US 20070077616A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/0077616 A1 KEASLING et al. (43) Pub. Date: Apr. 5, 2007

(54) BIOSYNTHESIS OF ISOPENTENYL Publication Classification PYROPHOSPHATE (51) Int. Cl. CI2P 33/00 (2006.01) (76) Inventors: Jay KEASLING, Berkeley, CA (US); CI2P 17/00 (2006.01) Vincent Martin, Montreal (CA); CI2P 9/00 (2006.01) Douglas Pitera, Oakland, CA (US); CI2P 7/04 (2006.01) Seon-Won Kim, Jeongdon-myeon CI2P 5/00 (2006.01) (KR); Sydnor T. Withers III, CI2P 5/02 (2006.01) Richmond, CA (US); Yasuo Yoshikuni, CI2N 9/10 (2006.01) Berkeley, CA (US); Jack Newman, San CI2N I/2 (2006.01) Francisco, CA (US); Artem C7H 2L/04 (2006.01) Valentinovich Khlebnikov, Mountain CI2N 15/74 (2006.01) View, CA (US) (52) U.S. Cl...... 435/52; 435/117; 435/131; 435/157; 435/166; 435/167; 435/252.3; 435/193; 435/471; Correspondence Address: 536/23.2; 435/252.33 BOZICEVIC, FIELD & FRANCIS LLP 1900 UNIVERSITY AVENUE (57) ABSTRACT SUTE 200 EAST PALO ALTO, CA 94.303 (US) Methods for synthesizing isopentenyl pyrophosphate are provided. A first method comprises introducing into a host microorganism a plurality of heterologous nucleic acid (21) Appl. No.: 11/610,686 sequences, each coding for a different enzyme in the meva lonate pathway for producing isopentenyl pyrophosphate. A related method comprises introducing into a host microor (22) Filed: Dec. 14, 2006 ganism an intermediate in the mevalonate pathway and at least one heterologous nucleic acid sequence, each sequence coding for an enzyme in the mevalonate pathway necessary Related U.S. Application Data for converting the intermediate into isopentenyl pyrophos phate. The invention also provides nucleic acid sequences, (62) Division of application No. 10/006,909, filed on Dec. enzymes, expression vectors, and transformed host cells for 6, 2001, now Pat. No. 7,172,886. carrying out the methods. Patent Application Publication Apr. 5, 2007 Sheet 1 of 5 US 2007/007761.6 A1

MEVALONATE PATHWAY AND PREFERRED ENZYMES AND SEQUENCES FOR PRODUCING ISOPENTENYL PYROPHOSPHATE

STEP PREFERRED PREFERRED ENZYME SEQUENCE O O 2- -- ?' - Acetyl-CoA Acetyl-CoA

Acetoacetyl-CoA thiolase SEQ ID NO 1 //C O . Acetoacetyl-CoA

HMG-CoA synthase SEQ ID NO2

C O

HC JXOl -CoA HMG-CoA

Truncated HMG-CoA reductase SEQID NO 3 O

HC OH Mevalonate FIG 1A Patent Application Publication Apr. 5, 2007 Sheet 2 of 5 US 2007/007761.6 A1

MEVALONATE PATHWAY AND PREFERRED ENZYMES AND SEQUENCES FOR PRODUCING ISOPENTENYL PYROPHOSPHATE (CONTINUED)

STEP PREFERRED PREFERRED ENZYME SEQUENCE O

- O OH Mewalionate

Mevalonate kinase SEQ ID NO 4 O SpH JXC CH HO e--- O Mevalonate 5-phosphate

Phosphomevalonate kinase SEQ ID NO 5 O Sso OH OH HO e----

C| O| Mevalonate 5-pyrophosphate

Mevalonate pyrophosphate decarboxylase SEQID NO 6

C H ----- O O Isopentenyl pyrophosphate

FIG 1B Patent Application Publication Apr. 5, 2007 Sheet 3 of 5 US 2007/007761.6 A1

12

ETE.coli DH.10B pBBRIMCS-3,

E. E.coli DPDXR1 pBBRMBI-2, |||||||||||||||||||||||||||||||||||||||||| E H O mM nM 10 mM. 20 nM 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||nM Mew Mew Mew Mew Mew FIG. 2

pAC -LYC only pBADMEVT, pBBRMBI-2, p.AC LYC

FIG. 3 Patent Application Publication Apr. 5, 2007 Sheet 4 of 5 US 2007/007761.6 A1

2. 5

2

5

0. 5

O pTRCADS only pBBRMBI-2 & pTRCADS

FIG. 4 Patent Application Publication Apr. 5, 2007 Sheet 5 of 5 US 2007/007761.6 A1

8000

7000

5 O 5 20 25 Retention Time (min) FIG. 5

250000

200000

SOCOC Casbene (Ricinus communis L.) retention time at 16.60

0000

5000

mtz

F.G. 6 US 2007/007761.6 A1 Apr. 5, 2007

BIOSYNTHESIS OF SOPENTENYL increase isopentenyl pyrophosphate production. Croteau et PYROPHOSPHATE al. describe in U.S. Pat. No. 6,190,895 the nucleic acid sequences that code for the expression of 1-deoxyxylulose TECHNICAL FIELD 5-phosphate synthase, an enzyme used in one biological 0001. The present invention relates to the biosynthesis of pathway for the synthesis of isopentenyl pyrophosphate. isopentenyl pyrophosphate (IPP) and isoprenoids derived Low yields of isopentenyl pyrophosphate remain, however, therefrom. More particularly, the invention relates to meth since several more enzymes are needed to catalyze other ods for biosynthesizing isopentenyl pyrophosphate, and to steps in this isopentenyl pyrophosphate biosynthetic path way. Further, the reference does not address an alternative nucleic acid sequences, enzymes, expression vectors, and pathway for isopentenyl pyrophosphate biosynthesis, transformed host cells for carrying out the methods. namely the mevalonate pathway. BACKGROUND 0006 Thus, the current invention is directed toward Solving these and other disadvantages in the art by increas 0002) Isoprenoids are compounds derived from the five ing the typically low yields associated with conventional carbon molecule, isopentenyl pyrophosphate. Investigators synthesis of isopentenyl pyrophosphate and isoprenoids. have identified over 29,000 individual isoprenoid com Specifically, the current invention is directed toward iden pounds, with new ones continuously being discovered. Iso tification of new methods for the synthesis of isopentenyl prenoids are often isolated from natural products, such as pyrophosphate, as isopentenyl pyrophosphate represents the plants and microorganisms, which use isopentenyl pyro universal precursor to isoprenoid synthesis. phosphate as a basic building block to form relatively complex structures. Vital to living organisms, isoprenoids SUMMARY OF THE INVENTION serve to maintain cellular fluidity and electron transport, as 0007 Accordingly, it is an object of the present invention well as function as natural pesticides, to name just a few of to overcome the above-mentioned disadvantages of the prior their roles in vivo. Furthermore, the pharmaceutical and art by providing a method for synthesizing isopentenyl chemical communities use isoprenoids as pharmaceuticals, pyrophosphate in a host microorganism, comprising the step nutriceuticals, flavoring agents, and agricultural pest control of introducing into the host microorganism a plurality of agents. Given their importance in biological systems and heterologous nucleic acid sequences, each coding for a usefulness in a broad range of applications, isoprenoids have different enzyme in the mevalonate pathway for producing been the focus of much attention by scientists. isopentenyl pyrophosphate. 0003 Conventional means for obtaining isoprenoids include extraction from biological materials (e.g., plants, 0008. It is another object of the invention to provide such microbes, and animals) and partial or total organic synthesis a method wherein the plurality of heterologous nucleic acid in the laboratory. Such means, however, have generally sequences is contained in at least one extrachromosomal proven to be unsatisfactory. For example, organic synthesis expression vector. is usually complex since several steps are required to obtain 0009. It is still another object of the invention to provide the desired product. Furthermore, these steps often involve Such a method wherein the isopentenyl pyrophosphate is the use of toxic solvents, which require special handling and further synthesized into an isoprenoid. disposal. Extraction ofisoprenoids from biological materials may also require toxic solvents. In addition, extraction and 0010. It is yet another object of the invention to provide purification methods usually provide a low yield of the such a method wherein the isoprenoid is selected from the desired isoprenoid, as biological materials typically contain group consisting of a monoterpene, sesquiterpene, diterpene, only small quantities of these compounds. Unfortunately, the sesterterpene, triterpene, tetraterpene, and a steroid. difficulty involved in obtaining relatively large amounts of 0011. It is a further object of the invention to provide such isoprenoids has limited their practical use. In fact, the lack a method wherein the plurality of heterologous nucleic acid of readily available methods by which to obtain certain sequences further comprises a DNA fragment coding for an isoprenoids has slowed down the progression of drug can enzyme capable of converting isopentenyl pyrophosphate to didates through clinical trials. Furthermore, once an iso dimethylallyl pyrophosphate. prenoid drug candidate has passed the usual regulatory scrutiny, the actual synthesis of the isoprenoid drug may not 0012. It is still a further object of the invention to provide lend itself to a commercial scale. a method wherein the host microorganism is a prokaryote. 0004 As a solution to such problems, researchers have 0013. It is an additional object of the invention to provide looked to biosynthetic production of isoprenoids. Some a method wherein the prokaryote is Escherichia coli. Success has been obtained in the identification and cloning 0014 Is it still another object of the invention to provide of the genes involved in isoprenoid biosynthesis. For a method for synthesizing isopentenyl pyrophosphate in a example, U.S. Pat. No. 6.291,745 to Meyer et al. describes host microorganism, wherein the method comprises intro the production of limonene and other metabolites in plants. ducing into the host microorganism an intermediate in the Although many of the genes involved in isoprenoid biosyn mevalonate pathway and at least one heterologous nucleic thesis may be expressed in functional form in Escherichia acid sequence, each said sequence coding for an enzyme in coli and other microorganisms, yields remain relatively low the mevalonate pathway necessary for converting the inter as a result of minimal amounts of precursors, namely mediate into isopentenyl pyrophosphate. isopentenyl pyrophosphate. 0015. It is still a further object of the invention to provide 0005. In an effort to address the lack of isopentenyl DNA fragments, expression vectors, and host cells for pyrophosphate, some investigators have attempted to carrying out the methods described herein. US 2007/007761.6 A1 Apr. 5, 2007

