DOCSLIB.ORG

ABCD2 Is a Direct Target of B-Catenin and TCF-4: Implications for X-Linked Adrenoleukodystrophy Therapy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ABCD2 Is a Direct Target of B-Catenin and TCF-4: Implications for X-Linked Adrenoleukodystrophy Therapy ABCD2 Is a Direct Target of b-Catenin and TCF-4: Implications for X-Linked Adrenoleukodystrophy Therapy Chul-Yong Park1,2, Han-Soo Kim3, Jiho Jang1,2, Hyunji Lee1,2, Jae Souk Lee1,2,4, Jeong-Eun Yoo1,2,4, Dongjin R. Lee1,2,4, Dong-Wook Kim1,2,4* 1 Department of Physiology, Yonsei University College of Medicine, Seodaemun-gu, Seoul, Korea, 2 Severance Biomedical Research Institute, Yonsei University College of Medicine, Seoul, Korea, 3 Department of Laboratory Medicine and Cell Therapy Center, Yonsei University College of Medicine, Seoul, Korea, 4 Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul, Korea Abstract X-linked adrenoleukodystrophy (X-ALD) is a peroxisomal disorder caused by mutations in the ABCD1 gene that encodes the peroxisomal ATP-binding cassette (ABC) transporter subfamily D member 1 protein (ABCD1), which is referred to as the adrenoleukodystrophy protein (ALDP). Induction of the ABCD2 gene, the closest homolog of ABCD1, has been mentioned as a possible therapeutic option for the defective ABCD1 protein in X-ALD. However, little is known about the transcriptional regulation of ABCD2 gene expression. Here, through in silico analysis, we found two putative TCF-4 binding elements between nucleotide positions 2360 and 2260 of the promoter region of the ABCD2 gene. The transcriptional activity of the ABCD2 promoter was strongly increased by ectopic expression of b-catenin and TCF-4. In addition, mutation of either or both TCF-4 binding elements by site-directed mutagenesis decreased promoter activity. This was further validated by the finding that b-catenin and the promoter of the ABCD2 gene were pulled down with a b-catenin antibody in a chromatin immunoprecipitation assay. Moreover, real-time PCR analysis revealed that b-catenin and TCF-4 increased mRNA levels of ABCD2 in both a hepatocellular carcinoma cell line and primary fibroblasts from an X-ALD patient. Interestingly, we found that the levels of very long chain fatty acids were decreased by ectopic expression of ABCD2-GFP as well as b-catenin and TCF-4. Taken together, our results demonstrate for the first time the direct regulation of ABCD2 by b-catenin and TCF-4. Citation: Park C-Y, Kim H-S, Jang J, Lee H, Lee JS, et al. (2013) ABCD2 Is a Direct Target of b-Catenin and TCF-4: Implications for X-Linked Adrenoleukodystrophy Therapy. PLoS ONE 8(2): e56242. doi:10.1371/journal.pone.0056242 Editor: Cara Gottardi, Northwestern University Feinberg School of Medicine, United States of America Received October 6, 2012; Accepted January 7, 2013; Published February 21, 2013 Copyright: ß 2013 Park et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This research was supported by grants from the National Research Foundation, Korean Ministry of Education, Science and Technology (the Bio & Medical Technology Development Program, 2012M3A9B4028631 and 2012M3A9C7050126), Korea Health technology R&D Project, Korean Ministry of Health & Welfare (A120254 and A100694). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] Introduction (C24:0 and C26:0) and monounsaturated (C26:1) VLCFAs in the plasma and tissues of X-ALD patients, due to the reduced b- X-linked adrenoleukodystrophy (X-ALD) is the most common oxidation of VLCFAs in peroxisomes [7]. Recently, we first peroxisomal disorder and is caused by mutations or large deletions reported the generation of X-ALD patient-derived induced of one or more exons in the ABCD1 gene located in Xq28, which pluripotent stem (iPS) cell models [8]. Generated X-ALD iPS encodes the peroxisomal member of the ATP-binding cassette cells were successfully differentiated into oligodendrocytes, the (ABC) transporter subfamily D member 1 (ABCD1), also known as main cell type