pharmaceutics

Article Targeting Cell Adhesion Molecules via Carbonate Apatite-Mediated Delivery of Specific siRNAs to Breast Cancer Cells In Vitro and In Vivo

Maeirah Afzal Ashaie 1, Rowshan Ara Islam 1, Nur Izyani Kamaruzman 1 , Nabilah Ibnat 1, Kyi Kyi Tha 1,2 and Ezharul Hoque Chowdhury 1,2,* 1 Jeffrey Cheah School of Medicine and Health Sciences, Monash University Malaysia, Jalan Lagoon Selatan, Bandar Sunway, Subang Jaya 47500, Malaysia 2 Health & Wellbeing Cluster, Global Asia in the 21st Century (GA21) Platform, Monash University Malaysia, Jalan Lagoon Selatan, Bandar Sunway, Subang Jaya 47500, Malaysia * Correspondence: [email protected]; Tel.: +603-5514-4978; Fax: +603-5514-6323



Received: 15 March 2019; Accepted: 17 May 2019; Published: 2 July 2019


Abstract: While several treatment strategies are applied to cure breast cancer, it still remains one of the leading causes of female deaths worldwide. Since chemotherapeutic drugs have severe side effects and are responsible for development of drug resistance in cancer cells, gene therapy is now considered as one of the promising options to address the current treatment limitations. Identification of the over-expressed genes accounting for constitutive activation of certain pathways, and their subsequent knockdown with specific small interfering RNAs (siRNAs), could be a powerful tool in inhibiting proliferation and survival of cancer cells. In this study, we delivered siRNAs against mRNA transcripts of over-regulated cell adhesion molecules such as catenin alpha 1 (CTNNA1), catenin beta 1 (CTNNB1), talin-1 (TLN1), vinculin (VCL), paxillin (PXN), and actinin-1 (ACTN1) in human (MCF-7 and MDA-MB-231) and murine (4T1) cell lines as well as in the murine female Balb/c mice model. In order to overcome the barriers of cell permeability and nuclease-mediated degradation, the pH-sensitive carbonate apatite (CA) nanocarrier was used as a delivery vehicle. While targeting CTNNA1, CTNNB1, TLN1, VCL, PXN, and ACTN1 resulted in a reduction of cell viability in MCF-7 and MDA-MB-231 cells, delivery of all these siRNAs via carbonate apatite (CA) nanoparticles successfully reduced the cell viability in 4T1 cells. In 4T1 cells, delivery of CTNNA1, CTNNB1, TLN1, VCL, PXN, and ACTN1 siRNAs with CA caused significant reduction in phosphorylated and total AKT levels. Furthermore, reduced band intensity was observed for phosphorylated and total MAPK upon transfection of 4T1 cells with CTNNA1, CTNNB1, and VCL siRNAs. Intravenous delivery of CTNNA1 siRNA with CA nanoparticles significantly reduced tumor volume in the initial phase of the study, while siRNAs targeting CTNNB1, TLN1, VCL, PXN, and ACTN1 genes significantly decreased the tumor burden at all time points. The tumor weights at the end of the treatments were also notably smaller compared to CA. This successfully demonstrates that targeting these dysregulated genes via RNAi and by using a suitable delivery vehicle such as CA could serve as a promising therapeutic treatment modality for breast cancers.

Keywords: breast cancer; siRNA; gene silencing; nanoparticle; carbonate apatite; α-catenin; β-catenin; talin-1; vinculin; paxillin and actinin-1

1. Introduction Breast cancer, which is a group of heterogeneous diseases, is divided into various categories based on characteristics such as histological grades, gene expression, and clinical levels [1]. While research still does not provide the exact mechanism involved in the invasion and metastasis of various types

Pharmaceutics 2019, 11, 309; doi:10.3390/pharmaceutics11070309 www.mdpi.com/journal/pharmaceutics Pharmaceutics 2019, 11, 309 2 of 28 of breast cancers, studies indicate aberrated cell adhesion molecules play a critical role in triggering a cascade of pathways, which are involved with initiation, progression, invasion, and metastasis of tumor cells to other organs [2–5]. The structural and functional integration of cells with their surrounding cells and matrix takes place via various cell adhesion proteins apart from integrins and cadherins. These proteins can be divided into several functional groups such as structural proteins, adaptor proteins, focal adhesion proteins, cytoskeletal actin-binding proteins, and signaling proteins. Some of the molecules that fall within these groups include catenins, actin, actinin, talin, vinculin, and paxillin. These protein molecules localize to integrin mediated cell-extracellular matrix adhesion contacts as well as cadherin mediated cell-cell contacts, at cytoplasmic domain, bridging the adhesion molecules with cytoskeleton. Apart from playing a role in cellular processes and signal transduction pathways, they also contribute toward various diseases such as cancer [6–15]. For instance, paxillin, which is a multi-domain adaptor protein, is involved in essential processes such as embryonic development, wound repair, and tumor metastasis by binding to various signaling proteins associated with actin cytoskeleton organization [16]. The dysregulated expression of these molecules have shown to impair the functioning of cell adhesion molecules such as that of cadherins and integrins [17,18]. For example, in basal like breast cancers, increased expression of α-actinin-1 was found to be responsible for cell migration of mammary epithelial breast cancer cells as a result of destabilization of E-cadherin adhesion [18]. The expression of these additional cell adhesion proteins is diverse in breast cancer and influences stages of invasion, proliferation, progression, and metastasis [7,19,20]. Co-localization of vinculin with activated Akt was shown not only to promote tumor cell invasion but also contribute to extracellular matrix stiffness, which, in turn, promoted tumor progression in mammary epithelium [21]. Another study done on tumor samples from primary breast carcinoma showed a presence of paxillin, which is associated with upregulation of HER2. Furthermore, depending on the status of HER2, the response of chemotherapy targeting this adaptor protein varies [22]. From these and other studies, it can be inferred that, besides conventional treatment regimens such as surgery, radiations, and chemotherapy, which are less effective especially in metastatic stages of breast cancer, targeting these additional protein cell adhesion molecules may serve an essential gateway for more effective treatment strategies. Furthermore, the targeting can also enhance the chemosensitivity of the drugs to tumor cells, which, otherwise, show multiple drug resistance. For instance, reduced expression of talin-1 enhanced chemosensitivity of breast cancer cells to docetaxel drug, which proposes talin-1 as a potential therapeutic target [20]. Similarly, various molecules have been identified, which can disrupt dysregulated WNT signaling and catenin dependent transcription. This inhibits the growth of carcinoma cells [23]. In another study, knockdown of β-catenin in triple negative breast cancer (TNBC) cells enhanced the tumor cell sensitivity to doxorubicin and cisplatin drugs, which indicates the essential role of transcriptional activity of this catenin sub-unit for TNBC cell chemosensitivity. Therefore, this makes it a promising therapeutic target for this type of breast cancer [23]. Thus, appropriate delivery of antagonistic molecules to regulate expression of these cell adhesion proteins could enhance the efficacy of treatment modalities and control tumor progression. While various molecular-targeted therapies are currently under research, one such approach, which is gaining momentum, is RNA interference (RNAi). Delivery of short double stranded RNA sequences known as small interfering RNAs (siRNAs), which target overregulated genes by inhibiting the gene expression via selective cleavage of an mRNA sequence in the cell cytoplasm, is being explored as a therapeutic option. Figure1 highlights some of the advantages of siRNA treatment. However, due to limitations of naked siRNA in penetrating plasma membrane and its susceptibility to nuclease mediated degradation [24,25], use of a delivery vehicle to carry and release the siRNA at the target site is required. Pharmaceutics 2019, 11, 309 3 of 28 Pharmaceutics 2019, 11, x 3 of 28

Figure 1. AdvantagesAdvantages of of using using siRNAs siRNAs as as therapeutics therapeutics for for treatment treatment of diseases such as breast breast cancer. While there are various delivery vehicles currently being used, nanoparticles serve as one of While there are various delivery vehicles currently being used, nanoparticles serve as one of the the promising vehicles for improved target-specific delivery. In order to design various nanocarriers promising vehicles for improved target-specific delivery. In order to design various nanocarriers properties such as size, surface morphology, loading efficiency, and release kinetics, hetero-dynamic properties such as size, surface morphology, loading efficiency, and release kinetics, hetero-dynamic properties are taken into consideration [26]. Various biodegradable nanoparticles such as liposomes, properties are taken into consideration [26]. Various biodegradable nanoparticles such as liposomes, polymeric nanoparticles, and inorganic nanoparticles, which have been used as carriers for drug polymeric nanoparticles, and inorganic nanoparticles, which have been used as carriers for drug and and molecular-based active therapeutic agents, have shown a promising effect by minimizing the molecular-based active therapeutic agents, have shown a promising effect by minimizing the side side effects as well as increasing the release of the agents to the specific site of action [27]. MM-302, effects as well as increasing the release of the agents to the specific site of action [27]. MM-302, which which is a liposome encapsulating doxorubicin, has characteristics for selective uptake of drugs to is a liposome encapsulating doxorubicin, has characteristics for selective uptake of drugs to tumor tumor cells only and is being evaluated in a clinical trial for treatment of advanced metastatic breast cells only and is being evaluated in a clinical trial for treatment of advanced metastatic breast cancer, cancer, which is positive to HER2 receptors [28]. Similarly, Genexol-PM®, a polymeric micelle loaded which is positive to HER2 receptors [28]. Similarly, Genexol-PM®, a polymeric micelle loaded with with paclitaxel drugs, is being used for treatment of breast cancer [29]. In another study, the Au-Fe3O4 paclitaxel drugs, is being used for treatment of breast cancer [29]. In another study, the Au-Fe3O4 nanoparticle scaffold loaded with cisplatin anti-cancer drugs and the herceptin antibody has been nanoparticle scaffold loaded with cisplatin anti-cancer drugs and the herceptin antibody has been used as targeted delivery to breast cancer cells [30]. Likewise, delivery of microRNA 34a (miR-34a) used as targeted delivery to breast cancer cells [30]. Likewise, delivery of microRNA 34a (miR-34a) encapsulated with hyaluronic acid/protamine sulfate nanocapsule has shown apoptosis and cell death encapsulated with hyaluronic acid/protamine sulfate nanocapsule has shown apoptosis and cell in triple negative breast cancer cells/tissues and reduced the proliferation of cancer cells [31]. death in triple negative breast cancer cells/tissues and reduced the proliferation of cancer cells [31]. Recently, pH sensitive inorganic carbonate apatite (CA) is gaining momentum in therapeutic Recently, pH sensitive inorganic carbonate apatite (CA) is gaining momentum in therapeutic delivery [32–34]. Studies show CA is effective in intracellular delivery and release of therapeutic delivery [32–34]. Studies show CA is effective in intracellular delivery and release of therapeutic agents such as DNA, siRNAs, and chemotherapeutic drugs from endosomal vesicle to cytosol of the agents such as DNA, siRNAs, and chemotherapeutic drugs from endosomal vesicle to cytosol of the cells, which allows the escape of enzymatic degradation and targeted delivery [35–38]. Therefore, cells, which allows the escape of enzymatic degradation and targeted delivery [35–38]. Therefore, this this serves as a promising therapeutic carrier. Various earlier in vitro studies showed successful serves as a promising therapeutic carrier. Various earlier in vitro studies showed successful reduction reduction of cell viability when CA-siRNA was employed to knockdown a target gene compared to of cell viability when CA-siRNA was employed to knockdown a target gene compared to the the treatments with free siRNA and CA particles. Furthermore, cellular uptake study showed that treatments with free siRNA and CA particles. Furthermore, cellular uptake study showed that the the efficiency of siRNA uptake using CA as a vehicle was higher than free siRNAs, which indicates efficiency of siRNA uptake using CA as a vehicle was higher than free siRNAs, which indicates efficient internalization of CA-siRNA complexes. The siRNA-CA complex formation was due to ionic efficient internalization of CA-siRNA complexes. The siRNA-CA complex formation was due to ionic interactions between negative phosphate backbone of siRNA and cation (Ca2+)-rich domains of CA interactions between negative phosphate backbone of siRNA and cation (Ca2+)-rich domains of CA nanoparticles. Bio-distribution analysis following 4 hours of intravenous administration revealed high nanoparticles. Bio-distribution analysis following 4 hours of intravenous administration revealed accumulation of siRNA in the tumors when delivered with CA, compared to free siRNA, which virtually high accumulation of siRNA in the tumors when delivered with CA, compared to free siRNA, which showed no accumulation. This indicates the profound role of nanoparticles in delivery of siRNAs to virtually showed no accumulation. This indicates the profound role of nanoparticles in delivery of the target site with the consequential effect on the tumor reduction [39,40]. siRNAs to the target site with the consequential effect on the tumor reduction [39,40]. Identifying the essential molecules that play a role in enhancing the tumor proliferation and Identifying the essential molecules that play a role in enhancing the tumor proliferation and growth in breast cancer and targeting them by siRNA-based therapy and nanotechnology could serve growth in breast cancer and targeting them by siRNA-based therapy and nanotechnology could serve promising therapeutic avenue against primary and metastatic breast cancers. Therefore, in this work, promising therapeutic avenue against primary and metastatic breast cancers. Therefore, in this work, we have targeted dysregulated additional cell adhesion proteins, namely, catenin alpha 1 (CTNNA1),

Pharmaceutics 2019, 11, 309 4 of 28 we have targeted dysregulated additional cell adhesion proteins, namely, catenin alpha 1 (CTNNA1), catenin beta 1 (CTNNB1), talin-1 (TLN1), vinculin (VCL), paxillin (PXN), and actinin-1 (ACTN1) via CA nano-carrier-facilitated delivery of specific siRNAs to investigate their potential therapeutic roles in inhibiting proliferation and survival of breast cancer cells in vitro and in the murine model of breast cancer. By developing these suitable molecular targeted therapies, pharmaceutical advancement in breast cancer treatment could be enhanced.

