DOCSLIB.ORG

The Flavr Savr Tomato, an Early Example of Rnai Technology

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Flavr Savr Tomato, an Early Example of Rnai Technology JOBNAME: horts 43#3 2008 PAGE: 1 OUTPUT: April 23 08:32:38 2008 tsp/horts/163067/02585 HORTSCIENCE 43(3):962–964. 2008. oligo probes or DNA probes complementary to PG. DNA oligo probes were ordered from IDT; a ‘‘+’’ symbol preceding represents an The Flavr Savr Tomato, an Early LNA-modified nucleotide. Sequences used Example of RNAi Technology were as follows: Elysia K. Krieger1, Edwards Allen, Larry A. Gilbertson, A1: AAAC+ATA+TGA+TAATATT+GCA+ TTT+GAGCAAG+CAT+GGA+ATGAA and James K. Roberts A2: ATTA+TAA+TGG+AGAATAT+AAA+ Monsanto Company, Chesterfield Campus, 700 Chesterfield Parkway, TTA+GTAGGGG+AAA+GTG+GAAAA Chesterfield, MO 63017 B1: ATGC+AAT+ATT+ATCATAT+GTT+ TTT+CCATCAC+CCT+TAG+CTCCA William Hiatt and Rick A. Sanders B2: ATAG+TCT+ATA+ATTATGG+GAT+ Monsanto Company, Calgene Campus, 1920 5th Street, Davis, CA 95616 ACT+TAACGTC+TTG+CAT+TTCCA Additional index words. Flavr Savr tomato, polygalacturonase, RNAi, T-DNA linkage Oligos were isotopically labeled with Abstract. The Flavr Savr tomato was introduced as the first genetically engineered whole [g-32P]ATP as described in Allen et al. food in 1994. The commercial event, resulting from transformation with an antisense (2005). DNA probes: Probe C—First 483 expression cassette of the endogenous polygalacturonase gene, was sequenced and found bp of the NptII sequence. Probe D—Last to contain two contiguous, linked, transfer DNA insertions. We found polygalacturonase 420 bp of the PG sequence. DNA probes suppression correlates with accumulation of ’21-nt small interfering RNAs, the were labeled with dCTP using the RadPrime hallmark of an RNA interference-mediated suppression mechanism. DNA-labeling system (catalog no. 18428- 011, Invitrogen) according to the manufac- turer’s directions. The Flavr Savr tomato has increased Southern blots and inverse PCRs. Geno- Results storage life through suppression of the to- mic DNA was isolated from tomato leaves, mato polygalacturonase (PG) gene, resulting and EcoRV Southern blots were done accord- Commercial Flavr Savr locus contains from transformation of an antisense expres- ing to Redenbaugh et al. (1992). To make two linked T-DNAs. Plants from commer- sion cassette of the PG cDNA (pCGN1436) inverse PCR libraries, 10 mg of genomic cial hybrid seed (CR3-1436-613:@.12/ (Sheehy et al., 1988). Efficacious but non- DNA was digested separately with XhoI, CF5013), not included in the previous anal- commercial pCGN1436 transformation NcoI, EcoRV, HindIII, and PstI and ligated ysis (Sanders and Hiatt, 2005), were grown events contain multiple T-DNA insertions to itself. Primers complementary to regions and selfed to obtain positive (4523, 3951, linked by right borders (Redenbaugh et al., of the T-DNA were used to walk out across 3949) and null (4193, 4131, 3975) sibling 1992; Sanders and Hiatt, 2005), leading to the the T-DNA inserts as well as into genomic plants for molecular analysis. Genomic DNA hypothesis that readthrough transcription of flanking regions. PCRs were done with Extaq from these plants was digested with EcoRV, the PG-linked antisense (PGAS) cassettes re- (Takara Bio, Shiga, Japan), and products and Southern blot hybridization was per- sulted