affected by the disease, and notably revealed the adrenoleukodystrophy protein (ALDP) [1,2]. X-ALD has an underlying pathophysiology which had not been observed in incidence of 1 in 17,000 males, and has several clinical patients’ fibroblasts or animal models. phenotypes, namely severe childhood cerebral form (CCALD, ABCD2 encodes the ALDP-related protein (ALDRP or ABCD2) early-onset type), a slowly progressive form called adrenomyelo- that share high homology with ABCD1 implying their functional neuropathy (AMN, late-onset type), and adult cerebral form redundancy or functional overlap [9]. Indeed, overexpression of (ACALD) [3,4]. Currently, no therapeutic drugs for X-ALD are ABCD2 has been shown to normalize peroxisomal b-oxidation available, although gene correction of autologous hematopoietic and prevent accumulation of VLCFAs in cultured human stem cell with a wild-type version of the ABCD1 gene by a lentiviral fibroblast cells obtained from an X-ALD patient [10–12] and in vector has been shown to provide clinical benefit in X-ALD an Abcd1 knockout mice model [13]. In addition, it has been patients [5]. ABCD1 transports very long chain fatty acids reported that levels of VLCFAs are restored by pharmacological (VLCFAs; those with more than 22 carbon atoms) or their CoA induction of the ABCD2 gene [10,14,15]. Thus, this complement- derivatives across the peroxisomal membrane for b-oxidation. Recently, it was demonstrated that human ABCD1 was able to ing gene can be an attractive target for X-ALD therapy [16]. transport VLCFA-CoA into the peroxisome in a yeast system [6]. b-catenin is not only a key protein involved in cell-cell adhesion Dysfunction of ABCD1 results in increased levels of saturated complexes with E-cadherin, but also an important component of PLOS ONE | www.plosone.org 1 February 2013 | Volume 8 | Issue 2 | e56242 Regulation of ABCD2 by b-Catenin and TCF-4 the Wnt signaling pathway, which is involved in diverse cellular from Invitrogen (#C-004-5C) and were cultured as recommended processes including cell growth, migration, differentiation, gene by the supplier. transcription, development of the nervous system, and self-renewal of stem cells [17–20]. In the presence of Wnt signaling, Plasmids, Reporter Gene Constructs, and Site-directed cytoplasmic b-catenin translocates into the nucleus [21] where it Mutagenesis forms a transcription complex with the lymphoid enhancer factor/ Expression vectors for Flag-tagged constitutively active b- T-cell factor (LEF/TCF) DNA binding protein, resulting in the catenin (b-catenin 4A; S33A, S37A, T41A, S45A), Myc-tagged transcription of target genes [22]. There are four TCF proteins wild-type TCF-4, and dominant negative TCF-4 (lacking the b- (TCF-1, LEF-1, TCF-3, TCF-4) in mammalian cells [23]. In the catenin binding site; DN-TCF-4) were obtained from Addgene absence of Wnt signaling, the TCFs interact with transcriptional (plasmid #24204, #16514, #24310, respectively; Cambridge CA) repressors (such as Groucho) and gene expression of target genes is [27,28]. The human ABCD2-GFP expression vector was pur- inhibited [24]. chased from OriGene (#RG211199). Human ABCD2 promoter Weinhofer et al., via promoter studies, demonstrated that sterol fragments (21300, 2800, 2500, 21300/2500, 2360, 2260, regulatory element-binding proteins (SREBPs), a family of 2160 bp) were amplified by PCR using i-MAXTM II DNA transcription factors that control the metabolism of cholesterol polymerase (iNtRON biotechnology, Korea) from HDF genomic and fatty acids, are involved in transcription of the ABCD2 gene DNA as a template, and subcloned into the pGL3-basic (Promega) [25,26]. However, the identities of other transcription factors vector. The primer sequences containing restriction sites are listed involved in transcription of the ABCD2 gene are not known. In this in Table 1. The ABCD2 promoter sequence (starting from study, we investigated putative transcription factors affecting the 21300 bp) was aligned