2. Materials and Methods

2.1. Materials Cell lines: Human breast cancer cell line (MCF-7), TNBC (MDA-MB-231), and murine metastatic breast cancer cell line (4T1). Reagents: Dulbecco’s modified eagle medium (DMEM) powder, fetal bovine serum (FBS), penicillin streptomycin, trypLE Express without phenol red and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) from Gibco BRL (Carlsbad, CA, USA). DMEM media, calcium chloride dihydrate (CaCl 2H O), sodium bicarbonate (NaHCO ), potassium phosphate monobasic (KH PO ), sodium 2· 2 3 2 4 phosphate dibasic heptahydrate (H15Na2O11P), bovine serum albumin (BSA), skim milk powder, tris (hydroxmethyl)amino-methane, phosphate inhibitor cocktail 2, EDTA-free protease inhibitor tablets, dimethyl sulphoxide (DMSO), and thiazolyl blue tetrazolium bromide (MTT), methanol, and trypan blue (0.4%) from Sigma-Aldrich (St. Louis, MO, USA). Sodium chloride (NaCl) and potassium chloride (KCl) from Fisher Scientific (Loughborough, Leicestershire, UK). Sodium dodecyl sulfate (SDS) and Restore PLUS Western blot stripping buffer from Thermo Fisher Scientific (Rockford, IL, USA). Triton C-100, glycine, blotting-grade blocker, Clarity Western ECL substrate, tween-20, bromophenol blue, quickstart Bradford 1X dye reagent, quickstart bovine serum albumin (BSA) standard set, dithiothreitol (DTT), and mini-protean TGX gels from Bio Rad (Hercules, CA, USA). Validated siRNAs from Qiagen (Valencia, CA, USA).

2.2. Methodology

2.2.1. Cell Culture MCF-7, MDA-MB-231, and 4T1 cell lines were cultured in 75 cm2 tissue flasks (Nunc, Orlando, FL, USA) with DMEM supplemented with 10% FBS, 50 µg/mL penicillin, 50 µg/mL streptomycin, and 1% HEPES, at 37 ◦C in humidified 5% CO2 incubator.

2.2.2. siRNA Design and Sequence All the siRNAs were validated by Qiagen. Table1 lists the siRNAs used and their sequences. Additionally, 1 nmol lyophilized power of each of the siRNAs targeting CTNNA1, CTNNB1, TLN1, VCL, PXN, and ACTN1 was reconstituted with RNase-free water to obtain 10-µM stock solution and stored at –20 ◦C.

Table 1. siRNAs used and their sequence.

Product Name Gene Name Code Target Sequence Hs_CTNNA1_6 Catenin alpha 1 CTNNA1 AAGTGGATAAGCTGAACATTA Hs_CTNNB1_5 Catenin beta 1 CTNNB1 CTCGGGATGTTCACAACCGAA Hs_PXN_6 Paxillin PXN CCGACTGAAACTGGAACCCTT Hs_ACTN1_5 Actinin 1 ACTN1 AACAAATCTGAATACGGCTTT Hs_TLN1_5 Talin 1 TLN1 AACAGAGACCCCTGAAGATCC Hs_VCL_5 Vinculin VCL AAAGATGATTGACGAGAGACA Pharmaceutics 2019, 11, 309 5 of 28

2.2.3. Infrared Spectroscopy Fourier transform-infrared (FT-IR) spectroscopy of generated carbonate apatite particles was performed using Varian 440 FTIR (Santa Clara, CA, USA). CA nanoparticles were prepared as discussed earlier [41]. Additionally, 44mM of sodium bicarbonate and DMEM powder was mixed using mili-Q water with pH adjusted to 7.4. 40 mM of Ca was added and, in order to generate CA nanoparticles, the mixture was incubated at 37 ◦C for 30 min. After 30 min, the complex was centrifuged at 3700 rpm, 4 ◦C for 30 min. After 30 min, the supernatant was removed and pellet was washed with mili-Q water and re-centrifuged under the same conditions. This was followed by removal of supernatant and in addition to a sufficient amount of mili-Q water to cover the pellet. The sample was left overnight in 4 ◦C. After overnight incubation at 4 ◦C, the sample was freeze dried and the powder proceeded for elemental analysis.

2.2.4. Generation of CA-siRNA Complex for In Vitro Study CA nanoparticles were prepared as discussed earlier [41]. Briefly, 44 mM sodium bicarbonate and DMEM powder was mixed using mili-Q water, with pH adjusted to 7.4. To the final 1 mL volume of this media, 1 nM of siRNA against CTNNA1, CTNNB1, TLN1, VCL, PXN, and ACTN1 was added individually, which was followed by the addition of 4 µL of 1M CaCl2. The final mixture was incubated at 37 ◦C for 30 min to generate specific siRNA-CA complexes. After 30 min of incubation, 10% FBA was added to stop the formation of complexes and prevent particle aggregation.

2.2.5. Cell Proliferation Assay by 3-(4,5-Dimethylthiazaol-2-yl)-2,5-diphenyltetrazolium Bromide (MTT) In order to assess cytotoxicity of siRNA-CA complex on MCF-7, MDA-MB-231, and 4T1 breast cancer cell lines, the MTT assay was performed. Briefly, cells from the exponential phase were seeded in a 24-well plate at a density of 50,000 cells/well in complete DMEM media (DMEM with 10% FBS, 1% PenStrep, and 1% HEPES) and the plate was incubated for 24 h at 37 ◦C in a humidified environment of an incubator with a 5% CO2 supply. After 24 h, the seeded cells were treated with prepared siRNA-CA complexes and incubated again at 37 ◦C in the incubator for 48 h. After 48 h, 50 µL of MTT solution (5 mg/mL) was added to each well and the plate was incubated for 4 h. Afterward, the media was removed and 300 µL of DMSO was added to each well prior to incubation for 5 min to completely dissolve the purple formazan crystals. Absorbance was taken using a microplate reader (Bio-Rad) at an optical density of 595 nm with a reference wavelength of 630 nm.

2.2.6. SDS-PAGE and Western Blot Prior to proceeding with in vivo tumor regression assay, protein expression of 4T1 cells treated with siRNA-CA complexes was checked using the Western blot. 4T1 cells were seeded and treated as mentioned earlier. After 48 h, lysis was done using a lysis buffer containing 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 50 mM beta-glycerolphosphate, phosphate inhibitor cocktail 2 1 mM EGTA, 50 nM NaF, complete EDTA-free protease inhibitor, and 1% Triton X-100. The lysates were collected and centrifuged at 13,000 rpm for 8 min, before collecting the supernatant and discarding the pellet. The Quick Start Bradford Protein Assay kit was used to determine lysate protein concentrations. Additionally, 9 µg proteins were loaded per well in precast gels, and the SDS-PAGE was run, which was followed by turbo transfer of proteins from gel to the nitrocellulose membrane. The nitrocellulose membranes were blocked for 1 h at room temperature with 5% non-fat dry milk in 1X TBST (pH 7.4, containing 0.1% Tween 20) and probed with a primary antibody overnight at 4 ◦C. After overnight probing, blots were washed with 1X TBST, which was followed by horseradish peroxide-conjugated secondary antibody probing at room temperature for 1 h. Excess of the secondary antibody was removed by washing membranes five times with 1X TBST. The Clarity Western ECL substrate was used to detect the signals. Membranes were visualized by using a Bio-Rad Gel Document System (Bio Rad). Pharmaceutics 2019, 11, 309 6 of 28

Densitometry analysis was done using ImageJ software (ImageJ 1.52a, Wayne Rasband, National Institutes of Health, USA, 2018) and treatment groups were normalized with CA treated controls.

2.2.7. In Vivo Tumor Regression Analysis In vivo work was done according to the instructions of Monash University Animal Ethics Committee, which approved the protocol for animal experiments (MARP/2016/126, 06/12/2016). Six to eight week-old female Balb/c mice of 15–20 gm body weights (obtained from School of Medicine and Health Science Animal Facility, Monash University, Subang Jaya, Malaysia) were provided with ab libitum and water and maintained in 12:12 light: dark condition throughout the experiment. Approximately 1 105 4T1 cells prepared in 100 µL PBS were subcutaneously injected on the third × mammary pad of mice. In order to locate the tumors and measure the size, the area was shaved with hair removal cream. Once tumors reached a palpable stage, 5 mice were randomly arranged in each group. CA nanoparticle complexes were formed with 8 µL of CaCl2 in 200 µL of DMEM media supplemented with 44 mM bicarbonate and 3.4 µg/kg of single siRNAs (CTNNA1, CTNNB1, TLN1, VCL, PXN, and ACTN1). The prepared siRNA-CA complexes were incubated at 37 ◦C for 30 min and then put on ice to slow down the particle aggregation. Additionally, 100 µL of siRNA-CA complexes were injected intravenously at the right or left caudal vein of mice. The treatment was given at the frequency of 4 doses, with two days apart from the previous dose. The vernier caliper was used to measure tumor volume. At the end of the treatment, tumors were excised, weighed, and images were taken.

2.3. Data Analysis Data from the MTT assay was presented as mean SD. The cell viability in the treated wells was ± expressed as a percentage and was calculated using the absorbance values obtained from the MTT assay by the following formula. % of cell viability = (OD treated OD reference)/(OD untreated OD reference) 100 − − × The cell death and actual cytotoxicity were calculated by the following formula. % cell death = 100% of cell viability % Actual cytotoxicity (of siRNA) = (% CA + siRNA cytotoxicity) (% CA cytotoxicity) − For tumor regression, the analysis tumor volume was calculated using the length and width of the tumor with the following formula. Tumor volume (in mm3) = Length (Width)2/2 × Statistical analysis for the densitometry was done using a Student t-test and in vivo tumor regression analysis was done using SPSS. For an in vivo study, the LSD post-hoc test for one-way ANOVA was used to compare the significant difference between siRNA-CA treated and CA treated groups. Data was considered statistically significant when * represented p < 0.05.

3. Results

3.1. Elemental Analysis of CA Nanoparticles Using FT-IR Spectroscopy The formation of CA from the lyophilized sample was confirmed via FT-IR spectroscopy. The IR 1 spectra was collected between 400–3800 cm− (Figure2). Three main chemical groups synthesized are 3 hydroxyl (OH−), carbonate ion (CO3−), and phosphate ion (PO4 −). From the IR spectrum, the OH− 1 stretch can be observed from 3727 to 2946, 1658, and 675 cm− . The peaks that represent CO3− can 1 3 be seen at 1480, 1415, and 866 cm− . The peaks that represent PO4 − can be seen at 1008, 585, 567, 1 1 3 and 540 cm− while peaks within 467 cm− represent weak PO4 −. Figure2b shows the magnified 3 image of the essential peaks of CO3− and PO4 −. Pharmaceutics 2019, 11, 309 7 of 28 Pharmaceutics 2019, 11, x 7 of 28

Figure 2. FT-IR spectra of lyophilized carbonate apatite (CA): (a) Spectra in the range of 400–3800 cm1−1, Figure 2. FT-IR spectra of lyophilized carbonate apatite (CA): (a) Spectra in the range of 400–3800 cm− , − 3−3 andand ( b(b)) magnified magnified peaks peaks ofof COCO33− andand PO PO44 .− .

3.2.3.2. AssessmentAssessment ofof siRNAsiRNA ConcentrationConcentration withwith/without/without CA-Assisted Delivery in Breast Cancer Cancer Cells Cells via via the the MTT Assay MTT Assay In order to see the optimum siRNA concentration for cell transfections, the MTT assay was In order to see the optimum siRNA concentration for cell transfections, the MTT assay was performed where two different cell adhesion siRNAs were used in MCF-7 and 4T1 cells. Three different performed where two different cell adhesion siRNAs were used in MCF-7 and 4T1 cells. Three concentrations of siRNAs were used (10 pM, 100 pM, and 1 nM) with/without CA as a delivery vehicle. different concentrations of siRNAs were used (10 pM, 100 pM, and 1 nM) with/without CA as a From Figure3a,b, we can see that, compared to free ACTN1 and TLN1 siRNAs, siRNAs bound to CA delivery vehicle. From Figure 3a,b, we can see that, compared to free ACTN1 and TLN1 siRNAs, nanoparticlessiRNAs bound caused to CA more nanoparticles reduction in caused cell viability. more Furthermore,reduction in thecell reductionviability. inFurthermore, cell viability the was higherreduction at a in 1-nM cell concentrationviability was higher of siRNA at a (~67%).1-nM concentration of siRNA (~67%).