in RNA interference (RNAi)-mediated were cloned and sequenced using pCR2.1- formed to determine T-DNA copy number PG suppression, rather than antisense- TOPO (Invitrogen Corp., Carlsbad, CA). and linkage (Fig. 1A). Bands were observed mediated sequestration, of the endogenous PCR primers. in the transgenic plants of 3698- and 5162-bp PG transcript (Watson et al., 2005). To test 1: TATACCCGCAGTCCGCTCACCCTACC corresponding to the PG region of the locus, this hypothesis, we determined if RNAi sup- 2: ACACGAAACTCATGAGGGAGGAGATG in addition to a 2-kb band of the native pression is responsible for the Flavr Savr phe- 3: GAGACCGATGTTCGTTCCGGAACCTT PG gene present in all lanes. This is consis- notype by characterizing the T-DNA locus of 4: AAGGTTCCGGAACGAACATCGGTCTC tent with the presence of two copies of the the Flavr Savr tomato event and analyzing for 5: ATTCAAAAGTCGTTAATGGCTGCGG PG region of the T-DNA. The transgene the presence of 21-nt PG small interfering ATCAAG locus and flanking genomic sequence were RNAs (siRNAs) diagnostic of RNAi. 6: CAATTGTAAATGGCTTCATGTCCGG obtained by inverse PCR amplification, clon- GAAATC ing, and sequence analysis of resulting frag- Materials and Methods ments. The locus sequence confirmed the PG enzyme activity assays. PG enzyme T-DNA linkage at the left border (LB) of Tomato plants. CF5013 is the tomato activity assays, measured as an A540 absor- one of the two T-DNAs; the second T-DNA is cultivar that resulted from a nonconventional bance, were done in replicates of six accord- truncated, removing all of the LB sequences cross between the homozygous PGAS inbred ing to Redenbaugh et al. (1992). The average and part of the MAS promoter (Fig. 1B). line CR3-1436-613:@.12 with the tomato enzyme activity of the three transgenic toma- These results were further confirmed by hybrid Mountain Spring. CF5013 is hetero- toes (4523, 3951, 3949) was 0.058, 0.073, amplifying the T-DNAs with flanking geno- zygous for the PGAS gene which is dominant and 0.075, respectively, compared with the mic and unique junction region primers and was sold commercially as the Flavr Savr nulls (4193, 4131, 3975), which were 1.032, (Fig. 1C) in transgenic (4523) and null tomato. These plants were selfed, and result- 1.11, and 0.98. (4193) siblings. The 6974-bp band (lane 1) ing sibling plants were screened by taqman RNA purification and Northern blots. contains the truncated (left) T-DNA. The PCR for NptII. Of the 64 plants screened, the Total RNA was purified from ripe tomatoes 7725-bp band (lane 3) contains the full-length ratio was 43 to 21 NptII positive to negative using Trizol (Invitrogen) and further cleaned (right) T-DNA. We were unable to amplify plants, which is consistent with a 3:1 ratio of using the RNA/DNA Midi Kit (Qiagen, across the insert (14,674-bp, lane 5), likely transgenic to non-transgenic tomato plants Valencia, CA), according to procedures pro- due to the inverted repeat sequence. In the (c2 P = 0.15). vided by the manufacturer. Low molecular null sibling, these primers amplify a 1058-bp weight Northern blots were done with 17% band (lane 6) verifying insert location. The Received for publication 23 Dec. 2007. Accepted polyacrylamide gels (Llave et al., 2002a), for publication 6 Jan. 2008. 