with the sequence of human chromosome expression of ABCD2 gene through in silico analysis, and found 12 (NCBI, Gene ID: 225). Mutations in the LEF-1/TCF binding two putative LEF-1/TCF binding elements between nucleotide sites were introduced using the 800-luc reporter plasmid by positions 2360 and 2260 of the promoter of the ABCD2 gene. To overlap extension PCR as described previously [29]. In brief, our knowledge, this is the first report that b-catenin and TCF-4 PCRs were performed to generate two DNA fragments (59 directly regulate the expression of ABCD2; this direct regulation fragment and 39 fragment) containing overlapping ends using the may provide a new drug discovery strategy for X-ALD. following specific primers: mTBE1-59primer, 5- GATG- Materials and Methods TAATTCGCCCTGCTCTCTCCTCA -3 and mTBE1-39 primer, 5- TGAGGAGAGAGCAGGGCGAAT- Cell Cultures TACATC -3; HepG2 cells (human hepatocellular carcinoma cell line) were mTBE2-59 primer, 5- TTCAAGGTTAGAAGG- cultured in RPMI1640 medium (Sigma) supplemented with 10% GAAGCTGCGAGG -3 and fetal bovine serum (FBS) and 1% penicillin/streptomycin (Invitro- mTBE2-39 primer, 5- CCTCGCAGCTTCCCTTC- gen). Huh7 cells (human hepatoma cell line) were cultured in TAACCTTGAA -3. Putative LEF-1/TCF binding sites are shown Dulbecco’s modified Eagle’s medium (DMEM) supplemented with in bold, and mutated sequences are underlined. After two rounds 10% FBS and 1% antibiotics. Human X-ALD fibroblasts from a of PCR, each full-length construct with the desired mutation single patient with X-ALD (CCALD type; GM04496, Coriell (800 bp DNA fragment) was amplified with primers for 800-luc Institute) were cultured in Eagle’s minimumessential medium (Table 1), and subcloned into the pGL3-basic vector. A construct (MEM, Invitrogen) supplemented with 15% FBS and 1% with mutations in both TBEs (Dm TBE) was generated by further antibiotics. Human dermal fibroblast (HDF) cells were purchased mutation of TBE2 from a TBE1-mutated plasmid.
Load more

Recommended publications
  • ABCG1 (ABC8), the Human Homolog of the Drosophila White Gene, Is a Regulator of Macrophage Cholesterol and Phospholipid Transport
    ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport Jochen Klucken*, Christa Bu¨ chler*, Evelyn Orso´ *, Wolfgang E. Kaminski*, Mustafa Porsch-Ozcu¨ ¨ ru¨ mez*, Gerhard Liebisch*, Michael Kapinsky*, Wendy Diederich*, Wolfgang Drobnik*, Michael Dean†, Rando Allikmets‡, and Gerd Schmitz*§ *Institute for Clinical Chemistry and Laboratory Medicine, University of Regensburg, 93042 Regensburg, Germany; †National Cancer Institute, Laboratory of Genomic Diversity, Frederick, MD 21702-1201; and ‡Departments of Ophthalmology and Pathology, Columbia University, Eye Research Addition, New York, NY 10032 Edited by Jan L. Breslow, The Rockefeller University, New York, NY, and approved November 3, 1999 (received for review June 14, 1999) Excessive uptake of atherogenic lipoproteins such as modified low- lesterol transport. Although several effector molecules have been density lipoprotein complexes by vascular macrophages leads to proposed to participate in macrophage cholesterol efflux (6, 9), foam cell formation, a critical step in atherogenesis. Cholesterol efflux including endogenous apolipoprotein E (10) and the cholesteryl mediated by high-density lipoproteins (HDL) constitutes a protective ester transfer protein (11), the detailed molecular mechanisms mechanism against macrophage lipid overloading. The molecular underlying cholesterol export in these cells have not yet been mechanisms underlying this reverse cholesterol transport process are characterized. currently not fully understood. To identify effector proteins that are Recently, mutations of the ATP-binding cassette (ABC) trans- involved in macrophage lipid uptake and release, we searched for porter ABCA1 gene have been causatively linked to familial HDL genes that are regulated during lipid influx and efflux in human deficiency and Tangier disease (12–14).