Pharmaceutics 2019, 11, 309 8 of 28 Pharmaceutics 2019, 11, x 8 of 28

Figure 3. Cell viability viability of MCF-7 MCF-7 cells and 4T1 cells cells via via the the MTT MTT assay. assay. Cells Cells were were treated treated with/without with/without CA bound with (a)) actinin-1actinin-1 (ACTN1) and (b) talin-1 (TLN1) siRNA at 10 pM, 100 pM, andand 11 nMnM concentration ofof siRNAssiRNAs for for 48 48 h. h. Transfection Transfection of of this this complex complex was was done done for for 48 48 h, whichh, which was was followed followed by absorbanceby absorbance reading reading at 595 at nm595 withnm with a reference a reference wavelength wavelength of 650 of nm. 650 Data nm.is Data presented is presented as mean as meanS.D. ± ± S.D. 3.3. Role of Additional Cell Adhesion Molecules in Proliferation and Survival of Breast Cancer Cells using the MTT3.3. Role Assay of Additional Cell Adhesion Molecules in Proliferation and Survival of Breast Cancer Cells using the MTTTreatment Assay of MCF-7, MDA-MB-231, and 4T1 cells by targeting CTNNA1, CTNNB1, TLN1, VCL, PXN,Treatment and ACTN1 of MCF-7, genes viaMDA-MB-231, siRNA-CA deliveryand 4T1 cell showeds by targeting varied cell CTNNA1, viabilities, CTNNB1, based onTLN1, the VCL, MTT assay.PXN, and Table ACTN12 shows genes actual via cytotoxicity siRNA-CA of delivery various treatmentshowed varied groups cell against viabilities, three cellbased lines on after the MTT 48 h ofassay. treatment. Table 2 shows actual cytotoxicity of various treatment groups against three cell lines after 48 h of treatment.Table 2. Enhancement of cytotoxicity of single additional cell adhesion of CA-siRNA complexes transfected in MCF-7, MDA-MB-231, and 4T1 cells. Table 2. Enhancement of cytotoxicity of single additional cell adhesion of CA-siRNA complexes transfected in MCF-7, MCF-7MDA-MB-231, and 4T1 cells. MDA-MB-231 4T1 CA + Cell MCF-7 Actual CellMDA-MB-231Actual Cell 4T1 Actual siRNAs Viability (%) Cytotoxicity Viability (%) Cytotoxicity Viability (%) Cytotoxicity CA + Cell Actual Cell Actual Cell Actual S.D. (%) S.D. S.D. (%) S.D. S.D. (%) S.D. siRNAs Viability± Cytotoxicity± Viability± Cytotoxicity± Viability± Cytotoxicity± CTNNA1 92.65 5.0 2.03 6.2 81.65 6.1 2.28 4.9 80.76 5.4 13.42 8.9 (%) ± S.D.± (%) ± S.D.± (%) ± S.D.± (%)− ± S.D.± (%) ± S.D.± (%) ± ±S.D. CTNNB1 76.46 10.8 14.54 9.3 86.93 3.1 8.15 7.6 77.06 3.0 16.03 5.3 CTNNA1 92.65 ± ±5.0 2.03 ± 6.2± 81.65 ± ±6.1 −2.28 ± 4.9 80.76 ±± 5.4 13.42 ± 8.9 TLN1 67.65 11.8 30.2 12.1 92.5 1.5 4.39 2.9 66.46 11.6 23.53 10.4 CTNNB1 76.46 ± 10.8± 14.54 ±± 9.3 86.93 ±± 3.1 8.15− ± ±7.6 77.06 ±± 3.0 16.03± ± 5.3 VCL 78.34 0.8 8.74 7.40 83.3 0.6 9.37 3.9 70.67 16.4 19.38 16.1 TLN1 67.65 ± 11.8± 30.2 ± 12.1± 92.5 ± ±1.5 −4.39 ± 2.9 66.46 ±± 11.6 23.53 ± 10.4 PXN 57.60 7.3 29.76 0.8 82.92 1.2 13.82 3.1 67.65 0.5 27.07 8.9 ± ± ± ± ± ± ACTN1VCL 78.34 66.67 ± 0.85.2 8.74 25.97 ± 7.408.9 83.3 87.15 ± 0.64.2 9.37 6.59 ± 3.90.4 70.67 71.81 ± 16.43.4 19.38 18.54 ± 16.16.3 PXN 57.60 ± 7.3± 29.76 ± 0.8± 82.92 ± ±1.2 13.82 ± 3.1 67.65 ±± 0.5 27.07 ± 8.9 ACTN1 66.67 ± 5.2 25.97 ± 8.9 87.15 ± 4.2 6.59 ± 0.4 71.81 ± 3.4 18.54 ± 6.3 Transfection of CA loaded CTNNA1 and CTNNB1 siRNAs caused slight cell viability reduction in 4T1Transfection cells (Figure of 4CAc). loaded The reduced CTNNA1 viability and CTNNB1 was ~80% siRNAs for caused CTNNA1 slight and cell ~77% viability in CTNNB1 reduction siRNAin 4T1 cells transfection. (Figure 4c). The reduced viability was ~80% for CTNNA1 and ~77% in CTNNB1 siRNA transfection.On the other hand, transfection of TLN1 siRNA loaded with CA nanoparticles caused reduced cellularOn viabilitythe other by hand, ~67% transfection in MCF-7 of cells TLN1 (Figure siRN5a)A loaded and ~72% with in CA 4T1 nanoparticles cells (Figure 5causedc). However, reduced incellular MDA-MB-231 viability cells,by ~67% no reductionin MCF-7 incells cell (Figure viability 5a) was and observed ~72% in (Figure 4T1 cells5b). (Figure 5c). However, in MDA-MB-231Transfection cells, of no VCL reduction siRNA loadedin cell viability with CA was nanoparticles observed (Figure caused 5b). no reduction in MCF-7 cell viabilityTransfection compared of to VCL a CA siRNA nanoparticle loaded treatedwith CA control nanoparticles (Figure6 a).caused On theno otherreduction hand, in in MCF-7 4T1 cells, cell aviability mild reduction compared to ~77%to a CA (Figure nanoparticle6c) could treated be seen. control In MDA-MB-231, (Figure 6a). ~83% On the cell other viability hand, was in observed4T1 cells, (Figurea mild reduction6b). to ~77% (Figure 6c) could be seen. In MDA-MB-231, ~83% cell viability was observed (Figure 6b).

Pharmaceutics 20192019,, 1111,, 309x 99 of of 28 Pharmaceutics 2019, 11, x 9 of 28 Targeting PXN via transfection of CA loaded PXN siRNA caused significant reduction in all threeTargeting cell lines. PXN PXNThe via viabilityvia transfection transfection greatly of ofreduced CA CA loaded loaded in PXNMCF-7 PXN siRNA (~57%)siRNA caused andcaused significant4T1 significant(67%) reductioncells reduction (Figure in all 7a in three and all cellFigurethree lines. cell 7c, Thelines.respectively). viability The viability greatly In MDA-MB-231 greatly reduced reduced in MCF-7cells, in viability (~57%) MCF-7 andreduction (~57%) 4T1 (67%)and to ~83%4T1 cells (67%) was (Figure seen cells7a,c, (Figure (Figure respectively). 7b). 7a and InFigure MDA-MB-231Lastly, 7c, respectively). transfection cells, viability Inof MDA-MB-231MCF-7 reduction and 4T1 tocells, cells ~83% viability with was ACTN1 seen reduction (Figure siRNA to7b). ~83% loaded was with seen CA (Figure nanoparticles 7b). also causedLastly, transfectiontransfectiona decrease in ofof cell MCF-7MCF-7 viability. andand 4T14T1The cellscellsviability withwith after ACTN1ACTN1 48 h siRNAsiRNA was ~67% loadedloaded in MCF-7 withwith CACA cells nanoparticlesnanoparticles (Figure 8a) alsoand caused~72%caused in aa decrease4T1decrease cells in (Figurein cell cell viability. viability. 8c). However, The The viability viability in MDA-MB-231 after after 48 48 h was h wascells, ~67% ~67% the in MCF-7cellin MCF-7 viability cells cells (Figure did (Figure not8a) show and 8a) ~72%andsuch ~72% a in high 4T1 in reduction cells4T1 (Figurecells compared(Figure8c). However, 8c). to However,the CA in MDA-MB-231 control in MDA-MB-231 (Figure cells, 8b). the cells, cell the viability cell viability did not did show not such show a highsuch reductiona high reduction compared compared to the CA to the control CA control (Figure 8(Figureb). 8b).

Figure 4. Effect of NPs-loaded siRNA against catenin alpha 1 (CTNNA1) and catenin beta 1 Figure(CTNNB1) 4.4.E Effectffgeneect of onof NPs-loaded cellNPs-loaded viability siRNA siRNAafter against 48 againsth using catenin catethe alpha ninMTT 1alpha (CTNNA1)assay 1. CA-CTNNA1(CTNNA1) and catenin and and beta catenin CA-CTNNB1 1 (CTNNB1) beta 1 genecomplexes(CTNNB1) on cell weregene viability preparedon cell after viability 48 at h a using final after thevolume 48 MTT h using of assay. 1 mLthe CA-CTNNA1 byMTT combining assay. and CA-CTNNA1 1 CA-CTNNB1nM CTNNA1 and complexes andCA-CTNNB1 CTNNB1 were prepared at a final volume of 1 mL by combining 1 nM CTNNA1 and CTNNB1 siRNAs individually siRNAscomplexes individually were prepared along atwith a final 4 mM volume CaCl2 ofinto 1 mLDMEM by combiningbuffered with 1 nM bicarbonate, CTNNA1 atand a pHCTNNB1 of 7.4, along with 4 mM CaCl into DMEM buffered with bicarbonate, at a pH of 7.4, followed by a 30-min siRNAsfollowed individually by a 30-min alongincubation.2 with 4Transfection mM CaCl2 intoof this DMEM complex buffered was done with for bicarbonate, 48 h, which at was a pH followed of 7.4, incubation. Transfection of this complex was done for 48 h, which was followed by an absorbance followedby an absorbance by a 30-min reading incubation. at 595 nm Transfection with a reference of this wavelength complex was of done650 nm. for Data 48 h, iswhich presented was followed as mean reading at 595 nm with a reference wavelength of 650 nm. Data is presented as mean S.D against ±by S.D an againstabsorbance (a) MCF-7 reading cells, at 595 (b )nm MDA-MB-231 with a reference cells, wavelength and (c) 4T1 of cells. 650 nm. Data is presented± as mean (±a )S.D MCF-7 against cells, (a) ( bMCF-7) MDA-MB-231 cells, (b) MDA-MB-231 cells, and (c) 4T1 cells, cells. and (c) 4T1 cells.

Figure 5. Cont.

Pharmaceutics 2019, 11, 309 10 of 28 Pharmaceutics 2019, 11, x 10 of 28 Pharmaceutics 2019, 11, x 10 of 28

Figure 5. Effect of NPs-loaded siRNA against talin-1 (TLN1) gene on cell viability after 48 h using the Figure 5. EffectEffect of NPs-loaded siRNA against talin-1 (TLN1) gene on cell viability after 48 h using the MTT assay. CA-TLN1 complex were prepared at a final volume of 1 mL by combining 1 nM TLN1 MTT assay.assay. CA-TLN1 complex were prepared at a finalfinal volume of 1 mL by combiningcombining 1 nM TLN1 siRNA along with 4 mM CaCl2 into DMEM buffered with bicarbonate, at a pH of 7.4, which was siRNAsiRNA alongalong withwith 44 mMmM CaClCaCl2 into DMEM bubufferedffered with bicarbonate, at a pH ofof 7.4,7.4, whichwhich waswas followed by a 30-min incubation.2 Transfection of this complex was done for 48 h, which was followed followedfollowed byby aa 30-min30-min incubation.incubation. Transfection ofof thisthis complexcomplex waswas donedone forfor 4848 h,h, whichwhich waswas followedfollowed by an absorbance reading at 595 nm with a reference wavelength of 650 nm. Data is presented as mean by an absorbance absorbance reading reading at at 595 595 nm nm with with a reference a reference wavelength wavelength of 650 of 650nm. nm.Data Datais presented is presented as mean as ± S.D against (a) MCF-7 cells, (b) MDA-MB-231 cells, and (c) 4T1 cells. mean± S.D againstS.D against (a) MCF-7 (a) MCF-7 cells, ( cells,b) MDA-MB-231 (b) MDA-MB-231 cells, and cells, (c and) 4T1 ( ccells.) 4T1 cells. ±

Figure 6. EffectEffect of NPs-loaded siRNA against the vinculin (VCL) gene on cell viability after 48 h using Figure 6. Effect of NPs-loaded siRNA against the vinculin (VCL) gene on cell viability after 48 h using an MTTMTT assay.assay. TheThe CA-VCL CA-VCL complex complex was was prepared prepared at aat finala final volume volume of 1of mL 1 bymL combining by combining 1 nM 1 VCL nM an MTT assay. The CA-VCL complex was prepared at a final volume of 1 mL by combining 1 nM siRNAVCL siRNA along along with with 4 mM 4 CaClmM 2CaClinto2 DMEMinto DMEM buffered buffered with with bicarbonate, bicarbonate, at a pHat a of pH 7.4, of followed 7.4, followed by a VCL siRNA along with 4 mM CaCl2 into DMEM buffered with bicarbonate, at a pH of 7.4, followed 30-minby a 30-min incubation. incubation. Transfection Transfecti of thison complexof this complex was done was for done 48 h. Thisfor 48 was h. followedThis was by followed an absorbance by an by a 30-min incubation. Transfection of this complex was done for 48 h. This was followed by an readingabsorbance at 595 reading nm with at 595 a reference nm with wavelengtha reference wavelength of 650 nm. Dataof 650 is nm. presented Data is as presented mean S.D as mean against ± absorbance reading at 595 nm with a reference wavelength of 650 nm. Data is presented± as mean ± (S.Da) MCF-7 against cells, (a) MCF-7 (b) MDA-MB-231 cells, (b) MDA-MB-231 cells, and (c )cells, 4T1 cells.and (c) 4T1 cells. S.D against (a) MCF-7 cells, (b) MDA-MB-231 cells, and (c) 4T1 cells.

Pharmaceutics 20192019,, 1111,, 309x 1111 of of 28 Pharmaceutics 2019, 11, x 11 of 28

Figure 7. Effect of NPs-loaded siRNA against the paxillin (PXN) gene on cell viability after 48 h using Figure 7. EffectEffect of NPs-loaded siRNA against the paxillin (PXN) gene on cell viability after 48 h using the MTTMTT assay.assay. The CA-PXN complex was prepared at a finalfinal volume of 1 mL by combining 1 nM the MTT assay. The CA-PXN complex was prepared at a final volume of 1 mL by combining 1 nM PXN siRNA along with 4 mM CaCl2 into DMEM buffered with bicarbonate, at a pH of 7.4, which was PXN siRNA along with 4 mM CaCl2 into DMEM buffered with bicarbonate, at a pH of 7.4, which was PXN siRNA along with 4 mM CaCl2 into DMEM buffered with bicarbonate, at a pH of 7.4, which was followed byby a 30-min incubation. Transfection ofof thisthis complexcomplex waswas donedone forfor 48 h, which was followed followed by a 30-min incubation. Transfection of this complex was done for 48 h, which was followed by an absorbance absorbance reading reading at at 595 595 nm nm with with a reference a reference wavelength wavelength of 650 of 650nm. nm.Data Datais presented is presented as mean as by an absorbance reading at 595 nm with a reference wavelength of 650 nm. Data is presented as mean mean± S.D againstS.D against (a) MCF-7 (a) MCF-7 cells, ( cells,b) MDA-MB-231 (b) MDA-MB-231 cells, and cells, (c and) 4T1 ( ccells.) 4T1 cells. ± S.D against± (a) MCF-7 cells, (b) MDA-MB-231 cells, and (c) 4T1 cells.

Figure 8. Cont.