764-bp band (lane 7) is the product across We thank Daniel Free and Christina Kavanaugh and high molecular weight Northern blots the unique T-DNA junction sequence. Taken for greenhouse support. were done with 1.5% agarose gels (Llave together, these results show the commercial 1To whom reprint requests should be addressed; et al., 2002b). Blots were hybridized with Flavr Savr tomato contained two T-DNAs e-mail [email protected] radioactive 42-nt isotopically labeled LNA linked in an inverted orientation. 962 HORTSCIENCE VOL. 43(3) JUNE 2008 JOBNAME: horts 43#3 2008 PAGE: 2 OUTPUT: April 23 08:32:39 2008 tsp/horts/163067/02585 an abundance of 21-nt siRNAs associated with sequence-specific mRNA degradation and translational repression (Brodersen and Voinnet, 2006; Fagard and Vaucheret, 2000; Hamilton et al., 2002; Watson et al., 2005). The 24-nt class, associated with transcrip- tional repression (Brodersen and Voinnet, 2006; Fagard and Vaucheret, 2000; Hamilton et al., 2002; Watson et al., 2005), was less abundant and some PG mRNA was still detectable in Flavr Savr tomatoes. If suppres- sion of PG activity was due to sequestration from translation by binding to antisense RNA (Metzlaff et al., 1997), the accumulation of sense PG transcript should be unaffected and antisense transcripts would be detected. In contrast, if suppression were due to trans- criptional or post-transcriptional gene silenc- ing, accumulation of the message would be reduced, suggesting transgene-associated suppression was not due to repression of endogenous PG mRNA transcription but to RNAi (Brodersen and Voinnet, 2006). It is interesting that siRNAs were detected for PGAS and NptII, but not for any other regions of the T-DNA. This suggests that Fig. 1. Characterization of siblings of the Flavr Savr tomato. (A) Southern blot confirmation of T-DNA suppression requires transcription from the number using probe D of the PG gene. Transgenic (4523, 3951, and 3949) and non-transgenic (4193, associated PG and NptII promoters. Using 4131, and 3975) siblings were analyzed. The T-DNA insertion corresponds to the 3.6- and 5.1-kb flanking sequence as a query in searches with hybridizing bands. (B) Diagram of the sequenced 13,621-bp T-DNA insertion and flanking genomic BLAST, we identified a region 1197-bp regions. DNA probes (bars C and D) and primers (arrows 1–6) used for confirmation PCRs are downstream of the T-DNA insert containing indicated. A putative CYP82 family cytochrome P450 mono-oxygenase gene in the adjacent genomic sequence is indicated (gray box). (C) Confirmation of linked T-DNA orientation by PCR with genomic a putative cytochrome P450 gene (Fig. 1B). flank and unique junction sequence primers. PCRs are shown in pairs; odd-numbered lanes use Potential promoter or enhancer elements as- transgenic sibling 4523 genomic DNA, even-numbered lanes use null sibling 4193 genomic DNA. sociated with this gene may be associated Sizes of the marker bands (lane L) are indicated at right. Left T-DNA, lanes 1 and 2 (primers 1 and 4); with transcription across the T-DNA locus right T-DNA, lanes 3 and 4 (primers 2 and 3); full insert, lanes 5 and 6 (primers 1 and 2); unique and could be responsible for contributing junction region, lanes 7 and 8 (primers 5 and 6). to the initial production of a dsRNA for the coding regions, thus resulting in the siRNAs from transgenes accumulate in that the level of NptII mRNA was low, con- production of the siRNAs.
