Limited Genetic Structure and Demographic Expansion of The

Limited genetic structure and demographic expansion of the Brassicogethes aeneus populations in France and in Europe Amandine Juhel, Corentin Barbu, Muriel Valantin-Morison, Bertrand Gauffre, Raphaël Leblois, Jerome Olivares, Pierre Franck

To cite this version:

Amandine Juhel, Corentin Barbu, Muriel Valantin-Morison, Bertrand Gauffre, Raphaël Leblois, et al.. Limited genetic structure and demographic expansion of the Brassicogethes aeneus populations in France and in Europe. Pest Management Science, Wiley, 2019, 75 (3), pp.667-675. 10.1002/ps.5162. hal-02619087

HAL Id: hal-02619087 https://hal.inrae.fr/hal-02619087 Submitted on 25 May 2020

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. jerome.olivare [email protected] [email protected] [email protected] [email protected] [email protected] Email co addressofall Tel Email Paris Juhel. S. Amandine Correspondance: This articleisprotected bycopyright.Allrightsreserved.

Accepted Article2

1 UR1115 etSystèmes Horticoles, Plantes culture de Amandine S

: +33 130: +33 815408 UMR Limited 3 - Brassicogethes aeneus

Saclay, 78850Thiverval : [email protected].

CBGPUMR 1062,INRA,SupAgro, IRD, CIRAD, Montpellier Univ. article as doi: 10.1002 differencesbetween version lead to this may been through the copyediting, typesetting, pagination andproofreading process, which This article hasbeen accepted for publication andundergone full peer review but has not 4

Institut de Computationnelle,Biologie Univ.Montpellier, Montpelier, France 210 G AUFFRE

Agronomie, INRA, AgroParisTech, UniversitéAgronomie, Paris INRA, AgroParisTech, s

@inra.fr

JUHEL genetic structure 2 , ,

Raphaël LEBLOISRaphaël -

Comment citer cedocument: authors:

, Corentin M , Corentin

/ps.5162

- Grignon, France.

populations Montpellier, France

BARBU Grignon, France M Arnme IR, goaiTc, Université AgroParisTech, INRA, Agronomie, UMR and demographic expansion 3 ,4 , Jerome OLIVARES 1 , Muriel VALANTIN, Muriel

and the Versionof Record. Please cite this INRA, in France and

F - 84914 Avignoncedex,France 2 - , Pierre FRANCK, Pierre Saclay, 78850 Thiverval - MORISON in Montpellier, Europ 1 , of

Bertrand Bertrand 2

the

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. at the European scale European the at the between RESULTS: Europeand in population on light size) population shed (dispersal, demography To rape. oilseed of pests significant most beetles, pollen The BACKGROUND: Abstract pollen rape, beetles Keywords: of beetle pollen prevent to enough of history demographic the of complexity from CONCLUSION: decades Europe inferences Demographic This articleisprotected bycopyright.Allrightsreserved. Accepted Article h dsrbto of distribution the , .

possibly

genetic diversity and structure and diversity genetic Brassicogethes aeneus Brassicogethes

The genetic differentiation among the population samples was low was samples population the among differentiation genetic The Estonian sampleEstonian from

population

Current population size and dispersal are not straightforward to estimate estimate to straightforward not are dispersal and size population Current orsodn to corresponding strong

433 individuals individuals in collected 433 . The genetic variability was similar among the 18 population samples. population 18 the among similar was variability genetic The Comment citer cedocument:

genetic suggest s should likelys should bethought European at the genetic genetic and

ed differentiation the rest ofEurope.the rest I , genetic diversity, genetic str genetic diversity, genetic ,

aiblt in variability n increase an a Brassicogethes aeneus Brassicogethes recent ,

the the twelve were analyzed were pest expansion

18 winter oilseed18 winter rape fields. at large geographical scales geographical large at f ise rape oilseed of microsatellite markers microsatellite s . Nevertheless, . . aeneus B. solation bydistancewas

of at different spatial scales in France in scales spatial different at . aeneus B. past

(Fabricius, 1775), is one of the of one is 1775), (Fabricius, vr Europe over ucture, microsatellites, oilseed microsatellites, ucture,

crop as n peet oln beetle pollen present and gene flow was im was flow gene continental level s area ’s

population ee devel were , the management the ,

eas of because only during but significant but

significant size oped . h last the

portant portant

over and the the Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. After aeneus ( beetle pollen The pests. characteriz to useful be could that demography present and relevant structure population pests crop on studies genetic Population middle age in Flanders and was the main source of vegetal oil until the middle of the the of middle the until oil vegetal of source Europe in century nineteenth main the was and Flanders in age middle fi was OSR populations. beetle pollen the of demography the affected fluctuated strongly has Europe in area cropped OSR struc very markers microsatellite in made popular have properties These screen. and develop to effective a microsatellite 10 polymorphic highly are markers markers genetic variable more requires structure genetic and variation genetic European popul beetle pollen between flow on based (France, in identified a In ofa scale in habitat in on buds in oviposit and pollen on feed to This articleisprotected bycopyright.Allrightsreserved. Accepted Article

4 ear summer South Eastern Europe Eastern South OSR , 1 10

ture td bsd on based study

ly summ their

compared to an average of roughly of average an to compared .

I Fbiis 17) is 1775) (Fabricius,

Consequently ntroduction flowers strategies

Belgium) Germany, and changes demographic

few kilometers. mlfe famn lnt plmrhs (FP sgetd hg lvl f gene of level high a suggested (AFLP) polymorphism length fragment amplified pollen beetle pollen in Europe in 4 emergence from overwintering areas overwintering from emergence , population between er e co re

before (June) of :

rsioehs aeneus Brassicogethes

pests a first a , t , crops and semi and crops n gn fo ocr. uh information Such occurs. flow gene and dominant iohnra DA fv pyoeei groups phylogenetic five DNA, mitochondrial

Comment citer cedocument: and seeks and seeks drop populations he eeis tde, s hy lo te netgto o sail genetic spatial of investigation the allow they as studies, genetics

(

Italy, Romania and Greece and Romania Italy,

pollen beetle pollen control ping o n o te ao pest major the of one , 12 ne in England and Wales, and England in ne

and . In France, OSR cropped area peaked up to 200 to up peaked area cropped OSR France, In .

eei markers genetic

down with for 1 ations in Sweden in ations .

8 a at smallat geographic . In addition, addition, In - overwintering fifth However, the study of contemporary processes affecting processes contemporary of study the However, natural habitats natural ,

an estimated average mutation rate of rate mutation average estimated an

thereby inflicting severe yield losses yield severe inflicting thereby on

dispersal provide the ground to pupate to ground the in the Baltic the in µ ,

= 6 x 10 x 6 = arcu, 75, omly named formally 1775), Fabricius,

genetic audn truhu te eoe n cost and genome the throughout abundant , in early in

is split in two in split is

information on the the on information s 7 sites

, but , 5 f ise rp (S) rp n Europe in crop (OSR) rape oilseed of ) , suggesting important gene flow gene important suggesting , , a , - in the recent history recent the in 8

and temporal

diversity contains information on past past on informationcontains diversity and Scandinavia and

a second a for mitochondrial DNA. In addition, In DNA. mitochondrial for outside crop the fou s confirmed genetic genetic confirmed pring e r

th the demographic history of crop crop of history demographic the 2

, adults migrate to OSR fields OSR to migrate adults , . one in North Western Europe Western North in one phases

The new generation emerges generation new The a hl dfnn spatially defining help can one in one scales

f oln beetles pollen of spatial scales at which at scales spatial , rst cropped cropped rst one , mainly Scotland, a third one third a Scotland, n

countries 3 11 , which may have have may which , . in spring and spring in . L struct roughly roughly

9 . Microsatellite . arva

kha in 1862, in kha in woodland Meligethes ure among among ure e during the during 6

also also . µ Studies s at the at s

= 5 x x 5 = were

feed one 2 .

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. which were pollen k sudden. more expansi War World colonies the from oil peanut before unless otherwiseunless specified aeneus B. aeneus meta the whereas meta their comparing level species French six the 2015 spring in site ( regions other various fields OSR Pollen to te markers. fields OSR 18 from populations OSR F beetle pollen reduced resistance treatments This articleisprotected bycopyright.Allrightsreserved.

AcceptedFig. Article ha in 1993 in ha irst . 2 2.1 st if ,

Pollen beetle were collected by beating by collected were beetle Pollen

1c). Hereafter, each Hereafter, 1c). treated we

pest might

coming

beetle adults were collected in 18 fields 18 in collected were adults beetle beetle Material andMethods this of aim The on of the the of on (99%)

the the impact ofthepesticides it Third, Third, developed

, the the , , to increased and 30% were 30% and Study sites and : at a fine spatial scale scale spatial fine a at 14

Brassicogethes

391 have . the , but several several but , using

population populations F Following the expansion the Following with the exception of exception the with down to 11 to down sampling sites sampling or example i example or temporal change in pollen beetle population effective size effective population beetle pollen in change temporal

oln beetle pollen OSR pyrethroids h i 1970 in kha

- inversely reduced pollen beetle population size population beetle pollen reduced inversely eu of femur

ag amount large with microsatellite markers microsatellite

in France ( France in cropped area cropped Comment citer cedocument: paper

OSR cropped area OSR croppedarea in size . sample

B. at at kha in 1939 in kha

pollen pollen beetle

n Finland n 12

B viridescens viridescens

viridescens

have spread throughout spread have various

from Eure from , . .aeneus ol hv be expected been have would

s to is O 460 has in the Eure department in France ( France in department Eure the in d Fig. leaginous s

field was considered as a different pollen beetle pollen different a as considered was field

on a asse uig h nwy eind microsatellite designed newly the using assessed was report likely -

h i 1982 in kha the the eeoe r developed

femur

spatial spatial 1b) and 1b) ,

s smooth. is variations in variations etcds in pesticides because of the progressive replacement of OSR oil by oil OSR of replacement progressive the of because of OSR ) sampling sites sampling .

