sign in sign up
<<
Home , Macrolide

VOL. 53 NO. 5, MAY2000 THE JOURNAL OF pp.516 - 524

Macrolide Esterase-producing Escherichia coli Clinically Isolated in Japan

Akio Nakamura, Kyoko Nakazawa, Izumi Miyakozawa, Satoko Mizukoshi, Kazue Tsurubuchi, Miyuki Nakagawa, Koji O'hara* and Tetsuo Sawai Department of Microbial Chemistry, Faculty of Pharmaceutical Sciences, Chiba University, Chiba 263-8522, Japan (Received for publication January 25, 2000)

Current Japanese clinical practice involves the usage of large amounts of newmacrolides such as and for the treatment of , Helicobacter pylori and avium complex . In this study, the phenotypes, genotypes, and macrolide resistance mechanisms of macrolide-inactivating Escherichia coll recovered in Japan from 1996 to 1997, were investigated. The isolation rate of A highly-resistant E. coli (MIC > 1600 /xg/ml) in Japan slightly increased from 0.5% in 1986 to 1.2% in 1997. In six macrolide-resistant strains, recovered from the strains collected for this study during 1996 to 1997, the inactivation of macrolide could be detected with or without added ATPin the assay system. The appearance of erythromycin A-inactivating enzyme independent of ATPwas novel from Japanese isolates, and the ]H NMRspectra of hydrolyzed by the three ATP-independent isolates were examined. It was clearly shown that the ring at the position of C-13 was cleaved as 13-H signal in aglycon of oleandomycin upper shifted. These results suggested the first detection of macrolide-lactone ring-hydrolase from clinical isolates in Japan. These results suggested the first detection of an ATP-independent macrolide-hydrolyzing enzyme from Japanese clinical isolates. Substrate specificity of the macrolide-hydrolyzing enzyme was determined with twelve macrolides including the newer membersof this group and it was found that not only erythromycin A but also the new macrolides, such as clarithromycin, roxithromycin, and were inactivated. The NMRdata, broad spectrum of activity, and independence of co-enzymesupported our namingof the enzymeas a macrolide esterase. PCRmethodology was employed to detect an ereB-like gene from the 3 isolates producing macrolide esterase, and one of these was subsequently shown to contain both ereB-like and ermB-Wksgenes. It was also clearly shown that the other three isolates, which inactivated macrolide in the presence of ATP, had an mphA-liko gene.