Load more

Recommended publications
  • 11:115:321 (44K PDF)
    Ethical Issues in Biochemical Research Spring 2021 11:115:321:01 George Pieczenik, Ph.D., Professor Spring 2021 Day M,W Time 2:15-3:35 Online: GoToMeeting and Zoom 3 credits, meeting twice a week for 80 minutes Course Description This course will address ethical issues in biochemistry, with some focus on genetics and molecular biology. The course will consist of lectures by the professor, as well as student presentations on selected topics. Issues to be covered will include the ethics of recombinant DNA technology, of genetically modified plants and animals, of stem cell use, scientific patents, and of creating DNA databases. Other topics will include the political use of genetics and evolutionary paradigms, and the use of fraudulent data and “pseudo science”, and how these tools can be used to sway public opinion. Important issues facing scientists and students currently will also be discussed, such as plagiarism . data manipulation and consequences of the biotechnology revolution. Course Requirements 1. Class Attendance & Participation: Students are expected to attend class online and to participate actively. There will be spot quizzes. Unexcused absences (>3) will result in failure. (10%) Online class attendance will be through GoToMyMeeting and/or Zoom. Classes will be recorded and deposited to Dropbox for students who can not make the class synchronously. 2. Essays on assigned topics: Students will present two power point topics assigned or requested. for presentation to the class. (70%) 3. Final exam; A final take home 2 hour exam. (20%) Optional reading list from which to prepare paper The Main text is Edwin Black's - America's War on the Weak Publisher: Four Walls Eight Windows; (September 2003) ISBN: 1568582587 Rosalind Franklin: The Dark Lady of DNA by Brenda Maddox , Harper Collins 2002, UK The Fraud of Abderhalden’s Enzymes by Ute Deichmann and Benno Muller-Hill, Nature vol 393.
    [Show full text]
  • Vegetable Biotechnology
    UC Davis, Vegetable Research and Information Center Biotechnology (Publication pending) VEGETABLE BIOTECHNOLOGY Vegetable Research and Information Center Vegetable Biotechnology Applications of Biotechnology in Vegetable Breeding, Production, Marketing, and Consumption Department of Vegetable Crops, University of California, Davis, CA 95616 Tel. 530-752-1249 Fax: 530-752-9659 email: [email protected] http://vric.ucdavis.edu Authors: Trevor V. Suslow and Kent J. Bradford Bioengineered Products Reach The Marketplace Revolutionary discoveries in biology in the 1970’s and 1980’s fueled predictions of dramatic changes in agriculture and stimulated entrepreneurial excitement and investment. Driven by continuing advances in knowledge, technology, and commercial experience, these predictions are now being realized in the marketplace. Beginning in 1994, the first wave of products from biotechnological applications to vegetables were introduced in pilot test markets. Vine-ripe tomatoes with extended shelf life, processing tomatoes with superior quality and deep red color, squash with novel virus resistance, and potatoes genetically modified to produce an insect-killing protein are examples of the traits introduced into commercial vegetable varieties with the tools of biotechnology These first products, such as the Flavr Savr® tomato which promised superior vine-ripened flavor, received both public visibility and regulatory scrutiny. Less visible to the public is the astounding behind-the-scenes impact of biotechnology in vegetable breeding, production, processing, and marketing. While not replacing traditional crop breeding and horticultural expertise, biotechnology has dramatically expanded the tools available for the genetic improvement and production of vegetables. The revolutionary (evolutionary in terms of biological sciences as a whole) advances that have resulted from public and private investments in basic and applied research are now entering commercial application, to the benefit of both producers and consumers.
    [Show full text]
  • CQR Genetically Modified Food
    Res earc her Published by CQ Press, an Imprint of SAGE Publications, Inc. CQ www.cqresearcher.com Genetically Modified Food Should labels be required? alifornia voters will decide in November whether foods produced with genetically modified ingredients — so-called GM foods — should bear special labels. C The controversial measure reflects the uneven ac - ceptance of genetically engineered crops since their rise in the 1990s. Organic farmers and other opponents of GM foods contend they may pose health or environmental risks, despite widespread scientific consensus that they are not inherently more risky than other crops. Foes of the labeling referendum, including GM farmers and seed producers, such as Monsanto, say that GM crops are more Plant breeder Alamgir Hossain is developing Golden Rice for Bangladesh. Supporters of the genetically engineered variety say it could save the lives of up to productive, pest-resistant and environmentally friendly than conven - 2.7 million children a year, but it has yet to be planted commercially; the Philippines may approve it for tional crops and that the fast-growing organic industry and misguid - cultivation in 2013. ed consumer groups are to blame for confusion about the science I behind them. Even as GM crops have been embraced by U.S. N THIS REPORT commodity growers, Europe remains skeptical. However, eight of S THE ISSUES ....................719 I the 10 countries with the most acreage in biotech crops are now BACKGROUND ................726 D in the developing world. CHRONOLOGY ................727 E CURRENT SITUATION ........732 CQ Researcher • Aug. 31, 2012 • www.cqresearcher.com AT ISSUE ........................733 Volume 22, Number 30 • Pages 717-740 OUTLOOK ......................735 RECIPIENT OF SOCIETY OF PROFESSIONAL JOURNALISTS AWARD FOR BIBLIOGRAPHY ................738 EXCELLENCE N AMERICAN BAR ASSOCIATION SILVER GAVEL AWARD THE NEXT STEP ..............739 GENETICALLY MODIFIED FOOD CQ Re search er Aug.