0016. Additional objects, advantages, and novel features preferably the nucleotide sequence of SEQ ID NO 1; (b) of the invention will be set forth in part in the description condensing acetoacetyl-CoA with acetyl-CoA to form that follows, and in part will become apparent to those HMG-CoA, preferably the nucleotide sequence of SEQ ID skilled in the art upon examination of the following, or may NO 2; (c) converting HMG-CoA to mevalonate, preferably be learned through routine experimentation upon practice of the nucleotide sequence of SEQ ID NO 3; (d) phosphory the invention. lating mevalonate to mevalonate 5-phosphate, preferably the nucleotide sequence of SEQ ID NO 4; (e) converting 0017. In one embodiment, the invention provides a mevalonate 5-phosphate to mevalonate 5-pyrophosphate, method for synthesizing isopentenyl pyrophosphate in a host preferably the nucleotide sequence of SEQID NO 5; and (f) microorganism. The method comprises introducing into a converting mevalonate 5-pyrophosphate to isopentenyl host microorganism a plurality of heterologous nucleic acid pyrophosphate, preferably the nucleotide sequence of SEQ sequences, each coding for a different enzyme in the meva lonate pathway for producing isopentenyl pyrophosphate. ID NO 6. As will be appreciated by those skilled in the art, the 0021. In yet another embodiment, the invention provides mevalonate pathway involves six enzymes. The pathway expression vectors comprising the DNA fragments starts from acetyl-CoA, proceeds through the intermediate described above and elsewhere in the application, as well as mevalonic acid, and results in isopentenyl pyrophosphate. host cells transformed with such expression vectors. The Of course, additional nucleotide sequences coding for other DNA fragments, expression vectors, and host cells trans genes may be introduced as well. In particular, nucleotide formed with the same expression vectors are useful in the sequences coding for enzymes necessary in the production present methods for synthesizing isopentenyl pyrophos of specific isoprenoids may be introduced into the host phate. microorganism, along with those coding for enzymes in the mevalonate pathway. Preferably, at least one extrachromo BRIEF DESCRIPTION OF THE DRAWINGS somal expression vector will be used to introduce the desired nucleic acid sequence(s), although more than one (e.g., two) 0022 FIGS. 1A and 1B schematically illustrate the meva different expression vectors may be used. In addition, the lonate pathway of isopentenyl pyrophosphate synthesis, desired nucleic acid sequence(s) may be incorporated into along with enzymes involved and nucleic acid sequences the host microorganism’s chromosomal material. coding for Such enzymes. 0.018. In another embodiment, the invention provides a 0023 FIG. 2 is a graph illustrating the difference in the method for synthesizing isopentenyl pyrophosphate in a host concentration of lycopene produced from natural levels of microorganism by introducing into the host microorganism isopentenyl pyrophosphate in non-engineered Escherichia an intermediate of the mevalonate pathway and one or more coli and from Escherichia coli engineered to overproduce heterologous nucleic acid sequences. The introduced isopentenyl pyrophosphate from a partial mevalonate-iso sequence or sequences each code for an enzyme in the prenoid pathway, at different concentrations of mevalonate mevalonate pathway necessary for converting the interme (Mev). diate into isopentenyl pyrophosphate. Thus, for example, if 0024 FIG. 3 is a graph illustrating the difference in mevalonate is the introduced intermediate, the method normalized lycopene concentration produced from natural requires introduction of nucleic acid sequences that code for levels of isopentenyl pyrophosphate in non-engineered the enzymes necessary to convert mevalonate into isopen Escherichia coli from Escherichia coli engineered to over tenyl pyrophosphate, for example, the introduction of produce isopentenyl pyrophosphate from the complete nucleic acid sequences coding for an enzyme that phospho mevalonate-isoprenoid pathway. rylates mevalonate to mevalonate 5-phosphate, an enzyme that converts mevalonate 5-phosphate to mevalonate 5-py 0025 FIG. 4 is a graph illustrating the difference in rophosphate, and an enzyme that converts mevalonate 5-py amorphadiene concentration produced from natural levels of rophosphate to isopentenyl pyrophosphate. Of course, other isopentenyl pyrophosphate in non-engineered Escherichia intermediates in the mevalonate pathway, along with the coli and from Escherichia coli engineered to overproduce necessary nucleic acid sequences, may be introduced as isopentenyl pyrophosphate from a partial mevalonate-iso well. prenoid pathway. 0026 FIG. 5 is a gas chromatographic spectrum illustrat 0019. Although any host microorganism, e.g., a prokary ing the production of diterpene using ethyl acetate extracts ote or eukaryote, may be employed, it is preferred that a from Escherichia coli engineered to produce isoprenoids prokaryote such as Escherichia coli be used. Preferably, the from the artificial, modified MBIS operon (a partial meva host organism does not synthesize isopentenyl pyrophos lonate-isoprenoid pathway), and expressing a casbene phate through the mevalonate pathway, but rather through cyclase. the deoxyxylulose-5-phosphate (DXP) pathway. In this way, side reactions involving the intermediates of the mevalonate 0027. For reference, FIG. 6 is the mass spectrum of the pathway are minimized, thereby enhancing the yield and isoprenoid casbene. efficiency of the present methods. DETAILED DESCRIPTION OF THE 0020. In another embodiment of the invention, DNA INVENTION fragments, each coding for an enzyme in the mevalonate pathway, are provided in one or more expression vectors. 0028 Before the invention is described in detail, it is to Thus, for the mevalonate pathway, the DNA fragments be understood that, unless otherwise indicated, this inven include those that code for enzymes capable of: (a) con tion is not limited to particular sequences, expression vec densing two molecules of acetyl-CoA to acetoacetyl-CoA, tors, enzymes, host microorganisms, or processes, as Such US 2007/007761.6 A1 Apr. 5, 2007 may vary. It is also to be understood that the terminology (ordinarily RNA or DNA) to be expressed by the host used herein is for purposes of describing particular embodi microorganism. Optionally, the expression vector also com ments only, and is not intended to be limiting. prises materials to aid in achieving entry of the nucleic acid 0029. As used in the specification and the appended into the host microorganism, such as a virus, liposome, claims, the singular forms “a,”“an, and “the' include plural protein coating, or the like. The expression vectors contem referents unless the context clearly dictates otherwise. Thus, plated for use in the present invention include those into for example, reference to an “expression vector” includes a which a nucleic acid sequence can be inserted, along with single expression vector as well as a plurality of expression any preferred or required operational elements. Further, the vectors, either the same (e.g., the same operon) or different; expression vector must be one that can be transferred into a reference to “microorganism’ includes a single microorgan host microorganism and replicated therein. Preferred expres ism as well as a plurality of microorganisms; and the like. sion vectors are plasmids, particularly those with restriction sites that have been well documented and that contain the 0030. In this specification and in the claims that follow, operational elements preferred or required for transcription reference will be made to a number of terms that shall be of the nucleic acid sequence. Such plasmids, as well as other defined to have the following meanings: expression vectors, are well known to those of ordinary skill 0031. The terms “optional' or “optionally as used herein in the art. mean that the subsequently described feature or structure may or may not be present, or that the Subsequently 0036) The term “transduce” as used herein refers to the described event or circumstance may or may not occur, and transfer of a sequence of nucleic acids into a host microor that the description includes instances where a particular ganism or cell. Only when the sequence of nucleic acids feature or structure is present and instances where the becomes stably replicated by the cell does the host micro feature or structure is absent, or instances where the event or organism or cell become “transformed.” As will be appre circumstance occurs and instances where it does not. ciated by those of ordinary skill in the art, “transformation' may take place either by incorporation of the sequence of 0032. The terms “host microorganism” and “cell are nucleic acids into the cellular genome, i.e., chromosomal used interchangeably herein to refer to a living biological integration, or by extrachromosomal integration. In contrast, cell that can be transformed via insertion of an expression an expression vector, e.g., a virus, is "infective' when it vector. Thus, a host organism or cell as described herein may transduces a host microorganism, replicates, and (without be a prokaryotic organism (e.g., an organism of the kingdom the benefit of any complementary virus or vector) spreads Eubacteria) or a eukaryotic cell. As will be appreciated by progeny expression vectors, e.g., viruses, of the same type as one of ordinary skill in the art, a prokaryotic cell lacks a the original transducing expression vector to other micro membrane-bound nucleus, while a eukaryotic cell has a organisms, wherein the progeny expression vectors possess membrane-bound nucleus. A preferred prokaryotic cell is the same ability to reproduce. Escherichia coli. Preferred eukaryotic cells are those derived from fungal, insect, or mammalian cell lines. 0037. The terms “isolated” or “biologically pure” refer to material that is Substantially or essentially free of compo 0033. The term “heterologous DNA” as used herein nents that normally accompany it in its native state. refers to a polymer of nucleic acids wherein at least one of the following is true: (a) the sequence of nucleic acids is 0038. As used herein, the terms “nucleic acid sequence, foreign to (i.e., not naturally found in) a given host micro 'sequence of nucleic acids,' and variations thereof shall be organism; (b) the sequence may be naturally found in a generic to polydeoxyribonucleotides (containing 2-deoxy given host microorganism, but in an unnatural (e.g. greater D-ribose), to polyribonucleotides (containing D-ribose), to than expected) amount; or (c) the sequence of nucleic acids any other type of polynucleotide that is an N-glycoside of a comprises two or more Subsequences that are not found in purine or pyrimidine base, and to other polymers containing the same relationship to each other in nature. For example, nonnucleotidic backbones, provided that the polymers con regarding instance (c), a heterologous nucleic acid sequence tain nucleobases in a configuration that allows for base that is recombinantly produced will have two or more pairing and base stacking, as found in DNA and RNA. Thus, sequences from unrelated genes arranged to make a new these terms include known types of nucleic acid sequence functional nucleic acid. Specifically, the present invention modifications, for example, Substitution of one or more of describes the introduction of an expression vector into a host the naturally occurring nucleotides with an analog; inter microorganism, wherein the expression vector contains a nucleotide modifications, such as, for example, those with nucleic acid sequence coding for an enzyme that is not uncharged linkages (e.g., methyl phosphonates, phosphotri normally found in a host microorganism. With reference to esters, phosphoramidates, carbamates, etc.), with negatively the host microorganisms genome, then, the nucleic acid charged linkages (e.g., phosphorothioates, phosphorodithio sequence that codes for the enzyme is heterologous. ates, etc.), and with positively charged linkages (e.g., ami noalklyphosphoramidates, aminoalkylphosphotriesters); 0034. The term “mevalonate pathway' is used herein to those containing pendant moieties, such as, for example, refer to the pathway that converts acetyl-CoA to isopentenyl proteins (including nucleases, toxins, antibodies, signal pep pyrophosphate through a mevalonate intermediate. tides, poly-L-lysine, etc.); those with intercalators (e.g., 0035) The terms “expression vector” or “vector” refer to acridine, psoralen, etc.); and those containing chelators (e.g., a compound and/or composition that transduces, transforms, metals, radioactive metals, boron, oxidative metals, etc.). As or infects a host microorganism, thereby causing the cell to used herein, the symbols for nucleotides and polynucle express nucleic acids and/or proteins other than those native otides are those recommended by the IUPAC-IUB Commis to the cell, or in a manner not native to the cell. An sion of Biochemical Nomenclature (Biochemistry 9:4022, “expression vector” contains a sequence of nucleic acids 1970). US 2007/007761.6 A1 Apr. 5, 2007

0039. The term “operably linked” refers to a functional sizing isopentenyl pyrophosphate via the mevalonate path linkage between a nucleic acid expression control sequence way. (such as a promoter) and a second nucleic acid sequence, wherein the expression control sequence directs transcrip tion of the nucleic acid corresponding to the second O O Sequence. us -- us 0040. In a first embodiment, the invention provides a S-CoA S-CoA method for synthesizing isopentenyl pyrophosphate, the Acetyl-CoA + Acetyl-CoA fundamental building block ofisoprenoids, in a host micro O O organism. ---. Acetoacetyl-CoA

--O-P-O-P-OH T.I. Thus, any DNA fragment coding for an enzyme capable of carrying out this step may be used in the present method. O O Preferably, however, the DNA fragment codes for an Isopentenyl pyrophosphate acetoacetyl-CoA thiolase. Genes for such thiolases are known to those of ordinary skill in the art and include, for example, the genes of acetyl-CoA thiolase from Ralstonia Isopentenyl pyrophosphate is also known as "isopentenyl eutrophus (Peoples et al. (1989), “Poly-f-Hydroxybutyrate diphosphate' and is commonly abbreviated as “IPP” The Biosynthesis in Alcaligenes eutrophus H16” and “Charac method comprises introducing into the host microorganism terization of the Genes Encoding B-Ketothiolase and a plurality of heterologous nucleic acid sequences each Acetoacetyl-CoA Reductase.J. Biol. Chem. 264 (26):5293 coding for a different enzyme in the mevalonate pathway for 15297); Saccharomyces cerevisiae (S. cerevisiae) (Hiser et producing isopentenyl pyrophosphate. As stated previously, al. (1994). “ERG10 From Saccharomyces cerevisiae the mevalonate pathway for producing isopentenyl pyro Encodes Acetoacetyl-CoA Thiolase.J. Biol. Chem. 269 phosphate in living organisms begins with acetyl-CoA and (50):31383-31389); and Escherichia coli. It is particularly involves a mevalonate intermediate. preferred, however, that the thiolase encoded by the nucle 0041. In another method for synthesizing isopentenyl otide sequence of SEQ ID NO 1 be used in the present pyrophophate, an intermediate in the mevalonate pathway is method. introduced into the host microorganism. Although any 0044) The next step in the mevalonate pathway requires method for introducing the intermediate may be used, it is the condensation of acetoacetyl-CoA, formed from the pre preferred to add the intermediate to the culture medium used ceding step, with yet another molecule of acetyl-CoA to to grow the host microorganism. In this way, the interme form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA). This diate is transported, e.g., via passive diffusion, across the step is catalyzed enzymatically using an enzyme that will cellular membrane and into the host microorganism. condense acetoacetyl-CoA with acetyl-CoA. 0042. Either before or after the intermediate is intro duced, nucleic acid sequence(s) are introduced that code for O O those enzymes of the mevalonate pathway necessary to convert the intermediate into isopentenyl pyrophosphate. As will be appreciated by one of ordinary skill in the art, the ulus S-CoA conversion from the intermediate into isopentenyl pyrophos Acetoacetyl-CoA phate may require one, two, three, or more steps. Although O any of the intermediates, i.e., acetyl Co-A, acetoacetyl-CoA, ul-yul HMG-CoA, mevalonate, mevalonate 5-phosphate, and HO S-CoA mevalonate 5-diphosphate, may be used, introduction of HMG-CoA DL-mevalonate is a particularly preferred intermediate when using this method in the production of isopentenyl Although any DNA fragment that codes for an enzyme pyrophosphate. Enantiomers of any of the intermediates, capable of carrying out this step may be used, it is preferred Such as the bioactive enantiomer D-mevalonate, may be that the DNA fragment code for an HMG-CoA synthase. used as well. Known genes for HMG-CoA synthases include, without 0043. As shown in the schematic of FIGS. 1A and 1B, the limitation, the synthases from Blattella germanica (Mar mevalonate pathway comprises six steps and involves six tinez-Gonzalez et al. (1993), “3-Hydroxy-3-Methylglutaryl intermediates. Initially, two molecules of acetyl-coenzyme A Coenzyme-A Synthase from Blattella germanica. Cloning, (more commonly referred to as “acetyl-CoA) are com Expression, Developmental Pattern and Tissue Expression, bined. Acetyl-CoA is produced naturally by the host micro Eur: J. Biochem, 217(2), 691-699); and S. cerevisiae, and organism when it is in the presence of a suitable carbon thus, are preferred. A particularly preferred synthase is Source. For example, eukaryotic cells naturally synthesize encoded by the nucleotide sequence of SEQ ID NO 2. acetyl-CoA from compounds derived from Sugars and fats. 0045. The third step converts HMG-CoA to mevalonate. An enzyme capable of condensing two molecules of acetyl As with the other steps, this conversion is enzymatically CoA to acetoacetyl-CoA is used in this first step of synthe controlled. US 2007/007761.6 A1 Apr. 5, 2007

