Theranostics 2019, Vol. 9, Issue 13 3952 Ivyspring International Publisher Theranostics 2019; 9(13): 3952-3965. doi: 10.7150/thno.30814 Research Paper Non-classical estrogen signaling in ovarian cancer improves chemo-sensitivity and patients outcome Dapeng Hao1*, Jingjing Li1*, Jianlin Wang1, Yuan Meng1, Zhiqiang Zhao1, Chao Zhang1, Kai Miao1, Chuxia Deng1, Benjamin K. Tsang3, Li Wang1,2, Li-jun Di1 1. Cancer Center, Faculty of health Sciences, University of Macau, Macau, SAR of the People’s Republic of China 2. Metabolism Core, Faculty of Health Sciences, University of Macau, Macau, SAR of the People’s Republic of China 3. Department of Obstetrics and Gynecology and Cellular and Molecular Medicine, University of Ottawa, Ottawa, Ontario K1N 6N5, Canada * Equal contribution Corresponding authors: Di li-jun at [email protected] and [email protected]. Room 4009, Faculty of Health Sciences (E12), University of Macau, Avenida da Universidade, Taipa, Macau, China. Tel. 853-88224497; Fax. 853-88222314 © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2018.10.20; Accepted: 2019.03.29; Published: 2019.05.31 Abstract Deficiency in homologous recombination repair (HRR) is frequently associated with hormone-responsive cancers, especially the epithelial ovarian cancer (EOC) which shows defects of HRR in up to half of cases. However, whether there are molecular connections between estrogen signaling and HRR deficiency in EOC remains unknown. Methods: We analyzed the estrogen receptor α (ERα) binding profile in EOC cell lines and investigated its association with genome instability, HRR deficiency and sensitivity to chemotherapy using extensive public datasets and in vitro/in vivo experiments. Results: We found an inverse correlation between estrogen signaling and HRR activity in EOC, and the genome-wide collaboration between ERα and the co-repressor CtBP. Though the non-classical AP-1-mediated ERα signaling, their targets were highly enriched by HRR genes. We found that depleting ERα in EOC cells up-regulates HRR activity and HRR gene expression. Consequently, estrogen signaling enhances the sensitivity of ovarian cancer cells to chemotherapy agents in vitro and in vivo. Large-scale analyses further indicate that estrogen replacement and ESR1 expression are associated with chemo-sensitivity and the favorable survival of EOC patients. Conclusion: These findings characterize a novel role of in mediating the molecular connection between hormone and HRR in EOC and encourage hormone replacement therapy for EOC patients. ERα Key words: Ovarian cancer; Estrogen signaling; Deficiency of homologous-recombination; Chemotherapy; Hormone replacement Introduction Epithelial ovarian cancer (EOC), especially the co-factors. Previous studies have demonstrated the high-grade serous EOC (HGSOC), is characterized by activating function of ERα by collaborating with positive ERα status in the vast majority of tumors, co-activators such as SRC-1 family, p300/CBP, regardless of tumor subtypes [1, 2], which is SWI/SNF complex, TRAP complex and other histone consistent with its estrogen etiology as shown by modifiers [5], and the repressive function via large-scale epidemiological studies [3]. ERα has been interacting with CtBP, LCoR, Rip140, ZNF366 and well studied for its transcriptional regulation in HDACs [6-8]. response to estrogen in breast cancer [4]. The ligand ERα regulates target genes through either bound ERα enters nucleus and can be either an classical model or non-classical model. In the classical activator or a repressor, depending on its interacting model that accounts for the majority of ERα bindings http://www.thno.org Theranostics 2019, Vol. 9, Issue 13 3953 on DNA in breast cancer cells, such as MCF7, ERα Supplementary materials for discussion of ovarian recognizes the estrogen response elements (EREs) to cancer cell lines). They were originally obtained from regulate gene transcription with the assistance of two NICLR (National infrastructure of cell line resource) pioneering factors, GATA3 and FOXA1 [4, 9]. In the with certificates. SKOV3 and HO8910 were cultured non-classical model, ER forms transcriptional in regular DMEM supplemented with 10% (v/v) FBS, complex with other DNA binding factors such as penicillin-streptomycin (Thermo Fisher). Cisplatin, AP-1 and SP1, and is recruitedα to the binding sites of β-Estradiol (estrogen), fulvestrant, doxycycline (Dox), these factors [10]. While the majority of ERα bindings olaparib were all purchased from Sigma Aldrich. The in breast cancer cells rely on GATA3 and FOXA1, anti-CtBP, anti-ERα, anti-Rad51, anti-GAPDH, these two pioneering factors are likely to be breast