Macrolide antibiotics are mainly active against Gram- oral administration of the drug4). positive bacteria such as Staphylococcus aureus. Acquired Recently, pathogenic, opportunistic, normal flora resistance to macrolide antibiotics has been extensively bacteria, or an -producing species resistant to studied in these bacteria and is generally due to N6- erythromycin A were classified against rRNAmethylase dimethylation of a specific adenine residue in 23S rRNA1>2). genes, efflux and inactivating genes2). Most of the strains Members of the family Enterobacteriaceae, like most were isolated from feces or blood cultures during selective Gram-negative organisms, are intrinsically resistant to low digestive tract decontamination with erythromycin A in levels of erythromycin A, probably by efflux pumps3). neutropenic patients. The strains inactivate the 14- However, higher local antibiotic concentrations of 0.5 to membered macrolides by producing erythromycin 6mg/g of feces are obtained in the lumen of the intestinal esterases5'6) or macrolide 2'-phosphotransferase I7'8). The tract after oral absorption of usually recommended 16-membered ring macrolides are efficiently utilized as therapeutic doses. Enterobacteriaceae highly resistant to substrates by only macrolide 2 ' -phosphotransferase II9'10). erythromycin A (MIC, >500 jUg/ml) can be isolated, after Macrolide 2'-phosphotransferase [MPH (2')] I was VOL.53 NO. 5 THE JOURNAL OF ANTIBIOTICS 517 discovered in Japan7), and erythromycin esterase I5), gene, and S. aureus RN4220/pEP194 which contains an erythromycin esterase II6), and MPH(2') II9) were reported ermC gene. These were gifts from Dr. J. Sutcliffe (Central from clinical isolates in France. Until now lactone-ring Research Division, Pflzer, Inc., Groton, USA). hydrolases such as erythromycin esterase, had not yet been E. coli K12W31 10n/ (rifampicin-resistant mutant), E. discovered in any other country2^. coli MLHlOnal (nalidixic acid-resistant mutant), P. In Europe, macrolide antibiotics are prescribed for the aeruginosa PAO2 142Rp (rifampicin-resistant mutant), and prevention of by Gram-negative bacteria such as S. aureus 209P20) were used as standard strains susceptible the prophylaxis of septicemia in immuno-compromised to macrolides7'8'15). E. coli MLHl0nal/R?4 and P. patients and the prevention of traveler's diarrhea. It was aeruginosa PAO2142Rp/RP421)were used as donor strains reported that about 50% of highly macrolide-resistant for the transconjugation of drug resistance. Bacillus subtilis strains recovered from patients have the ermAMgene, and ATCC6633 was used as the indicator organism for about 25%of macrolide-resistant strains have the ereA or the determination of the potency of the macrolide antibiotics7'8^. ereB genen). In Japan, large amounts of 14-membered ring macrolides such as erythromycin A, clarithromycin, and roxithromycin Chemicals are currently used for the treatment of diffuse The macrolides used were erythromycin A, panbronchiolitis, Helicobacter pylori infection and atypical roxithromycin, oleandomycin, triacetyloleandomycin, Micobacterium complex infections. For the treatment of (Sigma Chemical Co., Ltd., St. Louis, MO, diffuse panbronchiolitis, long-term chemotherapy (longer USA), leucomycin, , , , than 6 months) with erythromycin A, roxithromycin, or and (Wako Pure Chemical Co., Ltd., Osaka, Japan). clarithromycin with doses of 400~600 mg/day can improve Clarithromycin was a gift of Taisho Pharm. Co. Ltd. clinical manifestations and restore lung function in patients Azithromycin was a gift from Pflzer Pharm. Co. Ltd., and with chronic respiratory infections including P. miokamycin was donated from Meiji seika kaisha Co., Ltd. aeruginosa n' n\ Other anti-microbial agents (, carbenicillin, Such widespread usage threatened the clinical norfloxacin, kanamycin, and ) were purchased communitywith the development of macrolide-resistant from WakoPure Chemical Co., Ltd. strains of Enterobacteriaceae such as Escherichia coli, because intestinal bacteria were exposed to a significant Determination of MinimumInhibitory Concentrations concentration of macrolide over a long term. (MICs) The appearance of macrolide resistance among E. coli Minimum inhibitory concentrations (MICs) were strains recently isolated in Japan and the phenotypes and determined by the agar dilution method. Hundred-fold genotypes of macrolide highly-resistant strains were dilutions of overnight culture in Mueller-Hinton (MH) investigated in this study. broth (Difco Laboratories, Detroit, MI, USA) were inoculated on MHagar plates containing serial two-fold dilutions of macrolides. The MICs were determined after Materials and Methods incubation at 37°C for 18 hours15'22).

