DOCSLIB.ORG

Theranostics Non-Classical Estrogen Signaling in Ovarian Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Theranostics Non-Classical Estrogen Signaling in Ovarian Cancer Theranostics 2019, Vol. 9, Issue 13 3952 Ivyspring International Publisher Theranostics 2019; 9(13): 3952-3965. doi: 10.7150/thno.30814 Research Paper Non-classical estrogen signaling in ovarian cancer improves chemo-sensitivity and patients outcome Dapeng Hao1*, Jingjing Li1*, Jianlin Wang1, Yuan Meng1, Zhiqiang Zhao1, Chao Zhang1, Kai Miao1, Chuxia Deng1, Benjamin K. Tsang3, Li Wang1,2, Li-jun Di1 1. Cancer Center, Faculty of health Sciences, University of Macau, Macau, SAR of the People’s Republic of China 2. Metabolism Core, Faculty of Health Sciences, University of Macau, Macau, SAR of the People’s Republic of China 3. Department of Obstetrics and Gynecology and Cellular and Molecular Medicine, University of Ottawa, Ottawa, Ontario K1N 6N5, Canada * Equal contribution Corresponding authors: Di li-jun at [email protected] and [email protected]. Room 4009, Faculty of Health Sciences (E12), University of Macau, Avenida da Universidade, Taipa, Macau, China. Tel. 853-88224497; Fax. 853-88222314 © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2018.10.20; Accepted: 2019.03.29; Published: 2019.05.31 Abstract Deficiency in homologous recombination repair (HRR) is frequently associated with hormone-responsive cancers, especially the epithelial ovarian cancer (EOC) which shows defects of HRR in up to half of cases. However, whether there are molecular connections between estrogen signaling and HRR deficiency in EOC remains unknown. Methods: We analyzed the estrogen receptor α (ERα) binding profile in EOC cell lines and investigated its association with genome instability, HRR deficiency and sensitivity to chemotherapy using extensive public datasets and in vitro/in vivo experiments. Results: We found an inverse correlation between estrogen signaling and HRR activity in EOC, and the genome-wide collaboration between ERα and the co-repressor CtBP. Though the non-classical AP-1-mediated ERα signaling, their targets were highly enriched by HRR genes. We found that depleting ERα in EOC cells up-regulates HRR activity and HRR gene expression. Consequently, estrogen signaling enhances the sensitivity of ovarian cancer cells to chemotherapy agents in vitro and in vivo. Large-scale analyses further indicate that estrogen replacement and ESR1 expression are associated with chemo-sensitivity and the favorable survival of EOC patients. Conclusion: These findings characterize a novel role of in mediating the molecular connection between hormone and HRR in EOC and encourage hormone replacement therapy for EOC patients. ERα Key words: Ovarian cancer; Estrogen signaling; Deficiency of homologous-recombination; Chemotherapy; Hormone replacement Introduction Epithelial ovarian cancer (EOC), especially the co-factors. Previous studies have demonstrated the high-grade serous EOC (HGSOC), is characterized by activating function of ERα by collaborating with positive ERα status in the vast majority of tumors, co-activators such as SRC-1 family, p300/CBP, regardless of tumor subtypes [1, 2], which is SWI/SNF complex, TRAP complex and other histone consistent with its estrogen etiology as shown by modifiers [5], and the repressive function via large-scale epidemiological studies [3]. ERα has been interacting with CtBP, LCoR, Rip140, ZNF366 and well studied for its transcriptional regulation in HDACs [6-8]. response to estrogen in breast cancer [4]. The ligand ERα regulates target genes through either bound ERα enters nucleus and can be either an classical model or non-classical model. In the classical activator or a repressor, depending on its interacting model that accounts for the majority of ERα bindings http://www.thno.org Theranostics 2019, Vol. 9, Issue 13 3953 on DNA in breast cancer cells, such as MCF7, ERα Supplementary materials for discussion of ovarian recognizes the estrogen response elements (EREs) to cancer cell lines). They were originally obtained from regulate gene transcription with the assistance of two NICLR (National infrastructure of cell line resource) pioneering factors, GATA3 