-continued

HO ul-X- O- pi-OH

O Mevalonate 5-phosphate HO ul-YusOH Mevalonate Although any DNA fragment coding for an enzyme capable of mevalonate phosphorylation may be used, it is preferred that a DNA fragment coding specifically for mevalonate According to the present method, a DNA fragment coding kinase be used. Genes for Such kinases are known to those for an enzyme that is capable of converting HMG-CoA into of ordinary skill in the art and include, for example, the mevalonate is included in the expression vector. The HMG mevalonate kinase of S. cerevisiae (Oulmouden et al. CoA reductase genes from Sulfolobus solfataricus (Bochar (1991), “Nucleotide Sequence of the ERG12 Gene of Sac (1997), “3-Hydroxy-3-Methylglutaryl-Coenzyme A Reduc charomyces cerevisiae Encoding Mevalonate Kinase.” Curr. tase of Sulfolobus solfataricus: DNA Sequence, Phylogeny, Genet. 19(1):9-14). A particularly preferred sequence that codes for this particular kinase is identified in SEQ ID NO Expression in Escherichia coli of the himg A Gene, and 4. Purification and Kinetic Characterization of the Gene Pro duct, J. Bacteriol. 179(11): 3632-3638); Haloferax volcanii 0048. The fifth step in the mevalonate pathway requires (Bischoff et al. (1996), “3-Hydroxy-3-Methylglutaryl-Coen the addition of a second phosphate group to mevalonate Zyme A Reductase from Haloferax volcanii: Purification, 5-phosphate. An enzyme catalyzes this step. Characterization, and Expression in Escherichia coli,' J. Bacteriol. 178(1):19-23); and S. cerevisiae (Basson et al. (1988), "Structural and Functional Conservation Between Yeast and Human 3-Hydroxy-3-Methylglutaryl Coenzyme Her A Reductases, the Rate-Limiting Enzyme of Sterol Biosyn HO ul-X- O-P-OHOH thesis, Mol Cell Biol. 8(9):3797-808) are known, and are consequently preferred for the present methods. It is par O ticularly preferred, however, that the nucleotide sequence of Mevalonate 5-phosphate SEQ ID NO 3 that encodes an HMG-CoA reductase be used in the present methods. HOul-X-s, O-P-O-P-OH "... " 0046) The nucleotide sequence defined by SEQID NO 3 that encodes an HMG-CoA reductase is a truncated version O O of the S. cerevisiae gene coding for HMG-CoA reductase, Mevalonate 5-diphosphate HMG1. The protein coded for by HMG1 is an integral membrane protein located in the endoplasmic reticulum of S. cerevisiae; it consists of a membrane-spanning, regulatory In the present method, a DNA fragment that codes for an domain in its N-terminal region (amino acids 1-552) and a enzyme capable of adding a second phosphate group to catalytically active domain in its C-terminal region. (See mevalonate 5-phosphate is used in the expression vector. Polakowski (1998), "Overexpression of a Cytosolic Preferably, the DNA fragment codes for a phosphomeva Hydroxymethylglutaryl-CoA Reductase Leads to Squalene lonate kinase, Such as the gene of the same name obtained Accumulation in Yeast. Appl. Microbiol Biotechnol. 49:66 from S. cerevisiae (Tsay et al. (1991), “Cloning and Char 71.) The nucleotide sequence defined by SEQ ID NO 3 acterization of ERG8, an Essential Gene of Saccharomyces comprises an artificial start codon, followed by nucleotides cerevisiae that Encodes Phosphomevalonate Kinase. Mol. 1660-3165 of the HMG1 sequence. Therefore, the nucle Cell. Biol. 11(2): 620-31). Such kinases are known to those otide sequence defined by SEQID NO 3 codes for only the of ordinary skill in the art and include, for example, the catalytically active portion of S. cervisiae HMG-CoA reduc kinase coded by the nucleotide sequence of SEQ ID NO 5. tase. 0049. The sixth and final step of the mevalonate pathway is the enzymatic conversion of mevalonate 5-pyrophosphate 0047 The fourth step in the mevalonate pathway into isopentenyl pyrophosphate. involves the enzymatic phosphorylation of mevalonate to form mevalonate 5-phosphate. O OH S OH OH

HOul-X- O-P-O-P-OH - -

HOul-X- OH He O O Mevalonate Mevalonate 5-pyrophosphate US 2007/007761.6 A1 Apr. 5, 2007

microorganism relies exclusively on the “deoxyxylulose -continued 5-phosphate” (or “DXP) pathway for synthesizing isopen tenyl pyrophosphate. In Such host microorganisms, the mevalonate pathway does not inherently influence (save for -- O-P-O-P-OHT.I. the additional synthesis of isopentenyl pyrophosphate) the | | host microorganism, since it lacks any genes that are O O equipped to process the proteins (i.e., enzymes) or interme Isopentenyl pyrophosphate diates associated with the mevalonate pathway. Such organ isms relying exclusively or predominately on the deoxyxy Although any DNA fragment coding for a mevalonate lulose 5-phosphate pathway include, for example, pyrophosphate decarboxylase may be used, it is particularly Escherichia coli. Of course, it will be recognized by those of preferred that the gene from S. cerevisiae (Toth et al. (1996), ordinary skill in the art that the host microorganism used in “Molecular Cloning and Expression of the cDNAs Encoding the method may also conduct isopentenyl pyrophosphate Human and Yeast Mevalonate Pyrophosphate Decarboxy synthesis via the mevalonate pathway, either exclusively or lase.J. Biol. Chem. 271 (14)7895-7898) be used. A particu in combination with the deoxyxylulose 5-phosphate path larly preferred DNA fragment is the nucleotide sequence of way. SEQ ID NO 6. 0054 Sequences of nucleic acids coding for the desired 0050. When an intermediate is introduced, the method enzymes of the mevalonate pathway are prepared by any additionally requires introduction of DNA fragments that suitable method known to those of ordinary skill in the art, code for enzymes responsible for catalyzing those steps of including, for example, direct chemical synthesis or cloning. the mevalonate pathway located “downstream” from the For direct chemical synthesis, formation of a polymer of introduced intermediate. With reference to the mevalonate nucleic acids typically involves sequential addition of pathway described above and to the biosynthetic schemes 3'-blocked and 5'-blocked nucleotide monomers to the ter provided in FIGS. 1A and 1B, one of ordinary skill in the art minal 5'-hydroxyl group of a growing nucleotide chain, can readily determine which DNA fragments and enzymatic wherein each addition is effected by nucleophilic attack of steps are necessary when a given intermediate is introduced the terminal 5'-hydroxyl group of the growing chain on the into the host microorganism. 3'-position of the added monomer, which is typically a 0051. The mevalonate pathway is contrasted with the phosphorus derivative, such as a phosphotriester, phos mevalonate-independent (or deoxyxylulose-5-phosphate) phoramidite, or the like. Such methodology is known to pathway. In some organisms, isopentenyl pyrophosphate those of ordinary skill in the art and is described in the production proceeds by condensation of pyruvate and glyc pertinent texts and literature (e.g., in D. M. Matteuci et al. eraldehyde-3-phosphate, via 1-deoxyxylulose-5-phosphate (1980) Tet. Lett. 521:719; U.S. Pat. No. 4,500,707 to Caru (DXP) as an intermediate. (See Rohmer et al. (1993) Bio thers et al.; and U.S. Patent Nos. 5,436,327 and 5,700,637 to chem. J. 295:517-524.) While some organisms have genes Southern et al.). In addition, the desired sequences may be for only one pathway, other organisms have genes for both isolated from natural sources by splitting DNA using appro pathways. For a discussion of both the mevalonate and priate restriction enzymes, separating the fragments using deoxyxylulose 5-phosphate pathways, reference is made to gel electrophoresis, and thereafter, recovering the desired Lange et al. (2000), “Isoprenoid Biosynthesis: The Evolu nucleic acid sequence from the gel via techniques known to tion of Two Ancient and Distinct Pathways Across Genom those of ordinary skill in the art, such as utilization of es. Proc. Natl. Acad. Sci. USA 97(24): 13172-13177. polymerase chain reactions. (See, for example, U.S. Pat. No. 4,683,195 to Mullis.) 0.052 Any prokaryotic or eukaryotic host microorganism may be used in the present method so long as it remains 0055 Once each of the individual nucleic acid sequences viable after being transformed with a sequence of nucleic necessary for carrying out the desired steps of the meva acids. Generally, although not necessarily, the host micro lonate pathway has been determined, each sequence must be organism is bacterial. Examples of bacterial host microor incorporated into an expression vector. Incorporation of the ganisms include, without limitation, those species assigned individual nucleic acid sequences may be accomplished to the Escherichia, Enterobacter, Azotobacter, Erwinia, through known methods that include, for example, the use of Bacillus, Pseudomonas, Klebsielia, Proteus, Salmonella, restriction enzymes (such as BamHI, EcoRI, HhaI, XhoI. Serratia, Shigella, Rhizobia, Vitreoscilla, and Paracoccus Xmal, and so forth) to cleave specific sites in the expression taxonomical classes. Preferably, the host microorganism is vector, e.g., plasmid. The restriction enzyme produces single not adversely affected by the transduction of the necessary Stranded ends that may be annealed to a nucleic acid nucleic acid sequences, the Subsequent expression of the sequence having, or synthesized to have, a terminus with a proteins (i.e., enzymes), or the resulting intermediates sequence complementary to the ends of the cleaved expres required for carrying out the steps associated with the sion vector. Annealing is performed using an appropriate mevalonate pathway. For example, it is preferred that mini enzyme, e.g., DNA ligase. As will be appreciated by those mal “cross-talk” (i.e., interference) occur between the host of ordinary skill in the art, both the expression vector and the microorganism's own metabolic processes and those pro desired nucleic acid sequence are often cleaved with the cesses involved with the mevalonate pathway. same restriction enzyme, thereby assuring that the ends of the expression vector and the ends of the nucleic acid 0053 Those of ordinary skill in the art can readily sequence are complementary to each other. In addition, identify Suitable host microorganisms. For example, cross DNA linkers may be used to facilitate linking of nucleic talk is minimized or eliminated entirely when the host acids sequences into an expression vector. US 2007/007761.6 A1 Apr. 5, 2007

0056. A series of individual nucleic acid sequences can expression vectors include, without limitation: plasmids, also be combined by utilizing methods that are known to such as pSC101, pBR322, pBBR1MCS-3, puR, pEX, those having ordinary skill in the art. (See, for example, U.S. pMR100, p(cR4, pBAD24, puC19; bacteriophages, such as Pat. No. 4,683,195 to Minshull et al.) M13 phage and w phage; as well as mutant phages, such as 0057 For example, each of the desired nucleic acid wgt-WB. Of course, such expression vectors may only be sequences can be initially generated in a separate poly Suitable for a particular host microorganism. One of ordinary merase chain reaction (PCR). Thereafter, specific primers skill in the art, however, can readily determine through are designed such that the ends of the PCR products contain routine experimentation whether any particular expression complementary sequences. When the PCR products are vector is Suited for any given host microorganism. For mixed, denatured, and reannealed, the Strands having the example, the expression vector can be introduced into the matching sequences at their 3' ends overlap and can act as host organism, which is then monitored for viability and primers for each other. Extension of this overlap by DNA expression of the sequences contained in the vector. In polymerase produces a molecule in which the original addition, reference may be made to the relevant texts and sequences are 'spliced together. In this way, a series of literature, which describe expression vectors and their suit individual nucleic acid sequences may be "spliced” together ability to any particular host microorganism. and Subsequently transduced into a host microorganism 0061 The expression vectors of the invention must be simultaneously. Thus, expression of each of the plurality of introduced or transferred into the host microorganism. Such nucleic acid sequences is effected. methods for transferring the expression vectors into host 0.058 Individual nucleic acid sequences, or “spliced” microorganisms are well known to those of ordinary skill in nucleic acid sequences, are then incorporated into an expres the art. For example, one method for transforming Escher sion vector. The invention is not limited with respect to the chia coli with an expression vector involves a calcium process by which the nucleic acid sequence is incorporated chloride treatment wherein the expression vector is intro into the expression vector. Those of ordinary skill in the art duced via a calcium precipitate. Other salts, e.g., calcium are familiar with the necessary steps for incorporating a phosphate, may also be used following a similar procedure. nucleic acid sequence into an expression vector. A typical In addition, electroporation (i.e., the application of current to expression-vector contains the desired nucleic acid sequence increase the permeability of cells to nucleic acid sequences) preceded by one or more regulatory regions, along with a may be used to transfect the host microorganism. Also, ribosome binding site, e.g., a nucleotide sequence that is 3-9 microinjection of the nucleic acid sequencers) provides the nucleotides in length and located 3-11 nucleotides upstream ability to transfect host microorganisms. Other means, such of the initiation codon in Escherchia coli. See Shine et al. as lipid complexes, liposomes, and dendrimers, may also be (1975) Nature 254.34 and Steitz, in Biological Regulation employed. Those of ordinary skill in the art can transfect a and Development. Gene Expression (ed. R. F. Goldberger), host microorganism with a desired sequence using these or vol. 1, p. 349, 1979, Plenum Publishing, N.Y., for discus other methods. sions of ribosome binding sites in Escherichia coli. 0062 For identifying a transfected host microorganism, a 0059 Regulatory regions include, for example, those variety of methods are available. For example, a culture of regions that contain a promoter and an operator. A promoter potentially transfected host microorganisms may be sepa is operably linked to the desired nucleic acid sequence, rated, using a Suitable dilution, into individual cells and thereby initiating transcription of the nucleic acid sequence thereafter individually grown and tested for expression of via an RNA polymerase enzyme. An operator is a sequence the desired nucleic acid sequence. In addition, when plas of nucleic acids adjacent to the promoter, which contains a mids are used, an often-used practice involves the selection protein-binding domain where a repressor protein can bind. of cells based upon antimicrobial resistance that has been In the absence of a repressor protein, transcription initiates conferred by genes intentionally contained within the through the promoter. When present, the repressor protein expression Vector, Such as the amp, gpt, neo, and hyg genes. specific to the protein-binding domain of the operator binds to the operator, thereby inhibiting transcription. In this way, 0063. The host microorganism is transformed with at control of transcription is accomplished, based upon the least one expression vector. When only a single expression particular regulatory regions used and the presence or vector is used (without the addition of an intermediate), the absence of the corresponding repressor protein. Examples vector will contain all of the nucleic acid sequences neces include lactose promoters (LacI repressor protein changes sary for carrying out isopentenyl pyrophosphate synthesis conformation when contacted with lactose, thereby prevent via the mevalonate pathway. Although Such an all-encom ing the LacI repressor protein from binding to the operator) passing expression vector may be used when an intermediate and tryptophan promoters (when complexed with tryp is introduced, only those nucleic acid sequencers) necessary tophan, TrpR repressor protein has a conformation that binds for converting the intermediate to isopentenyl pyrophos the operator; in the absence of tryptophan, the TrpR repres phate are required. Sor protein has a conformation that does not bind to the 0064. When two versions of an expression vector are operator). Another example includes the tac promoter. (See used (without the addition of an intermediate), nucleic acid deBoer et al. (1983) Proc. Natl. Acad. Sci. U.S.A. 80:21-25.) sequences coding for some of the six proteins (i.e., enzymes) As will be appreciated by those of ordinary skill in the art, necessary for isopentenyl synthesis via the mevalonate path these and other expression vectors may be used in the way may be contained in a first expression vector, while the present invention, and the invention is not limited in this remainder are contained in a second expression vector. respect. Again, the nucleic acid sequence(s) necessary for converting 0060 Although any suitable expression vector may be an introduced intermediate into isopentenyl pyrophosphate used to incorporate the desired sequences, readily available will be contained in the expression vector(s). As will be US 2007/007761.6 A1 Apr. 5, 2007

