Biased Allosteric Regulation of the Prostaglandin F2
Receptor: From Small Molecules to
Large Receptor Complexes
By
Eugénie Goupil
Department of Pharmacology and Therapeutics
McGill University, Montréal, Canada
November, 2012
A thesis submitted to McGill in partial fulfillment of the requirements of the
degree of Doctor of philosophy
Copyright ©Eugénie Goupil, 2012
''In theory, there is no difference between theory and practice.
In practice, there is.''
-Lawrence Peter ''Yogi'' Berra
ii
Abstract
G protein-coupled receptors (GPCRs) represent the largest family of cell surface receptors, and thus some of the most important targets for drug discovery.
By binding to the orthosteric site where endogenous ligands bind, agonists and antagonists differentially modulate signals sent downstream from these receptors.
New evidence suggests that GPCRs possess topographically distinct or allosteric binding sites, which may differentially modulate agonist- and antagonist-mediated responses to selectively affect distinct signalling pathways coupled to the same receptor. These sites may either positively or negatively regulate receptor activity, depending on the pathway in question, and thus can act as biased ligands, leading to functional selectivity (or ligand-directed signalling). Another way of allosterically regulating GPCR signalling is through receptor oligomerization, which has recently emerged as a common mechanism for regulating receptor function.
The GPCR for prostaglandin F2 FP, is implicated in many important physiological responses, such as parturition, smooth muscle cell contraction and blood pressure regulation. Therefore, evaluating the potential use of allosteric modulators of FP to fine-tune PGF2-mediated signals, as well as generating a better understanding of its putative oligomerization partners would be of significant pharmacological and clinical interest.
iii In this thesis, I studied the impact of modulating, in both heterologous
(HEK 293 cells) and homologous (osteoblast, myometrial or vascular smooth muscle cells) systems, downstream cellular responses of FP by 1) an orthosteric, but biased ligand, previously characterized as a neutral antagonist 2) an allosteric molecule, designed based on the extracellular domains of FP, which had biased signalling properties and, 3) heterodimerization with a receptor partner, the angiotensin II type I receptor, where I demonstrated the asymmetrical organization of this new signalling unit both in vitro and in vivo.
Overall, my thesis unveils important roles for biased, allosteric ligands and receptor oligomerization in modulating FP signalling. This work also demonstrates the importance of understanding distinct receptor conformations, and their effects on cellular responses, which are adopted when GPCRs are allosterically modulated, to design better therapeutics with improved efficacy profiles and reduced side effects.
iv Résumé
Les récepteurs couplés aux protéines G (RCPGs) repésentent la plus grande famille des récepteurs exprimés à la membrane plasmique et sont aussi considérés comme étant des cibles imporantes dans la découverte de nouveaux médicaments. Lorsque des agonistes ou antagonistes se lient au site de liaison endogène d’un RCPG, ou site orthostérique, ces derniers peuvent en moduler les signaux déployés en aval. De nouvelles évidences suggèrent que les RCPGs possèdent des sites de liaison topographiquement distincts des sites orthostériques, appelés sites allostériques. Ces sites allostériques sont suspectés de sélectivement réguler les différents sentiers de signalisation induits lorsque les récepteurs sont liés, de manière concomitante, par des agonistes ou antagonites.
De plus, ces sites allostériques peuvent réguler de manière positive ou négative les différentes activités d’un RCPG, et donc être considérés comme étant des ligands biasés, menant à ce qui est appelé la sélectivité fonctionnelle (aussi connue sous le nom de signalisation dirigée par le ligand). Une autre façon de réguler les signaux des RCPGs, qui est présentement vue comme un autre mécanisme contrôlant leur fonction, est l’oligomérization de ces derniers avec d’autres RCPGs, phénomène pouvant être aussi considéré comme de l’allostérisme.
Le RCPG pour la prostaglandine F2, FP, est impliqué dans plusieur réponses physiologiques d’importance, telles la parturition, la contraction des cellules musculaires lisses, ou même la régulation de la pression sanguine. En somme, l’évaluation des différentes façons par lesquelles les signaux de FP
v peuvent être altérés, soit par l’utilisation d’un modulateur allostérique, soit par l’oligomérisation avec d’autres RCPG, est considérée primordiale d’un point de vue clinique et pharmacologique.
Dans cette thèse, j’ai étudié les impacts de la modulation des réponses en aval de FP dans des systèmes hétérologues (cellules HEK 293) ou homologues
(cellules ostéoblastiques, myométriales ou musculaires lisses vasculaires), lorsque celui-ci était régulé par 1) un ligand orthostérique, mais à fonctions biaisées, connu précédemment comme un antagoniste neutre, 2) une molecule allostérique, inspirée des domaines extracellulaires de FP, étant aussi capable de propriétés de signalisation biaisées et par 3) l’hétérodimérisation de FP avec un autre récepteur-
« partenaire », le récepteur à l’angiotensine II, pour lequel j’ai démonté la présence d’une organisation asymétrique de cette nouvelle « unité » de signalisation, in vitro et in vivo.
De manière générale, ma thèse soulève le rôle des ligands biaisés ou allostériques, ainsi que de l’oligomérisation, dans la modulation des signaux cellulaies dirigés par FP. Le travail accompli démontre aussi l’importance de comprendre les différentes conformations, et leurs effets sur les réponses cellulaires, prises quand les RCPGs sont modulés, afin de générer de meilleurs médicaments ayant une meilleure efficacité, mais aussi des effets secondaires plus minimes.
vi Table of Contents
Abstract...... iii
Résumé...... v
Table of Contents...... vii
Acknowledgements...... xiii
Author Contributions ...... xv
List of Figures ...... xviii
List of Tables ...... xxiii
Abbreviations...... xxiv
CHAPTER 1: General introduction and literature review...... 1
1.1 Preface...... 2
1.2 G protein-coupled receptors...... 3
1.3 The heterotrimeric G proteins...... 5
1.3.1 Discovery, structure and mechanism of action ...... 5
1.3.2 G subunits and their downstream effectors ...... 8
1.3.3 G subunits and their downstream effectors...... 11
1.3.4 Receptor tyrosine kinase transactivation by GPCRs...... 12
1.4 Desensitization and endocytosis of GPCRs...... 13
1.5 G protein-independent signalling, the case of -arrestins...... 16
1.6 The F prostanoid receptor, FP...... 17
1.6.1 The prostanoids and the physiological roles of PGF2/FP ...... 18
vii 1.6.2 Prostaglandin F2-induced signalling ...... 21
1.7 The angiotensin II type I receptor, AT1R...... 23
1.7.1 The renin-angiotensin-aldosterone system...... 23
1.7.2 Physiological roles of Ang II/AT1R ...... 24
1.7.3 Angiotensin II-induced signalling...... 26
1.7.4 Interplay between FP and AT1R systems...... 28
1.8 Functional selectivity of GPCR signalling with biased-ligands ...... 29
1.8.1 Historical aspects and conceptual innovations ...... 29
1.8.2 The true nature of GPCR ligands revealed ...... 32
1.8.3 Time dependence of ligand-induced functional selectivity ...... 35
1.9 GPCR functional selectivity with allosteric modulators...... 37
1.9.1 Modulation of GPCRs by allosteric ligands ...... 37
1.9.2 Allosteric modulation of Class C GPCRs...... 39
1.9.3 Allosteric modulation of Class A GPCRs...... 41
1.9.4 The use of bitopic ligands to achieve functional selectivity ...... 44
1.10 Structural correlates of allosteric and biased signalling...... 46
1.10.1 What the crystal structures tells us about GPCR conformations ...... 46
1.10.2 The G protein-GPCR crystal structures ...... 48
1.10.3 ECL2 as a key player in allosteric modulation of GPCRs...... 49
1.11 GPCR oligomers: asymmetry in structure, asymmetry in signalling...... 52
1.11.1 Class C GPCRs: the effects of constitutive dimerization on signalling
modulation ...... 53
viii 1.11.2 Class A GPCRs: different partners add texture to receptor signalling
...... 56
1.11.3 What crystal structures tell us about oligomerization...... 59
1.12 Implications of allosteric ligands, biased ligands and oligomerization for
drug development...... 61
1.13 Rationale and objectives of the study ...... 63
1.14 Figures for Chapter 1 ...... 65
CHAPTER 2: Biasing the prostaglandin F2 receptor responses toward EGFR- dependent transactivation of MAPK...... 93
2.1 Preface...... 94
2.2 Abstract...... 95
2.3 Introduction...... 96
2.4 Materials and Methods...... 97
2.5 Results...... 105
2.5.1 AL-8810 binds to the FP receptor and activates MAPK ...... 105
2.5.2 AL-8810-promoted MAPK activation independently of PKC ...... 107
2.5.3 β-arrestins are not involved in FP-mediated MAPK signalling...... 108
2.5.4 AL-8810 activates MAPK through EGFR transactivation ...... 109
2.5.5 AL-8810-induced EGF-shedding is responsible for EGFR activation
...... 110
2.5.6 Spatio-temporal activation of ERK1/2 is differentially regulated by
PGF2α and AL-8810...... 112
ix 2.5.7 AL-8810 and PGF2 induce different patterns of cellular proliferation
...... 114
2.6 Discussion ...... 115
2.7 Acknowledgements...... 120
2.8 Figures for Chapter 2 ...... 122
CHAPTER 3: A novel biased allosteric compound inhibitor of parturition selectively impedes the prostaglandin F2-mediated Rho/ROCK signalling pathway...... 140
3.1 Preface...... 141
3.2 Abstract...... 142
3.3 Introduction...... 143
3.4 Materials and Methods...... 145
3.5 Results...... 154
3.5.1 Design and optimization of the peptidomimetic PDC113.824...... 154
3.5.2 Tocolytic effects of PDC113.824 in normal and preterm labor models.
...... 155
3.5.3 PDC113.824 negatively modulates PGF2-mediated myometrial cell
contraction and Rho/ROCK signalling...... 156
3.5.4 Potentiation of FP-mediated PKC and MAPK signalling by
PDC113.824...... 160
3.5.5 PGF2-mediated G protein coupling to FP is differentially regulated by
PDC113.824...... 163
3.6 Discussion ...... 164
x 3.7 Acknowledgements...... 170
3.8 Supplementary Experimental Procedures ...... 171
3.9 Figures for Chapter 3 ...... 174
CHAPTER 4: Angiotensin II type I receptor-mediated vasoconstriction and hypertrophy is regulated by dimerization with the prostaglandin F2 receptor FP.
...... 195
4.1 Preface...... 196
4.2 Abstract...... 197
4.3 Introduction...... 199
4.4 Materials and Methods...... 202
4.5 Results...... 213
4.5.1 FP and AT1R form heterodimers in heterologous and native contexts.
...... 213
4.5.2 FP/AT1R dimerization alters binding properties of both receptors... 215
4.5.3 FP internalizes when heterodimerized with AT1R...... 217
4.5.4 Allosteric modulation of FP and AT1R signalling...... 220
4.5.5 Antagonism of FP inhibits AngII-induced cellular hypertrophy in
VSMC...... 223
4.5.6 Abdominal aorta contractile responses to AngII are modulated by FP
occupancy...... 225
4.6 Discussion ...... 227
4.7 Acknowledgements...... 235
4.8 Author contributions ...... 235
xi 4.9 Figures for Chapter 4 ...... 236
CHAPTER 5: General discussion and Conclusions ...... 254
5.1 Contributions to scientific understanding ...... 255
5.2 FP-mediated functional selectivity by orthosteric and allosteric ligands or
by dimerization ...... 257
5.3 The importance of the extracellular loops in GPCR-mediated modulation
...... 263
5.4 PDC- and AT1R-mediated allosterism on FP...... 264
5.5 FP endocytosis ...... 269
5.6 How cellular context matters ...... 271
5.7 It’s all about conformation...... 273
5.8 Conclusions...... 276
5.9 Figures for Chapter 5 ...... 278
REFERENCES ...... 281
APPENDICES ...... 340
Workplace hazardous materials information system training certificate
Principles of laboratory radiation safety (refresher) training certificate
Permission to reproduce material in Chapters 2-3-4 and 5.
xii Acknowledgements
First and foremost, I would like to thank both my supervisors, Dr. Terry
Hébert and Dr. Stéphane Laporte for giving me the chance to do my PhD in their labs. Thank you Stéphane for talking to me about science, and for your high spirits. I will always be grateful to what I have learned from you. Thank you Terry for being always so encouraging and understanding, and so dedicated to the lab and your students. Thank you both for your patience, you enthusiasm and your kindness. I was really lucky to be mentored by two such great scientists.
Next, I would like to thank the members my advisory committee, Dr. Dan
Bernard and Dr. Hans Zingg, for their support and their guidance throughout my studies, especially Dan, for all the helpful discussions for my future goals and career.
I would also like to thank our collaborators on the different FP-related projects, which were part of the CIHR team grant in allosteric regulation, a group coordinated by Dr. Christian LeGouill, to whom I would like to thank for his help.
A special thanks to Dr. Julie Dusseault and Dr. Louise Larose, for their encouragement and advice. You are both role models for me. I would also like to thank all the members of the polypeptide group, particularly Mary Lepenna, for her dedication to make the PPL a great work environment. I would like also Fiona
Law for her support and the many great discussions we had. Thank you also to
Jung Hwa Seo, for her encouragement and her generosity.
xiii Thank you to all the Hébert lab members, which I had the pleasure to meet during my PhD, most particularly Gayane Machkalyan, Dr. Carlis Rejon and Dr.
Paulina Wzal. Thank you to the Laporte lab members, Stéphanie Clément, Roni
Wisehart, Étienne Khoury, Ljiljana Nikolajev, Dr. Sylvain Armando, Dr. Yoon
Namkung, Dr. Brandon Zimmerman, Dr. May Simaan and Dr. Benjamin Aguila.
Thank you to Dr. Laetitia Chotard, Meiou Dai, Juliana Korah, Nadège Cassendro and Marc-André Sylvain, who made the H7 at the RVH a great place to work.
Thank you all for being always so supportive friends and such great lab members.
I would like to thank my friends, Éliane Lafontaine, Yvonne Chow,
Caroline Martin, Valérie Paquet, Sandra DaCal and Yolaine Dodier, for their encouragements and support throughout my studies.
I would like to thank my mother, Johanne, for all the sacrifices she made when we were young, so my sister and I would have a better life, and to my father, Richard, for his perpetual encouragements and amazement to what seemed normal to me. And also, a special thanks to Daniel, for his encouragements, and to my sister, Roseline, who is always there for me. I would also like to thank my family for their support.
Last, I would like to thank my dear significant other, Michael, for his patience and his love during all those years of grad school, telling me that
“everything is going to be fine”. Hab dich lieb.
xiv Author Contributions
Chapter 1
Parts of chapter 1 can be found in a review (Goupil et al., 2012a). I wrote the first draft of the review and the final version was elaborated with Dr. Terry Hébert and
Dr. Stéphane Laporte.
Chapter 2
I designed and performed the experiments for Figs. 2.4, 2.6-2.9 and parts of Fig.
2.1-2.3, 2.5 and 2.10. Veronica Wisehart, who is co-first author of the manuscript
(Goupil et al., 2012b) designed and conducted the experiments for Figs. 2.1, 2.2 and 2.5. Etienne Khoury conducted the experiments for Fig. 2.3 and parts of Fig.
2.6 and 2.7. Sahar Jaffal conducted the experiments for Fig. 2.10. Brandon
Zimmerman helped with design of some experiments and with writing of the different manuscript versions. Veronica Wisehart wrote the first draft of the manuscript with Dr. Stéphane Laporte. The final version was re-written by myself, Dr. Terry Hébert and Dr. Stéphane Laporte.
xv Chapter 3
I designed and conducted the experiments for all the figures except Fig. 3.2
(conducted by Christiane Quiniou/ Dr. Sylvain Chemtob) and Fig. 3.5/Suppl. Fig.
3.3 (conducted by Danaë Tassy/Dr. Audrey Claing). Veronica Wisehart conducted part of Fig. 3.6. Carine Bourguet (Dr. William Lubell) synthesized
PDC113.824. Darlaine Pétrin generated the pIRESP-HA-hFP construct. Dr.
Dominic Devost and Dr. Hans Zingg provided their expertise for the collagen contraction assay protocol. Dr. Christian LeGouill and Dr. Michel Bouvier helped with the writing of the manuscript. Dr. H. Uri Saragovi provided the anti-FP antibody (clone 3E12). I analyzed all the data with Dr. Stéphane Laporte and Dr.
Terry Hébert and wrote the first draft of the manuscript. The final version was elaborated together with Dr. Terry Hébert and Dr. Stéphane Laporte.
Chapter 4
I conducted and design the experiments for all the figures except Fig. 4.7
(Xiaoyan Luo/Dr. Eric Thorin). Stéphanie Clément helped with Fig. 4.5. Darlaine
Pétrin helped with the generation of the FP-Split-Venus constructs. Dr. H. Uri
Saragovi provided the anti-FP and anti-PAFR antibodies. I analyzed all the data with Dr. Stéphane Laporte and Dr. Terry Hébert. I wrote the first draft of the manuscript. The final version was elaborated together with Dr Stéphane Laporte and Dr. Terry Hébert.
xvi
Chapter 5
I conducted and design the experiments for Figure 5.2 and 5.3 (Erin Choi helped for some parts). Danaë Tassy (Dr. Audrey Claing), generated the data for Figure
5.1.
xvii List of Figures
Chapter 1
Figure 1. 1 Phylogenetic relationship between the GPCRs in the human genome.
...... 65
Figure 1. 2 The heterotrimeric G protein and its activation cycle...... 66
Figure 1. 3 GPCR-induced transactivation mechanisms...... 67
Figure 1. 4 Role of -arrestin in GPCR desensitization and endocytosis...... 68
Figure 1. 5 The pluridimensionality of G protein-coupled receptor signalling. ... 69
Figure 1. 6 Prostanoid biosynthesis...... 71
Figure 1. 7 The human F prostanoid receptor (FP)...... 73
Figure 1. 8 The renin-angiotensin-aldosterone system (RAAS)...... 75
Figure 1. 9 The involvement of the PGF2 and FP in systemic blood pressure, renal and cardiovascular responses...... 76
Figure 1. 10 GPCR activation modes...... 77
Figure 1. 11 GPCR functional selectivity...... 78
Figure 1. 12 Allosteric model of drug action...... 79
Figure 1. 13 The different types of allosteric modulation...... 81
Figure 1. 14 General architecture and modularity of GPCRs...... 83
Figure 1. 15. Allosteric possibilities for GPCR homo- or heterodimers...... 84
Figure 1. 16 Functional selectivity in GPCR heterodimers...... 85
Chapter 2
Figure 2. 1 AL-8810 binds FP receptor and activates MAPK...... 122
xviii Figure 2. 2 PGF2but not AL-8810 activates MAPK via PKC...... 124
Figure 2. 3 PGF2 analogs, except AL-8810, require downstream PKC to activate
ERK1/2...... 126
Figure 2. 4 β-arrestin is not recruited to FP in response to either PGF2or AL-
8810...... 127
Figure 2.5 AL-8810 activates MAPK through EGFR-dependent transactivation.
...... 128
Figure 2. 6 AL-induced EGFR transactivation is through an EGF shedding signalling pathway...... 130
Figure 2. 7 Src is involved in AL-8810-induced ERK1/2 activation...... 132
Figure 2. 8 ERK1/2 cellular localization is differentially affected by PGF2 or
AL-8810 treatment...... 133
Figure 2.9 Spatio-temporal control of ERK1/2 activation is differentially affected by PGF2 and AL-8810...... 135
Figure 2. 10 Different patterns of [3H]-thymidine incorporation are observed with
PGF2 and AL-8810-treated cells...... 137
Figure 2. 11 Signalling mechanisms for PGF2α and AL-8810 stimulation of FP.
...... 138
Supplementary Figure 2. 1 AL-8810 pre-treatment inhibits PGF2-mediated
ERK1/2 activation...... 139
xix Chapter 3
Figure 3.1 Structures of A. THG113 peptide (ILGHRDYK) and B. PDC113.824.
...... 174
Figure 3. 2 Tocolytic action of PDC113.824 in LPS- and PGF2-induced preterm labor in mice...... 175
Figure 3.3 PDC113.824 inhibits PGF2-induced cellular contraction in myometrial cells...... 177
Figure 3. 4 PGF2-mediated Rho activation is inhibited by PDC113.824...... 179
Figure 3.5 Cell ruffling induced by PGF2 through the Gα12-Rho-Rock pathway is inhibited by PDC113.824...... 181
Figure 3. 6 PDC113.824-mediated increase of PGF2-dependent ERK1/2 activation...... 183
Figure 3.7 PGF2-induced cellular contraction and ERK1/2 activation are independently regulated...... 185
Figure 3. 8 PDC113.824 is a positive modulator of PGF2-induced PKC activation...... 186
Figure 3.9 PDC113.824 allosterically modulates PGF2 binding to FP and biases coupling to Gq and G12...... 188
Figure 3. 10 PDC113.824-mediated biased signalling effects through FP...... 190
Supplementary Figure 3. 1 PDC113.824 synthesis ...... 192
Supplementary Figure 3. 2 Effects of PDC113.824 on myometrial contraction of spontaneously delivering mice immediately post-partum ...... 193
xx Supplementary Figure 3. 3 Effects of PI3 kinase inhibitor on PGF2-induced cellular ruffling in FP cells...... 194
Chapter 4
Figure 4. 1 FP and AT1R form heterodimers in HEK 293 cells and VSMC. .... 236
Figure 4. 2 PGF2 and AngII binding to the FP/AT1R dimer...... 238
Figure 4. 3 Split-FP/AT1R Venus internalizes following PGF2 and AngII stimulation...... 239
Figure 4. 4 L158,809, an AT1R antagonist, potentiates PGF2-induced ERK1/2 activation...... 241
Figure 4. 5 Allosteric modulation of FP and AT1R signalling in the context of the heterodimer...... 243
Figure 4. 6 AS604872, a FP antagonist, inhibits AngII-induced cellular hypertrophy in VSMC...... 244
Figure 4. 7 Effects of single or dual ligand occupancy on FP- or AT1R-mediated abdominal aorta contraction...... 246
Supplementary Figure 4. 1 [125I]-SBpA binding to AT1R...... 247
Supplementary Figure 4. 2 FP does not internalize...... 248
Supplementary Figure 4. 3 FP internalizes in response to ligand stimulation when
AT1R is present...... 249
Supplementary Figure 4. 4 PKC and EGFR pathways are implicated in PGF2- and AngII-induced ERK1/2 activation...... 251
xxi Supplementary Figure 4. 5 Effect of PGF2 or L158,809 on FP cells...... 252
Chapter 5
Figure 5. 1 PDC inhibitory effects on PGF2-mediated cellular ruffling are reversed by PKC inhibition...... 278
Figure 5. 2 Distinct PDC113.824 derivatives and their effects on PGF2-induced
ERK1/2 activation...... 279
Figure 5. 3 PDC113.824 and PGF2 do not displace [125I]-THG113.31 binding, but THG113 does...... 280
xxii List of Tables
Chapter 1
Table 1. 1 FP expression and its physiological/pathophysiological functions. .... 87
Table 1. 2 Comparison of tocolytic therapies ...... 88
Table 1. 3 Definitions of different ligands modulating potency and efficacy of
GPCRs and the functional selectivity of signalling...... 89
Table 1. 4 Reported allosteric modulators of GPCRs already on the market or in clinical trials...... 90
Table 1. 5 Crystal structures of GPCRs...... 91
Chapter 4
Table 4. 1 Ki values for FP and AT1R expressed alone or together...... 253
xxiii Abbreviations
Ang II: Angiotensin II
AT1R: Angiotensin II type 1 receptor
BRET: Bioluminescence resonance energy transfer
CCP: Clathrin-coated pit cDNA: Complementary deoxyribonucleic acid
CNS: Central Nervous System
DMEM: Dulbecco’s Modified Eagle Medium
EDTA: Ethylenediaminetetraacetic acid
ECL: GPCR Extracellular loops (e.g. ECL1-3)
EGF: Epidermal growth factor
EGFR: Epidermal growth factor receptor
ERK1/2: Extracellular signal-regulated kinases 1 and 2
FBS: Fetal bovine serum
FP: F prostanoid receptor
FRET: Fluorescence (Förster) resonance energy transfer
GFP: Green fluorescent protein
GPCR: G protein-coupled receptor
HA: Hemagglutinin
HEK 293: Human embryonic kidney cells
ICL: GPCR Intracellular loops (e.g. ICL1-3)
IP: Immunoprecipitation
MAPK: Mitogen-activated protein kinase
xxiv MMP: Matrix metalloprotease mRNA: Messenger ribonucleic acid
NAM: Negative allosteric modulator
PAM: Positive allosteric modulator
PBS: Phosphate-buffered saline
PCA: Protein fragment complementation assay
PCR: Polymerase chain reaction
PDGF: platelet-derived growth factor
PDGFR: platelet-derived growth factor receptor
PGF2: Prostaglandin F2
PKC: Protein kinase C
ROCK: Rho-associated protein kinase
SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis
SH2: Src homology 2 domain
WT: Wild type
xxv
CHAPTER 1: General introduction and literature review
1 1.1 Preface
In order to transduce signals from the environment into cellular responses, cells have evolved a unique entity: the receptor. Whereas several classes of receptors exist, G protein-coupled receptors (GPCRs) uniquely transmit their signals to intracellular effectors, following a change of conformation –or “shape”– in their structure, generated in most cases by a specific set of modifications, induced ligand binding. This “lock-and-key” model allows ligand-bound GPCRs to specifically transmit information into the cell by coupling to their cognate effectors downstream. Since, in principal, an almost infinite number of possible conformations exist in most GPCRs coupled to multiple effectors, the number of responses induced downstream is theoretically quite large. In this thesis, I studied the consequences of altering receptor conformations normally adopted –when receptor is occupied by its endogenous ligand– when allosterically modulated by another ligand, or by another interacting protein. These changes imputed to the system were evaluated by the analysis of 1) the different signalling cascades triggered by this ligand-bound receptor and 2) their cellular consequences.
Parts of this introduction are taken from a review article I wrote (Goupil et al., 2012a). These parts are reproduced in this thesis with the permission of
Bentham Science Publishers (see appendices).
2 1.2 G protein-coupled receptors
G protein-coupled receptors (GPCRs), which are seven transmembrane domain-containing receptors, represent the largest and the most diverse family of cell surface receptors, comprising approximately 2% of the human genome
(Lander et al., 2001). GRCRs can bind a wide variety of ligands, including biogenic amines (adrenaline, noradrenaline, dopamine, serotonin, histamine, acetylcholine), amino acids (glutamate, -aminobutyric acid or GABA), ions
(calcium), lipids (prostaglandins, leukotrienes, lysophosphatidic acid, anandamine, platelet-activating factor), peptides (angiotensin, bradykinin, oxytosin, bombesin, endothelin, endorphins) or larger proteins (thrombin, follicle- stimulating hormone, luteinizing hormone), light, odorants, pheromones, nucleotides, opiates, and cannabinoids (reviewed in (Marinissen and Gutkind,
2001)). Thus, not surprisingly, GPCRs are involved in regulating, in one way or another, almost all physiological events (Lagerstrom and Schioth, 2008).
The GPCR superfamily comprises over 800 different members, classified in five major classes (according to the “GRAFS” system, see Figure 1.1) based on their phylogeny: the Glutamate receptor family or class C (the eight metabotrophic glutamate receptors, two GABA receptors, the calcium sensing receptor (CASR), and five of the taste receptors), the Rhodopsin receptor-like family or class A (the largest group, containing 701 receptors, divided into five sub-groups), the Adhesion receptors (which comprises 24 members),
3 Frizzled/Taste receptors (that serve as receptors in the Wnt pathway, also comprises 24 members) and the peptide-regulated Secretin receptor family or class B (15 members).
Topologically speaking, all GPCRs feature seven transmembrane domains
connected by three extracellular (ECL1, 2, 3) and three intracellular (ICL1, 2, 3) loops regulating receptor conformation flanked by extracellular N- and cytosolic
C-terminal domains of variable length. This classical model describes the
Rhodopsin family. The Glutamate receptor family is characterized by the largest
N-terminal or “Venus flytrap” (VFT) domains. The VFT domain is composed of two lobes, where conformational changes dictate the activation level of the receptor (Tateyama et al., 2004; Tsuchiya et al., 2002). The Adhesion family has
GPCR-like transmembrane spanning domains, and its N-terminal domain contains large “epidermal growth factor-like” or “adhesion-like” motifs (Yona et al.,
2008). The Frizzled family contains a large cysteine-rich region in the N- terminus, which serves as a Wnt-binding domain (Logan and Nusse, 2004). The
Secretin family has a smaller N-terminal domain than the metabotropic glutamate receptor family, which forms a peptide-binding cleft composed of multiple - sheets and -helixes (Miller et al., 2012).
At present, 50% or so of currently marketed drugs directly target GPCRs and/or their downstream effectors (Flower, 1999; Fredriksson et al., 2003).
However, despite their capacity to alter receptor signalling for therapeutic ends, most drugs display undesirable side effects, poor subtype selectivity and often low efficacies. More importantly, only a small proportion of GPCRs (around 50) are
4 targeted by these drugs (Flower, 1999), which make further study of GPCR regulation critical to the design of improved therapeutics.
1.3 The heterotrimeric G proteins
1.3.1 Discovery, structure and mechanism of action
Heterotrimeric G proteins were discovered by Martin Rodbell
(Birnbaumer et al., 1971; Pohl et al., 1971a; Pohl et al., 1971b; Rodbell et al.,
1971a; Rodbell et al., 1971b; Rodbell et al., 1971c) and Alfred G. Gilman in the late 1970’s (Ross and Gilman, 1977), as being the transducer of a discriminator
the receptor, which facilitated communication from the extracellular space to the intracellular space possible requiring GTP to function (hence the name G protein
(Cassel and Selinger, 1976; Cassel and Selinger, 1977)), ultimately leading to amplification of such signals via production of second messengers.
The G protein is composed of three subunits, , and . The subunit is composed of the Ras and AH domains. The Ras domain is a Ras-like domain, and is also called the GTPase domain, responsible for GTP hydrolyis to GDP. The
AH or -helical domain is constituted of a long central helix (A) and five shorter -helixes (Lambright et al., 1996). The AH domain is quite flexible and can be stabilized by GTP binding (Westfield et al., 2011), which occurs in a deep cleft between the GTPase and helical domains (Lambright et al., 1996). G subunits form a heterodimer (Higgins and Casey, 1994). The subunit is
5 composed of seven -sheets of four anti-parallel strands, called the -propeller and a -helix in N-terminal, which forms a coiled-coil with the one of the two - helices of subunit (Sondek et al., 1996). The remaining helix of the subunit interacts with the -propeller region of the subunit. Only the subunit, but not the subunit interacts with the subunit via two different interfaces (Lambright et al., 1996): one between the -probeller and the switch I and II of the G
(regions sensible to nucleotide binding) and one between-probeller and the N- terminal helix of the G. Changes happening to the G protein when interacting with the receptor are discussed in a later section (1.10.2).
The interrelationship between ligand-bound receptors and G proteins was first suggested by De Lean et al., elaborated in the ternary complex model (De
Lean et al., 1980). This model described two different affinity states of the receptor for its ligand. When “component X” was present, a high affinity ternary hormone-receptor-X complex was formed. The complex could then be dissociated with the addition of GTP, leading to a lower affinity of the hormone for its receptor. Component X of course turned out to be the heterotrimeric G protein.
During this same period, it was shown that the G protein was heterotrimeric (, and subunits (Northup et al., 1980)). Moreover, the G subunit was indeed found to be a guanine nucleotide binding protein, exchanging GDP for GTP, after the receptor had been stimulated by agonists (reviewed in (Rodbell, 1980)).
Following the GTP loading to the G protein, the latter would dissociate into G and G moieties (Northup et al., 1983a), and activate downstream effectors (see sections 1.3.2 and 1.3.3). Finally, the G protein would return to its basal, GDP-
6 bound state, after the hydrolysis the GTP into GDP by the G subunit which possessed an intrinsic GTPase activity, where it would be reunited with G
(Northup et al., 1983b). This cycle of activation/deactivation is illustrated in
Figure 1.2B.
In the conventional view of receptor/G protein interactions, activated G proteins would randomly collide with a membrane-bound effector (in this case, adenylyl cyclase (Orly and Schramm, 1976; Tolkovsky and Levitzki, 1978)), following the fluid mosaic model. Later, another model suggested that the interactions between the receptor, G protein and effectors could be organized into complexes, where they might be localized in lipid microdomains, dependent on ligand binding (discussed in (Neubig, 1994)). This model which also included the possibility of pre-coupling (or a constitutive association) between the receptor and the G protein made the transition between the collision model and subsequent models. In more recent models, studies suggested that G proteins remained associated with receptors and their effectors, in a pre-coupled state, undergoing conformational changes upon ligand binding which would be responsible for activating signalling cascades downstream (Chidiac et al., 1994;
Gales et al., 2006; Neubig et al., 1988; Nobles et al., 2005). These models are also supported by the different crystal structures of the 2AR, where the biggest changes imparted to the receptor are not caused by ligand binding, but by the Gs protein coupling (Audet and Bouvier, 2012; Rasmussen et al., 2011a; Rasmussen et al., 2007). Finally, these models emphasized a physical basis for coupling specificity in tissues such as the heart or nervous system, where multiple
7 receptors, G proteins and effectors would need to be highly organized to regulate signalling, as opposed to tissues such as the retina where a single receptor, G proteins and effector were found. The notion of complexes as compared to randomly interacting partners following stimulation also could explain observations that signal amplification is more important in the latter while specificity is more important in the former.
1.3.2 G subunits and their downstream effectors
There are four main families of G subunits: i/o, s/olf, q/11 and 12/13
(Gilman, 1987). Each family is responsible for the activation of a given set of effectors, leading to the production of second messenger molecules.
Classically, Gs activates the adenylyl cyclase enzyme, whereas the Gi inhibits it. Adenylyl cyclase is responsible for the catalysis of ATP into cyclic
AMP (cAMP), a second messenger molecule. Activated Gs (GTP-bound) docks its 2 helix into the cytoplasmic (C2 domain) part of adenylyl cyclase catalytic domain, which will induce a conformational change in the enzyme and activates it
(Skiba and Hamm, 1998). Primary consequences of adenylyl cyclase activation is an increase in production of cAMP, leading to the regulation of hyperpolarization- activated cyclic nucleotide-gated channels (HNC, (Wahl-Schott and Biel, 2009)), activation of the exchange protein directly activated by cAMP (EPAC, a GEF (de
Rooij et al., 1998; Kawasaki et al., 1998))) and activation of protein kinase A
(PKA, (Edelman et al., 1987)). PKA is a cAMP-dependent serine/threonine kinase
8 and cAMP binding to its regulatory subunits leads to liberation of the catalytic subunits, which have for function to phosphorylate many cellular targets, such as
Ras-proximate-1 (Rap-1, a small Ras-like GTPase, a regulator of the
Raf/MEK/ERK cascade (Wang et al., 2006)), the cAMP response element- binding protein (CREB, a (Chrivia et al., 1993)), RelA (p65, a subunit of NFB heterodimers (Zhong et al., 1998)), L-type calcium channels (LTCC, (Kamp and
Hell, 2000)), as well as myosin light chain kinase (MLCK). MLCK phosphorylation leads to dephosphorylation of the myosin light chain (MLC) and therefore triggers smooth muscle relaxation (Scheid et al., 1979). For their capacity to inhibit smooth muscle contraction, ligands inducing the receptor to couple to Gs are often referred as “relaxing” ligands.
By contrast, Gi activation by GPCRs leads to inhibition of adenylyl cyclase activity, via binding into a cleft of the cytoplasmic (C1) domain, near the catalytic domain (Dessauer et al., 1998). The direct consequences are an inhibition of cAMP production, and therefore an inhibition of PKA or other downstream effectors. Gi has also been shown to directly activate the non- receptor tyrosine kinase Src (Corre et al., 1999; Ram et al., 2000), and the GTPase
Rap (Weissman et al., 2004) leading to activation of the ERK1/2 cascade
(Mochizuki et al., 1999). Gi can also activate ERK1/2 via other pathways
(Alblas et al., 1993; van Biesen et al., 1996; Winitz et al., 1993).
Gq, on the other hand, activates phopholypase C ((PLC, (Hanssen et al., 1991)), which cleaves phosphatidylinositol 4,5-biphosphate (PIP2) from the plasma membrane into two second messengers, inositol-(1,4,5)-phosphate (IP3)
9 and diacylglycerol (DAG). IP3 will eventually bind its receptor on the sarcoplasmic or endoplasmic reticulum, and induce the release of Ca2+ into cytoplasm, where it can bind to calmodulin (CaM) facilitating phosphorylation of
MLCK, leading to smooth muscle contraction. DAG, along with Ca2+, can activate canonical protein kinase C (PKC) isoforms, which, like PKA, can modulate many other proteins in the cells, amongst them the MAPKKK Raf, leading to the activation of the MAPKK MEK and the MAPK ERK1/2 (Gutkind,
2000).
G12/13 has been primarily linked to the activation of RhoGEFs (Rho- specific guanosyl exchange factors such as p115-RhoGEF, PDZ-RhoGEF, and leukemia-associated-RhoGEF (Kozasa et al., 1998; Suzuki et al., 2003)), leading to activation of the small GTPase Rho and subsequent cytoskeletal remodelling.
It is important to keep in mind that many of the effectors discussed above are not exclusive to a certain class of G protein, and therefore different G proteins often regulate the same pathway. For instance, activation of the ERK1/2 pathway is possible via all four classes of G proteins (Gutkind, 2000; Mochizuki et al.,
1999). Most G proteins also regulate other effectors such as calcium and potassium channels (Cabrera-Vera et al., 2003), for example the L-type voltage- gated calcium channel (Kamp and Hell, 2000), which is regulated by both Gs and Gq. Whereas G12/13 are considered the classical activators of Rho, Gq and
Gi have been shown to activate it as well, via p63RhoGEF (Lutz et al., 2005) and tyrosine kinase activity (Togashi et al., 1998), respectively.
10 1.3.3 G subunits and their downstream effectors
To date, there are five different Gβ subunits (G1-5) and 12 different Gγ
(G1-12) subunits in humans (Cabrera-Vera et al., 2003), which suggests the possibility of up to 60 the different G dimer combinations in a single cells expressing them all. Whereas it was initially believed to be a regulatory component of the G subunit, G was subsequently shown to activate several downstream pathways on its own. The first discovery of such direct G involvement in GPCR-induced signalling was the activation of Kir3 muscarinic- gated, inwardly rectifying potassium channels (Logothetis et al., 1987). Since then, many effectors have been shown to be modulated by G, including ion channels (the G protein-coupled inwardly-rectifying potassium channels mentioned above and voltage-gated calcium channels (Schoots et al., 1999;
Zamponi et al., 1997)), PLC (Zhang et al., 1996), PI3 kinase (Fruman et al.,
1998; Leopoldt et al., 1998), ERK1/2 via different pathways (Crespo et al., 1994;
Hawes et al., 1996; Luttrell et al., 1996) JNK (Coso et al., 1996) and p38 MAPK
(Yamauchi et al., 1997), a subset of the twelve adenylyl cyclase isoforms (Taussig et al., 1994; Wittpoth et al., 1999), leading to extensive signalling downstream
(Sunahara and Taussig, 2002). G subunits also modulate complex cellular responses, such as cytoskeletal remodelling (Popova and Rasenick, 2003) and transcription (Robitaille et al., 2010). More importantly, silencing of the G component of the heterotrimeric G protein has reinforced the importance of G
11 in cellular homeostasis (Hippe et al., 2009; Hwang et al., 2005; Krumins and
Gilman, 2006; Zhang et al., 2010b).
1.3.4 Receptor tyrosine kinase transactivation by GPCRs
Another signalling response, which may be both G protein-dependent or - independent, is receptor tyrosine kinase (RTK) transactivation by GPCRs, leading to ERK1/2 activation (Figure 1.3). In the canonical pathway, following growth factor stimulation, RTKs become activated by transphosphorylation of their intracellular domains in the context of a receptor dimer. Phosphorylated tyrosine residues act as docking sites for SH2 domain- or tyrosine-binding domain- containing proteins. For example, following RTK activation, the Grb2 adaptor protein is recruited to docking sites on the receptor and subsequently recruits the guanine nucleotide exchange factor Sos to the plasma membrane, which facilitates activation of the small G protein Ras and triggers the MAPK cascade (Egan et al.,
1993). In the early 1990, studies showed pertussis toxin (PTX, a Gi inhibitor)- sensitive activation of Ras (van Corven et al., 1993; Winitz et al., 1993), leading to mitogenic signals, a response usually controlled by RTKs. Since then, many studies have demonstrated the capacity of GPCRs to transactivate, amongst others, epidermal growth factor (EGF) receptors (EGFR, (Ahmed et al., 2003;
Eguchi et al., 1998; Goupil et al., 2012b; Maudsley et al., 2000; Murasawa et al.,
1998; Nair and Sealfon, 2003; Prenzel et al., 1999; Soltoff, 1998; Tsai et al.,
1997; Zwick et al., 1999)), platelet-derived growth factor (PDGF) receptor
12 (PDGFR, (Chi et al., 2010; Kotecha et al., 2002; Linseman et al., 1995; Oak et al.,
2001)) or insulin-like growth factor (IGF) receptors (IGFR, (Dalle et al., 2001;
Oligny-Longpre et al., 2012; Rao et al., 1995)). In order to transactivate EGFR, downstream effectors of GPCRs can activate matrix metalloproteases of the
ADAM family, which cleave membrane-bound pro-HB-EGF into EGF (Prenzel et al., 1999). The heterotrimeric G protein is the first actor leading to RTK transactivation, via G (Faure et al., 1994; Kranenburg et al., 1997) or G subunits (Blesen et al., 1995; Faure et al., 1994). Alternatively, the non-receptor tyrosine kinase Src, can also be activated by G (Daub et al., 1997; Dikic et al.,
1996), G (Luttrell et al., 1997; Pierce et al., 2001b) or directly by -arrestin
(Esposito et al., 2011; Fessart et al., 2005; Fessart et al., 2007; Noma et al., 2007;
Oligny-Longpre et al., 2012) and trans-activate RTK.
The physiological and pathophysiological consequences of RTK transactivation by GPCRs are many; the regulation of cellular proliferation and differentiation (Luttrell, 2002), cytoskeletal remodelling (Gohla et al., 1998), regulation of CNS synaptic transmission (Shah and Catt, 2004), cardioprotection
(Noma et al., 2007), cancer (Fischer et al., 2003) or cardiac hypertrophy (Seguchi et al., 2007; Thomas et al., 2002).
1.4 Desensitization and endocytosis of GPCRs
13 Desensitization is an important process regulating GPCR signalling.
Following ligand binding, in order to terminate GPCR signals sent downstream, receptors are desensitized. The canonical pathway of desensitization is considered to be internalization of the receptors (Figure 1.4), although questions remain regarding this process being involved only in terminating signals (see below).
This desensitization process requires the phosphorylation of ligand-occupied
GPCRs by the GPCR-kinases (GRKs), in a process called homologous desensitization (Krupnick and Benovic, 1998). Receptor phosphorylation leads to the recruitment of the adaptor proteins -arrestin1 or 2 (-arr1/2, or -arr) (Lohse et al., 1990; Pfister et al., 1985), which functionally and probably physically uncouple receptor from their cognate G-proteins. This GPCR--arr interaction also triggers formation of a clathrin-coated pit (CCP), with the help of many accessory proteins, such as the -subunit of the AP-2 adaptor (Laporte et al.,
1999) and clathrin (Goodman et al., 1996). After concentrating receptors in CCPs, the GTPase dynamin facilitates pinching off of the resulting vesicle, which then enters the endocytic pathway (Herskovits et al., 1993). In contrast, heterologous desensitization refers to ligand-independent endocytosis, where second messenger-dependent protein kinases, such as PKC or PKA, phosphorylate the receptor and uncouple it from the G protein (Chuang et al., 1996). Many possibilities arise once the receptor is endocytosed: it can either be processed via proteosomal pathways to be degraded in lysosomes (Marchese and Benovic,
2001), or it can be recycled back to the plasma membrane (Pippig et al., 1995)
(see (Kendall and Luttrell, 2009) for review). Moreover, the strength of
14 interaction between the receptor and the -arr also determines the fate of the receptor complex. In this sense, there are two main classes of GPCRs: class A, in which transient -arr binding occurs and favours rapid recycling of the receptor, and class B, in which more stable -arr binding occurs, leading to a very slow recycling rate and receptor degradation (Oakley et al., 1999; Oakley et al., 2000).
There are also a number of receptors, for which internalization, following ligand binding, occurs independently of -arr. For instance the receptor for thrombin, protease-activated receptor-1 (PAR1) was shown to internalize via a phosphorylation-dependent, -arr-independent pathway (Paing et al., 2002). Also, the metabotropic glutamate receptor 1 is internalized in a phosphorylation- independent, GRK binding-dependent pathway (Dhami et al., 2004). The serotonin 5-HT2A receptor, on the other hand, is unable to internalize because it cannot be phosphorylated, as shown by the use of a constitutively active -arr2 mutant (Gray et al., 2003). The secretin receptor was shown to be unaffected by
-arr or dynamin mutants, but internalization seemed to rely on PKA activation
(Walker et al., 1999). The prostacyclin (PGI2) receptor, was demonstrated to be desensitized by PKC, but its internalization was GRK-independent but clathrin/dynamin-dependent (Smyth et al., 2000).
Finally, there are a few receptors that have been shown not to internalize.
For instance, for the thromboxane A2 receptor (TXA2R), only the longer splice variant (TXA2R) can internalize, in a GRK2/dynamin/-arr-dependent pathway.
The shorter splice variant (TXA2R), does not internalize (Parent et al., 1999).
Another receptor of the same family, the receptor for prostaglandin F2 (PGF2),
15 or FP (the human variant at least), does not internalize or recruit -arr following agonist stimulation ((Goupil et al., 2012b) and Chapter 4 of this thesis).
Interestingly, ovine FP has two splice variants, called FPA and FPB, cloned in
1997 from a sheep corpus luteum cDNA library (Pierce et al., 1997). Whereas the longer isoform, FPA, internalizes following PGF2 stimulation, the shorter isoform, FPB, was internalized constitutively (Srinivasan et al., 2002). There is also the example of the -opioid receptor, which does not internalize in the presence of morphine (Whistler and von Zastrow, 1998), but does when occupied by other opiates, suggesting that internalization may be a biased signalling response (see below).
GPCR internalization does not simply lead to a termination of signalling
(Cheung et al., 1989; von Zastrow and Kobilka, 1992). Research performed in recent years shows that signalling can be re-directed after -arr1/2 binding to the receptor. These post-G-protein signalling pathways are described in the next section.
1.5 G protein-independent signalling, the case of -arrestins
It is known that G-protein-dependent, or post G protein signalling since we do not know if in these cases the G protein needs to be activated first triggers many or even most GPCR effects after ligand binding. However, several other effectors, called GPCR-interacting proteins (GIP, (Bockaert et al., 2004)) are also involved in receptor signalling events including a number of PDZ-domain
16 containing proteins ((Becamel et al., 2001; Hall et al., 1998; Richman et al., 2001;
Smith et al., 1999; Zitzer et al., 1999), the Janus kinase (JAK) (Guillet-Deniau et al., 1997; Marrero et al., 1995), the Arf nucleotide site opener (ARNO)/cytohesin-
2 complex (Gsandtner et al., 2005) and the -arrestins (Pfister et al., 1985).
Once -arrs form a complex with the receptor and the endocytic vesicle internalizes, signalling continues, until the late endosomal stage. The scaffolding and adapter role of -arr, previously unsuspected, has now emerged as major feature of GPCR signalling (Figure 1.5A) (Luttrell and Gesty-Palmer, 2010;
Miller and Lefkowitz, 2001). These signals are generally longer-lasting, compared to those mediated initially by the G proteins (Figure 1.5B) (Ahn et al., 2004;
Gesty-Palmer et al., 2006). For instance, Src can recruited to -arr-occupied
GPCRs (Luttrell et al., 1999), as well as the MAPKs ERK1/2 (DeFea et al., 2000),
JNK3 (McDonald et al., 2000), the E3 ubiquitin ligase Mdm2 (Shenoy et al.,
2001), the serine/threonine phosphatase PP2A (Beaulieu et al., 2005), among others. Moreover, the relevance of -arr-dependent signalling at the physiological level has also been demonstrated. -arr signalling is implicated in embryonic development, retinal function, dopamine-dependent behaviours, cardiovascular homeostasis, skeletal remodelling, immune system function, tumour growth and metastasis and metabolic regulation (see (Luttrell and Gesty-Palmer, 2010) for review).
1.6 The F prostanoid receptor, FP
17 1.6.1 The prostanoids and the physiological roles of PGF2/FP
Prostaglandins (PGs) were discovered in seminal fluid by von Euler (von
Euler, 1935) and Goldblatt (Goldblatt, 1935), and were believed to be part of prostatic secretion, hence their name. PGs are part of a larger group of molecules, called the eicosanoids, which also includes prostacyclins (PGI), thromboxanes
(TXA) and leukotrienes (LT), and are all characterized by 20 carbon-length lipid chains. There are three PGs: PGD2, PGE2, PGF2(see Figure 1.6B), one prostacyclin (PGI2), two thromboxanes (TXA2 and TXB2) and four major leukotrienes (LTA4, LTC4, LTD4 and LTE4). Together, the PGs, PGI2 and TXA form a subgroup, called the “prostanoids”. These are all derived from an intermediate molecule, arachidonic acid (AA), which is generated by phospholipase A2, using phospholipids present in the plasma membrane (Figure
1.6A). The enzymes responsible for converting AA into PGH2, which is the precursor for all prostanoids, are the cyclooxygenases (COX) or PGH2 synthases
(PGH2S). There are two COX isoforms: COX-1, which is ubiquitously expressed, and COX-2, which is inducible. Non-steroid anti-inflammatory drugs (NSAIDs), which reduce the inflammatory effects of prostanoids, inhibit one or both COX isoforms. PGH2 is then converted into all the different prostanoids, each having its own synthase (PG synthases: PGDS, PGES, PGFS, PGIS and TXS). In general, prostanoids are produced in an autocrine or paracrine manner (secreted from cells through a PG transporter) and are involved in many important physiological phenomenons.
18 PGs mediate inflammation in anaphylactic reactions (Engineer et al.,
1978), whereas PGI2 and TXA are implicated in the homeostatic balance to regulate the circulatory system (Majerus, 1983). More specifically, PGs are involved in control of the relaxation or contraction of smooth muscle tissue in many organs (e.g. uterus, GI track, lungs, eye and blood vessels, (Ruan et al.,
2011)).
All eicosanoids are endogenous ligands for GPCRs. The receptors for
PGE2 include EP1, EP2, EP3 and EP4, PGD2 has DP as its receptor, IP is the receptor for PGI2 and TP for the TXA2. The receptor for PGF2, the F prostanoid receptor or FP, (Figure 1.7A) was first cloned from a human uterine cDNA library in 1994 (Abramovitz et al., 1994). This was quickly followed by cloning of the two sheep isoforms ((Graves et al., 1995), FPA and FPB (Pierce et al., 1997)), mouse (Sugimoto et al., 1994), rat (Kitanaka et al., 1994) and cow (Sakamoto et al., 1994) receptors. FP is expressed mainly in the uterus (myometrium
(Matsumoto et al., 1997; Saito et al., 2003)), ovaries (Saito et al., 2003), but also in the heart (Sugimoto et al., 1994), brain, lungs (Sugimoto et al., 1994), eye
(Schlotzer-Schrehardt et al., 2002) and kidney (distal convoluted tube and cortical collecting ducts (Saito et al., 2003; Sugimoto et al., 1994)). The PGF2/FP system has been shown to be implicated in the initiation of luteolysis, in intraocular pressure regulation, in water reabsorption in the kidney and blood pressure regulation, in cardiac hypertrophy, in hypertrophy and vasoconstriction of the vascular smooth muscle cells (VSMC), and in the contraction of the myometrium during labour (see Table 1.1 for references).
19 Not long after FP cloning, its knockout (FP-/-) mouse model demonstrated the physiological importance of this receptor. Ovulation, fertilization and implantation in FP-/- mice were not different than for wild type animals. However, pregnant FP-/- mice failed to initiate parturition and were unable to undergo labour. Oxytocin (OT), the agonist for the oxytocin receptor (OTR, another
GPCR) is a strong uterogenic agent, triggered parturition in wild type mice, but not in FP-/- mice, showing the importance of FP in this process (Sugimoto et al.,
1997). Only ovarectomy, causing a decrease in progesterone levels (usually high during pregnancy and decreasing progressively before labour (Thorburn and
Challis, 1979)) and an increase in OTR mRNA, could restore the capacity of these mice to deliver. Therefore, the PGF2/FP system seems to be a major player in the induction of labour, being upstream of the OT/OTR system in the chain of events. More important findings regarding the FP-/- mice will be discussed in section 1.7.4 of this thesis.
Interestingly, during pregnancy, a balance exists between the contractile prostanoid receptors, mainly coupled to Gq (EP1, EP3, FP, TP) and the relaxing receptors, coupled to Gs (EP2, EP4, DP, IP). Indeed, FP is downregulated during pregnancy (Matsumoto et al., 1997), but its level increases at the onset of labour, as well as in preterm birth (Ma et al., 1999; Olson et al., 2003). Moreover, FP is also involved in preterm labour, or birth before 37 weeks of gestational age in humans, which remains a major clinical challenge in industrialized countries
(Joseph et al., 1998; McCormick, 1985). Whereas no common cause has been identified, the development of effective and safe tocolytics (drugs capable of
20 delaying labour) is still needed. Many tocolytics have been developed, however they all have significant maternal and foetal side effects (see Table 1.2). In order to develop better tocolytics (i.e. increased efficacy and potency, reduced side- effects), a peptidic ligand for FP, derived from the sequence of its ECL2 was designed. This peptide, called THG113 (see Figure 1.7 and Chapter 3 of this thesis), while not acting through the same binding site as PGF2, reduced
PGF2-induced myometrial contractions and delayed endotoxin-induced preterm birth in mice (Peri et al., 2002). To improve the potency and efficacy of this peptide, a peptide mimic was generated (see Chapter 3 of this thesis or (Goupil et al., 2010)), which showed the same capacities as THG113 to delay preterm and term birth, as well as myometrial contraction. Considering the importance of FP in smooth muscle contraction and parturition, an understanding of their effects on
FP-induced signalling pathways and the development of better ligands is critical.
1.6.2 Prostaglandin F2-induced signalling
Before cloning of its receptor, the effects of PGF2 on mediating calcium mobilization in the cell had been demonstrated (Sasaki, 1985). Then, FP was shown to couple to Gq (Ito et al., 1994b), leading to IP3 production (Davis et al.,
1987) and PKC activation (Sen et al., 2004; Wiltbank et al., 1991). FP activation also triggers cytoskeletal remodelling, via activation of Rho GTPase (Goupil et al., 2010; Pierce et al., 1999), a G12-dependent pathway in HEK 293 cells.
Moreover, FP couples to GI, as demonstrated in a study using the collecting duct
21 of the kidney (Hébert et al., 2005). FP also activates the MAPK ERK1/2 pathway, using the canonical pathway of Gq-PKC-Raf-MEK-ERK (Chen et al., 2001;
Goupil et al., 2010), or EGFR transactivation (Ahmed et al., 2003; Goupil et al.,
2012b). In cardiomyocytes, activation of the MAPK cascade by Ras and the
MAPKKK Raf leads to the induction of the early growth response factor-1 (Egr-1
(Xu et al., 2008)). In vascular smooth muscle cells (VSMC), EGFR transactivation by FP leads to cellular hypertrophy via two distinct pathways, one being dependent on ERK activation, the other on PI3K activation (Fan et al.,
2005; Fan et al., 2010).
As mentioned in the previous section, the ovine form of FP has two isoforms, FPA and FPB, the latter of which is 46 amino acids shorter (in the C- terminal tail (Pierce et al., 1997)), leading to activation of alternative signalling pathways. It was demonstrated that FPA underwent ligand-induced heterologous desensitization (via PKC) and clathrin-dependent internalization in HEK 293 cells, whereas FPB was constitutively endocytosed (Srinivasan et al., 2002).
Moreover, the truncated C-tail of FPB may have been responsible for the differences in signalling compared to FPA. Indeed, in the absence of PGF2, FPB was able to directly and constitutively recruit the p85 subunit of the PI3-kinase and activate it with subsequent recruitment of E-cadherin and -catenin (Fujino et al., 2002). This complex was however disrupted in the presence of PGF2, leading to the activation of PKC and Rho. In addition, a six transmembrane- containing domain splice variant of human FP has been cloned, and seems to be expressed primarily to the heart, the placenta and the skeletal muscle (Vielhauer et
22 al., 2004). Finally, six additional FP variants, called altFP1-6 have been identified by reverse-transcription PCR in the human eye. These variants, all shorter than
WT FP, are truncated before the TM7 and show sequence divergence in the last
20 residues. One of this variant, altFP4, was shown to heterodimerize with FP in a heterologous system and revealed differential cellular responses (Ca2+ mobilization kinetics) following the stimulation of these cells with PGF2 or bimatoprost, a prostamide analogue (Liang et al., 2008).
More recently, we have shown that FP was allosterically modulated (see the following sections for more details about GPCR allosteric regulation) by a peptide mimic molecule of its second extracellular loop (see Figure 1.7A, B), and that this modulation led to functional selectivity of signalling downstream. The
Gq-PKC-ERK pathway was potentiated, whereas the G12-Rho-ROCK-ruffling pathway was attenuated in response to PGF2in the presence of the mimic (see
Chapter 3 of this thesis (Goupil et al., 2010)).
1.7 The angiotensin II type I receptor, AT1R
1.7.1 The renin-angiotensin-aldosterone system
The renin-angiotensin-aldosterone system, or RAAS (Figure 1.8), is a primary system responsible for regulating blood pressure and water balance
(Nishiyama and Kim-Mitsuyama, 2010). It operates using a basic feedback mechanism: when the blood volume is low, renin, an enzyme is released from the
23 juxtaglomerular cells of the kidney to activate the RAAS response. Three main indications of lower blood pressure can trigger the RAAS: 1) low sodium as sensed by the nephron, 2) lower renal perfusion in the glomerulus or 3) lower blood pressure in the carotid sinus in the kidney. Renin will cleave angiotensinogen, an inactive peptide released from the liver, into angiotensin I
(Ang I). Ang I will then be converted to angiotensin II (Ang II), by the angiotensin-converting enzyme (ACE), present mainly in the lungs. Ang II, which is the major active product of the RAAS, will act in three main ways to readjust blood pressure: by contracting arterial and venous smooth muscle, by inducing release of aldosterone from the adrenal cortex, and by inducing release of anti- diuretic hormone (ADH or vasopressin) from the pituitary gland, stimulating the thirst sensation.
1.7.2 Physiological roles of Ang II/AT1R
Ang II was first identified as a pressor substance produced in the blood and named “hypertensin” and “angiotonin” by two different laboratories (Basso and Terragno, 2001). A few years later, the hybrid name “angiotensin” was chosen (Braun-Menendez and Page, 1958). Human Ang II is an octapeptide (Asp-
Arg-Val-Tyr-Ile-His-Pro-Phe) and the natural ligand of the Ang II type 1 or type 2 receptors (AT1R or AT2R (Goodfriend and Lin, 1970; Lin and Goodfriend,
1970)). In rodents, the AT1R has two subtypes, the AT1AR and the AT1BR
(Inagami, 1995). AT1R is responsible for most of the vasoactive effects of Ang II
24 and is found in the blood vessels, the heart, the kidney, the adrenal cortex, the lungs and the brain (de Gasparo et al., 2000b). AT2R, on the other hand, is expressed in foetal tissues and its expression decreases after birth (Nahmias and
Strosberg, 1995) but has been detected in the blood vessels, the pancreas, the heart, the kidney and the adrenal glands (de Gasparo et al., 2000b). However, its role in Ang II-mediated signalling and physiological responses is less understood, but it may be be to antagonize AT1R-mediated responses (Ciuffo et al., 1998;
Yamada et al., 1998). The fact that AT1R and AT2R dimerization was later demonstrated (Porrello et al., 2011; Zhang et al., 2009a) suggests that the observed effects were due to dimerization rather than simple molecular crosstalk
-/- between the two receptors. AT1AR knockout mice (Agtr1a ) presented significant blood pressure reduction, and were unresponsive to Ang II (Chen et al., 1997; Ito et al., 1995; Sugaya et al., 1995), a phenotype similar the knockout animals for
ACE and angiotensinogen, but with less impairment in kidney function, fertility and survival (Esther et al., 1996; Kim et al., 1995; Tanimoto et al., 1994).
Although Ang II has been characterized as an endocrine hormone
(converted in the lungs capillaries as seen in the previous section), it has also been shown to be produced in an autocrine and paracrine fashion, via “local” renin- angiotensin systems (RAS) in the brain, heart, kidney and blood vessels (Danser,
1996; Dzau, 1989; Touyz and Schiffrin, 2000). Moreover, some evidence has shown that AngII acts in an intracrine manner, that is, that Ang II can be synthesized and exerts its biological effects within the cell. Indeed, the intracrine effects of Ang II have been shown in the nucleus (Cook et al., 2007; Re et al.,
1984), in hepatocytes (Cook et al., 2002) and the heart (De Mello, 1998; De
25 Mello, 2006; Tadevosyan et al., 2010), as well as in VSMC (Haller et al., 1996;
Haller et al., 1999).