and FOXA1 [4, 9]. In the with certificates. SKOV3 and HO8910 were cultured non-classical model, ER forms transcriptional in regular DMEM supplemented with 10% (v/v) FBS, complex with other DNA binding factors such as penicillin-streptomycin (Thermo Fisher). Cisplatin, AP-1 and SP1, and is recruitedα to the binding sites of β-Estradiol (estrogen), fulvestrant, doxycycline (Dox), these factors [10]. While the majority of ERα bindings olaparib were all purchased from Sigma Aldrich. The in breast cancer cells rely on GATA3 and FOXA1, anti-CtBP, anti-ERα, anti-Rad51, anti-GAPDH, these two pioneering factors are likely to be breast anti-β-actin and anti-c-JUN antibodies were cancer specific markers [11]. Consequently, how ERα purchased from Santa Cruz (USA). The anti-caspase3, behaves in EOC is elusive. anti-PARP and the anti-γH2AX antibody was from In breast cancer, patients with ERα+ tumor have Millipore (USA). Anti-CtBP recognizes both CtBP1 much better survival than patients with ERα- tumor and CtBP2 unless otherwise indicated. Unless owing to the success of adjuvant hormone therapy specified in the manuscript, cells were cultured by using agents that block the mitogenic effect of normal media with physiological level of estrogen. estrogen, such as tamoxifen, fulvestrant and aromatase inhibitors [12, 13]. However, the Expression vectors and gene knockdown anti-estrogen therapies have been disappointing in vectors the treatment of EOC [14]. On the contrary, hormone The CtBP1 and CtBP2 coding sequence were replacement therapy (HRT), as an optional choice to cloned into pCMV-script expression vector with or alleviate the symptoms associated with without HA tag and FLAG tag respectively. The oophorectomy, shows a beneficial effect on the pLVX-tight-puro lentivirus vector (Clontech) was also survival of EOC patients, as demonstrated by clinical used for cloning of CtBP1 and CtBP2 as lentivirus trial [15] and retrospective study [16], although expression vector. ERα coding sequence was inconsistent data may also exist [17-19]. amplified from the pCI-nGL1-HEGO and further EOC is characterized by DNA repair defects [20], cloned into pLVX-Tight-Puro. For lentivirus especially the deficiency in homologous production, PLVX-Tight-Puro-CtBP (or ERα)-GFP recombination repair (HRR) [21]. The core HRR genes and pLVXTet-On-Advanced (Clontech) plasmids including RAD51, ATM/ATR, CHEK1/CHEK2, were co-transfected into 293FT cells for lentivirus BRCA1/BRCA2, MRN complex and Faconia anemia package. The lentivirus containing supernatant was (FA) genes, are frequently altered in EOC and other harvested post transfection for 72 hours, and spun hormone-related cancers [22, 23]. Since cells deficient down, filtered with 0.45μM syringe filter, then in these genes are vulnerable to replicative stress and infected the target cells and selected with Puromycin double-strand breaks, platinum-based chemotherapy and G418. Dox was added to the cell culture medium is still the primary choice for the treatment of EOC to induce inserting gene expression. All the gene [24]. Previous studies have suggest that hormone knockdown experiments were through the lentivirus therapy has no significant effect on chemotherapy in vector pLKO1. The shRNAs targeting CtBP (Sense breast cancer [25, 26]. However, the observation that 5’-CCGGAGGGAGGACCTGGAGAAGTTCCTCGAGGAA HRR deficient tumors frequently originate from CTTCTCCAGGTCCTC-3’ and anti-sense 5’-AATTCAA hormone enriched tissues points to a possibility that AAAAGGGAGGACCTGGAGAAGTTCCTCGAGGA HRR may have a molecular connection with ACTTCTCCAGGTCCTCCCT-3’) were cloned into hormones [27]. It has been found that estrogen pLKO1 for virus packaging in 293T cells and the increases the genome instability in ERα+ EOC cells supernatant were used for transduction directly or [28]. Here, we explore the ERα transcriptional further concentration. ERα knockdown is through programme on a global scale in EOC cells. We show siRNA according to Liang et al. [29]. All the luciferase that ERα represses HRR activity by direct bindings on assay was performed using the pGL3 series of vectors HRR genes via interacting with CtBP in EOC cells, from Promega. and suggest that estrogen