appreciated by those of ordinary skill in the art, a number of expression of the isomerase ensures that the conversion of different arrangements are possible, and the invention is not isopentenyl diphoshate into dimethylallyl pyrophosphate limited with respect to the particular arrangement used. does not represent a rate-limiting step in the overall pathway. 0065. Once the host microorganism has been transformed 0069. The present methods thus provide for the biosyn with the expression vector, the host microorganism is thetic production of isopentenyl pyrophosphate and iso allowed to grow. For microbial hosts, this process entails prenoids derived therefrom. As stated above, isopentenyl culturing the cells in a Suitable medium. It is important that pyrophosphate has been available only in relatively small the culture medium contain an excess carbon source, such as amounts, and the present methods provide a means for a Sugar (e.g., glucose) when an intermediate is not intro producing relatively large amounts of this important com duced. In this way, cellular production of acetyl-CoA, the pound. starting material necessary for isopentenyl pyrophosphate 0070 Further, the invention provides the ability to syn production in the mevalonate pathway, is ensured. When thesize increased amounts of isoprenoids. As stated above, added, the intermediate is present in an excess amount in the isoprenoids represent an important class of compounds and culture medium. include, for example, food and feed Supplements, flavor and 0.066 As the host microorganism grows and/or multi odor compounds, and anticancer, antimalarial, antifungal, plies, expression of the proteins (i.e., enzymes) necessary for and antibacterial compounds. Preferred isoprenoids are carrying out the mevalonate pathway, or for carrying out one those selected from the group consisting of monoterpenes, or more steps within the pathway, is effected. Once sesquiterpenes, diterpenes, Sesterterpenes, triterpenes, tet expressed, the enzymes catalyze the steps necessary for raterpenes, and steroids. As a class, terpenes are classified carrying out the steps of the mevalonate pathway, i.e., based on the number of isoprene units comprised in the converting acetyl-CoA into isopentenyl pyrophosphate. If an compound. Monoterpenes comprise ten carbons or two intermediate has been introduced, the expressed enzymes isoprene units, sesquiterpenes comprise 15 carbons or three catalyze those steps necessary to convert the intermediate isoprene units, diterpenes comprise 20 carbons or four into isopentenyl pyrophosphate. Any means for recovering isoprene units, Sesterterpenes comprise 25 carbons or five the isopentenyl pyrophosphate from the host microorganism isoprene units, and to so forth. Steroids (generally compris may be used. For example, the host microorganism may be ing about 27 carbons) are the products of cleaved or rear harvested and Subjected to hypotonic conditions, thereby ranged terpenes. lysing the cells. The lysate may then be centrifuged and the 0071 Monoterpenes include, for example, flavors such as Supernatant Subjected to high performance liquid chroma limonene, fragrances Such as citranellol, and compounds tography (HPLC). Once the isopentenyl pyrophosphate is having anticancer activity, such as geraniol. Sesquiterpenes recovered, modification may be carried out in the laboratory include, without limitation: periplanone B, a cockroach to synthesize the desired isoprenoid. hormone used to lure cockroaches into traps; artemisinin, an 0067. If desired, the isopentenyl pyrophosphate may be antimalarial drug, ginkgolide B, a platelet-activating factor left in the host microorganism for further processing into the antagonist; forskolin, an inhibitor of adenylate cyclase; and desired isoprenoid in vivo. For example, large amounts of farnesol, a compound shown to have anticancer activity. the isoprenoid lycopene are produced in Escherichia coli Nonlimiting examples of diterpenes include the antibacterial specially engineered with the expression vector pAC-LYC, and antifungal compound casbene and the drug paclitaxel. as shown in Examples 3 and 4. Lycopene can be recovered Among triterpenes (Co) and tetraterpenes (Co) are caro using any art-known means, such as those discussed above tenoids, which are used as antioxidants, coloring agents in with respect to recovering isopentenyl pyrophosphate. Lyco food and cosmetics, and nutritional Supplements (e.g., as pene is an antioxidant abundant in red tomatoes and may Vitamin A precursors). As pathways to these and other protect males from prostate cancer. (See Stahl et al. (1996) isoprenoids are already known, the invention can advanta Ach. Biochem. Biophys. 336(1): 1-9.) Of course, many other geously be incorporated into an overall scheme for produc isoprenoids can be synthesized through other pathways, and ing relatively large amounts of a desired isoprenoid. the invention is not limited with respect to the particular 0072 Conveniently, the invention also provides “downstream” pathway. Thus, the present method not only sequences, enzymes, expression vectors, and host cells or provides methods for producing isopentenyl pyrophosphate, microorganisms for carrying out the present methods. For but offers methods for producing isoprenoids as well. example, the six genes necessary for isopentenyl pyrophos 0068. Optionally, when it is desired to retain isopentenyl phate synthesis from acetyl-CoA are conveniently provided pyrophosphate in the host microorganism for further bio in SEQ ID NO 7. In addition, the invention also provides chemical processing, it is preferred that the heterologous sequences for the first three genes and the last three genes in nucleic acid sequences introduced into the host microorgan SEQ ID NOS 8 and 9, respectively. These sequences can ism also include a DNA fragment coding for an enzyme easily be included in an expression vector using techniques capable of converting isopentenyl pyrophosphate to dim described herein or other techniques well known to those of ethylallyl pyrophosphate. As appreciated by those of ordi ordinary skill in the art. In addition, the invention also nary skill in the art, a suitable isomerase will catalyze the provides host cells transformed with one or more of these conversion of isopentenyl pyrophosphate into dimethylallyl expression vectors for use in carrying out the present meth pyrophosphate. Such isomerases are known to those of ods. ordinary skill and include, for example, the isopentenyl 0073. It is to be understood that, while the invention has pyrophosphate isomerase (idi) coded by the nucleotide been described in conjunction with the preferred specific sequence of SEQ ID NO 10. Isoprenoid biosynthetic path embodiments thereof, the foregoing description is intended ways require dimethylallyl pyrophosphate, and increased to illustrate and not limit the scope of the invention. Other US 2007/007761.6 A1 Apr. 5, 2007

aspects, advantages, and modifications within the scope of followed by one cycle at 72° C. for ten minutes. Once each the invention will be apparent to those skilled in the art to gene of the operon was amplified from genomic DNA which the invention pertains. preparations, the operons were assembled by PCR reactions similar to the procedure described above, but using the 0074 All patents, patent applications and publications amplified DNA of all three genes as template DNA and only mentioned herein are hereby incorporated by reference in the forward primer of the outermost 5' gene and the reverse their entireties. primer of the outermost 3' gene. The assembled operons Experimental were isolated on 0.7% agarose gels and purified using a Qiagen gel purification kit (Valencia, Calif.) according to the 0075. The practice of the present invention will employ, manufacturers instructions. unless otherwise indicated, conventional techniques of the biosynthetic industry and the like, which are within the skill Cloning Mevalonate Operons into Sequencing and Expres of the art. Such techniques are explained fully in the sion Vectors literature. 0078. As expression of biochemical pathways is often 0076. In the following examples, efforts have been made Suboptimal from high-copy plasmids containing strong pro to ensure accuracy with respect to numbers used (e.g., moters, the artificial mevalonate operon(s) were cloned in a amounts, temperature, etc.), but some experimental error variety of expression vectors to determine the effect of and deviation should be accounted for. Unless indicated plasmid copy number and promoter strength on expression otherwise, temperature is in degrees Celsius and pressure is of the cloned pathway. Prior to testing for pathway expres at or near atmospheric pressure at sea level. All reagents, sion, the assembled operons were cloned into the pCR4 unless otherwise indicated, were obtained commercially. TOPO vector using the Invitrogen TOPOTA cloning system (Carlsbad, Calif.) for sequencing purposes. Ligation into EXAMPLE 1. pCR4 TOPO vector and transformation of Escherichia coli TOP10 cells were carried out according to the manufactur Cloning of the Mevalonate Pathway Operons er's instructions. The synthetic operons were excised from the sequenced pCR4 TOPO vectors using restriction Assembly of the Mevalonate Operons enzymes and ligated into the high-copy vector pBAD24. 0.077 Individual genes for a mevalonate-isoprenoid path which contains the arabinose-inducible araBAD promoter way were assembled to form artificial complete and at least (Guzman et al. (1995) J. Bacteriology 177:4121-4130); one functional operon. Cloning of the nucleic acid pTrc99A, which contains the IPTG-inducible tac promoter sequences coding for the enzymes of the mevalonate path (Amann et al. (1988) Gene 69:301-315); or into way was carried out and the reproduced sequences were pBBR1MCS-3 (Kovach et al. (1995) Gene 166:175-176) or divided into two operons. In one of the two operons, the last pUC19 (Yanisch-Perron et al. (1985) Gene 33:103-119), three genes of the biosynthetic pathway (mevalonate kinase which contain the unregulated Lac promoters (no plasmid (MK)—SEQ ID NO 4; phosphomevalonate kinase encoded LacI). The MevB operon was digested with PstI (PMK)—SEQ ID NO 5; and mevalonate pyrophosphate and ligated using T4 DNA ligase (New England Biolabs, decarboxylase (MPD) SEQ ID NO 6) were cloned by a Inc., Beverly, Mass.) into the PstI site of the low-copy polymerase chain reaction (PCR) as one operon by splicing vector, pBBR1MCS-3, containing P. promoter and tetra the genes together using overlap extensions (SOEing). This cycline resistance marker. The resulting plasmid, which operon is referred to as the mevalonate bottom (MevB) encodes the enzymes responsible for the conversion of operon (SEQ ID NO 9). In the second of the two operons, mevalonate to isopentenyl pyrophosphate, was named the first three genes of the pathway (acetoacetyl-CoA thio pBBRMevB. The MevT operon was cloned into the Sall site lase (atoB)-SEQ ID NO 1; HMG-CoA synthase of p3AD24 by digesting with SalI restriction enzyme and (HMGS)-SEQID NO 2; and a truncated version of HMG ligating with T4 DNA ligase. The resulting plasmid, which CoA reductase (thMGR) SEQID NO 3) were cloned as a encodes the enzymes responsible for the conversion of separate artificial operon using the same technique. This acetyl-CoA to mevalonate, was named pBADMevT. operon is referred to as the mevalonate top (MevT) operon Addition of Isopentenyl Pyrophosphate Isomerase to MevB (SEQ ID NO 8). The individual genes were isolated by PCR Operon from genomic DNA of Saccharomyces cerevisiae and Escherichia coli prepared by established microbiologic pro 0079 The syntheses of geranyl pyrophosphate (GPP), tocols. (See Sambrook et al., Molecular Cloning a Labo farnesyl pyrophosphate (FPP), and geranylgeranyl pyro ratory Manual, 3rd ed., Cold Harbor Springs Laboratory phosphate (GGPP) require both isopentenyl pyrophosphate Press.) The 100 uL PCR reactions contained 1xRfu buffer, (IPP) and its isomer, dimethylallyl pyrophosphate 1.5 mM MgSO (Stratagene, La Jolla, Calif.), 200 uM of (DMAPP), to create the backbone structure of all iso each dNTP (Gibco BRLTM, Life Technologies, Inc., Gaith prenoids. To ensure sufficient production of DMAPP from ersburg, Md.). 500 uM of each primer, 100 to 500 ng of IPP, an additional gene, idi (encoding isopentenyl pyrophos template DNA, 5% dimethyl sulfoxide (Sigma, St. Louis, phate isomerase, SEQ ID NO 10), was amplified by PCR Mo.), and 2.5 U of PfuTurbo DNA polymerase (Stratagene). from Escherichia colligenomic DNA using primers contain The reactions were carried out in a PTC-200 Peltier Thermal ing an Xmal restriction enzyme site at the 5' ends. Both the Cycler from MJ Research (South San Francisco, Calif.) with amplified product (containing idi) and p3BRMevB were the following temperature cycling program: an initial heat digested with Xmal and ligated, thereby placing idi at the 3' ing step up to 95°C. for four minutes was followed by 30 end of the MevB artificial operon. The resulting operon, cycles of 30 seconds of denaturing at 95°C., 30 seconds of containing the MevB operon and idi, is designated MBI annealing at 50° C., and 100 seconds of extension at 72°C., (SEQ ID NO 12). The resulting plasmid (containing the US 2007/007761.6 A1 Apr. 5, 2007 operon of genes that encode for enzymes that convert 0083 Escherichia coli strain DMY1 cells containing mevalonate to IPP and DMAPP) was named pBBRMBI-2. pBBRMBI-2 were able to grow on LB agar plates with 1 mMDL-mevalonate, whereas Escherichia coli DMY1 cells Addition of Polyprenyl Pyrophosphate Synthase(S) to MBI without the plasmid or with p3BR1MCS-3 (empty vector Operon control) did not grow. The MBI operon successfully con 0080. In order to direct products of the mevalonate path verted the Supplemented mevalonate to isopentenyl pyro way operons to the different classes of isoprenoids (monot phosphate and dimethylallyl pyrophosphate, thereby erpenes, sesquiterpenes, diterpenes, etc.), various polypre complementing the dxr deletion. nyl pyrophosphate synthases were cloned into the MBI 0084 Escherichia coli strain DMY1 cells containing operon, such as geranyl diphosposphate (GPP) synthase, pBADMevT and pBBRMBI-2 were able to grow on LB agar farnesyl pyrophosphate (FPP) synthase, and geranylgeranyl plates not supplemented with DL-mevalonate, whereas pyrophosphate (GGPP) synthase. Polyprenyl pyrophosphate Escherichia coli DMY1 cells without either of the plasmids synthases were cloned by PCR using forward primers with could not grow on LB agar alone. The expression of the a SacII restriction site and reverse primers with a SacI MevT and MBI operons successfully converted acetyl-CoA restriction site. Using restriction enzymes and T4 DNA to isopentenyl pyrophosphate and dimethylallyl pyrophos ligase, the polyprenyl pyrophosphate synthases were cloned phate in vivo, thereby restoring growth to Escherichia coli between the SacII and SacI sites of pBBRMBI-2. For strain DMY1, in which the native DXP isoprenoid pathway example, farnesyl pyrophosphate synthase gene ispA (SEQ is inactive. ID NO 11) was isolated by PCR from Escherichia coli genomic DNA and cloned between the SacII and SacI sites EXAMPLE 3 of pBBRMBI-2.3' of idi and the MevB operon. The resulting operon, containing the MevB operon, idi, and isp A (SEQID Production of Carotenoids from Mevalonate Using NO 11) has been designated MBIS (SEQ ID NO 13). The the MBI Artificial Operon plasmid, which encodes the enzymes responsible for the 0085. The production of a carotenoid was used to dem synthesis of farnesyl pyrophosphate (FPP) from mevalonate, onstrate the benefits of expressing the artificial mevalonate was named pBBRMBIS-2. dependent IPP biosynthetic pathway over the native Escherichia coli DXP-isoprenoid pathway. The increased EXAMPLE 2 productivity of the mevalonate-dependent isopentenyl pyro phosphate biosynthetic pathway encoded by the synthetic Functionality of the Engineered Mevalonate operons was assayed by coupling isopentenyl pyrophos Operon(s) by Growth/No-Growth Phenotype phate production to the production of lycopene. This was accomplished by co-transforming Escherichia coli with 0081 Functionality of the various genetic constructs was pAC-LYC, a low-copy broad-host plasmid that expresses the shown by expression of the artificial mevalonate-isoprenoid genes encoding the pathway for lycopene production from pathway. The plasmids were introduced into an Escherichia farnesyl pyrophosphate. The genes expressed from pAC coli host in which the mevalonate-independent (DXP) iso LYC are crtE (geranylgeranyl pyrophosphate synthase), crtB prenoid pathway was inactivated. Escherichia coli Strain (phytoene synthase), and crtI (phytoene desaturase) from DMY1 (Kuzuyama et al. (1999) Biosci. Biotechnol, Bio Erwinia herbicola, which were cloned into pACYC184 chem. 63.776-778) contains a mutation (insertion/deletion) using methods similar to those described in Examples 1 and in the gene encoding for 1-deoxyxylulose 5-phosphate 2. Escherichia coli naturally produces farnesyl pyrophos reductoisomerase (or DXR, the second step of the DXP phate from two molecules ofisopentenyl pyrophosphate and pathway) that causes inactivation of the mevalonate-inde one molecule of dimethylallyl pyrophosphate through the pendent pathway. Since this mutation is lethal to Escherichia enzyme farnesyl pyrophosphate synthase, isp A (SEQID NO coli, the Strain must be propagated in Luria-Bertoni (LB) 11). Alternatively, more flux can be directed from the medium (available from, for example, Sigma, St. Louis, mevalonate pathway to the lycopene pathway by including Mo.) containing 0.5 mM of methylerithrytol (ME), the the Escherichia coli gene encoding farnesyl pyrophosphate product of DXR; or it must have an alternate pathway for the synthase into the artificial operon(s). production of isopentenyl pyrophosphate. 0086) From previous experiments (not described herein), 0082 Cultures of Escherichia coli strain DMY1 were it was found that the production of isopentenyl pyrophos made electrocompetent according to the method of Sam phate from the mevalonate pathway operons was greater in brook et al. (above) and transformed with pBBRMBI-2, or the Escherichia coli strain DH 10B than in the Escherichia both pBBRMBI-2 and pBADMevT. Newly transformed coli strain DMY1. In order to demonstrate isopentenyl DMY1 cells were first allowed to recover on LB agar plates pyrophosphate production from the mevalonate pathway overnight, and were supplemented with 0.5 mM ME and only, the gene encoding 1-deoxyxylulose 5-phosphate appropriate antibiotics at 37° C. prior to testing growth on reductoisomerase, dxr, was inactivated in Escherichia coli media devoid of ME. DMY1 cells transformed with only strain DH1 OB by the method detailed by Datsenko et al. pBBRMBI-2 were plated on LB agar devoid of ME, but (2000), “One-step Inactivation of Chromosomal Genes in supplemented with 1 mM DL-mevalonate prepared by incu Escherichia coli K-12 Using PCR Products.PNAS97:6640 bating 1 volume of 2 MDL-mevalonic acid lactone (Sigma, 6645. In the resulting Escherichia coli strain, named St. Louis, Mo.) with 1.02 volumes of 2 M KOH at 37° C. for DPDXR1, the mevalonate independent pathway (or DXP 30 minutes. DMY1 cells transformed with both pathway) is inactive, and in order to Survive, the strain must pBBRMBI-2 and pBADMevT plasmids were plated on LB either be propagated in LB medium containing 0.5 mM of agar with antibiotics only (no ME or DL-mevalonate). All methylerithrytol (ME) or have an alternate pathway for the test plates were incubated for 48 hours at 37° C. production of isopentenyl pyrophosphate. US 2007/007761.6 A1 Apr. 5, 2007