. (spring 2016). (spring individual

sampling OSR cropped area over the last 60 years 60 last the over area cropped OSR Hereafter, Second, followed a similar trend similar a followed

analyz 18

crop in

. in cropped area cropped scales B five the B. one . viridescens viridescens . s in France raised France in s organized at organized and , es esistance aeneus

Most recent history. s

fields from fields

pollen beetle population sizes. point of each field each of point structure genetic

of n Europe in were most we

Europe

60 h i 2012 in kha 1600 from Switzerland (spring 2014) and 2014) (spring Switzerland from

the

All individuals w individuals All oln beetle pollen

only

and cross amplification on another on amplification cross and collected at location at collected

o increase to European European raise eei vrain n srcue in structure and variation genetic to

three three s sie n h meta the on spine a as

since 2000 since use

five several several sn mcoaelt markers microsatellite using d

. d from 10 from

Fig.

up but nested the the other European countries European other s a consequence of these of consequence a s

countries

s . . Collection took place took Collection . again

among might have been even been have might However, 1a), ee dniid as identified were B. insecticides 12,13 16 ere identified at the at identified ere

aeneus spatial spatial s , k

seven ha in 1973 to 70 to 1973 in ha which may have have may which w after . as

n uoe the Europe, In

12 (70% 12 oln beetle pollen since

investigated

scales OSR crops crops OSR the Second the

individuals fields in Europe in 16,17 sampling

1950 - femur and ,

: : were were from from six

15 B. of . , ,

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. Mastercycler thermocycler (Eppendorf). The tissue digestion was stopped by a final final a PCR forthe DNA template reactions. by stopped was digestion thermocycler tissue The (Eppendorf). thermocycler Mastercycler a using K proteinase 3% and (Biorad) 100 Chelex® 10% including solution µl 100 a in hours homogenizer at1500str H of µL 50 in ground extraction DNA h slce mcoaelt lc wr cmie i PR utpe, aeln ec forward each labelling p multiplex, PCR in combined were loci microsatellite selected The and at Genepop We (1996). Brookfield ( we locus, microsatellite each on studies genetic population primers forward M13 labelled We afinal72°Cfors with 72°C for extensionstepat 10min. 45 by followed s, 45 for 72°C and s, 45 for 54°C s, ThePCRwere:5minDNA conditions at95°C template. 95°Cfollowedby30cycles at for 30 M13 reverse of µM 0.4 dNTPs, each contain Buffer, volume Flexi reaction GoTaq® µl 12 a in locus microsatellite each for independently out sequence M13 labelled a with tailed was primer forward sequences GS 454 Roche rep identified using were markers microsatellite France) 255 of total (Lille, A pyrosequencing. GenoScreen by produced was al., following produced was sequences microsatellite with library DNA enriched An This articleisprotected bycopyright.Allrightsreserved.

AcceptedH Article rimer with a fluorescent dye fluorescent a with rimer O 19 etitions

2.3 2.2 and ) tested PCR amplification at these 48 microsatellite loci on loci microsatellite 48 these at amplification PCR tested - on 9 pollen beetles from three different oil seed rape fields in France. The DNA library DNA The France. in fields rape seed oil different three from beetles pollen 9 on tailed forward primer, 1 unit of unit 1 primer, forward tailed HWE

version 4.2.2 version

were selected and a primer pair was chosen for each of them using Primer3 using them of each for chosen was pair primer a and selected were D DNA extraction ee diversities gene out of the 93,675 DNA sequences obtained (0.3%). The 48 longest microsatellite longest 48 The (0.3%). obtained sequences DNA 93,675 the of out .

evelopment tp f 0 i a 9°. ial, h spraat f hs ouin a ue as used was solution this of supernatant the Finally, 98°C. at min 30 of step s

were performed in performed were 2 O 22 Comment citer cedocument: 1.5 mM MgCl mM 1.5 okes/min 30seconds. for

. using a 2 mm steel bead using a 1600 MiniG (Spex® SamplePrep) (Spex® MiniG 1600 a using bead steel mm 2 a using

tested tested of m We selected the polymorphic loci with loci polymorphic the selected We

(

2 H at their 5′ their at calculated the number of alleles of number the calculated Fr h lc ta apiid w vrfe ter aiblt for variability their verified we amplified, that loci the For . 0 icrosatellite E

primer ). additional devia

GoTaq® Flexi DNA Flexi GoTaq® etmtd h feuny f ul lee following alleles null of frequency the estimated e 96 2 in t Hardy to tions , 0.4 µM of labelled M13 forward primer, 0.04 µM of µM 0.04 primer, forward M13 labelled of µM 0.4 , , and 0.1 mg/ml Bovine Serum Albumin, 200 µM of of µM 200 Albumin, Serum Bovine mg/ml 0.1 and , - end - well format plate format well B. aeneus B.

(Table S1) (Table markers 10

Second, tissues were digested at 56°C digestedat were forSecond, tissues 14

cycles at 94°C for 30 s, 50°C for 45 s, and and s, 45 for 50°C s, 30 for 94°C at cycles

individuals from location from individuals - , either , eneg equilibrium Weinberg 21 s Polymerase (Promega) and 2 and (Promega) Polymerase . . First, pollen beetle tissues were tissues beetle pollen First, .

PCR amplifications were carried were amplifications PCR , the observed the , 6 six - FAM less than 10% than less B.

aeneus (6 -

carboxyfluorescein), y hi nme of number their by

- individuals heterozygosities FLX Titanium Titanium FLX

HE using (HWE) 1 ( 1

of null allele allele null of

Fig. Malausa et Malausa 20

ing 1X 1X ing 1). . Each .

µl of µl with

For Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. hroylr Epnof i a 0 l ecin oue otiig µ o master of µl were The PCRconditions DNAoftemplate. µl 2 and S1), 5 containing volume reaction µl 2 (QIAGEN), 10 a in (Eppendorf) thermocycler loci microsatellite selected from individuals beetle pollen 433 of total A from 1 location 565 or assignations were computed assuming admixture among the the among admixture assuming computed ‘burn were a assignations after iterations 2,000,000 of runs STRUCTURE in clustering Bayesian using assessed was sites sample all across structure genetic population t First, diversities 8 site HP richness Allelic calculated were of proportions pair locus each for equilibria linkage each For 4.1 version Biosystems).(Applied GeneMapper®, using scored POP7 were using Genotypes Analyzer Biosystems). DNA (Applied 3730xl polymer ABI an on injected was This Biosystems). (Applied HiD of μl 7.8 to added H µl 40 in diluted was product multiplex PCR Each min.for 20 72°C at step extension final a with min 1 for 72°C and s, 90 for 54°C s, 30 for 94°C at cycles This articleisprotected bycopyright.Allrightsreserved. Accepted Article - HEX 2.5. 2.4 RARE program RARE Roaie dyesclass) (Rhodamine

o 2.5.2. 2.5.1.

(

Stati n= (hexachloro sample site, deviation from deviation site, sample explore we Microsatellite analysis 16

stical analysis re comparedre

) µl of primer of µl Population geneticstructureatmultiplePopulation scales diversity Genetic

v 2 heterozygous ersion 2 ersion (

s h reference. the as to at each locus locus each at A r h nme of number the ) verify 24 in each in - , w , fluoresceine),

Comment citer cedocument: .2 hich was hich fraie ad . μ GeneScan™ μl 0.2 and formamide, i interspecific cross 25 between populationbetween

- (Table mix (primers concentration ranging from 0.13 to 2.5 to 0.13 from ranging concentration (primers mix . For each model each For .

sample site was estimated using a rarefaction method rarefaction a using estimated was site sample genotypes These loci loci These

o ec sample each for

parameterized with the smallest population smallest the with parameterized 1

) homogeneous homogeneous A

. PCR amplification amplification PCR . or Hardy llc richness llelic

TAMRA ( ee tested were ee lo etd on tested also were H O - - ) Weinberg equilibrium Weinberg

amplification. with values of values with - the and

n pro o 5000 trtos Individual iterations. 500,000 of period in’ samples

(carboxy 18 site unbiased estimate of estimate unbiased eei cutr ( clusters genetic , OSR

2 0. Two microliters of this dilution was dilution this of microliters Two 0. with

codn t Nei to according observed using was : 15 minutes at 95°C followed by 35 by followed 95°C 15at minutes : - sampl tetramethyl

G K

Mann

ENEPOP

carried out with a Mastercycler Mastercycler a with out carried nine nine from 1 to 20 to 1 from e heterozygosities

- sites

K - (HWE) B. 0 LZ Sz standard Size LIZ® 600 Whitney

K - rus n non and groups viride

rhodamine), ) within our dataset, dataset, our within )

were genotyped at the the at genotyped were gene diversities gene 23 version version

for each locus and locus each for , we performed 10 10 performed we , using s - Wilcoxon cens cens sample 0 4.2.2 ad gene and , G

individuals µM, Table µM, , using the using , ENEPOP or or 22

size - ATTO t .

equal est

- ( mix The H s E at .

) .

