CORE Metadata, citation and similar papers at core.ac.uk Provided by Springer - Publisher Connector Mycol Progress (2014) 13:131–144 DOI 10.1007/s11557-013-0900-z ORIGINAL ARTICLE Multigene phylogeny, taxonomy and reclassification of Hyaloperonospora on Cardamine Hermann Voglmayr & Young-Joon Choi & Hyeon-Dong Shin Received: 23 January 2013 /Revised: 12 March 2013 /Accepted: 21 March 2013 /Published online: 14 April 2013 # The Author(s) 2013. This article is published with open access at Springerlink.com Abstract Based on sequence data from cox1, cox2, ITS and Keywords Dentaria . Host range . Obligate parasites . LSU rDNA, it is shown that at least six species of Peronospora . Peronosporaceae Hyaloperonospora occur on the genus Cardamine,mostof which were commonly classified under Peronospora dentariae. Based on sequences from their type hosts, Introduction Peronospora dentariae, Peronospora cardamines-laciniatae, Peronospora dentariae-macrophyllae, Peronospora malyi Recent molecular phylogenetic studies showed that the genus and Peronospora nasturtii-aquatici are combined into Hyaloperonospora, established by Constantinescu and Fatehi Hyaloperonospora, and their circumscription is clarified. (2002)forPeronospora species infecting Brassicaceae, Hyaloperonospora cardamines-enneaphyllos is described as Capparaceae, Cistaceae, Limnanthaceae, Resedaceae and a new species from Cardamine enneaphyllos. The host range Zygophyllaceae, comprises a high biodiversity, its species of Hyaloperonospora nasturtii-aquatici, described from usually being highly host specific (e.g. Riethmüller et al. Nasturtium officinale, is shown to extend to various 2002;Choietal.2003; Voglmayr 2003; Göker et al. 2003, Cardamine species. Host range of species is shown to be 2004, 2009a;Choietal.2011; Voglmayr and Göker 2011). highly diagnostic, with no overlap in their host range, but Therefore, a narrow species circumscription as already advo- species commonly cannot be distinguished by morphology catedbyGäumann(1918, 1923) has been confirmed, alone. Both cox1 and cox2 are confirmed to be good markers disproving the widely applied concept of Yerkes and Shaw for phylogenetic species delimitation of closely related (1959), who classified all accessions from Brassicaceae under Hyaloperonospora species on Cardamine. asinglespecies,H. parasitica (see review in Voglmayr 2008). Although in general the narrow species concept of Gäumann (1918, 1923) has been shown to be more appropri- * H. Voglmayr ( ) ate, there are numerous problems in detail. Gäumann (1918, Department of Systematic and Evolutionary Botany, Faculty Center Biodiversity, University of Vienna, Rennweg 14, 1923) described numerous Peronospora species from 1030 Wien, Austria Brassicaceae based on subtle morphological differences and e-mail: [email protected] on evidence of high host specificity obtained by cross- inoculation studies; however, as cross-inoculation studies Y.-J. Choi Biodiversity and Climate Research Centre (BiK-F), could be performed only on a very limited number of hosts, Senckenberganlage 25, most of his species were mainly based on host range in D-60325 Frankfurt (Main), Germany combination with often subtle differences in conidial size andshape.Therefore,hecommonlyclassifiedaccessionsof H.-D. Shin Division of Environmental Science and Ecological Engineering, various related host species under the same species if they Korea University, Seoul 136-701, Korea were morphologically similar. As a result, he unfortunately did not select types for the species he described, but only a list Y.-J. Choi of material examined, which especially becomes a problem if Department of Biological Sciences, Institute of Ecology, Evolution and Diversity, Goethe University, Siesmayerstr. 70, accessions from several hosts were classified under the same D-60323 Frankfurt am Main, Germany species. Recently, the extensive molecular phylogenetic study 132 Mycol Progress (2014) 13:131–144 of Göker et al. (2009a) showed that several of his species were Gäumann (1918). No material from Cardamine graeca, the highly polyphyletic, as accessions from related hosts classi- type host of P. malyi, was included in the investigation of fied under the same species name by Gäumann (1918)are Göker et al. (2009a), so the status of that species also often not closely related, raising the problem of the correct remained unresolved. naming of species. For this, nomenclatural and taxonomic To clarify these nomenclatural uncertainties, recent col- decisions like lectotypification of heterogeneous entities are lections were obtained for the type hosts of all four species necessary. In addition, sequences have to be available for the described from Cardamine. Four genes (ITS, LSU, cox1, species originating from the