replacement has the potential to benefit EOC patients from chemotherapy. ChIP and ChIPseq After treatments, cells were cross-linked with 1% Materials and Methods (w/v) formaldehyde for 5 min at room temperature. Ice cold glycine (125mM) was applied to quench Cell lines, chemicals and antibodies formaldehyde. Then the cells were washed twice with SKOV3 and HO8910 cells were used as ice cold PBS and collected. Cross-linked cells were representative ovarian cancer cell lines (see http://www.thno.org Theranostics 2019, Vol. 9, Issue 13 3954 resuspended in 1 ml immunoprecipitation (IP) buffer permeablized in PBS supplemented with 10% goat (150mMNaCl, 50mM Tris-HCl (pH 7.5), 5mM EDTA, serum and 0.3% Triton X-100 for 15mins. Wash cells NP-40(0.5%), Triton X-100 (1%), and added cocktail twice by PBS. Then cells were treated with 3% H2O2 proteinase inhibitor (Sigma). Cell lysate were for 10mins and wash for twice. Block cells with sonicated for 10 x 30 s with 30 s break using Qsonica blocking buffer(10% goat serum in 1xPBS) for 1hr. Q700 sonicator. Then the sonicated cells were Incubate cells
Load more

Recommended publications
  • The Rise and Fall of the Bovine Corpus Luteum
    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 The Rise and Fall of the Bovine Corpus Luteum Heather Talbott University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Molecular Biology Commons, and the Obstetrics and Gynecology Commons Recommended Citation Talbott, Heather, "The Rise and Fall of the Bovine Corpus Luteum" (2017). Theses & Dissertations. 207. https://digitalcommons.unmc.edu/etd/207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. THE RISE AND FALL OF THE BOVINE CORPUS LUTEUM by Heather Talbott A DISSERTATION Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor John S. Davis University of Nebraska Medical Center Omaha, Nebraska May, 2017 Supervisory Committee: Carol A. Casey, Ph.D. Andrea S. Cupp, Ph.D. Parmender P. Mehta, Ph.D. Justin L. Mott, Ph.D. i ACKNOWLEDGEMENTS This dissertation was supported by the Agriculture and Food Research Initiative from the USDA National Institute of Food and Agriculture (NIFA) Pre-doctoral award; University of Nebraska Medical Center Graduate Student Assistantship; University of Nebraska Medical Center Exceptional Incoming Graduate Student Award; the VA Nebraska-Western Iowa Health Care System Department of Veterans Affairs; and The Olson Center for Women’s Health, Department of Obstetrics and Gynecology, Nebraska Medical Center.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Datasheet Blank Template
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . ZNF366 CRISPR/Cas9 KO Plasmid (h): sc-414899 BACKGROUND APPLICATIONS The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and ZNF366 CRISPR/Cas9 KO Plasmid (h) is recommended for the disruption of CRISPR-associated protein (Cas9) system is an adaptive immune response gene expression in human cells. defense mechanism used by archea and bacteria for the degradation of foreign genetic material (4,6). This mechanism can be repurposed for other 20 nt non-coding RNA sequence: guides Cas9 functions, including genomic engineering for mammalian systems, such as to a specific target location in the genomic DNA gene knockout (KO) (1,2,3,5). CRISPR/Cas9 KO Plasmid products enable the U6 promoter: drives gRNA scaffold: helps Cas9 identification and cleavage of specific genes by utilizing guide RNA (gRNA) expression of gRNA bind to target DNA sequences derived from the Genome-scale CRISPR Knock-Out (GeCKO) v2 library developed in the Zhang Laboratory at the Broad Institute (3,5). Termination signal Green Fluorescent Protein: to visually REFERENCES verify transfection CRISPR/Cas9 Knockout Plasmid CBh (chicken β-Actin 1. Cong, L. et al. 2013. Multiplex genome engineering using CRISPR/Cas hybrid) promoter: drives expression of Cas9 systems. Science 339: 819-823. 2A peptide: allows production of both Cas9 and GFP from the 2. Mali, P., et al. 2013. RNA-guided human genome engineering via Cas9. same CBh promoter Science 339: 823-826. Nuclear localization signal 3. Ran, F.A., et al. 2013. Genome engineering using the CRISPR-Cas9 system . Nuclear localization signal SpCas9 ribonuclease Nat.