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. using using Second, which the STRUCTUREHARVESTER the ( clusters ofnumber server web CLUMPAK the on pipeline standard the using summarized w individuals sampled the of locations the of contribution siae ad 5 cniec intervals confidence 95% and estimates (GSM) model mutation stepwise size population in variation past continuous framework likelihood maximum the in implemented Population two tailed all for and France from samples pooled for Eure, from samples between Difference mutations B markers H changes mutation at G parent distan by isolation neighborhood genetic iv) sites sample test site estimates This articleisprotected bycopyright.Allrightsreserved. Accepted Article OTTLENECK eq ( diversity ene

) the the s ∆ , we have estimated have we , 30 ( 00 p 1000 K . - G offspring dispersal distance

six 2.5.3. We also tested the groups found groups the tested also We , 33 method g ENEPOP

, enotypic differentiation between differentiation enotypic of

membership

Wilcoxon’s signed

the the Eure I n order to test if there has been a been has there if test to order n - 50

demographic history was further explored using using explored further was history demographic ermutations) drift drift excluding

F multiple % ST Past demographicPast changes stepwise (SMM) (SMM) stepwise H

28 sample sites sample

eso 1.2 version /(1 /(1 E

equilibrium ce ) at a locus a at ) the finds that K n i and K 32

H – sources to the admixture. As recommended by recommended As admixture. the to sources ) was explored using the estimated logarithm of likelihood (LnP(D)) and (LnP(D)) estimatedlogarithmthe likelihood of using explored ) was , where , MIGRAINE

E coefficients the Comment citer cedocument: size F

ST and solation H t different at - Estonia ) tp uain ad vrac aog utpe step multiple among variance a and mutations step eq

33 the against - ( using t using H

rank rank test Fig. version version D σ² . within within for the same number of alleles alleles of number same the for eq U

is the effective density of adults, and adults, of density effective the is -

point of greatest change in the distribution of LnP(D) with LnP(D) of distribution the in change greatest of point 31 by dr t nder

34 . w n sample n

1) dpe fr irstlie loci microsatellite for adapted Q ,

Th . as - software n the and wo .

itne (IBD) distance a a

was thehighest 0.6.92

. T spatial spatial

population can population tested tested composite composite

he inverse of the of inverse he e TPM he

contrasted oaih of logarithm e with STRUCTURE. with

9% CI) (95% population

OnePopVarSize site 29 used

wih ss olset iuain udr a under simulations coalescent uses which , recent . scales for each each for

Each i Each two , for

, iii)

s prior as H

parameter -

models of mutation of models a p phase eq the the

25 opulation expansion in Europe in expansion opulation using using ndividual for

sample a analysed was ige population single egahcl distance geographical . differ was

13 apig site sampling

IBD p o five to up

sample sites sites sample

in i) optd us computed (TPM) from s model

IBD was tested using tested was IBD all all that describes the the describes that was calculated was h simulations. the slope slope was assigned to the cluster for for cluster the to assigned was the the the the the ( the gene diversity expected diversity gene the .

MIGRAINE samples pooled samples Wang

eq was used to used was uain model mutation nes aaees f a of parameters infers y ersig pairwise regressing by parameters:

OnePopVarSize 18 ) σ² separately

located in France in located for the microsatellite the for u t demographic to due

ing using a generalized generalized a using is ape sites sample 27 26

. , the geographical the , the the

50 h ms likely most The

between ( F

single % mean eut were Results ST

fr pooled for , estimate the estimate infer ) tegh of strength pGSM

and tested and

s (i.e. (i.e. using using a

squared

s , p s Mantel Mantel sample f 12 of

mod ii) the , - H with

step oint and the E 1

el < 7 .

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. parameter range explore range parameter large the when significant sizes population ancestral and parameter change size population the of duration generation per rate fo state ancestral the to added or removed repeats of number the describing distribution geometric the of parameter ie markers nine allele ( heterozygotes the t remainingtwelveloci, these At EGYLO C5QWM, proportion ERC7C1 populations ( a on amplification for selected 48 the 255 which among sequences 93,675 GS 454 Roche using produced library DNA The t runs. 2 points, PACanc the size This articleisprotected bycopyright.Allrightsreserved. o convert Accepted1 Figure Article 0 , 000 trees, trees, 000 3.1 3 ee iest ( diversity gene with

W range did not exceed not did

marker Result 5 ) e used a mutation rate of 5 of rate mutation a used e . ) , ). Among these these Among ). . 00 ,

a dataset a Ma s scaled Second, w Second, s for all for s Design and s N

. 0 of null alleles alleles null of ratio algorithm to estimate likelihood estimate to algorithm

- and is, w First, successful s re, and trees, 94, Ma D904J, H

s , is inferred is , designed, O

parameter estimates 3 )

parametervalue - pool ranged from 0.18 to 0.87 (mean = 0.60) (Table (Table 0.60) = (mean 0.87 to 0.18 from ranged 5 r each mutation each r and

e discarded e 0.09 (mean = 0.03). = (mean 0.09 H N iterations with narrow parameter ranges deduced from the preliminary the from deduced ranges parameter narrow with iterations discarded e Comment citer cedocument: ratio E ing all ing d y c ly

) election of microsatellite markers 2

locus 5 between different iterations different between - 3 2

CT, Ma DCGTK, agd rm .7 o .5 ma = .3 and 0.63) = (mean 0.85 to 0.17 from ranged

5 cniec interval confidence 95% 3 trtos Next, iterations. loci ross to better characterize better to over

amplified on the the on amplified

; the genotyped individuals from the 13 French sites French 13 the from individuals genotyped the

, - henumberalleles of

2 ( reference amplifi twelve

N nine N

0 % 10 × ratio

anc since since two ;

10 were available to design microsatellite markers microsatellite design to available were 2 into biological into µ .= additional N , −4

- ed were finally were

µ JJ, Ma EJCJJ, h sae acsrl ouain size population ancestral scaled the

loci that were monomorphic monomorphic were that loci N MIGRAINE cld y uain rate mutation by scaled in the reference reference the in per locus per generation for all microsatellite loci microsatellite all for generation per locus per

Among apig site sampling / the current population size population current the in N ia runs final

anc . . viridescens B. P six ). reliminary runs were runs reliminary

loci the at hne i pplto sz ae thus are size population in changes Past

these twelve these - pollen beetle individuals tested and were and tested individuals beetle pollen L Ttnu pyrosequencing Titanium FLX -

reliable

used LE, Ma EL5EB, ranged fromranged

. os o icue one include not does

that were that strength We inferred We can automatically expand automatically can

of 24 individuals individuals 24 of to study the genetic genetic the study to e performed re apig site sampling , ones (i.e. ones (i.e.

f hc s which of of the the of

not at not B. aeneus B. - 21, Ma C2D1M, three three .

1 past n additional An ). The proportions of null null of proportions The ). change between current between change

N performed HWE scaled by scaled to changes in population in changes , vn ee observed were even N

us nine nine

( anc microsatellite loci microsatellite Ma ( . Ma ing from

and We fixed fixed We , and of ; - -

(mean = 6.00), (mean= MX, Ma DMBX2,

- rprin of proportion JO, Ma DJDOQ, 6A, Ma C6CAE,

and 6 or reduce or

pollen beetle pollen the mutation the , that showed that using 2 using 0 oain 1 location

0 points, 00 composite

and using and g D provided ) . . g Out of Out µ

initial , ,

the the the 0

10 0 1 - - - ,

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. sites Multi Ma 6.5 18 loci. microsatellite from individuals 433 total, In in but not polymorphic populations populations populationand Estonian samples0.0218( was ( one in France from individuals all test exact Fischer’s sites the with comparison in zero a results, ( differentiation genetic significant pairwise 153 the of Out cluster cluster third cluster second had membership method The A polymorphism in difference No 5. to 4.4 from ranged 0.62 of value mean a with and loci all across This articleisprotected bycopyright.Allrightsreserved.

p Acceptedi.e. Article r

= ( . - p 3.3. 3.2.

DCH30 Q

. samplesfrom The only significant linkage disequilibrium linkage significant only The 0.001)

(

ot iey au of value likely most > n oe te French the over and - p Observed heterozygosities ( heterozygosities Observed >0.5 locus tests

(Fig. 2 0.05). <

or on LnP( on or Genetic Genetic variability inpollen beetle ll 0.001 B. aeneus

rsetvl wt or with respectively , pairwise pairwise in th in

but , in one in one

coefficients

( ) Table S2). Table

. (

) is all with all , suggesting , structure at multiple scales did not

first cluster). first four Estonia, Estonia, , K sampling site The number of alleles per per alleles of number The sampling sites sampling

F ( p ) Ma 9

ST = was three was

niiul from individuals Comment citer cedocument: with a mean value of 5.2 of value mean a with

F 0.79 and 0.79 values values Q

- other genotyped other reveal Q Furthermore, C4QRG, Ma ST >0.5)

Pol

in each cluster each in K apig sites sampling across all loci and loci all across values calculated betweencalculated values that

from the the from and All any including the Estonian the including .

( was ( None of None pollen beetle from beetle pollen Table S Table p ( 5 location .

H p or

24 Similarly, = significant departuresignificant from HWE in

O without without

< 0.05 <

) ranged from 0.54 to 0.6 to 0.54 from ranged ) detected between the 18 the between detected 0 Swed - individuals .18). D3QFM, Ma four of these loci had alleles observed in observed alleles had loci these of four OSR apig sites sampling TUTR analysis STRUCTURE wteln hd hi highest their had Switzerland 3 sampling sites sampling , was the highest in the first cluster first the in highest the was , the

). ) en, did ) , all including at least one easternmost sample site sample easternmost one least at including all , G

For 404 For deemed to discard ofthem insufficient one

ils n uoe ee eoye a te 12 the at genotyped were Europe in fields

the lobal lobal

433 individuals 433 gene diversities gene populations sampling site sampling Table S4 Table sampling site sampling not

was across all loci and loci all across Estonia from Estonia from F - infcnl dfe fo 0 (respectively 0 from differ significantly Estonia might be an outlier an be might Estonia

DDEYS, Ma ST out of the 433 the of out ) observed

sample sample over over ). a 0.0 was .

