DOCSLIB.ORG

Chimeric Form of Tumor Necrosis Factor-A Has Enhanced Surface

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chimeric Form of Tumor Necrosis Factor-A Has Enhanced Surface Cancer Gene Therapy (2009) 16, 53–64 r 2009 Nature Publishing Group All rights reserved 0929-1903/09 $32.00 www.nature.com/cgt ORIGINAL ARTICLE Chimeric form of tumor necrosis factor-a has enhanced surface expression and antitumor activity R Rieger1, D Whitacre1, MJ Cantwell1,3, C Prussak2 and TJ Kipps1 1Department of Medicine, Moores Cancer Center, University of California, San Diego, La Jolla, CA, USA and 2Memgen, LLC, Solana Beach, CA, USA Tumor necrosis factor (TNF)-a is a type-II transmembrane protein that is cleaved by TNF-a-converting enzyme (TACE/ADAM-17) to release soluble TNF, a cytokine with potent antitumor properties whose use in clinical applications is limited by its severe systemic toxicity. We found that human cells transfected with vectors encoding TNF without the TACE cleavage site (DTACE-TNF) still released functional cytokine at substantial levels that varied between transfected cell lines of different tissue types. Vectors encoding membrane-associated domains of CD154, another TNF-family protein, conjoined with the carboxyl-terminal domain of TNF, directed higher-level surface expression of a functional TNF that, in contrast to DTACE-TNF, was resistant to cleavage in all cell types. Furthermore, adenovirus vectors encoding CD154-TNF had significantly greater in vivo biological activity in inducing regression of established, syngeneic tumors in mice than adenovirus vectors encoding TNF, and lacked toxicity associated with soluble TNF. As such, CD154-TNF is a novel TNF that appears superior for treatment of tumors in which high-level local expression of TNF is desired. Cancer Gene Therapy (2009) 16, 53–64; doi:10.1038/cgt.2008.57; published online 25 July 2008 Keywords: tumor; necrosis; factor; immunotherapy; adenovirus; CD154 9–11 Introduction from that of secreted TNF in vitro and in vivo. However, cells expressing such truncated forms of TNF Tumor necrosis factor (TNF)-a was initially described lacking the TACE cleavage site still could release 9 as a 17-kDa soluble cytokine that could induce local active TNF. Moreover, enzymes other than TACE could and systemic tumor regression.1 However, clinical trials cleave the 26-kDa TNF proform at sites other than that 12 revealed that the soluble cytokine had a low therapeutic recognized by TACE, to release a soluble TNF. As such, index, owing to its toxicity when present at therapeutic the interpretation that membrane TNF has biological concentrations in the systemic circulation.2–4 activity distinct from that of soluble TNF has to be Soluble TNF is released from the surface of tempered in light of the fact that soluble TNF still might cells expressing the 26-kDa proform of TNF through be released in the microenvironment of cells expressing the TNF-a-converting enzyme (TACE/ADAM-17),5,6 a such modified forms of TNF. matrix metalloproteinase that recognizes a cleavage site To address the hypothesis that membrane-bound TNF in the extracellular domain of the full-length TNF elicits a biological response distinct from that of the molecule.7 Deletion of this cleavage site results in soluble molecule, we generated chimeric forms of TNF the generation of a TNF molecule that has enhanced that are highly resistant to release from the cellular membrane stability.7–9 Mice made transgenic for this membrane. This was accomplished by fusing the active membrane-stabilized form of TNF produced significantly ligand-binding portion of the TNF molecule with the higher levels of interleukin-12 than wild-type mice or transmembrane and proximal extracellular domains of TNF-deficient mice after administration of lipopoly- TNF family proteins that primarily are expressed as cell- saccharide, suggesting that the transmembrane