    [Show full text]
  • Transient Ischaemic Attack (TIA) Prediction Rules
    National Institute for Health and Care Excellence 1 Draft for consultation Stroke (update) Evidence review B: transient ischaemic attack (TIA) prediction rules NICE guideline Prognostic evidence review November 2018 Draft for consultation This evidence review was developed by the National Guideline Centre STROKE (UPDATE): DRAFT FOR CONSULTATION Contents 1 Disclaimer The recommendations in this guideline represent the view of NICE, arrived at after careful consideration of the evidence available. When exercising their judgement, professionals are expected to take this guideline fully into account, alongside the individual needs, preferences and values of their patients or service users. The recommendations in this guideline are not mandatory and the guideline does not override the responsibility of healthcare professionals to make decisions appropriate to the circumstances of the individual patient, in consultation with the patient and, where appropriate, their carer or guardian. Local commissioners and providers have a responsibility to enable the guideline to be applied when individual health professionals and their patients or service users wish to use it. They should do so in the context of local and national priorities for funding and developing services, and in light of their duties to have due regard to the need to eliminate unlawful discrimination, to advance equality of opportunity and to reduce health inequalities. Nothing in this guideline should be interpreted in a way that would be inconsistent with compliance with those duties. NICE guidelines cover health and care in England. Decisions on how they apply in other UK countries are made by ministers in the Welsh Government, Scottish Government, and Northern Ireland Executive.
    [Show full text]
  • Genome-Wide Identification of Whole ATP-Binding Cassette (ABC)
    Jeong et al. BMC Genomics 2014, 15:651 http://www.biomedcentral.com/1471-2164/15/651 RESEARCH ARTICLE Open Access Genome-wide identification of whole ATP-binding cassette (ABC) transporters in the intertidal copepod Tigriopus japonicus Chang-Bum Jeong1, Bo-Mi Kim2, Jae-Seong Lee2* and Jae-Sung Rhee3* Abstract Backgrounds: The ATP-binding cassette (ABC) transporter superfamily is one of the largest transporter gene families and is observed in all animal taxa. Although a large set of transcriptomic data was recently assembled for several species of crustaceans, identification and annotation of the large ABC transporter gene family have been very challenging. Results: In the intertidal copepod Tigriopus japonicus, 46 putative ABC transporters were identified using in silico analysis, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that the 46 T. japonicus ABC transporters are classified into eight subfamilies (A-H) that include all the members of all ABC subfamilies, consisting of five ABCA, five ABCB, 17 ABCC, three ABCD, one ABCE, three ABCF, seven ABCG, and five ABCH subfamilies. Of them, unique isotypic expansion of two clades of ABCC1 proteins was observed. Real-time RT-PCR-based heatmap analysis revealed that most T. japonicus ABC genes showed temporal transcriptional expression during copepod development. The overall transcriptional profile demonstrated that half of all T. japonicus ABC genes were strongly associated with at least one developmental stage. Of them, transcripts TJ-ABCH_88708 and TJ-ABCE1 were highly expressed during all developmental stages. Conclusions: The whole set of T. japonicus ABC genes and their phylogenetic relationships will provide a better understanding of the comparative evolution of essential gene family resources in arthropods, including the crustacean copepods.