Consistentlywith n G p

lobal < 0.001 the apig site sampling and per per and s . The mean allelic richness ( richness allelic mean The .

sites had a had sampling sites sampling ( site

H 7, with a mean value of 0.60 0.60 of value mean a with 7, had European countries ( countries European between loci between 082

- E DQM5T F based on the the on based

) ranged from 0.57 to 0.64 to 0.57 from ranged ) ST differ significantly only 31 were 31 only

) the highest the

individuals . Q v Q sampling site sampling locus

( over the Eure the over p any of any

Q alue alue 0.001) < )

. . ra

au i th in value

the the F nged from 4.8 to to 4.8 from nged

above ( using the Ma ST 343

, STRUCTURE Q

B. viridescens B.

∆ sampling site sampling estimated the

associated to associated

- ewe all between 18 K value value s

EL7YR individuals

r 0.004 or

H (Table 2). (Table 0.5 sampling sampling method grouping E ed is , H ,

. in

in the the in

from from third

and and the A

or 28 r 1 ) ,

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. rest of Europe. of rest revealed analysis STRUCTURE as dataset + considered 0.0014 significant (Fig. distance geographical and differentiation genetic M single step, do single and thus aSMM.not fit be to 1, [5.4 10 x 5 of 41.2 and 2 expansion population recent MIGRAINE sites French 13 the in changes demographic a on pastperformed was analysis MIGRAINE of history the on light shed To gene diversity overall. and France Eure, from sites sampling pooled the for SMM TPM the for significant not with comparison expansions. demographical of signals with with agreement equilibrium drift mutation at alleles of diversities gene Each pooled Estonian the excluding dataset European the This articleisprotected bycopyright.Allrightsreserved. Accepted Article , 357 715 ne’ test antel’s 0.0012* 3.4 - ] N 1

). , ] 3 apig sites sampling , ratio 500 0.375 ) was larger than larger was ) 740] . * ;

ln(km F g

- ST ]) µ confidence interval interval confidence ln(km 4 Past demographic changes )

(

wih ugs ta mtto o toe markers those on mutation that suggest which , 10

was estimated to estimated was hn xldn te Estonian the excluding when F and 2 and /(1 − /(1 analysis hl cret n acsrl ouain ie were sizes population ancestral and current while , ST

), H for

population expansion was estimated to begin 40 begin to estimated was expansion population

The estimate of estimate The

/(1 ( E ), p H

in comparison with in comparison , F

930 E = slto b distance by isolation

eq − ST ) p

0.01

were ) = ) w was significant in significant was F = 0.23 = were among

( ST as

Comment citer cedocument: 95% CI: 95% the scaled the ) = ) ) -

lower than the gene diversities gene the than lower bt o we ol the only when not but , 0.0125+ analyzed separately analyzed consistent

. -

respectively 0.0 0.0030 Tbe 2). (Table excluded one, despite being despite one, excluded hc n gntc structure genetic no which The scaled current population size size population current scaled The 2 (95% CI: [0.003 CI: (95% 2 genetic neighborhood size size neighborhood genetic [607

ancestral 0.0029

H - with those with

20, 0.0008* eq

nine h dfct f ee iest ws infcn under significant was diversity gene of deficit The

) was detected with was detected 630] eeld infcn pstv creain between correlations positive significant revealed * .

dataset that the Estonian sample site was isolated from the the from isolated was site sample Estonian the that ln(km) Neighborhood size Neighborhood

population size population

out of the 1 the of out apig sites sampling )

, respectively. , ln(km ape site sample ih BOTTLENECK with both from

;

pool

when p 0.44]). French French

= ), P ad SMM and TPM

ing all the genotyped individuals from individuals genotyped the all ing BOTTLENECK 0.001 p

h dfct f ee diversity gene of deficit The 8

( all

= 0. = H relatively large ( large relatively Based on a on Based sampling sites sampling

was D the TPM the eq or the the or ( and )

apig sites sampling ) . σ² 20 Note that that Note are are N

( Isolation by distance was distance by Isolation expected for the same number same the for expected was not calculated on the full the on calculated not was F

anc

was detected. ST 100 and generations ago (95% CI (95% ago generations fe multistep often µ (

2 . aeneus B. Eure : 7

/(1 N

No significant excess of excess significant No 2.7 I ay case, any In . , model. 57 F 970 n average n for all France samples samples France all for µ ST

− analys pGSM , 95% CI 95% , individual

uain models mutation apig sites sampling 15.9

/(1 F with ( 5. upt from Outputs ST

5 CI: 95%

− were 9 = )

9% CI 95% , , 95% CI 95% , es

F ouain, a populations, SMM was estimated estimated was

mutation rate rate mutation ST supporting a supporting : [1.7 :

) = ) rather than than rather s - considered

.08 + 0.0058

the mean mean the based on based

but was but - [2, 0.0040 - : : 632]

were [4.7 [1.2 370 E also

the the

in in ), = - - -

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. irstlie oi selected loci microsatellite low of proportion library DNA enriched an from Europe. and France in we markers genetic which W lot on lot glaciations last aeneus three increased to due structure genetic sit sample cline IBD non detect may algorithm STRUCTURE with agreement significant samplewere Estonian the including Europe of rest the from samples area. study our of Overall, t B. the studies genetic population in in loci microsatellite selected twelve the of or species coleopteran This articleisprotected bycopyright.Allrightsreserved.

Acceptedhe Article e have e have B. viridescensB. the invasive western corn rootworm corn western invasive the viridescen se ir 4.1. 4

n oprsn with comparison in

polymorphism and neutra and polymorphism

cluster two

population demography because of recurrent adaptive recurrent of because demography population

o uh marker such no Discussion populations that that populations

Lack of population genetic structure the the developed aset of developed sympatric sympatric 42 ih atr longitude eastern with e .

s with STRUCTURE with s B n ID was IBD and s The microsatellite .

43,44 that were that aeneus

n u dtst was dataset our in little genetic differentiation genetic little , another , . TUTR plot STRUCTURE T

Although, genotyped he such as such species

These genetic structure genetic STRUCTURE analys STRUCTURE Comment citer cedocument: s IBD as IBD

had

absent in absent h nme o mres des markers of number the closely related closely were -

existent clusters when geographical sampling is clumped along an along clumped is sampling geographical when clusters existent

in loci twelve significant

in OSRthe crops the ground beetle ground the differentiated in differentiated o pplto gntc study genetic population for 12 microsatellite loci microsatellite 12

other

in general, in lity is necessary is lity

433

ancestry proportion of proportion ancestry previously selected to selected sn a using

n uti, Poland, Austria, in may may

microsatellite markers B. Ge . aeneus B. Brassicogethes three s aeneus

Diabrotica virgifera virgifera virgifera Diabrotica also also

t h Erpa scale European the at

based on microsatellites markers microsatellites on based was netic differentiation between all all between differentiation netic high OSR pestOSR the mitochondrial polymorphism mitochondrial the

. study available 41 B. aeneus B. correspond to correspond It is , - 40

. thus

different hogpt 5 prsqecn approach. pyrosequencing 454 throughput

individuals s

which which

The . 39

but

a be sgetd that suggested been has clearly Carabus nemoralis Carabus

B. aeneus B.

In 38

consistent F were selected among 48 markers 48 among selected were number of genetic clusters estimated clusters genetic of number

ST addition, four loci had alleles detected in detected alleles had loci four addition, species These loci These might be used be might igne Sweden Using this set of highly polymorphic polymorphic highly of set this Using

individuals assigned to assigned individuals amplified and amplified values support refuges in southern Europe southern in refuges

collected in 18 different OSR fields OSR different 18 in collected for d post glacial admixtures between admixtures glacial post , population t ,

ih h sm mto in method same the with

but evolution B. were with

og adtoa eauto of evaluation additional hough

ed n Estonia and w

are aeneus

iia t te rprin of proportion the to similar hen excluding the Estonian Estonian the excluding hen an isolation of the Estonian the of isolation an 35 always lower than lower always n vrsiain of overestimation an likely

37 to differentiate larvae of larvae differentiate to

seven and

. 45 genetic pestfor, acoleopteran Interest ,

was it is very suitable to suitable very is it good candidates for for candidates good Poecillus the . were polymorphic were

does not inform a inform not does populations h dtcin of detection The

the low at the scale the at low s ingly, nine ingly, STRUCTURE was relatively relatively was

third cluster cluster third

during the during cupreus designed designed

0.05, other other pairs with The

out the B. in 36

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. sd notably used, structure genetic population markers. AFLP using populations European loci Europe in Scandinavia, and Baltic the in populations Europe mitochondrial recombination of absence of because structure population reveal population population limited have might pesticides history. result and size population current high very encompass folds 6 about computed BOTTLENECK of expansion demographic the with age middle the since drastically more increas be to likely (figures surfaces cultivated (1 scale time evolutionary the on recent oviposition their variation Europe across European g structure, genetic of lack the with Consistent with the lack structu ofpopulation genetic ( Eure department significant not and low was differentiation genetic populat analyzed the of distributions geographical This articleisprotected bycopyright.Allrightsreserved. Accepted Article 4.2.

n hs study this in

from of e , which roughly overlaps with the genetic structure we observed with the microsatellitethe with observed we structure genetic the with overlaps roughly which , continent an

B. aeneus s o eape bfr isciie resistance insecticide before example, For

with MIGRAINE with sampl n S copd surface cropped OSR in

genetic structuration genetic B. ucsie exp successive in 46

aeneus N sequences DNA eas of because .