Ang II is an important regulator of cardiovascular homeostasis (by modulating blood volume and vascular resistance), sympathetic nervous activity, thirst response, myocardial and vascular remodelling (de Gasparo et al., 2000a).
The effects of Ang II on vascular smooth muscle cells (VSMC) in the vascular wall have been extensively studied. These cells are responsible for remodelling, repair, growth, contraction and relaxation of blood vessels, which is altered during vascular-related pathologies, such as atherosclerosis (thickening of the blood vessels), restenosis (a recurrence of the blood vessel narrowing after angioplasty) and hypertension (chronic high blood pressure). Ang II induces proliferation
(Wolf et al., 1996; Zimmerman et al., 2012), migration (Dubey et al., 1995;
Mugabe et al., 2010; Zimmerman et al., 2012), differentiation (Kobayashi et al.,
2006) and cellular hypertrophy (Berk and Rao, 1993; Ritchie et al., 1998;
Sadoshima et al., 1995) of both VSMC and ventricular cardiomyocytes.
1.7.3 Angiotensin II-induced signalling
Ang II, when bound to AT1R, signals mainly through Gq-mediated pathways, including activation of phospholipase C (PLC (Ushio-Fukai et al.,
1998)), leading to PKC and ERK activation (Tian et al., 1998) as well as cell contraction (Sauro et al., 1996). Ang II also activates PLD (Ushio-Fukai et al.,
1999a), and interestingly PLA2, leading to AA production ((Zafari et al., 1999),
26 discussed in the next section). AT1R also couples to Gi, inhibiting cAMP production (Jard et al., 1981). AT1R signals also activate L-type Ca2+ channels
(directly via G subunits (Macrez et al., 1997) or the PKC (Macrez-Lepretre et al., 1996)). Moreover, activated AT1R directly stimulated Janus Kinase/Signal
Transducers and Activators of Transcription (JAK/STAT) pathways (Marrero et al., 1995), in the G protein-independent or post G protein pathway described above (Li et al., 2005). In VSMC, Ang II activates PI3-kinase (Saward and
Zahradka, 1997) leading to the production of reactive oxygen species (ROS,
(Ushio-Fukai et al., 1999b)), modulating cellular growth and hypertrophy. AT1R- mediated signals are also involved in cytoskeletal remodelling, via activation of
Rho, Rac or the focal adhesion kinase, FAK, causing cellular matrix remodelling
(Turner et al., 1995). Ang II also regulates the activity of many transcription factors, including c-fos (Naftilan et al., 1989b), c-myc (Naftilan et al., 1989a) or
Egr-1 (Ling et al., 1999) resulting in complex cellular responses such as cellular survival, growth or hypertrophy.
Outside of the canonical Gq/PKC-mediated pathway, other effectors downstream of AT1R are responsible for ERK1/2 activation. RTK transactivation has demonstrated to be an important player in Ang II-mediated ERK1/2 activation. AT1R has been shown to transactivate EGFR via MMP activation
(Shah et al., 2004), PKC and Src (Ishida et al., 1998; Shah and Catt, 2002).
AT1R can also transactivate the platelet-derived growth factor (PDGF,
(Heeneman et al., 2000; Kim et al., 2000)), as well as the insulin-like growth factor receptor (IGFR (Ali et al., 1997; Du et al., 1996)). Moreover, ERK1/2
27 activation downstream of AT1R can operate on two different time scales: an early phase, G protein-dependent, and a late phase, -arr-dependent (Wei et al., 2003).
The MAPK p38 (Eguchi et al., 2001; Kusuhara et al., 1998) and JNK (Schmitz et al., 1998) are also activated following Ang II stimulation.
1.7.4 Interplay between FP and AT1R systems
Beyond its canonical role in the regulation of blood pressure and electrolyte balance, the RAAS, more particularly AT1R, has been found in the reproductive system (Pepperell et al., 1993; Speth et al., 1986; Speth and Husain,
1988). Many studies have shown interactions or crosstalk between FP and AT1R systems. For instance, in the bovine corpus luteum, PGF2, which induces luteolysis, can also regulate the release of Ang II, leading to a concomitant suppression of progesterone levels, to a greater extent than when Ang II was perfused alone (Hayashi and Miyamoto, 1999). Furthermore, studies have shown the involvement of PGF2 in controlling renin production (Schwertschlag et al.,
1980; Yu et al., 2009). In a reciprocal manner, AT1R activation, as discussed in the previous section, leads to AA production, through PLA2 (Zafari et al., 1999), controlling PG synthesis. A recent study showed that in FP-/- mice, RAAS activities were reduced, leading to a lowering of blood pressure and aberrant water metabolism (as measured by water consumption and urine output).
Moreover, the lack of FP attenuated development of atherosclerosis when crossed into knockout mice for the low-density lipoprotein receptor (LDLR).
28 Interestingly, the pressor effect of Ang II was greatly increased in these mice, even if AT1R mRNAs levels were decreased (Yu et al., 2009). A summary of the many roles of FP/PGF2 on blood pressure homeostasis, renal and cardiovascular responses is shown in Figure 1.9, where the RAAS is primarily active. It remains important to understand the potential interplay of this duo in physiological and pathophysiological situations.
1.8 Functional selectivity of GPCR signalling with biased-ligands
1.8.1 Historical aspects and conceptual innovations
Historically, GPCRs were considered to act as molecular switches; however, a more realistic (and complex) model now describes and accounts for multiple conformations assumed by the receptor before and once bound by a given ligand, or through interactions with other signalling partners. During the last decade, a number of new GPCR modulators have been developed which possess the capacity to “select” among the distinct receptor states, which include, as discussed below, both biased and allosteric ligands. In the following sections, different aspects of GPCR functional selectivity achieved with these modulators, the potential impact of receptor dimerization, and the implications for future drug development will be discussed.
Beginning with the development of the ternary complex model, ligand- bound GPCRs were assumed to couple with a single G protein, the latter being
29 responsible for activating downstream effector pathways ((De Lean et al., 1980), see (Kenakin, 2010a) for review). In this paradigm, GPCRs could exist in two different “states” or conformations: the inactive state, functionally and physically uncoupled from the G protein and the active state which was associated with a G protein, resulting in its activation. When it was recognized that agonist is not necessarily required to toggle receptors between the inactive and active forms, the
“two-state model”, was developed where the inactive receptor exists in an equilibrium between an inactivated (R), and an activated (R*) state (Leff, 1995).
Later, this new, but still simple, linear view was challenged, with studies showing the possibility of single receptors coupling to more than one G protein, leading to the activation of multiple downstream pathways ((Gether et al., 1995), Figure
1.10).
There are currently a wide variety of orthosteric ligands (i.e. molecules binding to the endogenous ligand binding site of a given receptor) which bind
GPCRs. These include classical agonists, antagonists (both reversible and irreversible), and inverse agonists (see Table 1.3 for definitions). Orthosteric agonists activate the receptor and engage heterotrimeric G protein coupling, leading to specific efficacies of activation on diverse signalling cascades mediated by specific effectors (Luttrell, 2006). Indeed, many classically defined agonists partially or fully activate and some antagonists (and inverse agonists) partially or fully block all the signalling pathways downstream of a given GPCR.
Interestingly, some orthosteric ligands either recognize or induce specific conformations in the receptor, which “direct” signals toward a subset of these pathways. This property of engaging the receptor toward specific signalling
30 outcomes has been termed biased signalling, ligand-directed signalling or stimulus trafficking and leads to the “functional selectivity” of GPCR responses
((Galandrin et al., 2007; Kenakin, 1995; Patel et al., 2010) and Figure 1.11).
Therefore, orthosteric ligands with such properties have collectively been referred to as “biased ligands”.
Kenakin first proposed the idea of “agonist-directed receptor trafficking” to explain inconsistencies between the two-state model and pharmacological data obtained experimentally (Kenakin, 1995). One of the earliest studies reporting biased signalling demonstrated the capacities of agonist-bound α2-adrenergic
(α2AR) (Eason et al., 1994) and cannabinoid receptors (Bonhaus et al., 1998) to preferentially couple to either Gαs or Gαi, leading to biased efficacies for cAMP production, depending on the ligand involved. Subsequent reports demonstrated that different pathways were triggered following activation of single serotonin receptor (Berg et al., 1998a; Berg et al., 1998b) or α2AR (Kukkonen et al., 2001) subtypes with the same type of ligand (e.g. different agonists). This led to the notion that there were multiple, discrete “active” states for a receptor, as seen for a change in the potency of the Gαs-mediated responses with different agonists of the calcitonin receptor type 2 (Watson et al., 2000). G proteins also play a role in biased signalling, possibly by inducing specific conformations of GPCRs to which they are coupled. Different purine nucleotides, able to bind to the active site of
Gαs, were able to induce distinct receptor conformations, leading to biased signalling depending on the ligand used to stimulate the β2-adrenergic receptor
(β2AR) (Seifert et al., 1999). This reiterated the importance of the mutual interdependence in receptor/G protein coupling. Thus, GPCRs can be considered
31 as “modular” entities, responding to distinct ligands with specific signalling outcomes depending on their specific sets of partners (see (Kenakin, 2009) and
(Kenakin, 2007)).
1.8.2 The true nature of GPCR ligands revealed
One intriguing question raised by these initial studies related to whether or not our definition of the nature of an individual ligand remained constant with respect to the entire signalling phenome of a receptor. With the understanding of biased signalling came the idea of re-evaluating multiple pathways potentially triggered by known ligands. Many possibilities suggested themselves, the simplest case being that a classical full agonist for one G protein-mediated response, might be an antagonist or inverse agonist for another event modulated by the same receptor (Gbahou et al., 2003). The reason why canonical antagonists had not been studied in standard agonist paradigms comes from the fact that they were used in pre-treatment paradigms or simultaneously with agonist treatment, and in generally higher doses, probably high enough to desensitize the system beforehand in many cases, thus masking any latent agonist activity.
Not surprisingly, more recent studies have demonstrated agonist effects mediated by so-called neutral antagonists. For instance, antagonist-mediated endocytosis with or without βarrestins, has been observed for the cholecystokinin receptor (Roettger et al., 1997), serotonin receptors (Gray and
Roth, 2001), neuropeptide Y receptors (Pheng et al., 2003) and the endothelin
32 receptor (Bhowmick et al., 1998). Atosiban, an oxytocin receptor antagonist, was shown to stimulate Gαi-mediated inhibition of cell proliferation in both Madin-
Darby canine kidney cells and in prostate cancer cells via persistent ERK1/2
MAPK activation despite inhibition of the canonical Gαq-coupled pathway
(Reversi et al., 2005a). Classically defined antagonists can also act as inverse agonists, stabilizing receptors in inactive conformations for specific pathways, as was shown for the platelet-activating factor receptor (PAFR). Various antagonists of PAFR showed distinct efficacies as inverse agonists for the inositol phosphate response with constitutively active receptor mutants (bearing lysine-to-arginine
L231R or aspartate-to-asparagine D363N mutations) or wild type PAFR (Dupré et al., 2001). Not all antagonists exhibited inverse agonist effects on both mutants, suggesting that the conformational “state” of a receptor was critical for specifying the precise range of signalling outcomes. Another study showed the inverse agonist effects of SR144528, an antagonist for the cannabinoid receptor CB2, on constitutive adenylyl cyclase activity of this receptor expressed in COS cells
(Portier et al., 1999).
In addition to their intrinsic interest to the signalling community, these findings suggested that inverse agonists, being a more recently defined class, could be used to reverse effects of constitutively activated mutant GPCRs seen in different pathologies (Parma et al., 1993; Robinson et al., 1992; Shenker et al.,
1993). However, inverse agonists, again redefined on a pathway-specific basis, can also act as agonists. A good example here is the βAR, for which inverse agonists for cAMP production, propranolol and ICI 118,551, have been shown to
33 induce -arrestin-dependent ERK1/2 activation (Azzi et al., 2003). Also, the patterns of ligand effects, when examined for two closely related GPCRs, the
β1AR and β2AR, were distinct depending on the signalling output measured. Both receptors bind a variety of catecholamine derivatives with varying affinities.
However, their use on both receptors lead to different efficacy profiles depending on whether cAMP production or MAPK activation was measured (Galandrin and
Bouvier, 2006). Signal transduction downstream of the AT1R is another example of pluridimensional efficacy. Several derivatives of Ang II have been synthesized, and when used to stimulate the AT1R, trigger unique activation patterns for downstream signalling pathways (Daniels et al., 2005; Holloway et al., 2002; Wei et al., 2003). For instance, the Laporte lab has shown that Ang II analogues having substitutions at position 8 (critical for binding to the AT1R and G protein activation), induced biased signalling through AT1R (Zimmerman et al., 2012).
Interestingly, there was a correlation between -Arr affinity for the receptor and the extent to which ERK1/2 was activated. Moreover, -Arr conformation was biased by those ligands, suggesting that different -Arr states also led to specific signalling downstream (cell proliferation and migration). A variation in efficacy has also been seen with SST2R somatostatin receptors, where specific ligands present different efficacy profiles for adenylyl cyclase activation and ligand- mediated endocytosis (Liu et al., 2005). Another report comparing the effects of
SST peptides and synthetic agonists showed that peptide ligands where able to induce endocytosis of SST2R, SST3R and SST5R, while synthetic agonists were only able to induce internalization of SST2 and SST3 (Cescato et al., 2006).
34 Similar protean effects of ligands were observed with the vasopressin receptor antagonist SB121463B (Azzi et al., 2003), and an endogenous inverse agonist for the melanocortin receptor, Agouti (Breit et al., 2006), suggesting that this type of bias may be generalizable to all GPCRs and their various signalling outcomes.
Quantification of signalling efficacy in a pathway-specific fashion can be used as an indicator to establish the limits of functional selectivity of a group of ligands targeting the same receptor. This type of analysis, when first presented in
Cartesian terms (Galandrin and Bouvier, 2006), indicated that most ligands would need to be re-evaluated and re-classified in terms of pathway-specific efficacy.
1.8.3 Time dependence of ligand-induced functional selectivity
Signal duration can also be a determinant in the functional selectivity. For instance, in the case of the ERK1/2 pathway, two waves of activation have been described: short-term activation being G protein-dependent, whereas longer stimulation is triggered by signalling mediated by endocytosed receptor-β-arrestin complexes (Ahn et al., 2004; Gesty-Palmer et al., 2006). Neurokinin A (NKA), a neuropeptide, can also activate two distinct waves of signalling, via its receptor
NK2. A shorter form of neurokinin (NKA-4-10) triggers rapid and short-term calcium mobilization, whereas the full length peptide favours a distinct conformational state of the receptor, leading, in addition to calcium mobilization, to a delayed and prolonged cAMP production (Palanche et al., 2001). This differential kinetics of signalling may imply a different set of signalling partners
35 leading to different biological outcomes. Moreover, some ligands drive ERK1/2 activation via transactivation of receptor tyrosine kinases (RTK) (Daub et al.,
1996), through shedding of EGFR ligands following activation of matrix metalloproteinases (Prenzel et al., 1999) or Src (Maudsley et al., 2000). This reinforces the idea that GPCRs are able to signal through multiple active conformations, and that, in principle, specific drugs could be designed to activate or inhibit subsets of these conformations. Interestingly, the time of treatment can also modulate the effects a ligand has on signalling. For example, it was shown using a constitutively activated cannabinoid CB2 receptor that SR144528, defined as an antagonist, acted as an inverse agonist following short term treatment, but as a neutral antagonist following longer treatments (Portier et al., 1999). Similar changes in ligand effects over time were seen with serotonin 5-HT receptors
(Berg et al., 1999). To date, little consideration to these types of effects has been given when such drugs are, or might, be used in clinical applications.
This sea change in our understanding of efficacy implies that individual ligands should be characterized pathway-by-pathway, rather than treating all receptors as identical a priori with respect to their signalling modalities. Inverse agonists, agonists or antagonists induce or select their own conformations based on whether or not they recognize receptors alone or in pre-assembled signalling complexes, and it is now clear that there are multiple sub-conformations of the R and R* states required to explain the functional selectivity achieved by biased ligands. Moreover, many classical inverse agonists, agonists and antagonists may yet be revealed to be biased ligands, requiring an extensive re-evaluation of their
36 effects on a multitude of GPCR effector pathways (Galandrin et al., 2007;
Kenakin, 2007; Kenakin, 2009; Kenakin, 2011; Leach et al., 2007).
1.9 GPCR functional selectivity with allosteric modulators
1.9.1 Modulation of GPCRs by allosteric ligands
To date, the G protein remains the best-characterized allosteric modulator of the receptor, through its capacity to modulate ligand-binding affinity. Some of the first models described the effect of G protein coupling to an activated or ligand-bound receptor as the “ternary complex model” (De Lean et al., 1980;
Limbird, 2004). This model can also be used if the G protein is substituted by an allosteric ligand, which modulates differentially the activated receptor bound by orthosteric agonist (May et al., 2007b). By binding to a topographically distinct binding site with respect to the orthosteric binding site, allosteric ligands have rapidly become an interesting alternative to modulate the selectivity and functionality of receptors and more recently ligand-directed signalling
(Christopoulos and Kenakin, 2002; Kenakin, 2010b; Kenakin and Miller, 2010;
Urwyler, 2011). Allosteric modulators, as such, existed for a long time before their full potential was recognized. They were initially described as non- competitive antagonists (Litschig et al., 1999; Varney et al., 1999). This non- competitive antagonism was often referred as insurmountable, because the
37 receptor-antagonist complex was a new entity in its own right (Vauquelin et al.,
2002a). However, the ternary complex model of allosteric modulation indicated that this could be viewed, in principle, as an adaptation of the system rather than as insurmountable antagonism (Figure 1.12). Allosteric modulators can affect
GPCRs at three different levels: 1) the binding of orthosteric ligand to the receptor, 2) the transmission of ligand binding information to other parts of the receptor or 3) the signalling downstream receptor activation (Figure 1.13). First, allosteric ligands have been shown to modulate the affinity of orthosteric drugs for their binding sites. In this type of modulation, cooperativity between the two binding sites can be neutral (no effect), positive (leftward shift of the binding curve) or negative (rightward shift of the binding curve). Interestingly, this allosteric effect is saturable, that is, when all the allosteric sites are occupied, no further allosteric modulation is observed. Moreover, the regulation of the different signalling modes downstream a given receptor can be achieved by modulating either the efficacy or potency of the response, with or without modulation of the binding affinity of the orthosteric ligand, or the coupling efficacy between the G protein and the receptor. For all the types of modulation described above, the allosteric ligand in question can therefore be a positive allosteric modulator
(PAM) or a negative allosteric modulator (NAM, see Table 1.3 for definitions).
One of the major characteristics of PAMs and NAMs is their inability to trigger
GPCR-induced responses in the absence of the orthosteric ligand. There are, however, ago-allosteric ligands or allosteric agonists, which behave like agonists, but via binding to an allosteric binding site. Ago-allosteric modulators, which do not require the presence of the orthosteric ligand to induce agonist effects, are
38 thought to be super-agonists when conjugated with orthosteric ligands. As a consequence, some ago-allosteric modulators have been shown to partially occupy the orthosteric binding site when acting alone (Holst et al., 2009). Finally, there are synthetic ligands that can simultaneously bind to both allosteric and orthosteric binding sites, a subclass of the so-called bitopic ligands (Valant et al.,
2009b). Bitopic ligands, in and of themselves are a very interesting class of molecules, which may combine a number of different pharmacophores, comprising allosteric and orthosteric ligands on the same receptor, or between receptor equivalents in homo- and hetero-oligomeric GPCRs ((Keov et al., 2011) and (Kamal and Jockers, 2009)).
1.9.2 Allosteric modulation of Class C GPCRs
Although many examples have now been described for allosteric modulators of GPCR function (see (Wang et al., 2009b) and (May et al., 2007b) for review) and some are already used clinically (Table 1.4), we will focus our discussion on the intersection between allosterism and biased signalling.
Allosteric ligands, with all their advantages, can also “tune” agonist-bound receptor responses downstream, as a biased-ligand can, acting through the orthosteric binding site. Only a few examples of such modulation have been observed to date, in both class A and class C GPCRs. For the class C GPCRs, allosteric modulation involves not just the heptahelical core of the receptor, but the large extracellular N-terminal, or “Venus flytrap” (VFT) domain. For the
39 metabotropic glutamate receptor 1α (mGluR1α), Gd3+ (gadolinium), a known modulator of glutamate-induced signalling, was revealed to be an allosteric ligand with biased properties. Indeed, by stabilization of the interface between both lobes of the VFT domain, Gd3+ facilitates changes from Gαs- to Gαq-coupled signalling following receptor stimulation (Tateyama and Kubo, 2006b). Another example from this class of GPCR is the calcium-sensing receptor (CaSR), which regulates parathyroid hormone (PTH) production to control calcium homeostasis. This receptor is coupled to both Gαq-induced release of intracellular calcium and Gαi- induced inhibition of cAMP production, leading to MAPK ERK1/2 activation
(Brennan and Conigrave, 2009). However, the balance between these two pathways was reversed when an autoantibody from an acquired hypocalciuric hypercalcemia patient was used to target the receptor. This autoantibody in fact acted as an allosteric modulator, increasing the relative contribution from the Gαq pathway compared to the Gαi pathway, decreasing ERK1/2 phosphorylation
(Makita et al., 2007). Interestingly, the same autoantibody used in presence of a calcimimetic had no effect on ERK1/2, making it insensitive to pertussis toxin, switching the MAP kinase signal dependence from Gαi to Gαq. Intriguingly, a recent study suggested that N. meningitidis, the Gram negative bacteria responsible for some forms of bacterial meningitis, also acts as an ago-allosteric ligand in that in binds to the N-terminal extracellular domain of the β2AR and specifically stimulates β-arrestin recruitment to sites of bacterial infection in endothelial cells with activating the canonical Gαs signalling pathway (Coureuil et al., 2010).
40 Another rich source of allosteric binding sites, more common for modulators of class C GPCRs, is the heptahelical domain itself. One of this class of regulators, N-[4-chloro-2-[(1,3-dioxo-1,3-dihydro-2Hisoindol-2-yl)methyl]- phenyl]-2-hydroxybenzamide (CPPHA) potentiates mGluR5-induced calcium release (O'Brien et al., 2004) and was later shown to have biased properties, as it also resulted in inhibition of ERK1/2 MAPK activity (Zhang et al., 2005).
Interestingly, 3,3’-difluororbenzaldazine (DFB), another allosteric modulator of mGluR5 binding to a site which overlaps with the CPPHA allosteric site (O'Brien et al., 2004), was able to potentiate both the calcium response and ERK1/2 activation. These results demonstrate that two different allosteric modulators, partially sharing a single allosteric binding site, can yield two specific signalling responses. These two examples highlight allosteric modulators of class C GPCRs which bind near the site of the orthosteric ligand even though it has often been suggested that the allosteric binding site of other class C GPCRs resides in the heptahelical domain (e.g. GABABR, (Pin and Prezeau, 2007) see below).
1.9.3 Allosteric modulation of Class A GPCRs
In contrast to class C GPCRs, allosteric modulation of class A receptors is thought to occur via regions outside the heptahelical transmembrane domain, on the extracellular surface of the receptor, which are less conserved and thus more receptor-specific (Peeters et al., 2011). This modulation often stabilizes specific receptor conformations, altering coupling to distinct heterotrimeric G proteins.
41 The first example of such a regulator was identified for the neurokinin NK2 receptor. When bound to its endogenous ligand, neurokinin A (NKA), NK2 can adopt distinct and sequential conformations, stabilized by two high affinity binding sites (Palanche et al., 2001). The first conformation, A1L, is thought to facilitate rapid dissociation kinetics of NKA from the receptor followed by Gαq- induced calcium mobilization, whereas the second conformation, A2L, results in slower ligand dissociation kinetics and leads to Gαs-induced cAMP production.
An allosteric ligand for NK2R, LPI805, preferentially stabilized the A1L conformation, diminishing the intensity of Gs-mediated cAMP accumulation, as the shorter version of the natural ligand NKA(4-10) would do (as discussed above) (Maillet et al., 2007). In a follow-up study, the authors were able to generate derivatives of the original allosteric ligand, which generated distinct selectivity profiles, acting as a PAM for calcium signalling and a NAM for cAMP production (Valant et al., 2009a). Another example of an allosteric modulator directly regulating coupling between the receptor and the G protein in a biased manner was shown for the prostaglandin F2α (PGF2α) receptor (FP). As I discuss in detail in Chapter 3, we developed a small molecule peptide mimic,
PDC113.824, derived originally from the sequence of the second extracellular loop of FP (Goupil et al., 2010). The peptide itself was initially characterized as a tocolytic in a mouse model of pre-term labour (Peri et al., 2002). As discussed below, ECL2 in many GPCRs may actually represent a hot-spot for allosteric regulation. PDC113.824 was demonstrated to stabilize a specific conformation of
FP receptor, where a Gαq-induced PKC-ERK1/2 pathway was potentiated and a
42 Gα12-induced, Rho-mediated cytoskeletal rearrangement was inhibited following
PGF2αstimulation (Goupil et al., 2010). Interestingly, there were no direct signalling consequences in that neither effector pathway was modulated by
PDC113.824 alone. However, basal levels of GTPγS incorporation were altered by PDC113.824 for both Gαq and Gα12, suggesting that the allosteric ligand recognized two distinct pre-formed, receptor/G protein complexes. As we will discuss below, this observation has implications regarding the actual molecular targets of biased and/or allosteric ligands. Moreover, the repercussions of such biased signalling were manifested in vivo, by inhibition of lipopolysaccharide- or
PGF2α-induced preterm labour in mice, in the presence of PDC113.824.
Interestingly, as for LPI805, the dissociation kinetics of [3H]-PGF2α from FP were more rapid in the presence of PDC113.824, and Gαq coupling was enhanced. These studies suggest that allosteric modulators, which enhance GTP binding to G proteins in the absence of orthosteric ligand, may lead to alterations in orthosteric ligand affinity for the receptor, leading to specific G protein- dependent signalling patterns.
The studies cited above demonstrate that allosteric ligands can also be signalling-biased, further increasing their potential clinical utility. Another example of such biased-signalling was shown with the small molecule
ADX61623, an allosteric modulator of the FSH receptor (FSHR) identified by high-throughput screening (Dias et al., 2011). This ligand increases the affinity of the FSH for FSHR, acting as a PAM for orthosteric ligand binding. On the other hand, it was found to inhibit cAMP-induced progesterone production in ovarian
43 primary cultures, acting as a NAM in this case. Interestingly, ADX61623 had no effect on estrogen production, indicating that the latter is Gαs-independent.
However, ADX61623,used in vivo, concomitant with FSH treatment, showed no particular effect on follicular development. These discrepancies between the effects of an allosteric modulator in endogenous cell systems and in animal models suggest that the stability or delivery of such modulators may be affected in vivo. Also, this demonstrates that the complex and subtle regulatory controls in physiological systems may add an additionally complexity in controlling these systems with allosteric modulators.
Some allosteric modulators have been identified to have more complex effects; in that they have distinct sites and mechanisms of actions, which all impinge on GPCR signalling. For example, a recent study demonstrated that small molecular potentiators of A1 adenosine receptor signalling, the so-called 2A3BT compounds, also have direct effects on G proteins distinct from their binding to the extracellular surface of the receptor (Valant et al., 2010). A similar note of complexity and caution was raised in another study which showed that an allosteric ligands for the CXCR4 chemokine receptor also interacted with CXCR7 but produced precisely the opposite signalling phenotype (Kalatskaya et al.,
2009).
1.9.4 The use of bitopic ligands to achieve functional selectivity
44 Functional selectivity can also be demonstrated using bitopic ligands.
These ligands, composed of two distinct pharmacophore moieties, either combinations of orthosteric ligands or orthosteric and allosteric ligands, are also able to favour specific conformations of GPCRs (Valant et al., 2009b). Such ligands have been used to understand biased signalling via muscarinic acetylcholine receptors (mAChR), one of the most extensively studied GPCR subfamilies with respect to allosteric regulation. It was shown that the partial agonist McN-A-343 had differential efficacy for distinct mAChR subtypes. McN-
A-343 was unable to completely displace antagonist (N-methylscopolamine,
NMS) binding to the M2 mAChR (Birdsall et al., 1983) and was shown to have a different mode of binding to the receptor, compared to common allosteric modulators or antagonists, suggesting a unique mode of action (May et al.,
2007a). McN-A-343 was also shown to exhibit functional selectivity for the Gα15 compared to Gαi-induced responses (Griffin et al., 2007). Later, using derivatives of the original molecule, it was shown that McN-A-343 was in fact a bitopic ligand, simultaneously binding to both orthosteric and allosteric sites of the M2 mAChR (Valant et al., 2008). Indeed, some of the derivatives were pure allosteric modulators with biased signalling properties. The allosteric moiety of the McN-A-
3 343 was unable to displace [ H]-NMS binding to M2 mAChR, rather acting as a
PAM for orthosteric antagonist binding (as shown by measuring dissociation kinetics of ligand binding to receptor) and as a NAM for allosteric agonist- mediated G protein/ERK1/2 activation.
As we have seen in this section, allosteric modulators show promise for use in biased signalling applications. Acting primarily in the presence of the
45 orthosteric ligand, one can imagine many possibilities for clinical use from the perspective of more selective therapeutic and reduced off-target effects.
1.10 Structural correlates of allosteric and biased signalling
1.10.1 What the crystal structures tells us about GPCR conformations
Since the bovine rhodopsin crystal structure has been elucidated in 2000, more than 15 different receptors have been crystallized for structural studies (see
Table 1.5 for details). Different types of orthosteric ligands have been used to capture receptors into a particular conformation. The recent crystal structures of antagonist-, inverse agonist- and more recently agonist-occupied GPCRs has highlighted the structural flexibility of most class A receptors as compared with rhodopsin (Hofmann et al., 2009; Jaakola et al., 2008; Palczewski, 2006;
Rasmussen et al., 2007; Warne et al., 2008). Several features, important for ligand binding as well as receptor activation, have been revealed in recent years (see
(Nygaard et al., 2009) and (Katritch et al., 2012) for review). For instance, the binding pocket is highly versatile and shows it can accommodate different types of orthosteric ligands (e.g. monoamines, nucleosides, acetylcholine, lipids or peptides). The region where the orthosteric ligand binds varies as well (deepness of the binding cleft inside of the hydrophobic core by the TM domains).
Moreover, the extracellular surface is also important for stabilization of the ligand-bound receptor conformations (see section 1.10.3).
46 In terms of conformational changes, GPCRs can be separated in two different regions: the ligand binding module and the downstream signalling module (Figure 1.14). Observations of the many structures generated to date suggest that the bottom part of the receptor is more conserved than the upper part.
However, the conformational changes sensed by the receptor are greater in the signalling module than in the binding module (Katritch et al., 2012), which confirms a transmission of the signal from top to bottom.
As suggested by in silico modeling of different agonists, antagonists and inverse agonists of β2AR (Audet and Bouvier, 2008), there are different conformations associated with signalling phenotypes observed in biochemical studies. Each conformation would allow different residues of TM3, 6 and 7, as well as the second extracellular loop (ECL2) to make contact with the different ligands used. The recent ligand-bound β1AR and β2AR structures show, not surprisingly, differences between the activated and inactivated states of the receptors, in that agonist leads to an opening of the cytoplasmic face of the heptahelical domain (Cherezov et al., 2007; Rasmussen et al., 2011a; Rasmussen et al., 2007; Rosenbaum et al., 2011; Warne et al., 2011; Warne et al., 2008).
Studies with the β2AR demonstrated that conformations linked to specific signalling outcomes could be detected using FRET between two labelled residues within the receptor, C-terminal tail and the end of TM6 (Granier et al., 2007).
Another report demonstrated the loss of functional selectivity in the dopamine receptor D2R when histidine 393 (in TM6) is mutated for an alanine (Tschammer et al., 2010). Further, micro-switches, conserved residues inside the “barrel” formed by the seven transmembrane domains (TM1-7), are involved in receptor
47 activation and in controlling the conformational state of the receptor, by inducing a rotamer change in the transmembrane helices (TMs). This event, following ligand binding, responsible for activation of the receptor, is the movement of the so-called “toggle switch”. This switch involves a global repositioning of the TMs, as a vertical “see-saw” movement, which results in the tightening of the orthosteric pocket and the opening of the intracellular side to allow G protein coupling. Importantly, the contribution of the G protein is to be included in the allosteric communication model of receptor activation, as TM5-6 in the toggle- switch model adapts to the presence of the G protein (Scheerer et al., 2008) and as suggested by the incapacity of the agonist alone to generate a full R* state
(Rosenbaum et al., 2011). Therefore, as predicted, GPCRs can adopt multiple conformations, within the theoretical energy landscape generated to understand the effect of different ligands on β2AR functional selectivity (reviewed in (Deupi and Kobilka, 2010)).
1.10.2 The G protein-GPCR crystal structures
The recent advances in crystallisation techniques have allowed structural determination of the agonist-bound 2AR with the Gs12 heterotrimeric G protein (therefore mimicking an active conformation of the receptor, (Rasmussen et al., 2011b)). This structure has allowed us to see major changes in the activated
2AR compared to the carazolol-bound (inactive conformation) structure, published five years earlier. The most drastic changes in the receptor were the
48 14Å outward movement of the TM6 and the -helical extension toward the cytoplasm of TM5, compared to the carazolol-bound structure, forming a binding pocket were the Gs can be imbedded. Moreover, after the receptor’s activation,
-helical domain from the the empty Gs undergoes a major displacement
(approximately 127 rotation between the two domains), with respect to the
GTPase domain ((Rasmussen et al., 2011b) and Figure 1.2A). GTP binding promotes the stabilization of the -helical domain on the GTPase domain, probably favouring uncoupling between the receptor and the G protein (Westfield et al., 2011). Finally, another study, using peptide amide hydrogen–deuterium exchange mass spectrometry (DXMS) showed that agonist-bound β2AR induced drastic changes in exchange rates for Gαs, but little changes for Gβ or Gγ, providing a rationale for a mechanism of GDP to GTP exchange (Chung et al.,
2011) after ligand binding.
1.10.3 ECL2 as a key player in allosteric modulation of GPCRs
In conjunction with X-ray crystallography, nuclear magnetic resonance
(NMR) spectroscopy has also been used to understand ligand-induced changes in
GPCR conformation (Tikhonova and Costanzi, 2009). A recent NMR study suggested the extracellular surface of the heptahelical domain, which is highly divergent in sequence between even homologous receptors, is an important target for both orthosteric and allosteric modulation, and therefore, functional selectivity
(Bokoch et al., 2010). Another study demonstrated the presence of an allosteric
49 “vestibule” in the extracellular entrance of the ligand binding pocket of the M2R, controlling the receptor’s conformational changes downstream, leading to G protein coupling and signalling (Bock et al., 2012). Similar observations have been made for the opioid receptor family, where a similar sequence as the M2R
“vestibule” is present in the extracellular space and is important for ligand selectivity (Katritch et al., 2012). This shows that these “vestibules”, via their poor sequence conservation between class A GPCRs, might also act as
“selectivitity filters” for orthosteric ligand binding.
As seen by comparison of the different ECL2s of the elucidated GPCR structures, many orientations and “shapes” can be taken to accommodate ligand binding (Granier and Kobilka, 2012). Indeed, ECL2 in some receptors adopts a - helix (e.g. 1ARor2AR) whereas in others is in a -sheet conformation (e.g. -
OR, -OR, -OR or NOP) or some for whom an organized structure has not been found yet (e.g. A2A or H1R). Interestingly, whereas the ECL2 structure is highly variable between classes of receptor, it is highly conserved within subtypes (e.g.
M2R and M3R or -OR, -OR, -OR and NOP or 1ARand 2AR, etc).
Moreover, the ECL2 usually has a cysteine which can form a disulfide bond with another cysteine residue in TM3, constraining this loop and forcing it to “shape” the entrance to the orthosteric binding site, regulating distinct states of the receptor (Unal et al., 2010). Furthermore, to confirm the plasticity of binding sites in GPCRs, all the antagonists or inverse agonists used in the crystal structures generated to date show different contact positions inside the binding site and to ECL2 and ECL3, while maintaining key common residues for the
50 general toggle-switch mechanism, reflecting the versatility of these receptors in accommodating ligands (Nygaard et al., 2009). Interestingly, some GPCRs possess a second disulfide bond linking the N-terminal domain to ECL2, which may also have repercussions for receptor conformation and functional selectivity
(Storjohann et al., 2008). Several reports, using site-directed mutagenesis, have demonstrated that a putative allosteric binding site may be located in ECL2.
Mutations of a cluster of acidic residues in ECL2 was enough to affect the functional selectivity of gallamine, an allosteric modulator of M2 mAChR (Leppik et al., 1994). Mutation of tyrosine 177 was also sufficient to abrogate the allosteric effects on M2 (Valant et al., 2008). The addition of a second mutation on
M2 orthosteric site, at tyrosine 104, was enough to abrogate functional selectivity induced by 77-LH-28-1, an allosteric modulator (Gregory et al., 2010). Moreover, a recent report suggested that a molecule-mimic of ECL2 itself (Peri et al., 2002) could be used to allosterically modulate FP into two different G protein-linked conformations (Goupil et al., 2010).
Another example of the functional selectivity achieved by the ECL2 was shown with the somatostatin receptor (SSTR), for which ECL2-specific antibodies were produced. These antibodies were unable to displace somatostatin binding to SSTR, but acted as agonists (Leu and Nandi, 2010). Finally, these results show that residues in ECL2 are important regulators of ligand-induced functional selectivity of GPCRs. Orthosteric ligands, once inside the barrel formed by the heptahelical domain, can adopt receptor-specific interactions with
ECL2 (Nygaard et al., 2009). It is therefore not surprising that this region of the
51 receptor may have evolved to control subtype selectivity, allowing it to transduce biased signals through the main binding pocket of GPCRs.
Class C GPCRs are quite different in their structure compared to class A or B receptors. Interestingly, for these receptors, with the exception of ions, the allosteric sites are not located in extracellular ligand-binding domains, but rather in the heptahelical domain itself, where the orthosteric ligand binds class A and B
GPCRs. Indeed, in class A GPCRs, the situation is reversed in that the extracellular loops provide sites for allosteric regulation. This also suggests that ligands analogous to orthosteric ligands for class A GPCRs could be identified as allosteric regulators of class C GPCR signalling (Goudet et al., 2004).
1.11 GPCR oligomers: asymmetry in structure, asymmetry in signalling
GPCRs have been long considered to be monomeric in their structural arrangements; however, it has become clear in recent years that most if not all
GPCRs can form dimers and possibly higher order structures (see (Bulenger et al.,
2005; Hébert and Bouvier, 1998; Kniazeff et al., 2011; Milligan, 2009; Prinster et al., 2005) for review). Although some GPCRs can still function when forced into a monomeric state (Whorton et al., 2007; Whorton et al., 2008), dimerization has proven critical in regulating all aspects of GPCR function (receptor trafficking to and from the cell surface, ligand binding, G protein coupling, downstream signalling, reviewed in (Terrillon and Bouvier, 2004)). While allosteric and biased ligands are useful ways to control GPCR signalling more selectively, the potential
52 relevance of these ligands to individual GPCRs is both increased and complicated by the existence of receptor homo- and hetero-oligomers (see Figure 1.15 for diagram). The notion that GPCRs can modulate one another allosterically, as the
G protein does with respect to receptor ligand binding affinity, will be discussed below
1.11.1 Class C GPCRs: the effects of constitutive dimerization on signalling modulation
Almost all class C GPCRs exist as dimers and the consequences of dimerization have been extensively studied for metabotropic glutamate receptors
(Romano et al., 1996), calcium-sensing receptors (Ward et al., 1998), taste receptors (Morini et al., 2005), and GABAB receptors (Jones et al., 1998). In fact, the most convincing example of dimerization in GPCRs remains the GABAB receptor. The GABABR1 harbors an ER retention signal and therefore must form a constitutive dimer with GABABR2 subunit to be targeted to the cell surface
(Jones et al., 1998; Kaupmann et al., 1998; Kuner et al., 1999; White et al., 1998).
Each protomer of this dimer has a distinct function. GABABR1 is responsible for ligand binding via its large extracellular N-terminal VFT domain, characteristic of class C GPCRs. Once bound, GABABR1 transmits a conformational signal to
GABABR2, which in return is responsible for activation of the G protein downstream (Duthey et al., 2002; Galvez et al., 2001). Until recently, the exact mechanism of the allosteric communication between both protomers of this dimer
53 was unknown. Previous data suggested that transactivation was the only means by which GABABR was able to initiate signalling, eliminating activation of the other protomer in cis (Pin and Prezeau, 2007). Indeed, it was demonstrated that 1) the
VFT domain of GABABR2 was not necessary for a functional heterodimer
(Monnier et al., 2011), and that 2) allosteric ligands can bind the heptahelical domain of GABABR2 (Binet et al., 2004), making a strong argument in favour of it serving a key regulatory role. However, it is now understood that allosteric modulation within the dimer occurs, through direct transactivation of the heptahelical domains of GABABR1 to GABABR2, after the VFT domain is primarily modulated by its ligand (Monnier et al., 2011).
Some class C metabotropic glutamate receptors (mGluR, composed of mGluR1 to 8) have been shown to form constitutive dimers (see (Pin and Acher,
2002) for review). Chimeras of the metabotropic glutamate receptor 1 (mGluR1) with the C-terminal tails of either GABABR1 or GABABR2 were used to create constitutive dimers whose trafficking and assembly could be controlled. This was used to demonstrate the crosstalk between the two protomers (Hlavackova et al.,
2005). These authors then created mutations within the heptahelical domain rendering one or both protomers able to bind MPEP, a non-competitive inverse agonist of mGluR5 (redefined in our discussion above as an allosteric modulator).
When only one protomer of the dimer was bound by MPEP, the dimer was insensitive to its inverse agonist effect. However, when the first protomer was kept as the original chimera (mGluR1 with GABABR1 C-tail) and the second protomer was able to bind MPEP but unable to activate G proteins, the agonist response was enhanced, leading to a strong signalling response downstream.
54 Finally, MPEP exhibited its full inhibitory effects when used with one protomer co-expressed with a second unable to bind MPEP or activate G proteins
(Hlavackova et al., 2005). These results again demonstrate an allosteric interaction between both protomers of a receptor dimer, caused by conformational changes induced by ligand binding to one protomer which is transmitted to the other. This raised the question, however, of how the large N-terminal domains of such dimers, responsible for orthosteric ligand binding, might be implicated in the intensity and specificity of the signal transmitted to the heptahelical domain.
Conformational changes in the extracellular VFT have been characterized by X-ray crystallography for the mGluR1, in the presence or absence of glutamate (Kunishima et al., 2000). It was revealed that two main conformations, an open or resting state and the closed or active state, were adopted by dimers of the VFT domains. Further, it was shown that in mGluR8, another metabotropic glutamate receptor, a single residue in the VFT domain is responsible for antagonistic effects on the whole receptor, by maintaining this domain in an open “state”. Mutating this residue to an alanine was sufficient to restore the closed or activated “state”, again showing the versatility and complexity of conformations that could be adopted by class C GPCRs (Bessis et al., 2002). The importance of the VFT domain as the first conformational step in receptor activation of the heptahelical domain was also reported. A recent study showed that the VFT of GABABR2 is necessary to control the intensity of the effect of an allosteric modulator, since the response to GABA was stronger with a dimer composed of GABABR1 and a chimera of GABABR2 lacking the VFT domain (Monnier et al., 2011). Thus, multiple conformational changes or “states”
55 within the receptor extracellular and heptahelical domains of class C GPCRs are necessary to achieve signalling. These findings suggest that GABA and glutamate, the two major inhibitory and stimulatory transmitters in the human brain, evolved separately from the other classes of GPCRs, using both the VFT and the heptahelical domains to activate differential responses through unique conformational interactions.
1.11.2 Class A GPCRs: different partners add texture to receptor signalling
One of the most interesting features of GPCR heterodimers is the potential of each receptor equivalent to bias the signalling of the other and vice versa. For instance, heterodimerization of the β2AR with the δ-opioid receptor leads to changes in trafficking and ERK1/2 MAPK activation (Jordan et al., 2001).
Internalization of both receptors was observed when the dimer was treated with ligands specific for either receptor. However, β2AR dimerization with the κ- opioid receptor (which does not internalize when expressed alone) did not result in internalization of the latter. This suggests that dimerization (especially heterodimerization) is a regulated event. The relationship between heterodimerization, trafficking and signalling has also been seen with members of the adrenergic receptor family. For example, the β1- and β2AR were shown to form heterodimers (Lavoie et al., 2002) with internalization and ERK1/2 activation profiles that were similar to when the β1AR was expressed alone - i.e. it exhibited a dominant effect over the β2AR. These findings may be relevant
56 clinically, since both receptors are expressed in the heart and have been shown to dimerize in cardiomyocytes (Zhu et al., 2005). Another study detected heterodimers of the β2- and β3AR, showing a similar dominant phenotype of the
β3AR over the β2AR with respect to receptor internalization (Breit et al., 2004).
This dominant dimer phenotype was also seen with adenosine A2A and dopamine
D2R receptors. Here, production of cAMP via the Gαs-coupled A2A receptor was blunted by the presence of the Gαi-coupled D2R receptor (Hillion et al., 2002).
With respect to the distinct signalling phenotypes in a receptor heterodimer, some recent studies of allosteric interactions between the receptors protomers are highly instructive. Of course, allosteric interactions between GPCRs in oligomers had been anticipated from studies of ligand binding cooperativity (Ma et al., 2008; Ma et al., 2007).
Allosteric modulation within a receptor homodimer was elegantly demonstrated for the Class A dopamine D2 receptor (D2R) (Han et al., 2009). In this study, the authors used different combinations of free receptor and receptor/G protein fusions to demonstrate these allosteric interactions. Importantly, it was shown that one protomer actually provided a transactivating signal to the fused G protein of the other protomer when the former was occupied by agonist. Agonist occupation of the second protomer actually dampened signalling, likely through a mechanism involving negative cooperativity which had previously been demonstrated using hormone desorption experiments in other GPCRs (Guan et al.,
2009; Guan et al., 2010; Urizar et al., 2005). Interestingly, as for the class C mGluR (Hlavackova et al., 2005), binding of an agonist to the first protomer of the dimer in conjunction with inverse agonist binding to the second protomer lead
57 to the highest efficacy (Han et al., 2009). Perhaps most intriguingly, this study showed that, as in Class C GPCRs, Class A homodimers may be arranged in an asymmetrical fashion with respect to the G protein. These findings need to be recapitulated in the context of Class A heterodimers as they have potentially important implications. The assembly of asymmetric heterodimers or hetero- oligomers implies that allosteric machines may be constructed in a cell that respond to a single ligand in terms of signalling output but could be allosterically regulated by ligands binding to different heterodimer partners. If receptor/G protein complexes are in fact pre-assembled, prior to reaching the plasma membrane (reviewed in (Dupré and Hébert, 2006; Dupré et al., 2009)), then different orientations of these machines might be constructed by reversing the specific asymmetric arrangement described above. Thus, two distinct, allosterically regulated receptors that respond as a single signalling unit, despite being a receptor heterodimer, may be regulated in distinct and cell-specific ways depending on how they are arranged with respect to each other. Thus, the formation of heterodimers could also lead to the formation of new signalling pathways, as demonstrated with D1R/D2R heterodimeric receptor complex. When expressed individually, these receptors do not couple to Gαq. However, when co- expressed, they were able to stimulate this pathway (Lee et al., 2004; Rashid et al., 2007). Taken together, these findings reveal the capacity of individual protomers to interpret and bias signals delivered to GPCRs and transmit it into the cell in a myriad of new ways. These notions will need to be accommodated in screens for biased and allosteric ligands in future.
58 It is likely that the dimer is the minimal unit of GPCR organization and that oligomers exist for most receptors. As shown in Figure 1.16, each GPCR protomer of a dimer is able to modulate its own conformation, when bound and when interacting with the other protomer of the complex. Each ligand might induce a specific conformation responsible for functional selectivity of signalling observed downstream. Several reports now discuss the notion of “receptor mosaics” that would each have specific functions and could be allosterically regulated by a number of unique signalling partners resident in any particular mosaic. Emerging imaging techniques such as resonance energy transfer (RET) or protein fragment complementation assays (PCA) are helping us understand the stoichiometry of these complexes (Ciruela et al., 2010; Pétrin and Hébert, 2011;
Vidi et al., 2010). The diversity of responses induced by GPCRs is not only dependent on different types of ligands, but on the arrangement of GPCR protomers within larger oligomeric complexes. More importantly, the formation of oligomers can explain the signalling diversity and the results obtained from ligand binding studies on native receptors expressed in tissue. Such hetero- oligomers, once fully characterized, may lead to the development of drugs selective for a given pathway in a given cell type, with fewer undesirable effects.
1.11.3 What crystal structures tell us about oligomerization
Recently, the crystal structure of the -opioid receptor (MOR) bound to an antagonist derived from morphine was elucidated (Manglik et al., 2012).
59 Interestingly, the crystal unit organization, comprised of four MOR aligned together, showed two different, alternating, oligomerization interfaces: a larger one between TM5 and TM6, forming a four-helices bundle, and a smaller one between TM1, TM2 and helix 8 (an alpha-helix like structure found in the C- terminal tail of some GPCRs). These results are consistent with previous reports showing the importance of TM5 and TM6 in dimerization (Granier et al., 2004;
Hébert et al., 1996).
The chemokine receptor (CXCR4) crystal structure was also recently elucidated. Five different dimer structures, bound to antagonists, were present as homodimers, containing different mutations allowing a better characterization of the allosteric changes within the dimer (Wu et al., 2010). Of particular note, one of the structures (CXCR4-3) bearing a tyrosine-to-proline mutation at position
240 (T240P), causes disruption of TM6 and was signalling impaired. When comparing the agonist-bound CXCR4 dimer structure not mutated for G protein coupling (CXCR4-1 or -2) versus CXCR4-3 dimer, the crystal packing arrangements were quite different. Despite the fact that both CXCR4-3 structures were bound by two different antagonists (one small molecule, one cyclic peptide), the results showed that the T240P mutation left the dimer in a specific conformation. The structure of the dimer with these antagonists revealed a change in the common interface between the two protomers that could eventually result in either negative or positive cooperativity.
60 1.12 Implications of allosteric ligands, biased ligands and oligomerization for drug development
Our technical capability for discovery of new drugs has improved dramatically in the last two decades with continuing advances in high-throughput and high-content screening (HTS and HCS). However, these approaches will certainly have to be modified such that a great deal more of the complete receptor signalling phenotype will need to be evaluated and new assays will have to be developed in order to screen for both biased and allosteric ligands. This means going beyond the classic antagonist- and agonist-based screens. Several aspects of the GPCR lifecycle can now be evaluated in such screens, which will aid the characterization of improved biased ligands and new allosteric ligands.
Biosensors generated from chimeric proteins designed to measure the activation of specific aspects of each or multiple signalling pathways are now commonly used to screen for biased ligands (Rocheville and Jerman, 2009; Thomsen et al.,
2005). Also, “label-free” sensors to detect subtle changes in the cell following
GPCR stimulation with different ligands have been used to screen for new drugs in heterologous and more importantly, in endogenous systems (Fang and Ferrie,
2008; Scott and Peters, 2010). Another HTS system uses yeast to express GPCRs and detects functional selectivity via a GPCR/G protein/ERK1/2 pathway readout
(Stewart et al., 2010). Moreover, sensors are now used in a dimerization paradigm, to find new receptor partners, using β-arrestin recruitment to GPCR dimers using BRET (See et al., 2010). In silico approaches such as molecular
61 docking with large virtual ligand sets, using known GPCR structures or homology models GPCRs may help limit the extent of later screens (Vilar et al., 2010). In addition, NMR and spectroscopy techniques now allow for the complete characterization of energy landscapes, to develop ligand “maps” of possible intermediate conformations taken by ligand-receptor complexes (Deupi and
Kobilka, 2010; Provasi and Filizola, 2010). It will be eventually possible to design new drugs that stabilize particular conformational states, to control functional selectivity and reduce unwanted side effects. This will also involve the generation of very large data sets that will need to be analyzed as the outcomes from these more complicated screens.
62 1.13 Rationale and objectives of the study
In the past ten years, a significant amount of work has been done regarding allosteric regulation of class A GPCRs (Kenakin, 2012). These studies improved our understanding of where allosteric ligands bind the receptor and how they can affect their downstream cellular responses, in a different way than the classical agonists, antagonists or inverse agonists. My primary receptor of interest here, the receptor for PGF2, or FP, has been established as a strong constrictor in many important physiological systems, such as the myometrium for preterm and term labour, the blood vessels for regulation of blood pressure and hypertension, and the myocardium for fibrosis, arrhythmia and hypertrophy. However, allosteric regulation on this receptor had not been studied.
We therefore hypothesized that FP signals delivered to the cellular milieu are modulated by allosteric receptor interactors. The central aim of my thesis was to develop a better understanding of the mechanisms underlying allosteric regulation on FP. Our objectives were:
1) To study how FP-mediated signals could be modulated by biased ligands.
Here, we examined the functional selectivity imparted to FP by AL-8810,
an orthosteric ligand, previously characterized as a classical orthosteric
antagonist.
63 2) To study how an allosteric ligand derived from ECL2 of FP modulates
PGF2-induced signalling pathways. In this section, we used a
peptidomimetic strategy, to convert a known peptide THG113 into an
allosteric modulator, PDC113.824, and we characterized its effects on FP
signalling. We also examine several analogues of PDC113.824 in Chapter
5.
3) To study the involvement of putative receptor partners for FP in the
context of receptor dimerization. Thus, we studied dimerization between
two pressor-generating receptors, the FP and the AT1R (a newly
discovered interaction), to understand how it affects PGF2- and Ang II-
mediated signalling.
64 1.14 Figures for Chapter 1
Figure 1. 1 Phylogenetic relationship between the GPCRs in the human genome.
The branches of the rhodopsin family are removed from the tree for clarity. Taken from (Fredriksson et al., 2003)
65
Figure 1. 2 The heterotrimeric G protein and its activation cycle.
A) Cartoon representation of heterotrimeric Gs bound to the 2-adrenergic receptor, according to the crystal structure. The subunit comprises the “Ras” domain, with the GTPase activity and binds to the receptor and the G dimer, and the highly flexible, nucleotide free AH helix domain. B) The G protein activation/deactivation cycle after ligand binding to the GPCR. See text for more detail. Adapted from (Rasmussen et al., 2011b).
66
Figure 1. 3 GPCR-induced transactivation mechanisms.
The many pathways leading to receptor tyrosine kinase (RTK, here the epidermal growth factor (EGF) receptor (EGFR)) transactivation by ligand (H)-activated
GPCR. G-protein-mediated pathways (GTP and ) lead to activation of downstream effectors or the kinase Src (Src-TK) that will transactivate EGFR via cytosolic pathways, or via activation of matrix metalloproteases (ADAM). - arrestin (-arr) recruitment to the receptor can also trigger Src and metalloprotease activation. Once activated, metalloproteases lead to EGF shedding and free EGF can activate its canonical pathway leading to ERK1/2 activation. Modified from (Luttrell and Luttrell, 2004)
67
Figure 1. 4 Role of -arrestin in GPCR desensitization and endocytosis.
Homologous desensitization of GPCRs starts with phosphorylation of receptors by GPCR kinases (such as GRK2). This will then induce translocation of - arrestin (arr) from the cytoplasm to ligand (H)-occupied receptor at the plasma membrane. -arrestins direct GPCR sequestration by linking the receptor to clathrin and AP-2 adaptor protein in the clathrin-coated pits (CCP). The GTPase dynamin pinches the CCP off the plasma membrane which brings it into the endocytic route. Once internalized, GPCRs exhibit two distinct patterns of - arrestin interaction: class A receptors have a poor avidity for -arrestin and dissociate from it allowing them to be rapidly recycled to the plasma membrane.
Class B receptors have more avidity for -arrestin, which will foster their degradation in most cases. Taken from (Kendall and Luttrell, 2009).
68
Figure 1. 5 The pluridimensionality of G protein-coupled receptor signalling.
A,B) For G protein-dependent signalling pathways (A, left side of diagram), different effectors are activated (adenylyl cyclase (AC), phospholipase C (PLC) or ion channels), leading to a rapid, but transient onset of signalling (B, non- shaded area). -arrestin-dependent pathways (A, right side of diagram, nonreceptor tyrosine kinase (TK), MAP kinases (MAPK) and E3 ubiquitin ligases
(E3)), by their capacity to functionally uncouple the G protein from the receptor,
69 act as ligand-regulated scaffolds, and represent novels signalling “states” of the receptor. -arrestin-mediated signals are characterized by a slower onset of more sustained duration (B, shaded area). From (Luttrell and Gesty-Palmer, 2010).
70
Figure 1. 6 Prostanoid biosynthesis.
A) All prostanoids (prostaglandins or PG, prostacyclin or PGI and thromboxane or
TxA) are derived from membrane phospholipids, which are transformed in arachidonic acid (AA) via the action of phospholipase A2 (PLA2). AA is the common precursor to all prostanoids. Then, cyclooxygenase (COX) converts AA into PHG2. Then, specific PG synthases will convert PGH2 into different PG isoforms, which will bind to their respective receptors (IP, EP, FP, DP or TP) and trigger activation of signalling cascades. PGD2 and PGE2 can also be precursors for PGF2. Modified from (Zhang et al., 2010a). B) Structure (top panel) and molecular geometry (bottom panel) of PGF2. Taken from (Breyer and Breyer,
2001).
71
72
Figure 1. 7 The human F prostanoid receptor (FP).
A) Snake-like representation of FP, using the amino acid sequence of the human receptor. In this secondary structure of FP, the sequence from where
THG113/PDC113.824 are derived is highlighted in orange (ILGHRDYK) at the beginning of the second extracellular loop (ECL2). Diagram modified from the
73 www.gpcr.org website. B) Three-dimensional representation of the ternary structure of FP, with the seven transmembrane domains and the extracellular loops, without the N- and C-terminal tails. This model is based on other crystallized GPCRs (credit: www.gpcr.org website for FP structure (based on the template for Histamine H1 Receptor bound to doxepin, an antagonist (3RZE structure)) and the YASARA program for visualization (www.yasara.org)). TM: transmembrane domain, ECL: extracellular loop, ICL: intracellular loop.
74
Figure 1. 8 The renin-angiotensin-aldosterone system (RAAS).
Lowering of blood pressure is required to trigger the RAAS. First, angiotensinogen is produced (mainly) in the liver and released into the circulation, where it will be cleaved in C-terminal by renin, an enzyme produced in the kidneys, generating angiotenin I. Angiotensin I will then be cleaved in C-terminal during its passage through the lungs by the angiotensin-converting enzyme, leading to the release of angiotensin II (Ang II). Ang II, the main product of the
RAAS system, will lead to many physiological responses, which will elevate blood pressure. Ang II will also stimulate the release of aldosterone from the adrenal cortex, as well as the anti-diuretic hormone (ADH) from the pituitary.
Adapted from (Klabunde, 2012).
75
Figure 1. 9 The involvement of the PGF2 and FP in systemic blood pressure, renal and cardiovascular responses.
PGF2α can act on three main organs: 1) the heart, where it regulates hypertrophy of cardiomyocytes, arrhythmia, or fibrosis (CM); 2) the kidney, more specifically the juxtaglomerular granular cells (JGC) where it induces production of renin, which activates the renin-angiotensin-aldosterone system (RAAS) and leads to blood pressure regulation by Ang II, via blood vessel constriction, where a deregulation in vessel constriction may lead to hypertension and atherosclerosis;
3) PGF2α acts also through FP in smooth muscle cells (SMC), where it promotes resistance artery constriction, which eventually also increases blood pressure and contributes to atherosclerosis; AGT, angiotensinogen; ACE, angiotensin- converting enzyme; ALD, aldosterone. Taken from (Zhang et al., 2010a)
76
Figure 1. 10 GPCR activation modes.
A) The first model of GPCR activation represents the receptor as an on/off switch
(binary mode), having one binding pocket triggering to one conformational change, leading to all cellular responses downstream. B) The new model of GPCR activation representing the GPCR as a multi-state mode protein, having multiple binding pockets (orthosteric and allosteric), triggering multiple conformational states leading to distinct responses downstream. Adapted from (Kenakin, 2003).
77
Figure 1. 11 GPCR functional selectivity.
Represented here are three examples of a GPCR (R) binding three different orthosteric ligands (Ligands 1, 2 and 3), which induce three different conformations of the receptor. These different receptor conformations will couple in a biased fashion to the G protein (A) or downstream effector (B and C), that is, favouring a certain set of downstream pathways, leading to “ligand-directed signalling” or “functional selectivity”. Taken from (Galandrin et al., 2007).
78
Figure 1. 12 Allosteric model of drug action.