Pharmaceutics 2019, 11, 309 12 of 28 Pharmaceutics 2019, 11, x 12 of 28

Pharmaceutics 2019, 11, x 12 of 28

Figure 8. EffectEffect of NPs-loaded siRNA against actinin-1 (ACTN1) gene on cell viability after 48 h using the MTT MTT assay assay.. The The CA-ACTN1 CA-ACTN1 complex complex was was prepared prepared at ata final a final volume volume of 1 of mL 1 mLby combining by combining 1 nM 1 Figure 8. Effect of NPs-loaded siRNA against actinin-1 (ACTN1) gene on cell viability after 48 h using ACTN1 siRNA along with 4 mM CaCl2 into DMEM buffered with bicarbonate, at a pH of 7.4, which nMthe ACTN1 MTT assay siRNA. The alongCA-ACTN1 with complex 4 mM CaCl was 2preparedinto DMEM at a final bu volumeffered with of 1 mL bicarbonate, by combining at 1 a nM pH of 7.4,

whichwasACTN1 followed was siRNA followed by along30 bymin with 30 of min 4 incubation. mM of incubation.CaCl2 into Transfection DMEM Transfection buffered of this of with this complex bicarb complexonate, was was atdone donea pH for of for 487.4, 48 h, which h, which which was followedwas followed byby an an absorbanceby absorbance 30 min of reading incubation. reading at 595at Transfection nm595 withnm awith of reference this a complexreference wavelength was wavelength done of for 650 48 nm. ofh, which Data650 nm. is was presented Data is aspresented meanfollowed as S.Dby mean againstan absorbance ± S.D (a )against MCF-7 reading ( cells,a) MCF-7 at (b595) MDA-MB-231 cells,nm with (b) MDA-MB-231a reference cells, and wavelength (cells,c) 4T1 and cells. of ( c650) 4T1 nm. cells. Data is ± presented as mean ± S.D against (a) MCF-7 cells, (b) MDA-MB-231 cells, and (c) 4T1 cells. 3.4. Effects Effects on PI3-Kinase/AKT PI3-Kinase/AKT andand MAPKMAPK PathwaysPathways inin 4T14T1 CellsCells 3.4. Effects on PI3-Kinase/AKT and MAPK Pathways in 4T1 Cells The Western blot analysis showed reduced expres expressionsion of both p-AKT and total AKT proteins, The Western blot analysis showed reduced expression of both p-AKT and total AKT proteins, upon 4848 h transfectionh transfection targeting targeting ACTN1, ACTN1, PXN, andPXN, CTNNA1 and CTNNA1 via siRNAs via loaded siRNAs with loaded CA nanoparticles with CA upon 48 h transfection targeting ACTN1, PXN, and CTNNA1 via siRNAs loaded with CA (Figurenanoparticles9). The (Figure reduction 9). wasThe significantlyreduction was di ffsignificantlyerent (p < 0.05) different compared (p < 0.05) to CA compared (Figure9b,c). to CA However, (Figure it wasnanoparticles only CTNNA1, (Figure 9). CTNNB1, The reduction and VCLwas significantly siRNA transfection different (p that < 0.05) caused compared low bandto CA intensities(Figure for 9b,c).9b,c). However, However, it it was was only only CTNNA1, CTNNB1, CTNNB1, and and VCL VCL siRNA siRNA transfection transfection that caused that caused low band low band p-MAPK and total MAPK (Figure8a) with p < 0.05 (Figure9d,e). intensitiesintensities for for p-MAPK p-MAPK and and totaltotal MAPKMAPK (Figure (Figure 8a) 8a) with with p < p0.05 < 0.05 (Figure (Figure 9d,e). 9d,e).

Figure 9. Cont.

Pharmaceutics 2019, 11, 309 13 of 28

Pharmaceutics 2019, 11, x 13 of 28

Pharmaceutics 2019, 11, x 13 of 28

FigureFigure 9. 9.(a ()Ea) ffEffectect of of intracellularintracellular delivery delivery of of CA CA loaded loaded single single additional additional cell adhesion cell adhesion siRNAs siRNAs on on proteinprotein expressions expressions in in 4T1 4T1 cells.cells. Cells Cells were were incubate incubatedd with with CA CAloaded loaded single single additional additional cell adhesion cell adhesion siRNAs (ACTN1, PXN, CTNNA1, CTNNB1, TLN1, and VCL) siRNAs for 48 h, which was followed siRNAs (ACTN1, PXN, CTNNA1, CTNNB1, TLN1, and VCL) siRNAs for 48 h, whichwas followed by cell lysis for Western blot analysis. After loading uniform (9 μg) concentration of proteins on SDS- by cell lysis for Western blot analysis. After loading uniform (9 µg) concentration of proteins on PAGE, proteinsFigure 9. were(a) Effect transferred of intracellular onto deliverya nitrocellu of CAlose loaded membrane single additional for detecting cell adhesion the expression siRNAs onof p- protein expressions in 4T1 cells. Cells were incubated with CA loaded single additional cell adhesion SDS-PAGE,AKT, total proteinsAKT, p-MAPK, were transferred total MAPK, onto and athe nitrocellulose housekeeping membranegene GAPDH. for Densitometry detecting the analysis expression of siRNAs (ACTN1, PXN, CTNNA1, CTNNB1, TLN1, and VCL) siRNAs for 48 h, which was followed p-AKT,of (b)total p-AKT, AKT, (c) p-MAPK,AKT, (d) p-MAPK, total MAPK, and ( ande) MAPK the housekeeping expression in gene4T1 cells GAPDH. treated Densitometry with single cell analysis by cell lysis for Western blot analysis. After loading uniform (9 μg) concentration of proteins on SDS- of (b) p-AKT, (c) AKT, (d) p-MAPK, and (e) MAPK expression in 4T1 cells treated with single cell adhesionPAGE, siRNAs proteins (ACTN1, were transferredPXN, CTNNA1, onto a nitrocelluCTNNB1,lose TLN1, membrane and VCL) for detecting loaded theCA. expression Data represents of p- adhesionas mean siRNAsAKT, ± S.D. total * (ACTN1,represents AKT, p-MAPK, PXN,a significant total CTNNA1, MAPK, diffe andrence CTNNB1, the ofho singleusekeeping TLN1, siRNAs gene and compared GAPDH. VCL) loaded Densitometry to CA, CA. with Data analysis p < represents0.05. as mean S.D.of ( *b) represents p-AKT, (c) AKT, a significant (d) p-MAPK, diff anderence (e) MAPK of single expression siRNAs in 4T1 compared cells treated to with CA, single with cellp < 0.05. 3.5. Delivery± adhesionof CA Loaded siRNAs siRNAs (ACTN1, against PXN, CTNNA1, Cell Ad hesionCTNNB1, Molecules TLN1, and in VCL) a Murine loaded Breast CA. Data Cancer represents Model 3.5. Delivery ofas CA mean Loaded ± S.D. * siRNAsrepresents againsta significant Cell diffe Adhesionrence of single Molecules siRNAs compared in a Murine to CA,Breast with p < Cancer0.05. Model 3.5.1. Body Weight 3.5.1. Body3.5. Weight Delivery of CA Loaded siRNAs against Cell Adhesion Molecules in a Murine Breast Cancer Model The average body weights for mice in all the treatment and control groups were monitored at theThe interval average3.5.1. ofBody every body Weight weightstwo days, for and mice it was in all observ the treatmented that the and weight control in all groups the groups were monitoredremained at the intervalunchanged of every (approximatelyThe twoaverage days, body and 20 weights g). it wasData for observed miceis shown, in all that thein thistreatment the case, weight andfor treatments incontrol all the groups groups with were CA remainedmonitored loaded TLN1 at unchanged (approximately(Figure the10a), interval VCL 20 g). (Figureof Dataevery 10b), istwo shown, anddays, ACTN1 and in thisit was (Figure case, observ for10c)ed treatments siRNAs.that the weight with in CAall the loaded groups TLN1 remained (Figure 10a), unchanged (approximately 20 g). Data is shown, in this case, for treatments with CA loaded TLN1 VCL (Figure(Figure 10b), 10a), and VCL ACTN1 (Figure (Figure10b), and 10ACTN1c) siRNAs. (Figure 10c) siRNAs.

Figure 10. Average body weight of CA treated (a) CA + TLN1 (b) CA + VCL and (c) CA+ ACTN1

group of mice on Day 8 and Day 21 of the tumor regression study. Data represents an average body weight of five mice S.D. ± Pharmaceutics 2019, 11, 309 14 of 28

3.5.2. Tumor Regression of CA Loaded siRNAs in a Mouse Breast Cancer Model In vivo tumor regression showed reduced tumor volume in the CA-CTNNA1 siRNA complex. The reduced tumor volume was observed after the first dose of treatment (Figure 11a). The highest fold (3.75) reduction was observed on Day 9 (Table3). * represents a significant reduction with p < 0.05, which was observed from Day 9 until Day 17 of treatment (Figure 11a). Post day 17, a significant increase in tumor volume was observed, which, on Day 21, was higher than the CA control. Figure 11b shows an excised tumor of the CA-CTNNA1 siRNA treated group vs. the CA treated group, while Figure 11c shows tumor weight at the end of treatment. The tumor appears to be of the same size and weight compared to CA. On the other hand, delivery of the CA-CTNNB1 siRNA complex caused a significant reduction (p < 0.05) at all the time points of measurement after injection of the first dose of treatment. Figure 12a shows that the tumor regression curve was almost consistent with no increase until Day 17. The tumor fold reduction in comparison to the CA control (4.80) was highest on Day 10 and Day 21 (Table4). Figure 12b shows the reduced tumor at the end of the treatment compared to the CA group and decreased tumor weight of ~0.41 g (Figure 12c), which is significantly lesser (p < 0.05) when compared to CA. Treatment of 4T1 induced mice with CA-TLN1, CA-VCL, CA-PXN, and CA-ACTN1 siRNA complex also caused reduced tumor volume compared to the CA treated control. While the trend of tumor volume over period of time kept increasing, the tumor volume was significantly lower (*) than CA control with p < 0.05 (Figures 13a, 14a, 15a and 16a, respectively). The highest tumor fold decrease of 2.58 on Day 12 in case of CA-TLN1 was observed (Table5). Figure 13b shows a reduced tumor of the treatment group at the end of the study with tumor weight being ~0.29g, which is significantly less (p < 0.05) than the CA control (Figure 13c). In case of the CA-VCL siRNA treated group, tumor regression volume was significantly lower (*) from Day 12 onwards with p < 0.05 (Figure 14a). Until Day 12, the tumor regression trend did not increase, while, from Day 12 onwards, it increased significantly slower than the control. The highest tumor fold reduction was observed on Day 12 with a 3.61-fold decrease (Table6). Figure 14b shows a reduced tumor for the treatment compared to CA at the end of the study with tumor weight reduced to ~0.24g (Figure 14c), which is significantly less (p < 0.05) than CA at ~0.63 g. Compared to the CA control, in PXN, the siRNA-CA treated group tumor regression curve remained constant throughout the experiment. While the tumor burden was ~180 mm3 on Day 21 for the control, in the PXN-CA treatment group, the tumor volume did no increase beyond ~30mm3. The highest fold decrease was recorded as 6.19 on Day 19 (Table7). Figure 15b shows a highly reduced tumor at the end of the treatment with average tumor weight being ~0.27 g (Figure 15c), which is significantly less (p < 0.05) than CA. Lastly, the ACTN1 siRNA-CA group showed a highly significant reduction in tumor size (p < 0.05) on all the days (Figure 16a). Compared to the CA group, the tumor volume curve remained constant up to Day 17, after which it slightly increased with the tumor burden not increasing above ~82 mm3. As shown in Table8, the maximum fold reduction of 4.64 was seen on Day 13 of the tumor regression measurement. Figure 16b shows a reduced tumor volume at the end of the treatment and the average weight of tumors was ~0.20 g (Figure 16c), which is significantly less (p < 0.05) than the CA.

Table 3. Tumor reduction in the CA-loaded CTNNA1 siRNA treated group (in folds) compared to the CA-treated group.

Day 9 Day 11 Day 13 Day 15 Day 17 Day 19 Day 21 3.74 3.41 2.65 2.60 3.40 1.44 0.88 Pharmaceutics 2019, 11, 309 15 of 28

Table 4. Tumor reduction in CA loaded CTNNB1 siRNA treated group (in folds) compared to the CA-treated group.

Day 10 Day 11 Day 13 Day 15 Day 17 Day 19 Day 21 4.8 3.8 3.7 5.1 2.7 4.2 4.8

Table 5. Tumor reduction in the CA-loaded TLN1 siRNA treated group (in folds) compared to the Pharmaceutics 2019, 11, x 15 of 28 CA-treated group. Day 10 Day 11 Day 13 Day 15 Day 17 Day 19 Day 21 Day 10 Day 12 Day 14 Day 16 Day 19 Day 21 4.8 3.8 3.7 5.1 2.7 4.2 4.8 1.58 2.58 2.11 2.29 2.04 1.91 Table 5. Tumor reduction in the CA-loaded TLN1 siRNA treated group (in folds) compared to the TableCA-treated 6. Tumor group. reduction in the CA-loaded VCL siRNA treated group (in folds) compared to the CA-treated group. Day 10 Day 12 Day 14 Day 16 Day 19 Day 21 1.58 2.58 2.11 2.29 2.04 1.91 Day 10 Day 12 Day 14 Day 16 Day 19 Day 21 Table 6. Tumor2.18 reduction in 3.61the CA-loaded VCL 1.85 siRNA treated 2.02 group (in folds) 2.16 compared to 1.64 the CA- treated group.

Table 7. Tumor reductionDay in 10 the Day CA-loaded 12 Day PXN14 Day siRNA 16 Daytreated 19 group Day 21 (in folds) compared to the CA treated group. 2.18 3.61 1.85 2.02 2.16 1.64

Table 7. TumorDay 10reduction in Day the 12CA-loaded Day PXN 14 siRNA treated Day 16group (in Dayfolds) 19 compared Day to the 21 CA treated group. 4.80 4.02 5.02 5.61 6.19 5.92 Day 10 Day 12 Day 14 Day 16 Day 19 Day 21 4.80 4.02 5.02 5.61 6.19 5.92 Table 8. Tumor reduction in the CA-loaded ACTN1 siRNA treated group (in folds) compared to the

CA treatedTable 8. group.Tumor reduction in the CA-loaded ACTN1 siRNA treated group (in folds) compared to the CA treated group. Day 10 Day 11 Day 13 Day 15 Day 17 Day 19 Day 21 3.02Day 10 4.42 Day 11 Day 4.64 13 Day 15 4.49 Day 17 4.50 Day 19 Day 3.42 21 3.19 3.02 4.42 4.64 4.49 4.50 3.42 3.19

FigureFigure 11. 11.Treatment Treatment eff effectect of of CA CA bound bound siRNA agai againstnst CTNNA1 CTNNA1 genes genes in the in the4T1 4T1induced induced tumor tumor mice model.mice 4T1 model. cells 4T1 were cells injected were injected subcutaneously subcutaneously in thein the mammary mammary padpad of mice. After After a palpable a palpable tumor, tumor, mice were treated intravenously through tail vein injection with 100 μL of CA-CTNNA1

siRNA formed in 4 μL of 1 M CaCl2. Four doses of treatment were given on Day 8, Day 11, Day 14,

Pharmaceutics 2019, 11, 309 16 of 28

mice were treated intravenously through tail vein injection with 100 µL of CA-CTNNA1 siRNA formed

Pharmaceuticsin 4 µL of 2019 1 M, 11,CaCl x 2. Four doses of treatment were given on Day 8, Day 11, Day 14, and16 of Day 28 17. Five mice were used per group and data was represented as mean SD. (a) Tumor outgrowth of mice Pharmaceutics 2019, 11, x ± 16 of 28 treatedand Day with 17. CA-CTNNA1 Five mice were values used are per significant group and fordata * representingwas representedp < as0.05 mean compared ± SD. (a to) Tumor the CA control. outgrowth of mice treated with CA-CTNNA1 values are significant for * representing p < 0.05 (b) Excisedand Day tumor17. Five of mice the were CA-CTNNA1 used per group siRNA and group data was compared represented to CAas mean at the ± SD. end (a of) Tumor the treatment. compared to the CA control. (b) Excised tumor of the CA-CTNNA1 siRNA group compared to CA at (c) Tumoroutgrowth weight of mice of the treated treated with group CA-CTNNA1 vs. the CA-treated values are group.significant for * representing p < 0.05 the end of the treatment. (c) Tumor weight of the treated group vs. the CA-treated group. compared to the CA control. (b) Excised tumor of the CA-CTNNA1 siRNA group compared to CA at the end of the treatment. (c) Tumor weight of the treated group vs. the CA-treated group.