Bacterial Strains Detection of Macrolide-inactivating Enzyme by Five hundred clinical isolates ofE. coli were collected at Lysozyme-DNase-RNase (LDR) Assay method random from 1996 to 1997 in Japan. Three erythromycin A For the detection of macrolide-inactivating enzymes, the highly-resistant strains producing a macrolide-inactivating LDRassay method was performed as follows21>23). Washed enzymewere used as the reference strains. These were cells from 6 ml of overnight cultures were suspended in MPH (2') I-producing E. coli Tf481A7'8'14'15), MPH(2') II- 330nl of TMK buffer, 100jil of co-enzyme solution producing E. coli BM25069'10'17), and erythromycin-esterase (40mM ATP, 2mM acetyl CoA, and 40mM UDPG, or I-producing E. coli BM694/pAT635'18). E. coli BM2506 and 80mM GSH), and 50^1 of antibiotic solution (125 jlg/ml). BM694/pAT63were gifts of Dr. P. C. Courvalin (Institut To this suspension 20/il of LDR solution [lysozyme Pasteur, Paris, France). (5mg/ml), DNase (lOO^ug/ml), and RNase (lOO^ug/ml)] Three erythromycin A-resistant Gram-positive strains was added. were used as controls: S. aureus RN1389which contains an The reaction mixture was incubated at 37°C for 20 hours. ermA gene, S. aureus 01A1117 which contains an ermB During the reaction, a 20jA aliquot was periodically 518 THE JOURNAL OF ANTIBIOTICS MAY 2000 removed onto a paper disc (8 mmdiameter, thin: Toyo Filter The intensity of the signal was compared with that of the Co., Ltd., Tokyo Japan), and heated in a microwave oven 1"-H signal at 5.07ppm of L-oleandrose. The homogenated (model NE-6200, Matsushita electric industrial Co., Ltd., decoupling modeof the NMRspectrometer was used for Osaka, Japan) (2X15sec) to stop the reaction and suppression of the HOD-signal at 4.78 ppm17~19' 26). subsequently the residual activity was determined by microbioas say. Transfer of Drug Resistance Transfer of drug resistance was done by mixed Preparation of Crude Extract and Enzymatic Inactivation cultivation of donor and recipient, either in nutrient broth or of Antibiotics on a membrane filter (Type HA, 0.45 ^m, Nihon Millipore A crude extract suspended in TMK buffer (0.01M Kogyo K.K., Tokyo, Japan). For the filter mating method, MgCl2, 0.06m KC1, and 0.006m 2-mercaptoethanol in exponentially growing cultures of donor (0.4ml) and 0.1 m Tris-HCl buffer, pH 7.8) was prepared according to recipient (0.4ml) were mixed, and the mixed culture was the method of O'Hara et a/.8). The protein concentration filtered through the membranefilter28^. was measured by the method of Lowry et al.24\ with bovine After overnight culture at 37°C on nutrient agar plates serum albumin as the standard. Enzymatic inactivation by containing both 50 jug/ml of rifampicin and 200 /ag/ml of the crude extract of antibiotics was performed according to erythromycin A, colonies were counted, and the transfer the method ofO'hara et aV\ Aliquots of 50^1 of40mM frequency of drug resistance was determined. ATP, 50^1 of each antibiotic (125 ^g/ml), and 400^1 of the crude extract diluted with TMKbuffer were mixed and Detection of the Macrolide-inactivating Enzyme Gene by allowed to react at 37°C for 0, 0.5, 1, 2, 4, and 18 hours. PCR Methodology Over the course of the reaction, a 20^1 aliquot was Primers for ereA, ereB, mphA, ermA, ermB and ermC periodically removedonto a paper disc, heated to stop the were used to provide specific PCRproducts of 420, 546, reaction, and the residual activity was determined by 837, 645, 639 and 642bp respectively. The detection microbioassay. method was equivalent to that described by Sutcliffe J. et al29\ For these experiments, the ereA primers were 5'- Release ofEnzyme from E. coli Cells by Osmotic Shock AACACCCTGAACCCAAGGGACG-3 ' and 5 '-CTTCAC- The release of the enzymefrom E. coli cells by osmotic ATCCGGATTCGCTCGA-3', the ereB primers were 5'- shock was performed by the modified method8) of Neu and AGAAATGGAGGTTCATACTTACCA -3 ' and 5'-CATA- Chou25) with 250 ml of culture. Detection of /3-lactamase, a TAATCATCACCAATGGCA-3', the mphA primers were reference for the release of enzymes in the periplasmic 5'-AACTGTACGCACTTGC-3' and 5'-GGTACTCTTC- space, was performed by UV spectrometry25) with GTTACC-3'. the ermA primers were 5'-TCTAAAAA- G as the substrate. GCATGTAAAAGAA-3 ' and 5 '-CTTCGATAGTTTATTA- ATATTAGT-3', the ermB primers were 5'-GAAAAG- NMRSpectrometry of Esterase GTACTCAACCAAATA -3' and 5'-AGTAACGGTACT- The NMRspectrometric measurementof the inactivation TAAATTGTTTAC-3', the ermC primers were 5'-TCA- of macrolide antibiotics by esterase was prepared as AAACATAATATAGATAAA-3 ' and 5 ' -GCTAATATTGTT- follows: 0.1 ml of a suspension of the solution of crude TAAATCGTCAAT-3', respectively. Primers for mphBm3) enzyme (600jig of protein), 1 mg of oleandomycin and were specifically designed for this study. The mphBprimers 0.4ml of 0.1 Mphosphate buffer (pH 7.0) were mixed in a were 5 ' -GCGATAGAATTCAAGGAGAAATAATATGAC- micro centrifuge tube and incubated at 37°C for 0, 1, 2, and CGTAGTCACGACCGCCGAT-3' (first 14 bases are the 4 hours. The reaction was stopped by heating the mixture at restriction enzyme site, next 12 bases represent the 100°C for 3 minutes. The supernatant was lyophilized after binding site for cloning, and the final 24 bases are centrifugation of the reaction mixture at 9,000X#, and then from the structural gene) and 5'-GTTTTCCCAGTCA- dissolved in 0.5ml of deuterium oxide (D2O; Merck, CGACGTTGT-3'. The Takara LA PCR kit was used as Germany) in an NMRtube (5 mminternal dia.). recommended by Takara Syuzo Co., Ltd. Kyoto, Japan, The ^-NMR spectra were recorded with a high- employing 4mMMgCl2for each primer of the ereA, ereB, resolution 500MHz Fourier Transform (FT) NMR mphA, and mphBgenes and 2 mMMgCl2 for each primer of spectrometer JNM-A500a (JAOL, Tokyo, Japan). The the ermA, ermB, and ermC genes. PCRproducts were residual 13-H (at 5.34ppm) signal relating to the extent of detected and distinguished by electrophoresis on 1% hydrolysis of the lactone ring of aglycone was integrated. agarose gels in 40 mMTris acetate-2 mMEDTAbuffer. VOL.53 NO. 5 THE JOURNAL OF ANTIBIOTICS 519