    [Show full text]
  • Network-Based Genetic Profiling, and Therapeutic Target Identification Of
    bioRxiv preprint doi: https://doi.org/10.1101/480632; this version posted November 29, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Network-based genetic profiling, and therapeutic target identification of Thyroid Cancer 1st Md. Ali Hossain 2nd Tania Akter Asa 3rd Julian Quinn 4rdMd. Mijanur Rahman Dept. of CSE Dept. of EEE Bone biology divisions Dept. of CSE MIU, Jahangirnagar University Islamic University Garvan Institute of Medical Research JKKNIU Dhaka, Bangladesh Kushtia, Bangladesh Sydney, Australia Bangladesh ali:cse:bd@gmail:com tania:eee:iu@gmail:com j:quinn@garvan:org:au mijan cse@yahoo:com 5th Fazlul Huq 6th Mohammad Ali Moni Biomedical Sciences, Faculty of Medicine and Health Biomedical Sciences, Faculty of Medicine and Health The University of Sydney The University of Sydney Sydney, Australia Sydney, Australia fazlul:huq@sydney:edu:au mohammad:moni@sydney:edu:au Abstract—Molecular mechanisms that underlie the pathogene- I. INTRODUCTION sis and progression of malignant thyroid cancer (TC) are poorly understood. In this study, we employed network-based integrative Thyroid cancer (TC) is the most common endocrine ma- analyses of TC lesions to identify key molecules that are possible lignant disease [24], and although it has a relatively low hub genes and proteins in molecular pathways active in TC. We thus studied a microarray gene expression dataset (GSE82208, mortality rate compared to most other common metastatic n=52) that compared TC to benign thyroid tumours (follicular diseases its incidence is rising and is now the fifth most thyroid adenomas) in order to identify differentially expressed common cancer disease in women, notably affecting those genes (DEGs) in TC.
    [Show full text]
  • Supplemental Text and Figures
    Supplemental Materials and Methods Experimental bone metastasis assay Primary PCa cells were sorted by GFP marker from mTmG+ tumors, and 105 cells in 20μL PBS were injected using Hamilton syringe into the tibia of 6-week old NSG mice. Mice were monitored biweekly for moribund signs for euthanasia and organ harvest. Noninvasive mouse and ex vivo imaging MRI imaging with Bruker ICON and fluorescence imaging of fresh organs with metastasis enumeration were recently described (Lu et al. 2017). Primary prostate cell sphere formation assay Isolate of primary cells from prostate, culture and counting of prostatospheres on Matrigel were performed as described (Lukacs et al. 2010). For organoid culture assay, we followed a published matrigel embedding method (Chua et al. 2014). RNA-Seq and differential gene expression Total RNA was isolated from prostate tumors using Direct-zol RNA MiniPrep Kit (Zymo Research) and processed for stranded total RNA-Seq using Illumina HiSeq 4000 at Sequencing and Microarray Facility at MD Anderson Cancer Center. The differential expression analysis was performed using the DESeq2 package of R. P-values obtained after multiple binomial tests were adjusted using BH method. Significant genes are defined by using a cut-off of 0.05 on the BH corrected p-value and an absolute log2 fold change value of at least 1.5. Histology and western blot H&E stain, immunohistochemical (IHC) and western blot were performed as previously described (Ding et al. 2011; Wang et al. 2016). Primary antibodies for IHC include Ki67 (Fisher, RM-9106-S1), cleaved caspase 3 (Cell Signaling Technology aka CST, 9661), cyclin D1 (Fisher, clone SP4), TGFBR2 (Abcam, ab61213), BMPR2 (Abcam, ab130206), AR (EMD Millipore, 06-680), phospho- Akt (CST, 4060), GFP (CST, 2956), E-Cadherin (CST, 14472).