FigureFigure 12. 12.Treatment Treatment eeffectffect of of CA CA bound bound siRNA siRNA agains againstt CTNNB1 CTNNB1 genes genesin a 4T1 in induced a 4T1 induced tumor mice tumor mice model.model. 4T1 4T1 cells cells werewere injected subcutaneously subcutaneously in the in themammary mammary pad of pad mice. of After mice. a palpable After a palpabletumor, tumor, miceFigure were 12. Treatmenttreated intravenously effect of CA throughbound siRNA tail vein agains injectiont CTNNB1 with genes 100 μinL a of 4T1 CA-CTNNB1 induced tumor siRNA mice micemodel. were 4T1 treated cells intravenouslywere injected subcutaneously through tail vein in the injection mammary with pad 100 of mice.µL of After CA-CTNNB1 a palpable siRNAtumor, formed formed in 4 μL of 1 M CaCl2. Four doses of treatment were given on Day 8, Day 11, Day 14, and Day in 417.miceµ FiveL ofwere mice 1 M treated were CaCl used 2intravenously. Four per group doses andthrough of data treatment tailwas veinrepresented were injection given as with mean on 100 Day ± SD. μL 8, (aof Day) TumorCA-CTNNB1 11, outgrowth Day 14, siRNA and of Day 17. Fivemiceformed mice treatedwere in 4 withμ usedL of CA-CTNNB1 1 perM CaCl group2. Four andvalues doses data are of wassignificant treatment represented for were * representing give asn mean on Day p SD.<8, 0.05 Day (a compared) 11, Tumor Day 14,outgrowth to andthe CADay of mice 17. Five mice were used per group and data was represented as mean ± SD. (a) Tumor outgrowth of treatedcontrol. with (b) CA-CTNNB1 Excised tumor values of the areCA-CTNNB1 significant siRNA for * representing group comparedp < 0.05to CA compared at the end to theof the CA control. mice treated with CA-CTNNB1 values are significant for * representing p < 0.05 compared to the CA (b)treatment. Excised tumor(c) Tumor of weight the CA-CTNNB1 of the treated group siRNA vs. group the CA compared treated group to with CA * at representing the end of p < the 0.05 treatment. comparedcontrol. ( bto) theExcised control. tumor of the CA-CTNNB1 siRNA group compared to CA at the end of the (c) Tumortreatment. weight (c) Tumor of the weight treated of the group treated vs. group the CA vs. treated the CA treated group group with * with representing * representingp < p0.05 < 0.05 compared to thecompared control. to the control.

Figure 13. Cont.

Pharmaceutics 2019, 11, x 17 of 28

Pharmaceutics 2019, 11, 309 17 of 28 Pharmaceutics 2019, 11, x 17 of 28

Figure 13. Treatment effect of CA bound siRNA against TLN1 genes in a 4T1 induced tumor mice model.FigureFigure 4T1 13. 13.cells TreatmentTreatment were injected effect effect ofsubcutaneously of CA CA bound bound siRNA siRNA in theagains againstmammaryt TLN1 TLN1 genes pad genes ofin mice.a 4T1 in ainducedAfter 4T1 induceda palpabletumor mice tumor tumor, mice micemodel. model.were 4T1treated 4T1 cellscells intravenously were injected injected subcutaneously th subcutaneouslyrough tail vein in the ininjection themammary mammary with pad 100 of pad mice.μL ofof After mice.CA-TLN1 a Afterpalpable siRNA a palpable tumor, formed tumor, mice were treated intravenously through tail vein injection with 100 μL of CA-TLN1 siRNA formed in 4mice μL of were 1 M treated CaCl2. intravenouslyFour doses of throughtreatment tail were vein given injection on Day with 8, 100 Dayµ L11, of Day CA-TLN1 14, and siRNA Day 17. formed Five in in 4 μL of 1 M CaCl2. Four doses of treatment were given on Day 8, Day 11, Day 14, and Day 17. Five miceµ were used per group and data was represented as mean ± SD. (a) Tumor outgrowth of mice 4 miceL of were 1 M CaClused2 per. Four group doses and of data treatment was represented were given as onmean Day ± 8,SD. Day (a) 11,Tumor Day outgrowth 14, and Day of 17.mice Five mice treatedwere with used CA-TLN1 per group values and data are wassignificant represented for * representing as mean SD. p < (0.05a) Tumor compared outgrowth to the ofCA mice control. treated treated with CA-TLN1 values are significant for * representing± p < 0.05 compared to the CA control. (b) withExcised(b) CA-TLN1Excised tumor tumorvalues of theof theare CA-TLN1 CA-TLN1 significant siRNA siRNA for * representing groupgroup comparedpared< 0.05to to CA comparedCA at atthe the end toend of the theof CA thetreatment. control. treatment. ((bc) Excised (c) Tumor weight of the treated group vs. the CA treated group with * representing p < 0.05 compared to tumorTumor of weight the CA-TLN1 of the treated siRNA group group vs. th comparede CA treated to CAgroup at thewith end * representing of the treatment. p < 0.05 (comparedc) Tumor to weight of the control. thethe treated control. group vs. the CA treated group with * representing p < 0.05 compared to the control.

Figure 14. Treatment effect of CA bound siRNA against VCL genes in a 4T1 induced tumor mice model. 4T1 cells were injected subcutaneously in the mammary pad of mice. After a palpable tumor, mice were treated intravenously through tail vein injection with 100 μL of CA-VCL siRNA formed in Figure 14. Treatment effect of CA bound siRNA against VCL genes in a 4T1 induced tumor mice model. Figure4 μ 14.L of Treatment 1 M CaCl2. effectFour doses of CA of boundtreatment siRNA were givenagains ont VCLDay 8, genes Day 11, in Daya 4T1 14, inducedand Day 17.tumor Five mice model.4T1mice cells4T1 were cells were used were injected per injected group subcutaneously andsubcutaneously data was inrepresented the in the mammary mammary as mean pad ± padSD. of mice.(ofa) mice.Tumor After After outgrowth a palpablea palpable of mice tumor, tumor, mice micewere treatedwere treated treated with intravenouslyCA-VCL intravenously values through are th roughsignificant tail tail vein veinfor injection* representinginjection with with p 100 < 100 0.05µL μ compared ofL of CA-VCL CA-VCL to siRNAthe siRNA CA control. formed formed in in 4 µL (b) Excised tumor of the CA-VCL siRNA group compared to CA at the end of the treatment. (c) Tumor 4 μofL of 1 M1 M CaCl CaCl2. Four2. Four doses doses of of treatment treatment were were given given on on Day Day 8, 8, Day Day 11, 11, Day Day 14, 14, and and Day Day 17. 17. Five Five mice were used per group and data was represented as mean SD. (a) Tumor outgrowth of mice treated mice were used per group and data was represented as mean± ± SD. (a) Tumor outgrowth of mice treated with with CA-VCL CA-VCL values values are significant are significant for * representing for * representingp < 0.05 pcompared < 0.05 compared to the CA to control.the CA (control.b) Excised (b) tumorExcised of tumor the CA-VCL of the CA-VCL siRNA group siRNA compared group comp to CAared at to the CA end at the of theend treatment. of the treatment. (c) Tumor (c) Tumor weight of the treated group vs. the CA-treated group with * representing p < 0.05 compared to the control.

Pharmaceutics 2019, 11, x 18 of 28

Pharmaceuticsweight 2019of the, 11 ,treated x group vs the CA-treated group with * representing p < 0.05 compared to the18 of 28 control. Pharmaceuticsweight 2019of the, 11 ,treated 309 group vs the CA-treated group with * representing p < 0.05 compared to the18 of 28 control.

Figure 15. Treatment effect of CA bound siRNA against PXN genes in a 4T1 induced tumor mice model. 4T1 cells were injected subcutaneously in the mammary pad of mice. After a palpable tumor, Figure 15. Treatment effect of CA bound siRNA against PXN genes in a 4T1 induced tumor mice model. miceFigure were 15. treatedTreatment intravenously effect of CA through bound tail siRNA vein injectionagainst PXNwith 100genes μL in of aCA-PXN 4T1 induced siRNA tumor formed mice in 4T1 cells were injected subcutaneously in the mammary pad of mice. After a palpable tumor, mice were 4model. μL of 4T11 M cells CaCl were2. Four injected doses subcutaneouslyof treatment were in thegiven mammary on Day pad8, Day of mice.11, Day After 14, aand palpable Day 17. tumor, Five treated intravenously through tail vein injection with 100 µL of CA-PXN siRNA formed in 4 µL of 1 M mice were treatedused per intravenously group and datathrough was tail represented vein injection as mean with ±100 SD. μ L( aof) TumorCA-PXN outgrowth siRNA formed of mice in CaCl2. Four doses of treatment were given on Day 8, Day 11, Day 14, and Day 17. Five mice were used treated4 μL of with1 M CaClCA-PXN2. Four values doses are of significanttreatment werefor * representinggiven on Day p 8,< 0.05Day compared11, Day 14, to and the Day CA control.17. Five per group and data was represented as mean SD. (a) Tumor outgrowth of mice treated with CA-PXN (miceb) Excised were usedtumor per of groupthe CA-PXN and data siRNA was group represented± was co mparedas mean to± CASD. at(a )the Tumor end of outgrowth the treatment. of mice (c) values are significant for * representing p < 0.05 compared to the CA control. (b) Excised tumor of Tumortreated weightwith CA-PXN of the treated values group are significant vs the CA for treated * representing group with p <* representing0.05 compared p < to 0.05 the compared CA control. to the CA-PXN siRNA group was compared to CA at the end of the treatment. (c) Tumor weight of the the(b) Excisedcontrol. tumor of the CA-PXN siRNA group was compared to CA at the end of the treatment. (c) treated group vs. the CA treated group with * representing p < 0.05 compared to the control. Tumor weight of the treated group vs the CA treated group with * representing p < 0.05 compared to the control.

Figure 16. Cont.

Pharmaceutics 2019, 11, 309 19 of 28 Pharmaceutics 2019, 11, x 19 of 28

FigureFigure 16. 16.Treatment Treatment e effectffect of of CA CA bound bound siRNA siRNA against against ACTN1 ACTN1 genes genes in in a a 4T1 4T1 induced induced tumor tumor mice mice model.model. 4T14T1 cellscells werewere injectedinjected subcutaneouslysubcutaneously inin thethe mammarymammary padpad ofof mice.mice. AfterAfter aa palpablepalpable tumor,tumor, micemice were were treated treated intravenously intravenously through through tail tail vein vein injection injection with with 100 100µ μLL of of CA-ACTN1 CA-ACTN1 siRNA siRNA formed formed µ inin 4 4 μLL ofof 11 M CaCl 2.. Four Four doses doses of of treatment treatment were were given given on on Day Day 8, Day 8, Day 11, 11,Day Day 14, and 14, andDay Day17. Five 17. Five mice were used per group and data was represented as mean SD. (a) Tumor outgrowth of mice were used per group and data was represented as mean ± SD.± (a) Tumor outgrowth of mice micetreated treated with withCA-ACTN1 CA-ACTN1 values values are significant are significant for * representing for * representing p < 0.05p compared< 0.05 compared to the CA to thecontrol. CA control.(b) Excised (b) Excisedtumor of tumor the CA-ACTN1 of the CA-ACTN1 siRNA group siRNA was group compared was compared to CA at the to CAend at of the the end treatment. of the treatment.(c) Tumor ( cweight) Tumor of weight the treated of the treatedgroup vs group the vs.CA thetreated CA treated group groupwith * with representing * representing p < 0.05p < 0.05was wascompared compared to the to thecontrol. control. 4. Discussion 4. Discussion Various additional cell proteins play roles in localizing adhesion contacts of cadherins and integrins Various additional cell proteins play roles in localizing adhesion contacts of cadherins and with actin filaments in the cytoplasm and communicate essential signal transduction. Their aberration integrins with actin filaments in the cytoplasm and communicate essential signal transduction. Their plays a critical role in disrupting the signaling pathways and results in various diseases including breast aberration plays a critical role in disrupting the signaling pathways and results in various diseases cancer. Some of the essential molecules, which are critically involved in breast cancer, are catenins, including breast cancer. Some of the essential molecules, which are critically involved in breast actinin, talin, vinculin, and paxillin. Table9 lists some of the essential pathways these molecules cancer, are catenins, actinin, talin, vinculin, and paxillin. Table 9 lists some of the essential pathways are linked with in various forms of breast cancer. Acting as intermediate molecules, these adhesion these molecules are linked with in various forms of breast cancer. Acting as intermediate molecules, proteins are responsible for the cascade of metastatic pathways (Figure 17). Targeting these additional these adhesion proteins are responsible for the cascade of metastatic pathways (Figure 17). Targeting proteins could serve an essential therapeutic approach for breast cancer. However, in order to ensure these additional proteins could serve an essential therapeutic approach for breast cancer. However, the enhanced target delivery, the use of a suitable carrier vehicle is one of the key factors. In vitro and in order to ensure the enhanced target delivery, the use of a suitable carrier vehicle is one of the key in vivo RNAi approaches are being applied to target these endogenous overexpressed genes using factors. In vitro and in vivo RNAi approaches are being applied to target these endogenous CA as a delivery vehicle for a release of siRNA at the target site. Furthermore, to see the effect of overexpressed genes using CA as a delivery vehicle for a release of siRNA at the target site. knockdown of the essential cell adhesion molecules, we performed a Western blot assay where we Furthermore, to see the effect of knockdown of the essential cell adhesion molecules, we performed targeted AKT and MAPK pathways. Since AKT and MAPK pathways are predominantly responsible a Western blot assay where we targeted AKT and MAPK pathways. Since AKT and MAPK pathways for regulating proliferation and survival of cancer cells, downregulation of the pathways also correlate are predominantly responsible for regulating proliferation and survival of cancer cells, with the induced cytotoxicity of the breast cancer cells. downregulation of the pathways also correlate with the induced cytotoxicity of the breast cancer cells.