A) The first representation of the allosteric ternary complex model of drug action involves a GPCR, “R” being bound by an orthosteric ligand “A”, with an affinity constant, “KA”, generating the “AR” complex, leading to a cellular stimulus downstream. Then, a third species, the allosteric ligand “B”, can bind the “RA” complex, with a specific affinity “KB” and a binding cooperativity value of , which denotes the magnitude and direction of the allosteric effect on ligand
79 binding affinity (=1, no effect, >1 positive allostery Then, this ARB complex will result in a modified cellular stimulus. B) the cubic allosteric ternary complex model, which describes the effects of the allosteric modulator not only on affinity (see red arrows, model as in A), but also efficacy (green arrow), taking into consideration the oscillation of the receptor between the active (R*) and inactive (R) conformational states, when unbound, bound to the orthosteric ligand “A” or the allosteric ligand “B” or both (ARB species). Allosteric agonism, which is represented by the “RB” species leading to a stimulus without the orthosteric ligand “A” shown leading to a stimulus with the blue arrow. Also, the different binding constants, KA and KB, and the conformational change state “L” can be altered by the different cooperativity factors, , and . It is important to note that a similar model can be built, when the allosteric ligand “B” is replaced by the G protein. The cooperativity constant will then be affected by the presence of GTP. Figure taken from (May et al., 2006). 80 A B Figure 1. 13 The different types of allosteric modulation. A) The allosteric modulator, once bound to an allosteric site on the GPCR, can modulate the 1) affinity of orthosteric ligand for the receptor 2) the efficacy of the orthosteric ligand to activate downstream effectors and 3) G protein (or effector) coupling to the receptor. B) These types of allosteric modulation can be measured in functional assays, where an orthosteric ligand (yellow) is affected by an allosteric ligand (red) on its binding (1, as shown by a change in fractional 81 binding B/B0, translated by the cooperativity factor left panel), on both its binding and efficacy (1+2, as shown by a change in potency, translated by a change in the fractional response, F/F0, middle panel) or when the allosteric ligand has allosteric properties, by direct activation of the effectors downstream (1+2+3, as seen by the change of basal response, right panel). Modified from ((Langmead and Christopoulos, 2006) for panel A and (Smith and Milligan, 2010) for panel B). 82 Figure 1. 14 General architecture and modularity of GPCRs. Structural diversity and conformational changes are different depending on the extracellular space, the hydrophobic core or the intracellular space. The structure is from the dopamine D3R receptor bound to eticlopride (PDB #3PBL). The receptor can be separated in two different parts: the ligand binding module, which is comprised mainly in the extracellular domains of the receptor and forms a vestibule to the orthosteric or allosteric ligand binding. This region shows greater diversity between GPCRs, but smaller conformational changes are observed. In contrast, the downstream signalling module, comprises the hydrophobic core and the intracellular surface, is more conserved amongst GPCRs, but undergoes larger conformational changes. ECL: extracellular (EC) loop, TM: transmembrane, ICL: intracellular (IC) loop, I-VII: TM helices numbers. Taken from (Katritch et al., 2012). 83 Figure 1. 15. Allosteric possibilities for GPCR homo- or heterodimers. A) For a GPCR homodimer, orthosteric ligand binding (yellow sphere) to each protomer of the dimer affects ligand binding on the other protomer (orange arrow), likely by a conformational change induced in the first protomer, leading to cooperativity. Concomitant binding of an allosteric modulator (red shape) to each protomer of the dimer, in addition to regulate one another as the orthosteric ligand did (red arrow), can also regulate orthosteric ligand binding to each protomer (black arrows), leading to allosterism. B) In a more complex model, an orthosteric ligand-bound (yellow sphere) protomer of a GPCR heterodimer can be regulated by the orthosteric ligand binding (magenta sphere) to the other protomer, leading to allosterism. The same phenomenon is observed for allosteric ligand binding (red and pink shapes) to its own protomer. In the case of a heterodimer, ligand binding leads only to allosterism. 84 Figure 1. 16 Functional selectivity in GPCR heterodimers. Different conformations adopted by GPCR heterodimers when: A) protomer A is occupied, B) protomer B is occupied, C) protomer A and B are occupied by the same ligands as A and B and D) protomer A is occupied with the same ligand as in A, but protomer B is occupied by a different ligand. Each combination of ligands reveal aspects of the “texture” of the complex, modifying receptor conformation in the heptahelical domains and in the second extracellular loop (ECL2), leading to a change of conformation in the G protein, modulating a specific subset of effectors responsible for a unique physiological response. Ligand binding to the receptor is represented as a shaded shape in the orthosteric binding pocket. These ligands lead to functional selectivity of the response, using communication between and within GPCR protomers. Adding allosteric 85 modulators beyond the orthosteric site for each protomer will also lead to distinct signalling outcomes. Lines ending in arrows indicate a stimulatory effector pathway, while lines ending in bars indicating a negative impact of a given ligand on effector activation. Figure taken from (Goupil et al., 2012a). 86 Table 1. 1 FP expression and its physiological/pathophysiological functions. Tissue/cell Physiological/pathophysiological References distribution process Luteolysis, parturition, preterm (Sugimoto et al., 1997), Ovary (Gross et al., 1998), (Saito labour et al., 2003) (Brodt-Eppley and Myatt, Myometrium Uterine contraction 1999), (Fischer et al., 2008) Endometrial adeno- Upregulation of tumorigenic and (Jabbour et al., 2005), (Sales et al., 2007), (Sales carcinoma angiogenic genes et al., 2005) (Mukhopadhyay et al., Eye Aqueous humor homeostasis 2001) Renal distal convoluted tubule, (Saito et al., 2003), Water and electrolyte reabsorption (Hébert et al., 2005), (Hao cortical collecting and Breyer, 2008) duct Juxtaglome-rular Renin secretion, blood pressure (Yu et al., 2009) apparatus regulation Lung fibroblast Pulmonary fibrosis (Oga et al., 2009) (Lai et al., 1996), (Kunapuli et al., 1997), (Li Cardiac fibroblast, Myocardial fibrosis, arrhythmia, et al., 1997), (Yoshida et cardiomyocyte cardiomyocyte hypertrophy al., 2002), (Takayama et al., 2005), (Wang et al., 2009a) Vascular smooth (Whittle et al., 1985), (Yu Hypertrophy, vasoconstriction et al., 2009), (Rice et al., muscle cells (VSMC) 2008) Lungs Bronchoconstriction (Kang et al., 1996) (Chemtob et al., 1990; Autoregulation of blood flow, Kim et al., 2012b; Li Brain enhancement of brain damage et al., 1995; Saleem et following injury al., 2009) This Table is modified from (Zhang et al., 2010a) 87 Table 1. 2 Comparison of tocolytic therapies Mechanism of Maternal Side Tocolytic Fetal Side Effects Action Effects Blocks myometrial respiratory drive, Magnesium contractions via neonatal pulmonary oedema, Sulfate blocade of Ca2+ ion mortality renal insufficiency actions 1AR agonists to Chest pain, heart -adrenergic activate Gs and rate problems, Tachicardy, cardiac agonists induce smooth hypotension, hypertrophy muscle relaxation myocardial injury Renal toxicity, Acute renal failure, PG synthase Inhibit Ca2+ ion cardiac failure, gastric and renal inhibitors influx pulmonary hypotension hypertension Block Ca2+ Risk of stroke, Calcium uterine blood channels, which hypotension, channel flow, foetal induces smooth tachycardia, blockers bleeding, hypoxia muscle relaxation uterine blood flow Inhibit OTR- Specificity to OTR- induced Gaq/i mediated signals Oxytocin coupling and (can block Foetal death antagonists therefore muscle vasopressin contraction receptor) Adapted from (Pryde et al., 2004). 88 Table 1. 3 Definitions of different ligands modulating potency and efficacy of GPCRs and the functional selectivity of signalling. Ligand Definition Ligands binding to the orthosteric binding site A ligand that activates one or more responses downstream of receptor binding. These can be full (maximal response) Agonist or partial (less than maximal response). Most of the time, endogenous ligands are defined as agonists. A ligand that has no effect on its own but inhibits the Neutral agonist or inverse agonist effects. These can be antagonist competitive or non-competitive with the orthosteric binding site. A ligand that reverses the constitutive activity of a given Inverse agonist receptor. Usually, inverse agonists exert the opposite pharmacological effect as receptor agonists. A ligand that yields differential responses downstream of Biased ligand receptor activation, also called functionally selective. Ligands binding to allosteric binding sites A ligand which acts only in the presence of the orthosteric Allosteric ligand. Can be positive (enhances) or negative (reduces) modulator for modulation of a given signalling pathway (i.e. can also be biased). Ago-allosteric An allosteric ligand that has an agonist effects on a given modulator pathway in the absence of the orthosteric ligand. Ligands binding to both orthosteric and allosteric binding sites A synthetic ligand that possesses a combination of binding sites can be combinations of pharmacophores in the Bitopic ligand orthosteric ligand binding site or combine orthosteric and allosteric moieties. 89 Table 1. 4 Reported allosteric modulators of GPCRs already on the market or in clinical trials. Compound Receptor Function Reference name NAM for gastro- mGluR5 ADX10059 (Zerbib et al., 2010) oesophageal reflux. PAM for diminution of parathyroid hormone (Goodman et al., CaSR Cinacalcet levels in secondary 2002) hyperparathyroidism. NAM for HIV entry to (Fatkenheuer et al., CCR5 Maraviroc CD4+ cells. 2005) 90 Table 1. 5 Crystal structures of GPCRs. Ligand Receptor Ligand Year Reference type* IA ZM241385 2008 (Jaakola et al., 2008) A UK-432097 (Xu et al., 2011) A Adenoside A2A Adenosine (Lebon et al., 2011) A NECA A2AAR (human) 2011 IA ZM241385 ANT XAC (Dore et al., 2011) ANT Caffeine ANT Cyanopindolol 2008 (Warne et al., 2008) P Dobutamine Adrenergic A Carmoterol 1 (Warne et al., 2011) A Isoprenaline 1AR 2011 (turkey) P Salbutamol IA Carazolol (Moukhametzianov ANT Cyanopindolol et al., 2011) ** (Rasmussen et al., IA Not resolved 2007 2007) (Rosenbaum et al., IA Carazolol 2007 2007) (Cherezov et al., 2007) IA Timolol 2008 (Hanson et al., 2008) IA ICI118551 (Wacker et al., 2 Adrenergic IA Compound #1 2010) 2AR ANT Alprenolol (human) ** 2010 (Bokoch et al., IA Not resolved 2010) BI-167107 + (Rasmussen et al., A nanobody*** 2011a) *** (Rosenbaum et al., A FAUC50 2011 2011) BI-167107 + (Rasmussen et al., A ** 2011 nanobody + G 2011b) Chemokine CXCR4 ANT IT1t 2010 (Wu et al., 2010) (human) ANT CVX15 peptide Dopamine D3R ANT Eticlopride 101 (Chien et al., 2010) (human) Histamine H R (Shimamura et al., 1 IA Doxepin 2011 (human) 2011) Rhodopsin (bovine) 2000 (Palczewski et al., IAG 11-cis retinal 2000) 2004 (Okada et al., 2004) (Sekharan et al., 9-cis retinal 2007 2007) (Nakamichi and A All-trans retinal 2006 Okada, 2006) 91 Ligand Receptor Ligand Year Reference type* (Standfuss et al., II-trans retinal + G 2011) A *** 2011 peptide (Choe et al., 2011) (Park et al., 2008) Opsin (bovine) APO *** 2008 (Scheerer et al., G peptide 2008) (Shimamura et al., 2008) Rhodopsin (squid) IA 11-cis retinal 2008 (Murakami and Kouyama, 2008) -opioid ANT Naltrindole 2012 (Granier et al., 2012) -OR (mouse) -funaltrexamine -opioid (Manglik et al., ANT (morphian 2012 -OR (mouse) 2012) antagonist) -opioid ANT JDTic 2012 (Wu et al., 2012) -OR (human) Nociceptin/orphanin Peptide mimic FQ peptide receptor (Thompson et al., ANT compound-24 (Goto 2012 NOP 2012) et al., 2006) (human) M3 Muscarinic Acetylcholine ANT Tiotropium 2012 (Kruse et al., 2012) M3 mAChR (rat) M2 Muscarinic Acetylcholine ANT QNB 2012 (Haga et al., 2012) M2 mAChR (human) Sphingosine 1- phosphate (Hanson et al., 2012; ANT ML056 2012 S1P1 Parrill et al., 2012) (human) * A = agonist, ANT = antagonist, IA = inverse agonist, P = partial agonist, APO = no ligand, but activated form receptor. **Monoclonal antibody-assisted crystallization. ***G protein mimic, bound on the intracellular site. Modified from (Katritch et al., 2012). 92 CHAPTER 2: Biasing the prostaglandin F2 receptor responses toward EGFR-dependent transactivation of MAPK 1,2* 1* 1 Eugénie Goupil , Veronica Wisehart , Etienne Khoury , Brandon Zimmerman1,2, Sahar Jaffal1,2, Terence E. Hébert2, Stéphane A. Laporte1,2 Reproduced with permission from Mol Endocrinol, 2012, Vol. 26 (7), 1189-1202 (see appendices). 93 2.1 Preface Before this study was published, not much was known regarding FP- mediated biased signalling. The mechanism by which PGF2 could induce ERK1/2 activation had been characterized in many cellular systems, and was via different routes, but the capacity of an orthosteric ligand to induce a specific conformation leading to a specific change in FP signalling had not been studied. Indeed, AL-8810, an orthosteric FP ligand, had been identified as a FP antagonist (Griffin et al., 1999), for its inhibitory actions on fluprostenol (a metabolic analog of PGF2)-induced inositol phosphate production, and used as such for quite a long time. However, no study examined AL-8810 in an “agonist” format. When I started my PhD, the groups of Drs. Hébert and Laporte were part of a CIHR team effort to improve our understanding of allosteric and ligand-directed signalling of FP. I therefore aimed to analyze orthosteric FP ligand-induced ERK1/2 activation, to detect biased signalling. We were surprised to see that AL-8810 was as potent as PGF2 for activation of ERK1/2. We therefore decided to examine how it activated this pathway. We found that AL-8810 did not activate the canonical Gq-mediated pathway for ERK1/2 activation, but uncovered the capacity of FP to display functional selectivity in PGF2-induced cellular responses. We also demonstrated that the definition given to ligands (i.e. full agonist, full antagonist or even inverse agonist) must be analyzed one effector at the time, rather than for all downstream responses induced by a given receptor. 94 2.2 Abstract The G protein-coupled prostaglandin F2 receptor (FP receptor) has been implicated in many physiological events including cardiovascular, respiratory, immune, reproductive and endocrine responses. Binding of prostaglandin F2α (PGF2α) to FP receptor elicits inositol production, and PKC-dependent MAPK activation through Gαq coupling. Here we report that AL-8810, previously characterized as an orthosteric antagonist of PGF2α-dependent, Gαq-mediated signalling, potently activates ERK1/2 in a PKC-independent manner. Rather, AL- 8810 promoted ERK1/2 activation via an EGFR transactivation mechanism in both HEK 293 cells and in the MG-63 osteoblast-like cells, which express endogenous FP receptors. Neither AL-8810- nor PGF2α-mediated stimulation of FP receptor promoted association with β-arrestins, suggesting that MAPK activation induced by these ligands is independent of β-arrestin signalling scaffold function. Interestingly, the spatio-temporal activation of ERK1/2 promoted by AL-8810 and PGF2α showed almost completely opposite responses in the nucleus and the cytosol. Finally, using [3H]-thymidine incorporation, we noted differential regulation of PGF2- and AL-8810-induced cell proliferation in MG-63 cells. This study reveals for the first time the signalling biased nature of FP receptor orthosteric ligands toward MAPK signalling. Our findings regarding specific patterns of ERK1/2 activation promoted by FP receptor ligands may help dissect the distinct roles of MAPK in FP receptor-dependent physiological responses. 95 2.3 Introduction The F prostanoid receptor (FP) is a member of the G protein-coupled receptor (GPCR) family, whose endogenous ligand is prostaglandin F2α (PGF2). PGF2α is involved in many physiological responses, and its action recognized in the regulation of parturition (including luteolysis), smooth muscle contraction, intraocular pressure, cardiac hypertrophy, kidney function and bone metabolism (Breyer and Breyer, 2001; Hakeda et al., 1991; Kamon et al., 2008; Lai et al., 1996; Lee et al., 1988; Makino et al., 2007; Olson et al., 2003). At the cellular level, PGF2α-dependent stimulation of FP triggers signalling cascades that result in activation of the mitogen-activated protein kinase (MAPK) pathway and cytoskeletal reorganization, mediated by Gαq and Gα12, respectively (Chen et al., 1998; Goupil et al., 2010; Pierce et al., 1999). FP-mediated stimulation of Gαq activates ERK1/2 MAPK via phospholipase C (PLC) and protein kinase C (PKC) (Davis et al., 1987; Ito et al., 1994a; Jimenez de Asua and Goin, 1997), resulting in various physiological effects ranging from gene transcription to cell proliferation. Several other mechanisms of GPCR-induced ERK1/2 activation have been demonstrated, including scaffolding of arrestins (Daaka et al., 1998), activation of Src (Dikic et al., 1996) or activation of protein kinase A (Daaka et al., 1997). Another known mechanism of GPCR-mediated MAPK activation involves transactivation of receptor tyrosine kinases (RTK), such as the epidermal growth factor receptor (EGFR, for review see (Pierce et al., 2001a)). 96 It is now well recognized that orthosteric ligands, some of which act to antagonize agonist-mediated signalling pathways, can also bias the receptor into other signalling modes (Conn et al., 2009; Digby et al., 2010; Kenakin, 2003) (Galandrin et al., 2007; Wang et al., 2009b). Numerous selective agonists for FP have been developed (e.g. fluprostenol, cloprostenol and bimatoprost), but few antagonists exist at present. AL-8810, which is an 11β-fluoro analog of PGF2α, has been described as a selective FP antagonist for fluprostenol-induced phosphoinositide production (Griffin et al., 1999); although it has also been shown to act as a weak partial agonist on this pathway. Many studies have reported that AL8810 has minimal or no agonist effects (i.e. acted as an antagonist) in cells and isolated tissues (Husain et al., 2005; Sales et al., 2007; Ueno and Fujimori, 2011), but some have reported in vivo activity (Woodward et al., 2007). Considering that we recently showed that the FP could be biased into selective signalling modes by an allosteric ligand (Goupil et al., 2010), we investigated the extent to which an orthosteric PGF2α analog promoted functional selectivity on FP. 2.4 Materials and Methods Materials [3H]-PGF23H]-thymidine and ECL reagent were from Perkin Elmer (Waltham, MA). PGF2α and AL-8810 were from Cayman (Ann Arbor, MI). 97 Angiotensin II (AngII), poly L-lysine hydrochloride, N-ethylmaleimide (NEM) were from Sigma-Aldrich (St Louis, MO). Mouse monoclonal anti-phospho- ERK1/2 (T202/Y204), rabbit polyclonal anti-total ERK1/2 and rabbit polyclonal anti-phosphoEGFR (Y1148) antibodies were from Cell Signaling (Danvers, MA). Anti-EEA1 and anti-Histone 2B were a kind gifts from Dr. Barry Posner and Dr. Jason Tanny (both from McGill University), respectively. Paraformaldehyde was from Electron Microscopy Sciences (Hatfield, PA). Dithiobis succinimidyl propionate (DSP) was from Pierce (Rockford, IL). MEM and DMEM were from Hyclone (Logan, UT). Fetal bovine serum (FBS), L-glutamine and gentamicin were from Invitrogen (Carlsbad, CA) and puromycin was from Invivogen (San Diego, CA). Anti-HA Affinity Matrix and mouse monoclonal anti-HA (clone 12CA5) antibody were from Roche (Laval, Canada). Phenylmethyl sulfonyl fluoride (PMSF), aprotinin, leupeptin and pepstatin were from Bioshop (Burlington, Canada). Pierce subcellular fractionation kit for cultured cells was purchased from Thermo Scientific (Rockford, IL). Bovine serum albumin (BSA) Fraction V, Gö6983 and AG1478 were from EMD Chemicals Inc (Gibbstown, NJ). Epidermal growth factor (EGF) was from Fitzgerald Industries International (Acton, MA). AS604872 (Merck Serono) was synthesized at L’Institut de Recherche en Immunologie et en Cancérologie (Université de Montréal, Montréal, Canada). Anti-βarrestin (clone 3978) was generated at the McGill University Animal Facility and described elsewhere (Zimmerman et al., 2009a). DNA constructs, cell lines, culture and transfection 98 PKCI-GFP was described in (Goupil et al., 2010) and was obtained from Dr. S. Ferguson (Robarts Research Institute, London, ON), YFP-tagged βarrestins (1 and 2) in (Zimmerman et al., 2009a) and pcDNA3.1-SrcK298R in (Fessart et al., 2007). The extracellular signal-regulated kinase activity reporters (EKAR- Nucleus and EKAR-Cytosol) were purchased from Addgene and have been described elsewhere (Harvey et al., 2008). pCMV-EGFR was obtained from Dr. L. M. Luttrell (Medical University of South Carolina). HEK 293 cells stably expressing human HA-tagged FP (FP cells) and HA-AT1R were described in (Goupil et al., 2010; Zimmerman et al., 2009a), respectively. MG-63 osteoblasts were kindly provided by Dr. J.-L. Parent (Université de Sherbrooke; Sherbrooke). Cell lines were grown at 37°C in 5% CO2 in MEM (HA-FP, HA-AT1R) or DMEM (MG-63) supplemented with 10% (v/v) heat-inactivated FBS, L- glutamine (5mM) and gentamycin (100 µg/ml). For transient transfection, cells seeded at a density of 1.5x106 cells per 100 mm dish, 1.5x105 per well in 6-well plates or 5x104 cells per 35 mm plates for microscopy, were transfected using conventional calcium phosphate co-precipitation. All experiments were performed 48 hours post-transfection. Ligand binding experiments For binding experiments, HEK 293 cells stably expressing the FP receptor were directly dosed for protein quantification and 100 g of intact cells was incubated with 1x105 cpm of [3H]-PGF2α (150-240 Ci/mmol) for one hour in the presence of either cold PGF2α or AL-8810 at varying concentrations at room 99 temperature in 0.5 mL of binding buffer as described previously (Goupil et al., 2010). Binding was stopped by addition of 2 mL cold Tris-HCl 50 mM pH 7.4 and cells were filtered on GF/B-filters. Incorporated radioactivity was measured by liquid scintillation spectrometry. Confocal microscopy and FRET experiments PKC translocation assays were performed as previously described (Goupil et al., 2010). Briefly, FP cells transfected with 0.5 μg PKCI-GFP were serum- starved for 30 min and treated with 1 μM PGF2α or 10 μM AL-8810 for 30 min each. For β-arrestin, FP-R cells transfected with 0.5 μg of either β-arrestin1-YFP or βarrestin2-YFP and GRK2, were serum-starved for 30 min and treated with either 1 μM PGF2α, 10 μM AL-8810 or 1 μM AngII for 30 min. Images were collected every 30 s using live-cell microscopy at 37ºC on a Zeiss LSM-510 Meta laser scanning microscope equipped with XL-3 temperature chamber with a 63X glycerol/water immersion lens in single track mode using excitation at 488 nm for GFP and 514 nm for YFP, measured with LP505 (GFP) and BP530-600 (YFP) filter sets. For p-ERK1/2 immunofluorescence, FP cells were plated on coverslips in 6-well plates at a density of 1x105 cells per well. 24 hours later, cells were starved in 0.5% serum. The next day, cells were stimulated with 1 M PGF2 or 10 M AL-8810 and fixed with 4% paraformaldehyde in PBS. Cells were then washed in PBS and blocked/permeabilized in PBS containing 2% BSA and 0.1% Triton-X- 100. Antibodies against p-ERK1/2 were added to coverslips (1/300 dilution) for 100 90 min in the blocking/permeabilizing solution. Following PBS washes, cells were blocked again and goat-anti-mouseAlexa488 secondary antibody was added to coverslips for 60 min (1/1000 dilution). The last 15 min of the incubation, Hoescht dye was added to the cells to label the nucleus. Cells were then mounted and visualized by confocal microscopy using excitation at 488 nm for p-ERK1/2 and 405 nm for Hoescht and emission filter sets BP505-530 and 420-480 for ERK1/2 and Hoescht, respectively. Colocalization was analyzed using the ImageJ program (NIH, colocalization_plugin). The p-ERK1/2 and nuclear staining images were background corrected (50 pixel radius) and a composite mask was generated. For the analysis, two pixels (from p-ERK1/2 and Hoescht signals) were considered colocalized if their intensities were higher than the threshold of their respective channels (50/255) and if the intensity ratio was higher than the 50% of the default value. FRET assays were performed using the extracellular signal-regulated kinase activity reporter (EKAR, (Harvey et al., 2008)) an ERK1/2-activity sensor. The core of the sensor is constituted of an ERK1/2 docking domain, a Cdc25C substrate peptide and a phospho-binding domain, all flanked by a cerulean fluorescent protein (CFP) on the N-terminus of a Venus yellow fluorescent protein (YFP) on the C-terminus. The two EKAR sensor versions used in this paper contained either a nuclear localisation signal (EKAR-nucleus) or a nuclear export signal (EKAR-cytosol) allowing not only the temporal, but the spatial localization of ERK1/2 activity. In the basal state, both the CFP (donor) and YFP (acceptor) are far enough apart such that and no FRET signal is observed. Following ERK1/2 activation, the latter can dock on the sensor and phosphorylate 101 the substrate peptide, which will then allow the phospho-binding domain to bind to the substrate peptide, leading to a conformational rearrangement of the sensor and of a proximity between the donor and the acceptor, yielding a FRET signal. The dynamic rage of the sensors was evaluated using the potent activator of MAPK, EGF, and found to be around 1.4 fold (data not shown). For FRET experiments, FP-R cells were seeded at or 5x104 cells per dish in 35mm- microscopy dish and transfected with either different EKAR sensors using calcium-phosphate. 24h later, cells were serum-starved O/N with in 0.2% FBS and challenged the next day with either 1 M PGF2 or AL-8810. Images were collected every minute for 60 min using live-cell microscopy at 37ºC on a Zeiss LSM-510 microscope equipped with an XL-3 temperature chamber with a 40X oil or 63X glycerol/water immersion lenses. FRET (YFP emission) and CFP images were collected using excitation at 405 nm. Emitted images were collected with the following filter sets: BP475-505 for CFP and BP530-600 for FRET. FRET and CFP signals values on single cells were calculated with Zen program and FRET values were normalized to the CFP signal. For FRET pseudocolor images, the FRET signal was represented using “rainbow coarse” rendering. Western blot and immunoprecipitation experiments For detection of ERK1/2 (phosphorylated and total), cells seeded in 6-well plates (1.5x105) for 48 hours and after 30 min starvation without serum, stimulated for different times with 1 μM PGF2α, 10 μM AL-8810 for indicated times and directly solubilized in 2X Laemmli buffer. For donor cell-mediated 102 EGFR transactivation experiments, FP (donor cells) and HEK 293 naïve cells (acceptor cells) were plated in 12-well plates and 48h later, serum starved. Donor cells were then stimulated with 1 μM PGF2α or 10 μM AL-8810 for 5 and 15 min. After stimulation, the media from FP-R cells was taken and added onto the acceptor cells (final dilution 1:2) and left to stimulate cells for 5 min. Cells were then lysed in Laemmli buffer and lysates were analysed by western blot using anti-phospho-ERK1/2 and anti-total-ERK1/2 antibodies. To detect activated EGFR (p-EGFR), cells were plated at a density of 1x105 cells per well in 6-well plates and transfected 24 hours later with pCMV-EGFR. 24 hours after transfection, cells were starved O/N with 0.5% FBS. The next day, cells were pretreated with DMSO or AG-1478 and stimulated with 5ng/ml of EGF. Cells were lysed in THG buffer (50 mM HEPES pH 7.4, 1% Triton-X-100 (v/v), 50 mM NaCl, 10% glycerol (v/v), 5 mM EDTA) containing proteases (25 g/ml aprotonin, 1 mM pepstatin A, 25 g/ml leupeptin and 1 mM PMSF) and phosphatase inhibitor (0.1 mM sodium orthovanadate). Proteins were then loaded directly on a 10% SDS-PAGE gel (p-EGFR) or 10% gel (phospho/total-ERK1/2) and transferred/probed for detection. For βarrestin co-immunoprecipitaion assays, FP-R cells or AT1R expressing cells (both receptors are HA-tagged) were seeded at 1.5x106 cells in 100 mm dishes and grown for 2 days. Cells were then serum- starved for 30 min and treated with 1 μM PGF2α, 10 μM AL-8810 or 1 μM AngII for 15 min. Following stimulation, 2 mM of crosslinking agent DSP was added to each plate at room temperature for 30 min. Media was aspirated and washed with 1X PBS containing Tris-HCl 50 mM pH 7.4. Cells were lysed with glycerol 103 buffer containing protease inhibitors and 10 mM NEM. Cell lysates were rocked for 30 min at 4°C, centrifuged for 30 min at 4°C and the supernatant was incubated overnight with anti-HA Affinity Matrix beads. A fraction of the supernatant was kept as the total cell lysate (TCL) prior to adding the beads. The next day, beads were washed and the immunoprecipitate was resuspended in 2X Laemmli buffer. Samples (immunoprecipitates and TCL) were then loaded on 10% SDS-PAGE gels and transferred to nitrocellulose prior to be probed with antibodies against proteins of interest (see figure legends for details). For cellular fractionation, FP cells were plated at a density of 5x105 cells cells/10cm dishes and after 48 hours, cells were starved for 30 min without serum prior to stimulation with 0.5 M of PGF2 or 5 M AL-8810. After stimulation, fractionation of the different subcellular compartments was done according to the manufacturer’s instructions (Pierce subcellular fractionation kit). Samples were loaded on a 10% gels and transferred/probed as described in figure legends. Semi- quantitative analysis of ERK1/2 and EGFR activation was done using ImageJ program. [3H]-thymidine incorporation experiments MG-63 osteoblast-like cells were plated at a density of or 1.3x104 cells cells/well in 24-well plates. 24 hours later, cells were starved in 0.2% FBS for 24 hours. Then, cells were treated with 1 M PGF2 or 10 M AL-8810 for 4, 8, 12 and 24 hours. The last 4 hours of the stimulation, 0.5 Ci of [3H]-thymidine per well was added. Cells were then washed rapidly once with cold PBS and washed 104 once for 30 min with 5% TCA at 4°C. NaOH 0.2M was then added to lyse the cells and the incorporated radioactivy was counted using a -counter after addition of scintillation liquid. Statistical analysis Statistical tests were performed with GraphPad Prism 5 software. Assumptions of normality and equal variance were met for all data analyzed. Independent t-tests were used to compare vehicle and treated samples (Fig. 1A). One-sample t-tests were used when the data was normalized and basal levels were considered in respect to the hypothetical value (1) (Fig. 1E). One-way ANOVA was used for Figs. 3B, 5D, 6C, 8A-B. Two-way ANOVA with repeated measures was used in Figure 8. Two-way ANOVA was used in Figs. 2B-C, 5, 6A, B, 7, 9, 10. All ANOVA analysis were followed by a Bonferroni posthoc test. A 2-tailed p-value less than 0.05 was considered significant. All results are expressed as mean standard error (SEM). Sample size (n) and p-values are given in individual figure legends. 2.5 Results 2.5.1 AL-8810 binds to the FP receptor and activates MAPK 105 Initially, we wanted to confirm that AL-8810 binds FP receptor at its orthosteric site. FP cells were incubated with radiolabelled [3H]-PGF2α, and the displacement of radioligand was measured as a function of increasing concentrations of either AL-8810 or PGF2α. AL-8810 and PGF2α both displaced 3 [ H]-PGF2α binding to the FP receptor in a dose-dependent manner, with Kis of approximately 500 nM (497 ± 63.3 nM), and 3 nM (3.26 ± 0.73 nM; Fig. 2.1A), respectively. Binding was FP-specific, since naïve HEK 293 cells showed no displaceable [3H]-PGF2α binding (Goupil et al., 2010). We next compared the extent to which PGF2α and AL-8810 promoted MAPK activation. Because of the marked difference between PGF2 and AL-8810 binding affinities, and to ensure that at least 95% of FP was occupied, we used PGF2 and AL-8810 at concentrations of 1 M and 10 M, respectively. Treatment of FP cells with PGF2α promoted phosphorylation of ERK1/2 in a time-dependent manner reaching a maximal response at 5 min of agonist treatment (Fig. 2.1B). When cells were stimulated with AL-8810, ERK1/2 was also robustly activated reaching similar levels of ERK1/2 phosphorylation as seen with PGF2α treatment, with peak activation occurring between 5 and 10 min (Fig. 2.1C). The MAPK activation in FP cells were FP-specific since both responses induced by AL-8810 and PGF2α were inhibited by the selective the FP receptor antagonist, AS604872 (Fig. 2.1D), whereas alone, AS604872 treatment of FP cells had no effect on ERK1/2 activation; confirming its antagonistic property on this signalling pathway (Suppl. Fig. 2.1A). Since AL-8810 has been often used as an antagonist for FP-mediated responses, using a prolonged pretreatment of cells (more than 30 106 min), we wondered if such modality could also lead to inhibition of PGF2- induced ERK1/2 activation in FP cells. Indeed, prolonged pretreatment of cells (30 min) with AL-8810 inhibited such response (Suppl. Fig. 2.1B). Finally, we investigated the effects of PGF2α and AL-8810 on MAPK activation in a physiologically relevant cell model expressing endogenous FP using the human osteoblastic cell line (MG-63) (Samadfam et al., 2006). Stimulation of MG-63 cells with either PGF2α or AL-8810 promoted rapid and significant phosphorylation of ERK1/2 (Fig. 2.1E). 2.5.2 AL-8810-promoted MAPK activation independently of PKC We previously reported that FP-dependent activated ERK1/2 through the Gαq/PLC/PCK signalling pathway (Goupil et al., 2010). Consistent with the activation of PLC by PGF2α, which generates inositol phosphate production and mobilizes Ca2+, PKCI-GFP was rapidly translocated from the cytosol to the plasma membrane (Fig. 2.2A, top panel). On the other hand, AL-8810 stimulation, elicited a faint and transient recruitment of PKCI-GFP to the plasma membrane (Fig. 2.2A, bottom panel, see arrows). Next, FP cells were pretreated with Gö6983, a broad spectrum PKC inhibitor, and assessed for ERK1/2 activation following either PGF2α or AL-8810 stimulation. In FP-R cells where PKC was inhibited, PGF2α-mediated MAPK responses were decreased by more than 80% (Fig. 2.2B), whereas AL-8810-promoted responses were not significantly altered compared to vehicle-treated cells (Fig. 2.2C). Interestingly, 107 AL-8810 was the only PGF2α analog tested that induced MAPK activation and for which the signal was not significantly affected by PKC inhibition, since bimatoprost-, cloprostenol- and fluprostenol-mediated ERK1/2 activation signals were all inhibited by Gö6983 (Fig. 2.3). 2.5.3 β-arrestins are not involved in FP-mediated MAPK signalling -arrestins are known to activate ERK1/2 following stimulation of many GPCRs via scaffolding the different components of the ERK1/2 pathway (Chen et al., 1998; Samadfam et al., 2006). As an explanation for AL-8810-induced PKC- independent ERK1/2 activation, we considered the potential involvement of β- arrestins scaffolding function in MAPK signalling. We determined whether PGF2α and AL-8810 promoted complex formation between FP and β-arrestin by assessing receptor-mediated translocation of YFP-βarrestin2 to the plasma membrane. To ensure that any lack of β-arrestin recruitment to FP was not due to poor phosphorylation of the receptor, we also co-expressed G protein-coupled receptor kinase 2 (GRK2) with the β-arrestin isoforms. Neither PGF2α nor AL- 8810 stimulation of FP cells resulted in translocation of either β-arrestin isoform to the plasma membrane (Fig. 2.4A). However, under similar conditions, cells stably expressing the angiotensin II type 1 receptor (AT1R), showed rapid and robust translocation of β-arrestin2 to the plasma membrane when stimulated with angiotensin II (Ang II), as well as internalization into endosomes (Fig. 2.4A). We also confirmed, using a crosslinking approach, whether agonist-stimulated FP 108 could recruit β-arrestins. Cells expressing the FP or AT1R were stimulated with either PGF2α and AL-8810, or Ang II. Receptors were immunoprecipitated and the associated β-arrestin was detected by western blotting. Ang II stimulation promoted complex formation between AT1R and both β-arrestin1 and 2. However, no such complexes were seen between the FP and β-arrestins following either PGF2α or AL-8810 stimulation (Fig. 2.4B). Therefore, these results suggest that β-arrestin recruitment in FP cells is not involved in either PGF2 or AL- 8810-induced ERK1/2 activation. 2.5.4 AL-8810 activates MAPK through EGFR transactivation GPCR-mediated activation of MAPK has been shown to occur in murine osteoblasts stimulated with PGF2 (Ahmed et al., 2003) via receptor tyrosine kinase transactivation (Prince et al., 2008). Thus, we next investigated the involvement of FP-promoted epidermal growth factor (EGF) receptor (EGFR) transactivation in FP cells. Cells were pretreated or not with 125 nM AG1478, an EGFR-selective inhibitor (IC50 of 3 nM for EGFR compared to 100 M for other receptor tyrosine kinases), and subsequently challenged with either PGF2α or AL- 8810. Cells pretreated with AG1478, showed a reduction, although not statistically significant, of ERK1/2 activation by less than 10% following PGF2α stimulation, as compared to vehicle (Fig. 2.5A). EGFR inhibition in AL-8810- stimulated cells led to a more robust and significant reduction in ERK1/2 activation, with a greater than 60% inhibition of the response (at 5 min, Fig. 109 2.5B). We then assessed FP-mediated activation of EGFR by assessing phosphorylation of one of its regulatory sites (i.e. Y1148, (Lombardo et al., 1995)). FP cells stimulated with EGF for either 5 or 15 minutes showed robust activation of EGFR (Fig. 2.5C, inset). We observed a slight increase for EGFR activation in PGF2α-treated FP cells, which however was not statistically significant as compared to untreated cells. On the other hand, stimulation of cells with AL-8810 promoted a significant EGFR activation that was more than 2 fold greater than what seen in unstimulated cells (Fig. 2.5C). In cells pretreated with AG1478, while we observed a consistent, but not statistically significant reduction in EGFR activation promoted by PGF2α (Fig. 2.5C), the responses induced by both AL-8810- and EGF were significantly inhibited after treatment with AG1478 by more than 95% and 75%, respectively. We also determined the involvement of EGFR in the FP-mediated MAPK pathway in MG-63 osteoblast cells. Surprisingly, both AL-8810- and PGF2α-induced ERK1/2 signals were significantly reduced by more than 50%, on average, following EGFR inhibition, while the EGF-induced response was blocked by more than 75% (Fig. 2.5D). Together, these results suggest that AL-8810 preferentially biases FP-induced ERK1/2 through EGFR transactivation. 2.5.5 AL-8810-induced EGF-shedding is responsible for EGFR activation One of the many mechanisms by which GPCRs can transactivate tyrosine kinase receptors is by “ectodomain shedding” of pro-heparin-binding-EGF-like 110 growth factor (pro-HB-EGF) by matrix metalloproteases, leading to autocrine released of mature EGF into the cellular milieu (Prince et al., 2008). To further investigate the mechanism by which AL-8810 signal could lead to EGFR transactivation and MAPK response, we first used an EGFR antagonist, PD153035, to inhibit binding of autocrine EGF to its receptor and subsequent signalling. PD153035 was found to antagonize EGF-induced ERK1/2 activation (Suppl. Fig. 2.1C). In cells pretreated with PD153035, no significant effect on PGF2-induced ERK1/2 activation was detected (Fig. 2.6A), but significant inhibition (by more than 40%) of ERK1/2 activation induced by AL-8810 was observed (at 5 and 15 min, Fig. 2.6B), consistent with results obtained with AG- 1478 (Fig. 2.5B). Our data thus suggest the involvement of pro-HB-EGF shedding and EGFR transactivation in AL-8810-dependent activation of MAPK. In order to confirm this, we stimulated FP cells with AL-8810 or PGF2, and assessed ERK1/2 responses in these cells (defined as donor cells, Fig. 2.6C), and naïve HEK 293 cells lacking FP (defined as acceptor cells, Fig. 2.6C) that were stimulated with conditioned medium from the donor cells. Treatment of HEK 293 cells with conditioned medium from AL-8810-treated donor cells promoted significant activation of the ERK1/2 response, whereas medium from PGF2- treated cells had very little effect, consistent with the release of HB-EGF into the media of FP cells but only when treated with AL-8810. Cytosolic non-receptor tyrosine kinases, such as Src, have also been shown to be involved in EGFR transactivation by GPCRs (Luttrell et al., 1997). To determine the potential involvement of Src in FP-mediated EGFR 111 transactivation and MAPK activation, we transfected FP cells with a Src kinase dead mutant, (SrcK298R), which we showed previously to act in a dominant negative fashion (Fessart et al., 2007). Whereas SrcK298R had no significant effect on PGF2α-induced ERK1/2 activation (Fig.7A), it inhibited between 60- 80% AL-8810-induced ERK1/2 activation (at 2, 5 and 15 min, Fig.7B). Together, our data suggest the involvement of Src, pro-HB-EGF shedding and EGFR transactivation in AL-8810-dependent activation of MAPK. 2.5.6 Spatio-temporal activation of ERK1/2 is differentially regulated by PGF2α and AL-8810 Receptor-activated ERK1/2 can remain in the cytosol or translocate to the nucleus, to target specific downstream effectors and transcription factors (Pouyssegur et al., 2002; Ramos, 2008). To assess the extent to which FP activation by either PGF2 or AL-8810 modulates ERK1/2 localization, we performed cellular fractionation of ligand-stimulated FP-R cells at different time points after stimulation. We observed that following PGF2 stimulation, ERK1/2, which was mainly localized in the cytosol, gradually moved away from this cellular compartment over time (Fig. 2.8A, white bars). On the other hand, ERK1/2 levels increased in the nuclear fraction, which reached significantly different levels after 60 min (Fig. 2.8B, white bars). A different subcellular localization pattern was observed in AL-8810-stimulated FP cells, where ERK1/2 was mainly localized in the nucleus at early time points of ligand treatment (Fig. 112 2.8B, black bars), and its presence diminishing over time, at the expense of an increasing ERK1/2 levels in the cytosolic fraction (Fig. 2.8A). We next used immunofluorescence to further investigate the FP ligand- induced bias on spatio-temporal regulation of ERK1/2 activation in the nucleus. Cells stimulated with PGF2 showed strong phospho-ERK1/2 signal appearing at longer time points of agonist treatment (30 and 60 min vs. 5 and 15 min, Fig. 2.8C). This signal colocalized within the nucleus as shown by the pixel composite overlays between both the phospho-ERK1/2 signal and the nucleus staining (as revealed by Hoescht). On the other hand most of the phospho-ERK1/2 signal induced by AL-8810 appeared at shorter time points of ligand-treatment, colocalized with the nucleus (5 and 15 min, Fig. 2.8C), and disappeared after 30 and 60 min. Finally, we used the extracellular signal-regulated kinase activity reporter (EKAR), a FRET-based sensor that has been modified to selectively assess ERK signalling in either the nucleus (EKARN) or the cytosol (EKARC) (Fig. 2.9, and ref. (Harvey et al., 2008)), to ERK1/2 activity in real time in both cellular compartments. FP cells were transfected with EKARN or EKARC and challenged with PGF2α or AL-8810, and ERK1/2 activity was monitored using confocal microscopy. AL-8810 stimulation of the FP promoted rapid (~2 min) and sustained (up to 60 min) ERK activity in the nucleus (Fig. 2.9A). In marked contrast, ERK activation in this compartment was delayed following PGF2α- mediated stimulation of FP receptor, being most evident only after longer periods of agonist treatment. On the other hand, the converse was observed for ERK1/2 113 signalling, when assessing activity in the cytosol (Fig. 2.9B). PGF2α stimulation of the FP induced rapid activation of ERK1/2 in the cytosol, while its activity was greatly delayed, if not absent at all, when receptors were challenged with AL- 8810. Finally, we observed that AL-8810-mediated ERK1/2 signalling was only significantly inhibited by AG1478 in the nucleus, while EGFR inhibition had little effects on ERK signalling promoted by PGF2α, both in the cytosol and nucleus. Taken together, these results imply that PGF2 and AL-8810 can regulate FP receptor-mediated ERK1/2 subcellular localization and activation in a distinct fashion. 2.5.7 AL-8810 and PGF2 induce different patterns of cellular proliferation GPCR-mediated activation of ERK1/2 can lead to different cellular responses, such as differentiation, development and proliferation (Zhang and Liu, 2002) (Meloche and Pouyssegur, 2007). Using [3H]-thymidine incorporation into MG-63 osteoblasts cells, we next assessed how PGF2 and AL-8810 induced DNA synthesis, a hallmark of cell growth. As shown in Fig. 2.10, PGF2 induced a constant increase in cell proliferation, starting after 4 h of stimulation and reaching a maximum response after 24 h. AL-8810, however, induced a stronger increase in [3H]-thymidine incorporation a 4 h of stimulation than PGF2, which was transient and decreased over time. Taken together, these results suggest that, as for the spatio-temporal EKR1/2 redistribution, FP effects on cell proliferation can be biased depending on the ligand used. 114 2.6 Discussion Here, we describe a previously unappreciated, biased agonist property of AL-8810, which was characterized initially as a selective antagonist of FP receptor-mediated, Gαq-dependent signalling. We show that AL-8810 promoted MAPK activation occurred mainly via EGFR transactivation in both heterologous and homologous FP-expressing cells, and in contrast to PGF2α-mediated ERK1/2 activation is independent of PKC and involves Src. The consequence of this biased signalling was revealed by distinct spatio-temporal regulation of ERK1/2 activation and cell proliferative responses. Consistent with the notion that AL-8810 acts as an orthosteric ligand, it competed for PGF2α binding to FP. We showed that at concentrations occupying most receptors, AL-8810 robustly activated ERK1/2 with a similar efficacy as PGF2α. This response could not be explained by a non-selective effect of AL- 8810 on other receptors, as we did not observe any such responses in HEK 293 cells lacking FP. Moreover, activation of ERK1/2 by both PGF2α and AL-8810 was inhibited by another selective FP antagonist, AS604872. We showed in FP cells that while ERK1/2 activation induced by PGF2α was mostly blocked by PKC inhibition, the response promoted by AL-8810 was insensitive to such treatment, but was largely blocked by inhibition of EGFR and Src. These results suggest that while both PGF2α and AL-8810 direct FP signalling toward MAPK activation, they did so through preferential engagement of distinct downstream 115 signalling mechanisms (Fig. 2.11). GPCRs also recruit β-arrestins to facilitate both their endocytosis and distinct signalling events such as MAPK activation following desensitization of primary cell surface signalling pathways (DeWire et al., 2007; Luttrell and Gesty-Palmer, 2010). We investigated the potential role of β-arrestin recruitment in both PGF2α- and AL-8810-mediated, FP-dependent signalling. Stimulation with neither PGF2α nor AL-8810 did not lead to recruitment of β-arrestin-1 or β-arrestin-2 to FP, suggesting that it does not employ β-arrestins for its internalization, or for activation of MAPK, at least in the cells tested here. The concept of ligand-directed signalling, or biased agonism, has been demonstrated for many different GPCRs and ligands (for reviews see (Conn et al., 2009; Digby et al., 2010; Galandrin et al., 2007; Kenakin, 2003; Wang et al., 2009b)). These ligands include compounds that act at both orthosteric and allosteric binding sites and induce specific receptor conformations that favor selective or specific downstream signalling pathways. Biased GPCR ligands have been shown to differentially activate Gα proteins (Goupil et al., 2010), induce β- arrestin-specific responses (Wei et al., 2003) and to transactivate EGFR (Kim et al., 2008). Interesting examples have recently been demonstrated using different competitive β-adrenergic antagonists that promoted MAPK activation in a G protein-independent manner through β-arrestin scaffolding (Galandrin et al., 2008; Wisler et al., 2007). Another example is the oxytocin receptor antagonist atosiban, which was shown to be an antagonist for Gq-induced signalling, but an agonist for the ERK1/2 pathway (Reversi et al., 2005b). Our findings add AL- 116 8810 to this list of orthosteric ligands that act as antagonists for one G protein- dependent signalling pathway, while preferentially activating another pathway. Our findings also underscore the need for caution when using AL-8810 as a competitive antagonist to study PGF2α-mediated responses in complex biological systems (Husain et al., 2005; Sales et al., 2007; Ueno and Fujimori, 2011; Woodward et al., 2007). Indeed, FP could engage MAPK, if signalling effectors such as those involved in autocrine EGFR-dependent transactivation are also present. Otherwise, if such cellular signalling complements are absent, AL-8810 would act as competitive antagonist for FP to inhibit PGF2α-mediated MAPK activation. We found that pre-treatment of cells with AL-8810 (e.g. for 30 min) inhibited PGF2α-mediated ERK1/2 activation. This antagonistic property, however, most likely reflects the desensitization of this signalling pathway (e.g. dephosphorylation of MAPK) rather than a competition of ligands at the receptor level. Such effects may also explain some of the AL-8810 antagonistic properties previously reporter by others. Osteoblasts express endogenous FP, which transactivate EGFR upon PGF2α stimulation (Ahmed et al., 2003; Samadfam et al., 2006). We observed that MAPK activation promoted by both PGF2α and AL-8810 in human MG-63 osteoblast cells was highly sensitive to EGFR inhibition, again consistent with the transactivation of this RTK by FP. This contrasts with PGF2α-mediated MAPK signalling in HEK 293 cells, which was mostly EGFR-independent, highlighting the cell-specific context of biased signalling. Indeed, although we observed consistent, but statistically non-significant effects on some EGFR-dependent 117 responses promoted by PGF2α (e.g. phosphorylation of EGFR), this was insufficient to engage HB-EGF shedding and activation of MAPK. Little is known about the molecular and structural requirements for ligand binding and FP activation (i.e. conformational rearrangement of the receptor promoted by the binding of ligands). The carboxylic acid group in C1 position of PGF2α has been shown to be important for ligand binding and activity on the receptor (Maddox et al., 1978; Powell et al., 1974; Schaaf and Hess, 1979; Schuster et al., 2000; Woodward et al., 2000). Substitution of the 15-hydroxyl group in PGF2α or insertion of cyclic groups in the alkyl chain such as in the case for bimatoprost, cloprostenol, and fluprostenol are generally well tolerated by the FP receptor in terms of ligand binding and activity. On the other hand, the 9- and 11-hydroxyl groups have been reported to be important for PGF2α binding to FP. Our findings with AL-8810, which bears an 11β-fluoro substitution, are not only consistent with previous binding data, but they also suggest that the hydroxyl group in the cyclopentane moiety is involved in stabilizing a conformation of FP that engages specific downstream effectors and signalling pathways. Indeed, crystallography studies of GPCR have revealed that even very minor changes in receptor conformation supported by different orthosteric ligands, can promote differential receptor states capable of distinct signalling events (Deupi and Kobilka, 2010; Kobilka and Deupi, 2007). Mechanisms controlling the activity of MAPKs and their sub-cellular localization such as shuttling of ERK1/2 between the cytoplasm and the nucleus are complex and remain incompletely understood (Pouyssegur et al., 2002; Ramos, 2008). Cellular compartmentalization of ERK1/2 seems to be an 118 important component for controlling its activity and function, since it targets specific transcription factors and protein kinases in the nucleus, and phosphorylates protein kinases and other structural proteins in the cytosol to regulate distinct cell responses (Yoon and Seger, 2006). Moreover, the duration of ERK1/2 signals is also a key determinant of the functional and physiological outcomes (Marshall, 1995). For instance, nuclear translocation and sustained activation of ERK1/2 promoted by some growth factors like NGF engender differentiation of pheochromocytoma (PC12) cells and neurite outgrowth, while transient activation of ERK1/2 induced by EGF, which remains mostly cytosolic, does not lead to such responses (Nguyen et al., 1993; Traverse et al., 1992). Using cellular fractionation, immunofluorescent labeling and a FRET-based biosensor, we demonstrated that ERK1/2 is differentially localized and activated in the cytosol and the nucleus, in a time-dependent manner, depending on which FP ligand was used. Whereas the activation of ERK1/2 using biochemical or immunofluorescent approaches appeared transient in nature, our data using a biosensor suggest a more sustained MAPK activation in different cellular compartments (e.g. AL-8810-induced MAPK activation in the nucleus vs. the same response induced by PGF2 is in the cytosol). This latter result perhaps suggests the inability of the biosensor to be deactivated (e.g. dephosphorylated by MAPK phosphatases), and to return to an “open” inactive conformation. Notwithstanding this possibility, our collective data support a different spatial and temporal regulation of ERK1/2 activation in the nucleus and cytosol by PGF2 and AL-8810. 119 GPCRs are known to either induce or inhibit cell proliferation (New and Wong, 2007). For instance, osteoblast-like cells have been shown to have dual responses to parathyroid hormone stimulation, the cellular context being important to either induce or inhibit cell proliferation (Fujita et al., 2002). Despite our finding that PGF2 and AL-8810 can signal to MAPK through similar signalling pathways, our results in MG-63 osteoblast cells using [3H]-thymidine incorporation suggest that FP can be biased into promoting complex physiological responses such as proliferation. This also suggested that other regulatory signalling mechanisms specific to PGF2- or AL-8810-dependent FP receptor activation must be at play. We have not assessed the spatio-temporal regulation of ERK1/2 activation by PGF2 and AL-8810 in MG-63 osteoblast cells. However, it is tempting to speculate that such differences in the regulation of MAPK between the two ligands could also be responsible for the distinct proliferation pattern observed here. This also opens the question of how PGF2 and AL-8810 differentially control cell proliferation. Future studies will be required to better understand the link between ligand-specific-mediated spatio-temporal activation of MAPK and the differential regulation of cellular responses like proliferation and perhaps other responses such as gene expression and/or cytoskeletal signalling, which may also contribute to the phenotype observed. 2.7 Acknowledgements 120 We thank Dr. Christian Le Gouill and Dr. William Lubell for helpful discussions. 121 2.8 Figures for Chapter 2 Figure 2. 1 AL-8810 binds FP receptor and activates MAPK. A: FP cells were incubated for 1 hr with vehicle (binding buffer), PGF2α or AL- 8810 at the indicated concentrations and [3H]-PGF2α displacement was measured. B,C: Cells were serum-starved for 30 min prior to stimulation with either 1 μM PGF2α (B) or 10 μM AL-8810 (C) for the indicated times. Cell lysates were analyzed by western blot using anti-phospho- and anti-total ERK1/2 antibodies. Signals were quantified by densitometry and plotted as fold over basal (i.e. not 122 treated) activation. D: Cells were pre-treated with either 1μM AS604872 or vehicle (ethanol) for 30 min and then stimulated for 5 minutes with PGF2α (PGF) or AL-8810 (AL). E: MG-63 osteoblasts were serum-starved overnight prior to treatment with either 1 M PGF2a or 10 M AL-8810 for the indicated times. Signals were analyzed as in B,C. Results are representative of 3 (A, B, D) and five (C, E) independent experiments (*p<0.05, **p<0.01 compared to non-treated cells). 123 Figure 2. 2 PGF2but not AL-8810 activates MAPK via PKC. A: Images obtained by confocal microscopy showing translocation of PKCI-GFP to the cell membrane following treatment with 1 μM PGF2 or 10 μM AL-8810. Lower right panel: after 30 min of AL-8810 stimulation, cells were stimulated with an excess of PGF2 to show functional FP-induced PKCI-GFP translocation. B, C: FP cells were serum-starved for 30 min prior to pre-treatment with either DMSO or 1 μM Gö6983 for 30 min. Cells were then treated with either 1 μM PGF2α (B) or 10 μM AL-8810 (C) for the indicated times. Cell 124 lysates were analyzed by western blotting using anti-phospho- and anti-total ERK1/2 antibodies. Signals were quantified by densitometry and plotted as fold over basal (i.e. not treated) activation. Results are representative of three (A), four (C) and five (B) independent experiments (*p<0.05, **p<0.01, ***p<0.001 compared to DMSO-treated cells). 125 Figure 2. 3 PGF2 analogs, except AL-8810, require downstream PKC to activate ERK1/2. A: Chemical structures of PGF2 analogs: bimatoprost (bimat.), cloprostenol (cloprost.), fluprostenol (fluprost.) and AL-8810. B: FP cells were serum-starved 30 min prior to pretreatment with DMSO or 1 M Go6983 for 30 min. Cells were then stimulated for 5 min with 1 M PGF2, bimatoprost, cloprostenol, fluprostenol or 10 M AL-8810 and signals were analyzed as in Figure 2. Results are representative of three (B) independent experiments (**p<0.01, ***p<0.001 compared to DMSO-treated cells). 126 Figure 2. 4 β-arrestin is not recruited to FP in response to either PGF2or AL-8810. A: Images obtained by confocal microscopy showing redistribution of β-arrestin- 2-YFP following 1 μM PGF2, 10 μM AL-8810 in FP cells or 1 μM Ang II treatment in HA-AT1R cells. B: FP-R cells or AT1R cells were serum-starved for 1 hour prior to stimulation with 1 μM Ang II, 1 μM PGF2α or 10 μM AL8810 at indicated time points. HA-tagged receptors were immunoprecipitated and cell lysates were western blotted using anti-β-arrestin (clone 3978, see Materials and Methods), anti-phospho ERK1/2 or anti-HA antibodies (IP indicates immunoprecipitation, and TCL indicates total cell lysate). Results are representative of three independent experiments. 