    [Show full text]
  • LSD1 Dual Function in Mediating Epigenetic Corruption of the Vitamin
    Battaglia et al. Clinical Epigenetics (2017) 9:82 DOI 10.1186/s13148-017-0382-y RESEARCH Open Access LSD1 dual function in mediating epigenetic corruption of the vitamin D signaling in prostate cancer Sebastiano Battaglia1*, Ellen Karasik2, Bryan Gillard2, Jennifer Williams2, Trisha Winchester3, Michael T. Moser2, Dominic J Smiraglia3 and Barbara A. Foster2* Abstract Background: Lysine-specific demethylase 1A (LSD1) is a key regulator of the androgen (AR) and estrogen receptors (ER), and LSD1 levels correlate with tumor aggressiveness. Here, we demonstrate that LSD1 regulates vitamin D receptor (VDR) activity and is a mediator of 1,25(OH)2-D3 (vitamin D) action in prostate cancer (PCa). Methods: Athymic nude mice were xenografted with CWR22 cells and monitored weekly after testosterone pellet removal. Expression of LSD1 and VDR (IHC) were correlated with tumor growth using log-rank test. TRAMP tumors and prostates from wild-type (WT) mice were used to evaluate VDR and LSD1 expression via IHC and western blotting. The presence of VDR and LSD1 in the same transcriptional complex was evaluated via immunoprecipitation (IP) using nuclear cell lysate. The effect of LSD1 and 1,25(OH)2-D3 on cell viability was evaluated in C4-2 and BC1A cells via trypanblueexclusion.TheroleofLSD1inVDR-mediatedgenetranscriptionwasevaluatedforCdkn1a, E2f1, Cyp24a1,andS100g via qRT-PCR-TaqMan and via chromatin immunoprecipitation assay. Methylation of Cdkn1a TSS was measured via bisulfite sequencing, and methylation of a panel of cancer-related genes was quantified using methyl arrays. The Cancer Genome Atlas data were retrieved to identify genes whose status correlates with LSD1 and DNA methyltransferase 1 (DNMT1).
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • The DEAD-Box Protein P72 Regulates ERΑ-&Sol;Oestrogen
    Oncogene (2009) 28, 4053–4064 & 2009 Macmillan Publishers Limited All rights reserved 0950-9232/09 $32.00 www.nature.com/onc ORIGINAL ARTICLE The DEAD-box protein p72 regulates ERa-/oestrogen-dependent transcription and cell growth, and is associated with improved survival in ERa-positive breast cancer NC Wortham1,6, E Ahamed2,6, SM Nicol1, RS Thomas2, M Periyasamy2, J Jiang2,3, AM Ochocka2, S Shousha3, L Huson4, SE Bray5, RC Coombes2, S Ali2 and FV Fuller-Pace1 1Centre for Oncology and Molecular Medicine, University of Dundee, Ninewells Hospital and Medical School, Dundee, UK; 2Department of Oncology, Imperial College London, Hammersmith Hospital Campus, London, UK; 3Department of Histopathology, Imperial College London, Charing Cross Hospital, London, UK; 4Statistical Advisory Service, Imperial College London, South Kensington Campus, London, UK and 5Tayside Tissue Bank, University of Dundee, Ninewells Hospital and Medical School, Dundee, UK The DEAD-box RNA helicases p68 (DDX5) and p72 Introduction (DDX17) have been shown to act as transcriptional co- activators for a diverse range of transcription factors, The DEAD-box subfamily of RNA helicases, originally including oestrogen receptor-a (ERa). Here, we show that, so named on the basis of the presence of a conserved although both proteins interact with and co-activate ERa motif having the sequence Asp-Glu-Ala-Asp, have been in reporter gene assays, small interfering RNA-mediated implicated in cellular processes involving the regulation knockdown of p72, but not p68, results in a significant of RNA structure, including pre-mRNA processing, inhibition of oestrogen-dependent transcription of endo- RNA export, RNA degradation, ribosome assembly, genous ERa-responsive genes and oestrogen-dependent translation and miRNA maturation (Linder et al., 1989; growth of MCF-7 and ZR75-1 breast cancer cells.
    [Show full text]