Table 1. MICofmacrolide antibiotic against E. coli producing a macrolide-inactivating enzyme.

1 4-membered 1 5-membered 1 6-membered OL TAO E M CAM RXM AZM JM LM MDM RKM SPM TS

M 26 >1600 >1600 >1600 200 25 44 >1600 >1600 >1600 25 160 >1600 1600 >1600 800 377 >1600 >1600 >1600 >1600 800 499 >1600 >1600 >1600 >1600 >1600 >1600 400 1 00 400

800 200 800 560 >1600 >1600800 >1 >1600 600 800 200 800

800 >1 600 >1600 400 >1600

>1 600 400 >1 600 1 00 400 >800 >1600 >1600 50 400 800 800 >1600 100 800 1600 1 00 400 800 800 >1600 400 800 >1600

400 800 >1600 800 >1 600

Tf481Aa) >800a) >1600 800a> 400a> 8OOa> 100 400b) 200b) 800b) 200b) 400b) 800b)

BM2506 >8OOa) >1600 8OOa> 200a> 800a> 50 >400b) >800b) >1600b) >200b) >1600b) >1600b)

BM694 >8OOa> >1600 >8OOa> > 8OOa> 200a> 50 800 400 800 400 800 800 /pAT63

1.6 200b> W3110r// 200a> 400 50a> 25a> 50a) 200b> 200b> 100b) 200b) 200b)

a Fromreference 15.

bOL: oleandomycin,FromreferenceTAO:triacetyloleandomycin, EM: erythromycin A, CAM:clarithromycin, RXM:roxithromycin,9. AZM:azithromycin, JM: josamycin, LM: leucomycin, MDM:midecamycin, MOM:miokamycin, RKM:rokitamycin, SPM: spiramycin, TS : tylosin.