0087. Escherichia coli strain DPDXR1 was transformed expressed using the two operons, MevT and MBI, which with p AC-LYC and pBBRMBI-2, while Escherichia coli were expressed from pBADMevT and pBBRMBI-2, respec strain DH1 OB was transformed with p AC-LYC and tively, and coupled to pAC-LYC to demonstrate the in vivo pBBR1MCS-3 (control) by electroporation. Transformants production of the carotenoid lycopene, using precursors were selected on LB agar plates Supplemented with 50 ug/ml produced by primary cellular metabolism. chloramphenicol, 10 ug/ml tetracycline, and 1 mM DL mevalonate by incubating overnight at 37°C. One colony of 0089 Escherichia coli strain DH10B was transformed each strain (Escherichia coli DPDXR1 harboring paC-LYC with pBADMevT, pBBRMBI-2, and paC-LYC by elec and pBBRMBI-2 or Escherichia coli DH10B harboring troporation. Transformants were selected on LB agar plates pAC-LYC and pBBR1MCS-3) was transferred from the LB containing 50 g/ml carbenicillin, 10 g/ml tetracycline, and agar selection plate to 5 ml of LB liquid medium also 50 ug/ml chloramphenicol. A single colony of the strain was Supplemented with 50 g/ml chloramphenicol, 10 ug/ml transferred from the LB agar plate to 5 ml of LB liquid medium containing the same antibiotics. This seed culture tetracycline, and 1 mM DL-mevalonate. These seed cultures was incubated by shaking at 37° C. until growth reached a were incubated at 37° C. until they reached a stationary stationary phase. The cell density of each seed culture was growth phase. The cell density of each seed culture was measured at ODoo, and the cells were used to inoculate 5 ml determined by measuring the optical density of the culture at test cultures of fresh LB medium plus the same antibiotics a wavelength of 600 nm (ODoo). These seed cultures were to give an ODoo of 0.03. The test cultures were incubated then used to inoculate 5 ml test cultures of LB medium with for 48 hours at 30° C., after which growth was arrested by appropriate antibiotics and increasing concentrations of DL chilling the cultures on ice. The remainder of the experi mevalonate. The volume of seed culture used to inoculate mental procedure was followed as described in Example 3. each fresh 5 ml culture was calculated to give an initial Final lycopene production (ug/ml lycopene per ODoo) of OD value of 0.03. Test cultures were incubated for 48 the pBADMevT, pBBRMBI-2, p.AC-LYC plasmid system hours at 30°C., after which growth was arrested by chilling was compared to the lycopene production from p AC-LYC the cultures on ice. The optical density of each culture was plasmid only (control) in the Escherichia coli DH 10B strain, measured. One ml of each culture was harvested by cen as shown in FIG. 3. This figure illustrates, in graph form, the trifugation (25000xg, 30 seconds), the supernatant was amount of lycopene produced for each strain, normalized for removed, and cell pellets were suspended in 500 uL of cell density, after shaking for 48 hours at 30°C. The column acetone by rapid mixing with a Fisher Vortex Genie 2TM on the left represents the amount of lycopene produced mixer (Scientific Industries, Inc., Bohemia, N.Y.). The naturally in a non-engineered Escherichia coli strain (con acetone/cell mixtures were incubated at 55° C. for 10 taining only pAC-LYC as a control). The column on the minutes to aid in the extraction of lycopene from the cells. right represents the amount of lycopene produced from an Extracted samples were centrifuged (25000xg, 7 minutes) to Escherichia coli strain engineered to overproduce isopente remove cell debris, and the cleared acetone Supernatants nyl pyrophosphate from the mevalonate-isprenoid pathway. were transferred to fresh tubes. The lycopene concentration of each acetone extraction was assayed by absorbance at 470 nm using a BeckmanTM DU640 Spectrophotometer (Beck EXAMPLE 5 man Coulter, Inc., Fullerton, Calif.) and a 400 uL quartz cuvette. Absorbance values at 470 nm were converted to Production of Terpenes by Coupling of Artificial lycopene concentrations using linear regressions from a Mevalonate Operon(s) standard curve produced using pure lycopene (Sigma, St. to Terpene Cyclases Louis, Mo.). Final lycopene concentrations of each Strain at increasing concentration of Substrate is reported in FIG. 2. 0090. Many valuable natural products were produced As shown in FIG. 2, lycopene production as a function of from the isoprenoid biosynthetic pathways described herein. Substrate concentration following shaking for 48 hours at Depending on the desired isoprenoid, the described oper 30° C. demonstrated that lycopene produced from natural on(s) were modified, and/or additional operons or other levels of isopentenyl pyrophosphate in non-engineered means for chemical synthesis were provided to produce the Escherichia coli strain DH1 OB (vertical stripes) remains precursors for the various classes. The following experi relatively constant, while lycopene produced from isopen ments demonstrated the synthesis of sesquiterpenes using tenyl pyrophosphate generated by engineered Escherichia the farnesyl pyrophosphate synthase, ispA (SEQID NO 11), coli strain DPDXR1 harboring the plasmid, pBBRMBI-2 as well as the means by which other classes of isoprenoids, (horizontal stripes), significantly increases at mevalonate Such as diterpenes, were synthesized by varying the synthase substrate concentrations of 10 mM and higher. cloned into the operon(s) to create the desired precursor. EXAMPLE 4 In vivo Production of Sesquiterpenes 0091 Amorphadiene, a precursor to the antimalarial drug Production of Carotenoids from Luria-Bertoni artemisinin, was produced from the co-expression of the Broth mevalonate-isoprenoid pathway, along with a sesquiterpene cyclase-encoding amorphadiene synthesis. The MBIS Using the Complete Mevalonate Pathway operon expressed from pBBRMBIS-2 was coupled with 0088. It was demonstrated that significantly higher levels amorpha-4,11-diene synthase (ADS) for the in vivo produc of isopentenyl pyrophosphate and isoprenoids derived there tion of the sesquiterpene amorpha-4,11-diene in Escherichia from were produced using the complete mevalonate-iso coli. prenoid operon when compared to the native DXP pathway. 0092. A gene coding for amorpha-4,11-diene synthase The complete mevalonate-isoprenoid pathway was (ADS) was constructed so that, upon translation, the amino US 2007/007761.6 A1 Apr. 5, 2007