    [Show full text]
  • Transcriptional and Post-Transcriptional Regulation of ATP-Binding Cassette Transporter Expression
    Transcriptional and Post-transcriptional Regulation of ATP-binding Cassette Transporter Expression by Aparna Chhibber DISSERTATION Submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Pharmaceutical Sciences and Pbarmacogenomies in the Copyright 2014 by Aparna Chhibber ii Acknowledgements First and foremost, I would like to thank my advisor, Dr. Deanna Kroetz. More than just a research advisor, Deanna has clearly made it a priority to guide her students to become better scientists, and I am grateful for the countless hours she has spent editing papers, developing presentations, discussing research, and so much more. I would not have made it this far without her support and guidance. My thesis committee has provided valuable advice through the years. Dr. Nadav Ahituv in particular has been a source of support from my first year in the graduate program as my academic advisor, qualifying exam committee chair, and finally thesis committee member. Dr. Kathy Giacomini graciously stepped in as a member of my thesis committee in my 3rd year, and Dr. Steven Brenner provided valuable input as thesis committee member in my 2nd year. My labmates over the past five years have been incredible colleagues and friends. Dr. Svetlana Markova first welcomed me into the lab and taught me numerous laboratory techniques, and has always been willing to act as a sounding board. Michael Martin has been my partner-in-crime in the lab from the beginning, and has made my days in lab fly by. Dr. Yingmei Lui has made the lab run smoothly, and has always been willing to jump in to help me at a moment’s notice.
    [Show full text]
  • ABC Transporter Subfamily D: Distinct Differences in Behavior Between ABCD1–3 and ABCD4 in Subcellular Localization, Function, and Human Disease
    Hindawi Publishing Corporation BioMed Research International Volume 2016, Article ID 6786245, 11 pages http://dx.doi.org/10.1155/2016/6786245 Review Article ABC Transporter Subfamily D: Distinct Differences in Behavior between ABCD1–3 and ABCD4 in Subcellular Localization, Function, and Human Disease Kosuke Kawaguchi and Masashi Morita Department of Biological Chemistry, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, 2630 Sugitani, Toyama 930-0194, Japan Correspondence should be addressed to Kosuke Kawaguchi; [email protected] Received 24 June 2016; Accepted 29 August 2016 Academic Editor: Hiroshi Nakagawa Copyright © 2016 K. Kawaguchi and M. Morita. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. ATP-binding cassette (ABC) transporters are one of the largest families of membrane-bound proteins and transport a wide variety of substrates across both extra- and intracellular membranes. They play a critical role in maintaining cellular homeostasis. To date, four ABC transporters belonging to subfamily D have been identified. ABCD1–3 and ABCD4 are localized to peroxisomes and lysosomes, respectively. ABCD1 and ABCD2 are involved in the transport of long and very long chain fatty acids (VLCFA) or their CoA-derivatives into peroxisomes with different substrate specificities, while ABCD3 is involved in the transport of branched chain acyl-CoA into peroxisomes. On the other hand, ABCD4 is deduced to take part in the transport of vitamin B12 from lysosomes into the cytosol. It is well known that the dysfunction of ABCD1 results in X-linked adrenoleukodystrophy, a severe neurodegenerative disease.
    [Show full text]
  • Whole Exome Sequencing Analysis of ABCC8 and ABCD2 Genes Associating with Clinical Course of Breast Carcinoma
    Physiol. Res. 64 (Suppl. 4): S549-S557, 2015 Whole Exome Sequencing Analysis of ABCC8 and ABCD2 Genes Associating With Clinical Course of Breast Carcinoma P. SOUCEK1,2, V. HLAVAC1,2,3, K. ELSNEROVA1,2,3, R. VACLAVIKOVA2, R. KOZEVNIKOVOVA4, K. RAUS5 1Biomedical Center, Faculty of Medicine in Pilsen, Charles University in Prague, Pilsen, Czech Republic, 2Toxicogenomics Unit, National Institute of Public Health, Prague, Czech Republic, 3Third Faculty of Medicine, Charles University in Prague, Prague, Czech Republic, 4Department of Oncosurgery, Medicon, Prague, Czech Republic, 5Institute for the Care for Mother and Child, Prague, Czech Republic Received September 17, 2015 Accepted October 2, 2015 Summary Charles University in Prague, Alej Svobody 76, 323 00 Pilsen, The aim of the present study was to introduce methods for Czech Republic. E-mail: [email protected] exome sequencing of two ATP-binding cassette (ABC) transporters ABCC8 and ABCD2 recently suggested to play Introduction a putative role in breast cancer progression and prognosis of patients. We performed next generation sequencing targeted at Breast cancer is the most common cancer in analysis of all exons in ABCC8 and ABCD2 genes and surrounding women and caused 471,000 deaths worldwide in 2013 noncoding sequences in blood DNA samples from 24 patients (Global Burden of Disease Cancer Collaboration 2015). with breast cancer. The revealed alterations were characterized A number of cellular processes that in some cases lead to the by in silico tools. We then compared the most frequent tumor resistance limits efficacy of breast cancer therapy. functionally relevant polymorphism rs757110 in ABCC8 with Multidrug resistance (MDR) to a variety of chemotherapy clinical data of patients.