showed low resistance to 1 6-membered ring macrolides. Results and Discussion The inactivation of macrolide antibiotics by the eryth- romycin A highly-resistant strains was investigated by the From the 500 clinical isolates of E. coli which were LDRmethod using intact cells, LDRsolution and various recovered in Japan during 1996 and 1997, six strains co-enzymes (ATP, GTP, UDPG, NADP and GSH), upon (1.2%) were discovered on subculture to be capable of which the reaction of someantibiotic-inactivating enzymes growth on plates containing 1,600 /ig/ml of erythromycin maybe dependent as previously reported. It was found that A. three erythromycin A-resistant (MIC: >1,600/ig/ml) MICvalues of various macrolides to these erythromycin strains of E. coli, M26, M44 and Ml60, inactivated A highly-resistant isolates were determined (Table 1). oleandomycin under the test conditions, independent of co- These six strains were highly resistant to all 14-membered enzyme. These results suggested that strains M26, M44and ring macrolides. On the other hand, the resistance pattern to Ml60 had a macrolide-inactivating hydrolase, possibly an 15- and 16-membered ring macrolides was different and on esterase. as esterases function independently of any co- this basis we classified the six strains into 3 groups enzymes. consisting of strain M26, strains M44 and Ml60, and The remaining three of the six highly erythromycin A- strains M377, M499 and M560 respectively. resistant strains (M377, M499 and M560), were found to As an example of the differences, wenoted that strain inactivate macrolide in the presence of ATP. Oleandomycin, M26 was highly resistant to azithromycin and 16- inactivated oleandomycin produced by erythromycin- membered ring macrolides, whereas strains M44and Ml60 esterase I from strain BM694/pAT63, and inactivated 520 THE JOURNAL OF ANTIBIOTICS MAY 2000

Table 2. Liberation ofmacrolide-inactivating enzyme by osmotic shock method.

Strains Resistance marker c)

Donor strain M26 EM CBPC TC GM KM NFLX M44 EM C B PC TC

M160 EM CBPC TC KM NFLX

ML1410«a/ / RP4 CBPC TC KM

Recipient strain W31 l Orif

Conjugant strain W31 10rz// M26 a> EM CBPC TC RFP W3 1 1 0rz// RP4 b> CBPC TC KM RFP

Selected by erythromycin A (200 jUg/ml) and rifampicin (25 JLLg/ml). Selected by tetracycline (25 /Ig/ml) and rifampicin (25 flg/ml). EM; erythromycin A (200//g/ml), CBPC; carbenicillin (400jUg/ml), TC; tetracycline (25 JUg/ml), GM; gentamicin (25 ug/ml), KM; kanamycin (25 Ug/ml), NFLX; norfloxacin (25 ug/ml), RFP; rifampicin (25 Ug/ml).

oleandomycin from strain M26 were analyzed by !H NMR. tetracycline and carbenicillin transferred with the macrolide The 10-H signal of oleandomycin shifted from 3.41 ppm to resistant phenotype to E. coli W3110rif. Macrolide 2.07ppm, and the 13-H signal of oleandomycin shifted resistance could not be transferred to P. aeruginosa from 5.32ppm to 4.22ppm, in the NMRspectra of both PAO2142Rp. These results suggest that the gene encoding enzymatically inactivated oleandomycin samples. These for the macrolide-hydrolyzing esterase is located on a changes indicated the cleavage of the lactone ring of transferable R-plasmid in strain M26. oleandomycin. Identical changes were seen in the The substrate specificity of the macrolide-hydrolyzing inactivated oleandomycin produced by strains M44 and esterase to 12 macrolides was also determined. The relative Ml60 and these results confirmed that the inactivated rates (oleandomycin as 100) of the inactivation of oleandomycin from the three strains (M26, M44, and oleandomycin, triacetyloleandmycin, erythromycin A, Ml60) was the same as that from the erythromycin esterase clarithromycin, roxithromycin, azithromycin, josamycin, I-producing strain BM694/pAT63.The test data indicated leucomycin, midecamycin, , spiramycin, and that, for the first time, strains producing the macrolide- tylosin were 100, 100, 88, 73, 44, 15, <2, <2, <2, <2, hydrolyzing esterase enzyme had appeared in Japan. <2, and <2, respectively (Fig. 1). The transfer frequency of the co-enzymeindependent The macrolide-hydrolyzing esterase inactivated 14- and macrolide resistant phenotype was investigated by the 15-membered-ring macrolide antibiotics, but not 16- membrane filter mating method. Macrolide resistance could membered-ring macrolides. It was clear that the enzyme's only be transferred from E. coli M26to recipient strain range of activity included not only older macrolides W31 10rif, and the transconjugant obtained inactivated represented by erythromycin A, but also newer macrolides oleandomycin. Its transfer frequency was 1 X 10~4, which is such as clarithromycin, roxithromycin, and azithromycin. the same as the transferable plasmid RP4. Transfer was From these results, it was thought that the macrolide- undetectable, being <1 X 10"8, for strains M44 and M160. hydrolyzing enzyme should be termed a macrolide esterase, Strain M26 demonstrated multiple drug-resistance rather than an erythromycin esterase. including tetracycline, carbenicillin, kanamycin, gentamicin The location of the macrolide esterase in E. coli M26 and norfloxacin (Table 2). The drug resistant phenotype for cells was determined in fractions obtained by the osmotic VOL. 53 NO. 5 THE JOURNAL OF ANTIBIOTICS 521