form of surface molecules (for example, CD154 or CD70). We TNF might affect cellular immune responses in vivo and generated adenovirus vectors encoding wild-type TNF have quantitatively and qualitatively distinct functions (Ad-wtTNF), TNF lacking the defined TACE site (Ad- DTACE-TNF) and chimeric forms of TNF with CD154 (Ad-CD154-TNF) or CD70 (Ad-CD70-TNF), and ex- Correspondence: Dr TJ Kipps, Moores UCSD Cancer Center, amined cells infected with such constructs for expression University of California, San Diego School of Medicine, 3855 Health Sciences Drive no. 0820, La Jolla, CA 92093-0820, USA. of functional cell-surface TNF relative to that of the E-mail: [email protected] soluble cytokine. Furthermore, we compared the ability 3Current address: Adventrx Pharmaceuticals, San Diego, CA, USA of CD154-TNF versus wtTNF to induce an antitumor Received 20 January 2008; revised 22 May 2008; accepted 3 June response against syngeneic fibrosarcoma and lymphoma 2008; published online 25 July 2008 in vivo. Antitumor activity of membrane-anchored TNF R Rieger et al 54 Materials and methods ATTCACAGGGCGATGATTCCAAAG. The putative Cell lines and mice matrix metalloproteinase cleavage site of CD154 was then HeLa (human cervical carcinoma), HT1080 (human deleted from this construct using Stratagene’s Quick- fibrosarcoma), A549 (human lung), HCT-15 and COLO- Change site-directed mutagenesis kit according to the 205 (human colon), DU-145 (human prostate), RPMI- manufacturer’s instructions with the following primers: 50-CAAAGAAGAGAAAAAAGAAGATGAGGATCCT 8226 (human myeloma), HT1376 (human bladder), L929 0 (mouse fibroblast), WEHI-164 (mouse fibrosarcoma) and GTAGCCC and 5 -GGGCTACAGGATCCTCATCTTC A20 (mouse B cell lymphoma) were obtained from ATCC, TTTTTTCTCTTCTTTG. Manassas, VA. The cell line 293AC2, a subclone of 293, The DTACE-TNF constructs were created by deletion was obtained from Molecular Medicine Inc. (San Diego, of the nucleotides corresponding to the first 12 amino CA). All cell lines except for 293AC2 were cultured in acids of the mature TNF, that is, amino acids 77–88 of RPMI-1640 containing 10% fetal calf serum (FCS) and the full-length human and 80–91 of the mouse protein. Using the QuickChange site-directed mutagenesis kit 2mML-glutamine and maintained in a 5% CO incubator. 2 (Stratagene, San Diego, CA), we deleted the nucleotide 293AC2 cells were cultured in DMEM containing 10% 0 ML sequence 5 -GTCAGATCATCTTCTCGAACCCCGAG FCS and 2 m -glutamine and maintained in a 10% CO2 0 incubator. TGACAAGCCT or 5 -CTCAGATCATCTTCTCAAAA Female BALB/c and FVB/N mice, 6–8 weeks of TTCGAGTGACAAGCCT, from the human or mouse age, were purchased from Charles River Laboratories TNF coding sequences, respectively. All clones were (Wilmington, MA) and housed at the University of validated by nucleic acid sequence analysis. The proteins California, San Diego (UCSD) animal facility. All animal encoded by each contruct was tested for its ability to bind studies were approved by the Animal Subjects Committee specific anti-TNF monoclonal antibodies (mAbs), as and the Biosafety Committee of the UCSD School of assessed by flow cytometry. Medicine and were performed in accordance with institu- tional guidelines. Adenovirus synthesis pcDNA3 plasmids containing the transgene of interest Chimeric gene construction were digested with the restriction enzymes NruI and SmaI We generated chimeric genes using cDNA encoding either to release a DNA fragment containing the CMV the mouse or human protein. Experiments conducted with promoter from pcDNA3, the transgene and the poly- human cells used constructs encoding the human protein adenylation signal from pcDNA3. Following gel puri- and studies performed with mouse tumor-cell lines or fication of this fragment by electrophoretic separation in a in vivo used constructs encoding the murine protein. 