Pharmaceutics 2019, 11, 309 20 of 28 Pharmaceutics 2019, 11, x 20 of 28

Figure 17.17. IntracellularIntracellular essential essential signaling signaling pathways pathways involving involving cell cell adhesion adhesion molecules molecules in tumorigenesis. in tumorigenesis. CA is an inorganic pH sensitive nanocarrier that is formed by a chemical reaction between Ca2+, PO 3 , and HCO , which give rise to an apatite structure with a molecular formula of CA is4 an− inorganic pH3− sensitive nanocarrier that is formed by a chemical reaction between Ca2+, Ca103(PO− 4)6 x(CO3)−x(OH)2 [34]. The formation of CA was confirmed by FT-IR, which indicates it as PO4 , and− HCO3 , which give rise to an apatite structure with a molecular formula of a hydroxyapatite. Via IR spectroscopy on lyophilized CA samples, apart from OH−, the crystalline Ca10(PO4)6−x(CO3)x(OH)2 [34]. The formation of CA was confirmed by FT-IR, which indicates it as a structure is composed of CO and PO 3 (Figure2a). Three distinct peaks at 1480, 1415, and 866 cm 1 hydroxyapatite. Via IR spectroscopy3− 4on− lyophilized CA samples, apart from OH−, the crystalline− 1 3 can be observed, which represent CO3− ion while peaks at 1008, 540–585 cm− represent PO4 − structure is composed of CO3− and PO43− (Figure 2a). Three distinct peaks at 1480, 1415, and 866 cm−1 (Figure2b). Since the CO 3− ion has four different vibrational modes, the peaks in the range of 1480 to can be observed, which represent CO3− ion while peaks at 1008, 540–585 cm−1 represent PO43− (Figure 1 1 1415 cm− are intense peaks due to high energy ν3 vibrations. The peak that is formed at 866 cm− is a 2b). Since the CO3− ion has four different vibrational modes, the peaks in the range of 1480 to 1415 3 weak peak formed due to a low energy ν2 vibrational mode. On the other hand, the PO4 − ion has an cm−1 are intense peaks due to high energy ν3 vibrations. The peak that is formed at 866 cm−1 is a weak 1 1 intense ν3 band at 1008 cm− while sharp intense ν4 bands are observed in the range of 600 to 540 cm− . peak formed due to a low energy ν2 vibrational mode. On the other hand, the PO43− ion has an intense 1 Furthermore, weak bands corresponding to ν2 vibration are observed in the region of 467 cm− [42–45]. ν3 band at 1008 cm−1 while sharp intense ν4 bands are observed in the range of 600 to 540 cm−1. Additionally, the position of the CO3− peaks at the ν2 mode in the hydroxyapatite lattice depends on Furthermore, weak bands corresponding to ν2 vibration are observed in the region of 467 cm−1 [42– 3 whether CO3− is substituted for the PO4 − or OH− ion [46]. As compared to P-O stretching, the O-H 45]. Additionally, the position of the CO3− peaks at the ν2 mode in the hydroxyapatite lattice depends stretching due to hydroxyapatite stoichiometry is considered weaker. The adsorbed water band is on whether CO3− is substituted for the PO43− or OH− ion [46]. As compared to P-O stretching, the O-H 1 verystretching wide (3700due to to hydroxyapatite 2800 cm− ) with stoichiometry a weaker intensity, is considered which mayweaker. have The resulted adsorbed from water a decrease band ofis OH ions in the spectrum due to CO vibrational modes. The peak at 1658 and 675 cm 1 is also a very− wide (3700 to 2800 cm−1) with a 3weaker− intensity, which may have resulted from a decrease− of characteristic of the OH− bending vibration in water. Several peaks could have been due to removal of OH− ions in the spectrum due to CO3− vibrational modes. The peak at 1658 and 675 cm−1 is also a water from the hydroxyapatite [39,42,44]. Since the hydroxyapatite is a main mineral component of characteristic of the OH- bending vibration in water. Several peaks could have been due to removal tissuesof water such from as the bones, hydroxyapatite teeth, and cartilage, [39,42,44]. the Sinc generatione the hydroxyapatite of this less crystalline is a main CA mineral may not component be foreign inof thetissues organism’s such as physicalbones, teeth, environment, and cartilage, which the imposes generation less of of a threatthis less to themcrystalline [32,47 CA]. may not be foreign in the organism’s physical environment, which imposes less of a threat to them [32,47].

Pharmaceutics 2019, 11, 309 21 of 28

Table 9. Critical signaling pathways involved in various breast cancers.

Proteins Critical Signaling Pathways Expression in References Adenocarcinomas, Catenins WNT TNBC/Basal-like breast cancers, [48,49] Metastasis TNBC/Basal-like breast cancers, Talin P13K-AKT, RAS, FAK-MAPK HER2-overexpressing, [13,50–52] Metastasis Vinculin FAK-MAPK, PI3K TNBC [14,21,53,54] Adenocarcinomas, Src/FAK/PI3K, ERK, TNBC/Basal-like breast cancers, Paxillin [7,8,22,55,56] Rho/ROCK, JNK, p38 MAPK HER2 overexpressing, Metastasis Adenocarcinomas, Actinin P13K-AKT, MAPK [9,10,18,57] TNBC/Basal-like breast cancers

Prior to cell adhesion siRNA treatments, determination of the suitable siRNA concentration for successful in vitro transfection is required. For this, we treated MCF-7 with a CA-ACTN1 siRNA and 4T1 cells with CA-TLN1 siRNA complexes prepared with 4 mM Ca2+ at three different concentrations (10 pM, 100 pM, and 1 nM) of the siRNAs. The two siRNAs were randomly selected to maintain the heterogeneity of the experiments. From Figure3a,b, two observations could be made. When the siRNAs were delivered without a carrier to the cells, no major reduction in cell viability could be seen, which could be due to two reasons. First, siRNA is anionic in charge with a strong phosphate backbone and is hydrophilic in nature. Hence, it faces repulsion due to anionic cell membranes, which limit its passive delivery across the cell membrane. Second, within physiological conditions, siRNAs are unstable and can be easily degraded by nucleases in plasma and cells [24]. Thus, naked delivery of siRNAs cannot cause sufficient reduction in cellular proliferation. On the contrary, when the same siRNAs were loaded with CA nanoparticles, reduction in the cell viability was observed, which indicates efficient siRNA delivery into the cytoplasm, silencing the overexpressed genes. The effective role of CA as a carrier vehicle of siRNA has been shown in previous in vitro and in vivo studies [39,40]. Significant uptake of siRNA observed in cancer cell lines as well as in tumor tissues compared to free siRNA was correlated to the reduced cell viability and enhanced tumor regression, respectively. The inefficiency of naked siRNA following systemic administration was due to its nuclease-mediated degradation as well as elimination via renal clearance. Furthermore, no changes in cytotoxicity and tumor regression following the scrambled siRNA treatment has been observed in previous studies, which indicates that the enhancement in cytotoxicity and tumor regression is not due to the non-specific interactions of the siRNA with other mRNA transcripts or any other off-target effects of the particular siRNA [39,58]. In addition, CA is highly efficient in the knockdown of target genes even with a picogram amount of the initial siRNA concentration [35]. CA with its cation-rich domains can form a complex with anionic siRNAs and the resultant complex is able to cross the plasma membrane through endocytosis. Furthermore, the complex protects the loaded siRNA from the nuclease attack. Due to being small in size, CA loaded siRNAs can undergo efficient endocytosis, which is followed by low pH-dependent fast dissolution of the particles and consequential endosomal escape of the released siRNAs, which likely occurs by neutralizing the endosomes and disrupting them via osmotic pressure. This prevents the lysosomal degradation [32,34,35,59]. This, in turn, results in the release of the siRNAs in cytosol of the target cell. The second observation from Figure3a,b was irrespective of the cell lines used. The maximum reduction in cell viability was observed at 1nM siRNA concentration loaded with CA nanoparticles. CA transports the therapeutics via enhanced permeability and a retention effect (EPR effect). As tumor cells consume high oxygen, fast angiogenesis occurs, causing weak vasculature and lymphatic circulation in tumor tissues. Passive targeting transportation of therapeutic materials Pharmaceutics 2019, 11, 309 22 of 28 via CA to tumor cells and interstitum take place where openings of these leaky tumor capillaries release the therapeutics at target tumor sites [60]. Catenins play a prominent role in breast cancer by modulating the tissue integrity by destabilizing the E-cadherin/catenin complex. Studies show varied expression of α-catenin and β-catenin in both primary tumors and metastatic tumors [19,61]. Targeting these molecules in appropriate breast cancer cells may disrupt the E-cadherin/catenin adhesion link and reduce the tumor burden. Based on the MTT assay, we observed that transfection of CA loaded with 1 nM concentration of single CTNNA1 and CTNNB1 siRNAs caused significant reduction in cell viability in 4T1 cells (Figure4c) with an average actual cytotoxicity of ~13% (CA-CTNNA1 siRNA) and ~16% (CA-CTNNB1 siRNA) (Table2). An earlier report revealed high expression of α-catenin and β-catenin in metastasized tumors with their high accumulation found in cytoplasm [19,62]. Since the 4T1 model represents the human metastatic breast cancer, upon targeting these genes using the siRNA-CA complex, a significant reduction in cell proliferation could be achieved. Furthermore, when intravenous delivery of CTNNA1 and CTNNB1 siRNAs loaded with CA nanoparticles was done in the 4T1 tumor bearing the Balb/c mice model, the reduced tumor volume compared to the CA nanoparticle treated controls (Figures 11a and 12a) indicated the role of these genes in tumorigenesis. The significant reduction for CA-CTNNA1 siRNA delivery (Figure 11a) was observed with p < 0.05 on Day 10, Day 13, and Day 17 of measurements compared to the CA control. Toward the end of the treatment, no significant difference was observed when compared to CA treatment. This may be due to other catenins playing an essential role in cell adhesion [5]. An in vivo tumor regression study showed a significant reduction in the tumor burden on all the days of measurement after the first dose of treatment for CTNNB1-CA delivery (Figure 12a). Furthermore, the tumor volume curve almost remained uniform throughout the experimental procedure, which indicates the essential role of CTNNB1 siRNA knockdown in this cancer model. Catenins are involved in proliferation via various signaling pathways including PI3K/AKT, Ras/MAPK, Wnt, and Hedgehog [62]. Since the pathways such as PI3K (AKT) and MAPK are significantly upregulated in metastatic cancers, we performed the Western blot to see the effect at a protein level after intracellular delivery of CTNNA1 and CTNNB1 siRNAs using CA nanoparticles in 4T1 cells. Our results showed a significantly reduced expression in the levels of phosphorylated and total AKT/MAPK (Figure9), which indicates e ffective perturbation of these essential signaling pathways in 4T1 cells via CA loaded siRNAs targeting CTNNA1 and CTNNB1 mRNA transcripts. Talin (TLN) serves one of the most important focal adhesion proteins, which recruits various adaptor proteins for cell adhesion [63] and its expression has been found to be high in various cancers [63,64]. Targeting this protein might enhance the therapeutic efficiency by downregulating tumor migration, invasion, and metastasis. We found that talin-1 siRNA (TLN1) electrostatistically complexed with CA nanoparticles showed high cytotoxicity in MCF-7 cells as well as 4T1 cells. As the viability was reduced to ~ 67% in MCF-7 cells (Figure5a) and ~72% in 4T1 cells (Figure5c), the actual cytotoxicity reached ~30% in MCF-7 cells and ~17% in 4T1-cells (Table2). These results suggest that silencing TLN1 expression could regulate the cell viability in certain breast cancers. The study showed that the overexpression of TLN1 in cells such as prostate cancer cells could lead to increased signaling of AKT and FAK pathways [13]. We also observed that, in 4T1 cells, the level of expression of both phosphorylated and total AKT was significantly reduced upon siRNA transfection when compared to controls (Figure9). However, on the other hand, the expression level for phosphorylated and total MAPK was significantly higher, which suggests that other oncogenic pathway(s) or downstream molecules might contribute to the upregulation of this pathway. Our in vivo study showed that delivery of the CA-TLN1 siRNA complex could reduce the tumor burden in the 4T1 induced murine breast cancer model (Figure 13a). The slower tumor growth and lower tumor weight (Figure 13c) in the treatment group correlates with reduced TLN1 expression. We could see that the tumor growth increased very slightly from Day 8 of treatment until Day 17 of treatment, with maximum tumor volume reaching to ~180 mm3 on Day 21. By reducing the expression level of TLN1, integrin-talin interaction could be hampered, which disrupts the association of various other signaling proteins and, Pharmaceutics 2019, 11, 309 23 of 28 consequently, reduces AKT/FAK signal transduction. Since this could affect the tumor proliferation rate, we observed only a slight increase in the tumor volume compared to the control. In addition, this might have led to a reduced tumor invasion and metastasis to other sites [13]. In MDA-MB-231 cells, no reduction in viability was observed (Figure5b). Targeting TLN1 was shown to reduce invadopodium formation, tumor invasion, and metastasis in case of MDA-MB-231 cells [64]. These changes might have taken place in our treatment without any visible effect on cell viability. No change in cell viability could be due to varied conditions of cell growth, low siRNA dosage for this aggressive cell line, or upregulation of another isoform of talin, talin-2 whose role has been found in certain cancers [65]. VCL siRNA-loaded CA caused reduced cell viability in both the aggressive forms of breast cancers (MDA-MB-231 and 4T1). While the cell viability was ~77% in 4T1 cells (Figure6c), in MDA-MB-231, it was mildly reduced to ~83% (Figure6b). The actual cytotoxicity was ~9% in MDA-MB-231 cells and ~13% for 4T1 cells (Table2). A subsequent tumor regression study in the animal model showed significantly lower tumor volume compared to the CA nanoparticle treated group (Figure 14a), with the static tumor growth observed up to Day 12, followed by a slow increase, which reaches a maximum up to 200 mm3 on Day 21 in treatment group vs. ~350 mm3 in the control. The tumor weight at the end of the treatment was ~0.24 g while, in the CA-treated group, it reached up to ~0.63 g (Figure 14c). VCL is an essential cell adaptor protein that functionally regulates cadherin-based cell-cell adhesion. Upregulated in primary invasive cancers, it mediates force-induced tumor cell invasions by facilitating contractile force in three-dimensional ECM as well as by impeding cell migration in a two-dimensional manner [14,15,53,66]. It also regulates survival and motility via the ERK/MAPK pathway [54]. Our Western blot analysis in 4T1 cells demonstrated that intracellular delivery of CA nanoparticles loaded VCL siRNA caused a significant reduction in both total and phosphorylated AKT and MAPK levels compared to controls (Figure9), which indicates the successful aberration of oncogenic pathways via knockdown of VCL adhesion molecule. Co-localizing at the invasive borders in human breast tumors and providing ECM stiffness, it associates with growth factor molecules and active AKT, and further facilitates PI3K and growth factor signaling [21]. Our results showed the PXN-CA complex caused high reduction in cell viability in MCF-7 and 4T1 cell lines, with a slight decrease in MDA-MB-231. The viability was ~57% in MCF-7 (Figure7a), ~83% in MDA-MB-231 cells (Figure7b), and ~67% in 4T1 cells (Figure7c). Subsequently, the cytotoxicity of ~30% (MCF-7), ~13% (MDA-MB-231), and ~21% (4T1) was observed (Table2). Western blot showed significant reduced expression of phosphorylated and total AKT upon delivery of the PXN-CA complex (Figure9), which indicates the direct impact of the knockdown of the PXN protein on the AKT pathway. However, the expression level of p-MAPK and MAPK was increased. TGF-β could cause activation of the MAPK signaling cascade. Furthermore, since the PXN family consists of two other proteins, which are closely related, they could have also enhanced the expression of MAPK [16,56]. In the tumor regression study, the tumor burden was reduced to a greater extent in the PXN-CA treated group (Figure5a) compared to the control with an average tumor weight reducing to ~0.24g (Figure5c), which is around 2.6 folds lesser than the average weight of CA tumors. Throughout the experimental procedure, the tumor growth curve was almost a straight line with the highest tumor volume less than 50 mm3 at the end of 21 days. This indicates the importance of targeted PXN knockdown in 4T1 induced breast cancers. As shown in earlier studies, in breast tumors, PXN is overexpressed and regulates breast cancer cell metastasis. With PXN being a downstream target of several activated hormones and growth factors, it associates with aggressive cancers and reduces the survival rate of patients. Therefore, by regulating its expression, it could serve as an essential therapeutic molecule to inhibit breast cancer cell invasion, migration, and metastasis as well as plasticity control [7,16,56]. Intracellular delivery of the actinin-1 (ACTN1) complexed with CA in breast cancer cells showed a significant reduction of viability in MCF-7 and 4T1 cell lines, while, in MDA-MB-231, no such effect was observed. The cell viability was reduced to ~66% in MCF-7 (Figure8a), ~87% in MDA-MB-231 (Figure8b), and ~ 71% in 4T1 cells (Figure8c). The cytotoxicity was ~26% in MCF-7 cells, ~6% in Pharmaceutics 2019, 11, 309 24 of 28