Fig. 1. Substrate specificity ofmacrolide-inactivating enzyme.

Table 3. Resistance marker ofmacrolide-resistant £. coli isolates.

Sample Relative activity of Relative activity of macrolide esterase (%) P-lactamase (%) 1. Supernatant of whole culture a) 0 0 2. 0.85% NaCl solution 0 0 3. Sucrose-Tris-EDTA solution 0 1 0 4. Cold water b> 98 90 5. Supernatant of sonicated cells c) 2 0 6. Cell debris 0 0

Macrolide (ML)-inactivating activity was measured by determining the amount of remaining oleandomycin in a bioassay. /3-lactamase activity was measured as the inactivation of penicillin Gdetermined by the UVspectrometry method. a Extracellular enzymefraction. b Periplasmic-space enzymefraction. c Intracellular enzyme fraction

shock method (Table 3). /J-Lactamase in strain M26was periplasmic enzyme. used as a reference periplasmic enzyme. The macrolide The macrolide esterase gene was detected by PCR esterase of E. coli M26was detected in the cold-water carried out with primers of each of the erythromycin fraction (fraction 4), the same as the periplasmic /}- esterase I- and erythromycin esterase II-producing genes lactamase. Thus, it appeared that macrolide esterase was a (ereA and ereB, respectively). PCRproducts from the ereB- 522 THE JOURNAL OF ANTIBIOTICS MAY 2000

Fig. 2. PCRanalysis of erythromycin-resistant determinants. (a) PCRproducts observed using primer ereB. (b) PCRproducts observed using primer mphA. (c) PCRproducts observed using primer ermB.