2 ing the last 40 years 40 last the Temporal n MIGRAINE and . .

T F demographic changes in recent history went up went

Kazachkova he OSR cultivated surfaces are in the 2010’s at an at 2010’s the in are surfaces cultivated OSR he ST . sites

generaliz

popula = neetnl, hy lo eiie tre rus of groups three delimited also they Interestingly, Comment citer cedocument:

.0) n among and 0.001)

suggesting

variations of the of variations

. aeneus B. nin n cnrcin of contraction and ansion h dmnne f FP markers AFLP of dominance the

support 4, 145, or 8 folds in respectively 40, 80 or 80 40, respectively in folds 8 or 145, 4, tion r lkl to likely are able 47

the . However, we should take into consideration large CI’s that that CI’s large consideration into take should we However, . (2008) (COI) . Nevertheless, . o ol with only not

analys s ed a ed t h Erpa scale) European the at

xaso of expansion n Europe in common a

population 8

rm ubr of number from ,

limited 000 year 000 e on a ee srne gntc tutr between structure genetic stronger even an found re s mainly

effective observed the the on estimates Point w enetic diversity was similar across the different the across similar was diversity enetic D apparition estern and central Europe and Europe central and estern

as ifferences expansion of expansion

rnh ape ( samples French h lt ices o OR surfaces OSR of increase late the Kazachkova et al. et Kazachkova

s eorpi histor demographic

a cnimd y h rsls of results the by confirmed was

pollen beetle beetle pollen oln ete ne oilseed need beetles pollen orsod o differences to correspond uh older much or generations of pollen beetle pollen of generations or o samples ion

population in Sweden

among eae ieped n h 2000s the in widespread became . aeneus B. of oln ete cletd vr the over collected beetles pollen ewe suis n h degree the in studies between

. O

It f h demographic the of SR crops SR the pollen beetle population beetle pollen the the samples from the French French the from samples the

start was

, . s with

43 ize population At a smaller spatial scale, scale, spatial smaller a At and F . 7 recent the in population

Ouvrard et al. et Ouvrard did not found any effect any found not did reasonable f xaso that expansion of were expected were y the

14 o ifrne in differences to all f h ple beetles pollen the of

. 0.003) 150 years 150 AFLP Th - time s e

, in

hypothesis in

and 7 oln beetle pollen

ae us for buds rape n agreement in south . high. o expect to

the markers markers the

parameters s 6

), and the the and ),

in France in increased given the given analy u even but oh the both - OSR eastern eastern

might might of a of s z

the the

an ed 16 of of of is is ,

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. corresponds to having mor having to corresponds beetles seem may 850 individual 1,357,500 and 2,370 between MI of larger population on pesticides of demographic markers study case interdictions insecticide resistance management ecologica to European the at population the of unity the given War World Second the since Europe in area cropping OSR the of expansion population scale. continental European France beetle pollen of structure genetic measuring for high The overkilometers several dispersal oftheadults individual compar individ 100 to 50 between ranged patterns distance by isolation between individuals beetle pollen may density pollen the of France for size population This articleisprotected bycopyright.Allrightsreserved. Accepted Article G 5 individuals individuals AN estimate RAINE

. ison Conclusion

eotd n h ltrtr, hc ae bu 25 dl idvdas e plant per individuals adult 2.5 about are which literature, the in reported Pollen beetle population were mainly structured by isolation by distance at the the at distance by isolation by structured mainly were population beetle Pollen availability of OSR resource S co pouto regions. production crop OSR s challenging is variability s s is s , which , high, but high, , size

hw how shows including l studies, l s with

fluctuations

still still of due to insecticide to due per kha of OSR crop OSR of kha per . aeneus B. egbrod size neighborhood oln ete population beetle pollen extremely small given the number of individuals per field and the known the and field per individuals of number the given small extremely likely co likely remain observed in the 12 developed microsatellite loci indicates they are they indicates loci microsatellite developed 12 the in observed s some gene flow flow gene some area

Comment citer cedocument: of the current current the of atrs in patterns , should be considered at considered be should , infer

in - and for 48 e adults in an OSR field than the maximum genetic estimate of the the of estimate genetic maximum the than field OSR an in adults e wide extremely population

rrespond by induced be – the the 50 ouain structure population e lo on te intr of signature the found also We ring . drastic changes changes drastic insect insect

recent past Such discrepancies between genetic and ecological estimates ecological and genetic between discrepancies Such management

uses current current . aeneus B.

s s

to the the to 13

low in comparison with comparison in low . i Erp and Europe in s pest likely occurs at occurs likely was no greater than increase increase than greater no was . aeneus B.

. Thes .

eotd n insect in reported s in France, which correspond to approximately 1.5 to 1.5 approximately to correspond which France, in s demograph s .

ue variance huge i OR fields OSR in s OSR ntc egbrod size neighborhood enetic because of their their of because

of e genetic estimates of the pollen beetle density beetle pollen the of estimates genetic e populations . f oln ete este bten er and years between densities beetle pollen of

B. aeneus B. , the European the effective apparition scale hc cn e nesod f euto in reduction if understood be can which cl characteristics ical

the continental scale, implying that the that implying scale, continental the

and the important dispersal according dispersal important the and h asne of absence the s . habitats

taxa ouain size population of We in

n xaso of expansion an the the reproducti 30 and continental scale continental the middle age middle the ue popu huge ofre the confirmed However, . uals ecological density of pollen of density ecological , OSR in crop rotation, crop in OSR , in population size because because size population in vlto of evolution

and were and s

estimated ae on based genetic genetic e success ve n France in ain ie and sizes lation

this number of of number this .

the the and the rapid the and weak . In any cases, cases, any In quite high quite Finally, tutr in structure insecticide . aeneus B. molecular ae on based

between genetic genetic

ranged ranged which useful

this and in

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. Terre Inovia who sent us samples. us sent who Inovia Terre Heimback, European and research project the in interest their for farmers participating the thank to like would grant and ( the to grateful are We Acknowledgments 8 7 6 5 4 3 2 1 References Bioinformatics Montpellier the and Biodiversity (MBB) HPC platform services. CBGP the as well as platforms, HPC bioinformatics INRA the This articleisprotected bycopyright.Allrightsreserved.

Accepted Article BASC, LabEx

o PF, to

a spotd y h PEERLESS the by supported was analysis, Euranalysis, JEntomol Meligethes aeneus J, Kazachkova N,Meijer diversityand EkbomB,Genetic in European pollen beetle, For Entomol aeneus J, Kazachkova N,Meijer diversand EkbomB,Genetic Genome (Nitidulidae: Meligethinae),andthe ofpopulation structure taxonomicMolecular ofplantassociations of pollenbeetles analysis the adult Ouvrard DM,MoulandM, P,Hicks Nicholls KCR, JA, Baldock Goddard EntomolActa Bohemoslovic studies onflightsofdispersal Taimr L,SedivyJ,B behaviour thepollenbeetle of AL, Mauchline PowellCook JW,SM, W,Chapman andOsborneJL,Migratory flight of pestsseed increase yield, Evol Ecol Gagic V, B,MalsherRiggi LG,R, G,RuschA,andBommarco Ekbom Netherlands,(2010).Springer Dordrecht Williams IH,ed.,Biocontrol pollen beetle, InsectMolBiol reference toinsecticideand Next action resistance: ofEuropeanpollenbeetle with transcriptome populations analysis, andits special CT,MaiwaldF,SchornC,BassZimmer C,Ott M ers MIGALE (http://migale.jouy.inra.fr) and GENOTOUL and (http://migale.jouy.inra.fr) MIGALE

A. Pollier, Pollier, A. B MM J ad AJ and JO MVM, CB, I A (I. ) inSweden: role ofspatial,temporalandinsecticide resistance factors, Agric

ANR 59 hman, R. Bomarco, M. Brandes, A. Gardarin, G. Grabenweger, U. U. Grabenweger, G. Gardarin, A. Brandes, M. Bomarco, R. hman, :1101 9 - :259 11 N. Schuler, G. Seimandi G. Schuler, N. Comment citer cedocument: ‘ – - gne ainl d l Recherche la de Nationale Agence

LABX 1116 1116 (2016). –

ergmannova I, E,andHanker experienceobtained Further in (Co 269 (2007). leoptera: Nitidulidae), populations usingAFLP assessed 105 - 0034 :807 - Part of this work was carried out by using the resources of resources the using by out carried was work this of Part Based Integrated ManagementBased ofOilseed RapePests,

64 ( Meligethes aeneus Meligethes 23 project project ) Meligethes aeneusMeligethes :325

, to RL to , – :511 814 (2008).

rjc ad the and project –

– 332 (1967). 526 (2014). 6 PEERLESS,

:2149 (

project GENOSPACE project - Corda, E. Veromann, and P. Wegorek) P. and Veromann, E. Corda,

– 2157 (2016). 2157 - C, andNauen R, A

F., marked F., marked with P23 (coleoptera),

, Pest (2017). ManagSci NA meta INRA - ANR generation ity inpollenbeetles ’

for - 12

(Toulouse it - Brassicogethes aeneus Brassicogethes AGRO iaca spot to support financial - ,

rga SMaCH program

sequencing of sequencing the ANR

de novode Interactive effects - 0006) , MA, - 16 idi - (Meligethes (Meligethes CE02

et al. . - AJ’s phD phD AJ’s yre e s yree , - 0008 We .