1% agarose gel, the DNA fragment was ligated into the The human CD154-TNF chimera was designed as EcoRV site of the adenoviral shuttle vector MCS (SK) follows. DNA encoding a fragment of human CD154 pXCX2. This plasmid is a modification of the plasmid spanning the intracellular, transmembrane and partial pXCX2 such that the pBluescript polylinker sequence has extracellular region adjacent to the transmembrane region been cloned into the E1 region (JR Tozer, UCSD, of CD154 was amplified from the full-length CD154 unpublished data, September 1993). A quantity of 5 mg cDNA by PCR using the following primers (50-GACAA each of the transgene containing MCS (SK) pXCX2 GCTTATGATCGAAACATACAACC and 50-TCAGG plasmid and JM17 plasmid were then cotransfected into ATCCTCATCTTTCTTCG). EcoRI and BamHI restric- 293AC2 cells using the calcium phosphate Profection Kit tion enzyme sites were added at the 50 and 30 ends of this from Promega according to the manufacturer’s instruc- fragment. DNA encoding the extracellular region of tions. Following transfection, the cells were cultured for human TNF distal to the TACE cleavage site was also 5 days to allow for homologous recombination and viral PCR-amplified from the full-length TNF cDNA using the synthesis. Total cells and supernatant were then harvested following primers: 50-CCGGATCCTGTAGCCCATGTT and freeze–thawed thrice to release cell-associated adeno- GTAGCAAACC and 50-GTTTCTAGATTCACAGAG virus. Clonal isolates of the adenovirus were then CAATGATTCCAAAG. XbaI and BamHI restriction obtained by plaque purification as previously described. enzyme sites were added to the ends of this fragment. Large-scale adenovirus preparations were prepared by The CD154 and TNF DNA fragments were digested with successively infecting increasing quantities of 293AC2. the restriction enzymes described above followed by The large-scale crude adenovirus preparations were then coligation into the EcoRI and XbaI sites of pcDNA3 purified over cesium chloride
Load more

Recommended publications
  • Dimerization of Ltβr by Ltα1β2 Is Necessary and Sufficient for Signal
    Dimerization of LTβRbyLTα1β2 is necessary and sufficient for signal transduction Jawahar Sudhamsua,1, JianPing Yina,1, Eugene Y. Chiangb, Melissa A. Starovasnika, Jane L. Groganb,2, and Sarah G. Hymowitza,2 Departments of aStructural Biology and bImmunology, Genentech, Inc., South San Francisco, CA 94080 Edited by K. Christopher Garcia, Stanford University, Stanford, CA, and approved October 24, 2013 (received for review June 6, 2013) Homotrimeric TNF superfamily ligands signal by inducing trimers survival in a xenogeneic human T-cell–dependent mouse model of of their cognate receptors. As a biologically active heterotrimer, graft-versus-host disease (GVHD) (11). Lymphotoxin(LT)α1β2 is unique in the TNF superfamily. How the TNFRSF members are typically activated by TNFSF-induced three unique potential receptor-binding interfaces in LTα1β2 trig- trimerization or higher order oligomerization, resulting in initiation ger signaling via LTβ Receptor (LTβR) resulting in lymphoid organ- of intracellular signaling processes including the canonical and ogenesis and propagation of inflammatory signals is poorly noncanonical NF-κB pathways (2, 3). Ligand–receptor interactions α β understood. Here we show that LT 1 2 possesses two binding induce higher order assemblies formed between adaptor motifs in sites for LTβR with distinct affinities and that dimerization of LTβR the cytoplasmic regions of the receptors such as death domains or α β fi by LT 1 2 is necessary and suf cient for signal transduction. The TRAF-binding motifs and downstream signaling components such α β β crystal structure of a complex formed by LT 1 2,LT R, and the fab as Fas-associated protein with death domain (FADD), TNFR1- fragment of an antibody that blocks LTβR activation reveals the associated protein with death domain (TRADD), and TNFR-as- lower affinity receptor-binding site.