type host before appropriate cox2) were sequenced and analyzed for numerous acces- reclassification can be achieved. sions from Cardamine to evaluate the host ranges and spe- Five of these problematic taxa for which no nomenclatural cies boundaries. decisions could yet be achieved due to reasons discussed above include Peronospora dentariae, P. cardamines-laciniatae, P. dentariae-macrophyllae, P. malyi and P. nasturtii-aquatici. Materials and methods Peronospora dentariae has already been described by Rabenhorst (1859) from an Italian collection from Cardamine Morphological analysis (Dentaria) heptaphylla, a rather rare montane species confined to the Jura, south-western Alps and Apennines, but Gäumann Conidiophores and conidia were removed from the under- (1918, 1923) also placed collections from various other neath of infected leaves, transferred to anhydrous lactic acid Cardamine species in that species. Peronospora cardamines- on a slide, carefully torn apart using forceps and needles, laciniatae, P. dentariae-macrophyllae and P. nasturtii-aquatici shortly heated using an alcohol burner and covered with a have been described by Gäumann (1918), based on differences cover slip. Slides were examined and photographed using a in conidial sizes. Peronospora cardamines-laciniatae was de- Zeiss Axio Imager.A1 (Zeiss, Jena, Germany) microscope scribed for accessions from the North American Cardamine equipped with a Zeiss AxioCam ICc3 digital camera. laciniata, P. dentariae-macrophyllae for accessions from the Measurements are reported as maxima and minima in pa- East Asian Cardamine leucantha (syn. C. macrophylla var. rentheses and the mean plus and minus the standard devia- dasyloba), and P. nasturtii-aquatici for accessions from tion of a number of measurements given in parentheses. Nasturtium officinale. Based on his conidial measurements, Gäumann (1918) assumed that accessions from the European Sample sources Cardamine bulbifera could also belong to P. cardamines- laciniatae, but later expressed strong doubts that they are Information on the samples used for morphological analysis, conspecific (Gäumann 1923). However, Gustavsson (1959) sequencing and phylogenetic analyses is given Table 1. found no significant differences in conidial size between ac- cessions from various Cardamine species either classified as P. DNA extraction, PCR and sequencing dentariae or P. cardamines-lacinatae andheconsideredthem to be synonymous. Finally, Lindtner (1957) described a fifth For DNA extraction, infected dry host tissue was placed in species, Peronospora malyi,fromCardamine graeca, based on 2-ml reaction tubes together with six sterile 2-mm glass larger conidia and oospores. beads and ground in a Retsch 200 mixer mill for 10 min at The extensive investigation of Göker et al. (2009a) a frequency of 30 Hz. DNA was extracted using the modi- showed that Hyaloperonospora accessions from various fied CTAB protocol described in Riethmüller et al. (2002). Cardamine species were placed in five distinct subgroups, A ca. 2,200-bp-long fragment containing partial nuSSU- two of which were part of their clade 1, and three of their ITS-LSU rDNAwas amplified using primers DC6 (Bonants et clade 6. However, as neither material from the type host of al. 1997) and LR6-O (Riethmüller et al. 2002) or LR6-O1 Peronospora dentariae, C. heptaphylla, nor from the type (designed here; 5′ CGCATCGCCAGACGAGC 3′). In cases host of P. cardamines-laciniatae, C. laciniata, were avail- where no product could be obtained, ITS and LSU were able for study at that time, it remained unclear to which separately amplified using primers DC6 and ITS4 (White et clades the names P. dentariae and P. cardamines-laciniatae al. 1990) and LR0R (Vilgalys and Hester 1990) and LR6-O1, should be applied. Therefore, the various Hyaloperonospora respectively. For cycle sequencing, primers ITS5-P (designed clades on Cardamine could not be properly classified. Due here; 5′ GGAAGGTGAAGTCGTAACAAGG 3′), ITS4, to these uncertainties, P. nasturtii-aquatici could also not be LR0R and LR6-O were used. For the mitochondrial cyto- properly classified, as accessions from Nasturtium officinale chrome c oxidase subunit I (cox1) sequences, primers Oom- were contained in a clade comprising accessions from var- CoxI-lev-up and Oom-CoxI-lev-lo (Robideau et al. 2011) ious Cardamine species, e.g., C. amara, C. hirsuta and C. were used for amplification and cycle sequencing; the cyto- pratensis, which were all placed in the older P. dentariae by chrome c oxidase subunit II (cox2) was amplified and cycle- Mycol Progress (2014) 13:131 Table 1 Sources and GenBank accession numbers of Hyaloperonospora and Perofascia material used for molecular phylogenetic analyses. For institution codes of herbarium