    [Show full text]
  • Whole Exome Sequencing Analysis of ABCC8 and ABCD2 Genes Associating with Clinical Course of Breast Carcinoma
    Physiol. Res. 64 (Suppl. 4): S549-S557, 2015 https://doi.org/10.33549/physiolres.933212 Whole Exome Sequencing Analysis of ABCC8 and ABCD2 Genes Associating With Clinical Course of Breast Carcinoma P. SOUCEK1,2, V. HLAVAC1,2,3, K. ELSNEROVA1,2,3, R. VACLAVIKOVA2, R. KOZEVNIKOVOVA4, K. RAUS5 1Biomedical Center, Faculty of Medicine in Pilsen, Charles University in Prague, Pilsen, Czech Republic, 2Toxicogenomics Unit, National Institute of Public Health, Prague, Czech Republic, 3Third Faculty of Medicine, Charles University in Prague, Prague, Czech Republic, 4Department of Oncosurgery, Medicon, Prague, Czech Republic, 5Institute for the Care for Mother and Child, Prague, Czech Republic Received September 17, 2015 Accepted October 2, 2015 Summary Charles University in Prague, Alej Svobody 76, 323 00 Pilsen, The aim of the present study was to introduce methods for Czech Republic. E-mail: [email protected] exome sequencing of two ATP-binding cassette (ABC) transporters ABCC8 and ABCD2 recently suggested to play Introduction a putative role in breast cancer progression and prognosis of patients. We performed next generation sequencing targeted at Breast cancer is the most common cancer in analysis of all exons in ABCC8 and ABCD2 genes and surrounding women and caused 471,000 deaths worldwide in 2013 noncoding sequences in blood DNA samples from 24 patients (Global Burden of Disease Cancer Collaboration 2015). with breast cancer. The revealed alterations were characterized A number of cellular processes that in some cases lead to the by in silico tools. We then compared the most frequent tumor resistance limits efficacy of breast cancer therapy. functionally relevant polymorphism rs757110 in ABCC8 with Multidrug resistance (MDR) to a variety of chemotherapy clinical data of patients.
    [Show full text]
  • Identification of Novel Snps of ABCD1, ABCD2, ABCD3
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by PubMed Central Neurogenetics (2011) 12:41–50 DOI 10.1007/s10048-010-0253-6 ORIGINAL ARTICLE Identification of novel SNPs of ABCD1, ABCD2, ABCD3, and ABCD4 genes in patients with X-linked adrenoleukodystrophy (ALD) based on comprehensive resequencing and association studies with ALD phenotypes Takashi Matsukawa & Muriel Asheuer & Yuji Takahashi & Jun Goto & Yasuyuki Suzuki & Nobuyuki Shimozawa & Hiroki Takano & Osamu Onodera & Masatoyo Nishizawa & Patrick Aubourg & Shoji Tsuji Received: 15 May 2010 /Accepted: 9 July 2010 /Published online: 27 July 2010 # The Author(s) 2010. This article is published with open access at Springerlink.com Abstract Adrenoleukodystrophy (ALD) is an X-linked dis- French ALD cohort with extreme phenotypes. All the order affecting primarily the white matter of the central mutations of ABCD1 were identified, and there was no nervous system occasionally accompanied by adrenal insuffi- correlation between the genotypes and phenotypes of ALD. ciency. Despite the discovery of the causative gene, ABCD1, SNPs identified by the comprehensive resequencing of no clear genotype–phenotype correlations have been estab- ABCD2, ABCD3,andABCD4 were used for association lished. Association studies based on single nucleotide poly- studies. There were no significant associations between these morphisms (SNPs) identified by comprehensive resequencing SNPs and ALD phenotypes, except for the five SNPs of of genes related to ABCD1 may reveal genes modifying ALD ABCD4, which are in complete disequilibrium in the phenotypes. We analyzed 40 Japanese patients with ALD. Japanese population. These five SNPs were significantly less ABCD1 and ABCD2 were analyzed using a newly developed frequently represented in patients with adrenomyeloneurop- microarray-based resequencing system.