127 Figure 2.5 AL-8810 activates MAPK through EGFR-dependent transactivation. A,B,C,D: FP cells (A, B, C) and MG-63 osteoblasts cells (D) were serum-starved for 30 min (A,B) or overnight (C, D) prior to pre-treatment with either DMSO or 125 nM AG1478 for 30 min. Cells were then treated with 1 μM PGF2α (A, C, D), 10 μM AL-8810 (B, C, D) or 5 ng/mL EGF (C, D) for the indicated times. Cell lysates were analyzed by western blot using anti-phospho-ERK1/2, anti-total- ERK1/2 (A,B, D) and anti-phospho EGFR (C) antibodies. Signals were quantified by densitometry and plotted as fold over basal (i.e. not treated). Results are 128 representative of three (D), five (A, B) or six (C) independent experiments. *p<0.05, **p<0.01, comparing DMSO and AG1478 treatment for each corresponding time points of ligand stimulation (Figs. 5A and B); **p<0.01, ***p<0.0001 compared to DMSO-treated, ligand-unstimulated cells (Figs. 5C and D); ✝✝ p<0.01 compared to DMSO-pretreated, PGF2-stimulated cells, at 5 and 15 min; $p<0.0001 compared to AG1478-pretreated, and PGF2- and AL8810- stimulated cells (Figs. 5C); ‡p<0.0001 compared to DMSO-pretreated, EGF- stimulated cells (Figs. 5C inset and 5D). 129 Figure 2. 6 AL-induced EGFR transactivation is through an EGF shedding signalling pathway. A,B: FP cells were plated in 6-well plates and 48 h later, cells were serum-starved for 30 min prior to pre-treatment with either DMSO or 1 M PD153035 for 30 min. Cells were then treated with 1 μM PGF2α or 10 μM AL-8810 for the indicated times. C: FP (donor cells in the scheme) and HEK 293 naïve cells 130 (acceptor cells in the scheme) were plated in 12-well plates and 48h later, serum starved. FP cells were then stimulated with 1 μM PGF2α or 10 μM AL-8810 for 5 and 15 min. After stimulation, the media of FP cells was taken and deposited on the acceptor cells (final dilution 1:2) and left for 5 min. Cells were then lysed in Laemmli buffer, and lysates were analyzed by western blot using anti-phospho- ERK1/2 and anti-total-ERK1/2 antibodies. Signals were quantified by densitometry and plotted as fold over basal (i.e. not treated) activation. Results are representative of five (A, B) and three (C) independent experiments (*p<0.05, **p<0.01, ***p<0.001 compared to DMSO-treated cells). 131 Figure 2. 7 Src is involved in AL-8810-induced ERK1/2 activation. A, B: FP cells were plated in 6-well plates and transfected 24 h later with an empty vector (pcDNA3.1+) or a kinase dead mutant of Src (SrcK298R). After 48h, cells were serum-starved for 30 min and then treated with 1 μM PGF2α or 10 μM AL-8810 for the indicated times. Cells were lysed and analyzed as in Figure 6. Results are representative of four independent experiments (**p<0.01, ***p<0.001 compared to empty vector transfected cells). 132 Figure 2. 8 ERK1/2 cellular localization is differentially affected by PGF2 or AL-8810 treatment. A, B: FP cells were starved 30 min prior to stimulation with 0.5 M PGF2 and 5 M AL-8810 for the indicated times. Cells were then lysed and the different fractions were extracted (see Materials and Methods for details). Cell lysates were analzsed by western blot using anti-total ERK1/2, anti-early endosome antigen 1 (EEA1, A) and anti-nucleoporin 62 (Nup62, B) antibodies. A shows cytosolic compartment, B shows nuclear compartment, the third panel shows an enrichment control for both cellular compartments. C: FP cells were starved 30 min prior to 133 stimulation with 1 μM PGF2α, 10 μM AL-8810 for the indicated times. Cells were then fixed and activated ERK1/2 were stained with anti-p-ERK1/2 and goat- anti-mouse-Alexa488 secondary antibodies (green signal). Nuclei were stained with Hoescht (represented as a red signal). Also shown is the overlay between Hoescht and p-ERK1/2 staining and composite mask showing co-localizing pixels between both signals (see Materials and Methods for details). Results are representative of four (A) and three (B) independent experiments. *p< 0.05 compared to the “0” time-point. Scale bars are 10µm. 134 Figure 2.9 Spatio-temporal control of ERK1/2 activation is differentially affected by PGF2 and AL-8810. 135 A, B: FP cells were transfected with EKAR-nucleus (A) or EKAR-cytosol (B) and stimulated with 1 μM PGF2α or 10 μM AL-8810 for a period up to 60 minutes. FRET and CFP images were collected every minute (see Materials and Methods for details) and the FRET/CFP ratio was calculated and plotted against time. Representative pseudocolor images are shown for EKAR-nucleus (A) or EKAR- cytosol (B). C: FP-R cells were transfected with EKAR-nucleus (left panel) or EKAR-cytosol (right panel) and cells were pre-treated with 125 nM AG-1478 for 30 min prior to stimulation with PGF2 and AL-8810 as in A, B. Shown on the graph are the FRET/CFP values for the maximal stimulation at 5 min for EKAR- Nucleus and 10 min for EKAR-cytosol. Scale bar represents 10 m. Results are representative of nine (A, B) and three independent experiments (50-83 cells in A, 42-50 cells in B, 15-22 cells in C.). *p< 0.05 (difference between treatments). 136 Figure 2. 10 Different patterns of [3H]-thymidine incorporation are observed with PGF2 and AL-8810-treated cells. MG-63 osteoblast cells were plated in 24-well plates. 24 h later, cells were starved for 24 h prior to stimulation with 1 M PGF2a and 10 M AL-8810 for 4, 8, 12 or 24 h. Inset: treatment with 10% serum. Results are representative of four independent experiments. *p< 0.05 and ***p< 0.0001 (difference between treatments). 137 Figure 2. 11 Signalling mechanisms for PGF2α and AL-8810 stimulation of FP. PGF2α activates ERK1/2 through both the canonical Gαq/11-PKC-dependent pathway, which seems to be mostly EGFR-independent in HEK 293 cells, and results in activated ERK1/2 remaining mainly in the cytosol at early time points and translocates to the nucleus at later time points. On the other hand, AL-8810 activates ERK1/2 through FP-dependent EGFR transactivation, via Src and EGF shedding, probably via matrix metalloproteases, leading to a rapid and transient activation ERK1/2 in the nucleus. 138 Supplementary Figure 2. 1 AL-8810 pre-treatment inhibits PGF2-mediated ERK1/2 activation. A: FP cells were plated in 6-well plates for 48 h. Cells were then starved for 30 min. and stimulated with 1 mM PGF2, 10 mM AL-8810 or 10 mM AS604872 for the indicated times. B: FP-R cells were plated in 6-well plates for 48h. Cells were then starved for 30 min. After 30 min. of pre-treatment with 10 mM AL- 8810, cells were stimulated with 10 nM PGF2 for the indicated times. C: FP cells were plated in 6-well plates for 48h. Cells were starved for 30 min., pre- treated with DMSO or 1 mM PD153035 for 30 min and then stimulated with 0.7 nM EGF for the indicated times. For A, B, C, cells were lysed in Laemmli 2X buffer (see Materials and Methods) and lysates were analysed by western blotting using anti-phospho- and anti-total-ERK1/2 antibodies. Results are representative of three independent experiments. 139 CHAPTER 3: A novel biased allosteric compound inhibitor of parturition selectively impedes the prostaglandin F2-mediated Rho/ROCK signalling pathway. Eugénie Goupil, Danaë Tassy, Carine Bourguet, Christiane Quiniou, Veronica Wisehart, Darlaine Pétrin, Christian Le Gouill, Dominic Devost, Hans H. Zingg, Michel Bouvier, H. Uri Saragovi, Sylvain Chemtob, William D. Lubell, Audrey Claing, Terence E. Hebert and Stéphane A. Laporte This research was originally published the Journal of Biological Chemistry. Goupil, E. et al., J Biol Chem, 2010, Vol. 285 (33), 25624-36. © the American Society for Biochemistry and Molecular Biology (see appendices for permissions). 140 3.1 Preface In the previous chapter, we characterized the ability of FP to bias its downstream signalling pathways when occupied by an orthosteric ligand. We found that FP, when bound to AL-8810 (an orthosteric ligand), led to EGFR- transactivation, a pathway not activated by PGF2 in HEK 293 cells. Next, still with the aim of generating a better understanding of how FP could be modulated, we wanted to verify if FP could take alternate conformations, but this time in the presence of an allosteric ligand, that is, a ligand binding to a topographically distinct site from the orthosteric or endogenous ligand (in our case, PGF2). In this manuscript, we studied the actions of a new allosteric compound for FP. This compound, PDC113.824, had been design as a peptide mimic of an octapeptide directly derived from FP’s second extracellular loop. This octapeptide, THG113, was demonstrated to be a strong tocolytic, as well as being allosteric (Peri et al., 2002). After verifying that PDC113.824 had no effects on FP when used alone, we found that it could bias FP-mediated signalling. Moreover, PDC113.824 retained the tocolytic capabilities of THG113. This manuscript showed for the first time that FP could be allosterically modulated. In addition, our study showed that receptor-mediated functional selectivity emerging from the design of a peptide mimic of the second extracellular loop of FP. Finally, we demonstrated for the first time receptor structure could be used to induce a specific “allosteric” conformation of the receptor. 141 3.2 Abstract The prostaglandin F2α (PGF2) receptor (FP) is a key regulator of parturition and a target for pharmacological management of preterm labor. However, an incomplete understanding of signalling pathways regulating myometrial contraction hinders development of improved therapeutics. Here we used a peptidomimetic inhibitor of parturition in mice, PDC113.824, whose structure was based on the N-terminal region of the second extracellular loop of FP receptor, to gain mechanistic insight underlying FP-mediated cell responses in the context of parturition. We show that PDC113.824 not only delayed normal parturition in mice but also that it inhibited both PGF2- and LPS-induced preterm labor. PDC113.824 inhibited PGF2-mediated, Gα12-dependent activation of the Rho/ROCK signalling pathways, actin remodeling and contraction of human myometrial cells likely by acting as a non-competitive, allosteric modulator of PGF2 binding. In contrast to its negative allosteric modulating effects on Rho/ROCK signalling, PDC113.824 acted as a positive allosteric modulator on PGF2-mediated PKC and ERK1/2 signalling. This bias in receptor-dependent signalling was explained by an increase in FP coupling to Gαq, at the expense of coupling to Gα12. Our findings regarding the allosteric and biased nature of PDC113.824 offer new mechanistic insights into FP signalling relevant to parturition, and also suggest novel therapeutic opportunities for the development of new tocolytic drugs. 142 3.3 Introduction Premature birth due to preterm delivery is the most important cause of neonatal mortality and morbidity in industrialized countries (Joseph et al., 1998; McCormick, 1985). A common cause of preterm labor is a spontaneous increase in uterine contraction. However, little is known regarding the factors that either maintain uterine quiescence or initiate spontaneous uterine contraction. Pharmacological interventions that aim at preserving or inducing uterine quiescence remain the most attractive strategy for managing preterm labor to date. Prostaglandins, whose synthesis is under the control of cyclo-oxygenases and specific prostaglandin synthases, play important roles during pregnancy and parturition (Makino et al., 2007; Olson, 2003). They are initiators of physiological labor and exert their effects through different G protein-coupled receptors (GPCRs). For instance, prostaglandin F2α (PGF2) promotes myometrial contraction through activation of PGF2 (FP) receptors (Olson et al., 2003; Phillippe et al., 1997). Moreover, FP null mice fail to deliver at term and are unresponsive to induced labor mediated by either PGF2 or the uterogenic hormone oxytocin (Sugimoto et al., 1998; Sugimoto et al., 1997). At the molecular level, activation of FP leads to inositol phosphate accumulation, protein kinase C (PKC) activation, and intracellular calcium release, consistent with coupling of FP to the Gαq family of G proteins (Davis et al., 1987; Ito et al., 1994a; Jimenez de Asua and Goin, 1997; Pierce et al., 1997). Activation of FP has also been shown to promote Rho-dependent reorganization of the cytoskeleton (Pierce et al., 1999). 143 Both signalling pathways are believed to contribute to phasic and tonic myometrial smooth muscle contraction. However, their relative contributions to uterine tissue contraction during parturition remain poorly understood. Thus, a better comprehension of PGF2-mediated signalling mechanisms through FP is not only essential to understanding parturition, but also for the potential development of drugs suppressing labor (tocolytics). At present, the use of tocolytics to delay preterm labor is often contraindicated due to significant maternal and fetal side effects (Pryde et al., 2004; Thornton et al., 2001). A new FP ligand, THG113, corresponding to a peptide derived from the sequence of the second extracellular loop of FP (Fig. 1A), was recently reported to inhibit preterm labor in a mouse model (Peri et al., 2002). However, the exact mechanism underlying its action on myometrial contraction remained unclear. In refining THG113 as a potential tocolytic compound specific for FP with enhanced efficacy toward myometrial contraction, a peptidomimetic compound, PDC113.824, was synthesized (Fig. 1B and Suppl. Fig. 1A). We used this compound to develop a better understanding of FP signalling in the context of myometrial cell contraction and the regulation of parturition. We report here, that PDC113.824 is a potent tocolytic agent, selective for FP. Interestingly, our results suggest that this compound acts as a functional allosteric modulator for FP as it exerts its effects at a site distinct from the orthosteric binding site, and further biases PGF2-bound receptors toward increased Gαq-PKC-MAPK signalling, while blocking cell contraction and cytoskeleton reorganization through inhibition of the Gα12-Rho-ROCK signalling pathway. 144 3.4 Materials and Methods Reagents [3H]-PGF2, [35S]-GTPS and ECL are from Perkin Elmer. [125I]-Angiotensin was labeled as described in (Speth and Harding, 2000). PGF2 is from Cayman. Rabbit polyclonal anti-Gαq (C-19) and anti-Gα12 (S-20) antibodies are from Santa Cruz. PD98059, Gö6983, LY294002 are from Calbiochem. Y27632 is from Ascent Scientific. C3 exoenzyme is from Cytoskeleton. Fluor488-Phalloidin is from Molecular Probes. Type I rat collagen, oxytocin and angiotensin II (AngII) are from Sigma. Mouse monoclonal anti-p-ERK and rabbit polyclonal anti-total ERK antibodies are from Cell Signaling. Puromycin is from Invivogen. MEM is from Hyclone. DMEM-F12, heat-inactivated fetal bovine serum (FBS) and gentamycin are from Invitrogen. Analytical RP-HPLC was performed on a C18 Gemini column (5µ, 4.6 mm 50 mm, flow rate 0.5 ml/min in 15 min) using a linear gradient from 20-80% of acetonitrile or methanol in water (each solvent containing 0.1% TFA). Elution products were detected at 214 nm. Boc-3-pyridylalanine is from GL- Biochem Shanghai and other peptide mimic synthesis products, such as coupling reagents were purchased from Sigma. Boc-Phe was synthesized from Boc-Phe according to an established method (Linder et al., 2002). DNA Constructs 145 Glu-glu-tagged (EE)-Gαq, GαqDN-EE (Q209L/D277N), Gα12-EE and pcDNA3.1+/FP receptor were obtained from the University of Missouri cDNA resource center (www.cdna.org). PKCI-GFP was from Dr. S. Ferguson (University of Western Ontario). Gα12 (Q231L/D299N) was obtained from Dr. G. Zamponi (University of Calgary). Raichu-RBD-1502 was obtained from Dr. M. Matsuda (Osaka University). pIRESP-HA-hFP receptor construct: The pIRES- Puro3 vector was digested with NheI/BamHI and a PCR fragment containing hemagglutinin (HA) tag overlapped with pIRES-Puro3 sequence (FWD:5’- CTAGCCACCATGGCTTACCCTTACGACGTGCCAGATTATGCC TGCGGATCCGGCGTTTAAAC-3’, RVS: 5’-GATCGTTTAAACGCCGGATCC GCACAGATAATCTGGCACGTCGTAAGGGTAAGCCATGGTGG-3’) was digested with the same enzymes and inserted into pIRES-Puro3. The new construct was renamed pIRESP-HA. pIRESP-HA was linearized with BamHI and PCR- amplified FP (from pcDNA3.1+/FP receptor. FWD: 5’- TTATGCCTGCGGATCCTCCATGAACAATTCCAAACAGC-3’, RVS: 5’- TTTAAACGCCGGATCCTAGGTGCTTGCTGATTTCTCTG-3’) was introduced by recombination, according to manufacturer instructions (In-Fusion PCR cloning kit, Clonetech). All clones were verified by bidirectional sequencing. FP antibody generation The peptide corresponding to the first extracellular loop of FP was synthesized by FMOC synthesis with >95% purity (Biosynthesis, Lewisville, TX) and included an additional residue (cysteine) at the amino terminus (NH2-CSMNNSKQLVS- 146 COO). The cysteine-containing peptide was conjugated to the sulfhydryl-reactive carrier protein keyhole limpet hemocyanin (KLH) (Pierce, Rockford, IL). The KLH-conjugated peptide in complete Freund’s adjuvant (Pierce) was injected intraperitoneally and subcutaneously (total 25 g, in 100 l) in female BALB/c mice. Subsequent immunizations were performed every 10–13 days with KLH- conjugated peptide in PBS. Serial dilutions of mouse serum were screened for reactivity using a solid-phase enzyme-linked immunosorbent assay (ELISA), testing the original peptide (unconjugated). Several other peptides or BSA were used as negative controls (not shown). Four days after the last immunization, splenocytes were fused with SP2/0 mouse myeloma cells following established protocols. Hybridoma supernatants were screened by ELISA against unconjugated peptide or controls as above. Supernatants were further screened for binding to cell surface FP by FACScan assays, using live HEK 293 cells stably transfected with FP or parental HEK 293 cells as a background control. Wells containing hybridomas secreting monoclonal antibodies reactive to FP were sub-cloned twice by limiting dilution and expanded for monoclonal antibody purification. The hybridoma line producing antibody 3E12/2B2 was used in this study. Cell culture and transfection A stable HEK 293 cell line expressing human FP was generated by transfection with pIRESP-HA-hFP receptor. Stable lines were selected in 0.7 μg/ml puromycin. All HEK 293-derived cell lines were grown at 37°C in 5% CO2 in MEM supplemented with 10% (v/v) heat-inactivated FBS and gentamycin (100 µg/ml). 147 hTERT-C3 myometrial cells were grown in DMEM-F12 as described previously (Devost and Zingg, 2007). For transient transfection, cells seeded at a density of 1x106 cells per 100-mm dish or 1x105 per well in a 6-well plate, were transfected using a conventional calcium phosphate co-precipitation method. All experiments were performed 48 h post-transfection. Ligand binding experiments For binding experiments, HEK 293 cells stably expressing HA-FP were directly dosed for protein quantification and 100 g of intact cells was incubated with 105 cpm of [3H]-PGF2 (150-240 Ci/mmol) in the presence of either vehicle (EtOH, 0.01% v/v), 1 M cold PGF2, 10 M AL-8810, 1 or 10 M PDC113.824 for 1 h at RT in 0.5 ml of binding buffer (described previously (Peri et al., 2002)). Potential allosteric interactions were detected using radioligand dissociation assays. Dissociation of [3H]-PGF2 was measured as follows: FP cells (100 g) were pre-incubated with 105 cpm [3H]-PGF2 with or without 1 M PDC113.824 in a total volume of 0.4 ml of binding buffer for 60 min. Ligand dissociation was then initiated by the addition of 1 M cold PGF2 for different times. Non- specific binding was determined by addition of 1 M PGF2 for 90 min. Binding was stopped by addition of 2 ml cold Tris-HCl 50 mM pH 7.4 and cells were filtered on GF/B-filters. Incorporated radioactivity was measured by liquid scintillation spectrometry. [35S]-GTPS loading studies 148 FP cells were co-transfected with EE-tagged-Gαq or -Gα12. On the day of the experiment, cells were serum starved prior to treatment with or without 0.5 M PDC113.824 at 37ºC for 30 min. Cells were collected in ice-cold buffer (10 mM Tris-HCl pH 7.4, 5 mM EDTA) and homogenized on ice by 20 strokes with a Teflon potter. The homogenate was centrifuged at 23 000x rpm at 4ºC and resuspended in TME buffer (50 mM Tris-HCl pH 7.4, 2 mM EDTA, 4.8 mM MgCl2, 100 mM NaCl). GDP (final concentration of 1 M) was added to 50 g of membranes and incubated on ice for 10 min. The reaction was moved to 30ºC and incubated for 5 min before the addition of [35S]-GTPS (1,250 Ci/mmol) to a final concentration of 5 nM. PGF2 was added 30 sec later and the reaction was allowed to proceed for 5 min. Reactions were stopped with cold IP buffer (50 mM Tris-HCl pH 7.5, 20 mM MgCl2, 150 mM NaCl, 0.5% NP-40, protease inhibitors, 100 µM GDP and GTP) and membranes were solubilised for 30 min at 4ºC. To immunoprecipitate specific complexes, 1.2 g of anti-Gαq (clone C-19, Santa Cruz) or anti-Gα12 (clone S-20, Santa Cruz) antibodies were added for 2 hrs at 4ºC. Protein G-agarose beads were added and incubated for an additional 60 min at 4ºC. Beads were then washed three times with IP buffer and incorporated 35S-GTPS was measured by liquid scintillation spectrometry. PKCI-GFP translocation FP cells co-transfected with PKCI-GFP were serum-starved for 30 min and pre- treated with vehicle (water) or PDC113.824 (2 M) for 30 min followed by treatment with increasing concentrations of PGF2 (from 10-11 to 10-7M) for 10 149 min each. Images were collected every 30 sec using live-cell microscopy at 37ºC on a Zeiss LSM-510 Meta laser scanning microscope equipped with XL-3 temperature chamber with a 63X glycerol/water immersion lens in single track mode using excitation at 488 nm for GFP and emission measured with the LP505 filter set. Translocation was determined by calculating the fluorescence level at the membrane (area under the curve) divided by the fluorescence level in the cytosol, using Metamorph (Universal Imaging Corporation). Cell ruffling and immunofluorescence studies FP cells were plated on cover slips. For dominant negative Gα12, Gα12(Q231L/D299N) was transfected 48 hrs prior to experiment. Cells were serum starved for 30 min and pre-treated or not with either 0.1 or 1 M PDC113.824 or the following pharmacological inhibitors: MEK1/2 (PD98059, 1 M), PI3K (LY294002, 1 M), PKC (Gö6983, 1 M), Rho kinase (Y27632, 1 M) for 30 min at 37ºC or with Rho inhibitor (C3 exoenzyme, 1 g/mL) for 4 hrs at 37ºC. Cells were then stimulated with 1 M PGF2 for 20 min, fixed with 4% paraformaldehyde (PFA), and stained with Fluor488-Phalloidin. Nine fields (50-75 cells/field) per cover slip were quantified to assess cellular ruffling. For FP labeling, PFA-fixed myometrial or FP cells were incubated with mouse-anti-FP (clone 3E12/2B2) for 90 min prior to applying goat-anti-mouse Alexa488-coupled secondary antibody for an extra 60 min. Raichu-Rho binding domain experiments 150 The Raichu-RBD probe was used as described previously (Itoh et al., 2002). Briefly, Raichu-RBD is composed of a YFP moiety in the N-terminal domain (m2Venus), a central Rho-binding domain (RBD) of Rhotekin and a CFP moiety in the C-terminal domain. FP or AT1R cells were plated on 35-mm microscopy dishes at a density of 50,000 cells. 24 hrs later, cells were transfected with Raichu- RBD alone or co-transfected with Gα12DN. 48 hours later, cells were serum starved for 30 min, pre-treated or not with PDC113.824 (1 M) for 30 min or C3 exoenzyme (1 g/ml) for 3-4 hours, followed by stimulation with 1 M PGF2 for 25 min. Images were collected every 30 sec for the first 6 min, then every minute until 12 min, and at 15, 20 and 25 min using live-cell microscopy at 37ºC on a Zeiss LSM-510 Meta laser scanning microscope as described above with excitation at 405 nm for CFP and the FRET channel, 514 nm for YFP and with emission measured with BP420-480 for CFP and BP530-600 for YFP and FRET. Energy transfer efficiency between the CFP (donor) and YFP (acceptor) was determined by calculating the ratio of the YFP over CFP fluorescence from three different regions of each cell, and corrected for background signal using Metamorph. FRET images were translated into colored gradient images using Rainbow2 visualization in Zen Light software (Zeiss). This function translates each pixel of the image into intensity values and reports them using a color code. 24-36 cells/condition were quantified in five to eight independent experiments. Collagen contraction assay 151 Collagen contraction assays were performed as described previously (Devost and Zingg, 2007). Briefly, 14,000 to 17,500 hTERT-C3 myometrial cells were plated in DMEM/F12 in 0.5% (v/v) FBS on the collagen lattice and left for 2hrs at 37°C. Cells were then pre-treated with either vehicle, C3 exoenzyme (1 g/ml) or PDC113.824 (2 M) for 2 hrs. To allow contraction, each collagen lattice was detached from the bottom of the well with a small spatula and left overnight at 37°C in the absence or presence of 1 M PGF2 or oxytocin. Contraction was stopped by fixing lattices in PBS with 4% PFA. The plate containing collagen lattices was then photographed using the Alpha Imager System. Percentage of contraction of collagen lattices was then calculated using Metamorph, using the following equation: % contraction = 100 – (area of lattice *100 / area of the well). Murine preterm labor models and ex vivo myometrial contraction assay Timed-pregnant CD-1 mice at 16 days gestational (normal term is 19.2 days) were anesthetized with isoflurane (2%). Primed osmotic pumps (Alzet pump, Alzet, Cupertino, CA) containing either saline or PDC113.824 (10 mg/day/animal) were subcutaneously implanted on the backs of the animals; infusion of PDC113.824 was immediately preceded by bolus injection of PDC113.824 (0.1 mg/animal i.p.). Within 15 min after placement of the pumps, animals were injected with PGF2 or lipopolysaccharide ([LPS] E. coli endotoxin, 50 g/animal i.p.) to mimic the inflammatory/infectious component of human preterm labor. In a separate group of animals PGF2 or LPS was injected 4 to 7 hrs prior to administration of PDC113.824. Animals were inspected every hour for the first 18 hrs and every 2 h 152 thereafter to document the timing of birth. All experiments were approved by the Animal Care Committee of CHU Sainte-Justine (Montreal, QC, Canada). Ex vivo myometrial contraction assay was performed as previously described (Peri et al., 2002). Briefly, uteri from mice were obtained from animals immediately following term delivery. Myometrial strips (2 to 3-mm wide and 1 to 2-cm long) from both were suspended in organ baths containing Krebs buffer equilibrated with 21% oxygen at 37°C with an initial tension at 2 g. After 1 hr of equilibration, changes in mean basal tension, as well as peak, duration and frequency of spontaneous contraction in the absence or presence of PGF2and PDC113.824 were recorded with a Kent digital polygraph system. Statistical analysis Statistical tests were performed with GraphPad Prism 4.3 software. Assumptions of normality and equal variance were met for all data analyzed. One-way analysis of variance (ANOVA) with Dunnett’s correction was used in Figs. 3B, D (comparing all results to vehicle treatment), 5B, E (comparing all results to PGF2 treatment) and Suppl. Fig. 2. Two-way ANOVA with repeated measures was used in Fig. 8E, F with Bonferroni correction. Independent t-tests were used in Figs. 2C, 2E, 4C, 6B-D, 8A and 9A-F, to compare between vehicle and PDC113.824. One- sample t-test (Figs. 4A, 4D, 7A and 9C-F) was used when the data was normalized and basal levels were considered in respect to the hypothetical value (1 or 100). Fisher’s exact test was used in Fig. 2A, B and D. A 2-tailed p-value less than 0.05 153 was considered significant. All results are expressed as mean standard error (SEM). Sample size (n) and P-values are given in the figure legends. 3.5 Results 3.5.1 Design and optimization of the peptidomimetic PDC113.824. Conversion of the THG113 sequence (Ile-Leu-Gly-His-Arg-Asp-Tyr-Lys) into the peptide mimic (Fig. 3.1 and Suppl. Fig. 3.1A) involved, in brief, a systematic analysis of the sequence using alanine and enantiomeric amino acid scans, which highlighted the importance of the Arg and Asp side-chains; replacement of the hydrophobic termini with hydrocarbon pharmacophores and the Gly-His residue by different indolizidinone turn mimics (Bourguet et al., 2009; Cluzeau and Lubell, 2005; Hanessian et al., 1997; Lombart and Lubell, 1996); and refinement near the Arg-Asp residue using different amino acid substitutions to arrive at the pyridylalanine--homophenylalanine surrogate. The 3-phenylacetamido indolizidin-2-one 9-carboxyl and the pyridinylalaninyl-- homophenylalanine sections of PDC113.824 (Fig. 3.1B) are thus believed to mimic the active β-turn geometry about the Gly residue and the signalling pharmacophore of the Arg-Asp-Tyr triad in the parent peptide, respectively. 154 3.5.2 Tocolytic effects of PDC113.824 in normal and preterm labor models. We first verified that the peptide mimetic, PDC113.824 acted as a tocolytic agent in vivo in normal parturition. Mice near term (gestational day 17.5) were treated or not with PDC113.824 and delivery was assessed in the animals (Fig. 3.2A). Results showed that PDC113.824 significantly delayed delivery compared to untreated animals who all delivered at term (day 19). Indeed, at day 19 only 50% of PDC113.824-treated animals had delivered. Delivery of all PDC113.824-treated animals was delayed to day 20. We also tested if PDC113.824 would also block provoked preterm labor using lipopolysaccharide (LPS), known to promote a general inflammatory state which results in prostaglandin synthesis and induce premature delivery (Peri et al., 2002). Results showed that for all the animals tested, delivery occurred within 12 hours following LPS injection into mice at gestational day 16 (Fig. 3.2B, C). Pretreatment with PDC113.824 prior to LPS injection significantly delayed delivery, such that by gestational day 17, only 20% of treated animals delivered. As was the case for normal term delivery (e.g. saline treatment), PDC113.824- treated mice did not deliver until day 19 even when treated with LPS. Hence, PDC113.824 significantly extended the average time of delivery following LPS treatment by approximately 20 hours as compared to untreated animals (Fig. 3.2C). We also verified whether PDC113.824 interfered specifically with PGF2- induced labor. Animals were treated or not with PDC113.824 prior to injection with PGF2 at gestational day 15.5 (Fig. 3.2D). All PGF2-treated animals 155 delivered rapidly by 2 hours post-injection. Again, PDC113.824 treatment markedly delayed delivery in PGF2-injected animals, as around 40% of the animals had delivered by day 16-17 post-injection (Fig. 3.2D). Accordingly, the mean time of delivery was significantly increased in the presence of PDC113.824 (Fig. 3.2E). To ensure that the observed labor-delaying effect of our synthetic tocolytic was mediated through its actions on the uterus, and to dissociate its potential effects on luteolysis, which would decrease levels of the natural tocolytic progesterone produced in the ovary (Sugimoto et al., 1997), we isolated myometrium from spontaneous post-partum mice and assessed the direct effects of PDC113.824 on spontaneous- and PGF2-induced contraction (Suppl. Fig. 3.2). Results showed that PDC113.824 significantly reduced both the strength and duration of both PGF2-induced and spontaneous myometrial contraction in a dose-dependent manner, consistent with the increased expression of FP in the uterus during labor which occurs even in rodents (Olson et al., 2003). Taken together, our results suggest that PDC113.824 delays both term and preterm labor, at least in part through the inhibition of uterine contraction. 3.5.3 PDC113.824 negatively modulates PGF2-mediated myometrial cell contraction and Rho/ROCK signalling. The putative inhibitory effects PDC113.824 on PGF2-mediated contraction were next examined in myometrial cells. Human myometrial smooth 156 muscle cells (hTERT-C3) were used as they have been previously shown to respond to uterotonic factors and to retain their contractile properties (Devost and Zingg, 2007). As a prelude to these experiments, the expression of endogenous FP receptor in these cells was confirmed using a monoclonal antibody raised against the receptor (clone 3E12/2B2; Fig. 3.3A). Antibody labeling was shown to be specific for FP, since immunofluorescent signals were not detected in HEK 293 cells, which do not express endogenous FP, but were detected at the cell surface in HEK 293 cells transfected with FP. Strong labeling of FP at the cell surface was also detected in myometrial cells (Fig. 3.3A). We also quantified the levels of endogenous FP at the plasma membrane in myometrial cells using [3H]-PGF2 binding studies (Fig. 3.3B). Both PGF2 and the selective FP antagonist AL-8810 displaced bound [3H]-PGF2 from myometrial cells and FP expression was approximately 5-10 fmol/mg of total protein. Next, PGF2 and PDC113.824 regulation myometrial cell contraction was tested in vitro using a cell-induced collagen lattice contraction assay (Fig. 3.3C). Cells were layered on top of collagen and grown for a period of 16 hours, which resulted in a decrease in the diameter of the collagen matrix due to self- contraction of the cells. Addition of PGF2 further increased contraction of hTERT-C3 cells. PDC113.824 alone had no effect on hTERT-C3 contraction per se. On the other hand, it inhibited PGF2-mediated cell contraction responses (Fig. 3.3C and D). Moreover, PDC113.824 exhibited no effect on the myometrial contraction induced by a distinct uterotonic agent, oxytocin (Fig. 3.3D, OT), demonstrating the specificity of the action of the compound for FP. Since the 157 contractile function of FP on smooth muscle has been shown to involve Rho- kinase activation (Ito et al., 2003; Schaafsma et al., 2004), we also verified its contribution on myometrial cell contraction. As shown in Fig. 3.3C and D, both basal and agonist-induced cell contractions were dependent on Rho GTPase activation, as C3 exoenzyme blocked both responses. To assess how PGF2-dependent activation of Rho was regulated by PDC113.824, we next used a biosensor for Rho activation expressed in HEK293 cells, as these cells are considerably easier to transfect than myometrial cells. We first characterized the binding properties of FP in these cells by stably expressing HA-tagged receptors (thereafter referred to as FP cells, see Experimental Procedures). No specific [3H]-PGF2 binding to untransfected cells was detected (Fig. 3.4A, inset). However, radiolabeled PGF2 binding on FP-expressing cells was robustly displaced by both unlabelled PGF2 as well as AL-8810 (Fig. 3.4A). The effect of PDC113.824 on [3H]-PGF2 binding was also tested in these cells. PDC113.824, at concentrations that inhibited myometrial contraction (1M) or higher (10µM), displaced no more than 15% of PGF2 binding to FP. Rho family GTPases are known FP effectors (Pierce et al., 1999), whose activities can be regulated by Gα12/13 (Buhl et al., 1995). Using FP cells, we next tested PGF2-dependent activation of Rho GTPases by imaging the fluorescent FRET-based biosensor Raichu-RBD, which consists of the RhoA binding domain (RBD) of Rhotekin flanked by the FRET pair YFP and CFP (Itoh et al., 2002). Under basal conditions, intra-molecular interaction of YFP and CFP in the Rho biosensor generated a detectable FRET signal (Fig. 3.4B). Binding of 158 endogenous, activated GTP-bound Rho to this biosensor following FP stimulation induced a decrease in FRET signal. Although PDC113.824 alone had no effect on Rho activation (data not shown), the response to PGF2 stimulation was decreased in its presence (Fig. 3.4B). Quantification of the FRET signal was assessed by measuring changes in the YFP/CFP emission ratio (Itoh et al., 2002; Nakamura et al., 2006) and revealed a time-dependent, agonist-mediated activation of Rho (Fig. 3.4C, i.e. decrease in FRET signal). PGF2α-stimulated Rho activity was greatly reduced at all time points in the presence of PDC113.824. PGF2-mediated activation of Rho, like contraction in myometrial cells was sensitive to C3 exoenzyme (Fig. 3.4D). We next assessed the contribution of Gα12 in Rho activation by expressing a dominant negative version of this Gsubunit (Gα12DN, Q231L/D299N, Fig. 3.4D, left panel). An inhibition of FP-mediated Rho activation was observed in a cell line expressing the Gα12DN. This response was specific to FP since PDC113.824 had no significant effect on the angiotensin II (Ang II) type 1 receptor (AT1R), another GPCR known to activate Rho (Aoki et al., 1998) (Fig. 3.4D, right panel). Rho GTPases can engage downstream targets including the protein kinase ROCK (Fujisawa et al., 1996), as well as promoting actin cytoskeletal rearrangement (Jaffe and Hall, 2005). We therefore assessed the effect of PGF2 and PDC113.824 on reorganization of the actin cytoskeleton manifested by membrane ruffling using phalloidin staining. Cell ruffling, as characterized by morphologic rounding of cell edges, was detected after 5 minutes of PGF2 159 stimulation (Fig. 3.5A) and persisted for more than 60 minutes (data not shown). This response was dependent on FP-mediated activation of Gα12, because co- expression of Gα12DN strongly inhibited PGF2-induced cell ruffling (Fig. 3.5B). Pre-treatment of cells with PDC113.824 again had a significant inhibitory effect on PGF2-mediated cell ruffling (Fig. 3.5D and E), while treatment of cells with either selective Rho GTPase (C3 exoenzyme) or ROCK (Y27632) inhibitors, both blocked completely PGF2-mediated cell ruffling (Fig. 3.5C and E). We also assessed the potential involvement of other signalling pathways downstream of FP on cell ruffling. Treatment of cells with selective inhibitors for classical PKC isozymes (Gö6983, Fig. 3.5) or phosphatidyl-inositol 3-kinase (LY294002; Suppl. Fig. 3.3) had no effect on membrane ruffling. The extent to which ERK1/2 MAPKs were involved in regulating cell ruffling was assessed, since they have been proposed to modulate Rho signalling (Pullikuth and Catling, 2007). Treatment of cells with the MEK1 inhibitor (PD98059) blocked only weakly PGF2-mediated cell ruffling (Fig. 3.5E). Taken together our results suggested that PDC113.824 acts as an allosteric modulator of FP-mediated myometrial contraction and cytoskeletal reorganization through inhibition of the Rho/ROCK signalling pathway. 3.5.4 Potentiation of FP-mediated PKC and MAPK signalling by PDC113.824. 160 Since our results suggested that PDC113.824 acts as a negative allosteric modulator (NAM) of the Rho/ROCK signalling pathway, we investigated whether it also antagonized other FP-mediated signalling pathways. As FP has been shown to promote ERK1/2 activation (Chen et al., 2001), we next tested PDC113.824 effects on PGF2-mediated MAPK activation. PGF2-dependent stimulation of FP receptor cells resulted in a time-dependent increase in ERK1/2 activation that reached maximal levels following 5 to 15 minutes of agonist stimulation (Fig. 3.6A, top panel). However, PDC113.824 alone had no effect on the ERK1/2 response (Fig. 3.6A, bottom panel). Rather than inhibiting PGF2-dependent activation of ERK1/2, the treatment of cells with PDC113.824 potentiated the response. Pretreatment with PDC113.284 significantly augmented the activation of ERK1/2 induced by PGF2 increasing both the efficacy and potency of the response by two-fold (Fig. 3.6B, EC50vehicle = 0.19 nM vs. EC50PDC113.824 = 0.10 nM). The effects of PDC113.824 on MAPK activation were again FP receptor-specific, since AngII-induced ERK1/2 activation in AT1R cells was not affected by pre-treatment with the peptidomimetic (Fig. 3.6C; EC50vehicle = 11.1 nM vs. EC50PDC113.824 = 16.8 nM). This effect of PDC113.284 on PGF2- dependent activation of ERK1/2 was also recapitulated in myometrial cells, as it potentiated the response by 1.5-fold relative to that of cells stimulated with PGF2 alone (Fig. 3.6D). Since PDC113.824 treatment increased PGF2- dependent activation ERK1/2, we also investigated the extent to which MAPK signalling contributed to myometrial cell contraction inhibition. As shown in Fig. 3.7A, pre-treatment of cells with PD98059, caused no significant effect on 161 PGF2-mediated cell contraction. Consistent with the notion that FP-dependent activation of Rho and MAPK are two independent signalling pathways, the inhibition of Rho with C3 exoenzyme did not affect ERK1/2 activation in FP cells (Fig. 3.7B). For Gq-coupled receptors like FP, activation of ERK1/2 can be mediated through activation of PKC. As shown in Fig. 3.8A, treatment of FP cells with the PKC inhibitor Gö6983 totally prevented PGF2-dependent activation ERK1/2. Thus, we also tested whether PDC113.824 potentiated PGF2-dependent activation of PKC by measuring PKCI-GFP recruitment to the plasma membrane (Fig. 3.8B and C). PKC recruitment to the plasma membrane following PGF2 stimulation of FP cells was evident at concentrations of 1nM agonist (Fig. 3.8B and D); while treatment of the cells with PDC113.824 alone had again no effect (Fig. 3.8D). Quantification of this response revealed a dose-dependent increase in PKCactivation upon PGF2 stimulation, with an EC50 of 2.5 nM (Fig. 3.8E, vehicle). Pre-treatment of cells with PDC113.824 prior to stimulation with PGF2 resulted in a two-fold increase in the efficacy of the response as well as a two-fold left shift in the potency of PKC recruitment (PDC113.824, EC50 = 1.17 nM; Fig. 3.8E). The specificity of PDC113.824 for FP was again demonstrated, as it had no effect on Ang II-dependent PKC activation (Fig. 3.8F). Together, these results suggest that PDC113.824 acts as positive allosteric modulator (PAM) on the PKC- MAPK signalling pathway induced by PGF2. 162 3.5.5 PGF2-mediated G protein coupling to FP is differentially regulated by PDC113.824. Our ligand binding experiments suggested that PDC113.824 allosterically regulates FP binding to PGF2 and/or its coupling to G proteins. Allosteric modulators are known to affect the off-rate of ligand binding to the orthosteric site on receptors (Kostenis and Mohr, 1996; Lanzafame and Christopoulos, 2004). We first investigated how PDC113.824 affected PGF2 binding to FP by measuring the kinetics of dissociation of PGF2. Upon exposure to excess cold agonist, the dissociation rate of [3H]-PGF2 in the presence of PDC113.824 was increased by more than 1.5-fold as compared to control treatment with vehicle (Fig. 3.9A). On the other hand, no significant effect of PDC113.824 was observed on binding off- rates for AT1R (Fig. 3.9B). We next assessed the effect of PDC113.824 on FP coupling to G proteins 35 by monitoring [ S]-GTPS loading onto Gαq and Gα12 following PGF2 stimulation. Pre-incubation of FP cells with PDC113.824 alone increased [35S]- GTPS loading onto Gαq to levels similar to that of PGF2 (i.e. in absence of PDC113.824). Consistent with the effects on PKC and ERK1/2, treatment with 35 PDC113.824 also significantly potentiated PGF2-promoted [ S]-GTPS-Gαq 35 binding (Fig. 3.9C). In contrast to Gαq, PDC113.824 both reduced [ S]-GTPS loading in the absence of the orthosteric agonist and also completely inhibited FP 35 receptor-stimulated [ S]-GTPS incorporation onto Gα12 (Fig. 3.9D). This effect is shown again to be specific for the FP as the agonist activation of AT1R, which 163 35 also resulted in [ S]-GTPS loading onto Gαq and Gα12 was not significantly influenced by PDC113.824 (Fig. 3.9E and F). 3.6 Discussion Here, we describe the design and characterization of PDC113.824 as a new allosteric modulator with biased signalling properties on FP, acting both as potent tocolytic agent in vivo and as an inhibitor of myometrial contraction in vitro and ex vivo. PDC113.824 actions were specific to FP, since no significant effects were observed on two other GPCRs, AT1R and the oxytocin receptor. Moreover, signalling studies performed using naïve HEK293 cells showed that PDC113.824 had no effect on ERK1/2 and cellular ruffling, suggesting that it doesn’t impact non-selectively effectors of these signaling pathways. However, further studies would be required to verify the extent to which PDC113.824 could affect receptors, other than FP, AT1R, and OTR, and other signalling pathways. Functional studies revealed that PDC113.824 increased agonist-mediated activation of MAPK by FP via Gq, while it inhibited cytoskeletal rearrangement and myometrial contraction through uncoupling of the receptor to the Gα12-Rho- ROCK signalling pathway (summarized in Fig. 3.10). The functional selectivity of PDC113.824 toward two distinct and opposite G protein-dependent events supports the biased nature of this compound on PGF2mediated, FP-dependent signalling. 164 A hallmark of allosteric affinity modulators is their ability to promote conformational changes in the receptor, which mechanistically can translate into alterations in the dissociation kinetics of preformed orthosteric ligand-receptor complexes (Christopoulos et al., 2004; Vauquelin et al., 2002b). These effects, however, are not seen if interacting ligands compete for the same orthosteric site. Our findings that PDC113.824 partially decreases [3H]PGF2 binding to FP (Fig. 3.4A, albeit no more than 15% of maximum binding) suggested that it can either act as an allosteric modulator of orthosteric site affinity (i.e. through a conformational change in the orthosteric binding site) and/or as a weak (partial) competitive ligand. The increased rate of dissociation of PGF2 in the presence of PDC113.824 is, however, more consistent with a conformational change in the orthosteric binding site of the receptor promoted by the non-competitive nature of an allosteric ligand. Although we cannot totally exclude that PDC113.824 may still partially compete with PGF2 for the orthosteric binding site, our results showing that PDC113.824 minimally decreases total binding of PGF2, while increasing agonist off-rate kinetics of ligand binding to the receptor, strongly suggest that PDC113.824 primarily acts as a negative affinity allosteric modulator of the FP receptor. Radioligand binding studies, using a labelled version of PDC113.824, will allow us to locate the binding site for this modulator on FP and demonstrate its specificity over other GPCRs more directly. While a number of studies have characterized the allosteric properties of synthetic compounds on different GPCRs (see (Conn et al., 2009) and (Valant et al., 2009b) for review), their potential to bias receptor signalling remains largely 165 unexplored. To our knowledge, PDC113.824 represents the first example of a synthetic allosteric modulator derived from a specific region of a GPCR (e.g. the N-terminal domain of the second extracellular loop of FP), which promotes functional selectivity for two distinct G protein-mediated signalling events. Our study not only provides conceptual insights into FP receptor signalling relevant to myometrial contraction, but also for the potential development of new classes of tocolytic drugs and other allosteric GPCR modulators with biased signalling properties. The extracellular loops of GPCRs have been demonstrated to be important for both ligand recognition and allosteric modulation of certain receptors (Avlani et al., 2007; Klco et al., 2005; Scarselli et al., 2007; Shi and Javitch, 2004). Transmembrane domains involved in ligand recognition and receptor activation have also been shown to influence extracellular loop conformations (Ahuja et al., 2009; Bokoch et al.). For instance, light-dependent activation of rhodopsin has been shown to induce changes in the conformation of the second extracellular loop. Moreover, a recent study on the 2-adrenergic receptor also revealed that ligands known to differentially affect the conformation of transmembrane domains and subsequent receptor activity also stabilize distinct conformation of the second extracellular loop (Bokoch et al.). Thus, PDC113.824, which mimics structural features of the second extracellular loop of FP, could constrain the conformation of agonist-bound receptor into selective coupling configurations, promoting more efficient Gq activation, while reducing coupling to G12. Interestingly, differential G protein coupling with FP was modulated by PDC113.824 even in the 166 absence of the orthosteric ligand suggesting that it primes two distinct pre-existing receptor/G protein complexes of FP/Gq and FP/Gα12 but in distinct ways. Alternatively, PDC113.824 may be capable of interacting with receptors that are constitutively active but not necessarily pre-coupled per se. Although PDC113.824 acted as a negative allosteric modulator for agonist binding, it seemed to affect how FP coupled to G protein in the absence of agonist in a biased fashion. Our study also yields new information regarding FP signalling and the mechanisms underlying myometrial contraction and cytoskeletal remodeling. We observed that blocking MAPK activation had only a marginal effect on cell ruffling, a response dependent on the Gα12-Rho-ROCK signalling pathway (Kurokawa and Matsuda, 2005; Takai et al., 1995), and no effects on myometrial cell contraction. Inhibiting Rho only affected cytoskeletal rearrangement and not FP-dependent activation of ERK1/2. Our findings suggest an important role of Gα12-Rho-ROCK pathway in regulating myometrial cell contraction and that Gq, which is involved in controlling the PKC-MAPK signalling pathway are independently regulated. However, we cannot exclude that other signalling events upstream of MAPKs, such as those seen for the PDC113.824-dependent increase in FP-mediated activation of PKC, contribute to blocking functional coupling of FP to Gα12/13. Our findings underscore the importance of FP signalling through the Gα12- Rho-ROCK pathway as a pharmacological target in the management of parturition and preterm labor. Our in vitro and in vivo data are consistent with both the observations that RhoA activity is increased in the myometrium during pregnancy, 167 and that inhibition of ROCK blocks both PGF2- and LPS-induced preterm labor in mice (Lartey and Lopez Bernal, 2009; Lartey et al., 2007; Tahara et al., 2005). However, the extent to which MAPK contributes to myometrial contraction and preterm labor remains an open question (Ohmichi et al., 1997). That PDC113.824 sensitizes PGF2-dependent activation of ERK1/2 in myometrial cells, while inhibiting myometrial contraction and parturition in mice suggests that MAPK plays a minor role in uterine contraction. Development of biased FP ligands which selectively engage the Gαq-PKC-MAPK signalling pathway, without affecting the Gα12-Rho-ROCK signalling pathway will be of great value in addressing this issue. To date, only a very few examples of biased allosteric modulators have been described which direct GPCR signalling toward distinct effector pathways. The metal ion Gd3+ allosterically modulates the orthosteric ligand glutamate for the mGluR1 homodimer to promote differential coupling of the receptor to either 3+ Gq and Gs (Tateyama and Kubo, 2006a). It is unlikely, however, that Gd acts in a selective manner, as it could affect other class C GPCRs. A calcium-sensing 2+ receptor (CaSR) autoantibody has also been shown to potentiate the Ca /Gq response, while inhibiting the Gi-dependent activation of MAPK (Makita et al., 2007). Recently, a drug screen has identified a new allosteric antagonist of NK2 receptor, which biases the receptor toward increased Ca2+ signalling, while inhibiting cAMP production (Maillet et al., 2007). PDC113.824 represents a significant addition to this new “repertoire” of allosteric modulators that bias receptors toward distinct G protein-dependent signalling events. Our findings are 168 also distinguishable, as they highlight the possibility of developing GPCR- specific synthetic allosteric and biased modulators by constructing mimics to particular regions of a given receptor. Ligands acting on orthosteric sites have also been shown to bias GPCR signalling (Galandrin et al., 2007; Kenakin, 2007). However, because allosteric sites on receptors are presumably more diverse than orthosteric sites, it is likely that many allosteric ligands described to act on GPCRs will also turn out to have unsuspected biased signalling properties. The clinical use of allosteric compounds has recently attracted more attention (Block et al., 2004; Dorr et al., 2005; Wang et al., 2009b). These modulators can be used at saturating concentrations, as their effects are only revealed in the presence of endogenous ligands (e.g. neutral allosteric ligands), potentially reducing adverse effects (Birdsall et al., 1999; Birdsall et al., 1996; Christopoulos and Kenakin, 2002). The design of allosteric ligands with biased signalling properties, as in the case of PDC113.824, offers not only the advantage of specificity for a single GPCR, but also selectivity for a specific subset of signalling pathways, further reducing unwanted side effects. At present, tocolytic drugs used in clinic have significant off target and/or non-selective actions (Pryde et al., 2004; Thornton et al., 2001). Sympathomimetics (e.g. ß-agonists), or non- steroidal anti-inflammatory drugs (NSAIDs, e.g. indomethacin) target multiple tissues and organs leading to unwanted responses in both the mother and fetus. Moreover, the benefit of oxytocin receptor blockade using antagonists (e.g. atosiban) in preventing pre-term labor remains limited, since oxytocin receptor, in contrast to FP, is not involved in regulating the initial stages of preterm parturition (Sugimoto et al., 1998; Sugimoto et al., 1997). Thus, the future development of 169 biased, allosteric compounds specific for FP will not only help further our understanding of mechanisms underlying parturition, but may also contribute to the design of better and more selective tocolytic drugs. 3.7 Acknowledgements This work was supported by a Canadian Institutes of Health Research Team Grant in GPCR Allosteric Regulation (CTiGAR, CTP 79848, to H.U.S, W.L., S.C., A.C., T.E.H., S.A.L and M.B.) and CIHR grants to T.E.H. (MOP- 36379) and S.A.L (PRG-82673 and MOP-74603). A.C. is a recipient of a New Investigator Award from the CIHR. T.E.H. is a Chercheur National of the “Fonds de la Recherche en Santé du Québec”, and M.B. and S.A.L. are Canada Research Chairs in Signal Transduction and Molecular Pharmacology, and in Molecular Endocrinology, respectively. We also thank PDC Biotech for unrestricted use of PDC113.824. 170 3.8 Supplementary Experimental Procedures Synthesis of PDC113.824- The peptide mimic PDC113.824 was readily synthesized using a solidphase protocol with construction of the phenylacetamido indolizidin-2-one 9-carboxyl pyridinylalaninyl moiety on an oxime resin using standard peptide chemistry with Boc-protection (Cluzeau and Lubell, 2005; Hanessian et al., 1997). Specifically, PDC113.824 was prepared using a Boc- protection strategy on oxime resin (Cluzeau and Lubell, 2005; Hanessian et al., 1997). L-Boc-3-pyridylalanine (150 mg, 0.56 mmol) was first coupled onto 1g ofthe resin (0.45 mmol/g) swollen in 15 ml of dichloromethane (DCM), using dicyclohexylcarbodiimide (DCC, 144 mg, 0.7 mmol) and ethyl 2-(hydroxyimino)- 2-cyanoacetate (EACNox, 198 mg, 1.4 mmol) for 24h at RT. After filtration, the resin was washed with DCM (5 × 10ml), EtOH (5 × 10ml) and again with DCM (5 × 10ml). Once the first residue was coupled to resin, capping of free sites was performed using acetic anhydride (0.2 ml, 2.2 mmol) in the presence of di-isopropylethylamine (DIEA) (0.175 ml, 1.1 mmol) in DCM for 12h at RT. The capped resin was filtered and washed with DCM (5 × 10ml), iPrOH:DCM (1:1, v:v, 1 × 10ml) and again with DCM (5 × 10ml). Deprotection of the Boc group was performed with 20% TFA in DCM (1 × 2 min and 2 × 15 min) and the resin was washed with DCM (5 × 10ml), iPrOH:DCM (1:1, v:v, 1 × 10ml) and again with DCM (5 × 10ml). The -turn mimic (3S,6S,9S)-3-N-(Boc)amino- indolizidin-2-one 9-carboxylic acid (prepared according to Lombart and Lubell (21), 179 mg, 0.6 mmol) and phenylacetic acid (82 mg, 0.6 mmol) were 171 sequentially coupled to the resin using O-(benzotriazol-1-yl)-N,N,N',N'- tetramethyluronium tetrafluoroborate (TBTU, 193 mg, 0.6 mmol) and hydroxybenzotriazole (HOBt, 81 mg, 0.6 mmol) in presence of DIEA (0.21 ml, 1.2 mmol) as base in dimethylformamide (DMF) for 3h. After each coupling reaction, the resin was washed using DMF (2 × 10ml), DCM (3 × 10ml), iPrOH:DCM (1:1, v:v, 2 × 10ml) and DCM (5 × 10ml) and monitored by both Kaiser test and LC/MS analysis of products from cleavage of an aliquot of the resin with methoxyethylamine in chloroform. Final cleavage was performed by nucleophilic displacement with -homophenylalanine benzyl ester (161 mg, 0.6 mmol) in the presence of DIEA (104 μL, 0.6 mmol) and AcOH (34μl, 0.6 mmol%) in DCM. Following cleavage from the resin, the crude product was purified by preparative reverse phase HPLC using a solvent gradient from 20-80% acetonitrile (containing 0.1% TFA) in water (containing 0.1% TFA) to afford 120 mg (0.17 mmol) of the benzyl ester at a yield of 37%.Hydrogenation of benzyl ester (0.17 mmol) with hydrogen at atmosphere pressure was performed using palladium-on-activated-carbon (10% wt, 60 mg) in EtOH (15 ml) for 5h. Filtration of the catalyst onto Celite™ with methanol and evaporation of volatiles yielded a residue, which was isolated by preparative HPLC using a gradient from 20-80% acetonitrile (containing 0.1% TFA) in water (containing 0.1% TFA) to afford 30 mg (0.048 mmol) of expected PDC113.824 (29% yield). 1H NMR (400 MHz, D2O): d8.55 (s, 1H), 8.47 (s, 1H), 8.27 (d, J= 6.9 Hz, 1H), 7.86 (s,1H), 7.32-7.22 (m, 10H), 4.49 (t, J= 6.4 Hz, 1H), 4.38-4.35 (m, 2H), 4.24 (d, J= 9.2Hz, 1H), 3.6-3.59 (m, 1H), 3.56 (s, 2H), 3.11 (dd, J= 6.4, 14.5 Hz, 1H), 3.04 (m, 1H), 172 2.87 (dd, J= 5.18, 13.7Hz, 1H), 2.65 (dd, J= 9.3, 14 Hz, 1H), 2.55 (m, 1H), 2.39- 2.35 (m, 1H), 2.12-2.02 (m, 4H), 1.75-1.72 (m, 1H), 1.68-1.65 (m, 1H), 1.54-1.43 (m, 2H); HRMS (m/z): [M+H]+ calculated for C35H39N5O6, 625.2900; found, 625.2903; RP-HPLC retention times 4.23 min (ACN/H2O); 6.23 min (MeOH/H2O). 173 3.9 Figures for Chapter 3 Figure 3.1 Structures of A. THG113 peptide (ILGHRDYK) and B. PDC113.824. 174 Figure 3. 