Source ofDNA for each lane: lanes 2 and 10, E. coli M26, lanes 3 and ll, is. coli M44, lanes 4 and 12, E. coli M160, lane 5, E. coli Tf481A, lane 7, E. coli M377, lane 8, E. coli M499, lane 9, E. coli M560, lanes 1, 6 and 14, E. coli W3110n/, lane 13, S. aureus 01Al117, M, DNAmakers. primer were detected in strains M26, M44and Ml60, to Japan. respectively (Fig. 2), showing that these macrolide esterase PCRwas also done using probes for the detection of the genes had a strong similarity to the ereB-gcnQ. The results mphAor mphBgenes. The mphAgene was detected from supported the conclusion that, for the first time, an ereB- those three strains, M377, M499 and M560, which were co- like gene had been detected in Japane and that it had been enzyme dependent and which could inactivate macrolide recovered at a rate of 0.6% from the 500 clinical isolates only in the presence ofATP (Fig. 2). studied. In conclusion, macrolide resistant strains showed a slight In addition, an ermi?-specific PCRproduct was detected increase from 0.5%7) to 1.2% of clinical isolates over a from strain M26, but not from the others (M44, Ml60, period of about 10 years in Japan. Andwe detected the M377, M499, and M560) (Fig. 2). Our results indicated appearance of the macrolide esterase enzymein clinical that the ere gene and ermgene were present in the same isolates ofE. coli in Japan recovered in 1996 and 1997. The transferable plasmid in strain M26, and one might speculate enzymewas characterized by its ability to inactivate the that both genes mayhave been transported from Europe1!) new macrolides such as clarithromycin, roxithromycin and VOL.53 NO. 5 THE JOURNAL OF ANTIBIOTICS 523 azithromycin in the absence of co-enzyme. The ereB and Arthur, M.; A. Andremont & P. Courvalin: Distribution of erythromycin esterase and rRNA ermBgenes were detected in these strains. In addition, the methylase genes in member of the family mphAgene was detected from three strains of E. coli, Enterobacteriaceae highly resistant to erythromycin. which elaborated a co-enzyme dependent resistance. Antimicrob. Agents Ghemother. 3 1 : 404-409, 1987 Homma, H.; A. Yamanaka, S. Tanimoto, M. Tamura, Y. Chijimatsu, S. Kira & T. Izumi: Diffuse Acknowl e dgments panbronchiolitis: a disease of the transitional zone of the lung. Chest 83: 63-69, 1983 This study was supported by a grant from the Ministry Jaffe, A.; J. Francis, M. Rosenthal & A. Bush: Long- of Health and Welfare, Japan, 1998, for molecular term azithromycin may improve lung function in characterization of antibiotic resistance and development of children with cyctic fibrosis. Lancet 35 1 : 420, 1999 methods for rapid detection of drug-resistant bacteria. Noguchi, N.; A. Emura, H. Matsuyama, K. O'hara, M. We thank Mr. Peter Macklon for assistance in the Sasatsu & M. Kono: Nucleotide sequence and preparation of the manuscript. characterization of erythromycin resistance determinant that encodes macrolide 2'-phosphotransferase I in Escherichia coli. Antimicrob. Agents Chemother. 39: References 2359-2363, 1995 O'hara, K. & K. Yamamoto: Reaction of roxithromycin 1) Weisblum, B.: Inducible resistance to macrolides, and clarithromycin with macrolide-inactivating enzymes , and type B antibiotics: the from highly erythromycin-resistant Escherichia coli. resistance phenotype, its biological diversity, and Antimicrob. Agents Chemother. 40: 1036- 1038, 1996 structural elements that regulate expression-a review. J. O'hara K.: 1993. Reaction mechanism ofmacrolide 2'- Antimicrob. Chemother. 16 (Suppl. A): 63-90, 1985 phosphotransferase from Escherichia coli to the 2'- 2) Roberts, M. C; J. Sutcliffe, P. Courvalin, L. B. modifled macrolide antibiotics. Jpn. J. Antibiotics 46: Jensen, J. Rood & H. Seppala: Nomenclature for 818-825, 1993 macrolide and macrolide-lincosamide-streptogramin B Noguchi, N.; J. Katayama & K. O'hara: Cloning and resistance determinants. Antimicrob. Agents Chemother. nucleotide sequence of the mphBgene for macrolide 2'- 41: 2823-2830, 1999 phosphotransferase II in Escherichia coli. FEMSMicrob. 