acid sequence would be identical to that described by Merke 0095 The amorphadiene concentration of the cultures et al. (2000) Ach. Biochem. Biophys. 381(2): 173-180. The seven hours after the addition of IPTG and mevalonate is ADS gene contains recognition sequences 5' and 3' of the shown in FIG. 4. The figure shows the concentration of coding DNA corresponding to the restriction endonucleases amorphadiene produced seven hours after the addition of NcoI and Xmal, respectively. The ADS gene was digested to mevalonate and isopropylthio-f-D-galactoside (IPTG). The completion with the restriction endonucleases, along with column on the left shows the concentration of amorphadiene DNA for the plasmid pTrc99A. The 1644-bp gene fragment produced from non-engineered Escherichia coli harboring and the 4155-bp plasmid fragment were purified using 0.7% the pTRCADS plasmid alone. The column on the right agarose gels and a Qiagen gel purification kit (Valencia, shows the concentration of amorphadiene produced from Calif.) according to the manufacturers instructions. The two engineered Escherichia coli harboring the pBBRMBIS-2 fragments were then ligated using T4 DNA ligase from New and pTRCADS plasmids. The Escherichia coli strain engi England Biolabs (Beverly, Mass.), resulting in plasmid neered to make farnesyl pyrophosphate from the mevalonate pTRCADS. The insert was verified by sequencing to be the isoprenoid pathway produced 2.2 g/ml amorphadiene, amorpha-4,11-diene synthase gene. whereas the non-engineered strain (without the mevalonate isoprenoid pathway) produced only 0.13 g/ml. 0093 Escherichia coli strain DH1 OB was transformed with both the pBBRMBIS-2 and pTRCADS plasmids by In Vivo Production of Diterpenes electroporation. Bacterial colonies were then grown on 0096) The plasmid pBBRMBIS-2 was modified to Luria-Bertoni (LB) agar containing 50 g/ml carbenicillin include a gene encoding geranylgeranyl pyrophosphate Syn and 10 ug/ml tetracycline. A single bacterial colony was thase (instead of farnesyl pyrophosphate synthase). To dem transferred from the agar plates to 5 ml LB liquid medium onstrate the utility of the artificial mevalonate-isoprenoid for containing the same antibiotics and cultured by shaking at in vivo diterpene production, this modified expression sys 37° C. for 16-18 hours. Five hundred uL of this culture was tem was coupled with a plasmid expressing casbene Syn transferred into 5 ml fresh LB liquid medium with the same thase. Casbene synthase cDNA cloned into expression vec antibiotics, then cultured by shaking at 37° C. to an optical tor pET21-d (Hill et al. (1996), Arch Biochem. Biophys. density of 0.816 at 600 nm (ODoo). A 1.6 ml portion of this 336:283-289) was cut out with SalI (New England Biolabs, culture was used to inoculate a flask containing 100 ml of Beverly, Mass.) and Ncol (New England Biolabs, Beverly, LB liquid medium with 50 ug/ml carbenicillin and 10 ug/ml Mass.) and re-cloned into high-copy-number expression tetracycline, which was cultured by shaking at 37° C. After vector pTrc99A. The gene fragment and the plasmid frag 1.5 hours, 1 ml of 1 M mevalonate and 100 uL of 500 mM ment were purified with 0.7% agarose gels using a Qiagen isopropylthio-B-D-galactoside (IPTG) were added to the gel purification kit (Valencia, Calif.) according to the manu culture, and it continued to be shaken at 37° C. Amorpha facturers instructions, The two fragments were then ligated 4,11-diene concentration was determined by extracting 700 using T4 DNA ligase from New England Biolabs (Beverly, ul samples (taken hourly) with 700 ul of ethyl acetate in Mass.), resulting in plasmid pTrcCAS. glass vials. The samples were then shaken at maximum speed on a Fisher Vortex Genie 2TM mixer (Scientific Indus 0097. Escherichia coli strain DH10B was transformed tries, Inc., Bohemia, N.Y.) for three minutes. The samples with both the modified pBBRMBIS-2 and pTrcCAS plas were allowed to settle in order to separate the ethyl acetate mids by electroporation. Bacterial colonies were then grown water emulsions. Prior to gas chromatography-mass spec on Luria-Bertoni (LB) agar containing 50 ug/ml carbenicil trometry analysis, the ethyl acetate layer was transferred lin and 10 g/ml tetracycline. A single bacterial colony was with a glass Pasteur pipette to a clean glass vial. transferred from the agar plates to 5 ml LB liquid medium containing the same antibiotics and cultured by shaking at 0094 Ethyl acetate culture extracts were analyzed on a 37° C. for 16-18 hours. Five hundred microlliters of this Hewlett-Packard 6890 gas chromatograph/mass spectrom culture was transferred into 5 ml fresh LB liquid medium eter (GC/MS). A 1 ul sample was separated on the GC using with 50 lug/ml carbericillin and 10 g/ml tetracycline, and a DB-5 column (available from, for example, Agilent Tech cultured by shaking at 37° C. to an optical density of 0.816 nologies, Inc., Palo Alto, Calif.) and helium carrier gas. The at 600 nm (OD). A 150 uL portion of this culture was used oven cycle for each sample was 80° C. for two minutes, to inoculate a flask containing 25 ml of LB liquid medium increasing temperature at 30°C/minute to a temperature of with 50 g/ml carbenicillin, 10 ug/ml tetracycline, and 20 160° C., increasing temperature at 3° C./min to 170° C., mM mevalonate. This mixture was cultured by shaking at increasing temperature at 50° C./minute to 300° C., and a 37° C. After 1.5 hours, 250 uL of 100 mM IPTG were added hold at 300° C. for two minutes. The resolved samples were to the culture, and it continued to be shaken at 37° C. analyzed by a Hewlett-Packard model 5973 mass selective Casbene concentration of the culture was determined hourly detector that monitored ions 189 and 204 m/z. Previous mass by extracting 450 ul samples. To these samples was added spectra demonstrated that the amorpha-4,11-diene synthase 450 uL of ethyl acetate in a glass vial. The samples were then product was amorphadiene and that amorphadiene had a shaken on a Fisher Vortex Genie 2TM mixer (Scientific retention time of 7.9 minutes using this GC protocol. Since Industries, Inc., Bohemia, N.Y.) for three minutes. The pure standards of amorpha-4,11-diene are not available, the samples were allowed to settle in order to separate the ethyl concentrations must be quantified in terms of caryophyllene acetate-water emulsion. The ethyl acetate layer was trans equivalence. A standard curve for caryophyllene has been ferred with a glass Pasteur pipette to a clean vial. determined previously, based on a pure standard from Sigma (St. Louis, Mo.). The amorpha-4,11-diene concentration is 0098. Ethyl acetate culture extracts were analyzed on a based on the relative abundance of 189 and 204 m/z ions to Hewlett-Packard 6890 gas chromatograph/mass spectrom the abundance of the total ions in the mass spectra of the two eter (GC/MS). A 1 ul sample was separated on the CC using compounds. a DB-5 column (available from, for example, Agilent Tech US 2007/007761.6 A1 Apr. 5, 2007 13 nologies, Inc., Palo Alto) and helium carrier gas. The oven retention time of 16.6 minutes using this GC protocol. FIG. cycle for each sample was 80°C. for two minutes, increasing 5 shows the gas chromatographic analysis and resulting temperature at 10° C./minute to a temperature of 300° C. GC/MS chromatogram for the ethyl acetate extracts taken and a hold at 300° C. for two minutes. The resolved samples seven hours after addition of IPTG from Escherichia coli were analyzed by a Hewlett-Packard model 5973 mass engineered to produce isoprenoids from the artificial modi selective detector that monitored ions 229, 257, and 272 m/z. fied MBIS operon, thereby expressing the casbene cyclase Previous mass spectra had demonstrated that the casbene from the pTrcCAS plasmid. As a reference, FIG. 6 shows the synthase product was casbene and that casbene had a spectrogram for casbene.

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS : 13 <210> SEQ ID NO 1 &2 11s LENGTH 1185 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &22O > FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic Acetoacetyl-CoA thiolase nucleotide sequence <400 SEQUENCE: 1 atgaaaaatt gtgtcatcgt cagtgcggta cqtactgcta togg tagttt taacggttca 60 citc.gctt.cca ccagogc.cat cqacctgggg gcigacagtaa ttaaag.ccgc cattgaacgt. 120 gcaaaaatcg attcacaa.ca cqttgatgaa gtgattatgg gtaacgtgtt acaa.gc.cggg 18O citggggcaaa atcc.ggcgc.g. tcagg cact g ttaaaaag.cg ggctgg caga aacggtgtgc 240 ggattcacgg to aataaagt atgtggttc g g g tottaaaa gtgtgg.cgct toccgc.ccag 3OO gcc attcagg caggtoaggc goaga.gcatt gtgg.cggggg gtatggaaaa tatgagttta 360 gcc cc ctact tactc gatgc aaaag cacgc totggittatc gtc.ttggaga cqgacaggtt 420 tatgacgtaa to citgcgcga togcctdatg td.cgccaccc atggittatca tatggggatt 480 accgc.cgaala acgtggctaa agagtacgga attaccc.gtg aaatgcagga toaactgg.cg 540 ctacattcac agcgtaaagc gg cago.cgca attgagtc.cg gtgcttttac agcc gaaatc 600 gtoccggtaa atgttgtcac to gaaagaaa acctitcgtot to agtcaaga cqaatticcc.g 660 aaag.cgaatt caacggctga agcgittaggit gcattgcgcc cqgc ctitcga taaag.cagga 720 acagt caccg citgggaacgc gttctgg tatt aacgacggtg cit gcc.gctot ggtgattatg 78O gaagaatctg cqgogctggc agcaggc citt accoccotgg citc.gcattaa aagttatgcc 840 agcggtggcg toccc.ccc.gc attgatgggt atggggc.cag tacctgccac goaaaaag.cg 9 OO ttacaactogg cqgggctgca actogcggat attgatctoa ttgaggctaa toaa.gcattt 96.O gctgcacagt to cittgcc.gt toggaaaaac citgggctittg attctgagaa agtgaatgtc 1020 aacgg.cgggg ccatcgc.gct cqggcatcct atcggtgcca gtggtgctog tattotggto 1080 acact attac atgcc atgca gg cacgc gat aaaacgctgg ggctggcaac actotgcatt 1140 ggcgg.cgg to agggaattgc gatggtgatt galacggttga attaa 1185

<210> SEQ ID NO 2 &2 11s LENGTH 1476 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &22O > FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic HMG-CoA synthase nucleotide sequence

<400 SEQUENCE: 2 US 2007/007761.6 A1 Apr. 5, 2007 14

-continued atgaaactict caactaaact ttgttggtgt gg tattaaag galagacittag gocgcaaaag 60 caacaacaat tacacaatac aaacttgcaa atgactogaac taaaaaaa.ca aaag accgct 120 gaacaaaaaa cca gacctica aaatgtcggt attaaaggta tocaaattta catcc caact 18O caatgtgtca accaatctga gctagaga aa tittgatggcg titt citcaagg taaatacaca 240 attggtotgg gccaaaccala catgtc.ttitt gtcaatgaca gagaagatat citact.cgatg 3OO toccita actd ttttgttctaa gttgatcaag agttacaa.ca togacaccala caaaattggit 360 agattagaag togg tact ga aactctgatt gacaagtcca agtctgtcaa gttctgtc.ttg 420 atgcaattgt ttggtgaaaa cactgacgto: gaagg tattg acacgcttaa tocctgttac 480 ggtggtacca acgc.gttgtt caactictttgaactggattgaatctaacgc atgggatggit 540 agagacgc.ca ttgtagtttg cqgtgatatt gccatctacg ataagggtgc cqcaagacca 600 accggtggtg ccgg tact.gt togctatotgg atcggtocto atgcticcaat totatttgac 660 totgtaagag cittcttacat ggaac acgcc tacgatttitt acaagccaga titt caccago 720 gaatatoctit acgtogatgg to atttittca ttaacttgtt acgtdaaggc ticttgatcaa 78O gtttacaaga gttattocaa gaaggctatt totaaagggit togttagcga toccgctggit 840 toggatgctt tdaacgttitt gaaatattitc g actacaacg tttitccatgttccaacctgt 9 OO aaattggtoa caaaatcata cqgtagatta citatataacg atttcagagc caatcct caa 96.O ttgttcc.cag aagttgacgc cqaattagct acticgcgatt atgac gaatc tittaa.ccg at O20 aagaac attgaaaaaactitt tottaatgtt gctaagc.cat to cacaaaga gagagttgcc O8O caatctittga ttgttccaac aaacacaggit aacatgtaca cc.gcatctgt titatgcc.gc.c 14 O tittgcatcto tattaalacta tottggat.ct gacgacittac aaggcaa.gcg tdttggttta 200 ttittcttacg gttccggittt agctgcatct citatattott gcaaaattgttggtgacgtc 260 caac at atta toaaggaatt agatattact aacaa attag cca agagaat caccgaaact 320 ccaaaggatt acgaagctgc catcgaattg agagaaaatg cccatttgaa gaagaacttic 38O aaac citcaag gttccattga gcatttgcaa agtggtottt act acttgac caa.catc gat 4 40 gacaaattta gaagat citta C gatgttaaa aaataa 476

<210> SEQ ID NO 3 &2 11s LENGTH 1509 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic HMG-CoA reductase nucleotide sequence <400 SEQUENCE: 3 atggttittaa ccaataaaac agt catttct g gatcgaaag toaaaagttt atcatctg.cg 60 caatcgagct catcagg acc titcatcatct agtgaggaag atgattocc g c gatattgaa 120 agcttggata agaaaatacg toctittagaa gaattagaag cattattaag tagtggaaat 18O acaaaacaat tdaagaacaa agaggtogct gcc ttggitta titcacggtaa gttacctittg 240 tacgctittgg agaaaaaatt aggtoatact acgaga.gc.gg ttgcggtacg tagga aggct 3OO citttcaattt togg cagaagc toct9tatta gcatctgatc gtttaccata taaaaattat 360 gacitacgacc gcgtatttgg cqcttgttgt gaaaatgtta taggittacat gcc tittgcc.c 420

US 2007/007761.6 A1 Apr. 5, 2007 16

-continued citacaaggct tagagatcat gactaagtta agtaaatgta aaggcaccga tigacgaggct 9 OO gtagaalacta ataatgaact gtatgaacaa citattggaat tdataagaat aaatcatgga 96.O citgcttgtct caatcggtgt ttcto atcct ggattagaac ttattaaaaa totgagc gat 1020 gatttgagaa ttggcticcac aaaacttacc ggtgctdgto goggcggttg citctttgact 1080 ttgttacgaa gagacattac toaa.gagcaa attgacagot toaaaaagaa attgcaagat 1140 gattittagtt acgaga catt togaaacagac ttggg togga citggctgct g tttgttaa.gc 1200 gcaaaaaatt togaataaaga tottaaaatc aaatc.cc tag tatto caatt atttgaaaat 1260 aaaactacca caaagcaa.ca aattgacgat citatt attgc caggaaacac gaatttacca 1320 tggactitcat ag 1332

<210 SEQ ID NO 5 &2 11s LENGTH 1356 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic Phosphomevalonate kinase nucleotide sequence <400 SEQUENCE: 5 atgtcagagt toga gag cctt cagtgc.ccca gggaaag.cgit tactagotgg toggatattta 60 gttittagata caaaatatga agcatttgta gtcggattat cqgcaagaat gcatgctgta 120 gcc catccitt acggttcatt gcaagggtct gataagtttg aagtgcgtgt gaaaagtaaa 18O caatttaaag atggggagtg gotgtaccat ataagttccta aaagtggctt cattcctgtt 240 to gatagg.cg gatctaagaa ccctttcatt gaaaaagtta togctaacgt atttagctac 3OO tittaaaccita acatggacga citact.gcaat agaaacttgttcgittattga tattittctot 360 gatgatgcct accattct ca ggaggatago gttaccgaac atcgtggcaa cagaagattg 420 agttitt catt cqcacaga at tdaagaagtt cocaaaa.cag ggctdggctic citcgg caggt 480 ttagtcacag titttaactac agctttggcc toctitttittg tatcgg acct ggaaaataat 540 gtag acaaat atagagaagt tattoata at ttagcacaag ttgct cattg toaa.gcticag 600 ggtaaaattg gaag.cgggitt to atgtag cq goggcagoat atggatctat cagatataga 660 agattoccac cc.gcattaat citctaatttg ccagatattg gaagtgctac ttacggcagt 720 aaactggcgc atttggttga tigaagaagac to gaatatta cqattaaaag talaccattta 78O cctt.cgggat taactittatg gatggg.cgat attaagaatg gttcagaaac agtaaaactg 840 gtoc agaagg taaaaaattg gtatgatticg catatgc.cag aaagcttgaa aatatataca 9 OO gaactc gatc atgcaaattic tag atttatg gatggacitat citaalactaga togcttacac 96.O gag act catg acgattacag cqatcagata tittgagt citc ttgagaggaa toactgtacc 1020 tgtcaaaagt atcctgaaat cacagaagtt agagatgcag ttgccacaat tag acgttcc 1080 tittagaaaaa talactaaaga atctggtgcc gat atcgaac citcc.cgtaca alactagotta 1140 ttggatgatt gccagaccitt aaaaggagtt cittacittgct taatacctgg togctggtggit 1200 tatgacgc.ca ttgcagtgat tactaagcaa gatgttgatc ttagggotca aaccqctaat 1260 gacaaaagat tittctaaggit toaatggctg gatgtaacto aggctgact g g g g tottagg 1320 aaagaaaaag atc.cggaaac ttatcttgat aaatag 1356 US 2007/007761.6 A1 Apr. 5, 2007 17

-continued

<210> SEQ ID NO 6 &2 11s LENGTH 1191. &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic Mevalonate pyrophosphate decarboxylase nucleotide sequence