    [Show full text]
  • The Unexpected Role of Lymphotoxin Β Receptor Signaling
    Oncogene (2010) 29, 5006–5018 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 www.nature.com/onc REVIEW The unexpected role of lymphotoxin b receptor signaling in carcinogenesis: from lymphoid tissue formation to liver and prostate cancer development MJ Wolf1, GM Seleznik1, N Zeller1,3 and M Heikenwalder1,2 1Department of Pathology, Institute of Neuropathology, University Hospital Zurich, Zurich, Switzerland and 2Institute of Virology, Technische Universita¨tMu¨nchen/Helmholtz Zentrum Mu¨nchen, Munich, Germany The cytokines lymphotoxin (LT) a, b and their receptor genesis. Consequently, the inflammatory microenviron- (LTbR) belong to the tumor necrosis factor (TNF) super- ment was added as the seventh hallmark of cancer family, whose founder—TNFa—was initially discovered (Hanahan and Weinberg, 2000; Colotta et al., 2009). due to its tumor necrotizing activity. LTbR signaling This was ultimately the result of more than 100 years of serves pleiotropic functions including the control of research—indeed—the first observation that tumors lymphoid organ development, support of efficient immune often arise at sites of inflammation was initially reported responses against pathogens due to maintenance of intact in the nineteenth century by Virchow (Balkwill and lymphoid structures, induction of tertiary lymphoid organs, Mantovani, 2001). Today, understanding the underlying liver regeneration or control of lipid homeostasis. Signal- mechanisms of why immune cells can be pro- or anti- ing through LTbR comprises the noncanonical/canonical carcinogenic in different types of tumors and which nuclear factor-jB (NF-jB) pathways thus inducing cellular and molecular inflammatory mediators (for chemokine, cytokine or adhesion molecule expression, cell example, macrophages, lymphocytes, chemokines or proliferation and cell survival.
    [Show full text]
  • Antagonist Antibodies Against Various Forms of BAFF: Trimer, 60-Mer, and Membrane-Bound S
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2016/07/19/jpet.116.236075.DC1 1521-0103/359/1/37–44$25.00 http://dx.doi.org/10.1124/jpet.116.236075 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 359:37–44, October 2016 Copyright ª 2016 by The American Society for Pharmacology and Experimental Therapeutics Unexpected Potency Differences between B-Cell–Activating Factor (BAFF) Antagonist Antibodies against Various Forms of BAFF: Trimer, 60-Mer, and Membrane-Bound s Amy M. Nicoletti, Cynthia Hess Kenny, Ashraf M. Khalil, Qi Pan, Kerry L. M. Ralph, Julie Ritchie, Sathyadevi Venkataramani, David H. Presky, Scott M. DeWire, and Scott R. Brodeur Immune Modulation and Biotherapeutics Discovery, Boehringer Ingelheim Pharmaceuticals, Inc., Ridgefield, Connecticut Received June 20, 2016; accepted July 18, 2016 Downloaded from ABSTRACT Therapeutic agents antagonizing B-cell–activating factor/B- human B-cell proliferation assay and in nuclear factor kB reporter lymphocyte stimulator (BAFF/BLyS) are currently in clinical assay systems in Chinese hamster ovary cells expressing BAFF development for autoimmune diseases; belimumab is the first receptors and transmembrane activator and calcium-modulator Food and Drug Administration–approved drug in more than and cyclophilin ligand interactor (TACI). In contrast to the mouse jpet.aspetjournals.org 50 years for the treatment of lupus. As a member of the tumor system, we find that BAFF trimer activates the human TACI necrosis factor superfamily, BAFF promotes B-cell survival and receptor. Further, we profiled the activities of two clinically ad- homeostasis and is overexpressed in patients with systemic vanced BAFF antagonist antibodies, belimumab and tabalumab.
    [Show full text]
  • TRAIL and Cardiovascular Disease—A Risk Factor Or Risk Marker: a Systematic Review
    Journal of Clinical Medicine Review TRAIL and Cardiovascular Disease—A Risk Factor or Risk Marker: A Systematic Review Katarzyna Kakareko 1,* , Alicja Rydzewska-Rosołowska 1 , Edyta Zbroch 2 and Tomasz Hryszko 1 1 2nd Department of Nephrology and Hypertension with Dialysis Unit, Medical University of Białystok, 15-276 Białystok, Poland; [email protected] (A.R.-R.); [email protected] (T.H.) 2 Department of Internal Medicine and Hypertension, Medical University of Białystok, 15-276 Białystok, Poland; [email protected] * Correspondence: [email protected] Abstract: Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a pro-apoptotic protein showing broad biological functions. Data from animal studies indicate that TRAIL may possibly contribute to the pathophysiology of cardiomyopathy, atherosclerosis, ischemic stroke and abdomi- nal aortic aneurysm. It has been also suggested that TRAIL might be useful in cardiovascular risk stratification. This systematic review aimed to evaluate whether TRAIL is a risk factor or risk marker in cardiovascular diseases (CVDs) focusing on major adverse cardiovascular events. Two databases (PubMed and Cochrane Library) were searched until December 2020 without a year limit in accor- dance to the PRISMA guidelines. A total of 63 eligible original studies were identified and included in our systematic review. Studies suggest an important role of TRAIL in disorders such as heart failure, myocardial infarction, atrial fibrillation, ischemic stroke, peripheral artery disease, and pul- monary and gestational hypertension. Most evidence associates reduced TRAIL levels and increased TRAIL-R2 concentration with all-cause mortality in patients with CVDs. It is, however, unclear Citation: Kakareko, K.; whether low TRAIL levels should be considered as a risk factor rather than a risk marker of CVDs.
