.1} kerr 25 dip 01, 20 0 13. 15' 11' 30 ""OH 0 0 40

50

-60 e -70

-80

-90

-100

-110

-120

e ab 130

140

.5 8.0 7.5 7.0 6:5 6:0 5:5 5.0 4,8 3.5 3'0 25 2.0 1.5 1.0 0.5 83Pr8) 4.0

Figure B.3.2. HSQC spectrum of korormicin A (18).

305 2015j107_EMC.3.1.2n tube434 B271_M3_434 0.0 COSY_CK DMSO {CABrukeekTopSpin3.1} ken 25 0.5

tzt 1.0

1.5

2.0

2.5

3.0

3.5

4.5

5.0

5.5 se - 6.0

0 La. 0 6.5

7.0

7:0 6.5 6.0 5.5 5:0 4:5 4.0 r2 ( 3.1 3.0 2.5 2.0 1:5 1:0 0:5 0.0

Figure B.3.3. COSY spectrum of korormicin A (18).

306 kerr_EMC_2015_0e19.2.1.1r

3 - 1 OH 0

7 N 1 N 6 s"------19 0 s S 16 4, 6 8

3, 5

10 8 3 13 16 9 14 1 OH 12 15

85 8:0 75 7:0 6:5 6:0 5.5 5:0 4:5 4:0 3:5 3:0 PPm

Figure B.3.4. I HNMR (600MHz, DMSO-d6) spectrum of ulbactin E (21).

307 kerr_EMC_2015_6119.8.1.1r

4 0-- 4 OH 0

6 10 16

12, 14 8, 16 6 9 15 10 4 53 13 7 11 2

I 80 175 170 165 160 155 150 145 140 135 130 125 120 115 110 105 100 95 90 85 80 75 70 65 60 55 50 45 40 35 30 PPm

Figure B.3.5. 13C NMR (150MHz) spectrum of ulbactin E (21).

308 kerr_EMC_2015_0619.4.1.2rt

30 0 00 0 0 40

50

70

0

90

100 13 NHS 110

120

130

140

7.8 7.6 7.4 7.2 7.0 6.8 6.6 6.4 6.2 6.0 5.8 5.6 5.4 5.2 5.0 4.8 4.6 4.4 4.2 4.0 3.8 3.6 3.4 3.2 3.0 2.8 PPm

Figure B.3.6. HSQC spectrum of ulbactin E (21).

309 err_EMC_201 5_de 1 9.3.1 .2rr

2.5

Et 00 00 d -3.0 0 p 63 0 6E3 OD 0 CP 63 -3.5

a (0 eifo -4.0

-4.5

0 0 -5.0 aE 15P eco 0 5.5

6.0 \-1

6.5

7.0

7.5

7.8 7.6 7.4 712 7:0 6:8 6:6 6:4 6:2 6.0 5.8 5.6 5.4 5.2 5.0 4.8 4.6 4.4 4.2 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.6 PPm

Figure B.3.7. COSY spectrum of ulbactin E (21).

310

kerr_EMC_2015_0319.5.1.2rr

-30 0 • • -40

3 -50

0 0 0 0 0 -60 a 0 9 • -70

10 16 • -80

-90

-100 E _ -110

-120

-130

-140

-150

-160

0 • 0 0 -170 0 o -180

7.8 7.6 7.4 7.2 7.0 6.8 6.6 6.4 6.2 6.0 5.8 5.6 5.4 5.2 5.0 4.8 4.6 4.4 4.2 4.0 3.8 3.6 3.4 3.2 3.0 2.8 PPm

Figure B.3.8. HMBC spectrum of ulbactin E (21).

311 2015mr19_EMC.1.1.1r

d6 ,22000000

SO- 21000000 20000000 50 DM

2. 19000000 4'-11' 18000000 17000000 16000000 5, 6, 12' 15000000 14000000 13000000 12000000 11000000 10000000 9000000 8000000 7000000 6000000 3, 3' 5000000 2' 000000 NH 2 3000000 4 2000000 1000000

-1000000 -2000000 80 7.5 7.0 6.5 6.0 55 5.0 4.5 4.0 3.5 3.0 2.5 2.0 15 10 0.5 PPM

Figure B.3.9. 111 NMR (600MHz, DMSO-d6) spectrum of long chain N-acyl L-leucine (25).

312 2015ja22_EMC.4.1.2rr tube883 RKEM883 HSC1C_CK DMSO {CABruker\TopSpin3.1) kerr 16 10

0 15

20

25

30

atitp 35 0. 119 40 a=

45

50 10 12'

11' 55

60

65

4.6 4.4 4.2 4.0 3.8 3.6 3.4 3.2 3.0 2.8 2.12 (p2.4 2.2 2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 m)

Figure B.3.10. HSQC spectrum of long chain N-acyl L-leucine (25).

313

2015ja22 EMC.3.1.2rr -0.5 tube883 RKEM883 COSY_CK DMS0 {C:\Bruker1TopSpin3.1} kerr 16 o cms -1.0 ig? C7 0

F20 2.5

3.0

3.5

0

-5.0 0

4, 8. to, 12' -5.5 2 N HO 7 1-6.0 5 4 3

7.0

-7.5

8.0

-8.5 8.5 8.0 7.5 7.0 6.5 6.0 5.5 5.0 45 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 f2 (PPrn)

Figure B.3.11. HSQC spectrum of long chain N-acyl L-leucine (25).

314 2015ja22_EMC.6.1.2a tube883 RKEM883 TOCSY_CK DMSO {CABruker\TopSpin3.1} kerr 16 -0

04, -1 so, 4•41 1

Ate * -2

-3

-4 EQ

-5 14-4 2 N H 0 0 r 9' ty' 5 4 3 0 -6

7

• 8

8.5 8.0 7.5 7.0 6.5 6.0 5.5 5.0 ttpm1.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0

Figure B.3.12. TOCSY spectrum of long chain N-acyl L-leucine (25). 2015ja22_EMC.5.1.2rr tube883 RKEM883 10 HMBCGP_CK DMSO {CABruker\TopSpin3.1} kerr 16 20 30 40 50 o r 60

N 6' 8' 10' 12' 70 Horik_) 7' 9, 4 11' 80 5.% 4J30 90 100 110 120 130 140 150 160 4 170 -180 -190 -200 .0 8.5 8.0 7.5 7.0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 f2 (pM)

Figure B.3.13. HMBC spectrum of long chain N-acyl L-leucine (25).

316