and CB , ) Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. 14 13 12 11 10 9 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 This articleisprotected bycopyright.Allrightsreserved. Accepted Article

Brassicas, EntomolBrassicas, Appl Exp HM,Hokkanen Themakingof apest:recruitment of http://agreste.agriculture.gouv.fr/IMG/pdf/AGRIFRA07c familiales droits unique., aux àpaiement AgricNouv Defis,200 M,L’agricultureDesrier depuis française petitesexploitations cinquanteans :des recherche agronomique, Paris (2006). Doré C,Histoire et “landscape” inlandscapegenetics, Heredity A,MurphyStorfer MA,Evans CS,Robinson SF, JS, Goldberg S,Spear Press Oxf (1999). Goldsteinand Schlotterer D phylogeography, MolEcol Wang IJ, genetics Recognizing landscape thetemporaldistinctionsbetween and Resour Resour visualizing STRUCTURE output theEvannomethod,ConservGenet and implementing DAand Earl vonHoldt STRUCTURE HARVESTER:awebsite BM, andprogramfor struc using the software the of Evanno G,Detecting of S,andGoudet number clusters Regnaut individuals J, acrossinferences modes populationprogram foridentifyingclustering andpackaging structure J,Kopelman NM,Mayzel I, Jakobsson NA, andMayrose M,Rosenberg to easy use buteasier misuse, MolResour(2016).Ecol Wang J,The programStructure forassigning computer individuals to populations: multilocu Pritchard JK, M,andDonnellyP,InferenceStephens of population using structure of richness,measures allelic Mol NotesEcol Kalinowski ST, hp of number individuals, Genetics heterozygosityNei M,Estimationof average distance andgenetic from a small Linux,MolEcolResour Windows and Rousset F,genepop’007:acompletere Biotechnol Schuelke forthefluorescentlabeling M,Aneconomic method of Nat PCRfragments, Programmers, Bioinforma Methods Protoc:365 H, Primer3onRozen SandSkaletsky theWWWfor General Users Biological andfor enriched DNAlibraries,Mol Resour Ecol throughput microsatellite isolation through 454GS Malausa T,GillesA, MegléCz E,BlanquartH,Duthoy S,Costedoat C, Audisio P, Nitidulidae Coleoptera : 69 Pyrethroid Germany: Heimbach UandMüllerA,Incidence of pyrethroid ( Danish oilseed rape LM,Insecticide Hansen 49 F. aeneus Węgorek P,Mrówczyoski M,andZamojskaJ,Resistanceofpo :209 :119 – – 4 216 (2013). 128 (2009). :359 s genotypedata, Genetics activeof) toselected substances insecticides inPoland, JPlantProt Res 18 – :233 361 (2012). Comment citer cedocument:

- K rare 1.0: a computer programfor 1.0:acomputer rare performingrarefaction on – amélioration plantes de cinquante cultivées, Institutdela national , Mol Ecol Resour Ecol , Mol 234 (2

Brassica napus L - resistant pests oilseed rape Pest inGermany, ManagSci - resistant pollenbeetles( ture: asimulationture: study, MolEcol 000).

C, Microsatellites: evolution applications, Oxf Univ and 95 :2605

:141 89 - – :145 K – 155 2608 (2010). ateretidae, Bologna Calderini (1993). 149 (2000). 15 ) fields, 8

:103 - – :1179 :945 implementation software of genepop for the 163 (1978). 11 :638 – – 5 106 (2008). 98

Pest ManagSci – 959 (2000). :187 1191 (2015). :128 – –

386 (1999). Meligethes Meligethes aeneus

644 ( – - - 189 (2005). resistant oilseedresistant rape in pests – FLX Titanium pyrosequencing ofFLX Titaniumpyrosequencing

142 (2007). Meligethes aeneus Meligethes 2011).

2.pdf. 14

:2611 59 llen beetle llen beetle (

:1057

– 2620 2620 (2005). F) foundF) in et al. et al. – C 1059 (2003).

LUMPAK onto oilseed , Putting the , High Meligethes : a -

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. 35 34 33 32 31 30 46 45 44 43 42 41 40 39 38 37 36 This articleisprotected bycopyright.Allrightsreserved. Accepted Article

Brouat C,Mondor Biol Evol ofLikelihood Inference Population Contractions Mol fromMicrosatelliteData, Size Leblois R,Pudlo F, Beeravolu J,Bertaux P, Reddy R, Néron C, Vitalis (1996) recent frequency populationbottlenecks fromallele data,Genetics JMandLuikartG,DescriptionofCornuet analysis andpower two testsfordetecting Mol Ecol Guillot G, LebloisA, and R, Coulon (1946). underWright S,Isolationdiversesystems ofby distance mating,Genetics Genetics isolationdistance, by Rousset F,Genetic Biol R, ofFrankham Relationship va genetic Science Animals, PopulationBazin E, Mitochondrial Does DiversitySize NotInfluence Genetic in Rhopalocera determination ofstructure faunal Dennis RLH, Williams WR, approach TG, andShreeve Amultivariate tothe 9 fromhoneybees Italy ( P,GarneryL,Celebrano Franck G, S J isolationdistance?, Appl Ecol by determine the of genetic a structure continuouslydistributedclustersor population: AC, Frantz Assoc DL,ClarkHartl A.,andClarkPrinciples of genetics,population Sunderland Sinauer Biochem (Coleoptera:complex Nitidulidae), Syst Ecol E, Molecular re Audisio A,Romanelli Biase P, CristinaAngelici M,KetmaierDe V,and DeMatthaeis (Coleoptera, Scarabaeidae), Entomol News Microsatellite Lociin AandTereba Niemczyk M, VariabilityandCross (Coleoptera: Entomol Nitidulidae), in Can Canada, andpotentialActual distribution invasiveof an pest, canola Mason PG,Olfert O, L, Sluchinski Weiss RM spp, Diabrotica Mol EcolNotes Coleoptera:rootworm (Insecta: Chrysomelidae) and cross microsatelliteKim KSandSappingtonTW,Polymorphic corn locifromthewestern among threepopulationsfrom France, western EurJEntomol beetle,carabid characterization of polymorphicmicrosatellite eleven markers from thebeneficial R,Ruault M, Marrec B,and S,RiboutC,Plantegenest Gauffre others,Iso nemoralis Isolation characterization of and lociintheground microsatellite beetle :907 10 – 116 . :1500 921 (2000).

31 18

(Coleoptera, Carabidae), Mol EcolResour (1997). Cellina S,Krier A, Schley L, andBurkeT,Using Bayesian spatial methods to :2805 :4734 – ), Zool J Linn Soc ), Zool JLinn 1508 (1996). - Poecilus Poecilus cupreus exam Comment citer cedocument: – 312 –

2823 2823 (2014).

4756 4756 (2009). Genson G, P,F, Genson Audiot Sennedot differentiation andestimationof fromF geneflow :570 Melolontha melolonthaMelolontha ination ofthe of thetaxonomy Apis mellifera ligustica –

572 (2006). 101 145

5 :115 (Coleoptera: andstructuringCarabidae), genetic :1 s among butterfly( species European 46 Frantz AC,StatisticalmethodsFrantz genetics, in spatial :1219 – olignac M,andCornuetJ olignac 49 (1991). :493 –

117 (2005). riation topopulation in wildlife, size Conserv – – 1228 (1997). 505 (2009). , BoudreaultC, Grossrieder M, 127

) and( Sicily and

:192 - Species Ampl

Melolontha Melolontha hippocastani 135

– Lesobre L,andRasplusJ 2 Meligethes viridescens 197 (2017). :119

28 :405

:1 A. m. sicula - – – – amplification with amplification other 120 (2002). 13 (2000). 413 (2003). Meligethes Meligethes viridescens - M, Hybrid origins M, Hybrid of ification ofification 111

:726 et al. 144 ), MolEcol -

statistics under –

Lepidoptera:

:2001 730 (2014). lation and Carabus Carabus , Maximum 31 et al.

species - :39 Y, – 2014 , – 59

- Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. 51 50 49 48 47 location 1. location 24 on Table Tables populations, ( sample, Estonian − population Estonian the including populations samples compa 3: Fig. The populationof origin isindicated x on the colour the to (bars) individuals of assignment proportional indicate Fig. countries inEurope.other Details on populationlocationsTable the in are 2. Fra from samples Population b) department. Eure the from 1: Fig. Figure Legends This articleisprotected bycopyright.Allrightsreserved. Accepted Article F

2: ) = ) rison between the Eure population samples population Eure the between rison Brassicogethes aeneus Brassicogethes 1

Summary of the results based on the STRUCTURE analysis for STRUCTUREanalysis the on based results the Summaryof Juhel A.,BarbuJuhel C,Franck P, Valantin Manning P,JApplEcol pest cont G,Krauss V,HolzschuhSchneider J, Riedinger A,andSteffan EcosystAgric Environ management context damage, andlandscape oninsect pestpopulationsandcrop A,Valantin Rusch fields, IOBC habitats ofpollennatural oilseed onbeetle adultsonwinter rape the abundance Kaasik R,Kovács G,J,TreierMölder ofK, Vaino VeromannE,Theimpact semi L,and Gilpin ME differentiation., Biology:Ecology,Genetics,I, andEvolution,Hanski Metapopulation Goudet studyof Giles B.structure J,Acase genetic inaplantand metapopulation woodlands to winter oilseed rapewoodlands winter oilseed fields, to PLoSONE. Characterization beetle, of the pollen Isolation by distance among European populations of populations European among distance by Isolation Geographical positions of the 18 the of positions Geographical

(circles), (circles), Characterization of the genetic variation at 21 polymorphic microsatellite loci based based loci microsatellite polymorphic 21 at variation genetic the of Characterization - 0.0125+ The name The p

> 0.05). > 0.05). ( Dotted line: Eure populations rol and yields depend onrol andyieldsdepend spatialtemporal cropcoverdynamics,ed.by (1997). F ewe pplto smls rm ifrn countries different from samples population between - ST 0.0029 WPRS Bull

of /(1 Comment citer cedocument: each

- − Morison M,Sarthou

F *

166

ln(km) ( ln(km) locus samp ) = ) 104 52 :118 :1283 - :85 0.0058 + 0.0058

les collected in an oil seed rape ( rape seed oil an in collected les w as – – p 125 (2013). 89 (2014). –

1292 1292 (2015). < 0.001). Long dash line: all populations except the the except populations all line: dash Long 0.001). < underlined. Accession Number (Acc. No.), (Acc. Number Accession underlined. B. aeneus B. - MorisonRoger M, 0.0014 - Brassicogethes aeneus Brassicogethes axis.