2 Tocolytic action of PDC113.824 in LPS- and PGF2-induced preterm labor in mice. A. Effects of PDC113.824 on duration of gestation terminated by spontaneous labor. Pregnant mice were treated with PDC113.824 (10 mg/kg/day) starting on 175 day 17.5 of gestation. B & D. Percentage of animals delivered following injection of LPS (B, 1.65 mg/kg by intraperitoneal injection) or PGF2 (D, 3.3 mg/kg, intraperitoneal) in the presence or absence of PDC113.824 (10 mg/kg/day). Control mice were injected with saline. Although bars are presented at 12, 15-24 hrs and 24-48 hrs for saline-injected animals, no mice delivered before term (72 hrs or day 19). Hours refers to time of delivery following LPS or PGF2 treatment. C & E. Average delivery time after LPS (C) or PGF2 (E) treatment in the presence or absence of PDC113.824. Days (D) refers to gestational age. Values are presented as mean ± SEM (C & E). Data are representative of 5-6 animals per treated group, other than n=18 for the saline-injected animals. *p<0.05, compared to saline-treated. 176 Figure 3.3 PDC113.824 inhibits PGF2-induced cellular contraction in myometrial cells. A. Confocal images of FP staining on hTERT-C3 myometrial cells using a mouse monoclonal anti-FP antibody (clone 3E12/2B2). Top left: FP staining in stably expressing FP cells, bottom left: labeling in naïve HEK 293 cells. Top right: FP in hTERT-C3 cells, bottom right: labeling with secondary antibody alone. Scale bar represents 10 m. B. Specific binding of [3H]-PGF2 to myometrial cells incubated with: vehicle (binding buffer), 10 µM AL-8810 or 10 µM PGF2. C. Images of collagen lattice contraction following pre-treatment with vehicle, PDC113.824 (PDC) or C3 exoenzyme (C3) and subsequent PGF2 or oxytocin (OT) stimulation. White dashed lines depict the area used to quantify contraction. 177 D. Quantification of contraction from cells with different pretreatments, followed by agonist stimulation. Results are representative of at least three independent experiments. *p<0.05, **p<0.01 compared to vehicle. 178 Figure 3. 4 PGF2-mediated Rho activation is inhibited by PDC113.824. A. Binding of [3H]-PGF to FP cells in the presence of 1 µM PGF2α, 10 µM AL- 8810, 1 µM or 10 µM PDC113.824. Inset: HEK 293 cells transfected with pcDNA3.1 were incubated with [3H]-PGF alone or with 1 µM unlabelled PGF2. B & C. FP cells were transfected with Raichu-RBD and pre-treated or not with 1 µM PDC113.824, followed by PGF2 stimulation. FRET signals were recorded as described in Experimental Procedures and represented as pseudocolour changes (B), or quantified by calculating the YFP/CFP intensity ratio (C, D). C. YFP/CFP ratio with or without pre-treatment with PDC113.824 in a time-course of stimulation using PGF2. D.YFP/CFP ratio on FP receptor or 179 AT1R expressing cells following different treatments. NT: untreated cells; C3 exo or G12DN: cells were pre-treated with C3 exoenzyme for 4 hrs or co-transfected with G12DN (Q231L/D299N) followed by stimulation with PGF2 for 25 min. Scale bar represents 10 m. Results are representative of six (A), eight (B, D left panel) and five (D right panel) independent experiments. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 compared to not treated. 180 Figure 3.5 Cell ruffling induced by PGF2 through the Gα12-Rho-Rock pathway is inhibited by PDC113.824. A. Representative phalloidin-staining images of cells stimulated or not with PGF2 showing cell ruffling. B & C. Effect of Gα12DN (B) and different inhibitors (C) on PGF2-induced cell ruffling. Cells stably expressing FP were transfected with Gα12 (Q231L/D299N) (B) or pre-treated with Y27632 (1 µM), C3 exoenzyme (1 µg/mL), PD98059 (1 µM) or Gö6983 (1 µM) (C) and then 181 stimulated with 1 M PGF2. D. Cell ruffling in FP cells that were pre-treated with either vehicle or PDC113.824 (0.1 or 1 µM) and stimulated with 1 M PGF2. E. Quantification of the cell ruffling shown in C and D. Fluorescence was examined by confocal microscopy and ruffling was quantified using 350 to 500 cells/condition/experiment. Scale bar represents 15 m. Results are representative of at least three independent experiments. **p<0.01, compared to PGF2-treated cells. 182 Figure 3. 6 PDC113.824-mediated increase of PGF2-dependent ERK1/2 activation. A. Effect of PGF2 and PDC113.824 on ERK1/2 MAPK activation. FP cells were serum-starved for 30 min prior to treatment for various times with either PGF2 (1 M, top panel) or PDC113.824 (2 µM, bottom panel). Cell lysates were analyzed by western blot using anti-phospho ERK and anti-total ERK antibodies. + denotes a control condition for MAPK activation from cells only stimulated with PGF2 (1 M, 5 min.). B-D. Effect of PDC113.824 on MAPK activation induced by PGF2 in FP cells (B), by Ang II in AT1R cells (C), by PGF2 in 183 hTERT-C3 myometrial cells. Cells were treated with 2 M PDC113.824 for 30 min and then stimulated with increasing concentrations of PGF2 (B) or AngII (C) f or 2 min or PGF2 for 5 min (D). Signals were quantified by densitometry and plotted in dose-response curves as fold over basal (i.e. not treated) activation versus PGF2 concentration. Results are representative of three (A) six (B), seven (C) and four (D) independent experiments. **p<0.01, ***p<0.001. 184 Figure 3.7 PGF2-induced cellular contraction and ERK1/2 activation are independently regulated. A. Effect of the MEK inhibitor, PD98059 on myometrial cell contraction. Left panel: hTERT-C3 cells were pre-treated with 10 M PD98059 for 2 hrs prior to treatment with 1 M PGF2 for 18 hrs. Quantification of myometrial cell contraction was calculated as in Fig. 3.3. Right panel: Representative images of collagen lattices used for quantification. B. Effect of C3 exoenzyme on PGF2- mediated ERK1/2 activation. FP receptor cells were serum-starved for 30 min prior to pre-treatment with 1 g/ml of C3 exoenzyme for 4 hrs. Cells were then treated with PGF2 (1 μM) for indicated times. Cell lysates were analysed by western blot using anti-phospho ERK and anti-total ERK antibodies. Bands were quantified by densitometry. Results are representative of four independent experiments. ***p<0.001 compared to DMSO or PD alone. 185 Figure 3. 8 PDC113.824 is a positive modulator of PGF2-induced PKC activation. A. Effect of PKC inhibitor Gö6983 on PGF2-mediated ERK1/2 activation. FP receptor cells were serum-starved for 30 min prior to pre-treatment with 1 Mof Gö6983 for 30 min. Cells were then treated with PGF2 (1 μM) for indicated times. Cell lysates were analysed by western blot using anti-phospho ERK and anti-total ERK antibodies. Bands were quantified by densitometry. B & C. Quantification of PKC translocation using FP cells transiently transfected with PKCβI-GFP (see Experimental Procedures). Fluorescence intensity as a function of the pixel distance (C) is taken from a line crossing the cell (B). D. Images obtained by confocal microscopy showing translocation of PKCI-GFP to the cell 186 membrane following PGF2 and PDC113.824 treatment. E & F. Quantification of the PKCI-GFP translocation in FP cells (E) or AT1R cells (F). Cells were serum-starved for 30 min, treated either with vehicle (water) or PDC113.824 (2 μM) for 30 min and then stimulated with increasing concentrations of PGF2 or AngII. Scale bar represents 10 μM. Results are representative of four (A) five (B- E) or three (F) independent experiments. *p<0.05, **p<0.01, ***p<0.001. 187 Figure 3.9 PDC113.824 allosterically modulates PGF2 binding to FP and biases coupling to Gq and G12. A & B. Assay to measure dissociation kinetics of [3H]-PGF2 binding to FP cells (A) or AT1R cells (B). Cells were incubated with [3H]-PGF2(A)or [125I]- 188 AngII (B) alone (vehicle) or with 1 µM PDC113.824 for 1 hr at RT. Loss of radioligand binding to FP or AT1R cells was monitored over time following the addition of 1µM cold PGF2 (A) or AngII (B). Inset: (A) Half-life of [3H]-PGF2 in presence of vehicle, 2.83 ± 0.34 min vs 1.79 ± 0.14 min for PDC113.824, p = 0.031 compared to vehicle (B) Half-life of [125I]-Ang II in presence of vehicle or PDC113.824. C-F. PGF2- or Ang II-mediated [35S]-GTPS binding to Gαq (C, E) and Gα12 (D, F) in FP (C, D) or AT1 receptor cells (E, F). Cells transfected with either Gαq-EE or Gα12-EE were serum starved for 15 min at 37ºC prior to treatement with vehicle or with 0.5 µM PDC113.824 for 20 min. Membranes were then prepared and incubated with [35S]-GTPS, and either left unstimulated (-) or stimulated with 1 µM PGF2 or Ang II (+) for 5 min at 30ºC. Incorporation of [35S]-GTPS on G proteins was measured after stopping the reaction by immunoprecipitation of either Gαq or Gα12 with subtype-specific antibodies. Inset: Western blots showing Gαq (C, E) and Gα12 (D, F) expression. Results are representative of three (A, B) or six (C-F) independent experiments. n.s., not significant, *p<0.05, ** p<0.01 compared to vehicle (A, B) or vehicle not treated ((-) C-F), #p<0.1 compared to vehicle ((+) C), &p<0.05 compared to PDC (-). 189 Figure 3. 10 PDC113.824-mediated biased signalling effects through FP. PGF2 induces ERK1/2 activation via Gαq, and actin reorganization and contraction through Gα12. PDC113.824 increases the coupling of the FP to Gαq, which increases PGF2-mediated activation of PKCI and ERK1/2 (i.e. acts as a positive allosteric modulator, PAM). In contrast, PDC113.824 reduces PGF2- induced cytoskeletal reorganization, modulation of cell ruffling, and myometrial cell contraction via decreased coupling of FP to Gα12 (i.e acts as a negative allosteric modulator, NAM). FP-mediated activation of PLC and production of 2+ inositol trisphosphate (IP3) promotes intracellular Ca release, which stimulates Ca2+-dependent, calmodulin-mediated activation of myosin light chain kinase and subsequent phosphorylation of myosin light chain to promote smooth muscle cell contraction. Activation of the Rho-ROCK pathway through Gα12 facilitates inhibitory regulation of the myosin light (MLC) phosphatase and the increase in 190 myosin light chain phosphorylation, which maintains the cell in the contracted state (Lartey and Lopez Bernal, 2009). 191 Supplementary Figure 3. 1 PDC113.824 synthesis (A) Solid support synthesis of PDC113.824. See Suppl. Experimental Procedures for more details. 192 Supplementary Figure 3. 2 Effects of PDC113.824 on myometrial contraction of spontaneously delivering mice immediately post-partum (A) Modulation of PGF2 (1mM)-induced myometrial contractions by PDC113.824. (B) Effects of PDC113.824 on mean tension of spontaneous myometrial contraction. (C) Effects of PDC113.824 on duration of spontaneous myometrial contractions. Values are mean ± SEM of n=4 per group. *p<0.05 compared to corresponding saline-treated tissues. 193 Supplementary Figure 3. 3 Effects of PI3 kinase inhibitor on PGF2-induced cellular ruffling in FP cells. A. Representative phalloidin-staining images of cells pre-treated or not with 1 µM LY294002 and stimulated or not with 1 µM PGF2 (vehicle same as in Figure 3.3.) B. Quantification of cellular ruffling shown in A. Scale bar represents 15 m. Results are representative of at least three independent experiments. *p<0.05, compared to PGF2-treated cells. 194 CHAPTER 4: Angiotensin II type I receptor-mediated vasoconstriction and hypertrophy is regulated by dimerization with the prostaglandin F2 receptor FP. Eugénie Goupil, Xiaoyan Luo, Stéphanie Clément, Darlaine Pétrin, Éric Thorin, Stéphane A. Laporte and Terence E. Hébert. To be submitted. 195 4.1 Preface The last few years have shown the vast capacity of GPCR cellular responses to be modulated by homo- or heterodimerization. In the two previous chapters, we have demonstrated how ligands could bias FP-mediated cellular responses: first via an orthosteric ligand, AL-8810, second, via an allosteric compound, PDC113.824. In this study, still searching for ways FP might be biased and allosterically modulated, we looked at the effect of a putative receptor partner on FP signalling and vice versa. A recent study had shown that FP-/- mice had reduced blood pressure, despite upregulation of angiotensin II (Ang II) type I receptors (AT1R) and an exacerbated hypertensive response to Ang II. Those interesting findings prompted us to hypothesize that FP and AT1R regulated each other’s signalling by the formation of a heterodimer. I will show, once more, how FP can adopt different conformations, leading to biased and allosteric signalling, when heterodimerized with AT1R. Moreover, we noted an influence of FP on AT1R-mediated vasoconstriction, a response that could be important to better understand pathophysiological conditions, such as hypertension and treatment paradigms used to deal with them. 196 4.2 Abstract The angiotensin II (Ang II) type I (AT1R) and the prostaglandin F2αPGF2α F prostanoid (FP) receptors are both potent regulators of blood pressure. Here, we show that AT1R and FP form heterodimeric complexes in both heterologous (HEK 293 cells) and endogenous (vascular smooth muscle cells, VSMC) systems. AT1R heterodimerization with FP led to an increase in the affinity for PGF2α. Antagonist-occupied FP modulated Ang II affinity for AT1R but the converse was not noted, suggesting asymmetric arrangements within the dimer. FP-induced ERK1/2 activation was attenuated in the presence of AT1R while Ang II- dependent activation of MAPK was increased in the presence of FP. Moreover, antagonist-occupied AT1R potentiated PGF2α-induced ERK1/2 activation in VSMC, while a similar occupation of FP by an antagonist had no effect on AT1R- mediated ERK1/2 activation, but inhibited Ang II-induced VSMC hypertrophy. Finally, PGF2α-occupied FP led to a dose-dependent potentiation in Ang II- induced contraction in abdominal aorta rings ex vivo, whereas FP antagonists had the opposite effect. Similar regulation of PGF2α-mediated vasoconstriction was observed when using AT1R agonist and antagonist. Taken together, our study suggests that the formation of the AT1R/FP dimer creates a novel allosteric signalling unit that shows asymmetrical responses, depending on the signalling outcome measured. The AT1R/FP dimer may represent a putative new 197 pharmacological target and therapeutic modality for the clinical management of hypertension. 198 4.3 Introduction G protein-coupled receptors (GPCRs) are one of the most versatile families of cell surface receptors, responsible for regulating a wide variety of cellular responses (Lagerstrom and Schioth, 2008). In recent years, much debate has arisen to answer the question whether GPCRs serve their physiological functions as monomers (Whorton et al., 2008), dimers (Fung et al., 2009; Han et al., 2009) or even larger oligomers (Breitwieser, 2004; Gurevich and Gurevich, 2008). Convincing arguments can however, be made for GPCR oligomers that function as allosteric machines (Kenakin, 2010b; Kenakin, 2012; Milligan and Smith, 2007). For instance, as an allosteric ligand for its cognate receptor, one ligand-occupied protomer of a heterodimer can act as an allosteric modulator for the other protomer, affecting ligand binding and/or signalling (Milligan and Smith, 2007). One obvious functional advantage of dimers, more easily understood in the context of heterodimers, is that they can act on each other via allosteric interactions, which may or may not depend on ligand occupation. In fact, a recent study suggested that ghrelin receptor significantly alters D2 dopamine receptor signalling, via heterodimerization in brain regions which never see ghrelin as a neurotransmitter, suggesting a function for the apo-receptor as an allosterically modulating interacting partner, rather than as a signalling receptor in these cells (Di et al.). Similar findings were obtained with D1/D2 dopamine receptor dimers (Rashid et al., 2007). Several groups, including ours, have shown that allosteric communication between the protomers of a dimer could lead to 199 functional selectivity of their downstream cellular signals (Rocheville et al., 2000; Wrzal et al., 2012a; Wrzal et al., 2012b). The receptor for prostaglandin F2 (PGF2), the F prostanoid receptor (FP), has been implicated in the regulation of complex physiological events, such as term and pre-term labour (Makino et al., 2007; Olson, 2003), ocular pressure homeostasis (Lee et al., 1988) and smooth muscle contraction (Bos et al., 2004). We and others have shown in previous studies that FP activates ERK1/2 in HEK 293 cells via the Gq-PKC pathway (Fujino et al., 2000; Goupil et al., 2010; Sales et al., 2005) and that this response could be modulated by both a biased (Goupil et al., 2012b) and allosteric ligands (Goupil et al., 2010). Moreover, FP desensitization by PGF2 did not involve the recruitment of -arrestins (-arr, (Goupil et al., 2012b)). Recently, a study showed the implication of FP in blood pressure regulation, where FP-/- mice had a reduced blood pressure and renin-angiotensin- aldosterone systems (RAAS) activity (Yu et al., 2009). Interestingly, the pressor effect of the angiotensin II (AngII) type I receptor (AT1R), a Gq-coupled GPCR, was greatly exacerbated in these mice, suggesting an interplay between their cellular responses when both receptors are present. The renin-angiotensin system (RAS) is a key regulator of blood pressure, electrolyte balance and numerous neuronal and endocrine actions associated with cardiovascular function. Previous studies have demonstrated that AT1 heterodimerizes both with CB1 cannabinoid receptors (Rozenfeld et al., 2011) and the 2AR (Barki-Harrington et al., 2003), which in both cases resulted in altered signalling profiles compared to 200 the parent receptors. These observations led us to consider the importance of a dimeric partnership between FP and AT1R, which could generate a biased response to their cognate ligands in tissues where both receptors were expressed. Here, we studied FP heterodimerization with AT1R and demonstrate reciprocal allosteric interactions present within the signalling unit former by this dimer. Both receptors cellular responses were reciprocally, but asymmetrically regulated. 201 4.4 Materials and Methods Materials [3H]-PGF2[125I]-carrier free radionucleotide, 3H]-thymidine, 3H]-leucine, [125I]-BK-Tyr8 and ECL reagent were from Perkin Elmer (Waltham, MA). PGF2α was from Cayman (Ann Arbor, MI). Angiotensin II (AngII), rabbit anti-Flag antibody, N-ethylmaleimide (NEM) and poly-L-ornithine hydrobromide were from Sigma-Aldrich (St Louis, MO). Mouse monoclonal anti-phospho-ERK1/2 (T202/Y204), rabbit polyclonal anti-total ERK1/2 antibodies were from Cell Signaling (Danvers, MA). Anti-mouse Flag antibody was from Sigma-Aldrich (St Louis, MO). Anti-β-arrestin (clone 3978) was generated at the McGill University Animal Facility and described elsewhere (Zimmerman et al., 2009b). Paraformaldehyde was from Electron Microscopy Sciences (Hatfield, PA). Dithiobis-succinimidyl propionate (DSP) was from Pierce (Rockford, IL). MEM and DMEM were from Hyclone (Logan, UT). Fetal bovine serum (FBS), L- glutamine, Fluor488-phalloidin, Hoescht stain and gentamicin were from Invitrogen (Carlsbad, CA). G418 and puromycin were from Invivogen (San Diego, CA). Anti-HA Affinity Matrix and mouse monoclonal anti-HA (clone 12CA5) antibody were from Roche (Laval, Canada). Phenylmethyl sulfonyl fluoride (PMSF), aprotinin, leupeptin and pepstatin were from Bioshop (Burlington, Canada). Bovine serum albumin (BSA) Fraction V and AG1478 were from EMD Chemicals Inc (Gibbstown, NJ). AS604872 (Merck Serono) was 202 synthesized at L’Institut de Recherche en Immunologie et en Cancérologie (IRIC, Université de Montréal, Montréal, Canada). PDC113.824 and AS604872 were synthesized by Zamboni Chemical Solutions (McGill University, Montreal, Canada). AL-8810 was from Cayman (Ann Arbor, MI). 125I]-Angiotensin II and 125I]-SBpA were labeled as described in (Speth and Harding, 2000). The IP-One HTRF assay kit was from Cisbio. DNA constructs pIRES-HA-hFP (Goupil et al., 2010), pcDNA3.1--Arr2-mRFP (Zimmerman et al., 2011) and B2R-YFP (Simaan et al., 2005) constructs were used as previously described. To make the Flag-B2R, human B2R was amplified from the pcDNA3- HA-B2R construct (Simaan et al., 2005) using forward primer: 5’- GCCAAGCTTGGTACCATGGACTACAAAGACGATGACGACAAGGTCAC CTTGCAAGGGCCCAC-3’ and reverse primer: 5’- CCTTCATGGTCCGGAACACCAGCA-3’. The PCR fragment was digested with HindIII and BspEI and inserted in pcDNA3-HA-B2R digested with the same enzymes. pECFP-N1-hFP was made from human FP was amplified by PCR from pIRESP-HA-FP (Goupil et al., 2010), using forward primer: 5’- CTGGAATTCATGTCCATGAACAATTCC-3’ and reverse primer 5’- CGGTACCGTCGACTGGGTGCTTGCTGATTTCTC-3’. The PCR fragment was digested with EcoRI and SalI and inserted in pECFP-N1 digested with the same enzymes. The pcDNA3-Flag-AT1R construct was made from human AT1R, containing a signal peptide was amplified by PCR from pRCMV-Flag-hAT1R 203 and flanked by HindIII and XbaI restriction sites in 5’ and 3’ respectively. The PCR fragment was digested HindIII and XbaI and inserted in pcDNA3 vector digested with the same enzymes. The AT1R-YFP construct was made from pcDNA3.1/Zeo(+)-HA-AT1R, amplified by PCR using forward primer: 5’- ACCCAGAAGCTTAAAATGGCCCTTAAC-3’ and reverse primer 5’- TACCGTCGACTCCACCTCAAAACAAGACGCAGG3’. The PCR fragment was digested with HindIII/SalI and inserted in pEYFP-N1 digested with the same enzymes. pcDNA3.1/Zeo(+)-hFP-Venus1 and -hFP-Venus2: human FP was amplified by PCR from pIRESP-HA-FP (Goupil et al., 2010), using forward primer 5’-CAGCACAGTGGCGGCCGCCACCATGTCCATGAACAATTCCA 3’ and reverse primer 5’- GCCACCGCCACCATCGATGGTGCTTGCTGATTTCTC-3’. The PCR was digested with NotI and ClaI and inserted in the pcDNA3.1/Zeo(+)-hVenus1 or pcDNA3.1/Zeo(+)-hVenus2 vectors, digested with the same enzymes. pcDNA3.1(+)AT1R-Venus1 and –AT1R-Venus2 were as described previously (Zhang et al., 2009b). Cell lines Stable HEK 293 cell lines expressing the human FP (FP cells), human AT1R (AT1R cells), or both receptors together (FP/AT1R cells) were generated by transfection with pIRESP-HA-hFP and/or pcDNA3-Flag-hAT1R. Stable lines were selected in 0.7 μg/ml puromycin (FP cells) or 100 g/ml G418 (AT1R cells) or both antibiotics together for FP/AT1R cells. All HEK 293-derived cell lines 204 were grown in DMEM supplemented with 10% (v/v) heat-inactivated FBS and gentamycin (20 µg/ml). Rat aortic vascular smooth muscle cells (VSMC) were a gift from Dr M. Servant (IRIC, Université de Montréal, Canada) and were grown in DMEM/high glucose supplemented with sodium pyruvate, 10% FBS (v/v) and gentamycin. All experiments were conducted on cells at passages 9–16. All cell lines were grown at 37°C in 5% CO2. Immunoprecipitation and western blotting HEK 293 cells expressing HA-FP, Flag-AT1R or both receptors were starved in MEM containing 20 mM HEPES for 30 min at 37°C and stimulated or not with 100 nM PGF2 or Ang II. Cells were then scraped in THG buffer (50 mM HEPES pH 7.4, 1% Triton X-100 (v/v), 10% glycerol (v/v), 50 mM NaCl, 5 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 25 g/ml leupeptin, 2.5 g/ml aprotinin, 1 mM pepstatin) and rocked for 30 min and then centrifuged for 30 min at 14,000 rpm, both at 4°C. 10% of the sample was collected and added to an equal amount of solubilization buffer as total cell lysate. Immunoprecipitation was performed with anti-HA or anti-Flag beads overnight at 4°C. After three washes, immunoprecipitates were detatched from beads with Laemmli buffer (250 mM Tris-HCl pH 6.8, 2% SDS (wt/vol), 10% glycerol (vol/vol), 0.01% bromophenol blue (wt/vol), and 5% -mercaptoethanol (vol/vol)). For ERK1/2 phosphorylation, HEK 293 cells or VSMC were plated in 12-well plates (100,000 cells or 50,000 cells per well) and stimulated according to figure legends. Cells were then solubilized in 150 l (VSMC) or 250 l (HEK 293 205 cells) Laemmli buffer. Samples were loaded on 10% SDS-PAGE gels and transferred to nitrocellulose membranes. After blocking for 1h in 10% milk/PBS- Tween, membranes were probed with the appropriate antibodies in 1% milk (anti- pERK1/2), 1% BSA (anti-total ERK1/2) or 1% milk/1%BSA (anti-HA, Flag, 3978, 3E12). For p-ERK1/2 and tot-ERK1/2 semi-quantitative analysis by densitometry, ImageJ was used. The p-ERK1/2 signal was normalized to tot- ERK1/2 and fold over basal activation was calculated. Ligand binding experiments For competition experiments, cells were plated in poly-L-ornithine-coated 24-well plate at a density of 1x105 (HEK 293 cells) or 7x104 (VSMC) cells per well and grown for 48 (HEK 293 cells) to 72 hrs (VSMC). Cells were then placed on ice and washed once with cold PBS and binding buffer was added (50 mM Tris pH 125 7.4, 5 mM MgCl2, 100 mM NaCl, 0.2% BSA) in the presence of [ I]-Ang II or [3H]-PGF2 and increasing concentrations of cold ligand (PGF2 or Ang II, in half-log increments). To assess allosteric interactions, 1 M PGF2 or Ang II or 10 M L158,809 or AS604872 were used in parallel with both radioligand and cold ligand. Binding was performed overnight at 4°C. The next day, cells were placed on ice and washed three times with cold PBS to remove non-specific binding and solubilised in 0.2 M NaOH for 10 min at room temperature. Radioactivity was quantified using either a -counter ([125I]) or added to 5 ml scintillation liquid and counted in a -counter ([3H]). 206 Photoaffinity labelling AT1R, FP/AT1R cells or VSMC were photolabeled as described previously (Laporte et al., 1996; Servant et al., 1997). Briefly, cells were incubated at room temperature for 90 min with 1 nM [125I]-SBpa in 500 l of binding buffer (50 mM Tris-HCl pH 7.4, 100 mM NaCl, 5 mM MgCl2 and 2 mg/ml BSA with or without cold AngII (1 M). After three washes, cells were resuspended in 500 l of cold binding buffer (pH adjusted at 7.4) and irradiated with UV light (365 nm, black- ray long wave, model B100AP lamp, Thermo-Fisher) for 30 min at 0°C. Cells were recovered, spun down and resuspended in 500 l lysis buffer (50 mM Hepes, 50 mM NaCl, 10% (vol/vol) glycerol, 0.5% (vol/vol) Nonidet P-40, and 2 mM EDTA) containing 1 mM phenylmethylsulfonyl fluoride, 25 g/ml leupeptin, 2.5 g/ml aprotinin, 1 mM pepstatin and lysed for 30 min at 4ºC with gentle rotation. Cell lysates were then spun down at 17,000 x g for 20 min and a sample (50 l) was taken for the total cell lysate. The remaining lysate was subjected to immunoprecipitation with pooled anti-FP (clones 6D12, 7D2, 8E9, 9G3 and 10G10) or anti-platelet activating factor receptor (clone 9H1) monoclonal antibodies overnight at 4°C. Protein G beads were then added for another 2 hrs. After three washes in glycerol buffer, incorporation was quantified using a - counter (Perkin Elmer) and then immunoprecipitates were solubilized in 30 l Laemmli buffer and ran on 10% SDS-PAGE. Gels were dried before autoradiography for 2 (AT1R and FP/AT1R cells) or 14 (VSMC) days on Amersham Hyperfilm ECL. 207 Endocytosis following ligand binding FP, AT1R or FP/AT1R cells were plated in 24-well plates. 48h later, cells were serum-starved for 30 min and stimulated with 100 nM PGF2 or Ang II for an additional 30 min. Cells were put on ice and media was aspirated to stop further stimulation. To remove ligands from cell surface, cells were washed three times for 5 min in 0.1 M sodium citrate pH 3.5 and three times with cold PBS. Binding with [3H]-PGF2 or [125I]-Ang II was performed overnight at 4°C. After three washes on ice with PBS, cells were lysed in 0.2 M NaOH and radioactivity was counted as described above. Confocal microscopy and acceptor photobleaching FRET For confocal microscopy, 48 hrs after transfection, cells were serum-starved for 30 min. Imaging was performed using a Zeiss LSM-510 Meta laser scanning microscope (Carl Zeiss, Thornwood, NY) equipped with XL-3 temperature chamber with a x63 glycerol/water immersion lens. Image acquisition was done in single track mode using 458 nm, 514 nm and 543 nm excitation wavelengths and using BP475-500, BP530-600 and LP560 emission filter sets for CFP, Venus/YFP and mRFP, respectively. For acceptor photobleaching FRET, HEK 293 cells were transfected with the fluorescent donor, FP-CFP, and the acceptors, AT1R-YFP or B2R-YFP. Forty- eight hours after transfection, cells were fixed in 4% paraformaldehyde (PFA), washed three times in PBS and imaging was performed as described above using 208 405 and 514 nm excitation wavelengths and filter sets BP475-500 and 530-600 for CFP and YFP, respectively. To calculate the change in fluorescence in the donor following the acceptor photobleaching, an image of both fluorophores (CFP and YFP) before the experiment (“pre-bleach”) was acquired. The YFP signal was then photobleached, using the 514 nm laser line of the Argon laser at 100% power, with 100 iterations, on a ~50 x 50 pixel region of interest (ROI). A similar, unbleached ROI was used as a reference, negative control. An image of both fluorophores was taken immediately after photobleaching (“post-bleach”). To calculate the effect of YFP photobleaching on CFP fluorescence, which is representative of the FRET between CFP and YFP, the following calculation was made on the photobleached and non-photobleached (control) ROI: FRET efficiency = [(Dpost-backpost)-(Dpre-backpre)]/ (Dpost-backpost) x 100, where D is the donor, “back” is a background ROI and “pre” and “post” refer to the pre- and post-bleach images. IP1 production assay VSMC were grown in 10cm dishes for 24 h. Then, cells were starved without serum. The next day, cells were washed once with PBS and collected in PBS-20 mM EDTA. For the assay, 104 cells per well (384-well plate) were used. Cells were first pre-treated for 30 min at 37C with vehicle, 20 M L158,809, or 10 M AL-8810 or AS604872. Cells were then treated with increasing concentrations of PGF2 or AngII for 60 min at 37C. IP1-d2 and anti–IP1-cryptate were added for 209 an additional two hours at room temperature. Plates were read on a Synergy 2 multimode microplate reader. Cellular hypertrophy measurements VSMC were plated in 24-well plates at a density of 15,000 cells/well in triplicates. The next day, cells were starved without serum for 24 hrs and then pre- treated or not for 30 min (see figure legends) and stimulated with 10 nM PGF2 or Ang II for an additional 24 hrs. The last 8 hrs of stimulation, 1 Ci of 3H]- thymidine (to measure DNA synthesis) and 3H]-leucine (to measure protein synthesis) were added per well. At the end of the stimulation period, cells were put on ice and washed once with PBS and then incubated for 15 min in 5% trichloroacetic acid. NaOH 0.2M was then added to lyse the cells and the incorporated radioactivity was counted using a -counter after addition of scintillation fluid. A 3H]-leucine/3H]-thymidine ratio greater than one was treated as a measure of cell hypertrophy. For visualization of VSMC hypertrophy by microscopy, cells were also pre-treated/treated as described above, in 12-well plates. Following stimulation, cells were fixed with 4% PFA and after four PBS washes, cells were blocked and permeabilized with PBS/2%BSA/0.05% Triton- X-100 for 20 min. Phalloidin coupled to Alexa488 was added during the secondary antibody incubation (goat-anti-mouse-Alexa568). Hoescht stain was added the last 15 min of secondary antibody incubation. After three PBS washes, staining was visualized using a LSM510 Zeiss confocal microscope using 405 and 210 488 nm excitation wavelengths and emission filters for Hoescht and phalloidin, respectively. Vessel contractility experiments Vessel constriction was studied ex vivo as described previously (Thorin, 1998). Segments of the abdominal aorta (2 mm in length) isolated from 3 m/o C57Bl/6J mice mounted on 20-µm tungsten wires in small vessel myographs, stretched to optimal tension and maintained in physiological saline solution (PSS: NaCl, 130 mM; KCl, 4.7 mM; KH2PO4, 1.18 mM; MgSO4, 1.17 mM; NaHCO3, 1.17 mM; CaCl2, 1.6 mM; EDTA, 0.023 mM; glucose, 10 mM; aerated with 12% O2/5% CO2/83% N2; pH 7.4) at 37°C. After a 40-min stabilization period, arterial segments were challenged with 40-mM KCl PSS (KCl was substituted for an equivalent concentration of NaCl). Single cumulative concentration-response curves to Ang II (0.1 nM to 0.3 µM) and PGF2α (01 µM to 30 µM) were obtained from independent segments. To determine the impact of activation of FP on Ang II-dependent contraction, segments were pre-incubated with a threshold constricting concentration of PGF2α (1 µM) followed 20 min later by a dose- response curve to Ang II. To then assess whether antagonist occupancy of FP could modulate Ang II-induced contraction, arterial segments were pre-incubated with AS604872 (1 µM) or AL-8810 (10µM), followed 20 min later by a dose- response curve to Ang II. Finally, to assess whether the occupation of AT1 receptors altered PGF2α-induced contraction, arterial segments were pre- incubated with the AT1 receptor antagonist L-158,809 (1 µM) followed 20 min later by a dose-response curve to PGF2α. At the end of each protocol, the 211 maximal tension (Emax) was determined by changing the PSS to a solution containing 127 mM KCl. The data are expressed as percentages of Emax. Data analysis All graphs are represented as the mean value ± SEM. Intensity of the signals from Western blots and FRET experiments was determined by densitometric analysis with ImageJ. Statistical analysis was performed with GraphPad Prism software with one- or two-way analysis of variance (ANOVA) when appropriate, with Bonferroni (comparison between all groups) or Dunnett’s (comparison to control) post hoc tests. A two-tailed p-value lower than 0.05 was considered significant. 212 4.5 Results 4.5.1 FP and AT1R form heterodimers in heterologous and native contexts. To initially assess whether FP and AT1R could heterodimerize, we transfected both receptors, alone or together, into HEK 293 cells and carried out co-immunoprecipitation experiments. As shown in Figure 4.1A, Flag-AT1R was pulled down with HA-FP after immunoprecipitation with anti-HA antibodies (lane 2), under basal conditions, when the cells were not stimulated by ligands for either receptor. A complementary result was obtained in that HA-FP was also co- immunoprecipitated with Flag-AT1R (Figure 4.1A, lane 5). However, HA-FP was not associated with another Flag-tagged vasoactive receptor, the bradykinin (BK) type 2 receptor (B2R) (Figure 4.1A, lanes 3 and 7), suggesting FP and AT1R interact to form a heterodimer. To confirm these observations, we next used acceptor photobleaching fluorescence resonance energy transfer (FRET), to detect the FP/AT1R dimer in living cells (Figure 4.1B). In this paradigm, when FRET occurs between fluorescent donor and acceptor, both fluorescent proteins fused to the receptors of interest, photobleaching of the acceptor result in an increase in donor fluorescence ((Gu et al., 2004), see Materials and Methods for details). We therefore generated a CFP-tagged FP construct as a FRET donor and YFP-tagged AT1R or B2R as potential FRET acceptors. As expected, when FP-CFP was co-transfected with 213 AT1R-YFP in HEK 293 cells, photobleaching of AT1R-YFP led to a strong increase (~20%) in FP-CFP fluorescence as measured by FRET efficiency, whereas there was no increase in the reference control (i.e. non-bleached) regions (Figure 4.1B, black bars). Again, FP-CFP did not associate with B2R-YFP, as there was no change in FP-CFP fluorescence following B2R-YFP photobleaching (Figure 4.1B, white bars). Next, we wanted to assess if the FP/AT1R dimer was present in a relevant physiological context with endogenously expressed receptors. To do so, we used vascular smooth muscle cells (VSMC), initially isolated from rat aorta, as they are known to express both FP (Dorn et al., 1992) and AT1R (de Gasparo et al., 2000b). Because of the lack of good antibodies to immuneprecipitate and to detect AT1R, we resorted to use a radiolabeled, photoreactive AngII analog, [125I]-Sar1- p-benzoyl-L-phenylalanine8(Bpa)-AngII (hereafter referred to [125I]-SBpa, (Laporte et al., 1996; Servant et al., 1997)), that can be covently link to AT1R (see Materials and Methods for details) and to mark endogenous AT1R in VSMCs. To ascertain that we detected the FP/AT1R dimer, we first tested [125I]- SBpa crosslinking to AT1R in HEK 293 cells stably expressing HA-FP and Flag- AT1R. [125I]-SBpa binding was detected, in both Flag-AT1R and HA-FP immunoprecipitates (Suppl. Figure 4.1A), suggesting again that the heterodimer could be detected in HEK 293 cells. Based on densitometric quantification of these experiments, we estimated the dimer ratio to be 1 FP/AT1R dimer: 20 AT1R, although we assume here that the affinity for the ligand remained similar under both conditions. 214 We next covalently linked [125I]-SBpa to AT1R endogenously expressed in VSMC, again by photoreactive crosslinking. First, we pulled down FP using anti-FP mouse monoclonal antibodies we have previously generated and characterized (Goupil et al., 2010) as a prelude to detection of radioligand-bound AT1R. As shown in Figure 4.1C (left panel), FP was pulled down from VSMC, using our anti-FP antibodies, as well as in FP cells, but not naïve HEK 293 cells. Importantly, a significant amount of [125I]-SBpa bound to AT1R was pulled down with FP following its immunoprecipitation in VSMC, showing the formation of a dimer between FP and AT1R (Figure 4.1D). This interaction was specific, since 1) it was displaceable by an excess of cold Ang II and 2) a control monoclonal antibody raised against another GPCR (anti-platelet activating factor receptor, PAFR) did not immunoprecipitate any [125I]-SBpa (Figure 4.1D). 4.5.2 FP/AT1R dimerization alters binding properties of both receptors. Many heterodimers have been shown to modulate the binding of endogenous ligands between the two protomers (Gomes et al., 2000; Lavoie and Hebert, 2003; Rocheville et al., 2000; Rozenfeld and Devi, 2010). To further characterize the properties of the putative FP/AT1 dimer, we performed competitive binding studies to determine the half maximal inhibitory binding concentration (Ki) of each receptor agonist, under various conditions (summarized in Table 1). First, we examined [3H]-PGF2 binding to FP in either FP or FP/AT1R cells. When expressed alone, the Ki for PGF2 on FP was of 4.79 215 0.68 nM. Interestingly, the presence of AT1R (unoccupied by ligand) was sufficient to increase the affinity of FP for PGF2e.g. reduce the Ki) to 1.85 0.31 nM (Figure 4.2A). In contrast, [125I]-Ang II binding to AT1R was not affected by its association with FP (Ki of 2.84 0.81 nM for AT1R alone and 1.32 0.25 nM when FP was present, Figure 4.2B). Next, we examined the effect of occupying one protomer of the FP/AT1R dimer on radioligand binding to the other protomer. When AT1R was bound by Ang II or an AT1R antagonist, L158,809, the Ki for PGF2 on FP remained similar (1.93 0.88 and 1.63 0.52 nM, respectively, Figure 4.2C). These results confirmed that the presence of AT1R alone was sufficient to modulate PGF2 binding to FP and that this was not altered by ligand occupancy of the AT1R. On the other hand, [125I]-Ang II binding to AT1R was altered by either antagonist (AS604872) or agonist (PGF2 occupation of FP, increasing the affinity of AT1R for Ang II from 2.84 0.81 to 0.47 0.18 and 1.54 0.79 nM (Figure 4.2D). Taken together, these results suggest that FP/AT1R dimers have distinct binding properties from either receptor expressed alone; these results also highlight a functional asymmetry in the allosteric regulation of the ligand’s binding within receptor heterodimer, demonstrating distinct functions of ligand occupancy to the partner receptor, in some cases ligand-dependent and in some not. 216 4.5.3 FP internalizes when heterodimerized with AT1R We have previously shown that FP neither recruits, nor internalizes in association with -arrestin following PGF2 stimulation (Goupil et al., 2012b). Here, as before, PGF2 stimulation did not trigger recruitment to, nor receptor endocytosis with -arr2-mCherry and the complex trafficking into endosomes (Suppl. Figure 4.2A and C) ruling out either -arrestin-dependent or -independent internalization of FP. Next, to assess whether FP could be internalized in the context of a heterodimer with AT1R, we co-expressed FP-CFP and AT1R-YFP with -arr2-mRFP in HEK 293 cells. As expected, AT1R-YFP expressed alone recruited and endocytosed with -arr1/2 into endosomes in response to Ang II stimulation (Suppl. Figure 4.2B and C). Stimulation of the FP-CFP/AT1R-YFP dimer with Ang II also led to strong internalization of both protomers with -arr2- mRFP (Suppl. Figure 4.3B). On the other hand, although PGF2 stimulation also led to internalization of FP and AT1R to a lesser extent, there was almost no - arr2 co-localization (Suppl. Figure 4.3A). Similar results were obtained by co- immunoprecipitation of -arr1/2 with HA-FP or Flag-AT1R (Figure 4.3E). When both receptors were expressed in HEK 293 cells, endogenous -arr1/2 was strongly recruited to Flag-AT1R after Ang II (Figure 4.3E, lane 6), but not PGF2 stimulation (Figure 4.3C, lane 5). Further, almost no -arr1/2 was co- immunoprecipitated with HA-FP when Flag-AT1R was present and either receptor was stimulated (Figure 4.3E, lane 2 and 3). This suggested that the heterodimer exhibited a trafficking pattern that was distinct from either parent 217 receptor. To confirm this, we next used a protein fragment complementation strategy to generate a pool of FP/AT1R dimers which could be followed directly. FP was tagged with the N-terminal moiety of the YFP Venus and AT1R with the C-terminal moiety, reconstituting the YFP fluorescence in HEK 293 cells. These split-Venus-tagged receptors were functional (Suppl. Figure 4.3E and (Zhang et al., 2009b)). When both receptors were co-expressed, the Venus protein was reconstituted and the YFP signal could be detected using confocal microscopy (Figure 4.3 A-D). Concurrent with our previous data, -arr2-mRFP recruitment to the Venus-dimer was almost absent when the latter was stimulated with PGF2 (Figure 4.3A), even though dimer endocytosis was evident. AngII stimulation of the Venus-dimer again led to -arr2-mRFP recruitment, as seen with non- complemented proteins (Suppl. Figure 4.3B). This confirmed the distinct trafficking pattern of the heterodimer and also suggested that heterodimeric GPCRs might adopt distinct trafficking patterns depending on how they are stimulated, another type of functional selectivity. Returning to the notion that each receptor can allosterically modulate the other, we then assessed if occupancy of FP and AT1R by their respective antagonists could lead to alterations in heterodimer internalization dynamics. Interestingly, when AT1R was occupied by L158,809, recruitment of -arrestins to HA-FP was increased compared to unoccupied AT1R (Figure 4.3C, merge inset). However, no differences were observed when FP was occupied by AS604872 on AT1R-induced -arrestin recruitment (Figure 4.3D). We again used radioligand binding to detect internalization of cell surface receptors in a more 218 quantitative manner. These studies allowed us to follow the loss of receptors from the cell surface, representative of GPCR internalization. AT1R behaved as expected (Gaborik et al., 2001; Laporte et al., 1996), with a loss of approximately 75% of surface binding after 30 min stimulation with Ang II (Figure 4.3F, white bars). Co-expression of FP did not modify this, as Ang II was equally able to induce internalization of AT1R (Figure 4.3F, black bars). Concordant with the imaging data, PGF2-induced internalization of approximately 15% of AT1R (Figure 4.3F, black bars). When expressed alone and stimulated by PGF2, [3H]- PGF2 binding to FP increased at the plasma membrane (Figure 4.3G, white bars), either suggesting recruitment of receptors from an intracellular pool or perhaps a change in ligand binding affinity. This increase in bound radioligand was abrogated when AT1R was co-expressed with FP (Figure 4.3G, black bars), again reflecting allosteric interactions between the two receptors. Ang II stimulation induced a slight decrease in [3H]-PGF2 surface binding, approximately 10% internalization of FP, presumably only the fraction coupled to AT1R (Figure 4.3G, black bars). To confirm the specificity of these effects, we performed confocal microscopy or ligand binding studies on FP in the presence of B2R. B2R did not induce internalization of FP when co-expressed, whether stimulated by PGF2 or BK, as assessed by confocal microscopy (Suppl. Figure 4.3C, D) or ligand binding (Suppl. Figure 4.3F, G). Reciprocally, stimulation of FP by PGF2 did not induce B2R endocytosis (Suppl. Figure 4.3D and F), whereas BK did (Suppl. 219 Figs. 3E and F). Taken together, these results suggest once again that AT1R is a specific allosteric partner for FP. 4.5.4 Allosteric modulation of FP and AT1R signalling. VSMC are critical actors in the regulation of blood vessel contraction and relaxation, important in the control of blood pressure (Rensen et al., 2007). It has been shown that VSMC endogenously express both FP and AT1R. However, the involvement of a putative heterodimer of the two receptors, on receptor signalling through either receptor had not been assessed. We pre-treated VSMC with L158,809, and then stimulated them for different times with PGF2. Our results show that PGF2-induced ERK1/2 activation was potentiated when AT1R is occupied by the antagonist L158,809 (Figure 4.4A), an effect that can only be explained by allosteric interactions between the two receptors, since L158,809 does not activate second messenger-regulated protein kinases that may modulate FP signalling (Suppl. Fig. 4.5). In contrast, Ang II-induced ERK1/2 activation was slightly reduced by pretreatment with the FP antagonist AS604872 (Figure 4.4B), again highlighting the asymmetry between protomers of the FP/AT1R dimer. MAPK activation was also completely abrogated in Ang II- or PGF2- stimulated VSMC when pre-treated with L158,809 (Figure 4.4A) or AS604872, respectively (Figure 4.4B), demonstrating the specificity of these antagonists for their cognate receptors. 220 We and others have previously shown that Gq/PKC activation was the major pathway leading to ERK1/2 activation by FP in HEK 293 cells (Goupil et al., 2010). To understand the mechanism behind L158,809-mediated potentiation of MAPK downstream of FP, we used Go6983, a pan-PKC inhibitor and assessed the extent to which PGF2- and AngII could still activate ERK1/2 in VSMC. We found that unlike heterologously transfected FP cells, less than 10% or the p- ERK1/2 signal in VSMC was inhibited by Go6983 pre-treatment (Suppl. Figure 4.4A). Similar results were obtained for Ang II-mediated p-ERK1/2 activation (Suppl. Figure 4.4A). GPCRs can also activate ERK1/2 via routes distinct from canonical G protein-mediated pathways, such as -arrestin scaffolding (Daaka et al., 1998; Tohgo et al., 2003; Tohgo et al., 2002), Src kinase activation (Dikic et al., 1996) or receptor tyrosine kinase transactivation (Pierce et al., 1999). More recently, we demonstrated that AL-8810, initially characterized as an orthosteric antagonist for FP, was shown to bias FP signalling towards epidermal growth factor receptor (EGFR) transactivation, leading to ERK1/2 activation. Moreover, many cell lines which endogenously express FP use this mechanism to activate MAPK (Ahmed et al., 2003; Sales et al., 2005). To assess the involvement of EGFR in PGF2-induced ERK1/2 activation in VSMC, we used the EGFR inhibitor AG-1478. ERK1/2 activation by PGF2 and Ang II was inhibited by more than 90% and 50% respectively, following pre-treatment with the EGFR inhibitor AG-1478 (Suppl. Figure 4.4B). Moreover, L158,809-mediated potentiation of PGF2-induced ERK1/2 activation was also abrogated in the presence of AG-1478 (Figure 4.4D), whereas Go6983 had no effect (Figure 4.4C). 221 These data confirm that AT1R-mediated functional selectivity on FP towards the ERK pathway is via EGFR-transactivation. As mentioned above, in HEK 293 cells, PGF2 and Ang II activate ERK1/2 through the canonical Gq/PKC pathway. Since our VSMC did not go primarily through this canonical pathway to activate MAPK, we verified the extent to which L158,809 or AS604872 could modulate PGF2- or Ang II- mediated G protein-dependent pathways in VSMC. To do so, we measured inositol-1-phosphate (IP1) production, a downstream effector of the Gq. Interestingly, PGF2- and AngII-mediated IP1 production was inhibited by L158,809 (Figure 4.4E) or AS604872 and AL-8810 (Figure 4.4F), respectively. These results suggest that AT1R, through L158,809 binding, can induce functional selectivity to FP-mediated pathways in VSMC. To our knowledge, these results represent the first demonstration that AT1R can modulate FP downstream signalling in an endogenous context. We next assessed if FP and AT1R signalling responses were affected by their dimer partners. When co-expressed with AT1R, FP-induced ERK1/2 activation was diminished by approximately 30% (Figure 4.5A). Interestingly the presence of FP had the opposite effect on AT1R-induced ERK1/2 activation, leading to a ~40% increase in the p-ERK1/2 signal (Figure 4.5B), showing that the balance of MAPK activation when FP and AT1R are in a dimeric form may be regulated by the extent of dual occupancy. We have previously shown that PDC113.824 (PDC), an allosteric modulator of FP, potentiated PGF2-induced ERK1/2 activation (Goupil et al., 2010). To assess if this allosteric modulation of 222 FP was affected by dimerization with AT1R, we pre-treated FP/AT1R cells with PDC and assessed changes in PGF2- or Ang II-induced ERK1/2 activation. Single receptor-expressing FP and AT1R cells were used as positive and negative controls, respectively. As expected, FP expressed alone was affected by PDC as previously demonstrated (Suppl. Figure 4.5C), whereas PDC had no effect on Ang II-induced ERK1/2 activation when AT1R was expressed alone (Suppl. Figure 4.5E). PDC potentiation of ERK1/2 activation was also observed in PGF2-treated FP/AT1R cells, to a similar extent to that observed with FP expressed alone (Suppl Figure 4.5D). However, PDC had no effect on Ang II- induced ERK1/2 activation when both receptors were present (Suppl. Figure 4.5E). Again, these results suggest that FP and AT1R can reciprocally, but asymmetrically regulate their downstream signalling outputs. 4.5.5 Antagonism of FP inhibits AngII-induced cellular hypertrophy in VSMC. As shown in Figure 4.4, PGF2-induced ERK1/2 activation in VSMC was affected by an AT1R antagonist, L158,809. Next, we wanted to determine if other FP or AT1R-mediated physiological responses were affected by allosteric effects occurring within the FP/AT1R heterodimer. One common response to hypertension in vivo is VSMC hypertrophy (Braun-Dullaeus et al., 1999). Cellular hypertrophy is characterised by an increase in cell size and protein content, without a concomitant increase in cell number (Berk, 2001). In order to determine 223 the extent of VSMC hypertrophy after stimulation of the FP/AT1R heterodimer, we used [3H]-thymidine incorporation as a marker of DNA synthesis (indicative of proliferation), and [3H]-leucine incorporation as a marker of protein synthesis. First, VSMC were pre-treated with L158,809 to determine whether [3H]- thymidine incorporation was potentiated following PGF2 stimulation. As shown in Figure 4.6A, PGF2 alone elicited a small increase in [3H]-thymidine, which could be inhibited by AS604872, the FP antagonist, but not by L158,809 pre- treatment (Figure 4.6A). Similar results were obtained with [3H]-leucine incorporation, although here pre-treatment with L158,809 had a slight potentiating effect on PGF2-induced protein synthesis (Figure 4.6B). Interestingly, AS604872 was as potent as L158,809 in inhibiting Ang II-induced [3H]-thymidine and [3H]-leucine incorporation (Figs. 6A and B), showing again the striking asymmetry in the regulation of cellular responses mediated by the receptor heterodimer. Finally, we calculated the ratio [3H]-thymidine/[3H]-leucine incorporation, which can be used as an index of hypertrophy (Braun-Dullaeus et al., 1999). As seen in Figure 4.6C, L158,809 did not alter PGF2-induced cellular hypertrophy, whereas AS604872 pre-treatment prevented it in Ang II-induced VSMC. Moreover, both PGF2-and Ang II-induced hypertrophy was inhibited by AG-1478 pre-treatment (Figure 4.6F and G), showing the importance of receptor- mediated transactivation of EGFR in FP and AT1R signalling in the regulation of cellular hypertrophy. More importantly, blockade of EGFR activation was sufficient to ablate AS604872-mediated inhibition of Ang II-induced hypertrophy, 224 suggesting that AS604872-occupied FP uses this pathway to alter AT1R signalling (Figure 4.6G). To confirm that the increase in de novo protein synthesis ([3H]-leucine incorporation) was accompanied by an increase in cell size, we labelled confluent VSMC with an actin marker (phalloidin-Alexa488) and a nuclear marker (Hoescht), following stimulation with the different FP and AT1R ligands. We confirmed the data generated in Figure 4.6C where we calculated the hypertrophy index, where the cellular size, as quantified by the ratio of cell size in proportion to nuclear size (Cavalier-Smith, 2005), was increased in both PGF2 and Ang II- stimulated VSMC (Figure 4.6D quantification and E, see top row). Moreover, as observed previously, L158,809 had no significant effect on PGF2-induced hypertrophy but AS604872 abolished the Ang II-mediated increase in cell size (Figure 4.6D quantification and E, middle and bottom rows, respectively). 4.5.6 Abdominal aorta contractile responses to AngII are modulated by FP occupancy. In order to determine the involvement of the FP/AT1R heterodimer on a second, but distinct physiological response mediated by both receptors, we next examined abdominal aorta contraction ex vivo. Stimulation of FP with increasing concentrations of PGF2 led to a dose-dependent increase in vasoconstriction (as shown by the % of maximal contraction mediated by 40 mM KPSS, or Emax, Figure 4.7A), which was positively modulated by AngII. A similar potentiation of 225 Ang II-mediated contraction by PGF2 was also detected (Figure 4.7B). This result could indicate an allosteric interaction between the two receptors in the context of a heterodimer, or it may represent some sort of priming event mediated by molecular crosstalk between the two receptors via the activation of second messenger-dependent protein kinases such as PKC. However, antagonist occupation of the dimer partner, should not, in principle lead to second messenger production and thus effects here more likely reflect a similar allosterism that we detected for ERK signalling. Our results indicate that occupation of FP with either AS604872 or AL-8810 reduced contraction mediated by Ang II (Figure 4.7B) Interestingly, FP-mediated vasoconstriction, in contrast to our results observed for ERK1/2 activation or cellular hypertrophy, was partially inhibited in the presence of L158,809, suggesting a transactivation-independent mechanism of action. This is consistent with contractility being dependent of Gq-mediated release of calcium rather than activation of ERK1/2. Taken together, these data demonstrate that the allosteric asymmetry between FP and AT1R manifests differently depending on the physiological outcome measured and the relevant downstream signalling pathways. 226 4.6 Discussion In the present work, we demonstrated for the first time, with multiple independent approaches that FP and AT1R formed a heterodimer in both heterologous and endogenous contexts. We showed that the affinity of an orthosteric ligand for its receptor could be allosterically modulated by the presence of a dimeric partner, occupied or not. The FP/AT1R dimer exhibited distinct signalling patterns from either FP or AT1R expressed alone. These responses were differentially modulated when the receptors were unoccupied, agonist- or antagonist-occupied, suggesting that the dimer itself can adopt multiple conformations. Finally, we underscored the physiological importance of this dimer through the mutual effects of both receptors on VSMC hypertrophy and vessel contractility. Taken together, our results suggest that allosteric communication occurs between FP and AT1R, and that is translated into distinct physiological outcomes depending on the downstream molecular pathways involved. We observed that L158,809, the AT1R antagonist, potentiated PGF2- induced ERK1/2 and cellular hypertrophy in VSMC via a EGFR transactivation mechanism. Interestingly, L158,809 did not change the fold activation of PGF2- activated ERK1/2 in FP cells (data not shown). This could be related to the fact than more than 90% of the ERK1/2 signal, in these latter cells, comes via activation of the Gq-PKC pathway (Fujino et al., 2000; Goupil et al., 2010). 