    [Show full text]
  • Flavr Savr Tomato Both Genes Are Translated Into Messenger RNA (Mrna)
    FlavrFlavr Savr SavrRR Tomato Tomato Miriam Kündig and Laura Ruiz-Guardiola Gymnasium Kirschgarten, Class 4A Index of contents Index of contents ....................................................................................................................... 1 1. Preface.................................................................................................................................... 2 1.1 Our questions: .................................................................................................................. 2 2. Introduction............................................................................................................................ 3 3. Description of engineering technique.................................................................................... 4 4. Documentation and pictures of research institutions............................................................ 5 5. Discussion............................................................................................................................... 6 5.1 Following the answers to our questionnaire in the preface: ........................................... 7 6. Summary................................................................................................................................. 8 7. Pictures & References............................................................................................................. 9 Seite 1 von 9 1. Preface When we got the assignment to write something about applications of genetic
    [Show full text]
  • Genetically Modified Seeds and the Patent Exhaustion Doctrine
    Genetically Modified Seeds and the Patent Exhaustion Doctrine Erin Carter I. Introduction In 2014, genetically modified (GM) seeds, mostly patented by Monsanto Company (Monsanto), were estimated to be used for 93-96% of all corn, cotton, and soybean production in the United States.1 The most widely sold patented plants are GM crops engineered to be resistant to herbicides, such as glyphosates, and those engineered to produce pesticides, such as the soil bacterium Bt (Bacillus thuringiensis).2 The first approval of a GM product patented for food use and commercial sale was Calgene’s Flavr-Savr tomato in the 1980’s.3 GM seeds are an invention of the 20th century—a byproduct of the expanding commercial seed industry.4 This expansion was the result of the three factors: the termination of the federal government’s seed program in 1924, the revival of Mendel’s plant-genetics studies, and the rising popularity of plant hybridization.5 These genetically modified plants are covered by patents owned by companies, most notably Monsanto and E. I. du Pont de Nemours and Company (DuPont).6 Patents for organisms are not new to the 21st century, but patents for self-replicating organisms, such as GM seeds, create novel complications for patent law. The laws surrounding the use of GM seeds have emerged into a combination of patent and contract law.7 The two critical aspects of patent law that affect GM seeds are the patent exhaustion doctrine and patent misuse. Patent exhaustion is 1 Recent Trends in GE Adoptions, U.S.D.A. ERS (Oct.
