ABCD2 Is a Direct Target of b-Catenin and TCF-4: Implications for X-Linked Adrenoleukodystrophy Therapy Chul-Yong Park1,2, Han-Soo Kim3, Jiho Jang1,2, Hyunji Lee1,2, Jae Souk Lee1,2,4, Jeong-Eun Yoo1,2,4, Dongjin R. Lee1,2,4, Dong-Wook Kim1,2,4* 1 Department of Physiology, Yonsei University College of Medicine, Seodaemun-gu, Seoul, Korea, 2 Severance Biomedical Research Institute, Yonsei University College of Medicine, Seoul, Korea, 3 Department of Laboratory Medicine and Cell Therapy Center, Yonsei University College of Medicine, Seoul, Korea, 4 Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, Seoul, Korea Abstract X-linked adrenoleukodystrophy (X-ALD) is a peroxisomal disorder caused by mutations in the ABCD1 gene that encodes the peroxisomal ATP-binding cassette (ABC) transporter subfamily D member 1 protein (ABCD1), which is referred to as the adrenoleukodystrophy protein (ALDP). Induction of the ABCD2 gene, the closest homolog of ABCD1, has been mentioned as a possible therapeutic option for the defective ABCD1 protein in X-ALD. However, little is known about the transcriptional regulation of ABCD2 gene expression. Here, through in silico analysis, we found two putative TCF-4 binding elements between nucleotide positions 2360 and 2260 of the promoter region of the ABCD2 gene. The transcriptional activity of the ABCD2 promoter was strongly increased by ectopic expression of b-catenin and TCF-4. In addition, mutation of either or both TCF-4 binding elements by site-directed mutagenesis decreased promoter activity. This was further validated by the finding that b-catenin and the promoter of the ABCD2 gene were pulled down with a b-catenin antibody in a chromatin immunoprecipitation assay. Moreover, real-time PCR analysis revealed that b-catenin and TCF-4 increased mRNA levels of ABCD2 in both a hepatocellular carcinoma cell line and primary fibroblasts from an X-ALD patient. Interestingly, we found that the levels of very long chain fatty acids were decreased by ectopic expression of ABCD2-GFP as well as b-catenin and TCF-4. Taken together, our results demonstrate for the first time the direct regulation of ABCD2 by b-catenin and TCF-4. Citation: Park C-Y, Kim H-S, Jang J, Lee H, Lee JS, et al. (2013) ABCD2 Is a Direct Target of b-Catenin and TCF-4: Implications for X-Linked Adrenoleukodystrophy Therapy. PLoS ONE 8(2): e56242. doi:10.1371/journal.pone.0056242 Editor: Cara Gottardi, Northwestern University Feinberg School of Medicine, United States of America Received October 6, 2012; Accepted January 7, 2013; Published February 21, 2013 Copyright: ß 2013 Park et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This research was supported by grants from the National Research Foundation, Korean Ministry of Education, Science and Technology (the Bio & Medical Technology Development Program, 2012M3A9B4028631 and 2012M3A9C7050126), Korea Health technology R&D Project, Korean Ministry of Health & Welfare (A120254 and A100694). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] Introduction (C24:0 and C26:0) and monounsaturated (C26:1) VLCFAs in the plasma and tissues of X-ALD patients, due to the reduced b- X-linked adrenoleukodystrophy (X-ALD) is the most common oxidation of VLCFAs in peroxisomes [7]. Recently, we first peroxisomal disorder and is caused by mutations or large deletions reported the generation of X-ALD patient-derived induced of one or more exons in the ABCD1 gene located in Xq28, which pluripotent stem (iPS) cell models [8]. Generated X-ALD iPS encodes the peroxisomal member of the ATP-binding cassette cells were successfully differentiated into oligodendrocytes, the (ABC) transporter subfamily D member 1 (ABCD1), also known as main cell type affected by the disease, and notably revealed the adrenoleukodystrophy protein (ALDP) [1,2]. X-ALD has an underlying pathophysiology which had not been observed in incidence of 1 in 17,000 males, and has several clinical patients’ fibroblasts or animal models. phenotypes, namely severe childhood cerebral form (CCALD, ABCD2 encodes the ALDP-related protein (ALDRP or ABCD2) early-onset type), a slowly progressive form called adrenomyelo- that share high homology with ABCD1 implying their functional neuropathy (AMN, late-onset type), and adult cerebral form redundancy or functional overlap [9]. Indeed, overexpression of (ACALD) [3,4]. Currently, no therapeutic drugs for X-ALD are ABCD2 has been shown to normalize peroxisomal b-oxidation available, although gene correction of autologous hematopoietic and prevent accumulation of VLCFAs in cultured human stem cell with a wild-type version of the ABCD1 gene by a lentiviral fibroblast cells obtained from an X-ALD patient [10–12] and in vector has been shown to provide clinical benefit in X-ALD an Abcd1 knockout mice model [13]. In addition, it has been patients [5]. ABCD1 