    [Show full text]
  • Prediction of Recurrent Stroke with ABCD2 and ABCD3 Scores in Patients with Symptomatic 50-99% Carotid Stenosis Elias Johansson1,2*, Jakob Bjellerup2 and Per Wester2
    Johansson et al. BMC Neurology 2014, 14:223 http://www.biomedcentral.com/1471-2377/14/223 RESEARCH ARTICLE Open Access Prediction of recurrent stroke with ABCD2 and ABCD3 scores in patients with symptomatic 50-99% carotid stenosis Elias Johansson1,2*, Jakob Bjellerup2 and Per Wester2 Abstract Background: Although it is preferable that all patients with a recent Transient Ischemic Attack (TIA) undergo acute carotid imaging, there are centers with limited access to such acute examinations. It is controversial whether ABCD2 or ABCD3 scores can be used to triage patients to acute or delayed carotid imaging. It would be acceptable that some patients with a symptomatic carotid stenosis are detected with a slight delay as long as those who will suffer an early recurrent stroke are detected within 24 hours. The aim of this study is to analyze the ability of ABCD2 and ABCD3 scores to predict ipsilateral ischemic stroke among patients with symptomatic 50-99% carotid stenosis. Methods: In this secondary analysis of the ANSYSCAP-study, we included 230 consecutive patients with symptomatic 50-99% carotid stenosis. We analyzed the risk of recurrent ipsilateral ischemic stroke before carotid endarterectomy based on each parameter of the ABCD2 and ABCD3 scores separately, and for total ABCD2 and ABCD3 scores. We used Kaplan-Meier analysis. Results: None of the parameters in the ABCD2 or ABCD3 scores could alone predict all 12 of the ipsilateral ischemic strokes that occurred within 2 days of the presenting event, but clinical presentation tended to be a statistically significant risk factor for recurrent ipsilateral ischemic stroke (p = 0.06, log rank test).
    [Show full text]
  • Peroxisomal ATP-Binding Cassette Transporters Form Mainly Tetramers
    Peroxisomal ATP-binding cassette transporters form mainly tetramers Flore Geillon, Catherine Gondcaille, Quentin Raas, Alexandre Dias, Delphine Pecqueur, Caroline Truntzer, Géraldine Lucchi, Patrick Ducoroy, Pierre Falson, Stéphane Savary, et al. To cite this version: Flore Geillon, Catherine Gondcaille, Quentin Raas, Alexandre Dias, Delphine Pecqueur, et al.. Per- oxisomal ATP-binding cassette transporters form mainly tetramers. Journal of Biological Chem- istry, American Society for Biochemistry and Molecular Biology, 2017, 292 (17), pp.6965-6977. 10.1074/jbc.M116.772806. hal-02329531 HAL Id: hal-02329531 https://hal.archives-ouvertes.fr/hal-02329531 Submitted on 23 Oct 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. cros ARTICLE Peroxisomal ATP-binding cassette transporters form mainly tetramers Received for publication, December 16, 2016, and in revised form, March 3, 2017 Published, Papers in Press, March 3, 2017, DOI 10.1074/jbc.M116.772806 Flore Geillon‡, Catherine Gondcaille‡, Quentin Raas‡, Alexandre M. M. Dias‡, Delphine Pecqueur§, Caroline Truntzer§, Géraldine Lucchi§, Patrick Ducoroy§, Pierre Falson¶, Stéphane Savary‡, and Doriane Trompier‡1 From the ‡Laboratoire Bio-PeroxIL EA7270 and §CLIPP-ICMUB, Universite´Bourgogne-Franche-Comté, 6 Bd Gabriel, 21000 Dijon, France and the ¶Drug Resistance and Membrane Proteins Team, Molecular Microbiology and Structural Biochemistry Laboratory, Institut de Biologie et Chimie des Protéines (IBCP), UMR5086 CNRS/Université Lyon 1, 7 Passage du Vercors, 69367 Lyon, France Edited by George M.