<400 SEQUENCE: 6 atgaccgttt acacago atc cqttaccgca ccc.gtcaa.ca togcaa.ccct taagtattgg 60 gggaaaaggg acacgaagtt gaatctg.ccc accalatt.cgt coatato agt gactittatcg 120 caagatgacc to agaacgtt gaccitctg.cg gct actocac citgagtttga acgcgacact 18O ttgtggittaa atggagaacc acacago atc gacaatgaaa gaactcaaaa ttgttctg.cgc 240 gaccitacgcc aattaagaaa goaaatggaa togaaggacg cct cattgcc cacattatct 3OO caatggaaac toccacattgt citc.cgaaaat a acttitccta cagoagctgg tittagct tcc 360 to cqctgctg gctittgctgc attggtotcit gcaattgcta agittatacca attaccacag 420 tdaactitcag aaatatotag aatagdaaga aagggg.tctg gttcagottg tag atcgttg 480 tittggcggat acgtggcc to ggaaatggga aaagctgaag atggtoatga titc catggca 540 gtacaaatcg cagacagotc tdactggcct cagatgaaag cittgttgtcct agttgtcago 600 gatattaaaa aggatgtgag titcCactcag g g tatgcaat tdaccgtggC aacct cogaa 660 citatttaaag aaagaattga acatgtcgta ccaaagagat ttgaagttcat gcgtaaag.cc 720 attgttgaaa aagattitcgc caccitttgca aaggaaacaa to atggattic caactictittc 78O catgccacat gtttgg acto tttcc citcca atattotaca togaatgacac titccaag.cgt 840 atcatcagtt gotgcc acac cattaatcag titttacggag aaacaatcgt to catacacg 9 OO tittgatgcag gtccaaatgc tigtgttgtac tacttagctgaaaatgagtc. gaaactctitt 96.O gcatttatct ataaattgtt togctctgtt cotggatggg acaagaaatt tactact gag 1020 cagott gagg citttcaacca totaatttgaa to atctaact titact gcacg tdaattggat 1080 cittgagttgc aaaaggatgt toccagagtg attittaacto aagttcggttc aggcc cacaa 1140 gaaacaaacg aatctttgat tdacgcaaag actggtotac caaaggaata a 1.191

<210 SEQ ID NO 7 &2 11s LENGTH 9253 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic 'single operon" nucleotide sequence <400 SEQUENCE: 7 gacgctttitt atc.gcaactc. tctactgttt citccatacco gtttittittgg gctagoagga 60 ggaatticacic atggtacccg g gaggaggat tactatatgc aaacggalaca C gtcattitta 120 ttgaatgcac agg gagttcc cacgggtacg citggaaaagt atgcc.gcaca cacgg cagac 18O acco gottac atctogcgtt citccagttgg citgtttaatg ccaaaggaca attattagtt 240 acco go.cgc.g. cactgagcaa aaaag catgg cct gg.cgtgt ggactaactic ggitttgttggg 3OO cacccacaac togg gagaaag caacgaagac goagtgatcc gcc gttgcc.g. titatgagctt 360 ggcgtggaaa ttacgc.citcc tdaatctato tatcc to act titcgctacc g c gccacc gat 420

US 2007/007761.6 A1 Apr. 5, 2007 25

-continued tgcc cc aggg aaag.cgttac tagctggtgg atatttagtt ttagatacaa aatatgaagc 1680 atttgtag to ggattatcgg caagaatgca totgtagcc catcc ttacg gttcattgca 1740 agggtotgat aagtttgaag togc gtgttgaa aagtaaacaa tittaaagatg g g gagtggct 1800 gtaccatata agticcitaaaa gtggcttcat toctotttcg atagg.cggat citaagaacco 1860 tittcattgaa aaagttatcg citaacgtatt tagctactitt aaacctaaca toggacgacta 1920 citgcaataga aacttgttcg ttattgatat tittctdtgat gatgcctacc attctdagga 1980 ggatagogtt accgaacatc gtggcaa.cag aagattgagt titt catt.cgc acaga attga 20 40 agaagttc.cc aaaacagggc tigggctocto ggcaggttta gtcacagttt talactacago 2100 tittggc citcc tttitttgtat cqgacctgga aaataatgta gacaaatata gagaagttat 216 O toataattta gcacaagttg citcattgtca agcto agggit aaaattggaa gogggtttga 2220 tgtagcgg.cg gcagoatatg gatctatoag atatagaaga titc.ccaccc.g. cattaatcto 228O taatttgcca gatattggaa gtgct actta cqg cagtaaa citggcgcatt togttgatga 234. O agaag actgg aat attacga ttaaaagtaa ccatttacct tcgggattaa citt tatggat 24 OO ggg.cgatatt aagaatggitt Cagaalacagt aaaactogto: Cagaaggtaa aaaattggta 2460 tgattogcat atgccagaaa gottgaaaat atatacagaa citc gatcat g caa attctag 252O atttatggat ggacitatcta alactagat.cg cittacac gag act catgacg attacagoga 258O toagatattt gag totcittg a gaggaatga citgtacctgt caaaagtatc. citgaaatcac 264 O agaagttaga gatgcagttg ccaca attag acgttcc titt agaaaaataa citaaagaatc 27 OO tggtgc.cgat atc galaccitc cc.gtacaaac tag cittattg gatgattgcc agaccittaaa 276 O. aggagttctt acttgcttaa tacctggtgc tiggtggittat gacgc.cattg cagtgattac 282O taag caagat gttgat citta gggctcaaac cqctaatgac aaaagattitt cita aggttca 2880 atggctggat gtaacticagg citg actdggg tottaggaaa gaaaaagatc cqgaaactta 2.940 tottgataaa taggaggtaa tactcatgac cqtttacaca gcatc.cgitta cc.gcaccc.gt 3OOO caa.catc.gca accottaagt attgggggaa aaggg acacg aagttgaatc tocccaccala 3060 titcg to cata toagtgacitt tatcgcaaga tigaccitcaga acgttgacct citgcggctac 312 O tgcaccitgag tittgaacg.cg acactttgttg gttaaatgga galaccacaca gcatcgacaa 318O tgaaagaact caaaattgtc. tcc.gc gacct acgc.caatta agaaaggaaa toggaatcgaa 324 O ggacgc.ctica ttgcc.cacat tat citcaatg gaalacto cac attgtc.t.ccg aaaataactt 33OO toctacagoa gctggtttag cittcc toc go togctggctitt gctgcattgg totctgcaat 3360 tgctaagtta taccaattac cacagtcaac titcagaaata totagaatag caagaaaggg 342O gtotggttca gcttgtag at C gttgtttgg cqgatacgtg gcc toggaaa toggaaaag.c 3480 tgaagatggit catgattcca togg cagtaca aatc.gcagac agotctgact ggcct cagat 354. O gaaagcttgt gtoctagttg to agcigatat taaaaaggat gtgagttcca citcagggitat 3600 gcaattgacc gtggcaacct cogalactatt taaagaaaga attgaac at g togtaccalaa 3660 gagatttgaa gtcatgcgta aagcc attgttgaaaaagat titcgccacct ttgcaaagga 372 O aacaatgatg gattccaact cittitccatgc cacatgtttg gacitcttitcc citccaatatt 378 O. citacatgaat gacactitcca agc gitatcat cagttggtgc cacac catta atcagttitta 384 O cggagaaa.ca atcgttgcat acacgtttga tigcaggtoca aatgctgtgt totactactt 39 OO

US 2007/007761.6 A1 Apr. 5, 2007 32

-continued ggcgaa.gcaa acgcgattct c gctggcgac gotttacaaa cqctdgc gtt citcgattitta 5 160 agcgatgc.cg atatgc.cgga agtgtcggac cqc gacagaa titt.cgatgat ttctgaactg 5220 gc gag.cgc.ca gtgg tattgc cqgaatgtgc ggtgg to agg cattagattt agacgcggaa 528 O ggcaaacacg tacctotgga C go gottgag cqtatto atc gtcataaaac cqgcgcattg 5340 attcgc.gc.cg cc.gttcgcct togtgcatta agcgc.cggag ataaaggacg togtgctctg 5 400 cc.gg tact.cg acaagtatgc agaga.gcatc ggccttgcct tcc aggttca ggatgacatc 546 O citggatgtgg togg gagatac togcaacgttg ggaaaacgcc agggit gcc.ga ccagoaactt 552O ggtaaaagta cct accotgc acttctgggit cittgagcaag ccc.ggaagaa agc.ccgg gat 558 O citgatcgacg atgcc.cgtca gtc.gctgaaa caactggctd aac agtcact c gatacctog 5640 gcactggaag cqctagogga citacatcatc cagcgtaata aataagagct coaattcgc.c 5700 citat agtgag togtattacg cqc.gctoact gg.ccgtogtt ttacaacgtc gtgactggga 576 O. aaac cotggc gttacccaac ttaatc.gc.ct to cago.acat coccotttcg ccagotggcg 582O taatagog aa gaggc.ccgca cc gatc.gc.cc titc.ccaa.cag ttgcgcagoc togaatgg.cga 588 O atggaaattg taag.cgittaa tattttgtta aaattic.gc.gt taaattitttgttaaatcago 594 O toatttittta accaataggc cqa 5963

1.-60. (canceled) 62. The transformed host cell of claim 61, wherein the one 61. A transformed host cell that synthesizes an isoprenoid or more heterologous nucleic acids is integrated into the or an isoprenoid precursor via a mevalonate pathway, chromosome of the host cell. 63. The transformed host cell of claim 61, wherein the one wherein the transformed host cell is a prokaryote that does or more heterologous nucleic acids is contained in at least not normally synthesize isopentenyl pyrophosphate one extrachromosomal expression vector. (IPP) through the mevalonate pathway, wherein the 64. The transformed host cell of claim 61, wherein the one transformed host cell comprises one or more nucleic or more heterologous nucleic acids is present in a single acids heterologous to the host cell, wherein the one or expression vector. more heterologous nucleic acids comprises nucleotide 65. The transformed host cell of claim 61, wherein the sequences that encode two or more mevalonate path transformed host cell overproduces the isoprenoid or iso way enzymes, and wherein said two or more meva prenoid precursor by at least about 5 fold as compared to a lonate pathway enzymes comprises an enzyme that control host cell that is not transformed with the one or more condenses two molecules of acetyl-CoA to acetoacetyl heterologous nucleic acids. CoA as the first step in the synthesis of the isoprenoid 66. The transformed host cell of claim 61, wherein the or isoprenoid precursor, and one or more additional isoprenoid precursor is mevalonate. mevalonate pathway enzymes selected from: 67. The transformed host cell of claim 61, wherein the transformed host cell further comprises a heterologous (a) an enzyme that condenses acetoacetyl-CoA with nucleic acid comprising a nucleotide sequence coding iso acetyl-CoA to form HMG-CoA: pentenyl pyrophosphate isomerase. 68. The transformed host cell of claim 67, wherein the (b) an enzyme that converts HMG-CoA to mevalonate; isoprenoid precursor is IPP, and wherein the IPP is further (c) an enzyme that phosphorylates mevalonate to meva modified enzymatically by the action of the isopentenyl lonate 5-phosphate; pyrophosphate isomerase to generate dimethylallyl pyro phosphate (DMAPP). (d) an enzyme that converts mevalonate 5-phosphate to 69. The transformed host cell of claim 68, wherein the mevalonate 5-pyrophosphate, and transformed host cell further comprises a heterologous (e) an enzyme that converts mevalonate 5-pyrophosphate nucleic acid comprising a nucleotide sequence encoding one to isopentenyl pyrophosphate, or more polyprenyl pyrophosphate synthases. 70. The transformed host cell of claim 69, wherein the wherein culturing of said transformed host cell in a DMAPP is further modified enzymatically with the one or suitable medium provides for production of the two or more polyprenyl pyrophosphate synthases to provide an more enzymes and synthesis of the isoprenoid or iso isoprenoid. prenoid precursor in a recoverable amount of at least 71. The transformed host cell of claim 70, wherein the about 1 mg/L. isoprenoid is a monoterpene. US 2007/007761.6 A1 Apr. 5, 2007