    [Show full text]
  • Genetically Engineered Organisms and the Environment: Current Status and Recommendations Author(S): A
    Genetically Engineered Organisms and the Environment: Current Status and Recommendations Author(s): A. A. Snow, D. A. Andow, P. Gepts, E. M. Hallerman, A. Power, J. M. Tiedje, L. L. Wolfenbarger Reviewed work(s): Source: Ecological Applications, Vol. 15, No. 2 (Apr., 2005), pp. 377-404 Published by: Ecological Society of America Stable URL: http://www.jstor.org/stable/4543362 . Accessed: 01/11/2011 16:27 Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at . http://www.jstor.org/page/info/about/policies/terms.jsp JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms of scholarship. For more information about JSTOR, please contact [email protected]. Ecological Society of America is collaborating with JSTOR to digitize, preserve and extend access to Ecological Applications. http://www.jstor.org Ecological Applications, 15(2), 2005, pp. 377-404 C) 2005 by the Ecological Society of America ESA Report GENETICALLYENGINEERED ORGANISMS AND THE ENVIRONMENT: CURRENT STATUS AND RECOMMENDATIONSI A. A. SNOW,2D. A. ANDOW,3P. GEPTS,4E. M. HALLERMAN,5A. POWER,6J. M. TIEDJE,7 AND L. L. WOLFENBARGER8 2Department of Evolution, Ecology, and Organismal Biology, Ohio State University, Columbus, Ohio 43210-1293 USA 3Department of Entomology and Center for Community Genetics, University of Minnesota, St. Paul, Minnesota
    [Show full text]
  • Consumer Acceptance of Genetically Modified Foods
    Consumer Acceptance of Genetically Modified Foods: Traits, Labels and Diverse Information Wallace E. Huffman Working Paper No. 10029 August 2010 IOWA STATE UNIVERSITY Department of Economics Ames, Iowa, 50011-1070 Iowa State University does not discriminate on the basis of race, color, age, religion, national origin, sexual orientation, gender identity, sex, marital status, disability, or status as a U.S. veteran. Inquiries can be directed to the Director of Equal Opportunity and Diversity, 3680 Beardshear Hall, (515) 294-7612. 10-27-08r Consumer Acceptance of Genetically Modified Foods: Traits, Labels and Diverse Information Wallace E. Huffman♣ Abstract. New experimental economic methods are described and used to assess consumers' willingness to pay for food products that might be made from new transgenic and intragenic genetically modified (GM) traits. Participants in auctions are randomly chosen adult consumers in major US metropolitan areas and not college students. Food labels are kept simple and focus on key attributes of experimental goods. Diverse private information from the agricultural biotech industry (largely Monsanto and Syngenta), environmental groups (largely Greenpeace and Friends of the Earth) and independent third-party information is used to construct the information treatments. Food labels and information treatments are randomized, which is a deviation from traditional lab methods. Auctions are best described as sealed bid random n-th price and not the standard Vickery 2nd price auctions. I show that participants in these experiments respond to both food labels and information treatments, but no single type of information is dominant. ♣ The author is C.F. Curtiss Distinguished Professor of Agriculture and Life Sciences, Professor of Economics, Iowa State University, and Visiting Professor, Erasmus University-Rotterdam.
    [Show full text]
  • Here's the List
    List of Genetically Modified Organisms for 8th grade research project May 2017 1. lavender-colored carnations- http://en.wikipedia.org/wiki/Dianthus_caryophyllus#Colors 2. blue roses- http://en.wikipedia.org/wiki/Blue_rose 3. glowing fish- http://en.wikipedia.org/wiki/GloFish 4. golden rice- http://en.wikipedia.org/wiki/Golden_rice 5. salmon- http://en.wikipedia.org/wiki/Genetically_modified_salmon 6. insect- http://en.wikipedia.org/wiki/Genetically_modified_insect 7. MON 810- http://en.wikipedia.org/wiki/MON_810 8. Amflora- http://en.wikipedia.org/wiki/Amflora 9. Roundup Ready Soybean- http://en.wikipedia.org/wiki/Roundup_ready_soybean 10. Flavr Savr- http://en.wikipedia.org/wiki/Flavr_savr 11. Wheat- http://en.wikipedia.org/wiki/Genetically_modified_wheat 12. Mouse- http://en.wikipedia.org/wiki/Knockout_mouse 13. Pig- http://en.wikipedia.org/wiki/Enviropig 14. Bull- http://en.wikipedia.org/wiki/Herman_the_Bull 15. Sheep- http://en.wikipedia.org/wiki/Dolly_the_sheep 16. Ice-minus bacteria- http://en.wikipedia.org/wiki/Ice-minus_bacteria 17. supermice- http://en.wikipedia.org/wiki/Metabolic_supermice 18. oncomouse- http://en.wikipedia.org/wiki/Oncomouse 19. rat- http://en.wikipedia.org/wiki/Knockout_rat 20. goats- http://en.wikipedia.org/wiki/BioSteel 21. green fluorescence- http://en.wikipedia.org/wiki/Green_fluorescent_protein 22. Ruppy- http://en.wikipedia.org/wiki/Ruppy 23. mosquito- http://en.wikipedia.org/wiki/Aedes_aegypti 24. corn- http://en.wikipedia.org/wiki/SmartStax 25. poplar tree- http://en.wikipedia.org/wiki/Genetically_modified_tree 26. dog- http://en.wikipedia.org/wiki/Snuppy 27. rice fish- http://en.wikipedia.org/wiki/Oryzias_latipes 28. medicine- http://en.wikipedia.org/wiki/ATryn 29. papaya- http://en.wikipedia.org/wiki/Carica_papaya 30.