anti-β-actin and anti-c-JUN antibodies were cancer specific markers [11]. Consequently, how ERα purchased from Santa Cruz (USA). The anti-caspase3, behaves in EOC is elusive. anti-PARP and the anti-γH2AX antibody was from In breast cancer, patients with ERα+ tumor have Millipore (USA). Anti-CtBP recognizes both CtBP1 much better survival than patients with ERα- tumor and CtBP2 unless otherwise indicated. Unless owing to the success of adjuvant hormone therapy specified in the manuscript, cells were cultured by using agents that block the mitogenic effect of normal media with physiological level of estrogen. estrogen, such as tamoxifen, fulvestrant and aromatase inhibitors [12, 13]. However, the Expression vectors and gene knockdown anti-estrogen therapies have been disappointing in vectors the treatment of EOC [14]. On the contrary, hormone The CtBP1 and CtBP2 coding sequence were replacement therapy (HRT), as an optional choice to cloned into pCMV-script expression vector with or alleviate the symptoms associated with without HA tag and FLAG tag respectively. The oophorectomy, shows a beneficial effect on the pLVX-tight-puro lentivirus vector (Clontech) was also survival of EOC patients, as demonstrated by clinical used for cloning of CtBP1 and CtBP2 as lentivirus trial [15] and retrospective study [16], although expression vector. ERα coding sequence was inconsistent data may also exist [17-19]. amplified from the pCI-nGL1-HEGO and further EOC is characterized by DNA repair defects [20], cloned into pLVX-Tight-Puro. For lentivirus especially the deficiency in homologous production, PLVX-Tight-Puro-CtBP (or ERα)-GFP recombination repair (HRR) [21]. The core HRR genes and pLVXTet-On-Advanced (Clontech) plasmids including RAD51, ATM/ATR, CHEK1/CHEK2, were co-transfected into 293FT cells for lentivirus BRCA1/BRCA2, MRN complex and Faconia anemia package. The lentivirus containing supernatant was (FA) genes, are frequently altered in EOC and other harvested post transfection for 72 hours, and spun hormone-related cancers [22, 23]. Since cells deficient down, filtered with 0.45μM syringe filter, then in these genes are vulnerable to replicative stress and infected the target cells and selected with Puromycin double-strand breaks, platinum-based chemotherapy and G418. Dox was added to the cell culture medium is still the primary choice for the treatment of EOC to induce inserting gene expression. All the gene [24]. Previous studies have suggest that hormone knockdown experiments were through the lentivirus therapy has no significant effect on chemotherapy in vector pLKO1. The shRNAs targeting CtBP (Sense breast cancer [25, 26]. However, the observation that 5’-CCGGAGGGAGGACCTGGAGAAGTTCCTCGAGGAA HRR deficient tumors frequently originate from CTTCTCCAGGTCCTC-3’ and anti-sense 5’-AATTCAA hormone enriched tissues points to a possibility that AAAAGGGAGGACCTGGAGAAGTTCCTCGAGGA HRR may have a molecular connection with ACTTCTCCAGGTCCTCCCT-3’) were cloned into hormones [27]. It has been found that estrogen pLKO1 for virus packaging in 293T cells and the increases the genome instability in ERα+ EOC cells supernatant were used for transduction directly or [28]. Here, we explore the ERα transcriptional further concentration. ERα knockdown is through programme on a global scale in EOC cells. We show siRNA according to Liang et al. [29]. All the luciferase that ERα represses HRR activity by direct bindings on assay was performed using the pGL3 series of vectors HRR genes via interacting with CtBP in EOC cells, from Promega. and suggest that estrogen replacement has the potential to benefit EOC patients from chemotherapy. ChIP and ChIPseq After treatments, cells were cross-linked with 1% Materials and Methods (w/v) formaldehyde for 5 min at room temperature. Ice cold glycine (125mM) was applied to quench Cell lines, chemicals and antibodies formaldehyde. Then the cells were washed twice with SKOV3 and HO8910 cells were used as ice cold PBS and collected. Cross-linked cells were representative ovarian cancer cell lines (see http://www.thno.org Theranostics 2019, Vol. 9, Issue 13 3954 resuspended in 1 ml immunoprecipitation (IP) buffer permeablized in PBS supplemented with 10% goat (150mMNaCl, 50mM Tris-HCl (pH 7.5), 5mM EDTA, serum and 0.3% Triton X-100 for 15mins. Wash cells NP-40(0.5%), Triton X-100 (1%), and added cocktail twice by PBS. Then cells were treated with 3% H2O2 proteinase inhibitor (Sigma). Cell lysate were for 10mins and wash for twice. Block cells with sonicated for 10 x 30 s with 30 s break using Qsonica blocking buffer(10% goat serum in 1xPBS) for 1hr. Q700 sonicator. Then the sonicated cells were Incubate cells