MDA-MB-231 cells, and ~18% in 4T1 cells (Table2). This indicates the important role of this gene in proliferation of breast cancer cells. The slight decrease in viability of MDA-MB-231 could be due to higher invasive properties of these cells. Furthermore, upregulated α-Actinin-4 might also enhance the cell viability, as this form of actinin was shown to enhance cell proliferation in various cancers [57]. The Western blot showed significantly reduced expression in phosphorylated and total AKT levels upon transfection of 4T1 cells (Figure9), which are upregulated in overexpressed ACTN1 cells. No reduction in p-MAPK and MAPK could either be due to the presence of α-Actinin-4, which could activate the ERK/MAPK pathway, or due to cross talks of this pathway with other biological cell molecules, cell receptors, and transcription factors. In addition, both actinin forms have been found to be linked with EGFR, where EGFR causes stimulation of actinin phosphorylation (actinin-4 more than actinin-1), which activates the cascade of signaling pathways [67]. An in vivo tumor regression result was correlated to the cell viability data obtained in 4T1 cells and showed a highly significant reduction in tumor volume upon delivery of ACTN1-CA complex (Figure 16a) compared to the CA control. The tumor growth curve for the treatment group was almost constant until Day 17 of treatment, which indicates controlled tumor growth, and, after Day 17, a slight increase was observed. The tumor volume did not increase more than ~80 mm3, with tumor weight not exceeding 0.24 g (Figure 16c). In tumors, α-Actinin-1 serves as an adapter protein, which, under pressure, redistributes to membranes where it facilitates recruitment of the Src protein to β1-integrin-associated focal adhesion, while the other unit, α-Actinin-4, has been focused upon for its tumorigenesis role in breast cancer. ACTN1 still remains a potential molecule to be explored for its contribution toward the tumor burden. Therefore, by targeting this protein, it could provide a therapeutic model for inhibition of pressure stimulated tumor cell adhesions and control of the tumor growth and metastasis [11,68–71]. In the treatment groups, the high reduction in tumor volume might also have been due to frequent 4 doses of administration, which allows the siRNA-CA complex to last for a longer duration in the system, before being degraded and eliminated from the system.

5. Conclusions In the current study, we successfully targeted dysregulated CTNNA1, CTNNB1, TLN1, VCL, PXN, and ACTN1 genes by delivering respective siRNAs with the help of nano-sized CA particles in breast cancer cells as well as in a murine breast cancer model. In the murine metastatic cell line (4T1), significant inhibition was observed in AKT and MAPK pathways, which indicates that, by targeting these selective genes, the essential pathways involved in tumor cell proliferation could be affected. We showed downregulation of both phosphorylated and total AKT in samples treated with CA-associated siRNAs targeting CTNNA1, CTNNB1, TLN1, VCL, PXN, and ACTN1 mRNA transcripts and downregulation of phosphorylated MAPK and total MAPK in all of the samples treated with CTNNA1, CTNNB1, and VCL mRNAs. Since AKT and MAPK are downstream signaling molecules of the targeted adhesion molecules playing a critical role in oncogenesis, altercation in their expression and activation levels compared to controls indicate successful knockdown of CTNNA1, CTNNB1, TLN1, VCL, PXN, and ACTN1 target adhesion molecules. The delivery of CA-siRNA complexes caused significant tumor inhibitory effects even at a low concentration of siRNAs, likely as a result of low pH responsive-dissolution of the particles and fast endosomal release of the siRNAs from the nanoparticle carrier complex. Figure 18 summarizes the association of various cell adhesion molecules and their role in adhesion, proliferation, and metastasis of tumor cells and how CA-siRNA targeted delivery can result in cleavage of mRNA sequences of overregulated genes, which results in the inhibition of essential proliferation pathways. Thus, targeting of these dysregulated genes via RNAi and by use of the CA delivery vehicle could confer promising therapeutic benefit to human malignancy such as breast cancer. Pharmaceutics 2019, 11, 309 25 of 28 Pharmaceutics 2019, 11, x 25 of 28

FigureFigure 18. 18. EssentialEssential cell cell adhesion adhesion molecules molecules and and pathwa pathwaysys interlinked interlinked in breast in breast tumorigenesis tumorigenesis and aberrationand aberration of these of pathways these pathways and by andintroducti by introductionon of specific of siRNAs, specific eventually siRNAs, hampering eventually tumorigenesis.hampering tumorigenesis.

Author Contributions: M.A.A. carried out experiments. R.A.I. assisted in FT-IR, N.I.K. N.I. and K.K.T. provided Author Contributions: M.A.A. carried out experiments. R.A.I. assisted in FT-IR, N.I.K., N.I. and K.K.T. provided thethe technical technical assistance assistance and and resources, resources, and E. E.H.C.H.C. designed and supervised the project. Funding:Funding: AA seed seed grant grant from from the Health the Health & Wellbeing & Wellbeing Cluster, Cluster, Global GlobalAsia in Asiathe 21st in Century the 21st (GA21) Century Platform, (GA21) MonashPlatform, University Monash UniversityMalaysia Malaysiaand a andFRGS a FRGSgrant grantof Ministry of Ministry of ofHigher Higher Education, Education, Malaysia (FRGS/1/2016/STG05/MUSM/02/3), supported this work. (FRGS/1/2016/STG05/MUSM/02/3), supported this work. Conflicts of Interest: The authors declare no conflicts of interest. Conflict of Interest: The authors declare no conflicts of interest. References References 1. Malhotra, G.K.; Zhao, X.; Band, H.; Band, V. Histological, molecular and functional subtypes of breast cancers. 1. Malhotra, G.K.; Zhao, X.; Band, H.; Band, V. Histological, molecular and functional subtypes of breast Cancer Biol.Ther. 2010, 10, 955–960. [CrossRef][PubMed] cancers. Cancer Biol.Ther. 2010, 10, 955–960. 2. Jin, X.; Mu, P. Targeting breast cancer metastasis. Breast Cancer Basic Clin. Res. 2015.[CrossRef][PubMed] 2. Jin, X.; Mu, P. Targeting breast cancer metastasis. Breast Cancer: Basic Clin. Res. 2015, 3. Parekh, A.; Weaver, A.M. Regulation of cancer invasiveness by the physical extracellular matrix environment. doi:10.4137/BCBCR.S25460. Cell adhes. Migr. 2009, 3, 288–292. [CrossRef][PubMed] 3. Parekh, A.; Weaver, A.M. Regulation of cancer invasiveness by the physical extracellular matrix 4. Bendas, G.; Borsig, L. Cancer cell adhesion and metastasis: Selectins, integrins, and the inhibitory potential environment. Cell adhes. Migr. 2009, 3, 288–292. of heparins. Int. J. Cell Biol. 2012, 2012, 676731. [CrossRef][PubMed]

4.5. Bendas,Berx, G.; G.; Van Borsig, Roy, F. L. The Cancer E-cadherin cell ad/cateninhesion complex:and metastasis: An important Selectins, gatekeeper integrins, in and breast the cancerinhibitory tumorigenesis potential ofand heparins malignant. Int.progression. J. Cell Biol. 2012Breast, 2012 Cancer, 676731. Res. 2001, 3, 289. [CrossRef][PubMed]

5.6. Berx,Cowin, G.; P.; Van Rowlands, Roy, F. T.M.; The Hatsell, E-cadherin/catenin S.J. Cadherins comp and cateninslex: An inimportant breast cancer. gatekCurr.eeper Opin. in breast Cell Biol. cancer2005 , tumorigenesis17, 499–508. [CrossRef and malignant] progression. Breast Cancer Res. 2001, 3, 289.

6.7. Cowin,Deakin, P.; N.O.; Rowlands, Pignatelli, T.M.; J.; Turner, Hatsell, C.E. S.J. Diverse Cadherins roles and for catenins the paxillin in breast family cancer of proteins. Curr. in Opin. cancer. CellGenes Biol. Cancer 2005, 172012, 499–508., 3, 362–370. [CrossRef]

7.8. Deakin,López-Colom N.O.; éPignatelli,, A.M.; Lee-Rivera, J.; Turner, I.; C.E. Benavides-Hidalgo, Diverse roles for R.; the Ló paxillinpez, E.Paxillin: family of A proteins crossroad in in cancer pathological. Genes Cancercell migration. 2012, 3, 362–370.J. Hematol. Oncol. 2017, 10, 50. [CrossRef] 8. López-Colomé, A.M.; Lee-Rivera, I.; Benavides-Hidalgo, R.; López, E. Paxillin: A crossroad in pathological cell migration. J. Hematol. Oncol. 2017, 10, 50.