227 Moreover, in VSMC, PGF2-mediated IP1 production, a Gq-dependent second messenger, was decreased when cells were pretreated with L158,809. These results are consistent with L158,809-mediated inhibition of arterial contraction in the presence of increasing concentrations of PGF2, which is likely Gq- dependent. Our data suggest that AT1R, when engaged with L158,809, biases FP signalling, potentiating transactivation of EGFR and ERK in VSMC while simultaneously inhibiting signalling via Gq. Another FP orthosteric ligand, AL- 8810, in contrast to PGF2, has been shown to transactivate EGFR in FP cells (Chapter 2, (Goupil et al., 2012b)). This suggests that in a cellular context where FP and AT1R form heterodimers, AL-8810-mediated ERK1/2 activation cells may be positively affected by L158,809 as well. Interestingly, AL-8810 has the same effect as AS604872 on vessel contractility in that when it occupied FP, it blocked Ang II-mediated arterial constriction. It is clear that the cellular context and the available signalling partners are critical determinants of outcomes of single and dual ligand occupancy in the heterodimer context. GPCR homo- or heterodimerization has also been shown to alter patterns of receptor endocytosis (Cvejic and Devi, 1997; Lavoie et al., 2002; Pfeiffer et al., 2002). Many GPCRs, who cannot undergo endocytosis on their own, do so in the presence of a heterodimer partner. A classical example is the -opioid receptor, unable to internalize alone, but is in the presence of the 2-adrenergic receptor (Jordan et al., 2001). As shown previously, human FP does not internalize or for that matter, recruit -arr to mediate receptor desensitization (Goupil et al., 2012b). However, in the presence of AT1R, FP internalized, but also failed to strongly 228 recruit -arrestin, even when pure populations of FP/AT1R heterodimers were followed using protein fragment complementation assays, suggesting that the heterodimer adopts a unique trafficking itinerary, distinct from either of the parent receptors. Moreover, -arr2-mRFP recruitment to FP was enhanced in the presence of L158,809, suggesting that it drives the AT1R and thus the FP/AT1R complex into a conformation that facilitate FP-mediated recruitment of -arrestin. It remains to be seen whether FP also oligomerizes with other receptor partners, increasing the “conformational” diversity of its ligands. How these different, conformationally driven trafficking patterns translate into signalling outcomes would be an interesting area for future study. Over the years, our definitions of GPCR allostery have been expanded and diversified. Ligands are not the only receptors’ modulators (Kenakin and Miller, 2010). It is well established now that receptor dimerization can cause a change in conformation within the dimer, responsible for altered responses downstream (Vilardaga et al., 2008b). Importantly, a recent study has shown that the two- receptor equivalents in the context of a D2 dopamine receptor (D2R) homodimer are organized asymmetrically with respect to their G protein partners (Han et al., 2009) such that occupation of one receptor activates the receptor to facilitate downstream signalling and occupation of the other modulates signalling allosterically without inducing a signal of its own. This has tremendous implications for the formation of receptor heterodimers, in that multiple asymmetrical arrangements become possible depending on the relative orientation of each monomer to the G protein and possibly effector molecules. This greatly 229 increases the potential organizational complexity of GPCR signalling and suggests that determinants of signalling complex assembly will be of paramount importance in initially defining signalling specificity in a given tissue, cellular or subcellular compartment. Further, it suggests perhaps why heterodimers may have been difficult to detect in vivo since one receptor might in fact be silent with respect to signalling and thus missed in standard drug screens. That arrangement can be reversed if the complex is assembled or arranged differently- i.e. even with the same set of interacting partners, signalling output will be quite distinct. Here, we characterized the reciprocity of allosteric interactions between FP and AT1R. These allosteric interactions were asymmetrical, but surprisingly, this depended on the outcome we measured. The conformation adopted when AT1R is bound to an antagonist (e.g. L158,809) and FP is bound to PGF2 triggered a specific arrangement of the signalling unit responsible for a subset of signalling pathways. A number of studies have illustrated asymmetric cross-talk between the protomers of a dimer leading to cis- or trans-allosteric regulation, showing that each units in a dimer has its own responsibility (Han et al., 2009; Maurice et al., 2010; Sohy et al., 2007; Vilardaga et al., 2008a). Our results showed an asymmetrical allostery between FP and AT1R for non-canonical pathways, such as receptor tyrosine kinase transactivation. However, for the canonical Gq pathway regulated by FP and AT1R, symmetrical modulation was observed, suggesting again that GPCR allostery can be pathway-selective. Binding of orthosteric ligands to a heterodimer always leads to allostery (Milligan and Smith, 2007). Dimer-induced changes in binding at partner 230 receptors is analagous to conformational changes induced in the presence of a GTP- or GDP bound G protein (Goupil et al., 2012a). Our data shows that unoccupied AT1R alone was sufficient to alter the affinity of PGF2 for FP, a situation previously observed for somatostatin binding to SSTR5 for SST in the presence of D2R (Rocheville et al., 2000). In contrast, only ligand-occupied FP had effects on Ang II binding to AT1R. Such results have been previously observed for the /-opioid receptor (Gomes et al., 2000) or 1AR/2AR heterodimers (Lavoie and Hebert, 2003) where occupancy of one protomer altered the affinity for subtype-selective ligands of the other. A change in the dissociation kinetics of radioligand binding to a receptor is a hallmark of allosteric modulation (Christopoulos et al., 2004; Goupil et al., 2010). Indeed, only a change in receptor conformation in the assessed receptor can explain the change in dissociation kinetics. Therefore, the effects observed in our dissociation kinetics studies suggest that FP and AT1R can only regulate one another by a change in conformation, leading to an allosteric effect within the dimer. We demonstrated that PGF2 had increased affinity for the FP/AT1R dimer compared to FP alone, although the ERK signalling response noted for FP/AT1R was attenuated compared to FP. Further, formation of the FP/AT1R dimer resulted in the opposite effect for Ang II-mediated ERK1/2 activation. Since the canonical pathway in HEK 293 cells for activation of ERK1/2 is via Gq coupling, our results suggest that Gq couples better to AT1R than FP, when they are in a dimeric form. Asymmetry in the context of GPCR heterodimers can be viewed in multiple ways- either structural, functional or a combination of the 231 two. As discussed above, the notion of structural asymmetry stems from the fact that in a receptor homodimer, which receptor “talks” to the G protein, depends on its relevant orientation with respect to its G protein partner (Han et al., 2009). These authors showed that one receptor protomer of the D2 dopamine receptor interacts with G protein with intracellular loops 2 and 3 while the other interacts via loop 3 exclusively. This physical asymmetry leads to an asymmetry in signalling output as well in that agonist binding to one protomer engages the signalling machinery while agonist binding to the second provides a negative allosteric signal. Interestingly, occupation of the second protomer with an inverse agonist while the first is occupied by agonist results in increased signalling (Han et al., 2009). If this asymmetry holds true for GPCR heterodimers in general, than the consequences for cellular signalling will be important- i.e. in a heterodimer there are two distinct orthosteric ligand-binding sites. Thus, depending on the asymmetry with respect to the assembly with the G protein and possibly effector partners, one of the ligands might activate the receptor, while the second distinct ligand binding to its partner could act as an allosteric modulator. Functional asymmetry can be defined as differences in signalling mediated by a receptor heterodimer, where occupancy of one receptor alters signalling via the other and this relationship may differ depending on how the receptors are stimulated. This type of organization might also play out in a pathway-, cell- or tissue-specific fashion. Taken logically, these dimer partners would be silent in single ligand screens used to develop drugs for individual GPCRs. However, they would not be “silent” in vivo and these allosteric effects in the heterodimer context may be responsible for many off-target effects. An example would be that the AT1R 232 antagonist, L158,809, strongly potentiates FP signalling to the ERK pathway which may be involved in hypertrophy of VSMC. This may suggest that some of the effects of AT1R blockers used to treat heart failure and hypertension, might actually be caused by allosteric effects on FP. More importantly, our data suggest that the change in ligand affinity for a cognate receptor is not necessarily proportional to the responses downstream. This may also explain why the FP allosteric modulator, PDC113.824, a positive allosteric modulator (PAM) for Gq- mediated activation of ERK1/2, had the same effect on PGF2-mediated ERK1/2 in FP/AT1R and FP cells. Also, the increase in Ang II-mediated ERK1/2 activation in FP/AT1R cells compared to AT1R cells suggests that PDC effects on FP are not transmitted to AT1R through the dimer interface, at least for ERK signalling. The present study establishes for the first time the consequences of FP and AT1R dimerization on AT1R- and FP-mediated cellular signalling and physiological events. AT1R-mediated responses, such as DNA and protein synthesis or cellular hypertrophy were inhibited by AS604872, the FP antagonist. Interestingly, L158,809, the AT1R antagonist, had no effect on these responses regulated by FP, showing again an asymmetry within the dimer. Ang II-mediated cellular hypertrophy has been shown to lead to blood vessel thickening via reorganization of the cytoskeleton, a response exacerbated when a misbalance of the RAAS occurs. Our studies in VSMC suggest that FP ligands might be useful as a means allosterically regulate AT1R signalling in hypertension. In addition, the recent study by Yu et al. shows that the pressor effect of AngII is greatly 233 augmented in FP-/- mice, suggesting that FP normally restrains AT1R signalling in this regard (Yu et al., 2009). Moreover, the unique signalling signature of the FP/AT1R dimer we observed using the different ligand combinations might be responsible for some of the observed side effects in patients treated with angiotensin receptor blockers (ARBs), such as L158,809, a losartan derivative. Recent studies have stressed the importance of developing better AT1R-biased ligands to control its responses by functional selectivity. However, the implication of AT1R dimerization with FP, or other GPCRs and the modulation of its signals by FP ligands, should be taken into consideration as interesting new therapeutic modality. The use of AT1R blockers to treat hypertension and a parallel therapy with FP ligands to regulate Ang II-induced physiological and pathophysiological responses in the RAAS might be considered. 234 4.7 Acknowledgements We thank Dr. H. Uri Saragovi (McGill University) for the FP antibodies. This study was supported by a Canadian Institutes of Health Research (CIHR) Team Grant in GPCR Allosteric Regulation [CTiGAR, CTP 79848], in which both T.E.H. and S.A.L are both co-investigators, and CIHR grants to T.E.H. (CIHR; MOP-36379) and S.A.L [PRG-82673 and MOP-74603]. T.E.H. is a Chercheur National of the “Fonds de la Recherche en Santé du Québec”(FRSQ). S.A.L. was supported by a Canada Research Chair in Molecular Endocrinology, and now by a “Chercheur Senior” scholarship from FRSQ. 4.8 Author contributions E.G., S.A.L. and T.E.H. designed the study. E.G., X.L. and S.C. performed experiments. E.G., X.L., E.T., S.A.L. and T.E.H. analyzed the data. E.G and X.L. generated the figures. E.G., E.T., S.A.L. and T.E.H wrote the paper. D.P. generated AT1R-Venus1/2 constructs and assisted with FP-Venus1/2 construct design. 235 4.9 Figures for Chapter 4 Figure 4. 1 FP and AT1R form heterodimers in HEK 293 cells and VSMC. A) Co-immunoprecipitation in HEK 293 cells expressing HA-FP alone, Flag- AT1R alone, Flag-B2R alone, HA-FP/Flag-AT1R or HA-FP/Flag-B2R co- expressed together. Black arrows show AT1R (upper panel) or FP (lower panel) and open arrows show B2R (upper panel) mature or immature forms. IgG are shown with open arrows (lower panel). B) Acceptor photobleaching FRET between FP-CFP (donor) and AT1R-YFP or B2R-YFP (acceptors). Upper panel: quantification of donor fluorescence before and after acceptor photobleaching (see Materials and Methods for details). Lower panel: representative fluorescent 236 images with magnified region (white box) where AT1R-YFP was photobleached. C) Immunoprecipitation of FP in VSMC using anti-6D12 FP antibody. Western blots of anti-6D12 (left) or anti-HA on stripped membrane (right). HEK 293 and HA-FP cells were used as negative and positive controls, respectively. Black arrows show FP, open arrow show IgG. D) raw counts in CPM (lower panel) of [125I]-SBpA crosslinked to AT1R, obtained after immuoprecipitation of FP with pooled anti-FP monoclonal antibodies (clones 6D12, 7D2, 8E9, 9G3 and 10G10) in VSMC (see Materials and Methods for details). Tot: total binding. NSB: non- specific binding (binding in the presence of 1 M AngII). IP: FP, immunoprecipitation with anti-FP monoclonal antibodies. IP: PAFR, immunoprecipitation with anti-platelet activating factor receptor monoclonal antibody (negative control). ***p<0.001 compared to FP-CFP/AT1R-YFP bleached regions. Data are representative of four (A), three (B, C) or one (D) independent experiments. 237 Figure 4. 2 PGF2 and AngII binding to the FP/AT1R dimer. A) [3H]-PGF2 binding on HA-FP alone or in the presence of unoccupied Flag- AT1R. B) [125I]-Ang II binding on Flag-AT1R alone or in the presence of unoccupied HA-FP. C) [3H]-PGF2 binding on HA-FP in presence of L158,809- or Ang II-occupied AT1R. D) [125I]-Ang II binding on Flag-AT1R in the presence of AS604872- or PGF2-occupied HA-FP. See Table 1 for the Ki values and statistics. Data are representative of three to four independent experiments (A-D) performed in duplicate. 238 Figure 4. 3 Split-FP/AT1R Venus internalizes following PGF2 and AngII stimulation. A, B) YFP-Venus is reconstituted with AT1R-Venus1 and FP-Venus2 and the dimer internalizes following stimulation with 100 nM PGF2 (A) or AngII (B). - 239 Arr2-mRFP is strongly recruited to the endocytosed dimer when stimulated by AngII (B), and only weakly when stimulated by PGF2 (A). C, D) The FP-AT1R- Venus dimer internalizes with -arr2-mCherry when stimulated with 100 nM PGF2 and AT1R is bound by 2 M L158,809 (C) or when it is stimulated with 100 nM AngII and FP is bound by 1 M AS604872 (D). Enlarged regions (white square) of the merge images is shown in the corner. E, F) -arrestin1/2 co- immunoprecipitation with HA-FP or Flag-AT1R in FP/AT1R cells following 100 nM PGF2 or Ang II stimulation (E). F, G) FP or AT1R ligand-mediated endocytosis as shown by changes in cell surface [125I]-Ang II (F) or [3H]-PGF2 (G) binding in AT1R (F,white bars), FP (G, white bars) or in FP/AT1R cells (F, G, black bars), following stimulation with 100 nM Ang II or PGF2. *p< 0.05, ***p<0.001 compared to not treated (NT). 240 Figure 4. 4 L158,809, an AT1R antagonist, potentiates PGF2-induced ERK1/2 activation. 241 A) Effect of pre-treatment of VSMC with 2 M L158,809 on 100 nM PGF2- induced ERK1/2 activation (100 nM Ang II is used as control). B) Effect of VSMC pre-treatment with 1 M AS604872 on 100 nM Ang II-induced ERK1/2 activation (100 nM PGF2 is used as control). C, D) Effect of 1 M Go6983 (C) or 125 nM AG-1478 (D) on L158,809 potentiation of PGF2-induced ERK1/2 activation in VSMC. E, F) Effects of 2 M L158,809 or 1 M AS604872 on PGF2(E)- or AngII (F)-induced IP1 production in VSMC. ERK1/2 activation is monitored using anti-p-ERK1/2 antibody. Total protein loading was monitored using anti-total-ERK1/2 antibody. Data are representative of three (A, B), one (C) two (D) and four (E, F) independent experiments. *p<0.05, **p<0.01, ***p<0.001 comparing vehicle to L158,809 (A, D, E) or AS604872 (B) for PGF2 stimulation. +p< 0.05, ++p< 0.01, +++p<0.001 comparing vehicle to L158,809 (A) or vehicle to AS604872 (F) for Ang II stimulation. p<0.05 comparing vehicle to AL-8810 (F) for AngII stimulation. 242 Figure 4. 5 Allosteric modulation of FP and AT1R signalling in the context of the heterodimer. A) Effect of Flag-AT1R on PGF2-induced ERK1/2 activation. B) Effect of HA- FP on Ang II-induced ERK1/2 activation. Data are representative of five (A) or three (B) independent experiments. *p<0.05, **p<0.01, ***p<0.001 comparing FP to FP/AT1R or AT1R to FP/AT1R. Data are representative of three independent experiments. *p<0.05, **p<0.01, ***p<0.001 compared to cells pre- treated with vehicle. 243 Figure 4. 6 AS604872, a FP antagonist, inhibits AngII-induced cellular hypertrophy in VSMC. A, B) [3H]-thymidine (A) or [3H]-leucine (B) incorporation in VSMC following 30 min pre-treatment with vehicle, 20 M L158,809 or 1 M AS604872 and 24h treatment with 10 nM of PGF2 or AngII. C) [3H]-thymidine/[3H]-leucine ratio representative of cellular hypertrophy. D) Quantification of cell size using nuclear area on confluent VSMC as treated in A and B. E) Phalloidin-Alexa 488 (actin, green) and Hoescht (nucleus, blue) staining in VSMC treated as in A and B to assess cell size. F, G) [3H]-thymidine/[3H]-leucine ratio in VSMC pre-treated first 244 with AG-1478 and then by 20 M L158,809 and stimulated for 24h with 10 nM PGF2 (F) or by 1 M AS604873 and stimulated for 24h with 10 nM AngII (G). Data are representative of four (A), three (B, F, G), two (D, E) independent experiments. *p<0.05, ***p<0.001 compared to not treated cells. 245 Figure 4. 7 Effects of single or dual ligand occupancy on FP- or AT1R- mediated abdominal aorta contraction. A) Abdominal aorta contraction (% of 40 mM KPSS or Emax contraction) as induced by increasing concentration of PGF2, in the absence (vehicle, closed circles, dotted line) or presence of 1 M Ang II (closed squares) or L158,809 (closed triangles). B) Abdominal aorta contraction (% of 40 mM KPSS or Emax contraction) as induced by increasing concentrations of Ang II, in the absence (vehicle, closed circles, dotted line) presence of 1 M PGF2 (closed squares), AS604872 (AS, downward closed triangles) or 10 M AL-8810 (AL, upward closed triangles). Data are representative of three to five independent experiments *p<0.05, **p<0.01, ***p<0.001 compared to vehicle. 246 Supplementary Figure 4. 1 [125I]-SBpA binding to AT1R. A) [125I]-SBpA crosslinked (see Material and Methods for details) in presence of binding buffer (total binding or “tot”) or in the presence of 1 M Ang II (non- specific binding “NSB”) to Flag-AT1R/HA-FP cells after immunoprecipitation of Flag or HA (left and middle panels). TCL, Total cell lysate (right panel) before immunoprecipitation. Data are representative of one independent experiment. 247 Supplementary Figure 4. 2 FP does not internalize. A) FP-CFP does not internalize alone or in the presence of -arr2-mRFP following stimulation with 100 nM PGF2. B) AT1R-YFP internalizes with - arr2-mRFP following stimulation with 100 nM Ang II. C) Ang II-stimulated Flag- AT1R but not PGF2-stimulated HA-FP recruits -arr1/2 as detected by co- immunoprecipitation. Data representative of three independent experiments. 248 Supplementary Figure 4. 3 FP internalizes in response to ligand stimulation when AT1R is present. A, B) FP-CFP and AT1R-YFP internalization with -arr2-mRFP following 100 nM PGF2 (A) or Ang II (B) stimulation. C, D) B2R-YFP co-expressed with FP- CFP does not internalize or recruit -Arr2-mRFP, when stimulated with 100 nM PGF2 (C) but does when stimulated by bradykinin (BK, 100 nM, D). FP-CFP does not internalize when co-expressed with B2R-YFP and stimulated with either 100 nM PGF2 (C) or bradykinin (BK) (D). B2R-YFP, however, internalizes 249 with -arr2-mRFP when stimulated with BK (D). E) Functionality of the FP- Venus1 and FP-Venus2 construct as assessed by PGF2-induced ERK1/2 activation. AT1R-Venus1 and –Venus2 functionality was assessed in (Zhang et al., 2009b). F, G) FP or B2R ligand-mediated endocytosis as shown by cell surface binding of [125I]-BK-Tyr8 or (F) [3H]-PGF2 (G) in HEK 293 cells transfected by B2R alone (F, white bard), in FP cells (G, white bars) or in FP cells transfected with B2R (F, G, black bars), following stimulation with 100 nM PGF2 or BK. Data are representative of three independent experiments, performed in duplicate. *p<0.05, **p<0.01 compared to not treated (NT). 250 Supplementary Figure 4. 4 PKC and EGFR pathways are implicated in PGF2- and AngII-induced ERK1/2 activation. A) Effect of the PKC inhibitor, Go6983 (2 M) on 1 M PGF2- and Ang II- induced ERK1/2 activation in VSMC. B) Effect EGFR inhibitor, AG-1478 (125 nM) on 1 M PGF2- and Ang II-induced ERK1/2 activation in VSMC. C-F) Effects of PDC113.824 on PGF2 (C, D)- or Ang II (E, F)-induced ERK1/2 activation in HA-FP cells (C) or Flag-AT1R cells (E) or in FP/AT1R cells (D, F). 251 Data are representative of three independent experiments. +p<0.05, +++p<0.001 compared to Ang II in the presence of DMSO. *p< 0.05, **p<0.01 compared to PGF2 in the presence of DMSO. Supplementary Figure 4. 5 Effect of PGF2 or L158,809 on FP cells. ERK1/2 activation in FP cells following treatment with PGF2 or the AT1R antagonist, L158,809, for the indicated times. Data are from a single experiment. 252 Table 4. 1 Ki values for FP and AT1R expressed alone or together. 3H-PGF2 on FP 125I-Ang II on AT1R Partner (nM) (nM) None 4.79 0.68 2.84 0.81 AT1R unoccupied 1.85 0.31** - L158,809-bound AT1R 1.63 0.52** - Ang II-bound AT1R 1.93 0.88* - FP unoccupied - 1.32 0.25 AS604872-bound FP - 0.47 0.17 PGF2-bound FP - 1.54 0.79 Stable FP, AT1R or FP/AT1R cells were incubated in a constant quantity of 3H- PGF2 (FP, FP/AT1R cells) or of 125I-Ang II (AT1R, FP/AT1R cells) in the presence of a dose-response of cold PGF2 (3H-PGF2binding) or cold AngII (125I-Ang II binding). “None” in the partner column means receptor expressed alone. Binding constant (Ki) values are shown in nM stardard error of the mean. *p<0.05, **p<0.01 compared to “None”. 253 CHAPTER 5: General discussion and Conclusions 254 5.1 Contributions to scientific understanding The goal of this thesis was to develop a better understanding of the functional selectivity imparted to FP signalling when modulated by 1) a biased ligand, 2) a novel allosteric compound, or 3) a putative heterodimerization partner. In Chapter 2 (Goupil et al., 2012b), we showed that FP could be biased by a known competitive antagonist, AL-8810, toward a new pathway, in HEK 293 cells. AL-8810 should now be considered as a biased ligand rather than an antagonist, since it activates ERK1/2 via EGFR transactivation, and has no known effect on the canonical Gq pathway (IP1) production and PKCI-GFP translocation). Moreover, neither PGF2, nor AL-8810 could induce FP internalization. Finally, AL-8810 treatment altered the sub-cellular localization of ERK1/2 in a temporal fashion, as compared with PGF2, demonstrating once more the possibility of achieving two different responses with ligands sharing the same binding site. In Chapter 3 (Goupil et al., 2010), we demonstrated that a peptide mimic of the second extracellular loop of a GPCR could be defined and used as an allosteric modulator. This small molecule, PDC113.824 (PDC) did not compete for the orthosteric site on FP and did not have any effect when used alone. However, in the presence of PGF2, PDC led to functional selectivity of the signalling routes downstream, which has been observed only on a few occasions 255 with known allosteric compounds. We demonstrated for the first time that FP couples to G12, activation of which by this receptor led to cellular ruffling, decreased by PDC’s presence, whereas the opposite was observed for Gq and its downstream signalling effects. More importantly, not only did PDC delay PGF2- or LPA-induced preterm labour, but it could also delay normal labour, suggesting a common mechanism of regulation between both phenomena. In Chapter 4 (Goupil et al., in preparation), we showed for the first time heterodimerization of FP with another GPCR, AT1R. Not only did we show this interaction in a heterologous system (HEK 293 cells), but we were able to detect it endogenously, it in vascular smooth muscle cells (VSMC). Interestingly, functional selectivity was present, in a reciprocal manner, when FP and AT1R were co-expressed. PGF2 and Ang II binding to their respective receptors was modulated, as well as signalling downstream. We showed that the occupancy of one protomer of a dimer could change the signalling of the other protomer. Indeed, 1) FP was able to internalized when co-expressed with AT1R, 2) PGF2- induced ERK1/2 activation in VSMC was potentiated when AT1R was occupied by an antagonist (L158,809) and 3) Ang II-induced VSMC hypertrophy was reversed in the presence of AS604872, an antagonist of FP. Finally, we show that PGF2- or Ang II-induced contractions of murine arteries could be potentiated or inhibited by occupancy of the partner receptor by agonist or antagonist, respectively, suggesting allosterism within the dimer to control this physiological response. 256 5.2 FP-mediated functional selectivity by orthosteric and allosteric ligands or by dimerization The case of AL-8810, a competitive antagonist showing functional selectivity when tested on other FP signalling pathways, is not unique. Indeed, many antagonists can be agonists for selective pathways (Daniels et al., 2005; Holloway et al., 2002; Wei et al., 2003). Our results suggest that the alkyl chain of PGF2 and other FP agonists (see structure in Fig. 2.3A fluprostenol, cloprostenol, bimatoprost) is not important for Gq-mediated signalling (a PKC inhibitor affected equally all ligands-mediated ERK1/2 activation). However, the cyclopentane group seems to play a major role: AL-8810 is the only molecule containing a fluoride atom at position 11 instead of a hydroxyl group. Interestingly, PGE2, which is the endogenous agonist of the EP receptors, can also bind FP, but with reduced affinity (30-50 times less) compared to PGF2. Similarly to AL-8810, which has 300 times less affinity for FP than PGF2, PGE2 has a ketone group instead of a hydroxyl group at position 9, which is the only difference between both molecules. Therefore, it is possible that these molecules, by binding FP with lower affinity, bias the receptor into a distinct conformation from that imparted by canonical agonists. For instance, the neurokinin A (NKA) receptor has different affinities for the full length NKA and its truncated form, which lead to biased waves of signalling (Palanche et al., 2001). Another example showing the importance of all the different chemical groups of an agonist for signalling are the many derivatives versions of Ang II 257 1 4 1 4 8 8 1 5 8 (Sar Ile -AngII, Sar Ile Ile -AngII, Sar1BpA -AngII, Sar Val DPhe -AngII, Asp1Val5Gly8-AngII). Each of these ligands has their own specific signalling signatures (Ahn et al., 2004; Holloway et al., 2002; Violin et al., 2010; Zimmerman et al., 2012), reinforcing our idea that different pharmacophores of a ligand are important for functional selectivity. Endogenous agonists probably underwent evolutionary pressure, unlike other types of ligands, to drive their endogenous receptors into the best conformation (R* state) leading to a fully- activated receptor, coupled to its canonical G protein, for optimal physiological responses. The results obtained in Chapter 2 show a differential redistribution of ERK1/2 in HEK 293 cells following stimulation by PGF2 or AL-8810, as well as a change in the proliferation pattern in osteoblasts. These results show that signalling bias can be temporally controlled, depending on the ligand used. The growth arrest observed following AL-8810 proliferation in the osteoblastic cell line used may be the result of cellular differentiation. Ligand-directed signalling can also be achieved in GPCRs with the use of allosteric ligands. This way of inducing functional selectivity seems to be the safest, considering the “ceiling effect” and the possibility of designing a neutral allosteric modulator, which acts only in the presence of the endogenous ligand (see section 1.9.1). In Chapter 3, we showed that PDC potentiated Gq-mediated pathways and reduced those mediated by G12. Which mechanism is responsible for this imbalance? The first possibility is the PDC-linked FP conformation, once bound by PGF2, has more affinity for Gq than G12, whether or not pre- 258 assembled receptor/G protein complexes are involved or not. Another explanation is that PDC-induced potentiation of Gq leads to a retro-inhibition of G12. Results obtained examining PGF2-induced cellular ruffling, a response downstream G12, showed that PKC inhibitor Go6983 was able to reverse the inhibitory effects of PDC (Figure 5.1). Thus, it is possible that the potentiation of the Gq-mediated pathways is responsible for G12 pathways inhibition. In order to get a better understanding of how the different PDC chemical groups (see Figure 3.1B) biased signalling by FP, a series of azapeptide derivatives was designed (Figure 5.2A) in an effort to generate mimics that were easier to synthesize (less steps and with better yields) and to allow structure- function studies. For all these compounds, called CAR10.0-10.4, the indolizidin- 2-one amino acid group on PDC was replaced with different azapeptide groups (Bourguet et al., 2011). These compounds allowed us to undertake some structure-function studies on their effects on ERK1/2 activation (Figure 5.2B) as well as on cellular ruffling and myometrial contraction. Interestingly, CAR10.0 (which has an aza-glycine group instead of the indolizidine), 10.1 (aza- propargylglycine group) and 10.2 (aza-phenylalanine group) potentiated PGF2- induced ERK1/2 activation whereas CAR10.3 (aza-allyl-glycine group) and 10.4 (aza-alanine) reduced it. We had observed previously that PDC blocked cellular ruffling in HA-FP cells stimulated by PGF2, whereas it could potentiate ERK1/2 activation (see Figure 3.5 and 3.6). Interestingly, the CAR analogues that potentiated ERK1/2 did not necessarily inhibit cellular ruffling. For instance CAR10.1 potentiated PGF2-induced ERK1/2 activation, but had no significant 259 effect on cellular ruffling, whereas CAR10.0 and 10.2 acted like PDC. As for PGF2-mediated myometrial contraction, only CAR10.0, 10.1 and 10.2 acted as negative allosteric modulators (Bourguet et al., 2011). These results reinforce the fact that functional selectivity on GPCRs is not only triggered by orthosteric ligands, but also by allosteric ligands. Whereas the Gq or G12 protein coupling is modulated in the same fashion by the CAR compounds as they were by the PDC remains to be determined. Moreover, once the exact binding site of these compounds is known, structure-function relationships will be easier to evaluate. Another way of biasing GPCR signals is through heterodimerization with a receptor partner. We showed in Chapter 4 that the FP/AT1R dimer could change complex cellular responses such as cellular hypertrophy and arterial contraction. Interestingly, blockade of FP using AS604872 antagonist inhibited Ang II- induced hypertrophy in VSMC, without having an effect on ERK1/2 activation. However, when we looked reciprocally at the effects of AT1R antagonist, L158,809, on PGF2-induced hypertrophy and ERK1/2 activation, both responses were potentiated. These data suggest that the signalling bias mediated by dimerization is not necessarily symmetrical. Whether this is due to direct dimerization or indirect downstream interactions between both protomers, remains to be determined. However, comparison of our data on arterial contraction, IP1 production and ERK1/2 potentiation suggests that the bias applied on both systems comes directly from receptor dimerization, since both responses are not controlled by the same pathways. Other studies have shown such effects, for instance, in the case of the 2AR/OTR dimer, where 2AR ligands modulated 260 OT-induced ERK1/2 activation and vice versa (Wrzal et al., 2012a). Interestingly, in contrast to the transactivation-mediated signals (ERK1/2 and hypertrophy), which were asymmetrically regulated within the dimer, the contractile (on the abdominal murine aorta) and second messenger (IP1 production in VSMC) bias was reciprocally transmitted between FP and AT1R. This reinforces the idea of a unique entity, made by FP and AT1R, where each receptor’s ligands combination deliver a unique set downstream signals. Furthermore, heterodimerization with AT1R gave FP the capacity to internalize following agonist treatment, suggesting that the presence of AT1R alone drove FP into a conformation more appropriate for endocytosis (see section 5.5 for more discussion). More importantly, FP antagonist AS604872 acted as an inhibitor for Ang II-mediated contractile responses, suggesting that FP ligands and AT1R blockers could be used in parallel to treat hypertension and other Ang II-induced physiological and pathophysiological responses of the RAAS. In addition to AT1R, our lab has shown (Dr. Paulina Wrzal and Darlaine Pétrin, unpublished results, personal communication), using bioluminescence resonance energy transfer (BRET) studies, that other receptors can heterodimerize with FP: the oxytocin receptor (OTR), the 2-adrenergic receptor (2AR) and the platelet-activating factor receptor (PAFR). Interestingly, Dr Wrzal has shown, in human myometrial cells, that PGF2-mediated ERK1/2 activation could be modulated by OTR or 2AR ligands. The extent to which biased signals are generated downstream of FP/OTR and FP/2AR dimer pairs is not known. However, our preliminary data demonstrates that AT1R may not be the only 261 partner for FP in vivo. Interestingly, FP has many splice variants (most of them lacking TM7, see section 1.6.2) and one dimer of FP receptors has been characterized (FP-altFP4). This particular combination of receptors generated different signals in response to PGF2 or bimatoprost. Adding to the complexity of other receptor partners (such as AT1R, OTR or 2AR), this suggests the presence of a unique set of FP/FP variants dimers in vivo, in a tissue-dependent fashion, to control FP-mediated cellular responses. The scope of the studies presented in this thesis was to characterize the effects of FP modulators – biased and allosteric ligands, heterodimerization partners – on its downstream signalling and cellular responses. I had the opportunity to study only a few signalling pathways downstream FP, amongst them G12-Rho, Gq-ERK1/2 and EGFR-ERK1/2. Understanding that the wiring of GPCR signalling can be directed to many different G proteins, including the several G subunits and the multiple combinations of G possible, and that the cellular context in which receptor are expressed is important (see section 5.6), FP probably couples to many other partners as well. For instance, we know that in VSMC, FP activates the Akt pathway (data not shown), and in skeletal myotubes, the PI3K/mammalian target of rapamycin (mTOR) cascade (Markworth and Cameron-Smith, 2011). Moreover, studies have reported the coupling of Gi to FP (Hébert et al., 2005). These observations suggest that many opportunities exist to bias FP wiring and that future studies will be necessary to decrypt how FP modulators (ligands and receptors) affect other signalling routes. 262 5.3 The importance of the extracellular loops in GPCR-mediated modulation In Chapter 3, I demonstrated that a peptide mimic of the extracellular loop 2 (ECL2) of FP could be used as an allosteric modulator. The original compound, THG113 (now called PDC113), an octapeptide (Ile-Leu-Gly-His-Arg-Asp-Tyr- Lys, see Fig. 1.7 for localization on FP), was demonstrated to bind FP on a distinct site from PGF2, and was shown to inhibit IP3 production, as well as endotoxin-induced preterm labour in mice (Peri et al., 2002). The peptide mimic described in Chapter 3, PDC, allowed us to preserve the essential structural features of THG113 and its activity. The way PDC interacts with FP remains unknown. However we can speculate that it would compete with regions usually modulated by FP own ECL2, changing the usual conformation of PGF2-bound FP. Whereas most orthosteric agonists of class A GPCRs bind to helices 2, 3, 5, 6 and 7 within the barrel core (Granier and Kobilka, 2012), the positions of allosteric ligand binding on this GPCR class are much more variable. Many studies have demonstrated the importance of the extracellular loops (ECL2, ECL3) for allosteric ligand binding on the different muscarinic receptor subtypes (Gnagey et al., 1999; Krejci and Tucek, 2001; Matsui et al., 1995; Voigtlander et al., 2003), whereas other studies refers to an allosteric binding site a little deeper into the orthosteric site, in the vicinity of the extracellular domains (Andrews et al., 2008; Dragic et al., 2000). ECL2 has been shown to be a highly dynamic segment of the extracellular domains (Bokoch et al., 2010) and is important for receptor activation as well (Ahuja et al., 2009; Rosenbaum et al., 2007). For 263 instance, stabilization of the somatostatin receptor ECL2 by a specific antibody was sufficient to induce an active conformation of this receptor (Leu and Nandi, 2010). Reinforcing this idea of the importance of ECL2 in class A GPCR conformation is its high diversity in amino acid sequence, making it an attractive target for allosteric drug design (Granier and Kobilka, 2012). Therefore, it seems that alteration of the extracellular receptor surface using antibodies, peptides or peptide mimics can lead to allosterism on GPCRs as well as functional selectivity of signalling. We have generated a series of alanine mutants for all the residues of the FP ECL2, which will allow us, in future work, to determine how it affects allosteric ligand signalling. Also, it would be interesting to examine the capacity of other peptides, derived from FP ECL2 and ECL3, to allosterically modulate this receptor. Finally, the FlAsH (fluorescein arsenical helix binder) technology is under development in our lab. With this technique, a molecule able to recognize a unique tag sequence (Cys-Cys-Pro-Gly-Cys-Cys) in a protein of interest can be used to fluorescently label this protein. In the case of GPCRs, we have already begun to tag the ECL1, 2 and ICL3 of FP with the FlAsH recognition sequence. Conjugating this FlAsH-tagging as a fluorescent acceptor for BRET will be a powerful tool to detect the different conformational changes imparted to FP, when modulated by its orthosteric or allosteric ligands, or by its oligomerization with other GPCRs. 5.4 PDC- and AT1R-mediated allosterism on FP 264 Allosteric regulation of GPCRs occurs when a ligand or protein partner, by binding to a site distinct from the endogenous binding pocket, induces a change in conformation in the receptor that can be transmitted to its effectors downstream. In theory, positive and negative allosteric modulators (PAM and NAM) have no activity in the absence of the orthosteric ligand, that is, they are neutral. However, their allosteric effects would be seen when the orthosteric ligand is present. In Chapter 3, we explored the ways by which FP was allosterically modulated with a small molecule, PDC. At the cellular level, PDC allosteric effects were seen as an increase in PGF2-mediated ERK1/2 activation (via Gq) and a decrease in PGF2-mediated cellular ruffling (via G12). Interestingly, the conformation of the receptor taken when it is PDC-bound suggests that it couples more to Gq, even in the absence of PGF2 (see Figure 3.9C). However, this “pre-coupled state” of the receptor is not sufficient to induce FP-mediated signalling (ie ERK1/2 activation). This phenomenon has been shown for other allosteric ligands, such as the M1 muscarinic acetylcholine receptor (Thomas et al., 2008) or the adenosine receptor (Childers et al., 2005), and reinforces the idea that the receptor exists in a pre-coupled state with G protein partners. Preterm and term labour are two physiological responses distinctly regulated (Lopez Bernal, 2007). Whereas the importance or FP in the initiation of parturition is clear (Sugimoto et al., 1997), its exact function in preterm labour is not (Challis et al., 2002). The PDC compound we characterized in Chapter 3 is 265 not only an allosteric modulator of FP, but also a tocolytic. The mechanism by which PDC inhibited preterm and term birth in mice (Figure 3.2) remains to be elucidated. However, the results obtained with postpartum myometrial strips suggest that FP directly inhibits myometrial contractions (Suppl. Figure 3.2). Because PDC also inhibits normal (or term) labour, we can postulate that FP involvement in both phenomena is the same but the triggers between normal and spontaneous parturition are different. We could not determine where PDC binds (see previous section), but it competed partially with PGF2 (less than 15%). This diminution in PGF2 binding could be due to cooperativity rather than real competition, suggesting that PDC does not share a binding site with the orthosteric pocket. However, our data using dissociation kinetics of [3H]-PGF2 on FP (Figure 3.9A), a measurement of the dynamics of the ligand to its receptor, suggested that PDC action on FP rather leads to negative cooperativity. Moreover, PDC favours a conformation which enhances PGF2 effects (potentiation of ERK1/2 activation), without increasing its affinity for the receptor, again excluding the possibility of competition between PDC and PGF2 for the same binding site. In order to determine where PDC would bind FP, we iodinated an altered version of THG113, THG113.31 (with a citrulline substitution at position 5, to improve its affinity for FP (Peri et al., 2002), now called PDC31). [125I]- THG113.31 binding to FP was displaceable by THG113 (Figure 5.3), as predicted. However, PDC did not displace [125I]-THG113.31 binding, showing that these two compounds did not share the same allosteric binding site (Figure 266 5.3). This also suggests that 1) the peptide mimic engendered new properties to the molecule, allowing it to regulate other parts of FP or that 2) there may be more than one allosteric binding site on FP. More studies are required, using radiolabeled PDC, to determine 1) where it binds FP and 2) if the different PDC derivatives (CAR10.0 to 10.4) share the same site. If they share different binding pockets, this will be really interesting to understand, using structure-function studies how 1) their individual binding sites affect PGF2-mediated signalling and 2) which residue or structures in the molecule are responsible for patterns of signalling bias or allosteric effects, through specific FP extracellular domains. In the Introduction, I discussed the fact that the best-known allosteric modulator of a GPCR was the G protein itself (1.9.1), demonstrating that other entities in addition could play this role. The evidence for GPCR oligomerization leading to allosterism is now significant. In Chapter 4, I showed that FP and AT1R were allosteric partners for one another. This notion of a receptor partner being an allosteric modulator reinforces the idea that there is more than one allosteric site on a GPCR: the extracellular domains (ECL2 and ECL3) for small allosteric molecules and the dimerization interface for the receptor partner. Therefore, the transmembrane domains of a GPCR involved in dimerization could also be considered as allosteric sites. We have also looked at the effects of FP allosteric modulator, PDC, on the FP/AT1R dimer signalling. Whereas the potentiation of PGF2-mediated ERK1/2 activation was preserved in the FP/AT1R dimer, PDC still had no effect on Ang II-mediated signals on AT1R alone or on FP/AT1R (Suppl. Figure 4.4). However, 267 the fact that the presence of AT1R was sufficient to reduce FP-induced ERK1/2 activation (Figure 4.5) suggests that some PDC effects are abolished or altered when FP dimerizes with AT1R. Interestingly, both PDC and L158,809-bound AT1R had the same actions on PGF2-induced ERK1/2 activation in HEK293 cells and VSMC. As predicted by the ternary complex model of allosteric modulation (Figure 1.12A), orthosteric ligand binding can be affected by an allosteric interaction (ligand or protein). We have shown in Chapter 3 and 4 that PGF2 binding to FP could be allosterically modulated by PDC (Figure 3.9A) and by AT1R (Figure 4.2A and dissociation kinetic studies, data not shown). These results can only be explained by cooperativity between the orthosteric and allosteric binding sites, rather than binding competition (PDC effect) or changes in downstream signalling (AT1R dimerization with FP). Moreover, the changes in affinity of PGF2 for FP in the presence of AT1R (Figure 4.2A), can only be a consequence of a change in conformation of FP induced by its dimerization with AT1R. Little is know about the stoichiometry of the different receptors or even the receptor:G protein ratios within an oligomer. The data in Chapter 4, as well as many recent publications, suggest that dimers or larger oligomers tend to be asymmetric in their functional regulation of cellular responses (Han et al., 2009; Maurice et al., 2010). This is a phenomenon well characterized for class C GPCRs, where one protomer usually binds the ligand, conveys its activation to a second protomer, which activates the G protein and other effectors (Pin et al., 268 2005). In Chapter 4, we showed by different ways the intrinsic asymmetry of the FP/AT1R dimer system. For instance, AT1R bound by an antagonist (L158,809) increased ERK1/2 activation downstream of PGF2bound FP, but the opposite (FP bound to an antagonist, AS604872) has no effect on Ang II-mediated ERK1/2 activation. Another example of asymmetry in the FP/AT1R system is the differences observed for activated ERK1/2 when FP and AT1R were alone or in a dimeric form (Figure 4.5). These changes in ERK1/2 fold activation could be explained by a change in the coupling between the Gq and the receptors, or the coupling to a new effector (such as another G protein). Interestingly, our in vivo data in arterial beds and IP1 production show some symmetry within the dimer. Indeed, unlike the MAPK data in VSMC, FP antagonists inhibited Ang II-induced contraction and PGF2 potentiated it. In a reciprocal manner, AT1R antagonist inhibited PGF2-induced contraction and Ang II potentiated this response. However, this symmetry can be taken for an asymmetric response, when we consider the fact that ERK1/2 activation and contraction are activated by two different pathways. Thus L158,809-bound AT1R inhibits PGF2-induced, Gq dependent contraction, whereas it potentiates PGF2-induced, EGFR-dependent ERK1/2 activation. Therefore, it seems that asymmetry is the direct result of FP allosteric regulation by AT1R, or AT1R allosteric regulation by FP. 5.5 FP endocytosis 269 As mentioned in the introduction, ovine FP was shown to endocytose following PGF2 stimulation (Srinivasan et al., 2002). In Chapter 2 and 4 of this thesis, I showed that FP, when expressed alone, does not internalize, nor recruit - arrestin. However, co-expression with AT1R rescued FP and allowed it to internalize, but without -arrestin, suggesting that physiologically other pathways can trigger AT1R internalization. In contrast, even though AT1R strongly recruits and endocytoses with -arrestin, its dimerization with FP acted negatively for its recruitment of -arrestin (Figure 4.3B). Using biased ligands, many studies have demonstrated the role of -arrestin-mediated AT1R signalling to promote cardioprotection (Ahn et al., 2009; Kim et al., 2012a; Violin et al., 2010). The effects the PGF2-induced endocytosis of the FP/AT1R dimer without -arrestin, on such cellular responses, needs to be addresses. However, the increase in - arrestin recruitment to the complex when L158,809 is present (Figure 4.3C), suggests that these traditional AT1R antagonists, unable to trigger any -arrestin response, may have differential effects when a receptor partner is agonist- occupied. Ovine and human FP amino acid sequences are more than 90% identical, with a few differences in the last amino acids of their C-terminal tails. For instance, human FP has alanine residues whereas the ovine FP has threonines (see Figure 1.7), which are important target phosphorylation sites for protein kinases implicated in GPCR desensitization, such as PKC, PKA or GRK (Delom and Fessart, 2011). More importantly, human FP lacks the CXXXC consensus site for palmitoylation, which regulates association of the receptor to the plasma 270 membrane, as well as the strength of signalling and internalization (Charest and Bouvier, 2003; Chini and Parenti, 2009; Munshi et al., 2001). These differences between both species may account for the lack of internalization of human FP, leaving AT1R to be an important allosteric partner, facilitating its internalization. Future work, using mutants of the human FP containing the palmitoylation consensus and the threonine phosphorylation sites present in the ovine FP, will help determine if these regions are important for FP endocytosis. Many questions remain: why, for instance when FP is expressed alone in HEK 293 cells, is there a 1.5 fold increase in [3H]-PGF2 binding, following PGF2 stimulation? One possibility is the trafficking of a pool of cytosolic FP towards the membrane. Another possibility is a positive cooperativity imparted to FP when PGF2 stimulation occurs, changing receptor conformation and leading to an apparent increase of [3H]-PGF2 binding. Experiments to assess time as a factor for this increase or determining the Ki for cells who have been treated with PGF2, will help sort this issue. 5.6 How cellular context matters GPCR dimerization and oligomerization has been shown many times in native tissues (Albizu et al., 2010; Fotiadis et al., 2003). It is now clear that some of the effects observed in native environment, which are different than those observed in the overexpression context, may have been caused by different 271 cellular contexts or endogenous GPCR partners. For instance, in Chapter 2, we showed activation of ERK1/2 following stimulation of MG-63 osteoblast cells by AL-8810. Intriguingly, AL-8810 had no effect in VSMCs or myometrial cells (data not shown). This indicates that MG-63 cells present a specific cellular context in which AL-8810 had effects. Another important difference in FP signalling between heterologous and homologous systems is the pathway responsible for PGF2-induced ERK1/2 activation. As observed in Chapters 2 and 3 in HEK 293 cells, stably expressing FP activates MAPK through the canonical Gq-PKC pathway. However, many publications, including our own work in Chapters 2 and 4, have shown another prominent pathway responsible for MAPK activation. EGFR transactivation by endogenously expressed FP was shown in osteoblasts (Chapter 2 and (Ahmed et al., 2003) and in VSMCs. These results suggest that cellular context in which FP is present can bias its cellular signalling. Similar discrepancies have been observed for other GPCRs (AT1R, vasopressin and bradykinin receptors, etc.), reinforcing this idea. One explanation for the many signalling responses observed downstream of GPCR activation is the presence of lipid microdomains, which generate and localize signalling “hubs” made up of a GPCR oligomer and a specific set of G proteins and effectors. This “hub” would create unique receptor signalling microdomains that are specialized depending on the tissue (Barnett-Norris et al., 2005; Harder and Simons, 1997; Insel et al., 2005; Ostrom and Insel, 2004). In Chapter 4, we have demonstrated that FP and AT1R not only form a dimer in an endogenous context, but that the cellular responses downstream can be 272 asymmetrically regulated by both protomer of this dimer. The importance of the FP/AT1R dimer goes beyond the regulation of blood pressure. FP and AT1R are also expressed in the brain (Ogawa et al., 2011; Sugimoto et al., 1994), in the heart (Sugimoto et al., 1994) and in the myometrium (Bing et al., 1996; Matsumoto et al., 1997; Saito et al., 2003). It will be interesting to assess physiological responses in cells expressing both these receptors, and see how the cellular context affects allosteric communication. Moreover, as mentioned earlier, FP may also dimerize with the oxytocin receptor (OTR) and the platelet-activating factor receptor (PAFR). It will be interesting to see if larger receptor complexes (consisting of FP, AT1R and other receptors) are formed in heterologous systems, but also in native contexts. 5.7 It’s all about conformation After ligand binding, this new ligand-receptor complex adopts the best conformations energy-wise (Deupi and Kobilka, 2010). With the relatively recent crystal structure of the 1- and2-adrenergic receptors, the adenosine A2 receptor, the dopamine D3 receptor, the M2 muscarinic receptor and the -opioid receptor occupied by different ligand types (inverse agonists, inverse antagonists (Chien et al., 2010; Granier and Kobilka, 2012)), all leading to a specific arrangement of the transmembrane domains and the loops, GPCRs have proven themselves to be allosteric machines. In this thesis, we have shown that in HEK 293 cells, AL-8810 273 nudges the receptor into a signalling mode where it favours EGFR transactivation, whereas PGF2 and its derivatives (fluprostenol, cloprostenol, bimatoprost) do not. PDC113.824 acts on PGF2-occupied FP to potentiate the Gq-PKC-ERK pathway whereas the G12-Rho-ROCK-cell contraction pathway is inhibited. PGF2-occupied FP is affected by the presence of AT1R, leading to its endocytosis, as well as changes in cellular hypertrophy and arterial contraction. These are three examples, here, of three different “activated” receptor conformations, which can be added to the unbound, “inactive” FP conformation and the PGF2-bound FP conformation. Thus, there could be as many FP-mediated responses or “conformations” as the different ligands or partners able to “bind” FP. We can classify these in five major classes: 1) the different orthosteric ligands (PGF2, AL-8810, fluprostenol, bimatoprost, cloprostenol, AS604872) binding FP alone, 2) the different allosteric compounds binding FP by themselves (such as the PDC or the CAR derivatives), or 3) when those allosteric compounds are in the presence of an orthosteric ligand on FP, and finally 4) as for the oligomerization of FP with different unoccupied or 5) occupied receptor partners (AT1R, OTR or PAFR). For future work, it will be interesting to accurately catalog the different FP conformations and the physiological responses they trigger. The signalling signatures of FP should be characterized using biosensor panels, to understand exactly which pathways are involved with each ligand and receptor partner. Ultimately, crystallography, nuclear magnetic resonance and in silico modelling techniques will help determine the exact conformations taken by FP when bound 274 by PDC113.824 and CAR ligands, by its different orthosteric ligands, or when bound to different dimerization partners, such as the AT1 receptor. 275 5.8 Conclusions GPCRs are versatile allosteric machines, able to either shift their shape to accommodate specific ligands, or to be specifically recognized as pre-assembled complexes by biased or allosteric ligands. This spectrum of responses to different ligands reflects the spectrum of possible GPCR signalling architectures and is responsible for the functional selectivity observed in the downstream events occurring in the cell. Modulators that exhibit both allosteric and biased effects would be ideal drugs, since they act only in the presence of the endogenous ligand (in vivo), are saturable and offer unparalleled specificity of signalling. Our definitions of the term “agonist” need to include qualifiers for the pathway being measured, and the global signalling repertoire of a given receptor needs to be considered when validating new drugs. The extracellular regions of GPCRs, with their receptor- specific sequences and unique conformational arrangements, will likely represent an important target for the design of new biased and allosteric therapeutics. Receptor protomers in GPCR oligomers can be viewed as allosteric modulators for their partners. As our understanding of receptor asymmetries increases, so will our ability to exploit distinct receptor-receptor interactions therapeutically. To understand how the biased and allosteric ligands control GPCRs- mediated downstream pathways will direct us to the design of new compounds targeting a specific subset of effectors. With the rapid evolution of structural biology and the information it gives us regarding specific GPCRs, it will 276 eventually be possible to design a specific ligands fostering unique receptor conformations, leading to modulation of subsets of activated signals downstream. These new drugs will have the exact amount of potency, efficacy and pathway specificity required, leading to reduced side effects. Finally, the studies on fundamental GPCRs function will give rise not only to a better understanding of the different states they can adopt, but also to the generation of better therapeutics. 277 5.9 Figures for Chapter 5 Figure 5. 1 PDC inhibitory effects on PGF2-mediated cellular ruffling are reversed by PKC inhibition. Percentage (%) of HA-FP cells undergoing cellular ruffling under untreated conditions, in the presence of 1 M PGF2, in the presence of PKC inhibitor, Go6983 (Go, 1 M) and PGF2, or in the presence of PDC113.824 (PDC 1 M) and PGF2, or in the presence of PDC and Go. Data from Danaë Tassy/Dr. Audrey Claing. Unpublished results. 278 Figure 5. 2 Distinct PDC113.824 derivatives and their effects on PGF2- induced ERK1/2 activation. A) The five different CAR structures (CAR10.0 to 10.4). B) HA-FP cells were pre-treated with 1 M of the CAR compounds for 30 min following by 5 min stimulation with 1 M PGF2 Analysis of ERK1/2 activation was performed as described in section 2.4 under “Western blot and immunoprecipitation experiments”. Results from CAR10.0, 10.1 and 10.2 are published in (Bourguet et al., 2011). Results from CAR10.3 and 10.4 are unpublished and generated by me. 279 2000 1500 1000 (CPM) 500 125I-THG113.31 Binding 0 r e ff u .824 B HG113 T M PGF2 M m 0 1 1 M PDC113 0 1 Figure 5. 3 PDC113.824 and PGF2 do not displace [125I]-THG113.31 binding, but THG113 does. Total binding of [125I]-THG113.31 (same sequence as THG113, but with a citrulline instead of an arginine residue at position 5, to enhance binding affinity to FP) on HA-FP cells in the presence of binding buffer (Buffer), or an excess of THG113, PDC113.824 or PGF2. For [125I]-THG113.31 iodination, see Methods of Chapter 3 (section 3.4). [125I]-THG113.31 is only displaceable by itself but not by PGF2 or PDC113.824. 280 REFERENCES Abramovitz M, Boie Y, Nguyen T, Rushmore TH, Bayne MA, Metters KM, Slipetz DM and Grygorczyk R (1994) Cloning and expression of a cDNA for the human prostanoid FP receptor. J Biol Chem 269(4): 2632-2636. Ahmed I, Gesty-Palmer D, Drezner MK and Luttrell LM (2003) Transactivation of the epidermal growth factor receptor mediates parathyroid hormone and prostaglandin F2-stimulated mitogen-activated protein kinase activation in cultured transgenic murine osteoblasts. Mol Endocrinol 17(8): 1607-1621. Ahn S, Kim J, Hara MR, Ren XR and Lefkowitz RJ (2009) -Arrestin-2 Mediates Anti-apoptotic Signaling through Regulation of BAD Phosphorylation. J Biol Chem 284(13): 8855-8865. Ahn S, Shenoy SK, Wei H and Lefkowitz RJ (2004) Differential kinetic and spatial patterns of -arrestin and G protein-mediated ERK activation by the angiotensin II receptor. J Biol Chem 279(34): 35518-35525. Ahuja S, Hornak V, Yan EC, Syrett N, Goncalves JA, Hirshfeld A, Ziliox M, Sakmar TP, Sheves M, Reeves PJ, Smith SO and Eilers M (2009) Helix movement is coupled to displacement of the second extracellular loop in rhodopsin activation. Nat Struct Mol Biol 16(2): 168-175. Albizu L, Cottet M, Kralikova M, Stoev S, Seyer R, Brabet I, Roux T, Bazin H, Bourrier E, Lamarque L, Breton C, Rives ML, Newman A, Javitch J, Trinquet E, Manning M, Pin JP, Mouillac B and Durroux T (2010) Time-resolved FRET between GPCR ligands reveals oligomers in native tissues. Nat Chem Biol 6(8): 587-594. Alblas J, van Corven EJ, Hordijk PL, Milligan G and Moolenaar WH (1993) Gi- mediated activation of the p21ras-mitogen-activated protein kinase pathway by alpha 2-adrenergic receptors expressed in fibroblasts. J Biol Chem 268(30): 22235-22238. Ali MS, Schieffer B, Delafontaine P, Bernstein KE, Ling BN and Marrero MB (1997) Angiotensin II stimulates tyrosine phosphorylation and activation of insulin receptor substrate 1 and protein-tyrosine phosphatase 1D in vascular smooth muscle cells. J Biol Chem 272(19): 12373-12379. Andrews G, Jones C and Wreggett KA (2008) An intracellular allosteric site for a specific class of antagonists of the CC chemokine G protein-coupled receptors CCR4 and CCR5. Mol Pharmacol 73(3): 855-867. 