    [Show full text]
  • Commentary Mechanisms of Tumor Necrosis Factor Α Action On
    Proc. Natl. Acad. Sci. USA Vol. 96, pp. 9449–9451, August 1999 Commentary Mechanisms of tumor necrosis factor ␣ action on neurodegeneration: Interaction with insulin-like growth factor-1 Sarah A. Loddick and Nancy J. Rothwell* School of Biological Sciences, University of Manchester, Manchester M13 9PT, United Kingdom The role of cytokines and growth factors in diverse forms of cause cell death when infused into a normal rodent brain, there neurodegeneration is now widely recognized. Several proin- is considerable evidence that TNF␣ mediates neuronal death flammatory cytokines, notably tumor necrosis factor (TNF) ␣ in an injured brain (e.g., ref. 9). Administration of exogenous and IL-1, have been shown to mediate diverse forms of TNF␣ markedly exacerbates ischemic injury in vivo (7) and, experimental neurodegeneration (1, 2), although in several most importantly, acute inhibition of TNF␣ action, by admin- cases both neurotoxic and neuroprotective actions have been istration of TNF soluble receptor (which prevents its action) (7, reported. Similarly numerous growth factors, including insu- 11) or a neutralizing antibody to TNF␣ (e.g., refs. 7 and 12) lin-like growth factor (IGF), fibroblast growth factor, trans- markedly attenuates ischemic brain damage in rat and mouse. forming growth factor ␤, ciliary neurotrophic factor, vascular In contrast, studies in mice lacking TNF␣ receptor suggest endothelial growth factor, glia-derived neurotrophic factor, that TNF␣ may also have neuroprotective actions, mediated by brain-derived neurotrophic factor, nerve growth factor, and the p55 receptor (13, 14). Ischemic and excitotoxic injury is several neurotrophins have neuroprotective and͞or neurotro- greater in animals that lack either the p55 receptor or both phic actions in vivo and in vitro (e.g., refs.
    [Show full text]
  • The Role of Tumor Necrosis Factor Alpha (TNF-)
    International Journal of Molecular Sciences Review The Role of Tumor Necrosis Factor Alpha (TNF-α) in Autoimmune Disease and Current TNF-α Inhibitors in Therapeutics Dan-in Jang 1,†, A-Hyeon Lee 1,† , Hye-Yoon Shin 2, Hyo-Ryeong Song 1,3 , Jong-Hwi Park 1, Tae-Bong Kang 4 , Sang-Ryong Lee 5,* and Seung-Hoon Yang 1,* 1 Department of Medical Biotechnology, Collage of Life Science and Biotechnology, Dongguk University, Seoul 04620, Korea; [email protected] (D.-i.J.); [email protected] (A.-H.L.); [email protected] (H.-R.S.); [email protected] (J.-H.P.) 2 School of Life Science, Handong Global University, Pohang, Gyeongbuk 37554, Korea; [email protected] 3 Department of Pharmacy, College of Pharmacy, Yonsei University, Seoul 03722, Korea 4 Department of Biotechnology, College of Biomedical and Health Science, Konkuk University, Chungju 27478, Korea; [email protected] 5 Department of Biological Environmental Science, Collage of Life Science and Biotechnology, Dongguk University, Seoul 04620, Korea * Correspondence: [email protected] (S.-R.L.); [email protected] (S.-H.Y.) † These authors contributed equally to this work. Abstract: Tumor necrosis factor alpha (TNF-α) was initially recognized as a factor that causes the Citation: Jang, D.-i.; Lee, A-H.; Shin, necrosis of tumors, but it has been recently identified to have additional important functions as a H.-Y.; Song, H.-R.; Park, J.-H.; Kang, pathological component of autoimmune diseases. TNF-α binds to two different receptors, which T.-B.; Lee, S.-R.; Yang, S.-H. The Role initiate signal transduction pathways.