JP, andRoger (diamonds).

population samples. a) Population samples Population a) samples. population (Squares), * ln(km

0.05).

)), ( )), Solid line: all populat all line: Solid - nce. c) Population samples from from samples Population c) nce. Estrade J,Effect ofcrop Estrade Brassicogethes aeneus Brassicogethes between the French population French the between - p Estrade J,Butier A,

0.01). Dashed line: French line: Dashed 0.01). - , dispersal from Dewenter I,Biological Brassica napus Brassica - coded genetic clusters. clusters. genetic coded K

(triangles) = 2 and 2 =

ions, K et al.

sequences , between between , . = 3: plots 3: =

) field at field ) P airwise airwise F , ST

/(1 /(1 -

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. MF321854 Ma Acc. No. Locus in the of locus. allele, microsatellite the of Ma MF321858 Ma MF321868 Ma MF321859 Ma MF321865 Ma MF321857 Ma MF321867 Ma MF321866 Ma MF321872 Ma MF321874 Ma MF321873 Ma MF321871 Ma MF321863 Ma MF321862 Ma MF321855 Ma This articleisprotected bycopyright.Allrightsreserved. Accepted Article ------observed ------EGYLO DM3QY EB7XX DQM5T EPL2N ESV1Z ESPVQ EL7YR DDEYS DCH30 D3QFM D904J C5QWM C6CAE C4QRG CEALQ

B N owr () n rvre R primer (R) reverse and (F) forward

umber

aeneus

( H R: AGTGGATGTAGAGAAATAGTGG F: AAGAGTATAAGTCGTCGAGC R: CACCTATCGTGCAGATCAC F: CTTACTCGCTCGTCCTATATC R: GGCAAGATAACTCAGATCC F: GGGAGAGTGATGTACCTTTG R: CGTTCGACGTTGTGTTACC F: CCGACTTATCAGGTGTATGG R: CAGGAACTCGAACAAAGC F: GTCAGTTGTTTGGCTTATTG R: CATATGCGACATCGTTGG F: GTTAGGATATGAATGTTTCTGC R: CGGAAGAGTTGTTTTGTATG F: CAGGATGATTTCAGTGGAG R: GACTGTTCGGCTAGTTTTTATG F: GTACACCGAGAGGCTTTGTC R: F: CGCAGATCTAAATTCGTGTG R: GCTGCTGCGTAATTATAGTG F: GGAGCACGTAGCAGGAC R: GTGAGAGTAAGTTAAAGGCG F: TTTCATTAAGCAACCTGTCG Primer sequences (5' F: GGAGGGTCAGAAGAGTTTG R: CCTTCAACTGTAATCAAAGC F: TATTATGCTCCACCATTAGG R: GTTTCTGATTCGTTCTTGTC F: TCAAGTCTGACAACCAAAAG R: CCAAGATTAGGTCCACTCG F: CCTCTACGTCATGGTATGG R: F: CATGTAAGCTATTTTGGGACG O

of alleles ( alleles of

) population sample from1 location CTATTTGCTTTGCTTGGATGC GTATAGCGAAACAACAAGTGC and expected and and Comment citer cedocument: ie f h sqecd irstlie allele microsatellite sequenced the of size A ), range of allele sizes, allele of range ), ( - H 3') E

)

proportion of proportion

motif ,

. hete (CA) (AC) (AC) (TC) motif Repeat (AAG) (AC) (GA) (GT) (AC) (CT) (AC) (TG) (GGA) (GAA) (CA) (GGA) estimates of the the of estimates

n nme o rpa i the in repeat of number and rozygotes 6 6 7 9 7 7 8 8 12 7 8 7

7 11 7 9

128 117 103 222 (bp) Size 143 257 172 126 195 305 23 153 171 110 134 19

8 3

were reported for each locus each for reported were 5 5 6 3 A 6 4 2 4 7 3 8 5 8 7 9 4

proportion of null alleles, null of proportion 122 111 9 2 range Size 123 250 168 121 183 301 21 143 177 104 130 18

3 06 ee eotd o each for reported were - 8 4 1 ------134 125 09 22 139 256 190 129 197 3 23 153 198 116 160 19 05

2 2 3

0.00 0.00 0.00 0.00 alleles Null 0.21 0.22 0.15 0.23 0.09 0.08 0.08 0.07 0.03 0.00 0.00 0.00

sequenced

0.62 0.72 0.44 0.17 H 0.71 0.67 0.41 0.49 0.77 0.65 0.85 0.65 0.77 0.53 0.79 0.58

0.67 0.87 0.43 0.18 H 0.36 0.31 0.22 0.17 0.61 0.50 0.70 0.52 0.70 0.50 0.86 0.71

This articleisprotected bycopyright.Allrightsreserved. Accepted Article - - - - - DJDOQ EL5EB EJCJJ DCGTK C2D1M

R: TATTGACGAGCTAATTTTGG F: ACGTTTAATTAGTTGGTTGG R: CAGTAACCATAGCTCGACAC F: CCAAGAAAGGGAACAGG R: CAAGAAACTTGACACTTAAATC F: CATAGTCTGTAAAGCATGTTG R: CAATAGACACCATCAATTAGG F: CCGACAAGTGCATTACG R: TGGACCTCTTGGTATATTGG F: ATCGTAGCCATCTATTGAGC R: GTGTACGTGTTATAAGGCTGTG Comment citer cedocument:

(GA) (AG) (TC) (AG) (CTT) 7 13 8 8

119 313 295 176 162

3 3 3 5 9

153 282 295 154 159 - - - - - 163 313 311 170 180

0.24 0.18 0.28 0.21 0.17

0.43 0.46 0.51 0.70 0.62

0.11 0.18 0.10 0.35 0.36

Version postprint 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 Site

(2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus

Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. under the SM the under Two the under equilibrium obser allelic (N), sample population ( per richness genotyped individuals of number sample, population aeneus 2: Table

EuropeTotal Estonia Sweden Poland Austria Switzerland France Total Lot Haute Ile Maine Aube Cher Eure Eure Total Eure 6 Eure 5 Eure 4 Eure 3 Eure 2 Eure 1 Location This articleisprotected bycopyright.Allrightsreserved. Accepted Article & & Vilaine &

Garonne - ved &

Loire Garonne

Loire

population samples. Latitude (Lat) and longitude (Long) of the location of the the of location the of (Long) longitude and (Lat) Latitude samples. population

Mean genetic variability ( variability genetic Mean

A ee iest ( diversity gene

r cmue for computed )

M were underlined.M were 58.343 55.658 52.187 48.208 47.431 - 44.180 43.408 48.112 47.664 48.259 47.217 48.299 - 48.972 48.986 48.973 48.945 48.923 48.864 Latitude -

Comment citer cedocument: - 26.527 13.083 18.809 16.374 8.519 - 0.530 1.646 - - 3.845 2.199 1.245 - 1.448 1.428 1.421 1.465 1.213 1.243 Longitude

1.776 0.789 - H Phase mutations Phase E

ad xetd ee iest ( diversity gene expected and ) 1, bevd proportion observed =16,

± 433 24 21 24 30 28 312 24 24 45 25 30 16 26 138 24 23 23 24 22 25 n

standard deviation) over 12 microsatellite loci in 18 in loci microsatellite 12 over deviation) standard

5.30 (±1.66) 5.23 (±1.78) 5.07 (±1.74) 5.43 (±1.83) 5.63 (±2.35) 5.06 (±1.59) 5.40 (±1.75) A 5.38 (±1.79) 4.43 (±1.54) 5.18 (±1.53) 5.22 (±1.93) 5.65 (±2.43) 5.97 (±2.19) 5.32 (±1.67) 5.50 (±1.61) 5.44 (±1.56) 5.24 (±1.83) 5.42 (±2.03) 5.08 (±1.98) 5.50 (±2.43) 5.01 (±1.35) r

(TPM).