    [Show full text]
  • Plant Biotechnology: Past, Present, and Future
    J. AMER. SOC. HORT. SCI. 127(4):462–466. 2002. Plant Biotechnology: Past, Present, and Future John D. Williamson Department of Horticultural Science, North Carolina State University, Raleigh, NC 27695-7609 The door to producing genetically engineered plants opened with and nontranslated RNAs (Beachy, 1997; Fitchen and Beachy, the seminal discovery by Chilton et al. (1977) that the soil bacterium 1993). The effectiveness and range of PDR vary widely, and present Agrobacterium tumefaciens caused crown gall disease by transfer- data are inadequate to establish the precise molecular mechanisms ring a small, defined, plasmid DNA fragment into the plant genome. of resistance for most. Nonetheless, in addition to developing By 1984 a number of research groups (Bevan et al., 1983; Fraley et disease-resistant plant varieties for agriculture (e.g., Asgrow’s al., 1983; Herrera-Estrella et al., 1984) had applied this discovery to Freedom II squash), PDR has increased our understanding of viral create disarmed plasmid vectors which could be used to insert pathogenesis and disease. These advances in understanding the foreign genes into plants. Now, after decades of promise, genetically fundamental principles underlying resistance and pathogenicity, in engineered plant products are finally reaching consumers. So, what turn, will likely lead to second generation genes that confer in- took so long? At least four formidable obstacles blocked the way. creased levels of sustainable resistance. First, the host range of A. tumefaciens was somewhat limited and did not include a number of important crops such as corn, wheat, etc. Fruit quality—Antisense technology and the Flavr Savr Other more flexible gene transfer methods [e.g., Biolistic transfor- tomato mation (Johnston, 1990); or PEG coprecipitation (O’Neill et al., 1993)] now commonly supplement or replace Agrobacterium- The first commercialized, and perhaps best known, transgenic mediated transformation.
    [Show full text]
  • Thirty Years of Plant Transformation
    Thirty years of plant transformation A case study exploring the impact of plant transformation technology on plant science research and the global agricultural biotechnology industry Credits, left to right, Dominik Maenni, Jason Yardley, Toony, US Agricultural Research Service Thirty years of plant transformation In 1983 researchers demonstrated that they could insert role in identifying the genetic basis of important crop new genes into a plant genome, using a species of soil characteristics, which breeders are incorporating into Impact Summary bacteria called Agrobacterium tumefaciens. new varieties with increased yield, disease resistance AFRC-funded research at the Plant Breeding or which produce healthier, more nutritious food. Institute (PBI), Cambridge, published in 1983 The breakthrough was made simultaneously by three Much of this work relies on genetic tools developed by enabled researchers to create transgenic research groups, including a team at the Plant Breeding researchers at PBI. plants using Agrobacterium-mediated plant Institute (PBI) in Cambridge UK, which was funded transformation. by BBSRC’s predecessor the Agricultural and Food Plant transformation technology also led to the creation Research Council (AFRC). The genetic tools developed of the agricultural biotechnology industry, which in at PBI became freely available to academics, ensuring 2012 had a global market value of US$14.84Bn1. The the technique was adopted by research groups around genetically modified crops produced by this industry are The technology, including novel vectors and the world. now grown in countries such as the USA, Brazil, India reporter genes developed at PBI, revolutionised and China, although different regulations and on-going research around the world, and now forms a Since then, the technology, known as ‘Agrobacterium- public debate mean few are grown in Europe.