    [Show full text]
  • The Recent History of Tumour Necrosis Factor (Tnf)
    THE RECENT HISTORY OF TUMOUR NECROSIS FACTOR (TNF) The transcript of a Witness Seminar held by the History of Modern Biomedicine Research Group, Queen Mary University of London, on 14 July 2015 Edited by A Zarros, E M Jones, and E M Tansey Volume 60 2016 ©The Trustee of the Wellcome Trust, London, 2016 First published by Queen Mary University of London, 2016 The History of Modern Biomedicine Research Group is funded by the Wellcome Trust, which is a registered charity, no. 210183. ISBN 978 1 91019 5208 All volumes are freely available online at www.histmodbiomed.org Please cite as: Zarros A, Jones E M, Tansey E M. (eds) (2016) The Recent History of Tumour Necrosis Factor (TNF). Wellcome Witnesses to Contemporary Medicine, vol. 60. London: Queen Mary University of London. CONTENTS What is a Witness Seminar? v Acknowledgements E M Tansey and A Zarros vii Illustrations and credits ix Abbreviations xi Introduction Professor Jon Cohen xv Transcript Edited by A Zarros, E M Jones, and E M Tansey 1 Appendix 1 Timeline of important events in the history of TNF 73 Appendix 2 Simplified overview of the main biological actions of TNF in rheumatoid arthritis 75 Appendix 3 Overview of TNF inhibitors mentioned in the current Witness Seminar transcript 77 Glossary 79 Biographical notes 83 References 93 Index 105 Witness Seminars: Meetings and publications 111 WHAT IS A WITNESS SEMINAR? The Witness Seminar is a specialized form of oral history, where several individuals associated with a particular set of circumstances or events are invited to meet together to discuss, debate, and agree or disagree about their memories.
    [Show full text]
  • Upregulation of Ciliary Neurotrophic Factor (CNTF) and CNTF Receptor ␣ in Rat Kidney with Ischemia-Reperfusion Injury
    J Am Soc Nephrol 12: 749–757, 2001 Upregulation of Ciliary Neurotrophic Factor (CNTF) and CNTF Receptor ␣ in Rat Kidney with Ischemia-Reperfusion Injury CHUL WOO YANG,* SUN WOO LIM,† KI WHAN HAN,† HEE JONG AHN,* JUNG HEE PARK,* YOUNG HEE KIM,† MATTHIAS KIRSH,‡ JUNG HO CHA,† JOO HYUN PARK,* YONG SOO KIM,* JIN KIM,† and BYUNG KEE BANG* *Division of Nephrology, Department of Internal Medicine, Kangnam St. Mary’s Hospital, and †Department of Anatomy, The College of Medicine, The Catholic University of Korea, Seoul, Korea; and ‡Institute of Anatomy, University of Freiburg, Freiburg, Germany. Abstract. Ciliary neurotrophic factor (CNTF) is presumed to weak and limited to the descending thin limb of the loop of play a role as a survival factor in neuronal cells, but little is Henle. With I/R injury, CNTF mRNA and protein expressions known about its role in the kidney. To investigate this, the were strikingly increased as compared with the sham-operated expression of CNTF and CNTF receptor ␣ (CNTFR ␣) was rat kidney, and the immunoreactivity of CNTF was mainly analyzed in the ischemic rat kidney. An ischemia/reperfusion observed in the regenerating proximal tubules. The expression (I/R) injury was induced by clamping both renal arteries for 45 of CNTFR ␣ mRNA was also increased after I/R injury, and its min. Animals were killed at 1, 2, 3, 5, 7, 14, and 28 d after location and expression patterns were similar to the expression ischemia. The expression of CNTF and CNTFR ␣ was moni- of CNTF. These findings suggest a possible role of CNTF as a tored by reverse transcription-PCR, in situ hybridization, im- growth factor during renal tubular repair processes after I/R munoblotting, immunohistochemistry, and electron micros- injury and an autocrine or paracrine function of CNTF acting copy.