281 Aoki H, Izumo S and Sadoshima J (1998) Angiotensin II activates RhoA in cardiac myocytes: a critical role of RhoA in angiotensin II-induced premyofibril formation. Circ Res 82(6): 666-676. Audet M and Bouvier M (2008) Insights into signaling from the 2-adrenergic receptor structure. Nat Chem Biol 4(7): 397-403. Audet M and Bouvier M (2012) Restructuring g-protein- coupled receptor activation. Cell 151(1): 14-23. Avlani VA, Gregory KJ, Morton CJ, Parker MW, Sexton PM and Christopoulos A (2007) Critical role for the second extracellular loop in the binding of both orthosteric and allosteric G protein-coupled receptor ligands. J Biol Chem 282(35): 25677-25686. Azzi M, Charest PG, Angers S, Rousseau G, Kohout T, Bouvier M and Pineyro G (2003) -arrestin-mediated activation of MAPK by inverse agonists reveals distinct active conformations for G protein-coupled receptors. Proc Natl Acad Sci U S A 100(20): 11406-11411. Barki-Harrington L, Luttrell LM and Rockman HA (2003) Dual inhibition of beta-adrenergic and angiotensin II receptors by a single antagonist: a functional role for receptor-receptor interaction in vivo. Circulation 108(13): 1611-1618. Barnett-Norris J, Lynch D and Reggio PH (2005) Lipids, lipid rafts and caveolae: their importance for GPCR signaling and their centrality to the endocannabinoid system. Life Sci 77(14): 1625-1639. Basso N and Terragno NA (2001) History about the discovery of the renin- angiotensin system. Hypertension 38(6): 1246-1249. Beaulieu JM, Sotnikova TD, Marion S, Lefkowitz RJ, Gainetdinov RR and Caron MG (2005) An Akt/-arrestin 2/PP2A signaling complex mediates dopaminergic neurotransmission and behavior. Cell 122(2): 261-273. Becamel C, Figge A, Poliak S, Dumuis A, Peles E, Bockaert J, Lubbert H and Ullmer C (2001) Interaction of serotonin 5-hydroxytryptamine type 2C receptors with PDZ10 of the multi-PDZ domain protein MUPP1. J Biol Chem 276(16): 12974-12982. Berg KA, Maayani S, Goldfarb J and Clarke WP (1998a) Pleiotropic behavior of 5-HT2A and 5-HT2C receptor agonists. Ann N Y Acad Sci 861: 104-110. Berg KA, Maayani S, Goldfarb J, Scaramellini C, Leff P and Clarke WP (1998b) Effector pathway-dependent relative efficacy at serotonin type 2A and 2C 282 receptors: evidence for agonist-directed trafficking of receptor stimulus. Mol Pharmacol 54(1): 94-104. Berg KA, Stout BD, Cropper JD, Maayani S and Clarke WP (1999) Novel actions of inverse agonists on 5-HT2C receptor systems. Mol Pharmacol 55(5): 863-872. Berk BC (2001) Vascular smooth muscle growth: autocrine growth mechanisms. Physiol Rev 81(3): 999-1030. Berk BC and Rao GN (1993) Angiotensin II-induced vascular smooth muscle cell hypertrophy: PDGF A-chain mediates the increase in cell size. J Cell Physiol 154(2): 368-380. Bessis AS, Rondard P, Gaven F, Brabet I, Triballeau N, Prezeau L, Acher F and Pin JP (2002) Closure of the Venus flytrap module of mGlur8 receptor and the activation process: Insights from mutations converting antagonists into agonists. Proc Natl Acad Sci U S A 99(17): 11097-11102. Bhowmick N, Narayan P and Puett D (1998) The endothelin subtype A receptor undergoes agonist- and antagonist-mediated internalization in the absence of signaling. Endocrinology 139(7): 3185-3192. Binet V, Brajon C, Le Corre L, Acher F, Pin JP and Prezeau L (2004) The heptahelical domain of GABA(B2) is activated directly by CGP7930, a positive allosteric modulator of the GABA(B) receptor. J Biol Chem 279(28): 29085- 29091. Bing C, Johnson IR and Broughton Pipkin F (1996) Angiotensin receptors in myometrium and myometrial vessels from uteri of women during the follicular and luteal phases of the menstrual cycle and in late pregnancy. Clin Sci 90(6): 499-505. Birdsall NJ, Burgen AS, Hulme EC, Stockton JM and Zigmond MJ (1983) The effect of McN-A-343 on muscarinic receptors in the cerebral cortex and heart. Br J Pharmacol 78(2): 257-259. Birdsall NJ, Farries T, Gharagozloo P, Kobayashi S, Lazareno S and Sugimoto M (1999) Subtype-selective positive cooperative interactions between brucine analogs and acetylcholine at muscarinic receptors: functional studies. Mol Pharmacol 55(4): 778-786. Birdsall NJ, Lazareno S and Matsui H (1996) Allosteric regulation of muscarinic receptors. Prog Brain Res 109: 147-151. Birnbaumer L, Pohl SL and Rodbell M (1971) The glucagon-sensitive adenyl cyclase system in plasma membranes of rat liver. II. Comparison between glucagon- and fluoride-stimulated activities. J Biol Chem 246(6): 1857-1860. 283 Blesen Tv, Hawes BE, Luttrell DK, Krueger KM, Touhara K, Porfflri E, Sakaue M, Luttrell LM and Lefkowitz RJ (1995) Receptor-tyrosine-kinase- and G- mediated MAP kinase activation by a common signalling pathway. Nature 376(6543): 781-784. Block GA, Martin KJ, de Francisco AL, Turner SA, Avram MM, Suranyi MG, Hercz G, Cunningham J, Abu-Alfa AK, Messa P, Coyne DW, Locatelli F, Cohen RM, Evenepoel P, Moe SM, Fournier A, Braun J, McCary LC, Zani VJ, Olson KA, Drueke TB and Goodman WG (2004) Cinacalcet for secondary hyperparathyroidism in patients receiving hemodialysis. N Engl J Med 350(15): 1516-1525. Bock A, Merten N, Schrage R, Dallanoce C, Batz J, Klockner J, Schmitz J, Matera C, Simon K, Kebig A, Peters L, Muller A, Schrobang-Ley J, Trankle C, Hoffmann C, De Amici M, Holzgrabe U, Kostenis E and Mohr K (2012) The allosteric vestibule of a seven transmembrane helical receptor controls G-protein coupling. Nat Commun 3: 1044. Bockaert J, Fagni L, Dumuis A and Marin P (2004) GPCR interacting proteins (GIP). Pharmacol Ther 103(3): 203-221. Bokoch MP, Zou Y, Rasmussen SG, Liu CW, Nygaard R, Rosenbaum DM, Fung JJ, Choi HJ, Thian FS, Kobilka TS, Puglisi JD, Weis WI, Pardo L, Prosser RS, Mueller L and Kobilka BK (2010) Ligand-specific regulation of the extracellular surface of a G-protein-coupled receptor. Nature 463(7277): 108-112. Bonhaus DW, Chang LK, Kwan J and Martin GR (1998) Dual activation and inhibition of adenylyl cyclase by cannabinoid receptor agonists: evidence for agonist-specific trafficking of intracellular responses. J Pharmacol Exp Ther 287(3): 884-888. Bos CL, Richel DJ, Ritsema T, Peppelenbosch MP and Versteeg HH (2004) Prostanoids and prostanoid receptors in signal transduction. The international journal of biochemistry & cell biology 36(7): 1187-1205. Bourguet CB, Goupil E, Tassy D, Hou X, Thouin E, Polyak F, Hébert TE, Claing A, Laporte SA, Chemtob S and Lubell WD (2011) Targeting the prostaglandin F2 receptor for preventing preterm labor with azapeptide tocolytics. J Med Chem 54(17): 6085-6097. Bourguet CB, Hou X, Chemtob S and Lubell WD (2009) Exploring the relationship between turn geometry and allosteric antagonism of peptide mimic ligands for the prostaglandin F2 receptor. Adv Exp Med Biol 611: 271-273. 284 Braun-Dullaeus RC, Mann MJ, Ziegler A, von der Leyen HE and Dzau VJ (1999) A novel role for the cyclin-dependent kinase inhibitor p27(Kip1) in angiotensin II-stimulated vascular smooth muscle cell hypertrophy. J Clin Invest 104(6): 815- 823. Braun-Menendez E and Page IH (1958) Suggested Revision of Nomenclature-- Angiotensin. Science 127(3292): 242. Breit A, Lagacé M and Bouvier M (2004) Hetero-oligomerization between 2- and 3-adrenergic receptors generates a -adrenergic signaling unit with distinct functional properties. J Biol Chem 279(27): 28756-28765. Breit A, Wolff K, Kalwa H, Jarry H, Buch T and Gudermann T (2006) The natural inverse agonist agouti-related protein induces arrestin-mediated endocytosis of melanocortin-3 and -4 receptors. J Biol Chem 281(49): 37447- 37456. Breitwieser GE (2004) G protein-coupled receptor oligomerization: implications for G protein activation and cell signaling. Circ Res 94(1): 17-27. Brennan SC and Conigrave AD (2009) Regulation of cellular signal transduction pathways by the extracellular calcium-sensing receptor. Curr Pharm Biotechnol 10(3): 270-281. Breyer MD and Breyer RM (2001) G protein-coupled prostanoid receptors and the kidney. Annu Rev Physiol 63: 579-605. Brodt-Eppley J and Myatt L (1999) Prostaglandin receptors in lower segment myometrium during gestation and labor. Obstet Gynecol 93(1): 89-93. Buhl AM, Johnson NL, Dhanasekaran N and Johnson GL (1995) G12 and G13 stimulate Rho-dependent stress fiber formation and focal adhesion assembly. J Biol Chem 270(42): 24631-24634. Bulenger S, Marullo S and Bouvier M (2005) Emerging role of homo- and heterodimerization in G-protein-coupled receptor biosynthesis and maturation. Trends Pharmacol Sci 26(3): 131-137. Cabrera-Vera TM, Vanhauwe J, Thomas TO, Medkova M, Preininger A, Mazzoni MR and Hamm HE (2003) Insights into G protein structure, function, and regulation. Endocr Rev 24(6): 765-781. Cassel D and Selinger Z (1976) Catecholamine-stimulated GTPase activity in turkey erythrocyte membranes. Biochim Biophys Acta 452(2): 538-551. 285 Cassel D and Selinger Z (1977) Mechanism of adenylate cyclase activation by cholera toxin: inhibition of GTP hydrolysis at the regulatory site. Proc Natl Acad Sci U S A 74(8): 3307-3311. Cavalier-Smith T (2005) Economy, Speed and Size Matter: Evolutionary Forces Driving Nuclear Genome Miniaturization and Expansion. Annals of Botany 95(1): 147-175. Cescato R, Schulz S, Waser B, Eltschinger V, Rivier JE, Wester HJ, Culler M, Ginj M, Liu Q, Schonbrunn A and Reubi JC (2006) Internalization of sst2, sst3, and sst5 receptors: effects of somatostatin agonists and antagonists. J Nucl Med 47(3): 502-511. Challis JR, Sloboda DM, Alfaidy N, Lye SJ, Gibb W, Patel FA, Whittle WL and Newnham JP (2002) Prostaglandins and mechanisms of preterm birth. Reproduction 124(1): 1-17. Charest PG and Bouvier M (2003) Palmitoylation of the V2 vasopressin receptor carboxyl tail enhances -arrestin recruitment leading to efficient receptor endocytosis and ERK1/2 activation. J Biol Chem 278(42): 41541-41551. Chemtob S, Beharry K, Rex J, Varma DR and Aranda JV (1990) Prostanoids determine the range of cerebral blood flow autoregulation of newborn piglets. Stroke 21(5): 777-784. Chen D, Fong HW and Davis JS (2001) Induction of c-fos and c-jun messenger ribonucleic acid expression by prostaglandin F2 is mediated by a protein kinase C-dependent extracellular signal-regulated kinase mitogen-activated protein kinase pathway in bovine luteal cells. Endocrinology 142(2): 887-895. Chen DB, Westfall SD, Fong HW, Roberson MS and Davis JS (1998) Prostaglandin F2 stimulates the Raf/MEK1/mitogen-activated protein kinase signaling cascade in bovine luteal cells. Endocrinology 139(9): 3876-3885. Chen X, Li W, Yoshida H, Tsuchida S, Nishimura H, Takemoto F, Okubo S, Fogo A, Matsusaka T and Ichikawa I (1997) Targeting deletion of angiotensin type 1B receptor gene in the mouse. The American journal of physiology 272(3 Pt 2): F299-304. Cherezov V, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK and Stevens RC (2007) High- resolution crystal structure of an engineered human 2-adrenergic G protein- coupled receptor. Science 318(5854): 1258-1265. 286 Cheung AH, Sigal IS, Dixon RA and Strader CD (1989) Agonist-promoted sequestration of the 2-adrenergic receptor requires regions involved in functional coupling with Gs. Mol Pharmacol 35(1): 132-138. Chi SS, Vetiska SM, Gill RS, Hsiung MS, Liu F and Van Tol HH (2010) Transactivation of PDGFR by dopamine D4 receptor does not require PDGFR dimerization. Molecular brain 3: 22. Chidiac P, Hébert TE, Valiquette M, Dennis M and Bouvier M (1994) Inverse agonist activity of -adrenergic antagonists. Mol Pharmacol 45(3): 490-499. Chien EY, Liu W, Zhao Q, Katritch V, Han GW, Hanson MA, Shi L, Newman AH, Javitch JA, Cherezov V and Stevens RC (2010) Structure of the human dopamine D3 receptor in complex with a D2/D3 selective antagonist. Science 330(6007): 1091-1095. Childers SR, Li X, Xiao R and Eisenach JC (2005) Allosteric modulation of adenosine A1 receptor coupling to G-proteins in brain. J Neurochem 93(3): 715- 723. Chini B and Parenti M (2009) G-protein-coupled receptors, cholesterol and palmitoylation: facts about fats. J Mol Endocrinol 42(5): 371-379. Choe HW, Kim YJ, Park JH, Morizumi T, Pai EF, Krauss N, Hofmann KP, Scheerer P and Ernst OP (2011) Crystal structure of metarhodopsin II. Nature 471(7340): 651-655. Christopoulos A and Kenakin T (2002) G protein-coupled receptor allosterism and complexing. Pharmacol Rev 54(2): 323-374. Christopoulos A, May LT, Avlani VA and Sexton PM (2004) G-protein-coupled receptor allosterism: the promise and the problem(s). Biochem Soc Trans 32(Pt 5): 873-877. Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy MR and Goodman RH (1993) Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365(6449): 855-859. Chuang TT, Iacovelli L, Sallese M and De Blasi A (1996) G protein-coupled receptors: heterologous regulation of homologous desensitization and its implications. Trends Pharmacol Sci 17(11): 416-421. Chung KY, Rasmussen SG, Liu T, Li S, DeVree BT, Chae PS, Calinski D, Kobilka BK, Woods VL, Jr. and Sunahara RK (2011) Conformational changes in the G protein Gs induced by the 2 adrenergic receptor. Nature 477(7366): 611- 615. 287 Ciruela F, Vilardaga JP and Fernandez-Duenas V (2010) Lighting up multiprotein complexes: lessons from GPCR oligomerization. Trends Biotechnol 28(8): 407- 415. Ciuffo GM, Alvarez SE and Fuentes LB (1998) Angiotensin II receptors induce tyrosine dephosphorylation in rat fetal membranes. Regul Pept 74(2-3): 129-135. Cluzeau J and Lubell WD (2005) Design, synthesis, and application of azabicyclo[X.Y.0]alkanone amino acids as constrained dipeptide surrogates and peptide mimics. Biopolymers 80(2-3): 98-150. Conn PJ, Christopoulos A and Lindsley CW (2009) Allosteric modulators of GPCRs: a novel approach for the treatment of CNS disorders. Nat Rev Drug Discov 8(1): 41-54. Cook JL, Giardina JF, Zhang Z and Re RN (2002) Intracellular angiotensin II increases the long isoform of PDGF mRNA in rat hepatoma cells. J Mol Cell Cardiol 34(11): 1525-1537. Cook JL, Mills SJ, Naquin RT, Alam J and Re RN (2007) Cleavage of the angiotensin II type 1 receptor and nuclear accumulation of the cytoplasmic carboxy-terminal fragment. Am J Physiol Cell Physiol 292(4): C1313-1322. Corre I, Baumann H and Hermouet S (1999) Regulation by Gi2 proteins of v-fms- induced proliferation and transformation via Src-kinase and STAT3. Oncogene 18(46): 6335-6342. Coso OA, Teramoto H, Simonds WF and Gutkind JS (1996) Signaling from G protein-coupled receptors to c-Jun kinase involves subunits of heterotrimeric G proteins acting on a Ras and Rac1-dependent pathway. J Biol Chem 271(8): 3963- 3966. Coureuil M, Lecuyer H, Scott MG, Boularan C, Enslen H, Soyer M, Mikaty G, Bourdoulous S, Nassif X and Marullo S (2010) Meningococcus Hijacks a 2- adrenoceptor/-Arrestin pathway to cross brain microvasculature endothelium. Cell 143(7): 1149-1160. Crespo P, Xu N, Simonds WF and Gutkind JS (1994) Ras-dependent activation of MAP kinase pathway mediated by G-protein beta gamma subunits. Nature 369(6479): 418-420. Cvejic S and Devi LA (1997) Dimerization of the -opioid receptor: implication for a role in receptor internalization. J Biol Chem 272(43): 26959-26964. 288 Daaka Y, Luttrell LM, Ahn S, Della Rocca GJ, Ferguson SS, Caron MG and Lefkowitz RJ (1998) Essential role for G protein-coupled receptor endocytosis in the activation of mitogen-activated protein kinase. J Biol Chem 273(2): 685-688. Daaka Y, Luttrell LM and Lefkowitz RJ (1997) Switching of the coupling of the 2-adrenergic receptor to different G proteins by protein kinase A. Nature 390(6655): 88-91. Dalle S, Ricketts W, Imamura T, Vollenweider P and Olefsky JM (2001) Insulin and insulin-like growth factor I receptors utilize different G protein signaling components. J Biol Chem 276(19): 15688-15695. Daniels D, Yee DK, Faulconbridge LF and Fluharty SJ (2005) Divergent behavioral roles of angiotensin receptor intracellular signaling cascades. Endocrinology 146(12): 5552-5560. Danser AH (1996) Local renin-angiotensin systems. Mol Cell Biochem 157(1-2): 211-216. Daub H, Wallasch C, Lankenau A, Herrlich A and Ullrich A (1997) Signal characteristics of G protein-transactivated EGF receptor. EMBO J 16(23): 7032- 7044. Daub H, Weiss FU, Wallasch C and Ullrich A (1996) Role of transactivation of the EGF receptor in signalling by G-protein-coupled receptors. Nature 379(6565): 557-560. Davis JS, Weakland LL, Weiland DA, Farese RV and West LA (1987) Prostaglandin F2 stimulates phosphatidylinositol 4,5-bisphosphate hydrolysis and mobilizes intracellular Ca2+ in bovine luteal cells. Proc Natl Acad Sci U S A 84(11): 3728-3732. de Gasparo M, Catt KJ, Inagami T, Wright JW and Unger T (2000a) International union of pharmacology. XXIII. The angiotensin II receptors. Pharmacol Rev 52(3): 415-472. de Gasparo M, Catt KJ, Inagami T, Wright JW and Unger T (2000b) International Union of Pharmacology. XXIII. The Angiotensin II Receptors. Pharmacol Rev 52(3): 415-472. De Lean A, Stadel JM and Lefkowitz RJ (1980) A ternary complex model explains the agonist-specific binding properties of the adenylate cyclase-coupled -adrenergic receptor. J Biol Chem 255(15): 7108-7117. De Mello WC (1998) Intracellular angiotensin II regulates the inward calcium current in cardiac myocytes. Hypertension 32(6): 976-982. 289 De Mello WC (2006) Renin increments the inward calcium current in the failing heart. J Hypertens 24(6): 1181-1186. de Rooij J, Zwartkruis FJ, Verheijen MH, Cool RH, Nijman SM, Wittinghofer A and Bos JL (1998) Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP. Nature 396(6710): 474-477. DeFea KA, Zalevsky J, Thoma MS, Dery O, Mullins RD and Bunnett NW (2000) -arrestin-dependent endocytosis of proteinase-activated receptor 2 is required for intracellular targeting of activated ERK1/2. J Cell Biol 148(6): 1267-1281. Delom F and Fessart D (2011) Role of Phosphorylation in the Control of Clathrin- Mediated Internalization of GPCR. International journal of cell biology 2011: 246954. Dessauer CW, Tesmer JJ, Sprang SR and Gilman AG (1998) Identification of a Gialpha binding site on type V adenylyl cyclase. J Biol Chem 273(40): 25831- 25839. Deupi X and Kobilka BK (2010) Energy landscapes as a tool to integrate GPCR structure, dynamics, and function. Physiology (Bethesda) 25(5): 293-303. Devost D and Zingg HH (2007) Novel in vitro system for functional assessment of oxytocin action. Am J Physiol Endocrinol Metab 292(1): E1-6. DeWire SM, Ahn S, Lefkowitz RJ and Shenoy SK (2007) -arrestins and cell signaling. Annu Rev Physiol 69: 483-510. Dhami GK, Dale LB, Anborgh PH, O'Connor-Halligan KE, Sterne-Marr R and Ferguson SS (2004) G Protein-coupled receptor kinase 2 regulator of G protein signaling homology domain binds to both metabotropic glutamate receptor 1a and Gq to attenuate signaling. J Biol Chem 279(16): 16614-16620. Di L, Kerns EH, Ma XJ, Huang Y and Carter GT (2008) Applications of high throughput microsomal stability assay in drug discovery. Combinatorial chemistry & high throughput screening 11(6): 469-476. Dias JA, Bonnet B, Weaver BA, Watts J, Kluetzman K, Thomas RM, Poli SM, Mutel V and Campo B (2011) A negative allosteric modulator demonstrates biased antagonism of the follicle stimulating hormone receptor. Mol Cell Endocrinol. Digby GJ, Conn PJ and Lindsley CW (2010) Orthosteric- and allosteric-induced ligand-directed trafficking at GPCRs. Curr Opin Drug Discov Devel 13(5): 587- 594. 290 Dikic I, Tokiwa G, Lev S, Courtneidge SA and Schlessinger J (1996) A role for Pyk2 and Src in linking G-protein-coupled receptors with MAP kinase activation. Nature 383(6600): 547-550. Dore AS, Robertson N, Errey JC, Ng I, Hollenstein K, Tehan B, Hurrell E, Bennett K, Congreve M, Magnani F, Tate CG, Weir M and Marshall FH (2011) Structure of the adenosine A(2A) receptor in complex with ZM241385 and the xanthines XAC and caffeine. Structure 19(9): 1283-1293. Dorn GW, 2nd, Becker MW and Davis MG (1992) Dissociation of the contractile and hypertrophic effects of vasoconstrictor prostanoids in vascular smooth muscle. J Biol Chem 267(34): 24897-24905. Dorr P, Westby M, Dobbs S, Griffin P, Irvine B, Macartney M, Mori J, Rickett G, Smith-Burchnell C, Napier C, Webster R, Armour D, Price D, Stammen B, Wood A and Perros M (2005) Maraviroc (UK-427,857), a potent, orally bioavailable, and selective small-molecule inhibitor of chemokine receptor CCR5 with broad- spectrum anti-human immunodeficiency virus type 1 activity. Antimicrob Agents Chemother 49(11): 4721-4732. Dragic T, Trkola A, Thompson DA, Cormier EG, Kajumo FA, Maxwell E, Lin SW, Ying W, Smith SO, Sakmar TP and Moore JP (2000) A binding pocket for a small molecule inhibitor of HIV-1 entry within the transmembrane helices of CCR5. Proc Natl Acad Sci U S A 97(10): 5639-5644. Du J, Sperling LS, Marrero MB, Phillips L and Delafontaine P (1996) G-protein and tyrosine kinase receptor cross-talk in rat aortic smooth muscle cells: thrombin- and angiotensin II-induced tyrosine phosphorylation of insulin receptor substrate-1 and insulin-like growth factor 1 receptor. Biochem Biophys Res Commun 218(3): 934-939. Dubey RK, Jackson EK and Luscher TF (1995) Nitric oxide inhibits angiotensin II-induced migration of rat aortic smooth muscle cell. Role of cyclic-nucleotides and angiotensin1 receptors. J Clin Invest 96(1): 141-149. Dupré DJ and Hébert TE (2006) Biosynthesis and trafficking of seven transmembrane receptor signalling complexes. Cell Signal 18(10): 1549-1559. Dupré DJ, Le Gouill C, Rola-Pleszczynski M and Stankova J (2001) Inverse agonist activity of selected ligands of platelet-activating factor receptor. J Pharmacol Exp Ther 299(1): 358-365. Dupré DJ, Robitaille M, Rebois RV and Hébert TE (2009) The role of G subunits in the organization, assembly, and function of GPCR signaling complexes. Annu Rev Pharmacol Toxicol 49: 31-56. 291 Duthey B, Caudron S, Perroy J, Bettler B, Fagni L, Pin JP and Prezeau L (2002) A single subunit (GB2) is required for G-protein activation by the heterodimeric GABA(B) receptor. J Biol Chem 277(5): 3236-3241. Dzau VJ (1989) Multiple pathways of angiotensin production in the blood vessel wall: evidence, possibilities and hypotheses. J Hypertens 7(12): 933-936. Eason MG, Jacinto MT and Liggett SB (1994) Contribution of ligand structure to activation of 2-adrenergic receptor subtype coupling to Gs. Mol Pharmacol 45(4): 696-702. Edelman AM, Blumenthal DK and Krebs EG (1987) Protein serine/threonine kinases. Annu Rev Biochem 56: 567-613. Egan SE, Giddings BW, Brooks MW, Buday L, Sizeland AM and Weinberg RA (1993) Association of Sos Ras exchange protein with Grb2 is implicated in tyrosine kinase signal transduction and transformation. Nature 363(6424): 45-51. Eguchi S, Dempsey PJ, Frank GD, Motley ED and Inagami T (2001) Activation of MAPKs by angiotensin II in vascular smooth muscle cells. Metalloprotease- dependent EGF receptor activation is required for activation of ERK and p38 MAPK but not for JNK. J Biol Chem 276(11): 7957-7962. Eguchi S, Numaguchi K, Iwasaki H, Matsumoto T, Yamakawa T, Utsunomiya H, Motley ED, Kawakatsu H, Owada KM, Hirata Y, Marumo F and Inagami T (1998) Calcium-dependent epidermal growth factor receptor transactivation mediates the angiotensin II-induced mitogen-activated protein kinase activation in vascular smooth muscle cells. J Biol Chem 273(15): 8890-8896. Engineer DM, Morris HR, Piper PJ and Sirois P (1978) The release of prostaglandins and thromboxanes from guinea-pig lung by slow reacting substance of anaphylaxis, and its inhibition. Br J Pharmacol 64(2): 211-218. Esposito G, Perrino C, Cannavo A, Schiattarella GG, Borgia F, Sannino A, Pironti G, Gargiulo G, Di Serafino L, Franzone A, Scudiero L, Grieco P, Indolfi C and Chiariello M (2011) EGFR trans-activation by urotensin II receptor is mediated by -arrestin recruitment and confers cardioprotection in pressure overload- induced cardiac hypertrophy. Basic Res Cardiol 106(4): 577-589. Esther CR, Jr., Howard TE, Marino EM, Goddard JM, Capecchi MR and Bernstein KE (1996) Mice lacking angiotensin-converting enzyme have low blood pressure, renal pathology, and reduced male fertility. Laboratory investigation; a journal of technical methods and pathology 74(5): 953-965. Fan C, Katsuyama M, Nishinaka T and Yabe-Nishimura C (2005) Transactivation of the EGF receptor and a PI3 kinase-ATF-1 pathway is involved in the 292 upregulation of NOX1, a catalytic subunit of NADPH oxidase. FEBS Lett 579(5): 1301-1305. Fan C, Katsuyama M, Wei H, Xia Q, Liu W and Yabe-Nishimura C (2010) Molecular mechanisms underlying PGF2-induced hypertrophy of vascular smooth muscle cells. Yakugaku zasshi : Journal of the Pharmaceutical Society of Japan 130(2): 211-214. Fang Y and Ferrie AM (2008) Label-free optical biosensor for ligand-directed functional selectivity acting on 2-adrenoceptor in living cells. FEBS Lett 582(5): 558-564. Fatkenheuer G, Pozniak AL, Johnson MA, Plettenberg A, Staszewski S, Hoepelman AI, Saag MS, Goebel FD, Rockstroh JK, Dezube BJ, Jenkins TM, Medhurst C, Sullivan JF, Ridgway C, Abel S, James IT, Youle M and van der Ryst E (2005) Efficacy of short-term monotherapy with maraviroc, a new CCR5 antagonist, in patients infected with HIV-1. Nat Med 11(11): 1170-1172. Faure M, Voyno-Yasenetskaya TA and Bourne HR (1994) cAMP and subunits of heterotrimeric G proteins stimulate the mitogen-activated protein kinase pathway in COS-7 cells. J Biol Chem 269(11): 7851-7854. Fessart D, Simaan M and Laporte SA (2005) c-Src regulates clathrin adapter protein 2 interaction with beta-arrestin and the angiotensin II type 1 receptor during clathrin- mediated internalization. Mol Endocrinol 19(2): 491-503. Fessart D, Simaan M, Zimmerman B, Comeau J, Hamdan FF, Wiseman PW, Bouvier M and Laporte SA (2007) Src-dependent phosphorylation of 2-adaptin dissociates the -arrestin-AP-2 complex. J Cell Sci 120(Pt 10): 1723-1732. Fischer DP, Hutchinson JA, Farrar D, O'Donovan PJ, Woodward DF and Marshall KM (2008) Loss of prostaglandin F2, but not thromboxane, responsiveness in pregnant human myometrium during labour. J Endocrinol 197(1): 171-179. Fischer OM, Hart S, Gschwind A and Ullrich A (2003) EGFR signal transactivation in cancer cells. Biochem Soc Trans 31(Pt 6): 1203-1208. Flower DR (1999) Modelling G-protein-coupled receptors for drug design. Biochim Biophys Acta 1422(3): 207-234. Fotiadis D, Liang Y, Filipek S, Saperstein DA, Engel A and Palczewski K (2003) Atomic-force microscopy: Rhodopsin dimers in native disc membranes. Nature 421(6919): 127-128. 293 Fredriksson R, Lagerstrom MC, Lundin LG and Schioth HB (2003) The G- protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Mol Pharmacol 63(6): 1256-1272. Fruman DA, Meyers RE and Cantley LC (1998) Phosphoinositide kinases. Annu Rev Biochem 67: 481-507. Fujino H, Srinivasan D, Pierce KL and Regan JW (2000) Differential regulation of prostaglandin F2 receptor isoforms by protein kinase C. Mol Pharmacol 57(2): 353-358. Fujino H, Srinivasan D and Regan JW (2002) Cellular Conditioning and Activation of β-Catenin Signaling by the FPB Prostanoid Receptor. J Biol Chem 277(50): 48786-48795. Fujisawa K, Fujita A, Ishizaki T, Saito Y and Narumiya S (1996) Identification of the Rho-binding domain of p160ROCK, a Rho-associated coiled-coil containing protein kinase. J Biol Chem 271(38): 23022-23028. Fujita T, Meguro T, Fukuyama R, Nakamuta H and Koida M (2002) New signaling pathway for parathyroid hormone and cyclic AMP action on extracellular-regulated kinase and cell proliferation in bone cells. Checkpoint of modulation by cyclic AMP. J Biol Chem 277(25): 22191-22200. Fung JJ, Deupi X, Pardo L, Yao XJ, Velez-Ruiz GA, Devree BT, Sunahara RK and Kobilka BK (2009) Ligand-regulated oligomerization of 2-adrenoceptors in a model lipid bilayer. The EMBO journal 28(21): 3315-3328. Gaborik Z, Szaszak M, Szidonya L, Balla B, Paku S, Catt KJ, Clark AJ and Hunyady L (2001) Beta-arrestin- and dynamin-dependent endocytosis of the AT1 angiotensin receptor. Mol Pharmacol 59(2): 239-247. Galandrin S and Bouvier M (2006) Distinct signaling profiles of 1 and 2 adrenergic receptor ligands toward adenylyl cyclase and mitogen-activated protein kinase reveals the pluridimensionality of efficacy. Mol Pharmacol 70(5): 1575- 1584. Galandrin S, Oligny-Longpre G, Bonin H, Ogawa K, Gales C and Bouvier M (2008) Conformational rearrangements and signaling cascades involved in ligand- biased mitogen-activated protein kinase signaling through the 1-adrenergic receptor. Mol Pharmacol 74(1): 162-172. Galandrin S, Oligny-Longpre G and Bouvier M (2007) The evasive nature of drug efficacy: implications for drug discovery. Trends Pharmacol Sci 28(8): 423-430. 294 Gales C, Van Durm JJ, Schaak S, Pontier S, Percherancier Y, Audet M, Paris H and Bouvier M (2006) Probing the activation-promoted structural rearrangements in preassembled receptor-G protein complexes. Nat Struct Mol Biol 13(9): 778- 786. Galvez T, Duthey B, Kniazeff J, Blahos J, Rovelli G, Bettler B, Prezeau L and Pin JP (2001) Allosteric interactions between GB1 and GB2 subunits are required for optimal GABA(B) receptor function. EMBO J 20(9): 2152-2159. Gbahou F, Rouleau A, Morisset S, Parmentier R, Crochet S, Lin JS, Ligneau X, Tardivel-Lacombe J, Stark H, Schunack W, Ganellin CR, Schwartz JC and Arrang JM (2003) Protean agonism at histamine H3 receptors in vitro and in vivo. Proc Natl Acad Sci U S A 100(19): 11086-11091. Gesty-Palmer D, Chen M, Reiter E, Ahn S, Nelson CD, Wang S, Eckhardt AE, Cowan CL, Spurney RF, Luttrell LM and Lefkowitz RJ (2006) Distinct - arrestin- and G protein-dependent pathways for parathyroid hormone receptor- stimulated ERK1/2 activation. J Biol Chem 281(16): 10856-10864. Gether U, Lin S and Kobilka BK (1995) Fluorescent labeling of purified 2- adrenergic receptor. Evidence for ligand-specific conformational changes. J Biol Chem 270(47): 28268-28275. Gilman AG (1987) G proteins: transducers of receptor-generated signals. Annu Rev Biochem 56: 615-649. Gnagey AL, Seidenberg M and Ellis J (1999) Site-directed mutagenesis reveals two epitopes involved in the subtype selectivity of the allosteric interactions of gallamine at muscarinic acetylcholine receptors. Mol Pharmacol 56(6): 1245- 1253. Gohla A, Harhammer R and Schultz G (1998) The G-protein G13 but not G12 mediates signaling from lysophosphatidic acid receptor via epidermal growth factor receptor to Rho. J Biol Chem 273(8): 4653-4659. Goldblatt MW (1935) Properties of human seminal plasma. J Physiol (Lond) 84(2): 208-218. Gomes I, Jordan BA, Gupta A, Trapaidze N, Nagy V and Devi LA (2000) Heterodimerization of mu and delta opioid receptors: A role in opiate synergy. J Neurosci 20(22): RC110. Goodfriend TL and Lin SY (1970) Receptors for angiotensin I and II. Circ Res 27(1 Suppl 1): 163-174. 295 Goodman OB, Jr., Krupnick JG, Santini F, Gurevich VV, Penn RB, Gagnon AW, Keen JH and Benovic JL (1996) Beta-arrestin acts as a clathrin adaptor in endocytosis of the beta2-adrenergic receptor. Nature 383(6599): 447-450. Goodman WG, Hladik GA, Turner SA, Blaisdell PW, Goodkin DA, Liu W, Barri YM, Cohen RM and Coburn JW (2002) The Calcimimetic agent AMG 073 lowers plasma parathyroid hormone levels in hemodialysis patients with secondary hyperparathyroidism. J Am Soc Nephrol 13(4): 1017-1024. Goto Y, Arai-Otsuki S, Tachibana Y, Ichikawa D, Ozaki S, Takahashi H, Iwasawa Y, Okamoto O, Okuda S, Ohta H and Sagara T (2006) Identification of a novel spiropiperidine opioid receptor-like 1 antagonist class by a focused library approach featuring 3D-pharmacophore similarity. J Med Chem 49(3): 847-849. Goudet C, Gaven F, Kniazeff J, Vol C, Liu J, Cohen-Gonsaud M, Acher F, Prezeau L and Pin JP (2004) Heptahelical domain of metabotropic glutamate receptor 5 behaves like rhodopsin-like receptors. Proc Natl Acad Sci U S A 101(1): 378-383. Goupil E, Laporte SA and Hébert TE (2012a) Functional Selectivity in GPCR Signaling: Understanding the Full Spectrum of Receptor Conformations. Mini reviews in medicinal chemistry. Goupil E, Tassy D, Bourguet C, Quiniou C, Wisehart V, Pétrin D, Le Gouill C, Devost D, Zingg HH, Bouvier M, Saragovi HU, Chemtob S, Lubell WD, Claing A, Hébert TE and Laporte SA (2010) A novel biased allosteric compound inhibitor of parturition selectively impedes the prostaglandin F2-mediated Rho/ROCK signaling pathway. J Biol Chem 285(33): 25624-25636. Goupil E, Wisehart V, Khoury E, Zimmerman B, Jaffal S, Hébert TE and Laporte SA (2012b) Biasing the Prostaglandin F2 Receptor Responses toward EGFR- Dependent Transactivation of MAPK. Mol Endocrinol 26(7): 1189-1202. Granier S, Kim S, Shafer AM, Ratnala VR, Fung JJ, Zare RN and Kobilka B (2007) Structure and conformational changes in the C-terminal domain of the 2- adrenoceptor: insights from fluorescence resonance energy transfer studies. J Biol Chem 282(18): 13895-13905. Granier S and Kobilka B (2012) A new era of GPCR structural and chemical biology. Nature Chem Biol 8(8): 670-673. Granier S, Manglik A, Kruse AC, Kobilka TS, Thian FS, Weis WI and Kobilka BK (2012) Structure of the delta-opioid receptor bound to naltrindole. Nature 485(7398): 400-404. 296 Granier S, Terrillon S, Pascal R, Demene H, Bouvier M, Guillon G and Mendre C (2004) A cyclic peptide mimicking the third intracellular loop of the V2 vasopressin receptor inhibits signaling through its interaction with receptor dimer and G protein. J Biol Chem 279(49): 50904-50914. Graves PE, Pierce KL, Bailey TJ, Rueda BR, Gil DW, Woodward DF, Yool AJ, Hoyer PB and Regan JW (1995) Cloning of a receptor for prostaglandin F2 from the ovine corpus luteum. Endocrinology 136(8): 3430-3436. Gray JA, Bhatnagar A, Gurevich VV and Roth BL (2003) The interaction of a constitutively active arrestin with the arrestin-insensitive 5-HT(2A) receptor induces agonist-independent internalization. Mol Pharmacol 63(5): 961-972. Gray JA and Roth BL (2001) Paradoxical trafficking and regulation of 5-HT(2A) receptors by agonists and antagonists. Brain Res Bull 56(5): 441-451. Gregory KJ, Hall NE, Tobin AB, Sexton PM and Christopoulos A (2010) Identification of orthosteric and allosteric site mutations in M2 muscarinic acetylcholine receptors that contribute to ligand-selective signaling bias. J Biol Chem 285(10): 7459-7474. Griffin BW, Klimko P, Crider JY and Sharif NA (1999) AL-8810: a novel prostaglandin F2 analog with selective antagonist effects at the prostaglandin F2 (FP) receptor. J Pharmacol Exp Ther 290(3): 1278-1284. Griffin MT, Figueroa KW, Liller S and Ehlert FJ (2007) Estimation of agonist activity at G protein-coupled receptors: analysis of M2 muscarinic receptor signaling through Gi/o,Gs, and G15. J Pharmacol Exp Ther 321(3): 1193-1207. Gross GA, Imamura T, Luedke C, Vogt SK, Olson LM, Nelson DM, Sadovsky Y and Muglia LJ (1998) Opposing actions of prostaglandins and oxytocin determine the onset of murine labor. Proc Natl Acad Sci U S A 95(20): 11875-11879. Gsandtner I, Charalambous C, Stefan E, Ogris E, Freissmuth M and Zezula J (2005) Heterotrimeric G protein-independent signaling of a G protein-coupled receptor. Direct binding of ARNO/cytohesin-2 to the carboxyl terminus of the A2A adenosine receptor is necessary for sustained activation of the ERK/MAP kinase pathway. J Biol Chem 280(36): 31898-31905. Gu Y, Di WL, Kelsell DP and Zicha D (2004) Quantitative fluorescence resonance energy transfer (FRET) measurement with acceptor photobleaching and spectral unmixing. J Microsc 215(Pt 2): 162-173. Guan R, Feng X, Wu X, Zhang M, Zhang X, Hébert TE and Segaloff DL (2009) Bioluminescence resonance energy transfer studies reveal constitutive dimerization of the human lutropin receptor and a lack of correlation between 297 receptor activation and the propensity for dimerization. J Biol Chem 284(12): 7483-7494. Guan R, Wu X, Feng X, Zhang M, Hébert TE and Segaloff DL (2010) Structural determinants underlying constitutive dimerization of unoccupied human follitropin receptors. Cell Signal 22(2): 247-256. Guillet-Deniau I, Burnol AF and Girard J (1997) Identification and localization of a skeletal muscle secrotonin 5-HT2A receptor coupled to the Jak/STAT pathway. J Biol Chem 272(23): 14825-14829. Gurevich VV and Gurevich EV (2008) GPCR monomers and oligomers: it takes all kinds. Trends Neurosci 31(2): 74-81. Gutkind JS (2000) Regulation of mitogen-activated protein kinase signaling networks by G protein-coupled receptors. Science's STKE : signal transduction knowledge environment 2000(40): re1. Haga K, Kruse AC, Asada H, Yurugi-Kobayashi T, Shiroishi M, Zhang C, Weis WI, Okada T, Kobilka BK, Haga T and Kobayashi T (2012) Structure of the human M2 muscarinic acetylcholine receptor bound to an antagonist. Nature 482(7386): 547-551. Hakeda Y, Harada S, Matsumoto T, Tezuka K, Higashino K, Kodama H, Hashimoto-Goto T, Ogata E and Kumegawa M (1991) Prostaglandin F2 stimulates proliferation of clonal osteoblastic MC3T3-E1 cells by up-regulation of insulin-like growth factor I receptors. J Biol Chem 266(31): 21044-21050. Hall RA, Premont RT, Chow CW, Blitzer JT, Pitcher JA, Claing A, Stoffel RH, Barak LS, Shenolikar S, Weinman EJ, Grinstein S and Lefkowitz RJ (1998) The 2-adrenergic receptor interacts with the Na+/H+-exchanger regulatory factor to control Na+/H+ exchange. Nature 392(6676): 626-630. Haller H, Lindschau C, Erdmann B, Quass P and Luft FC (1996) Effects of intracellular angiotensin II in vascular smooth muscle cells. Circ Res 79(4): 765- 772. Haller H, Lindschau C, Quass P and Luft FC (1999) Intracellular actions of angiotensin II in vascular smooth muscle cells. J Am Soc Nephrol 10 Suppl 11: S75-83. Han Y, Moreira IS, Urizar E, Weinstein H and Javitch JA (2009) Allosteric communication between protomers of dopamine class A GPCR dimers modulates activation. Nat Chem Biol 5(9): 688-695. 298 Hanessian S, McNaughton-Smith G, Lombart H-G and Lubell WD (1997) Design and Synthesis of Conformationally Constrained Amino Acids as Versatile Scaffolds and Peptide Mimetics. Tetrahedron 53(38): 12789-12854. Hanson MA, Cherezov V, Griffith MT, Roth CB, Jaakola VP, Chien EY, Velasquez J, Kuhn P and Stevens RC (2008) A specific cholesterol binding site is established by the 2.8 A structure of the human beta2-adrenergic receptor. Structure 16(6): 897-905. Hanson MA, Roth CB, Jo E, Griffith MT, Scott FL, Reinhart G, Desale H, Clemons B, Cahalan SM, Schuerer SC, Sanna MG, Han GW, Kuhn P, Rosen H and Stevens RC (2012) Crystal structure of a lipid G protein-coupled receptor. Science 335(6070): 851-855. Hanssen RG, Aarden EM, van der Venne WP, Pang PK and Wendelaar Bonga SE (1991) Regulation of secretion of the teleost fish hormone stanniocalcin: effects of extracellular calcium. Gen Comp Endocrinol 84(1): 155-163. Hao CM and Breyer MD (2008) Physiological regulation of prostaglandins in the kidney. Annu Rev Physiol 70: 357-377. Harder T and Simons K (1997) Caveolae, DIGs, and the dynamics of sphingolipid-cholesterol microdomains. Curr Opin Cell Biol 9(4): 534-542. Harvey CD, Ehrhardt AG, Cellurale C, Zhong H, Yasuda R, Davis RJ and Svoboda K (2008) A genetically encoded fluorescent sensor of ERK activity. Proc Natl Acad Sci U S A 105(49): 19264-19269. Hawes BE, Luttrell LM, van Biesen T and Lefkowitz RJ (1996) Phosphatidylinositol 3-kinase is an early intermediate in the G-mediated mitogen-activated protein kinase signaling pathway. J Biol Chem 271(21): 12133- 12136. Hayashi K and Miyamoto A (1999) Angiotensin II Interacts with Prostaglandin F2α and Endothelin-1 as a Local Luteolytic Factor in the Bovine Corpus Luteum In Vitro. Biol Reprod 60(5): 1104-1109. Hébert RL, Carmosino M, Saito O, Yang G, Jackson CA, Qi Z, Breyer RM, Natarajan C, Hata AN, Zhang Y, Guan Y and Breyer MD (2005) Characterization of a rabbit kidney prostaglandin F2 receptor exhibiting G(i)-restricted signaling that inhibits water absorption in the collecting duct. J Biol Chem 280(41): 35028- 35037. Hébert TE and Bouvier M (1998) Structural and functional aspects of G protein- coupled receptor oligomerization. Biochem Cell Biol 76(1): 1-11. 299 Hébert TE, Moffett S, Morello JP, Loisel TP, Bichet DG, Barret C and Bouvier M (1996) A peptide derived from a 2-adrenergic receptor transmembrane domain inhibits both receptor dimerization and activation. J Biol Chem 271(27): 16384- 16392. Heeneman S, Haendeler J, Saito Y, Ishida M and Berk BC (2000) Angiotensin II induces transactivation of two different populations of the platelet-derived growth factor beta receptor. Key role for the p66 adaptor protein Shc. J Biol Chem 275(21): 15926-15932. Herskovits JS, Burgess CC, Obar RA and Vallee RB (1993) Effects of mutant rat dynamin on endocytosis. J Cell Biol 122(3): 565-578. Higgins JB and Casey PJ (1994) In vitro processing of recombinant G protein subunits. Requirements for assembly of an active complex. J Biol Chem 269(12): 9067-9073. Hillion J, Canals M, Torvinen M, Casado V, Scott R, Terasmaa A, Hansson A, Watson S, Olah ME, Mallol J, Canela EI, Zoli M, Agnati LF, Ibanez CF, Lluis C, Franco R, Ferre S and Fuxe K (2002) Coaggregation, cointernalization, and codesensitization of adenosine A2A receptors and dopamine D2 receptors. J Biol Chem 277(20): 18091-18097. Hippe H-J, Wolf NM, Abu-Taha I, Mehringer R, Just S, Lutz S, Niroomand F, Postel EH, Katus HA, Rottbauer W and Wieland T (2009) The interaction of nucleoside diphosphate kinase B with Gβγ dimers controls heterotrimeric G protein function. Proceedings of the National Academy of Sciences 106(38): 16269-16274. Hlavackova V, Goudet C, Kniazeff J, Zikova A, Maurel D, Vol C, Trojanova J, Prezeau L, Pin JP and Blahos J (2005) Evidence for a single heptahelical domain being turned on upon activation of a dimeric GPCR. EMBO J 24(3): 499-509. Hofmann KP, Scheerer P, Hildebrand PW, Choe HW, Park JH, Heck M and Ernst OP (2009) A G protein-coupled receptor at work: the rhodopsin model. Trends Biochem Sci 34(11): 540-552. Holloway AC, Qian H, Pipolo L, Ziogas J, Miura S, Karnik S, Southwell BR, Lew MJ and Thomas WG (2002) Side-chain substitutions within angiotensin II reveal different requirements for signaling, internalization, and phosphorylation of type 1A angiotensin receptors. Mol Pharmacol 61(4): 768-777. Holst B, Frimurer TM, Mokrosinski J, Halkjaer T, Cullberg KB, Underwood CR and Schwartz TW (2009) Overlapping binding site for the endogenous agonist, small-molecule agonists, and ago-allosteric modulators on the ghrelin receptor. Mol Pharmacol 75(1): 44-59. 300 Husain S, Jafri F and Crosson CE (2005) Acute effects of PGF2 on MMP-2 secretion from human ciliary muscle cells: a PKC- and ERK-dependent process. Invest Ophthalmol Vis Sci 46(5): 1706-1713. Hwang JI, Choi S, Fraser ID, Chang MS and Simon MI (2005) Silencing the expression of multiple G-subunits eliminates signaling mediated by all four families of G proteins. Proc Natl Acad Sci U S A 102(27): 9493-9498. Inagami T (1995) Recent progress in molecular and cell biological studies of angiotensin receptors. Curr Opin Nephrol Hypertens 4(1): 47-54. Insel PA, Head BP, Ostrom RS, Patel HH, Swaney JS, Tang CM and Roth DM (2005) Caveolae and lipid rafts: G protein-coupled receptor signaling microdomains in cardiac myocytes. Ann N Y Acad Sci 1047: 166-172. Ishida M, Ishida T, Thomas SM and Berk BC (1998) Activation of extracellular signal-regulated kinases (ERK1/2) by angiotensin II is dependent on c-Src in vascular smooth muscle cells. Circ Res 82(1): 7-12. Ito K, Shimomura E, Iwanaga T, Shiraishi M, Shindo K, Nakamura J, Nagumo H, Seto M, Sasaki Y and Takuwa Y (2003) Essential role of rho kinase in the Ca2+ sensitization of prostaglandin F2-induced contraction of rabbit aortae. J Physiol 546(Pt 3): 823-836. Ito M, Oliverio MI, Mannon PJ, Best CF, Maeda N, Smithies O and Coffman TM (1995) Regulation of blood pressure by the type 1A angiotensin II receptor gene. Proc Natl Acad Sci U S A 92(8): 3521-3525. Ito S, Sakamoto K, Mochizuki-Oda N, Ezashi T, Miwa K, Okuda-Ashitaka E, Shevchenko VI, Kiso Y and Hayaishi O (1994a) Prostaglandin F2 receptor is coupled to Gq in cDNA-transfected Chinese hamster ovary cells. Biochem Biophys Res Commun 200(2): 756-762. Ito S, Sakamoto K, Mochizuki-Oda N, Ezashi T, Miwa K, Okuda-Ashitaka E, Shevchenko VI, Kiso Y and Hayaishi O (1994b) Prostaglandin F2 receptor is coupled to Gq in cDNA-transfected Chinese hamster ovary cells. Biochem Biophys Res Commun 200(2): 756-762. Itoh RE, Kurokawa K, Ohba Y, Yoshizaki H, Mochizuki N and Matsuda M (2002) Activation of rac and cdc42 video imaged by fluorescent resonance energy transfer-based single-molecule probes in the membrane of living cells. Mol Cell Biol 22(18): 6582-6591. 301 Jaakola VP, Griffith MT, Hanson MA, Cherezov V, Chien EY, Lane JR, Ijzerman AP and Stevens RC (2008) The 2.6 angstrom crystal structure of a human A2A adenosine receptor bound to an antagonist. Science 322(5905): 1211-1217. Jabbour HN, Sales KJ, Boddy SC, Anderson RA and Williams AR (2005) A positive feedback loop that regulates cyclooxygenase-2 expression and prostaglandin F2 synthesis via the F-series-prostanoid receptor and extracellular signal-regulated kinase 1/2 signaling pathway. Endocrinology 146(11): 4657- 4664. Jaffe AB and Hall A (2005) Rho GTPases: biochemistry and biology. Annu Rev Cell Dev Biol 21: 247-269. Jard S, Cantau B and Jakobs KH (1981) Angiotensin II and -adrenergic agonists inhibit rat liver adenylate cyclase. J Biol Chem 256(6): 2603-2606. Jimenez de Asua L and Goin M (1997) Prostaglandin F2 (PGF2) triggers protein kinase C (PKC) and tyrosine kinase activity in cultured mammalian cells. Adv Exp Med Biol 400A: 531-538. Jones KA, Borowsky B, Tamm JA, Craig DA, Durkin MM, Dai M, Yao WJ, Johnson M, Gunwaldsen C, Huang LY, Tang C, Shen Q, Salon JA, Morse K, Laz T, Smith KE, Nagarathnam D, Noble SA, Branchek TA and Gerald C (1998) GABA(B) receptors function as a heteromeric assembly of the subunits GABA(B)R1 and GABA(B)R2. Nature 396(6712): 674-679. Jordan BA, Trapaidze N, Gomes I, Nivarthi R and Devi LA (2001) Oligomerization of opioid receptors with 2-adrenergic receptors: a role in trafficking and mitogen-activated protein kinase activation. Proc Natl Acad Sci U S A 98(1): 343-348. Joseph KS, Kramer MS, Marcoux S, Ohlsson A, Wen SW, Allen A and Platt R (1998) Determinants of preterm birth rates in Canada from 1981 through 1983 and from 1992 through 1994. N Engl J Med 339(20): 1434-1439. Kalatskaya I, Berchiche YA, Gravel S, Limberg BJ, Rosenbaum JS and Heveker N (2009) AMD3100 is a CXCR7 ligand with allosteric agonist properties. Mol Pharmacol 75(5): 1240-1247. Kamal M and Jockers R (2009) Bitopic ligands: all-in-one orthosteric and allosteric. F1000 Biol Rep 1. Kamon M, Fujita D, Goto N, Amano H and Sakamoto K (2008) Prostaglandin F2 negatively regulates bone resorption in murine osteoclast development. Prostaglandins Other Lipid Mediat 87(1-4): 26-33. 302 Kamp TJ and Hell JW (2000) Regulation of cardiac L-type calcium channels by protein kinase A and protein kinase C. Circ Res 87(12): 1095-1102. Kang KH, Shim JJ, Banerjee M and Newman JH (1996) PGF2 causes bronchoconstriction and pulmonary vasoconstriction via thromboxane receptors in rat lung. The Korean journal of internal medicine 11(1): 74-81. Katritch V, Cherezov V and Stevens RC (2012) Diversity and modularity of G protein-coupled receptor structures. Trends Pharmacol Sci 33(1): 17-27. Kaupmann K, Malitschek B, Schuler V, Heid J, Froestl W, Beck P, Mosbacher J, Bischoff S, Kulik A, Shigemoto R, Karschin A and Bettler B (1998) GABA(B)- receptor subtypes assemble into functional heteromeric complexes. Nature 396(6712): 683-687. Kawasaki H, Springett GM, Mochizuki N, Toki S, Nakaya M, Matsuda M, Housman DE and Graybiel AM (1998) A family of cAMP-binding proteins that directly activate Rap1. Science 282(5397): 2275-2279. Kenakin T (1995) Agonist-receptor efficacy. II. Agonist trafficking of receptor signals. Trends Pharmacol Sci 16(7): 232-238. Kenakin T (2003) Ligand-selective receptor conformations revisited: the promise and the problem. Trends Pharmacol Sci 24(7): 346-354. Kenakin T (2007) Functional selectivity through protean and biased agonism: who steers the ship? Mol Pharmacol 72(6): 1393-1401. Kenakin T (2009) Biased agonism. F1000 Biol Rep 1. Kenakin T (2010a) The Evolution of Receptors: From On–Off Switches to Microprocessors. John Wiley & Sons, Inc. Kenakin T (2010b) G protein coupled receptors as allosteric proteins and the role of allosteric modulators. J Recept Signal Transduct Res 30(5): 313-321. Kenakin T (2011) Functional selectivity and biased receptor signaling. J Pharmacol Exp Ther 336(2): 296-302. Kenakin T and Miller LJ (2010) Seven transmembrane receptors as shapeshifting proteins: the impact of allosteric modulation and functional selectivity on new drug discovery. Pharmacol Rev 62(2): 265-304. Kenakin TP (2012) Biased signalling and allosteric machines: new vistas and challenges for drug discovery. Br J Pharmacol 165(6): 1659-1669. 303 Kendall RT and Luttrell LM (2009) Diversity in arrestin function. Cellular and molecular life sciences : CMLS 66(18): 2953-2973. Keov P, Sexton PM and Christopoulos A (2011) Allosteric modulation of G protein-coupled receptors: a pharmacological perspective. Neuropharmacology 60(1): 24-35. Kim HS, Krege JH, Kluckman KD, Hagaman JR, Hodgin JB, Best CF, Jennette JC, Coffman TM, Maeda N and Smithies O (1995) Genetic control of blood pressure and the angiotensinogen locus. Proc Natl Acad Sci U S A 92(7): 2735- 2739. Kim IM, Tilley DG, Chen J, Salazar NC, Whalen EJ, Violin JD and Rockman HA (2008) -blockers alprenolol and carvedilol stimulate -arrestin-mediated EGFR transactivation. Proc Natl Acad Sci U S A 105(38): 14555-14560. Kim K-S, Abraham D, Williams B, Violin JD, Mao L and Rockman HA (2012a) β-Arrestin-biased AT1R stimulation promotes cell survival during acute cardiac injury. American Journal of Physiology - Heart and Circulatory Physiology 303(8): H1001-H1010. Kim S, Zhan Y, Izumi Y, Yasumoto H, Yano M and Iwao H (2000) In vivo activation of rat aortic platelet-derived growth factor and epidermal growth factor receptors by angiotensin II and hypertension. Arterioscler Thromb Vasc Biol 20(12): 2539-2545. Kim YT, Moon SK, Maruyama T, Narumiya S and Dore S (2012b) Prostaglandin FP receptor inhibitor reduces ischemic brain damage and neurotoxicity. Neurobiol Dis 48(1): 58-65. Kitanaka J, Hasimoto H, Sugimoto Y, Negishi M, Aino H, Gotoh M, Ichikawa A and Baba A (1994) Cloning and expression of a cDNA for rat prostaglandin F2 receptor. Prostaglandins 48(1): 31-41. Klabunde RE (2012) Cardiovascular Physiology Concepts. Second ed. Lippincott Williams & Wilkins, Philadelphia. Klco JM, Wiegand CB, Narzinski K and Baranski TJ (2005) Essential role for the second extracellular loop in C5a receptor activation. Nat Struct Mol Biol 12(4): 320-326. Kniazeff J, Prezeau L, Rondard P, Pin JP and Goudet C (2011) Dimers and beyond: The functional puzzles of class C GPCRs. Pharmacol Ther. Kobayashi K, Imanishi T and Akasaka T (2006) Endothelial progenitor cell differentiation and senescence in an angiotensin II-infusion rat model. 304 Hypertension research : official journal of the Japanese Society of Hypertension 29(6): 449-455. Kobilka BK and Deupi X (2007) Conformational complexity of G-protein- coupled receptors. Trends Pharmacol Sci 28(8): 397-406. Kostenis E and Mohr K (1996) Two-point kinetic experiments to quantify allosteric effects on radioligand dissociation. Trends Pharmacol Sci 17(8): 280- 283. Kotecha SA, Oak JN, Jackson MF, Perez Y, Orser BA, Van Tol HH and MacDonald JF (2002) A D2 class dopamine receptor transactivates a receptor tyrosine kinase to inhibit NMDA receptor transmission. Neuron 35(6): 1111- 1122. Kozasa T, Jiang X, Hart MJ, Sternweis PM, Singer WD, Gilman AG, Bollag G and Sternweis PC (1998) p115 RhoGEF, a GTPase activating protein for G12 and G13. Science 280(5372): 2109-2111. Kranenburg O, Verlaan I, Hordijk PL and Moolenaar WH (1997) Gi-mediated activation of the Ras/MAP kinase pathway involves a 100 kDa tyrosine- phosphorylated Grb2 SH3 binding protein, but not Src nor Shc. EMBO J 16(11): 3097-3105. Krejci A and Tucek S (2001) Changes of cooperativity between N- methylscopolamine and allosteric modulators alcuronium and gallamine induced by mutations of external loops of muscarinic M(3) receptors. Mol Pharmacol 60(4): 761-767. Krumins AM and Gilman AG (2006) Targeted Knockdown of G Protein Subunits Selectively Prevents Receptor-mediated Modulation of Effectors and Reveals Complex Changes in Non-targeted Signaling Proteins. J Biol Chem 281(15): 10250-10262. Krupnick JG and Benovic JL (1998) The role of receptor kinases and arrestins in G protein-coupled receptor regulation. Annu Rev Pharmacol Toxicol 38: 289-319. Kruse AC, Hu J, Pan AC, Arlow DH, Rosenbaum DM, Rosemond E, Green HF, Liu T, Chae PS, Dror RO, Shaw DE, Weis WI, Wess J and Kobilka BK (2012) Structure and dynamics of the M3 muscarinic acetylcholine receptor. Nature 482(7386): 552-556. Kukkonen JP, Jansson CC and Akerman KE (2001) Agonist trafficking of G(i/o)- mediated (2A)-adrenoceptor responses in HEL 92.1.7 cells. Br J Pharmacol 132(7): 1477-1484. 305 Kunapuli P, Lawson JA, Rokach J and FitzGerald GA (1997) Functional characterization of the ocular prostaglandin f2 (PGF2) receptor. Activation by the isoprostane, 12-iso-PGF2. J Biol Chem 272(43): 27147-27154. Kuner R, Kohr G, Grunewald S, Eisenhardt G, Bach A and Kornau HC (1999) Role of heteromer formation in GABAB receptor function. Science 283(5398): 74-77. Kunishima N, Shimada Y, Tsuji Y, Sato T, Yamamoto M, Kumasaka T, Nakanishi S, Jingami H and Morikawa K (2000) Structural basis of glutamate recognition by a dimeric metabotropic glutamate receptor. Nature 407(6807): 971-977. Kurokawa K and Matsuda M (2005) Localized RhoA activation as a requirement for the induction of membrane ruffling. Mol Biol Cell 16(9): 4294-4303. Kusuhara M, Takahashi E, Peterson TE, Abe J, Ishida M, Han J, Ulevitch R and Berk BC (1998) p38 Kinase is a negative regulator of angiotensin II signal transduction in vascular smooth muscle cells: effects on Na+/H+ exchange and ERK1/2. Circ Res 83(8): 824-831. Lagerstrom MC and Schioth HB (2008) Structural diversity of G protein-coupled receptors and significance for drug discovery. Nat Rev Drug Discov 7(4): 339- 357. Lai J, Jin H, Yang R, Winer J, Li W, Yen R, King KL, Zeigler F, Ko A, Cheng J, Bunting S and Paoni NF (1996) Prostaglandin F2 induces cardiac myocyte hypertrophy in vitro and cardiac growth in vivo. The American journal of physiology 271(6 Pt 2): H2197-2208. Lambright DG, Sondek J, Bohm A, Skiba NP, Hamm HE and Sigler PB (1996) The 2.0 A crystal structure of a heterotrimeric G protein. Nature 379(6563): 311- 319. Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, Devon K, Dewar K, Doyle M, FitzHugh W, Funke R, Gage D, Harris K, Heaford A, Howland J, Kann L, Lehoczky J, LeVine R, McEwan P, McKernan K, Meldrim J, Mesirov JP, Miranda C, Morris W, Naylor J, Raymond C, Rosetti M, Santos R, Sheridan A, Sougnez C, Stange-Thomann N, Stojanovic N, Subramanian A, Wyman D, Rogers J, Sulston J, Ainscough R, Beck S, Bentley D, Burton J, Clee C, Carter N, Coulson A, Deadman R, Deloukas P, Dunham A, Dunham I, Durbin R, French L, Grafham D, Gregory S, Hubbard T, Humphray S, Hunt A, Jones M, Lloyd C, McMurray A, Matthews L, Mercer S, Milne S, Mullikin JC, Mungall A, Plumb R, Ross M, Shownkeen R, Sims S, Waterston RH, Wilson RK, Hillier LW, McPherson JD, Marra MA, Mardis ER, Fulton LA, Chinwalla AT, Pepin KH, Gish WR, Chissoe SL, Wendl MC, Delehaunty KD, Miner TL, Delehaunty A, 306 Kramer JB, Cook LL, Fulton RS, Johnson DL, Minx PJ, Clifton SW, Hawkins T, Branscomb E, Predki P, Richardson P, Wenning S, Slezak T, Doggett N, Cheng JF, Olsen A, Lucas S, Elkin C, Uberbacher E, Frazier M, Gibbs RA, Muzny DM, Scherer SE, Bouck JB, Sodergren EJ, Worley KC, Rives CM, Gorrell JH, Metzker ML, Naylor SL, Kucherlapati RS, Nelson DL, Weinstock GM, Sakaki Y, Fujiyama A, Hattori M, Yada T, Toyoda A, Itoh T, Kawagoe C, Watanabe H, Totoki Y, Taylor T, Weissenbach J, Heilig R, Saurin W, Artiguenave F, Brottier P, Bruls T, Pelletier E, Robert C, Wincker P, Smith DR, Doucette-Stamm L, Rubenfield M, Weinstock K, Lee HM, Dubois J, Rosenthal A, Platzer M, Nyakatura G, Taudien S, Rump A, Yang H, Yu J, Wang J, Huang G, Gu J, Hood L, Rowen L, Madan A, Qin S, Davis RW, Federspiel NA, Abola AP, Proctor MJ, Myers RM, Schmutz J, Dickson M, Grimwood J, Cox DR, Olson MV, Kaul R, Shimizu N, Kawasaki K, Minoshima S, Evans GA, Athanasiou M, Schultz R, Roe BA, Chen F, Pan H, Ramser J, Lehrach H, Reinhardt R, McCombie WR, de la Bastide M, Dedhia N, Blocker H, Hornischer K, Nordsiek G, Agarwala R, Aravind L, Bailey JA, Bateman A, Batzoglou S, Birney E, Bork P, Brown DG, Burge CB, Cerutti L, Chen HC, Church D, Clamp M, Copley RR, Doerks T, Eddy SR, Eichler EE, Furey TS, Galagan J, Gilbert JG, Harmon C, Hayashizaki Y, Haussler D, Hermjakob H, Hokamp K, Jang W, Johnson LS, Jones TA, Kasif S, Kaspryzk A, Kennedy S, Kent WJ, Kitts P, Koonin EV, Korf I, Kulp D, Lancet D, Lowe TM, McLysaght A, Mikkelsen T, Moran JV, Mulder N, Pollara VJ, Ponting CP, Schuler G, Schultz J, Slater G, Smit AF, Stupka E, Szustakowski J, Thierry- Mieg D, Thierry-Mieg J, Wagner L, Wallis J, Wheeler R, Williams A, Wolf YI, Wolfe KH, Yang SP, Yeh RF, Collins F, Guyer MS, Peterson J, Felsenfeld A, Wetterstrand KA, Patrinos A, Morgan MJ, de Jong P, Catanese JJ, Osoegawa K, Shizuya H, Choi S and Chen YJ (2001) Initial sequencing and analysis of the human genome. Nature 409(6822): 860-921. Langmead CJ and Christopoulos A (2006) Allosteric agonists of 7TM receptors: expanding the pharmacological toolbox. Trends Pharmacol Sci 27(9): 475-481. Lanzafame A and Christopoulos A (2004) Investigation of the interaction of a putative allosteric modulator, N-(2,3-diphenyl-1,2,4-thiadiazole-5-(2H)-ylidene) methanamine hydrobromide (SCH-202676), with M1 muscarinic acetylcholine receptors. J Pharmacol Exp Ther 308(3): 830-837. Laporte SA, Oakley RH, Zhang J, Holt JA, Ferguson SS, Caron MG and Barak LS (1999) The 2-adrenergic receptor/arrestin complex recruits the clathrin adaptor AP-2 during endocytosis. Proc Natl Acad Sci U S A 96(7): 3712-3717. Laporte SA, Servant G, Richard DE, Escher E, Guillemette G and Leduc R (1996) The tyrosine within the NPXnY motif of the human angiotensin II type 1 receptor is involved in mediating signal transduction but is not essential for internalization. Mol Pharmacol 49(1): 89-95. Lartey J and Lopez Bernal A (2009) RHO protein regulation of contraction in the human uterus. Reproduction 138(3): 407-424. 