    [Show full text]
  • Genetically Modified Crops & Their Advantages Over
    January 2018, Volume 5, Issue 1 JETIR (ISSN-2349-5162) GENETICALLY MODIFIED CROPS & THEIR ADVANTAGES OVER TRADITIONAL CROPS Mahi Tyagi1, Sonali Gangwar2 , Maya Datt Joshi3 1M.Tech Scholar, Department of Biotechnology, Shobhit University,Meerut (U.P)-India 2 Assistant Professor, Centre of Biological Engineering, Shobhit University,Gangoh,Saharanpur (U.P) -India 3 Associate Professor Department of Biotechnology, Shobhit University,Meerut (U.P) -India Abstract: Genetically Engineering have been used from a long time to get the desired traits in the produce for many reasons either to achieve high yield or to resist the stress conditions. Throughout history many crops have been modified from their original state by selection, controlled breeding etc. With time, new methods have been developed to modify crops genetically using genetic engineering approach, to develop new plants with different characteristics more rapidly with best results like high yield with good quality, insect resistance, drought & stress tolerance and Phytoremediation etc. Genetically Modified Crops were in a huge debate for its use and their effects on human and environment. But with modern methods and more safer approach GM crops have the potential to solve world’s hunger and malnutrition like big problems and to contribute to the ecosystem by reducing the use of chemicals, fertilizers and pesticides. This review will address different methodologies use to develop the Genetically Modified Crops from history times to present, Ways to identify the presence of GMOs, Present GM Crops with their modified traits. Keywords: Genetically Modified Crops, Genetic Engineering, GMOs, Phytoremediation. I. INTRODUCTION Genetically modified crops are plants used in agriculture in which the DNA has been modified using genetic engineering approach to get the desired quality.
    [Show full text]
  • SFP- What Are GM Food
    Sustainability Problem-Solving Sustainable Food Production GMO’s – The Solution to World Hunger or a Disaster in the Making? • How does the process of genetic modification differ from selective breeding? • What are the pros and cons of GMO’s? Science & Language Arts Connections Common Core Standards Text Types and Purposes W.CCR. 7. Conduct short as well as more sustained research projects based on focused questions, demonstrating understanding of the subject under investigation. Genetically Modified Foods – A Positive CCSS.ELA-Literacy.WHST.6-8.1 Write arguments focused on discipline-specific content. Innovation or “Frankenfood”? CCSS.ELA-Literacy.WHST.6-8.1a Introduce claim(s) about a topic or issue, acknowledge and The topic of genetically modified foods (GMO’s) is one of the distinguish the claim(s) from alternate or opposing most hotly contested innovations in the world of food claims, and organize the reasons and evidence logically. production. In the United States, over 93% of soybean and 75% of corn crops are grown from herbicide-tolerant genetically CCSS.ELA-Literacy.WHST.6-8.1b Support claim(s) with logical reasoning and relevant, modified seeds. These corn and soy crops are primarily used as accurate data and evidence that demonstrate an feed for animals and in processed food products. There are no understanding of the topic or text, using credible sources. laws in the U.S. stating that foods containing GMO’s must be CCSS.ELA-Literacy.RI.5.9 Integrate information labeled as such. In stark contrast, Europe has banned all GM from several texts on the same topic in order to crops except for one strain of corn, and foods containing any write or speak about the subject knowledgeably.
    [Show full text]