    [Show full text]
  • Study of Molecular and Immunological Factors That Determine the Sensitivity to the Antitumor Effect of Tumor Necrosis Factor
    Study of molecular and immunological factors that determine the sensitivity to the antitumor effect of Tumor Necrosis Factor Leander Huyghe Thesis submitted in fulfillment of the requirements for the degree of DOCTOR IN SCIENCES: BIOTECHNOLOGY Promoter: Prof. Dr. Peter Brouckaert 2008 Ghent University, Faculty of Sciences VIB Department for Molecular Biomedical Research Cover pictures: C57BL/6 mouse, PECAM-1 stained tumor blood vessels, crystal structure of human Tumor Necrosis Factor (from Eck, M.J., Sprang, S.R. (1989) J. Biol. Chem. 264: 17595-605), May-Grünwald Giemsa stained blood smear showing lymphocyte and neutrophil, cultured B16Bl6 melanoma cells Study of molecular and immunological factors that determine the sensitivity to the antitumor effect of Tumor Necrosis Factor Leander Huyghe Thesis submitted in fulfillment of the requirements for the degree of DOCTOR IN SCIENCES: BIOTECHNOLOGY Promoter: Prof. Dr. Peter Brouckaert 2008 Ghent University, Faculty of Sciences VIB Department for Molecular Biomedical Research Examination committee: Reading committee: Prof. Dr. Peter Brouckaert 1 Prof. Dr. Dirk Elewaut 2 Prof. Dr. Olivier Feron 3 Prof. Dr. Bart Vanhaesebroeck 4 Other members: Prof. Dr. Johan Grooten (chair) 5 6 Prof. Dr. Georges Leclercq 1 Prof. Dr. Claude Libert 7 Dr. Jeroen Hostens 1 VIB Department for Molecular Biomedical Research, Ghent University, Ghent, Belgium 2 Department of Rheumatology, Ghent University Hospital, Ghent, Belgium 3 Unit of Pharmacology and Therapeutics, University of Louvain (UCL) Medical School, Brussels, Belgium 4 Centre for Cell Signaling, Institute of Cancer, Queen Mary University of London, London, UK 5 Department of Molecular Biology, Ghent University, Ghent, Belgium 6 Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium 7 Philip Morris Research Laboratories, Leuven, Belgium i TABLE OF CONTENTS LIST OF ABBREVIATIONS ....................................................................................
    [Show full text]
  • Dual Role of TNF and Ltα in Carcinogenesis As Implicated by Studies in Mice
    cancers Review Dual Role of TNF and LTα in Carcinogenesis as Implicated by Studies in Mice Ekaterina O. Gubernatorova 1,2,*, Almina I. Polinova 1,2, Mikhail M. Petropavlovskiy 1,2, Olga A. Namakanova 1,2, Alexandra D. Medvedovskaya 1,2, Ruslan V. Zvartsev 1,3, Georgij B. Telegin 4, Marina S. Drutskaya 1,3,* and Sergei A. Nedospasov 1,2,3,5,* 1 Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, 119991 Moscow, Russia; [email protected] (A.I.P.); [email protected] (M.M.P.); [email protected] (O.A.N.); [email protected] (A.D.M.); [email protected] (R.V.Z.) 2 Department of Immunology, Faculty of Biology, Lomonosov Moscow State University, 119234 Moscow, Russia 3 Center for Precision Genome Editing and Genetic Technologies for Biomedicine, Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, 119991 Moscow, Russia 4 Branch of Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry of the Russian Academy of Sciences (BIBCh, RAS), 142290 Pushchino, Russia; [email protected] 5 Sirius University of Science and Technology, Federal Territory Sirius, 354340 Krasnodarsky Krai, Russia * Correspondence: [email protected] (E.O.G.); [email protected] (M.S.D.); [email protected] (S.A.N.) Simple Summary: Tumor necrosis factor (TNF) and its closely related cytokine, lymphotoxin alpha (LTα), are part of the TNF superfamily and exert their functions via both overlapping and non- Citation: Gubernatorova, E.O.; redundant signaling pathways. Reported pro- and antitumorigenic effects of TNF and lymphotoxin Polinova, A.I.; Petropavlovskiy, M.M.; are often context-dependent and may be contingent on a particular experimental approach, such Namakanova, O.A.; Medvedovskaya, as transplantable and chemically induced tumor models; tissue and organ specificity; types of cells A.D.; Zvartsev, R.V.; Telegin, G.B.; producing these cytokines or responding to them; and the genotype and genetic background of mice.