3) Nikaido, H.: Multidrug efflux pumps of Gram-negative Lett. 144: 197-202, 1996 bacteria, ! Bacteriol. 178: 5853-5859, 1996 O'hara, K.: Application of nuclear magnetic resonance 4) Sabath, L. D.; V Lorian, D. Gerstein, P. B. Loder & spectrometry to measure the activity of bacterial M. Finland: Enhancing effect on alkalinisation of the macrolide esterase. Microbios. 79: 231-239, 1994 mediumon the activity of erythromycin against Gram- O'hara, K.; T. Kanda, H. Matsuyama & N. Noguchi: negative bacteria. Appl. Microbiol. 16: 1288-1292, Determination of !H- or 13C-NMR spectra of 1968. oleandomycin (OL), the esterolitic cleavage compound 5) Barthelemy, P.; D. Autisser, G. Gerbaud & P. of OL and OL 2'-phosphate using two-dimensional Courvalin: Enzymatic hydrolysis of erythromycin by methods in D2O solution. Jpn. J. Antibiotics 48: Escherichia coli. A new mechanism of resistance. J. 437-440, 1995 Antibiotics 37: 1692-1696, 1984 Nakamura, A.; K. Taniguchi, K. Tsurubuchi, K. 6) Arthur, M.; D. Autissier & P. Courvalin: Analysis of O'hara & T. Sawai: Resistance to macrolide antibiotics the nucleotide sequence of the ereB encoding the found in methicillin-resistant Japanese clinical isolates erythromycin esterase type II. Nucleic Acids Research of Staphylococcus aureus in 1996. Jpn. J. Antibiotics 5 1 : 14: 4987-4999, 1986 494-500, 1998 7) O'hara, K.; T. Kanda & M. Kono: Structure of a O'hara, K.; T. Kawabe, K. Taniguchi, M. Ohnuma, M. phosphorylated derivative of oleandomycin, obtained by Nakagawa, Y. Naitou & T. Sawai: A Simple assay for reaction of oleandomycin with an extract of an determining inactivation in intact cells erythromycin-resistant strain of Escherichia coli. J. of . Microbios, 90: 177-186, Antibiotics 41: 823-827, 1988 1997 8) O'hara, K.; T. Kanda, K. Ohmiya, T. Ebisu & M. Japan Society of Chemotherapy: Method of MIC Kono: Purification and characterization of macrolide 2'- determination. Chemotherapy (Tokyo) 29: 76-79, 198 1 phosphotransferase from a strain of Escherichia coli that Taniguchi, K.; A. Nakamura, K. Tsurubuchi, K. is highly resistant to erythromycin. Antimicrob. Agents O'hara & T. Sawai: Identification of Escherichia coli Chemother. 33: 1354-1357, 1989 clinical isolates producing macrolide 2'-phosphotrans- 9) Kono, M; K. O'hara & T. Ebisu: Purification and ferase by a highly sensitive detection method. FEMS characterization of macrolide 2 '-phoshotransferase type Microb. Lett. 167: 191-195, 1998 II from a strain of Escherichia coli highly resistant to Lowry, O. H.; N. J. Rosebrough, A. L. Farr & R. J. macrolide antibiotics. FEMSMicrob. Lett. 97: 89-94, Randall: Protein measurement with the Folin phenol 1992 reagent. J. Biol. Chem. 193: 265-275, 1951 0) Taniguchi, K.; A. Nakamura, K. Tsurubuchi, A. Ishii, Neu, H. C. & J. Chou: release of surface enzymes in K. O'hara & T. Sawai: Identification of functional Enterobacteriaceae by osmotic shock. J. Bacteriol. 94: amino acid in the macrolide 2'-phosphotransferase II. 1934-1945, 1967 Antimicrob. Agents Chemother. 43: 2063-2065, 1999 O'hara, K.; S. Haruta, T. Sawai, M. Tsunoda & S. 524 THE JOURNAL OF ANTIBIOTICS MAY 2000 Iyobe: Novel metallo /3-lactamase mediated by Shigella O'hara, K.: Two different type offosfomycin resistance flexneri plasmid. FEMSMicrob. Lett. 162: 201-206, in clinical isolates of Klebsiella pneumoniae. FEMS 1998 Microb. Lett. 114: 9-6, 1993 O'hara, K.; Y. Shiomi & M. Kono: Application of Sutcliffe, X; T. Grebe, A. T. Kamradt & L. nuclear magnetic resonance spectrometry to measurethe Wondrack: Detection of erythromycin-resistant de- activity of /Mactamase inhibitor. Jpn. J. Antibiotics 36: terminants by PCR. Antimicrob. Agents Chemother. 40: 2763-2768, 1983 2562-2566, 1996