72. The transformed host cell of claim 71, wherein the 100. The transformed host cell of claim 61, wherein the monoterpene is selected from limonene, citranellol, and nucleotide sequence encoding the enzyme that condenses geraniol. acetoacetyl-CoA with acetyl-CoA to form HMG-CoA com 73. The transformed host cell of claim 70, wherein the prises the nucleotide sequence set forth in SEQ ID NO:2. isoprenoid is a sesquiterpene. 101. The transformed host cell of claim 61, wherein the 74. The transformed host cell of claim 73, wherein the nucleotide sequence encoding the enzyme that converts sesquiterpene is selected from periplanone B, artemisinin, HMG-CoA to mevalonate comprises the nucleotide ginkgolide B, forskolin, and faroesol. sequence set forth in SEQ ID NO:3. 75. The transformed host cell of claim 70, wherein the 102. The transformed host cell of claim 61, wherein the isoprenoid is a diterpene. nucleotide sequence encoding the enzyme that phosphory 76. The transformed host cell of claim 75, wherein the lates mevalonate to mevalonate 5-phosphate comprises the diterpene is selected from casbene and paclitaxel. nucleotide sequence set forth in SEQ ID NO:4. 77. The transformed host cell of claim 70, wherein the 103. The transformed host cell of claim 61, wherein the isoprenoid is a triterpene. nucleotide sequence encoding the enzyme that converts 78. The transformed host cell of claim 70, wherein the mevalonate 5-phosphate to mevalonate 5-pyrophosphate isoprenoid is a tetraterpene. comprises the nucleotide sequence set forth in SEQ ID 79. The transformed host cell of claim 70, wherein the NO:5. isoprenoid is a steroid. 104. The transformed host cell of claim 61, wherein the 80. The transformed host cell of claim 70, wherein the nucleotide sequence encoding the enzyme that converts isoprenoid is lycopene. mevalonate 5-pyrophosphate to isopentenyl pyrophosphate 81. The transformed host cell of claim 70, wherein the comprises the nucleotide sequence set forth in SEQ ID isoprenoid is casbene. NO:6. 82. The transformed host cell of claim 70, wherein the 105. The transformed host cell of claim 67, wherein the isoprenoid is amorphadiene. nucleotide sequence encoding the isopentenyl pyrophos 83. The transformed host cell of claim 61, wherein the phate isomerase comprises the nucleotide sequence set forth transformed host cell is of a genus selected from Escheri in SEQ ID NO:10. chia, Enterobacter, Azotobacter, Erwinia, Bacillus, 106. The transformed host cell of claim 61, wherein the Pseudomonas, Klebsiella, Proteus, Salmonella, Serratia, one or more heterologous nucleic acids comprises the nucle Shigella, Rhizobia, Vitreoscilla, and Paracoccus. otide sequence set forth in SEQID NO:8. 84. The transformed host cell of claim 61, wherein the 107. The transformed host cell of claim 61, wherein the transformed host cell is of the genus Escherichia. one or more heterologous nucleic acids comprises the nucle 85. The transformed host cell of claim 61, wherein the otide sequence set forth in SEQ ID NO:9. transformed host cell is an Escherichia coli. 108. The transformed host cell of claim 61, wherein said 86. The transformed host cell of claim 61, wherein the transformed host cell also synthesizes IPP via a DXP path transformed host cell is of the genus Enterobacter. way. 87. The transformed host cell of claim 61, wherein the 109. The transformed host cell of claim 61, wherein said transformed host cell is of the genus Azotobacter: transformed host cell comprises an inactivated DXP path 88. The transformed host cell of claim 61, wherein the way. transformed host cell is of the genus Erwinia. 110. A genetically modified host cell that synthesizes an 89. The transformed host cell of claim 61, wherein the isoprenoid or an isoprenoid precursor via a mevalonate transformed host cell is of the genus Bacillus. pathway, 90. The transformed host cell of claim 61, wherein the wherein the transformed host cell is a prokaryote that does transformed host cell is of the genus Pseudonmonas. not normally synthesize isopentenyl pyrophosphate 91. The transformed host cell of claim 61, wherein the (IPP) through the mevalonate pathway, wherein the transformed host cell is of the genus Klebsiella. transformed host cell comprises one or more nucleic 92. The transformed host cell of claim 61, wherein the acids heterologous to the host cell, wherein the one or transformed host cell is of the genus Proteus. more heterologous nucleic acids comprise nucleotide 93. The transformed host cell of claim 61, wherein the sequences that encode two or more mevalonate path transformed host cell is of the genus Salmonella. way enzymes, and wherein said two or more meva 94. The transformed host cell of claim 61, wherein the lonate pathway enzymes comprises an enzyme that transformed host cell is of the genus Serratia. condenses two molecules of acetyl-CoA to acetoacetyl 95. The transformed host cell of claim 61, wherein the CoA as the first step in the synthesis of the isoprenoid transformed host cell is of the genus Shigella. or isoprenoid precursor, and one or more additional 96. The transformed host cell of claim 61, wherein the mevalonate pathway enzymes selected from: transformed host cell is of the genus Rhizobia. (a) an enzyme that condenses acetoacetyl-CoA with 97. The transformed host cell of claim 61, wherein the acetyl-CoA to form HMG-CoA: transformed host cell is of the genus Vitreoscilla. 98. The transformed host cell of claim 61, wherein the (b) an enzyme that converts HMG-CoA to mevalonate: transformed host cell is of the genus Paracoccus. (c) an enzyme that phosphorylates mevalonate to meva 99. The transformed host cell of claim 61, wherein the lonate 5-phosphate; nucleotide sequence encoding the enzyme that condenses two molecules of acetyl-CoA to acetoacetyl-CoA comprises (d) an enzyme that converts mevalonate 5-phosphate to the nucleotide sequence set forth in SEQ ID NO:1. mevalonate 5-pyrophosphate, and US 2007/007761.6 A1 Apr. 5, 2007 34

(e) an enzyme that converts mevalonate 5-pyrophosphate 129. The transformed host cell of claim 119, wherein the to isopentenyl pyrophosphate, isoprenoid is lycopene. 130. The transformed host cell of claim 119, wherein the and wherein said nucleotide sequences are present in two isoprenoid is casbene. or more operons, 131. The transformed host cell of claim 119, wherein the wherein culturing of said transformed host cell in a isoprenoid is amorphadiene. suitable medium provides for production of the two or 132. The transformed host cell of claim 110, wherein the more enzymes and synthesis of the isoprenoid or iso transformed host cell is of a genus selected from Escheri prenoid precursor. chia, Enterobacter, Azotobacter, Erwinia, Bacillus, 111. The transformed host cell of claim 110, wherein said Pseudomonas, Klebsiella, Proteus, Salmonella, Serratia, culturing provides for synthesis of the isoprenoid or iso Shigella, Rhizobia, Vitreoscilla, and Paracoccus. prenoid precursor in a recoverable amount of at least about 133. The transformed host cell of claim 10, wherein the 1 mg/L. transformed host cell is of the genus Escherichia. 112. The transformed host cell of claim 110, wherein the 134. The transformed host cell of claim 10, wherein the one or more heterologous nucleic acids is integrated into the transformed host cell is an Escherichia coli. chromosome of the host cell. 135. The transformed host cell of claim 110, wherein the 113. The transformed host cell of claim 110, wherein the transformed host cell is of the genus Enterobacter: one or more heterologous nucleic acids is contained in at 136. The transformed host cell of claim 110, wherein the least one extrachromosomal expression vector. transformed host cell is of the genus Azotobacter: 114. The transformed host cell of claim 110, wherein the 137. The transformed host cell of claim 110, wherein the one or more heterologous nucleic acids is present in a single transformed host cell is of the genus Erwinia. expression vector. 138. The transformed host cell of claim 110, wherein the 115. The transformed host cell of claim 110, wherein the transformed host cell is of the genus Bacillus. transformed host cell overproduces the isoprenoid or iso 139. The transformed host cell of claim 110, wherein the prenoid precursor by at least about 5 fold as compared to a transformed host cell is of the genus Pseudomonas. control host cell that is not transformed with the one or more 140. The transformed host cell of claim 110, wherein the heterologous nucleic acids. transformed host cell is of the genus Klebsiella. 116. The transformed host cell of claim 110, wherein the 141. The transformed host cell of claim 110, wherein the transformed host cell further comprises a heterologous transformed host cell is of the genus Proteus. nucleic acid comprising a nucleotide sequence coding iso 142. The transformed host cell of claim 110, wherein the pentenyl pyrophosphate isomerase. transformed host cell is of the genus Salmonella. 117. The transformed host cell of claim 116, wherein the 143. The transformed host cell of claim 110, wherein the isoprenoid precursor is IPP, and wherein the IPP is further transformed host cell is of the genus Serratia. modified enzymatically by the action of the isopentenyl 144. The transformed host cell of claim 110, wherein the pyrophosphate isomerase to generate dimethylallyl pyro transformed host cell is of the genus Shigella. phosphate (DMAPP). 145. The transformed host cell of claim 110, wherein the 118. The transformed host cell of claim 110, wherein the transformed host cell is of the genus Rhizobia. transformed host cell further comprises a heterologous 146. The transformed host cell of claim 110, wherein the nucleic acid comprising a nucleotide sequence encoding one transformed host cell is of the genus Vitreoscilla. or more polyprenyl pyrophosphate synthases. 147. The transformed host cell of claim 110, wherein the 119. The transformed host cell of claim 118, wherein the transformed host cell is of the genus Paracoccus. DMAPP is further modified enzymatically with the one or 148. The transformed host cell of claim 110, wherein the more polyprenyl pyrophosphate syntheses to provide an nucleotide sequence encoding the enzyme that condenses isoprenoid. two molecules of acetyl-CoA to acetoacetyl-CoA comprises 120. The transformed host cell of claim 119, wherein the the nucleotide sequence set forth in SEQ ID NO:1. isoprenoid is a monoterpene. 149. The transformed host cell of claim 110, wherein the 121. The transformed host cell of claim 120, wherein the nucleotide sequence encoding the enzyme that condenses monoterpene is selected from limonene, citranellol, and acetoacetyl-CoA with acetyl-CoA to form HMG-CoA com geraniol. prises the nucleotide sequence set forth in SEQ ID NO:2. 122. The transformed host cell of claim 119, wherein the 150. The transformed host cell of claim 110, wherein the isoprenoid is a sesquiterpene. nucleotide sequence encoding the enzyme that converts 123. The transformed host cell of claim 122, wherein the HMG-CoA to mevalonate comprises the nucleotide sesquiterpene is selected from periplanone B, artemisinin, sequence set forth in SEQ ID NO:3. ginkgolide B, forskolin, and farnesol. 151. The transformed host cell of claim 110, wherein the 124. The transformed host cell of claim 119, wherein the nucleotide sequence encoding the enzyme that phosphory isoprenoid is a diterpene. lates mevalonate to mevalonate 5-phosphate comprises the 125. The transformed host cell of claim 124, wherein the nucleotide sequence set forth in SEQ ID NO:4. diterpene is selected from casbene and paclitaxel. 152. The transformed host cell of claim 110, wherein the 126. The transformed host cell of claim 119, wherein the nucleotide sequence encoding the enzyme that converts isoprenoid is a triterpene. mevalonate 5-phosphate to mevalonate 5-pyrophosphate 127. The transformed host cell of claim 119, wherein the comprises the nucleotide sequence set forth in SEQ ID isoprenoid is a tetraterpene. NO:5. 128. The transformed host cell of claim 119, wherein the 153. The transformed host cell of claim 110, wherein the isoprenoid is a steroid. nucleotide sequence encoding the enzyme that converts US 2007/007761.6 A1 Apr. 5, 2007 mevalonate 5-pyrophosphate to isopentenyl pyrophosphate (b) an enzyme that condenses acetoacetyl-CoA with comprises the nucleotide sequence set forth in SEQ ID acetyl-CoA to form HMG-CoA: NO:6. 154. The transformed host cell of claim 110, wherein the (c) an enzyme that converts HMG-CoA to mevalonate; nucleotide sequence encoding the isopentenyl pyrophos (d) an enzyme that phosphorylates mevalonate to meva phate isomerase comprises the nucleotide sequence set forth lonate 5-phosphate; in SEQ ID NO:10. 155. The transformed host cell of claim 110, wherein the (e) an enzyme that converts mevalonate 5-phosphate to one or more heterologous nucleic acids comprises the nucle mevalonate 5-pyrophosphate; otide sequence set forth in SEQ ID NO:8. (f) an enzyme that converts mevalonate 5-pyrophosphate 156. The transformed host cell of claim 110, wherein the to isopentenyl pyrophosphate (IPP), and one or more heterologous nucleic acids comprises the nucle otide sequence set forth in SEQ ID NO:9. g) an enzyme that isomerizes IPP to dimethylallyl pyro 157. The transformed host cell of claim 110, wherein said phosphate (DMAPP): transformed host cell also synthesizes IPP via a DXP path way. wherein culturing of said transformed host cell in a 158. The transformed host cell of claim 110, wherein said suitable medium provides for production of the transformed host cell comprises an inactivated DXP path enzymes and synthesis of the isoprenoid or isoprenoid way. precursor. 159. A transformed Escherichia coli host cell that syn 163. The method of claim 162, wherein said nucleotide thesizes an isoprenoid or an isoprenoid precursor via a sequences are present in two or more operons. mevalonate pathway, 164. The transformed host cell of claim 162, wherein said transformed host cell comprises an inactivated DXP path wherein the transformed host cell comprises one or more way. nucleic acids heterologous to the host cell, wherein the 165. A transformed Escherichia coli host cell that syn one or more heterologous nucleic acids comprise nucle thesizes an isoprenoid or an isoprenoid precursor via a otide sequences that encode: mevalonate pathway, (a) an enzyme that condenses two molecules of acetyl wherein the transformed host cell comprises one or more CoA to acetoacetyl-CoA as the first step in the synthesis nucleic acids heterologous to the host cell, wherein the of the isoprenoid or isoprenoid precursor, one or more heterologous nucleic acids comprise nucle (b) an enzyme that condenses acetoacetyl-CoA with otide sequences that encode two or more mevalonate acetyl-CoA to form HMG-CoA: pathway enzymes, and wherein said two or more meva lonate pathway enzymes comprises an enzyme that (c) an enzyme that converts HMG-CoA to mevalonate; condenses two molecules of acetyl-CoA to acetoacetyl (d) an enzyme that phosphorylates mevalonate to meva CoA as the first step in the synthesis of the isoprenoid lonate 5-phosphate; or isoprenoid precursor, and one or more additional (e) an enzyme that converts mevalonate 5-phosphate to mevalonate pathway enzymes selected from: mevalonate 5-pyrophosphate, and (a) an enzyme that condenses acetoacetyl-CoA with (f) an enzyme that converts mevalonate 5-pyrophosphate acetyl-CoA to form HMG-CoA: to isopentenyl pyrophosphate, (b) an enzyme that converts HMG-CoA to mevalonate: wherein culturing of said transformed host cell in a (c) an enzyme that phosphorylates mevalonate to meva suitable medium provides for production of the lonate 5-phosphate; enzymes and synthesis of the isoprenoid or isoprenoid precursor. (d) an enzyme that converts mevalonate 5-phosphate to 160. The method of claim 159, wherein said nucleotide mevalonate 5-pyrophosphate, and sequences are present in two or more operons. (e) an enzyme that converts mevalonate 5-pyrophosphate 161. The transformed host cell of claim 159, wherein said to isopentenyl pyrophosphate, transformed host cell comprises an inactivated DXP path way. and wherein said nucleotide sequences are present in two 162. A transformed Escherichia coli host cell that syn or more operons, thesizes an isoprenoid or an isoprenoid precursor via a mevalonate pathway, wherein culturing of said transformed host cell in a suitable medium provides for production of the two or wherein the transformed host cell comprises one or more more enzymes and synthesis of the isoprenoid or iso nucleic acids heterologous to the host cell, wherein the prenoid precursor. one or more heterologous nucleic acids comprise nucle 166. The transformed host cell of claim 165, wherein said otide sequences that encode: transformed host cell comprises an inactivated DXP path (a) an enzyme that condenses two molecules of acetyl way. CoA to acetoacetyl-CoA as the first step in the synthesis of the isoprenoid or isoprenoid precursor,