Pharmaceutics 2019, 11, 309 26 of 28

9. Christerson, L.B.; Vanderbilt, C.A.; Cobb, M.H. MEKK1 interacts with α-actinin and localizes to stress fibers and focal adhesions. Cell Motil. Cytoskel. 1999, 43, 186–198. [CrossRef] 10. Guvakova, M.A.; Adams, J.C.; Boettiger, D. Functional role of α-actinin, PI 3-kinase and MEK1/2 in insulin-like growth factor I receptor kinase regulated motility of human breast carcinoma cells. J. Cell Sci. 2002, 115, 4149–4165. [CrossRef] 11. Quick, Q.; Skalli, O. α-Actinin 1 and α-actinin 4: Contrasting roles in the survival, motility, and RhoA signaling of astrocytoma cells. Exp. Cell Res. 2010, 316, 1137–1147. [CrossRef][PubMed] 12. Critchley, D.R.; Gingras, A.R. Talin at a glance. J. Cell Sci. 2008, 121, 1345–1347. [CrossRef][PubMed] 13. Sakamoto, S.; McCann, R.O.; Dhir, R.; Kyprianou, N. Talin1 promotes tumor invasion and metastasis via focal adhesion signaling and anoikis resistance. Cancer Res. 2010, 70, 1885–1895. [CrossRef][PubMed] 14. Carisey, A.; Ballestrem, C. Vinculin, an adapter protein in control of cell adhesion signalling. Eur. J. Cell Biol. 2011, 90, 157–163. [CrossRef][PubMed] 15. Hazan, R.B.; Kang, L.; Roe, S.; Borgen, P.I.; Rimm, D.L. Vinculin is associated with the E-cadherin adhesion complex. J. Biol. Chem. 1997, 272, 32448–32453. [CrossRef][PubMed] 16. Turner, C.E. Paxillin interactions. J. Cell Sci. 2000, 113, 4139–4140. [PubMed] 17. Albigès-Rizo, C.; Frachet, P.; Block, M.R. Down regulation of talin alters cell adhesion and the processing of the alpha 5 beta 1 integrin. J. Cell Sci. 1995, 108, 3317–3329. [PubMed] 18. Kovac, B.; Mäkelä, T.P.; Vallenius, T. Increased α-actinin-1 destabilizes E-cadherin-based adhesions and associates with poor prognosis in basal-like breast cancer. PLoS ONE 2018, 13, e0196986. [CrossRef][PubMed] 19. Bukholm, I.; Nesland, J.; Børresen-Dale, A.L. Re-expression of E-cadherin, α-catenin and β-catenin, but not of γ-catenin, in metastatic tissue from breast cancer patients. J. Pathol. 2000, 190, 15–19. [CrossRef] 20. Haining, A.W.; Lieberthal, T.J.; del Río Hernández, A. Talin: A mechanosensitive molecule in health and disease. FASEB J. 2016, 30, 2073–2085. [CrossRef][PubMed] 21. Rubashkin, M.G.; Cassereau, L.; Bainer, R.; DuFort, C.C.; Yui, Y.; Ou, G.; Paszek, M.J.; Davidson, M.W.; Chen, Y.-Y.; Weaver, V.M. Force engages vinculin and promotes tumor progression by enhancing PI3K activation of phosphatidylinositol (3,4,5)-triphosphate. Cancer Res. 2014, 74, 4597–4611. [CrossRef][PubMed] 22. Short, S.M.; Yoder, B.J.; Tarr, S.M.; Prescott, N.L.; Laniauskas, S.; Coleman, K.A.; Downs-Kelly, E.; Pettay, J.D.; Choueiri, T.K.; Crowe, J.P.; et al. The expression of the cytoskeletal focal adhesion protein paxillin in breast cancer correlates with HER2 overexpression and may help predict response to chemotherapy: a retrospective immunohistochemical study. Breast J. 2007, 13, 130–139. [CrossRef][PubMed] 23. Xu, J.; Prosperi, J.R.; Choudhury, N.; Olopade, O.I.; Goss, K.H. β-catenin is required for the tumorigenic behavior of triple-negative breast cancer cells. PLoS ONE 2015, 10, e0117097. 24. Xu, C.-f.; Wang, J. Delivery systems for siRNA drug development in cancer therapy. Asian J. Pharm. Sci. 2015, 10, 1–12. [CrossRef] 25. Behlke, M.A. Progress towards in vivo use of siRNAs. Mol. Ther. 2006, 13, 644–670. [CrossRef][PubMed] 26. Fatemian, T.; Chowdhury, E. Cytotoxicity Enhancement in Breast Cancer Cells with Carbonate Apatite-Facilitated Intracellular Delivery of Anti-Cancer Drugs. Toxics 2018, 6, 12. [CrossRef][PubMed] 27. Kumari, A.; Yadav, S.K.; Yadav, S.C. Biodegradable polymeric nanoparticles based drug delivery systems. Colloids Surf. B 2010, 75, 1–18. [CrossRef] 28. Pandey, H.; Rani, R.; Agarwal, V. Liposome and their applications in cancer therapy. Braz. Arch. Biol. Technol. 2016, 59, e16150477. [CrossRef] 29. Li, Y.; Humphries, B.; Yang, C.; Wang, Z. Nanoparticle-Mediated Therapeutic Agent Delivery for Treating Metastatic Breast Cancer-Challenges and Opportunities. Nanomaterials 2018, 8, 361. [CrossRef] 30. Bhattacharyya, S.; Kudgus, R.A.; Bhattacharya, R.; Mukherjee, P. Inorganic nanoparticles in cancer therapy. Pharm. Res. 2011, 28, 237–259. [CrossRef] 31. Yalcin, S.; Gunduz, U. Nanoparticle based delivery of miRNAs to overcome drug resistance in breast cancer. J. Nanomed. Nanotechnol. 2016, 7, 414. 32. Chowdhury, E. pH-sensitive nano-crystals of carbonate apatite for smart and cell-specific transgene delivery. Exp. Opin. Drug Deliv. 2007, 4, 193–196. [CrossRef] 33. Chowdhury, E.; Akaike, T. High performance DNA nano-carriers of carbonate apatite: multiple factors in regulation of particle synthesis and transfection efficiency. Int. J. Nanomed. 2007, 2, 101. [CrossRef] Pharmaceutics 2019, 11, 309 27 of 28

34. Chowdhury, E.H. H-sensitive nanocrystals of carbonate apatite-a powerful and versatile tool for efficient delivery of genetic materials to mammalian cells. In Advances in Biomaterials Science and Biomedical Applications; InTechOpen, 2013. 35. Hossain, S.; Stanislaus, A.; Chua, M.J.; Tada, S.; Tagawa, Y.I.; Chowdhury, E.H.; Akaike, T. Carbonate apatite-facilitated intracellularly delivered siRNA for efficient knockdown of functional genes. J. Control. Release 2010, 147, 101–108. [CrossRef][PubMed] 36. Mozar, F.S.; Chowdhury, E.H. Surface-modification of carbonate apatite nanoparticles enhances delivery and cytotoxicity of gemcitabine and anastrozole in breast cancer cells. Pharmaceutics 2017, 9, 21. [CrossRef] 37. Tiash, S.; Othman, I.; Rosli, R.; Hoque Chowdhury, E. Methotrexate-and cyclophosphamide-embedded pure and strontiumsubstituted carbonate apatite nanoparticles for augmentation of chemotherapeutic activities in breast cancer cells. Curr. Drug Deliv. 2014, 11, 214–222. [CrossRef] 38. Kunnath, A.P.; Tiash, S.; Fatemian, T.; Morshed, M.; Mohamed, S.M.; Chowdhury, E.H. Intracellular delivery of ERBB2 siRNA and p53 gene synergistically inhibits the growth of established tumour in an immunocompetent mouse. J. Cancer Sci. Ther. 2014, 6, 99–104. [CrossRef] 39. Tiash, S.; Kamaruzman, N.I.B.; Chowdhury, E.H. Carbonate apatite nanoparticles carry siRNA(s) targeting growth factor receptor genes egfr1 and erbb2 to regress mouse breast tumor. Drug Deliv. 2017, 24, 1721–1730. [CrossRef] 40. Tiash, S.; Chowdhury, E.H. siRNAs targeting multidrug transporter genes sensitise breast tumour to doxorubicin in a syngeneic mouse model. J. Drug Target. 2019, 27, 325–337. [CrossRef][PubMed] 41. Kunnath, A.P.; Kamaruzman, N.I.; Chowdhury, E.H. Nanoparticle-facilitated intratumoral delivery of Bcl-2/IGF-1R siRNAs and p53 Gene synergistically inhibits tumor growth in immunocompetent mice. J. Nanomed. Nanotechnol. 2015, 6, 1. [CrossRef] 42. Rehman, I.; Bonfield, W. Characterization of hydroxyapatite and carbonated apatite by photo acoustic FTIR spectroscopy. J. Mater. Sci. 1997, 8, 1–4. [CrossRef] 43. Berzina-Cimdina, L.; Borodajenko, N. Research of calcium phosphates using Fourier transform infrared spectroscopy. In Infrared Spectroscopy-Materials Science, Engineering and Technology; IntechOpen, 2012. 44. Veiderma, M.; Knubovets, R.; Tonsuaadu, K. Structural properties of apatites from Finland studied by FTIR spectroscopy. Bull. Geol. Soc. Finland 1998, 70, 69–75. [CrossRef] 45. Chowdhury, E.H.; Akaike, T. pH-sensitive inorganic nano-particles and their precise cell targetibility: An efficient gene delivery and expression system. Curr. Chem. Biol. 2007, 1, 201–213. 46. Stoch, A.; Jastrzebski, W.; Bro˙zek,A.; Trybalska, B.; Cichoci´nska,M.; Szarawara, E. FTIR monitoring of the growth of the carbonate containing apatite layers from simulated and natural body fluids. J. Mol. Struct. 1999, 511, 287–294. [CrossRef] 47. Chowdhury, E.H. pH-responsive magnesium-and carbonate-substituted apatite nano-crystals for efficient and cell-targeted delivery of transgenes. Open J. Genet. 2013, 3, 38. [CrossRef] 48. Geyer, F.C.; Lacroix-Triki, M.; Savage, K.; Arnedos, M.; Lambros, M.B.; MacKay, A.; Natrajan, R.; Reis-Filho, J.S. β-Catenin pathway activation in breast cancer is associated with triple-negative phenotype but not with CTNNB1 mutation. Modern Pathol. 2011, 24, 209. [CrossRef] 49. Michaelson, J.S.; Leder, P. β-catenin is a downstream effector of Wnt-mediated tumorigenesis in the mammary gland. Oncogene 2001, 20, 5093. [CrossRef] 50. Li, L.; Li, X.; Qi, L.; Rychahou, P.; Jafari, N.; Huang, C. The role of talin2 in breast cancer tumorigenesis and metastasis. Oncotarget 2017, 8, 106876. [CrossRef] 51. Hironaka-Mitsuhashi, A.; Matsuzaki, J.; Takahashi, R.U.; Yoshida, M.; Nezu, Y.; Yamamoto, Y.; Shiino, S.; Kinoshita, T.; Ushijima, T.; Hiraoka, N.; et al. A tissue microRNA signature that predicts the prognosis of breast cancer in young women. PLoS ONE 2017, 12, e0187638. [CrossRef] 52. Desiniotis, A.; Kyprianou, N. Significance of talin in cancer progression and metastasis. In International Review of Cell and Molecular Biology; Elsevier: Cambridge, MA, USA, 2011; pp. 117–147. 53. Mierke, C.T.; Kollmannsberger, P.; Zitterbart, D.P.; Diez, G.; Koch, T.M.; Marg, S.; Ziegler, W.H.; Goldmann, W.H.; Fabry, B. Vinculin facilitates cell invasion into 3D collagen matrices. J. Biol. Chem. 2010.[CrossRef] 54. Subauste, M.C.; Pertz, O.; Adamson, E.D.; Turner, C.E.; Junger, S.; Hahn, K.M. Vinculin modulation of paxillin–FAK interactions regulates ERK to control survival and motility. J. Cell Biol. 2004, 165, 371–381. [CrossRef][PubMed] Pharmaceutics 2019, 11, 309 28 of 28

55. Huang, C.; Rajfur, Z.; Borchers, C.; Schaller, M.D.; Jacobson, K. JNK phosphorylates paxillin and regulates cell migration. Nature 2003, 424, 219. [CrossRef][PubMed] 56. Deakin, N.O.; Turner, C.E. Distinct roles for paxillin and Hic-5 in regulating breast cancer cell morphology, invasion, and metastasis. Mol. Biol. Cell 2011, 22, 327–341. [CrossRef][PubMed] 57. Hsu, K.-S.; Kao, H.-Y. Alpha-actinin 4 and Tumorigenesis of Breast Cancer, in Vitamins and Hormones; Elsevier: Cambridge, MA, USA, 2013; pp. 323–351. 58. Kamaruzman, N.; Tiash, S.; Ashaie, M.; Chowdhury, E. siRNAs Targeting Growth Factor Receptor and Anti-Apoptotic Genes Synergistically Kill Breast Cancer Cells through Inhibition of MAPK and PI-3 kinase pathways. Biomedicines 2018, 6, 73. [CrossRef][PubMed] 59. Tada, S.; Chowdhury, E.H.; Cho, C.S.; Akaike, T. pH-sensitive carbonate apatite as an intracellular protein transporter. Biomaterials 2010, 31, 1453–1459. [CrossRef][PubMed] 60. Chowdhury, E.H. Nanotherapeutics: From Laboratory to Clinic; CRC Press: Boca Raton, FL, USA, 2016. 61. Park, D.; KÅresen, R.; Axcrona, U.; Noren, T.; Sauer, T. Expression pattern of adhesion molecules (E-cadherin, α-, β-, γ-catenin and claudin-7), their influence on survival in primary breast carcinoma, and their corresponding axillary lymph node metastasis. Apmis 2007, 115, 52–65. [CrossRef][PubMed] 62. Benjamin, J.M.; Nelson, W.J. Bench to bedside and back again: molecular mechanisms of α-catenin function and roles in tumorigenesis. In Seminars in Cancer Biology; Elsevier: Cambridge, MA, USA, 2008. 63. Jevnikar, Z.; Rojnik, M.; Jamnik, P.; Doljak, B.; Fonovi´c,U.P.; Kos, J. Cathepsin H mediates the processing of talin and regulates migration of prostate cancer cells. J. Biol. Chem. 2013, 288, 2201–2209. [CrossRef] [PubMed] 64. Beaty, B.T.; Wang, Y.; Bravo-Cordero, J.J.; Sharma, V.P.; Miskolci, V.; Hodgson, L.; Condeelis, J. Talin regulates moesin–NHE-1 recruitment to invadopodia and promotes mammary tumor metastasis. J. Cell Biol. 2014, 205, 737–751. [CrossRef][PubMed] 65. Fang, K.P.; Dai, W.; Ren, Y.H.; Xu, Y.C.; Zhang, S.M.; Qian, Y.B. Both Talin-1 and Talin-2 correlate with malignancy potential of the human hepatocellular carcinoma MHCC-97 L cell. BMC Cancer 2016, 16, 45. [CrossRef] 66. Lifschitz-Mercer, B.; Czernobilsky, B.; Feldberg, E.; Geiger, B. Expression of the adherens junction protein vinculin in human basal and squamous cell tumors: Relationship to invasiveness and metastatic potential. Human Pathol. 1997, 28, 1230–1236. [CrossRef] 67. Shao, H.; Wu, C.; Wells, A. Phosphorylation of alpha-actinin-4 upon epidermal growth factor (EGF) exposure regulates its interaction with actin. J. Biol. Chem. 2010, 285, 2591–2600. [CrossRef][PubMed] 68. Kikuchi, S.; Honda, K.; Tsuda, H.; Hiraoka, N.; Imoto, I.; Kosuge, T.; Umaki, T.; Onozato, T.; Shitashige, M.; Yamaguchi, U.; et al. Expression and gene amplification of actinin-4 in invasive ductal carcinoma of the pancreas. Clin. Cancer Res. 2008, 14, 5348–5356. [CrossRef][PubMed] 69. Welsch, T.; Keleg, S.; Bergmann, F.; Bauer, S.; Hinz, U.; Schmidt, J. Actinin-4 expression in primary and metastasized pancreatic ductal adenocarcinoma. Pancreas 2009, 38, 968–976. [CrossRef][PubMed] 70. Craig, D.H.; Downey, C.; Basson, M.D. siRNA-mediated reduction of α-actinin-1 inhibits pressure-induced murine tumor cell wound implantation and enhances tumor-free survival. Neoplasia 2008, 10, 217–222. [CrossRef][PubMed] 71. Craig, D.H.; Haimovich, B.; Basson, M.D. α-Actinin-1 phosphorylation modulates pressure-induced colon cancer cell adhesion through regulation of focal adhesion kinase-Src interaction. Am. J. Physiol.-Cell Physiol. 2007, 293, C1862–C1874. [CrossRef]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).