transports very long chain fatty acids reported that levels of VLCFAs are restored by pharmacological (VLCFAs; those with more than 22 carbon atoms) or their CoA induction of the ABCD2 gene [10,14,15]. Thus, this complement- derivatives across the peroxisomal membrane for b-oxidation. Recently, it was demonstrated that human ABCD1 was able to ing gene can be an attractive target for X-ALD therapy [16]. transport VLCFA-CoA into the peroxisome in a yeast system [6]. b-catenin is not only a key protein involved in cell-cell adhesion Dysfunction of ABCD1 results in increased levels of saturated complexes with E-cadherin, but also an important component of PLOS ONE | www.plosone.org 1 February 2013 | Volume 8 | Issue 2 | e56242 Regulation of ABCD2 by b-Catenin and TCF-4 the Wnt signaling pathway, which is involved in diverse cellular from Invitrogen (#C-004-5C) and were cultured as recommended processes including cell growth, migration, differentiation, gene by the supplier. transcription, development of the nervous system, and self-renewal of stem cells [17–20]. In the presence of Wnt signaling, Plasmids, Reporter Gene Constructs, and Site-directed cytoplasmic b-catenin translocates into the nucleus [21] where it Mutagenesis forms a transcription complex with the lymphoid enhancer factor/ Expression vectors for Flag-tagged constitutively active b- T-cell factor (LEF/TCF) DNA binding protein, resulting in the catenin (b-catenin 4A; S33A, S37A, T41A, S45A), Myc-tagged transcription of target genes [22]. There are four TCF proteins wild-type TCF-4, and dominant negative TCF-4 (lacking the b- (TCF-1, LEF-1, TCF-3, TCF-4) in mammalian cells [23]. In the catenin binding site; DN-TCF-4) were obtained from Addgene absence of Wnt signaling, the TCFs interact with transcriptional (plasmid #24204, #16514, #24310, respectively; Cambridge CA) repressors (such as Groucho) and gene expression of target genes is [27,28]. The human ABCD2-GFP expression vector was pur- inhibited [24]. chased from OriGene (#RG211199). Human ABCD2 promoter Weinhofer et al., via promoter studies, demonstrated that sterol fragments (21300, 2800, 2500, 21300/2500, 2360, 2260, regulatory element-binding proteins (SREBPs), a family of 2160 bp) were amplified by PCR using i-MAXTM II DNA transcription factors that control the metabolism of cholesterol polymerase (iNtRON biotechnology, Korea) from HDF genomic and fatty acids, are involved in transcription of the ABCD2 gene DNA as a template, and subcloned into the pGL3-basic (Promega) [25,26]. However, the identities of other transcription factors vector. The primer sequences containing restriction sites are listed involved in transcription of the ABCD2 gene are not known. In this in Table 1. The ABCD2 promoter sequence (starting from study, we investigated putative transcription factors affecting the 21300 bp) was aligned with the sequence of human chromosome expression of ABCD2 gene through in silico analysis, and found 12 (NCBI, Gene ID: 225). Mutations in the LEF-1/TCF binding two putative LEF-1/TCF binding elements between nucleotide sites were introduced using the 800-luc reporter plasmid by positions 2360 and 2260 of the promoter of the ABCD2 gene. To overlap extension PCR as described previously [29]. In brief, our knowledge, this is the first report that b-catenin and TCF-4 PCRs were performed to generate two DNA fragments (59 directly regulate the expression of ABCD2; this direct regulation fragment and 39 fragment) containing overlapping ends using the may provide a new drug discovery strategy for X-ALD. following specific primers: mTBE1-59primer, 5- GATG- Materials and Methods TAATTCGCCCTGCTCTCTCCTCA -3 and mTBE1-39 primer, 5- TGAGGAGAGAGCAGGGCGAAT- Cell Cultures TACATC -3; HepG2 cells (human hepatocellular carcinoma cell line) were mTBE2-59 primer, 5- TTCAAGGTTAGAAGG- cultured in RPMI1640 medium (Sigma) supplemented with 10% GAAGCTGCGAGG -3 and fetal bovine serum (FBS) and 1% penicillin/streptomycin (Invitro- mTBE2-39 primer, 5- CCTCGCAGCTTCCCTTC- gen). Huh7 cells (human hepatoma cell line) were cultured in TAACCTTGAA -3. Putative LEF-1/TCF binding sites are shown Dulbecco’s modified Eagle’s medium (DMEM) supplemented with in bold, and mutated sequences are underlined. After two rounds 10% FBS and 1% antibiotics. Human X-ALD fibroblasts from a of PCR, each full-length construct with the desired mutation single patient with X-ALD (CCALD type; GM04496, Coriell (800 bp DNA fragment) was amplified with primers for 800-luc Institute) were cultured in Eagle’s minimumessential medium (Table 1), and subcloned into the pGL3-basic vector. A construct (MEM, Invitrogen) supplemented with 15% FBS and 1% with mutations in both TBEs (Dm TBE) was generated by further antibiotics. Human dermal fibroblast (HDF) cells were purchased mutation of TBE2 from a TBE1-mutated plasmid.