    [Show full text]
  • Is Osteopontin a Friend Or Foe of Cell Apoptosis in Inflammatory
    International Journal of Molecular Sciences Review Is Osteopontin a Friend or Foe of Cell Apoptosis in Inflammatory Gastrointestinal and Liver Diseases? Tomoya Iida ID , Kohei Wagatsuma, Daisuke Hirayama and Hiroshi Nakase * Department of Gastroenterology and Hepatology, Sapporo Medical University School of Medicine, Minami 1-jo Nishi 16-chome, Chuo-ku, Sapporo 060-8543, Japan; [email protected] (T.I.); [email protected] (K.W.); [email protected] (D.H.) * Correspondence: [email protected]; Tel.: +81-11-611-2111; Fax: +81-11-611-2282 Received: 22 November 2017; Accepted: 19 December 2017; Published: 21 December 2017 Abstract: Osteopontin (OPN) is involved in a variety of biological processes, including bone remodeling, innate immunity, acute and chronic inflammation, and cancer. The expression of OPN occurs in various tissues and cells, including intestinal epithelial cells and immune cells such as macrophages, dendritic cells, and T lymphocytes. OPN plays an important role in the efficient development of T helper 1 immune responses and cell survival by inhibiting apoptosis. The association of OPN with apoptosis has been investigated. In this review, we described the role of OPN in inflammatory gastrointestinal and liver diseases, focusing on the association of OPN with apoptosis. OPN changes its association with apoptosis depending on the type of disease and the phase of disease activity, acting as a promoter or a suppressor of inflammation and inflammatory carcinogenesis. It is essential that the roles of OPN in those diseases are elucidated, and treatments based on its mechanism are developed. Keywords: osteopontin; apoptosis; gastrointestinal; liver; inflammation; cacinogenesis 1. Introduction Cancer epidemiologists have described three carcinogenesis factors: daily diet, smoking, and inflammation [1].
    [Show full text]
  • Or Tumor Necrosis Factor-Α
    Differential Effects of Interleu kin 1-a (IL-1a) or Tumor Necrosis Factor-a (TNF-a) on Motility of Human Melanoma Cell Lines on Fibronectin Sybren K. Dekker,* Jacqueline Vink,* Bert Jan Vermeer,t Jan A. Bruijn,:j: Martin C. MihmJr.,* and H. Randolph Byers* 'Dermatopathology Division, Department of Pathology, Harvard Medical School, and Massachusetts General Hospital, Boston, Massachusetts, U.S.A.; and Departments of tDermatology and :j:Pathology, University of Leiden, Leiden, The Netherlands Interleukin-la (IL-la) and tumor necrosis factor-a melanoma cell lines tested; downward shift of the a 2 , a 3 , a4 , (TNF-a) induce a motogenic response in a number of benign and PI integrin subunits was detected among three of the and malignant cells. We examined the chemokinetic effects melanoma cell lines as were upward shifts of the a 4 , as, and of these cytokines on the cell migration of four melanoma a6 integrin subunits among three of the melanoma cell lines. cell lines on fibronectin using modified Boyden chambers IL-la and TNF-a induced enhanced migration on fibronec­ and video-time lapse analysis. Flow cytometry analysis of tin in one of the melanoma cell lines and were related to an IL-l receptors, TNF receptors, and shifts in PI integrin ex­ upward shift in the a 4 and as integrin subunit expression. pression were correlated with the effects of these cytokines Taken together, the findings indicate that expression of a on cell migration on fibronectin. The four melanoma cell particular receptor for IL-l or TNF does not necessarily sig­ lines exhibited heterogeneous expression of types I and II nal a motogenic response in melanoma cells, but induces IL-l receptors as well as p60 TNF receptors.
    [Show full text]