    [Show full text]
  • Peroxisomal Cofactor Transport
    biomolecules Review Peroxisomal Cofactor Transport Anastasija Plett, Lennart Charton and Nicole Linka * Institute of Plant Biochemistry and Cluster of Excellence on Plant Sciences (CEPLAS), Heinrich Heine University, Universitätsstrasse 1, 40,225 Düsseldorf, Germany; [email protected] (A.P.); [email protected] (L.C.) * Correspondence: [email protected]; Tel.: +49-(0)211-81-10412; Fax: +49-(0)211-81-13706 Received: 2 July 2020; Accepted: 7 August 2020; Published: 12 August 2020 Abstract: Peroxisomes are eukaryotic organelles that are essential for growth and development. They are highly metabolically active and house many biochemical reactions, including lipid metabolism and synthesis of signaling molecules. Most of these metabolic pathways are shared with other compartments, such as Endoplasmic reticulum (ER), mitochondria, and plastids. Peroxisomes, in common with all other cellular organelles are dependent on a wide range of cofactors, such as adenosine 50-triphosphate (ATP), Coenzyme A (CoA), and nicotinamide adenine dinucleotide (NAD). The availability of the peroxisomal cofactor pool controls peroxisome function. The levels of these cofactors available for peroxisomal metabolism is determined by the balance between synthesis, import, export, binding, and degradation. Since the final steps of cofactor synthesis are thought to be located in the cytosol, cofactors must be imported into peroxisomes. This review gives an overview about our current knowledge of the permeability of the peroxisomal membrane with the focus on ATP, CoA, and NAD. Several members of the mitochondrial carrier family are located in peroxisomes, catalyzing the transfer of these organic cofactors across the peroxisomal membrane. Most of the functions of these peroxisomal cofactor transporters are known from studies in yeast, humans, and plants.
    [Show full text]
  • Connecting Cholesterol Efflux Factors to Lung Cancer Biology And
    International Journal of Molecular Sciences Review Connecting Cholesterol Efflux Factors to Lung Cancer Biology and Therapeutics Maria Maslyanko †, Ryan D. Harris † and David Mu * Leroy T. Canoles Jr. Cancer Research Center, Department of Microbiology and Molecular Cell Biology, Eastern Virginia Medical School, Norfolk, VA 23501, USA; [email protected] (M.M.); [email protected] (R.D.H.) * Correspondence: [email protected] † Equal contribution. Abstract: Cholesterol is a foundational molecule of biology. There is a long-standing interest in understanding how cholesterol metabolism is intertwined with cancer biology. In this review, we focus on the known connections between lung cancer and molecules mediating cholesterol efflux. A major take-home lesson is that the roles of many cholesterol efflux factors remain underexplored. It is our hope that this article would motivate others to investigate how cholesterol efflux factors contribute to lung cancer biology. Keywords: lung cancer; cholesterol efflux; ABCA1; ABCG1; Apo AI; miRNA; miR-33a; miR-200b-3p; LRPs; LAL; NPC1; STARD3; SMPD1; NCEH1; SR-BI; TTF-1; drug resistance; cisplatin 1. Introduction Citation: Maslyanko, M.; Harris, Cholesterol is essential for cell viability and cell membrane integrity. Cholesterol is R.D.; Mu, D. Connecting Cholesterol also a precursor to many physiologically important hormones. The interest in the intercon- Efflux Factors to Lung Cancer Biology nection between cholesterol metabolism and cancer is best illustrated by the abundance of and Therapeutics. Int. J. Mol. Sci. literature on this subject matter. A quick search of PubMed.gov (accessed on 4 June 2021) 2021, 22, 7209. https://doi.org/ using the two key words (Cholesterol AND Cancer) retrieves over 20,000 publications.
    [Show full text]