0.63 (± 0.59 (±0.14) 0.62 (±0.16) 0.57 (±0.16) 0.63 (±0.16) 0.61 (±0.17) 0.67 (± 0.21) H 0.63 (±0.27) 0.63 (±0.26) 0.63 (±0.25) 0.63 (±0.24) 0.63 (±0.23) 0.63 (±0.22) 0.63 (±0.21) 0.63 (±0.20) 0.63 (±0.19) 0.63 (±0.18) 0.63 (±0.17) 0.58 (±0.21) 0.61 (±0.22) 0.61 (±0.15) S O lower ignificantly

f eeoyos genotypes heterozygous of 0.17)

H 0.63 (±0.17) 0.54 (±0.17) 0.58 (±0.19) 0.58 (±0.22) 0.63 (±0.18) 0.60 (±0.20) 0.62 H 0.63 0.59 (±0.22) 0.57 0.60 (±0.18) 0.59 (±0.22) 0.64 (±0.20) 0.63 (± 0.66 (±0.15) 0.59 (±0.18) 0.61 (±0.20) 0.65 (±0.19) 0.55 (±0.21) 0.63 (±0.23) 0.60 (±0.18) eq E

a te mutation the at ) (±0.18) (± (±0.17) 0.18) 0.18) H E

values than than values 0.65 ( 0.63 (± 0.15) 0.64 (± 0.13) 0.66 (± 0.11) 0.66 (± 0.17) 0.63 (± 0.10) 0.65 (± 0.11) H 0.68 (± 0.08) 0.59 (± 0.15) 0.63 (± 0.15) 0.63 (± 0.14) 0.65 (± 0.18) 0.68 (± 0.16) 0.68 (± 0.07) 0.67 (± 0.10) 0.67 (± 0.09) 0.64 (± 0.12) 0.64 0.62 (± 0.14) 0.64 (± 0.17) 0.64 (± 0.11) eq

(TPM) (± 0.14) ± 0.11)

( - H drift

H O B. B. 0.79 (± 0.06) 0.69 (± 0.15) 0.69 (± 0.14) 0.69 (± 0.13) 0.69 (± 0.12) 0.69 (± 0.11) 0.78 (± 0.05) 0.73 (± 0.07) 0.73 (± 0.07) 0.72 (± 0.07) 0.70 (± 0.08) 0.69 (± 0.10) 0.69 (± 0.09) 0.69 (± 0.08) 0.75 (± 0.09) 0.69 (± 0.08) 0.69 (± 0.08) 0.71 (± 0.07) 0.71 (± 0.08) 0.70 (± 0.08) 0.72 (± 0.07) H eq ), eq

(SMM)

Comment citer cedocument:

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P.

Fig. This articleisprotected bycopyright.Allrightsreserved. Accepted Article

Comment citer cedocument:

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P.

Fig. 3 This articleisprotected bycopyright.Allrightsreserved. Accepted Article

Comment citer cedocument:

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. tetramethyl (6 FAM multiplex. each locus each of (C) concentration molar the and primer forward the of dye S1: Table Supporting Information specific of specific at field rape seed in individuals S2: Table This articleisprotected bycopyright.Allrightsreserved. Accepted Article

- Polymorphic microsatellite loci selected in this study with reference to the labelled labelled the to reference with study this in selected loci microsatellite Polymorphic B. - carboxyfluorescein),

rhodamine), ATTO dyesclass). 565(Rhodamine Ma Locus Ma Ma Ma Ma Ma Ma Ma Ma Ma Ma Ma Characteriz viridescens viridescens

twelve ------ESV1Z ESPVQ EPL2N DQM5T DM3QY DDEYS DCH30 D3QFM EB7XX EL7YR CEALQ C4QRG site

14. Sizes of the PCR products, number of alleles of number products, PCR the of Sizes 14. B. aeneus B. Comment citer cedocument:

Ma Ma Ma Ma Ma Ma Multiplex 2 Ma Ma Ma Ma Ma Ma Multiplex 1 Locus ID

ation ation

but not but not

------EB7XX DQM5T EL7YR DCH30 DDEYS EPL2N ESV1Z DM3QY ESPVQ D3QFM CEALQ C4QRG

2 a of Number 2 2 3 5 / 3 / 1 / 1 2

microsatellite B. aeneus lleles

E (hexachloro HEX eei vrain n eight in variation genetic

Tamra 6 Atto Atto Hex Hex Tamra 6 Dye Atto Hex Hex Tamra - - 113 132 161 151 / 110 / 91 / 175 222 313 range Size FAM FAM

were reported.

- - -

565 565 565

------.

116 134 170 161 116 224 315

viridescens viridescens

0.25 µM 0.05 µM 0.30 µM 0.15 µM 0.15 0.20 µM 0.50 µM 0.07 µM C (nM) 0.15 µM 0.10 µM 0.15 µM 0.50 µM / / / 155, 157 / 110, 112 / 91 / / / 313, 315 viridescens only Alleles -

loecie, AR (carboxy TAMRA fluoresceine),

µM

individuals

rsioehs viridescens Brassicogethes present present in

per locus and allele allele and locus per were B . collected in a in collected

6 - -

Version postprint (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P. 4 3 2 1 K bold font. between ranging S Table 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 This articleisprotected bycopyright.Allrightsreserved.

Accepted Article

10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 Reps 3

The posterior probabilitiesofThe posterior S

ummary 1 and 1 ------Mean LnP(K) 14224.59 14274.46 14283.83 14329.26 14264.27 14294.37 14325.54 14274.86 14291.71 14302.14 14255.88 14270.97 14321.61 14227.07 14183.35 14112.66 14083.62 13988.83 13995.95 14021.4 of the the of Comment citer cedocument: 20 0

. The . STRUCTURE analysis performed on the full dataset full the on performed analysis STRUCTURE

highest highest 119.09 85.56 95.97 156.77 87.80 143.59 135.01 88.99 96.92 122.57 81.65 84.94 74.66 71.71 61.23 47.01 39.55 9.82 13.66 0.00 StdevLnP(K)

=2 and K

value and the and value

K =3 are 0.001=3 are and0.999respectively. - 15.09 50.64 - - - - - 7.12 25.45 — Ln'(K) 49.87 9.37 45.43 - 30.10 31.17 - 16.85 10.43 46.26 94.54 43.72 70.69 29.04 94.79 64.99 50.68

two

highest mean highest 56.69 61.35 35.55 145.18 50.82 26.97 41.65 65.75 101.91 18.33 — Ln''(K)| — 40.50 36.06 110.42 95.09 1.07 81.85 67.53 6.42

LnP(

for 0.46 0.75 0.42 1.94 0.71 0.44 0.89 1.66 10.38 1.34 — Δ — 0.47 0.38 0.70 1.08 0.01 0.61 0.76 0.07 a range range a K K

) are in are )

Version postprint 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 (2019). Limited genetic structureand demographicexpansion ofthe Brassicogethes aeneus

Juhel, A., Barbu,C.,Valantin-Morison, M.,Gauffre, B.,Leblois,R., Olivares,J.,Franck, P.

onlocationsdetails and code see S Table This articleisprotected bycopyright.Allrightsreserved.

Accepted0.0277 - 0.0099 0.0134 0.0051 - 0.0024 - - - 0.0070 Article- - - 0.0099 0.0030 0.0077 / 1

0.0018 0.0005 0.0016 0.0014 0.0039 0.0029 0.0044 0.0016

4 0.0230 0.0066 0.0057 0.0072 0.0051 0.0045 0.0095 - 0.0001 0.0017 - - 0.0031 - 0.0164 0.0010 / NS 2 .

0.0002 0.0026 0.0035 0.0033

Pairwise Pairwise

0.0044 0.0013 - 0.0003 0.0017 0.0066 - - - 0.0037 / NS NS 3 0.0267 0.0028 0.0018 0.0067 0.0042

0.0011 0.0035 0.0033 0.0031

F ST

Comment citer cedocument:

estimates 0.0418 0.0118 0.0104 0.0113 0.0026 0.0140 0.0001 0.0057 0.0093 0.0140 0.0154 0.0067 0.0100 0.0107 / NS NS NS 4

Table ------/ NS NS NS NS 5 0.0212 - - 0.0085 0.0036 (left part) and significant and part) (left

0.0061 0.0052 0.0042 0.0073 0.0044 0.0081 0.0055 0.0044 0.0094 0.0054

). 6 0.0254 0.0046 0.0016 0.0070 0.0050 0.0004 0.0026 0.0014 - 0.0016 0.0042 - / NS NS NS NS NS

Bold character indicate significant 0.0071 0.0053

7 0.0305 - 0.0028 0.0110 0.0029 - - - - 0.0008 0.0008 / NS NS NS NS NS NS

0.0004 0.0050 0.0013 0.0044 0.0049

8 0.0313 0.0062 0.0091 0.0077 0.0051 0.0088 0.0134 0.0023 0.0037 0.0002 / NS NS NS NS NS NS NS

values (right part) (right values

9 0.0214 - 0.0035 0.0082 0.0051 - 0.0005 - - / NS NS NS NS NS NS NS NS

0.0032 0.0033 0.0045 0.0067

10 0.0194 - - 0.0012 - - - - / NS NS NS NS NS NS NS NS NS

0.0034 0.0057 0.0020 0.0010 0.0027 0.0049

values.

between 11 0.0087 - - 0.0046 0.0034 0.0022 - / NS NS NS NS NS NS NS NS NS NS

0.0051 0.0033 0.0061

0.0280 0.0037 - 0.0021 - 0.0058 / NS NS NS NS NS NS NS NS NS NS NS 12 18

0.0049 0.0036

population

0.0331 - 0.0041 0.0161 0.0087 / NS NS NS NS NS NS NS NS NS NS NS NS 13

0.0020

s amples 0.0281 - 0.0014 - / NS NS NS NS NS NS NS NS NS NS NS NS NS 14

0.0005 0.0051

of 0.0285 0.0146 0.0039 / NS NS NS NS NS NS NS NS * * NS NS NS * 15

Brassicogethes aeneus Brassicogethes

0.0077 - / NS *** * NS NS NS * *** *** NS NS *** * NS *** 16

0.0014

0.0110 / NS * NS NS NS NS NS NS NS NS * NS * NS NS NS 17

/ *** *** *** *** *** *** *** *** *** *** *** *** *** *** *** *** *** 18 (for (for