307 Lartey J, Smith M, Pawade J, Strachan B, Mellor H and Lopez Bernal A (2007) Up-regulation of myometrial RHO effector proteins (PKN1 and DIAPH1) and CPI-17 (PPP1R14A) phosphorylation in human pregnancy is associated with increased GTP-RHOA in spontaneous preterm labor. Biol Reprod 76(6): 971-982. Lavoie C and Hebert TE (2003) Pharmacological characterization of putative beta1-beta2-adrenergic receptor heterodimers. Can J Physiol Pharmacol 81(2): 186-195. Lavoie C, Mercier JF, Salahpour A, Umapathy D, Breit A, Villeneuve LR, Zhu WZ, Xiao RP, Lakatta EG, Bouvier M and Hébert TE (2002) 1/2-adrenergic receptor heterodimerization regulates 2-adrenergic receptor internalization and ERK signaling efficacy. J Biol Chem 277(38): 35402-35410. Leach K, Sexton PM and Christopoulos A (2007) Allosteric GPCR modulators: taking advantage of permissive receptor pharmacology. Trends Pharmacol Sci 28(8): 382-389. Lebon G, Warne T, Edwards PC, Bennett K, Langmead CJ, Leslie AG and Tate CG (2011) Agonist-bound adenosine A2A receptor structures reveal common features of GPCR activation. Nature 474(7352): 521-525. Lee PY, Shao H, Xu LA and Qu CK (1988) The effect of prostaglandin F2 on intraocular pressure in normotensive human subjects. Invest Ophthalmol Vis Sci 29(10): 1474-1477. Lee SP, So CH, Rashid AJ, Varghese G, Cheng R, Lanca AJ, O'Dowd BF and George SR (2004) Dopamine D1 and D2 receptor Co-activation generates a novel phospholipase C-mediated calcium signal. J Biol Chem 279(34): 35671-35678. Leff P (1995) The two-state model of receptor activation. Trends Pharmacol Sci 16(3): 89-97. Leopoldt D, Hanck T, Exner T, Maier U, Wetzker R and Nurnberg B (1998) Gbetagamma stimulates phosphoinositide 3-kinase-gamma by direct interaction with two domains of the catalytic p110 subunit. J Biol Chem 273(12): 7024-7029. Leppik RA, Miller RC, Eck M and Paquet JL (1994) Role of acidic amino acids in the allosteric modulation by gallamine of antagonist binding at the m2 muscarinic acetylcholine receptor. Mol Pharmacol 45(5): 983-990. Leu FP and Nandi M (2010) GPCR somatostatin receptor extracellular loop 2 is a key ectodomain for making subtype-selective antibodies with agonist-like activities in the pancreatic neuroendocrine tumor BON cell line. Pancreas 39(8): 1155-1166. 308 Li DY, Varma DR and Chemtob S (1995) Up-regulation of brain PGE2 and PGF2 receptors and receptor-coupled second messengers by cyclooxygenase inhibition in newborn pigs. J Pharmacol Exp Ther 272(1): 15-19. Li J-M, Iwai M, Cui T-X, Min L-J, Tsuda M, Iwanami J, Suzuki J, Mogi M and Horiuchi M (2005) Effect of Azelnidipine on Angiotensin II-Mediated Growth- Promoting Signaling in Vascular Smooth Muscle Cells. Mol Pharmacol 67(5): 1666-1673. Li Y, Kang JX and Leaf A (1997) Differential effects of various eicosanoids on the production or prevention of arrhythmias in cultured neonatal rat cardiac myocytes. Prostaglandins 54(2): 511-530. Liang Y, Woodward DF, Guzman VM, Li C, Scott DF, Wang JW, Wheeler LA, Garst ME, Landsverk K, Sachs G, Krauss AH, Cornell C, Martos J, Pettit S and Fliri H (2008) Identification and pharmacological characterization of the prostaglandin FP receptor and FP receptor variant complexes. Br J Pharmacol 154(5): 1079-1093. Limbird LE (2004) The receptor concept: a continuing evolution. Mol Interv 4(6): 326-336. Lin SY and Goodfriend TL (1970) Angiotensin receptors. The American journal of physiology 218(5): 1319-1328. Linder MR, Steurer S and Podlech J (2002) (S)-3-(tert-Butoxycarbonylamino)-4- phenylbutanoic Acid. Org Synth 79: 154-164. Ling S, Dai A, Ma YH, Wilson E, Chatterjee K, Ives HE and Sudhir K (1999) Matrix-dependent gene expression of egr-1 and PDGF A regulate angiotensin II- induced proliferation in human vascular smooth muscle cells. Hypertension 34(5): 1141-1146. Linseman DA, Benjamin CW and Jones DA (1995) Convergence of angiotensin II and platelet-derived growth factor receptor signaling cascades in vascular smooth muscle cells. J Biol Chem 270(21): 12563-12568. Litschig S, Gasparini F, Rueegg D, Stoehr N, Flor PJ, Vranesic I, Prezeau L, Pin JP, Thomsen C and Kuhn R (1999) CPCCOEt, a noncompetitive metabotropic glutamate receptor 1 antagonist, inhibits receptor signaling without affecting glutamate binding. Mol Pharmacol 55(3): 453-461. Liu Q, Cescato R, Dewi DA, Rivier J, Reubi JC and Schonbrunn A (2005) Receptor signaling and endocytosis are differentially regulated by somatostatin analogs. Mol Pharmacol 68(1): 90-101. 309 Logan CY and Nusse R (2004) The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20: 781-810. Logothetis DE, Kurachi Y, Galper J, Neer EJ and Clapham DE (1987) The subunits of GTP-binding proteins activate the muscarinic K+ channel in heart. Nature 325(6102): 321-326. Lohse MJ, Benovic JL, Codina J, Caron MG and Lefkowitz RJ (1990) -Arrestin: a protein that regulates -adrenergic receptor function. Science 248(4962): 1547- 1550. Lombardo CR, Consler TG and Kassel DB (1995) In vitro phosphorylation of the epidermal growth factor receptor autophosphorylation domain by c-src: identification of phosphorylation sites and c-src SH2 domain binding sites. Biochemistry (Mosc) 34(50): 16456-16466. Lombart HG and Lubell WD (1996) Rigid Dipeptide Mimetics: Efficient Synthesis of Enantiopure Indolizidinone Amino Acids. J Org Chem 61(26): 9437–9446. Lopez Bernal A (2007) Overview. Preterm labour: mechanisms and management. BMC pregnancy and childbirth 7 Suppl 1: S2. Luttrell DK and Luttrell LM (2004) Not so strange bedfellows: G-protein-coupled receptors and Src family kinases. Oncogene 23(48): 7969-7978. Luttrell LM (2002) Activation and targeting of mitogen-activated protein kinases by G-protein-coupled receptors. Can J Physiol Pharmacol 80(5): 375-382. Luttrell LM (2006) Transmembrane signaling by G protein-coupled receptors. Methods Mol Biol 332: 3-49. Luttrell LM, Della Rocca GJ, van Biesen T, Luttrell DK and Lefkowitz RJ (1997) G subunits mediate Src-dependent phosphorylation of the epidermal growth factor receptor. A scaffold for G protein-coupled receptor-mediated Ras activation. J Biol Chem 272(7): 4637-4644. Luttrell LM, Ferguson SS, Daaka Y, Miller WE, Maudsley S, Della Rocca GJ, Lin F, Kawakatsu H, Owada K, Luttrell DK, Caron MG and Lefkowitz RJ (1999) -arrestin-dependent formation of 2 adrenergic receptor-Src protein kinase complexes. Science 283(5402): 655-661. Luttrell LM and Gesty-Palmer D (2010) Beyond desensitization: physiological relevance of arrestin-dependent signaling. Pharmacol Rev 62(2): 305-330. 310 Luttrell LM, Hawes BE, van Biesen T, Luttrell DK, Lansing TJ and Lefkowitz RJ (1996) Role of c-Src tyrosine kinase in G protein-coupled receptor- and G subunit-mediated activation of mitogen-activated protein kinases. J Biol Chem 271(32): 19443-19450. Lutz S, Freichel-Blomquist A, Yang Y, Rümenapp U, Jakobs KH, Schmidt M and Wieland T (2005) The Guanine Nucleotide Exchange Factor p63RhoGEF, a Specific Link between Gq/11-coupled Receptor Signaling and RhoA. J Biol Chem 280(12): 11134-11139. Ma AW, Pawagi AB and Wells JW (2008) Heterooligomers of the muscarinic receptor and G proteins purified from porcine atria. Biochem Biophys Res Commun 374(1): 128-133. Ma AW, Redka DS, Pisterzi LF, Angers S and Wells JW (2007) Recovery of oligomers and cooperativity when monomers of the M2 muscarinic cholinergic receptor are reconstituted into phospholipid vesicles. Biochemistry (Mosc) 46(26): 7907-7927. Ma X, Wu WX and Nathanielsz PW (1999) Differential regulation of prostaglandin EP and FP receptors in pregnant sheep myometrium and endometrium during spontaneous term labor. Biol Reprod 61(5): 1281-1286. Macrez-Lepretre N, Morel JL and Mironneau J (1996) Angiotensin II-mediated activation of L-type calcium channels involves phosphatidylinositol hydrolysis- independent activation of protein kinase C in rat portal vein myocytes. J Pharmacol Exp Ther 278(2): 468-475. Macrez N, Morel JL, Kalkbrenner F, Viard P, Schultz G and Mironneau J (1997) A dimer derived from G13 transduces the angiotensin AT1 receptor signal to stimulation of Ca2+ channels in rat portal vein myocytes. J Biol Chem 272(37): 23180-23185. Maddox YT, Ramwell PW, Shiner CS and Corey EJ (1978) Amide and i-amino derivatives of F prostaglandins as prostaglandin antagonists. Nature 273(5663): 549-552. Maillet EL, Pellegrini N, Valant C, Bucher B, Hibert M, Bourguignon JJ and Galzi JL (2007) A novel, conformation-specific allosteric inhibitor of the tachykinin NK2 receptor (NK2R) with functionally selective properties. FASEB J 21(9): 2124-2134. Majerus PW (1983) Arachidonate metabolism in vascular disorders. J Clin Invest 72(5): 1521-1525. 311 Makino S, Zaragoza DB, Mitchell BF, Robertson S and Olson DM (2007) Prostaglandin F2 and its receptor as activators of human decidua. Semin Reprod Med 25(1): 60-68. Makita N, Sato J, Manaka K, Shoji Y, Oishi A, Hashimoto M, Fujita T and Iiri T (2007) An acquired hypocalciuric hypercalcemia autoantibody induces allosteric transition among active human Ca-sensing receptor conformations. Proc Natl Acad Sci U S A 104(13): 5443-5448. Manglik A, Kruse AC, Kobilka TS, Thian FS, Mathiesen JM, Sunahara RK, Pardo L, Weis WI, Kobilka BK and Granier S (2012) Crystal structure of the - opioid receptor bound to a morphinan antagonist. Nature 485(7398): 321-326. Marchese A and Benovic JL (2001) Agonist-promoted ubiquitination of the G protein-coupled receptor CXCR4 mediates lysosomal sorting. J Biol Chem 276(49): 45509-45512. Marinissen MJ and Gutkind JS (2001) G-protein-coupled receptors and signaling networks: emerging paradigms. Trends Pharmacol Sci 22(7): 368-376. Markworth JF and Cameron-Smith D (2011) Prostaglandin F2α stimulates PI3K/ERK/mTOR signaling and skeletal myotube hypertrophy. American Journal of Physiology - Cell Physiology 300(3): C671-C682. Marrero MB, Schieffer B, Paxton WG, Heerdt L, Berk BC, Delafontaine P and Bernstein KE (1995) Direct stimulation of Jak/STAT pathway by the angiotensin II AT1 receptor. Nature 375(6528): 247-250. Marshall CJ (1995) Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell 80(2): 179- 185. Matsui H, Lazareno S and Birdsall NJ (1995) Probing of the location of the allosteric site on m1 muscarinic receptors by site-directed mutagenesis. Mol Pharmacol 47(1): 88-98. Matsumoto T, Sagawa N, Yoshida M, Mori T, Tanaka I, Mukoyama M, Kotani M and Nakao K (1997) The prostaglandin E2 and F2 receptor genes are expressed in human myometrium and are down-regulated during pregnancy. Biochem Biophys Res Commun 238(3): 838-841. Maudsley S, Pierce KL, Zamah AM, Miller WE, Ahn S, Daaka Y, Lefkowitz RJ and Luttrell LM (2000) The 2-adrenergic receptor mediates extracellular signal- regulated kinase activation via assembly of a multi-receptor complex with the epidermal growth factor receptor. J Biol Chem 275(13): 9572-9580. 312 Maurice P, Daulat AM, Turecek R, Ivankova-Susankova K, Zamponi F, Kamal M, Clement N, Guillaume JL, Bettler B, Gales C, Delagrange P and Jockers R (2010) Molecular organization and dynamics of the melatonin MT(1) receptor/RGS20/G(i) protein complex reveal asymmetry of receptor dimers for RGS and G(i) coupling. EMBO J 29(21): 3646-3659. May LT, Avlani VA, Langmead CJ, Herdon HJ, Wood MD, Sexton PM and Christopoulos A (2007a) Structure-function studies of allosteric agonism at M2 muscarinic acetylcholine receptors. Mol Pharmacol 72(2): 463-476. May LT, Leach K, P.M. S and A. C (2006) Allosteric regulation of G protein- coupled receptors. Annu Rev Pharmacol Toxicol 47: 1-51. May LT, Leach K, Sexton PM and Christopoulos A (2007b) Allosteric modulation of G protein-coupled receptors. Annu Rev Pharmacol Toxicol 47: 1- 51. McCormick MC (1985) The contribution of low birth weight to infant mortality and childhood morbidity. N Engl J Med 312(2): 82-90. McDonald PH, Chow CW, Miller WE, Laporte SA, Field ME, Lin FT, Davis RJ and Lefkowitz RJ (2000) -arrestin 2: a receptor-regulated MAPK scaffold for the activation of JNK3. Science 290(5496): 1574-1577. Meloche S and Pouyssegur J (2007) The ERK1/2 mitogen-activated protein kinase pathway as a master regulator of the G1- to S-phase transition. Oncogene 26(22): 3227-3239. Miller LJ, Dong M and Harikumar KG (2012) Ligand binding and activation of the secretin receptor, a prototypic family B G protein-coupled receptor. Br J Pharmacol 166(1): 18-26. Miller WE and Lefkowitz RJ (2001) Expanding roles for -arrestins as scaffolds and adapters in GPCR signaling and trafficking. Curr Opin Cell Biol 13(2): 139- 145. Milligan G (2009) G protein-coupled receptor hetero-dimerization: contribution to pharmacology and function. Br J Pharmacol 158(1): 5-14. Milligan G and Smith NJ (2007) Allosteric modulation of heterodimeric G- protein-coupled receptors. Trends Pharmacol Sci 28(12): 615-620. Mochizuki N, Ohba Y, Kiyokawa E, Kurata T, Murakami T, Ozaki T, Kitabatake A, Nagashima K and Matsuda M (1999) Activation of the ERK/MAPK pathway by an isoform of rap1GAP associated with G alpha(i). Nature 400(6747): 891- 894. 313 Monnier C, Tu H, Bourrier E, Vol C, Lamarque L, Trinquet E, Pin JP and Rondard P (2011) Trans-activation between 7TM domains: implication in heterodimeric GABA(B) receptor activation. EMBO J 30(1): 32-42. Morini G, Bassoli A and Temussi PA (2005) From small sweeteners to sweet proteins: anatomy of the binding sites of the human T1R2_T1R3 receptor. J Med Chem 48(17): 5520-5529. Moukhametzianov R, Warne T, Edwards PC, Serrano-Vega MJ, Leslie AG, Tate CG and Schertler GF (2011) Two distinct conformations of helix 6 observed in antagonist-bound structures of a beta1-adrenergic receptor. Proc Natl Acad Sci U S A 108(20): 8228-8232. Mugabe BE, Yaghini FA, Song CY, Buharalioglu CK, Waters CM and Malik KU (2010) Angiotensin II-induced migration of vascular smooth muscle cells is mediated by p38 mitogen-activated protein kinase-activated c-Src through spleen tyrosine kinase and epidermal growth factor receptor transactivation. J Pharmacol Exp Ther 332(1): 116-124. Mukhopadhyay P, Bian L, Yin H, Bhattacherjee P and Paterson C (2001) Localization of EP(1) and FP receptors in human ocular tissues by in situ hybridization. Invest Ophthalmol Vis Sci 42(2): 424-428. Munshi UM, Peegel H and Menon KM (2001) Palmitoylation of the luteinizing hormone/human chorionic gonadotropin receptor regulates receptor interaction with the arrestin-mediated internalization pathway. European journal of biochemistry / FEBS 268(6): 1631-1639. Murakami M and Kouyama T (2008) Crystal structure of squid rhodopsin. Nature 453(7193): 363-367. Murasawa S, Mori Y, Nozawa Y, Gotoh N, Shibuya M, Masaki H, Maruyama K, Tsutsumi Y, Moriguchi Y, Shibazaki Y, Tanaka Y, Iwasaka T, Inada M and Matsubara H (1998) Angiotensin II type 1 receptor-induced extracellular signal- regulated protein kinase activation is mediated by Ca2+/calmodulin-dependent transactivation of epidermal growth factor receptor. Circ Res 82(12): 1338-1348. Naftilan AJ, Pratt RE and Dzau VJ (1989a) Induction of platelet-derived growth factor A-chain and c-myc gene expressions by Angiotensin II in cultured rat vascular smooth muscle cells. J Clin Invest 83(4): 1419-1424. Naftilan AJ, Pratt RE, Eldridge CS, Lin HL and Dzau VJ (1989b) Angiotensin II induces c-fos expression in smooth muscle via transcriptional control. Hypertension 13(6 Pt 2): 706-711. 314 Nahmias C and Strosberg AD (1995) The angiotensin AT2 receptor: searching for signal-transduction pathways and physiological function. Trends Pharmacol Sci 16(7): 223-225. Nair VD and Sealfon SC (2003) Agonist-specific transactivation of phosphoinositide 3-kinase signaling pathway mediated by the dopamine D2 receptor. J Biol Chem 278(47): 47053-47061. Nakamichi H and Okada T (2006) Local peptide movement in the photoreaction intermediate of rhodopsin. Proc Natl Acad Sci U S A 103(34): 12729-12734. Nakamura T, Kurokawa K, Kiyokawa E and Matsuda M (2006) Analysis of the spatiotemporal activation of rho GTPases using Raichu probes. Methods Enzymol 406: 315-332. Neubig RR (1994) Membrane organization in G-protein mechanisms. FASEB J 8(12): 939-946. Neubig RR, Gantzos RD and Thomsen WJ (1988) Mechanism of agonist and antagonist binding to alpha 2 adrenergic receptors: evidence for a precoupled receptor-guanine nucleotide protein complex. Biochemistry (Mosc) 27(7): 2374- 2384. New DC and Wong YH (2007) Molecular mechanisms mediating the G protein- coupled receptor regulation of cell cycle progression. Journal of molecular signaling 2: 2. Nguyen TT, Scimeca JC, Filloux C, Peraldi P, Carpentier JL and Van Obberghen E (1993) Co-regulation of the mitogen-activated protein kinase, extracellular signal-regulated kinase 1, and the 90-kDa ribosomal S6 kinase in PC12 cells. Distinct effects of the neurotrophic factor, nerve growth factor, and the mitogenic factor, epidermal growth factor. J Biol Chem 268(13): 9803-9810. Nishiyama A and Kim-Mitsuyama S (2010) New approaches to blockade of the renin-angiotensin-aldosterone system: overview of regulation of the renin- angiotensin-aldosterone system. Journal of pharmacological sciences 113(4): 289-291. Nobles M, Benians A and Tinker A (2005) Heterotrimeric G proteins precouple with G protein-coupled receptors in living cells. Proc Natl Acad Sci U S A 102(51): 18706-18711. Noma T, Lemaire A, Naga Prasad SV, Barki-Harrington L, Tilley DG, Chen J, Le Corvoisier P, Violin JD, Wei H, Lefkowitz RJ and Rockman HA (2007) - arrestin-mediated 1-adrenergic receptor transactivation of the EGFR confers cardioprotection. J Clin Invest 117(9): 2445-2458. 315 Northup JK, Smigel MD, Sternweis PC and Gilman AG (1983a) The subunits of the stimulatory regulatory component of adenylate cyclase. Resolution of the activated 45,000-dalton (alpha) subunit. J Biol Chem 258(18): 11369-11376. Northup JK, Sternweis PC and Gilman AG (1983b) The subunits of the stimulatory regulatory component of adenylate cyclase. Resolution, activity, and properties of the 35,000-dalton (beta) subunit. J Biol Chem 258(18): 11361- 11368. Northup JK, Sternweis PC, Smigel MD, Schleifer LS, Ross EM and Gilman AG (1980) Purification of the regulatory component of adenylate cyclase. Proc Natl Acad Sci U S A 77(11): 6516-6520. Nygaard R, Frimurer TM, Holst B, Rosenkilde MM and Schwartz TW (2009) Ligand binding and micro-switches in 7TM receptor structures. Trends Pharmacol Sci 30(5): 249-259. O'Brien JA, Lemaire W, Wittmann M, Jacobson MA, Ha SN, Wisnoski DD, Lindsley CW, Schaffhauser HJ, Rowe B, Sur C, Duggan ME, Pettibone DJ, Conn PJ and Williams DL, Jr. (2004) A novel selective allosteric modulator potentiates the activity of native metabotropic glutamate receptor subtype 5 in rat forebrain. J Pharmacol Exp Ther 309(2): 568-577. Oak JN, Lavine N and Van Tol HH (2001) Dopamine D(4) and D(2L) Receptor Stimulation of the Mitogen-Activated Protein Kinase Pathway Is Dependent on trans-Activation of the Platelet-Derived Growth Factor Receptor. Mol Pharmacol 60(1): 92-103. Oakley RH, Laporte SA, Holt JA, Barak LS and Caron MG (1999) Association of -arrestin with G protein-coupled receptors during clathrin-mediated endocytosis dictates the profile of receptor resensitization. J Biol Chem 274(45): 32248- 32257. Oakley RH, Laporte SA, Holt JA, Caron MG and Barak LS (2000) Differential affinities of visual arrestin, arrestin1, and arrestin2 for G protein-coupled receptors delineate two major classes of receptors. J Biol Chem 275(22): 17201- 17210. Oga T, Matsuoka T, Yao C, Nonomura K, Kitaoka S, Sakata D, Kita Y, Tanizawa K, Taguchi Y, Chin K, Mishima M, Shimizu T and Narumiya S (2009) Prostaglandin F2 receptor signaling facilitates bleomycin-induced pulmonary fibrosis independently of transforming growth factor-. Nat Med 15(12): 1426- 1430. 316 Ogawa K, Hirooka Y, Kishi T and Sunagawa K (2011) Brain AT1 receptor activates the sympathetic nervous system through toll-like receptor 4 in mice with heart failure. J Cardiovasc Pharmacol 58(5): 543-549. Ohmichi M, Koike K, Kimura A, Masuhara K, Ikegami H, Ikebuchi Y, Kanzaki T, Touhara K, Sakaue M, Kobayashi Y, Akabane M, Miyake A and Murata Y (1997) Role of mitogen-activated protein kinase pathway in prostaglandin F2- induced rat puerperal uterine contraction. Endocrinology 138(8): 3103-3111. Okada T, Sugihara M, Bondar AN, Elstner M, Entel P and Buss V (2004) The retinal conformation and its environment in rhodopsin in light of a new 2.2 A crystal structure. J Mol Biol 342(2): 571-583. Oligny-Longpre G, Corbani M, Zhou J, Hogue M, Guillon G and Bouvier M (2012) Engagement of -arrestin by transactivated insulin-like growth factor receptor is needed for V2 vasopressin receptor-stimulated ERK1/2 activation. Proc Natl Acad Sci U S A 109(17): E1028-1037. Olson DM (2003) The role of prostaglandins in the initiation of parturition. Best Pract Res Clin Obstet Gynaecol 17(5): 717-730. Olson DM, Zaragoza DB, Shallow MC, Cook JL, Mitchell BF, Grigsby P and Hirst J (2003) Myometrial activation and preterm labour: evidence supporting a role for the prostaglandin F receptor--a review. Placenta 24 Suppl A: S47-54. Orly J and Schramm M (1976) Coupling of catecholamine receptor from one cell with adenylate cyclase from another cell by cell fusion. Proc Natl Acad Sci U S A 73(12): 4410-4414. Ostrom RS and Insel PA (2004) The evolving role of lipid rafts and caveolae in G protein-coupled receptor signaling: implications for molecular pharmacology. Br J Pharmacol 143(2): 235-245. Paing MM, Stutts AB, Kohout TA, Lefkowitz RJ and Trejo J (2002) -Arrestins regulate protease-activated receptor-1 desensitization but not internalization or downregulation. J Biol Chem 277(2): 1292-1300. Palanche T, Ilien B, Zoffmann S, Reck MP, Bucher B, Edelstein SJ and Galzi JL (2001) The neurokinin A receptor activates calcium and cAMP responses through distinct conformational states. J Biol Chem 276(37): 34853-34861. Palczewski K (2006) G protein-coupled receptor rhodopsin. Annu Rev Biochem 75: 743-767. Palczewski K, Kumasaka T, Hori T, Behnke CA, Motoshima H, Fox BA, Le Trong I, Teller DC, Okada T, Stenkamp RE, Yamamoto M and Miyano M (2000) 317 Crystal structure of rhodopsin: A G protein-coupled receptor. Science 289(5480): 739-745. Parent JL, Labrecque P, Orsini MJ and Benovic JL (1999) Internalization of the TXA2 receptor alpha and beta isoforms. Role of the differentially spliced cooh terminus in agonist-promoted receptor internalization. J Biol Chem 274(13): 8941-8948. Park JH, Scheerer P, Hofmann KP, Choe HW and Ernst OP (2008) Crystal structure of the ligand-free G-protein-coupled receptor opsin. Nature 454(7201): 183-187. Parma J, Duprez L, Van Sande J, Cochaux P, Gervy C, Mockel J, Dumont J and Vassart G (1993) Somatic mutations in the thyrotropin receptor gene cause hyperfunctioning thyroid adenomas. Nature 365(6447): 649-651. Parrill AL, Lima S and Spiegel S (2012) Structure of the first sphingosine 1- phosphate receptor. Sci Signal 5(225): pe23. Patel CB, Noor N and Rockman HA (2010) Functional selectivity in adrenergic and angiotensin signaling systems. Mol Pharmacol 78(6): 983-992. Peeters MC, van Westen GJ, Guo D, Wisse LE, Muller CE, Beukers MW and Ijzerman AP (2011) GPCR structure and activation: an essential role for the first extracellular loop in activating the adenosine A2B receptor. FASEB J 25(2): 632- 643. Pepperell JR, Nemeth G, Yamada Y and Naftolin F (1993) The type 1 angiotensin-II receptor mediates intracellular calcium mobilization in rat luteal cells. Endocrinology 133(4): 1678-1684. Peri KG, Quiniou C, Hou X, Abran D, Varma DR, Lubell WD and Chemtob S (2002) THG113: a novel selective FP antagonist that delays preterm labor. Semin Perinatol 26(6): 389-397. Pétrin D and Hébert TE (2011) Imaging-based approaches to understanding G protein-coupled receptor signalling complexes. Methods Mol Biol 756: 37-60. Pfeiffer M, Koch T, Schröder H, Laugsch M, Höllt V and Schulz S (2002) Heterodimerization of Somatostatin and Opioid Receptors Cross-modulates Phosphorylation, Internalization, and Desensitization. J Biol Chem 277(22): 19762-19772. Pfister C, Chabre M, Plouet J, Tuyen VV, De Kozak Y, Faure JP and Kuhn H (1985) Retinal S antigen identified as the 48K protein regulating light-dependent phosphodiesterase in rods. Science 228(4701): 891-893. 318 Pheng LH, Dumont Y, Fournier A, Chabot JG, Beaudet A and Quirion R (2003) Agonist- and antagonist-induced sequestration/internalization of neuropeptide Y Y1 receptors in HEK293 cells. Br J Pharmacol 139(4): 695-704. Phillippe M, Saunders T and Basa A (1997) Intracellular mechanisms underlying prostaglandin F2-stimulated phasic myometrial contractions. Am J Physiol 273(4 Pt 1): E665-673. Pierce KL, Bailey TJ, Hoyer PB, Gil DW, Woodward DF and Regan JW (1997) Cloning of a carboxyl-terminal isoform of the prostanoid FP receptor. J Biol Chem 272(2): 883-887. Pierce KL, Fujino H, Srinivasan D and Regan JW (1999) Activation of FP prostanoid receptor isoforms leads to Rho-mediated changes in cell morphology and in the cell cytoskeleton. J Biol Chem 274(50): 35944-35949. Pierce KL, Luttrell LM and Lefkowitz RJ (2001a) New mechanisms in heptahelical receptor signaling to mitogen activated protein kinase cascades. Oncogene 20(13): 1532-1539. Pierce KL, Tohgo A, Ahn S, Field ME, Luttrell LM and Lefkowitz RJ (2001b) Epidermal growth factor (EGF) receptor-dependent ERK activation by G protein- coupled receptors: a co-culture system for identifying intermediates upstream and downstream of heparin-binding EGF shedding. J Biol Chem 276(25): 23155- 23160. Pin JP and Acher F (2002) The metabotropic glutamate receptors: structure, activation mechanism and pharmacology. Curr Drug Targets CNS Neurol Disord 1(3): 297-317. Pin JP, Kniazeff J, Liu J, Binet V, Goudet C, Rondard P and Prezeau L (2005) Allosteric functioning of dimeric class C G-protein-coupled receptors. The FEBS journal 272(12): 2947-2955. Pin JP and Prezeau L (2007) Allosteric modulators of GABA(B) receptors: mechanism of action and therapeutic perspective. Curr Neuropharmacol 5(3): 195-201. Pippig S, Andexinger S and Lohse MJ (1995) Sequestration and recycling of 2- adrenergic receptors permit receptor resensitization. Mol Pharmacol 47(4): 666- 676. Pohl SL, Birnbaumer L and Rodbell M (1971a) The glucagon-sensitive adenyl cyclase system in plasma membranes of rat liver. I. Properties. The Journal of biological chemistry 246(6): 1849-1856. 319 Pohl SL, Krans HM, Kozyreff V, Birnbaumer L and Rodbell M (1971b) The glucagon-sensitive adenyl cyclase system in plasma membranes of rat liver. VI. Evidence for a role of membrane lipids. J Biol Chem 246(14): 4447-4454. Popova JS and Rasenick MM (2003) G mediates the interplay between tubulin dimers and microtubules in the modulation of Gq signaling. J Biol Chem 278(36): 34299-34308. Porrello ER, Pfleger KD, Seeber RM, Qian H, Oro C, Abogadie F, Delbridge LM and Thomas WG (2011) Heteromerization of angiotensin receptors changes trafficking and arrestin recruitment profiles. Cell Signal 23(11): 1767-1776. Portier M, Rinaldi-Carmona M, Pecceu F, Combes T, Poinot-Chazel C, Calandra B, Barth F, le Fur G and Casellas P (1999) SR 144528, an antagonist for the peripheral cannabinoid receptor that behaves as an inverse agonist. J Pharmacol Exp Ther 288(2): 582-589. Pouyssegur J, Volmat V and Lenormand P (2002) Fidelity and spatio-temporal control in MAP kinase (ERKs) signalling. Biochem Pharmacol 64(5-6): 755-763. Powell WS, Hammarstrom S, Samuelsson B and Sjoberg B (1974) Letter: Prostaglandin-F2 receptor in human corpora lutea. Lancet 1(7866): 1120. Prenzel N, Zwick E, Daub H, Leserer M, Abraham R, Wallasch C and Ullrich A (1999) EGF receptor transactivation by G-protein-coupled receptors requires metalloproteinase cleavage of proHB-EGF. Nature 402(6764): 884-888. Prince LA, Rodriquez E, Campagna J, Brown L, Fischer D and Grant WD (2008) Hyperglycemia in ED patients with no history of diabetes. The American journal of emergency medicine 26(5): 532-536. Prinster SC, Hague C and Hall RA (2005) Heterodimerization of g protein- coupled receptors: specificity and functional significance. Pharmacol Rev 57(3): 289-298. Provasi D and Filizola M (2010) Putative active states of a prototypic g-protein- coupled receptor from biased molecular dynamics. Biophys J 98(10): 2347-2355. Pryde PG, Janeczek S and Mittendorf R (2004) Risk-benefit effects of tocolytic therapy. Expert Opin Drug Saf 3(6): 639-654. Pullikuth AK and Catling AD (2007) Scaffold mediated regulation of MAPK signaling and cytoskeletal dynamics: a perspective. Cell Signal 19(8): 1621-1632. 320 Ram PT, Horvath CM and Iyengar R (2000) Stat3-mediated transformation of NIH-3T3 cells by the constitutively active Q205L Galphao protein. Science 287(5450): 142-144. Ramos JW (2008) The regulation of extracellular signal-regulated kinase (ERK) in mammalian cells. The international journal of biochemistry & cell biology 40(12): 2707-2719. Rao GN, Delafontaine P and Runge MS (1995) Thrombin stimulates phosphorylation of insulin-like growth factor-1 receptor, insulin receptor substrate-1, and phospholipase C- 1 in rat aortic smooth muscle cells. J Biol Chem 270(46): 27871-27875. Rashid AJ, So CH, Kong MM, Furtak T, El-Ghundi M, Cheng R, O'Dowd BF and George SR (2007) D1-D2 dopamine receptor heterooligomers with unique pharmacology are coupled to rapid activation of Gq/11 in the striatum. Proc Natl Acad Sci U S A 104(2): 654-659. Rasmussen SG, Choi HJ, Fung JJ, Pardon E, Casarosa P, Chae PS, Devree BT, Rosenbaum DM, Thian FS, Kobilka TS, Schnapp A, Konetzki I, Sunahara RK, Gellman SH, Pautsch A, Steyaert J, Weis WI and Kobilka BK (2011a) Structure of a nanobody-stabilized active state of the 2-adrenoceptor. Nature 469(7329): 175-180. Rasmussen SG, Choi HJ, Rosenbaum DM, Kobilka TS, Thian FS, Edwards PC, Burghammer M, Ratnala VR, Sanishvili R, Fischetti RF, Schertler GF, Weis WI and Kobilka BK (2007) Crystal structure of the human 2-adrenergic G-protein- coupled receptor. Nature 450(7168): 383-387. Rasmussen SG, DeVree BT, Zou Y, Kruse AC, Chung KY, Kobilka TS, Thian FS, Chae PS, Pardon E, Calinski D, Mathiesen JM, Shah ST, Lyons JA, Caffrey M, Gellman SH, Steyaert J, Skiniotis G, Weis WI, Sunahara RK and Kobilka BK (2011b) Crystal structure of the 2-adrenergic receptor-Gs protein complex. Nature 477(7366): 549-555. Re RN, Vizard DL, Brown J, LeGros L and Bryan SE (1984) Angiotensin II receptors in chromatin. J Hypertens Suppl 2(3): S271-273. Rensen SS, Doevendans PA and van Eys GJ (2007) Regulation and characteristics of vascular smooth muscle cell phenotypic diversity. Netherlands heart journal : monthly journal of the Netherlands Society of Cardiology and the Netherlands Heart Foundation 15(3): 100-108. Reversi A, Rimoldi V, Marrocco T, Cassoni P, Bussolati G, Parenti M and Chini B (2005a) The oxytocin receptor antagonist atosiban inhibits cell growth via a "biased agonist" mechanism. J Biol Chem 280(16): 16311-16318. 321 Reversi A, Rimoldi V, Marrocco T, Cassoni P, Bussolati G, Parenti M and Chini B (2005b) The oxytocin receptor antagonist atosiban inhibits cell growth via a "biased agonist" mechanism. The Journal of biological chemistry 280(16): 16311- 16318. Rice KM, Uddemarri S, Desai DH, Morrison RG, Harris R, Wright GL and Blough ER (2008) PGF2-associated vascular smooth muscle hypertrophy is ROS dependent and involves the activation of mTOR, p70S6k, and PTEN. Prostaglandins Other Lipid Mediat 85(1-2): 49-57. Richman JG, Brady AE, Wang Q, Hensel JL, Colbran RJ and Limbird LE (2001) Agonist-regulated Interaction between 2-adrenergic receptors and spinophilin. J Biol Chem 276(18): 15003-15008. Ritchie RH, Schiebinger RJ, LaPointe MC and Marsh JD (1998) Angiotensin II- induced hypertrophy of adult rat cardiomyocytes is blocked by nitric oxide. The American journal of physiology 275(4 Pt 2): H1370-1374. Robinson PR, Cohen GB, Zhukovsky EA and Oprian DD (1992) Constitutively active mutants of rhodopsin. Neuron 9(4): 719-725. Robitaille M, Gora S, Wang Y, Goupil E, Petrin D, Del Duca D, Villeneuve LR, Allen BG, Laporte SA, Bernard DJ and Hebert TE (2010) G is a negative regulator of AP-1 mediated transcription. Cell Signal 22(8): 1254-1266. Rocheville M and Jerman JC (2009) 7TM pharmacology measured by label-free: a holistic approach to cell signalling. Curr Opin Pharmacol 9(5): 643-649. Rocheville M, Lange DC, Kumar U, Patel SC, Patel RC and Patel YC (2000) Receptors for dopamine and somatostatin: formation of hetero-oligomers with enhanced functional activity. Science 288(5463): 154-157. Rodbell M (1980) The role of hormone receptors and GTP-regulatory proteins in membrane transduction. Nature 284(5751): 17-22. Rodbell M, Birnbaumer L, Pohl SL and Krans HM (1971a) The glucagon- sensitive adenyl cyclase system in plasma membranes of rat liver. V. An obligatory role of guanylnucleotides in glucagon action. J Biol Chem 246(6): 1877-1882. Rodbell M, Krans HM, Pohl SL and Birnbaumer L (1971b) The glucagon- sensitive adenyl cyclase system in plasma membranes of rat liver. 3. Binding of glucagon: method of assay and specificity. J Biol Chem 246(6): 1861-1871. 322 Rodbell M, Krans HM, Pohl SL and Birnbaumer L (1971c) The glucagon- sensitive adenyl cyclase system in plasma membranes of rat liver. IV. Effects of guanylnucleotides on binding of 125I-glucagon. J Biol Chem 246(6): 1872-1876. Roettger BF, Ghanekar D, Rao R, Toledo C, Yingling J, Pinon D and Miller LJ (1997) Antagonist-stimulated internalization of the G protein-coupled cholecystokinin receptor. Mol Pharmacol 51(3): 357-362. Romano C, Yang WL and O'Malley KL (1996) Metabotropic glutamate receptor 5 is a disulfide-linked dimer. J Biol Chem 271(45): 28612-28616. Rosenbaum DM, Cherezov V, Hanson MA, Rasmussen SGF, Thian FS, Kobilka TS, Choi H-J, Yao X-J, Weis WI, Stevens RC and Kobilka BK (2007) GPCR Engineering Yields High-Resolution Structural Insights into β2-Adrenergic Receptor Function. Science 318(5854): 1266-1273. Rosenbaum DM, Zhang C, Lyons JA, Holl R, Aragao D, Arlow DH, Rasmussen SG, Choi HJ, Devree BT, Sunahara RK, Chae PS, Gellman SH, Dror RO, Shaw DE, Weis WI, Caffrey M, Gmeiner P and Kobilka BK (2011) Structure and function of an irreversible agonist-2-adrenoceptor complex. Nature 469(7329): 236-240. Ross EM and Gilman AG (1977) Resolution of some components of adenylate cyclase necessary for catalytic activity. J Biol Chem 252(20): 6966-6969. Rozenfeld R and Devi LA (2010) Receptor heteromerization and drug discovery. Trends Pharmacol Sci 31(3): 124-130. Rozenfeld R, Gupta A, Gagnidze K, Lim MP, Gomes I, Lee-Ramos D, Nieto N and Devi LA (2011) AT1R-CB(1)R heteromerization reveals a new mechanism for the pathogenic properties of angiotensin II. Embo J 30(12): 2350-2363. Ruan YC, Zhou W and Chan HC (2011) Regulation of smooth muscle contraction by the epithelium: role of prostaglandins. Physiology 26(3): 156-170. Sadoshima J, Qiu Z, Morgan JP and Izumo S (1995) Angiotensin II and other hypertrophic stimuli mediated by G protein-coupled receptors activate tyrosine kinase, mitogen-activated protein kinase, and 90-kD S6 kinase in cardiac myocytes. The critical role of Ca(2+)-dependent signaling. Circ Res 76(1): 1-15. Saito O, Guan Y, Qi Z, Davis LS, Komhoff M, Sugimoto Y, Narumiya S, Breyer RM and Breyer MD (2003) Expression of the prostaglandin F receptor (FP) gene along the mouse genitourinary tract. American journal of physiology Renal physiology 284(6): F1164-1170. 323 Sakamoto K, Ezashi T, Miwa K, Okuda-Ashitaka E, Houtani T, Sugimoto T, Ito S and Hayaishi O (1994) Molecular cloning and expression of a cDNA of the bovine prostaglandin F2 receptor. J Biol Chem 269(5): 3881-3886. Saleem S, Ahmad AS, Maruyama T, Narumiya S and Dore S (2009) PGF2 FP receptor contributes to brain damage following transient focal brain ischemia. Neurotoxicity research 15(1): 62-70. Sales KJ, Boddy SC, Williams AR, Anderson RA and Jabbour HN (2007) F- prostanoid receptor regulation of fibroblast growth factor 2 signaling in endometrial adenocarcinoma cells. Endocrinology 148(8): 3635-3644. Sales KJ, List T, Boddy SC, Williams AR, Anderson RA, Naor Z and Jabbour HN (2005) A novel angiogenic role for prostaglandin F2-FP receptor interaction in human endometrial adenocarcinomas. Cancer Res 65(17): 7707-7716. Samadfam R, Gallant MA, Miousse MC, Parent JL and de Brum-Fernandes AJ (2006) Implication of prostaglandin receptors in the accumulation of osteoprotegerin in human osteoblast cultures. J Rheumatol 33(6): 1167-1175. Sasaki T (1985) Formation of inositol phosphates and calcium mobilization in Swiss 3T3 cells in response to prostaglandin F2 alpha. Prostaglandins Leukot Med 19(2): 153-159. Sauro MD, Sudakow R and Burns S (1996) In vivo effects of angiotensin II on vascular smooth muscle contraction and blood pressure are mediated through a protein tyrosine-kinase-dependent mechanism. J Pharmacol Exp Ther 277(3): 1744-1750. Saward L and Zahradka P (1997) Angiotensin II activates phosphatidylinositol 3- kinase in vascular smooth muscle cells. Circ Res 81(2): 249-257. Scarselli M, Li B, Kim SK and Wess J (2007) Multiple residues in the second extracellular loop are critical for M3 muscarinic acetylcholine receptor activation. J Biol Chem 282(10): 7385-7396. Schaaf TK and Hess HJ (1979) Synthesis and biological activity of carboxyl- terminus modified prostaglandin analogues. J Med Chem 22(11): 1340-1346. Schaafsma D, Gosens R, Bos IS, Meurs H, Zaagsma J and Nelemans SA (2004) Allergic sensitization enhances the contribution of Rho-kinase to airway smooth muscle contraction. Br J Pharmacol 143(4): 477-484. Scheerer P, Park JH, Hildebrand PW, Kim YJ, Krauss N, Choe HW, Hofmann KP and Ernst OP (2008) Crystal structure of opsin in its G-protein-interacting conformation. Nature 455(7212): 497-502. 324 Scheid CR, Honeyman TW and Fay FS (1979) Mechanism of -adrenergic relaxation of smooth muscle. Nature 277(5691): 32-36. Schlotzer-Schrehardt U, Zenkel M and Nusing RM (2002) Expression and localization of FP and EP prostanoid receptor subtypes in human ocular tissues. Invest Ophthalmol Vis Sci 43(5): 1475-1487. Schmitz U, Ishida T, Ishida M, Surapisitchat J, Hasham MI, Pelech S and Berk BC (1998) Angiotensin II stimulates p21-activated kinase in vascular smooth muscle cells: role in activation of JNK. Circ Res 82(12): 1272-1278. Schoots O, Wilson JM, Ethier N, Bigras E, Hebert TE and Van Tol HH (1999) Co-expression of human Kir3 subunits can yield channels with different functional properties. Cell Signal 11(12): 871-883. Schuster VL, Itoh S, Andrews SW, Burk RM, Chen J, Kedzie KM, Gil DW and Woodward DF (2000) Synthetic modification of prostaglandin F2 indicates different structural determinants for binding to the prostaglandin F receptor versus the prostaglandin transporter. Mol Pharmacol 58(6): 1511-1516. Schwertschlag U, Seyberth HW, Muller H, Grunewald R, Erlenmaier T, Rohs HG and Hackenthal E (1980) Intrarenal conversion of prostaglandin F2 into prostaglandin E2 and renin release in the isolated perfused rat kidney. Clin Sci 59 Suppl 6: 117s-119s. Scott CW and Peters MF (2010) Label-free whole-cell assays: expanding the scope of GPCR screening. Drug Discov Today 15(17-18): 704-716. See HB, Seeber RM, Kocan M, Eidne KA and Pfleger KD (2010) Application of G Protein-Coupled Receptor-Heteromer Identification Technology to Monitor beta-Arrestin Recruitment to G Protein-Coupled Receptor Heteromers. Assay Drug Dev Technol. Seguchi O, Takashima S, Yamazaki S, Asakura M, Asano Y, Shintani Y, Wakeno M, Minamino T, Kondo H, Furukawa H, Nakamaru K, Naito A, Takahashi T, Ohtsuka T, Kawakami K, Isomura T, Kitamura S, Tomoike H, Mochizuki N and Kitakaze M (2007) A cardiac myosin light chain kinase regulates sarcomere assembly in the vertebrate heart. J Clin Invest 117(10): 2812-2824. Seifert R, Gether U, Wenzel-Seifert K and Kobilka BK (1999) Effects of guanine, inosine, and xanthine nucleotides on 2-adrenergic receptor/G(s) interactions: evidence for multiple receptor conformations. Mol Pharmacol 56(2): 348-358. 325 Sekharan S, Sugihara M, Weingart O, Okada T and Buss V (2007) Protein assistance in the photoisomerization of rhodopsin and 9-cis-rhodopsin--insights from experiment and theory. J Am Chem Soc 129(5): 1052-1054. Sen A, Browning J, Inskeep EK, Lewis P and Flores JA (2004) Expression and activation of protein kinase C isozymes by prostaglandin F(2alpha) in the early- and mid-luteal phase bovine corpus luteum. Biol Reprod 70(2): 379-384. Servant G, Laporte SA, Leduc R, Escher E and Guillemette G (1997) Identification of angiotensin II-binding domains in the rat AT2 receptor with photolabile angiotensin analogs. J Biol Chem 272(13): 8653-8659. Shah BH and Catt KJ (2002) Calcium-independent activation of extracellularly regulated kinases 1 and 2 by angiotensin II in hepatic C9 cells: roles of protein kinase Cdelta, Src/proline-rich tyrosine kinase 2, and epidermal growth receptor trans-activation. Mol Pharmacol 61(2): 343-351. Shah BH and Catt KJ (2004) GPCR-mediated transactivation of RTKs in the CNS: mechanisms and consequences. Trends Neurosci 27(1): 48-53. Shah BH, Yesilkaya A, Olivares-Reyes JA, Chen HD, Hunyady L and Catt KJ (2004) Differential pathways of angiotensin II-induced extracellularly regulated kinase 1/2 phosphorylation in specific cell types: role of heparin-binding epidermal growth factor. Mol Endocrinol 18(8): 2035-2048. Shenker A, Laue L, Kosugi S, Merendino JJ, Jr., Minegishi T and Cutler GB, Jr. (1993) A constitutively activating mutation of the luteinizing hormone receptor in familial male precocious puberty. Nature 365(6447): 652-654. Shenoy SK, McDonald PH, Kohout TA and Lefkowitz RJ (2001) Regulation of receptor fate by ubiquitination of activated 2-adrenergic receptor and -arrestin. Science 294(5545): 1307-1313. Shi L and Javitch JA (2004) The second extracellular loop of the dopamine D2 receptor lines the binding-site crevice. Proc Natl Acad Sci U S A 101(2): 440-445. Shimamura T, Hiraki K, Takahashi N, Hori T, Ago H, Masuda K, Takio K, Ishiguro M and Miyano M (2008) Crystal structure of squid rhodopsin with intracellularly extended cytoplasmic region. J Biol Chem 283(26): 17753-17756. Shimamura T, Shiroishi M, Weyand S, Tsujimoto H, Winter G, Katritch V, Abagyan R, Cherezov V, Liu W, Han GW, Kobayashi T, Stevens RC and Iwata S (2011) Structure of the human histamine H1 receptor complex with doxepin. Nature 475(7354): 65-70. 326 Simaan M, Bedard-Goulet S, Fessart D, Gratton JP and Laporte SA (2005) Dissociation of beta-arrestin from internalized bradykinin B2 receptor is necessary for receptor recycling and resensitization. Cell Signal 17(9): 1074-1083. Skiba NP and Hamm HE (1998) How Gs activates adenylyl cyclase. Nat Struct Biol 5(2): 88-92. Smith FD, Oxford GS and Milgram SL (1999) Association of the D2 dopamine receptor third cytoplasmic loop with spinophilin, a protein phosphatase-1- interacting protein. J Biol Chem 274(28): 19894-19900. Smith NJ and Milligan G (2010) Allostery at G protein-coupled receptor homo- and heteromers: uncharted pharmacological landscapes. Pharmacol Rev 62(4): 701-725. Smyth EM, Austin SC, Reilly MP and FitzGerald GA (2000) Internalization and sequestration of the human prostacyclin receptor. J Biol Chem 275(41): 32037- 32045. Sohy D, Parmentier M and Springael JY (2007) Allosteric transinhibition by specific antagonists in CCR2/CXCR4 heterodimers. J Biol Chem 282(41): 30062- 30069. Soltoff SP (1998) Related adhesion focal tyrosine kinase and the epidermal growth factor receptor mediate the stimulation of mitogen-activated protein kinase by the G-protein-coupled P2Y2 receptor. Phorbol ester or [Ca2+]i elevation can substitute for receptor activation. J Biol Chem 273(36): 23110-23117. Sondek J, Bohm A, Lambright DG, Hamm HE and Sigler PB (1996) Crystal structure of a G-protein dimer at 2.1A resolution. Nature 379(6563): 369-374. Speth RC, Bumpus FM and Husain A (1986) Identification of angiotensin II receptors in the rat ovary. Eur J Pharmacol 130(3): 351-352. Speth RC and Harding JW (2000) Radiolabeling of Angiotensin Peptides, in Angiotensin Protocols pp 275-295. Speth RC and Husain A (1988) Distribution of angiotensin-converting enzyme and angiotensin II-receptor binding sites in the rat ovary. Biol Reprod 38(3): 695- 702. Srinivasan D, Fujino H and Regan JW (2002) Differential internalization of the prostaglandin F2 receptor isoforms: role of protein kinase C and clathrin. J Pharmacol Exp Ther 302(1): 219-224. 327 Standfuss J, Edwards PC, D'Antona A, Fransen M, Xie G, Oprian DD and Schertler GF (2011) The structural basis of agonist-induced activation in constitutively active rhodopsin. Nature 471(7340): 656-660. Stewart GD, Sexton PM and Christopoulos A (2010) Detection of novel functional selectivity at M3 muscarinic acetylcholine receptors using a Saccharomyces cerevisiae platform. ACS Chem Biol 5(4): 365-375. Storjohann L, Holst B and Schwartz TW (2008) A second disulfide bridge from the N-terminal domain to extracellular loop 2 dampens receptor activity in GPR39. Biochemistry (Mosc) 47(35): 9198-9207. Sugaya T, Nishimatsu S, Tanimoto K, Takimoto E, Yamagishi T, Imamura K, Goto S, Imaizumi K, Hisada Y, Otsuka A and et al. (1995) Angiotensin II type 1a receptor-deficient mice with hypotension and hyperreninemia. J Biol Chem 270(32): 18719-18722. Sugimoto Y, Hasumoto K, Namba T, Irie A, Katsuyama M, Negishi M, Kakizuka A, Narumiya S and Ichikawa A (1994) Cloning and expression of a cDNA for mouse prostaglandin F receptor. J Biol Chem 269(2): 1356-1360. Sugimoto Y, Segi E, Tsuboi K, Ichikawa A and Narumiya S (1998) Female reproduction in mice lacking the prostaglandin F receptor. Roles of prostaglandin and oxytocin receptors in parturition. Adv Exp Med Biol 449: 317-321. Sugimoto Y, Yamasaki A, Segi E, Tsuboi K, Aze Y, Nishimura T, Oida H, Yoshida N, Tanaka T, Katsuyama M, Hasumoto K, Murata T, Hirata M, Ushikubi F, Negishi M, Ichikawa A and Narumiya S (1997) Failure of parturition in mice lacking the prostaglandin F receptor. Science 277(5326): 681-683. Sunahara RK and Taussig R (2002) Isoforms of mammalian adenylyl cyclase: multiplicities of signaling. Mol Interv 2(3): 168-184. Suzuki N, Nakamura S, Mano H and Kozasa T (2003) G12 activates Rho GTPase through tyrosine-phosphorylated leukemia-associated RhoGEF. Proc Natl Acad Sci U S A 100(2): 733-738. Tadevosyan A, Maguy A, Villeneuve LR, Babin J, Bonnefoy A, Allen BG and Nattel S (2010) Nuclear-delimited angiotensin receptor-mediated signaling regulates cardiomyocyte gene expression. J Biol Chem 285(29): 22338-22349. Tahara M, Kawagishi R, Sawada K, Morishige K, Sakata M, Tasaka K and Murata Y (2005) Tocolytic effect of a Rho-kinase inhibitor in a mouse model of lipopolysaccharide-induced preterm delivery. Am J Obstet Gynecol 192(3): 903- 908. 328 Takai Y, Sasaki T, Tanaka K and Nakanishi H (1995) Rho as a regulator of the cytoskeleton. Trends Biochem Sci 20(6): 227-231. Takayama K, Yuhki K, Ono K, Fujino T, Hara A, Yamada T, Kuriyama S, Karibe H, Okada Y, Takahata O, Taniguchi T, Iijima T, Iwasaki H, Narumiya S and Ushikubi F (2005) Thromboxane A2 and prostaglandin F2 mediate inflammatory tachycardia. Nat Med 11(5): 562-566. Tanimoto K, Sugiyama F, Goto Y, Ishida J, Takimoto E, Yagami K, Fukamizu A and Murakami K (1994) Angiotensinogen-deficient mice with hypotension. J Biol Chem 269(50): 31334-31337. Tateyama M, Abe H, Nakata H, Saito O and Kubo Y (2004) Ligand-induced rearrangement of the dimeric metabotropic glutamate receptor 1. Nat Struct Mol Biol 11(7): 637-642. Tateyama M and Kubo Y (2006a) Dual signaling is differentially activated by different active states of the metabotropic glutamate receptor 1. Proc Natl Acad Sci U S A 103(4): 1124-1128. Tateyama M and Kubo Y (2006b) Dual signaling is differentially activated by different active states of the metabotropic glutamate receptor 1alpha. Proc Natl Acad Sci U S A 103(4): 1124-1128. Taussig R, Tang WJ, Hepler JR and Gilman AG (1994) Distinct patterns of bidirectional regulation of mammalian adenylyl cyclases. J Biol Chem 269(8): 6093-6100. Terrillon S and Bouvier M (2004) Roles of G-protein-coupled receptor dimerization. EMBO Rep 5(1): 30-34. Thomas RL, Mistry R, Langmead CJ, Wood MD and Challiss RA (2008) G protein coupling and signaling pathway activation by M1 muscarinic acetylcholine receptor orthosteric and allosteric agonists. J Pharmacol Exp Ther 327(2): 365-374. Thomas WG, Brandenburger Y, Autelitano DJ, Pham T, Qian H and Hannan RD (2002) Adenoviral-directed expression of the type 1A angiotensin receptor promotes cardiomyocyte hypertrophy via transactivation of the epidermal growth factor receptor. Circ Res 90(2): 135-142. Thompson AA, Liu W, Chun E, Katritch V, Wu H, Vardy E, Huang XP, Trapella C, Guerrini R, Calo G, Roth BL, Cherezov V and Stevens RC (2012) Structure of the nociceptin/orphanin FQ receptor in complex with a peptide mimetic. Nature 485(7398): 395-399. 329 Thomsen W, Frazer J and Unett D (2005) Functional assays for screening GPCR targets. Curr Opin Biotechnol 16(6): 655-665. Thorburn GD and Challis JR (1979) Endocrine control of parturition. Physiol Rev 59(4): 863-918. Thorin E (1998) Functional cross-talk between endothelial muscarinic and alpha2- adrenergic receptors in rabbit cerebral arteries. Br J Pharmacol 125(6): 1188- 1193. Thornton S, Vatish M and Slater D (2001) Oxytocin antagonists: clinical and scientific considerations. Exp Physiol 86(2): 297-302. Tian Y, Smith RD, Balla T and Catt KJ (1998) Angiotensin II activates mitogen- activated protein kinase via protein kinase C and Ras/Raf-1 kinase in bovine adrenal glomerulosa cells. Endocrinology 139(4): 1801-1809. Tikhonova IG and Costanzi S (2009) Unraveling the structure and function of G protein-coupled receptors through NMR spectroscopy. Curr Pharm Des 15(35): 4003-4016. Togashi H, Emala CW, Hall IP and Hirshman CA (1998) Carbachol-induced actin reorganization involves Gi activation of Rho in human airway smooth muscle cells. American Journal of Physiology - Lung Cellular and Molecular Physiology 274(5): L803-L809. Tohgo A, Choy EW, Gesty-Palmer D, Pierce KL, Laporte S, Oakley RH, Caron MG, Lefkowitz RJ and Luttrell LM (2003) The stability of the G protein-coupled receptor-beta-arrestin interaction determines the mechanism and functional consequence of ERK activation. J Biol Chem 278(8): 6258-6267. Tohgo A, Pierce KL, Choy EW, Lefkowitz RJ and Luttrell LM (2002) beta- Arrestin scaffolding of the ERK cascade enhances cytosolic ERK activity but inhibits ERK-mediated transcription following angiotensin AT1a receptor stimulation. J Biol Chem 277(11): 9429-9436. Tolkovsky AM and Levitzki A (1978) Mode of coupling between the beta- adrenergic receptor and adenylate cyclase in turkey erythrocytes. Biochemistry (Mosc) 17(18): 3795. Touyz RM and Schiffrin EL (2000) Signal transduction mechanisms mediating the physiological and pathophysiological actions of angiotensin II in vascular smooth muscle cells. Pharmacol Rev 52(4): 639-672. Traverse S, Gomez N, Paterson H, Marshall C and Cohen P (1992) Sustained activation of the mitogen-activated protein (MAP) kinase cascade may be required for differentiation of PC12 cells. Comparison of the effects of nerve 330 growth factor and epidermal growth factor. The Biochemical journal 288 ( Pt 2): 351-355. Tsai W, Morielli AD and Peralta EG (1997) The m1 muscarinic acetylcholine receptor transactivates the EGF receptor to modulate ion channel activity. EMBO J 16(15): 4597-4605. Tschammer N, Bollinger S, Kenakin T and Gmeiner P (2010) Histidine 6.55 is a major determinant of ligand biased signaling in dopamine D2L receptor. Mol Pharmacol. Tsuchiya D, Kunishima N, Kamiya N, Jingami H and Morikawa K (2002) Structural views of the ligand-binding cores of a metabotropic glutamate receptor complexed with an antagonist and both glutamate and Gd3+. Proc Natl Acad Sci U S A 99(5): 2660-2665. Turner CE, Pietras KM, Taylor DS and Molloy CJ (1995) Angiotensin II stimulation of rapid paxillin tyrosine phosphorylation correlates with the formation of focal adhesions in rat aortic smooth muscle cells. J Cell Sci 108 ( Pt 1): 333-342. Ueno T and Fujimori K (2011) Novel suppression mechanism operating in early phase of adipogenesis by positive feedback loop for enhancement of cyclooxygenase-2 expression through prostaglandin F2 receptor mediated activation of MEK/ERK-CREB cascade. The FEBS journal 278(16): 2901-2912. Unal H, Jagannathan R, Bhat MB and Karnik SS (2010) Ligand-specific conformation of extracellular loop-2 in the angiotensin II type 1 receptor. J Biol Chem 285(21): 16341-16350. Urizar E, Montanelli L, Loy T, Bonomi M, Swillens S, Gales C, Bouvier M, Smits G, Vassart G and Costagliola S (2005) Glycoprotein hormone receptors: link between receptor homodimerization and negative cooperativity. EMBO J 24(11): 1954-1964. Urwyler S (2011) Allosteric Modulation of Family C G-Protein-Coupled Receptors: from Molecular Insights to Therapeutic Perspectives. Pharmacol Rev. Ushio-Fukai M, Alexander RW, Akers M, Lyons PR, Lassegue B and Griendling KK (1999a) Angiotensin II receptor coupling to phospholipase D is mediated by the betagamma subunits of heterotrimeric G proteins in vascular smooth muscle cells. Mol Pharmacol 55(1): 142-149. Ushio-Fukai M, Alexander RW, Akers M, Yin Q, Fujio Y, Walsh K and Griendling KK (1999b) Reactive oxygen species mediate the activation of Akt/protein kinase B by angiotensin II in vascular smooth muscle cells. J Biol Chem 274(32): 22699-22704. 331 Ushio-Fukai M, Griendling KK, Akers M, Lyons PR and Alexander RW (1998) Temporal dispersion of activation of phospholipase C-1 and - isoforms by angiotensin II in vascular smooth muscle cells. Role of q/11, 12, and G protein subunits. J Biol Chem 273(31): 19772-19777. Valant C, Aurelio L, Urmaliya VB, White P, Scammells PJ, Sexton PM and Christopoulos A (2010) Delineating the mode of action of adenosine A1 receptor allosteric modulators. Mol Pharmacol 78(3): 444-455. Valant C, Gregory KJ, Hall NE, Scammells PJ, Lew MJ, Sexton PM and Christopoulos A (2008) A novel mechanism of G protein-coupled receptor functional selectivity. Muscarinic partial agonist McN-A-343 as a bitopic orthosteric/allosteric ligand. J Biol Chem 283(43): 29312-29321. Valant C, Maillet E, Bourguignon JJ, Bucher B, Utard V, Galzi JL and Hibert M (2009a) Allosteric functional switch of neurokinin A-mediated signaling at the neurokinin NK2 receptor: structural exploration. J Med Chem 52(19): 5999-6011. Valant C, Sexton PM and Christopoulos A (2009b) Orthosteric/allosteric bitopic ligands: going hybrid at GPCRs. Mol Interv 9(3): 125-135. van Biesen T, Hawes BE, Raymond JR, Luttrell LM, Koch WJ and Lefkowitz RJ (1996) Go-protein -subunits activate mitogen-activated protein kinase via a novel protein kinase C-dependent mechanism. J Biol Chem 271(3): 1266-1269. van Corven EJ, Hordijk PL, Medema RH, Bos JL and Moolenaar WH (1993) Pertussis toxin-sensitive activation of p21ras by G protein-coupled receptor agonists in fibroblasts. Proc Natl Acad Sci U S A 90(4): 1257-1261. Varney MA, Cosford ND, Jachec C, Rao SP, Sacaan A, Lin FF, Bleicher L, Santori EM, Flor PJ, Allgeier H, Gasparini F, Kuhn R, Hess SD, Velicelebi G and Johnson EC (1999) SIB-1757 and SIB-1893: selective, noncompetitive antagonists of metabotropic glutamate receptor type 5. J Pharmacol Exp Ther 290(1): 170-181. Vauquelin G, Van Liefde I, Birzbier BB and Vanderheyden PM (2002a) New insights in insurmountable antagonism. Fundam Clin Pharmacol 16(4): 263-272. Vauquelin G, Van Liefde I and Vanderheyden P (2002b) Models and methods for studying insurmountable antagonism. Trends Pharmacol Sci 23(11): 514-518. Vidi PA, Przybyla JA, Hu CD and Watts VJ (2010) Visualization of G protein- coupled receptor (GPCR) interactions in living cells using bimolecular fluorescence complementation (BiFC). Curr Protoc Neurosci Chapter 5: Unit 5 29. 332 Vielhauer GA, Fujino H and Regan JW (2004) Cloning and localization of hFP(S): a six-transmembrane mRNA splice variant of the human FP prostanoid receptor. Arch Biochem Biophys 421(2): 175-185. Vilar S, Ferino G, Phatak SS, Berk B, Cavasotto CN and Costanzi S (2010) Docking-based virtual screening for ligands of G protein-coupled receptors: Not only crystal structures but also in silico models. J Mol Graph Model. Vilardaga JP, Nikolaev VO, Lorenz K, Ferrandon S, Zhuang Z and Lohse MJ (2008a) Conformational cross-talk between 2A-adrenergic and mu-opioid receptors controls cell signaling. Nature chemical biology 4(2): 126-131. Vilardaga JP, Nikolaev VO, Lorenz K, Ferrandon S, Zhuang Z and Lohse MJ (2008b) Conformational cross-talk between alpha2A-adrenergic and mu-opioid receptors controls cell signaling. Nat Chem Biol 4(2): 126-131. Violin JD, DeWire SM, Yamashita D, Rominger DH, Nguyen L, Schiller K, Whalen EJ, Gowen M and Lark MW (2010) Selectively engaging -arrestins at the angiotensin II type 1 receptor reduces blood pressure and increases cardiac performance. J Pharmacol Exp Ther 335(3): 572-579. Voigtlander U, Johren K, Mohr M, Raasch A, Trankle C, Buller S, Ellis J, Holtje HD and Mohr K (2003) Allosteric site on muscarinic acetylcholine receptors: identification of two amino acids in the muscarinic M2 receptor that account entirely for the M2/M5 subtype selectivities of some structurally diverse allosteric ligands in N-methylscopolamine-occupied receptors. Mol Pharmacol 64(1): 21- 31. von Euler U (1935) Über die spezifische blutdrucksenkende Substanz des menschlichen Prostata- und Samenblasensekrets. Wien Klin Wochenschr 14(33): 1182-1183. von Zastrow M and Kobilka BK (1992) Ligand-regulated internalization and recycling of human 2-adrenergic receptors between the plasma membrane and endosomes containing transferrin receptors. J Biol Chem 267(5): 3530-3538. Wacker D, Fenalti G, Brown MA, Katritch V, Abagyan R, Cherezov V and Stevens RC (2010) Conserved binding mode of human 2 adrenergic receptor inverse agonists and antagonist revealed by X-ray crystallography. J Am Chem Soc 132(33): 11443-11445. Wahl-Schott C and Biel M (2009) HCN channels: structure, cellular regulation and physiological function. Cell Mol Life Sci 66(3): 470-494. 333 Walker JK, Premont RT, Barak LS, Caron MG and Shetzline MA (1999) Properties of secretin receptor internalization differ from those of the 2- adrenergic receptor. J Biol Chem 274(44): 31515-31523. Wang D, Patel VV, Ricciotti E, Zhou R, Levin MD, Gao E, Yu Z, Ferrari VA, Lu MM, Xu J, Zhang H, Hui Y, Cheng Y, Petrenko N, Yu Y and FitzGerald GA (2009a) Cardiomyocyte cyclooxygenase-2 influences cardiac rhythm and function. Proc Natl Acad Sci U S A 106(18): 7548-7552. Wang L, Martin B, Brenneman R, Luttrell LM and Maudsley SR (2009b) Allosteric modulators of G protein-coupled receptors: Future therapeutics for complex physiological disorders. J Pharmacol Exp Ther 331(2): 340-348. Wang Z, Dillon TJ, Pokala V, Mishra S, Labudda K, Hunter B and Stork PJS (2006) Rap1-Mediated Activation of Extracellular Signal-Regulated Kinases by Cyclic AMP Is Dependent on the Mode of Rap1 Activation. Mol Cell Biol 26(6): 2130-2145. Ward DT, Brown EM and Harris HW (1998) Disulfide bonds in the extracellular calcium-polyvalent cation-sensing receptor correlate with dimer formation and its response to divalent cations in vitro. J Biol Chem 273(23): 14476-14483. Warne T, Moukhametzianov R, Baker JG, Nehme R, Edwards PC, Leslie AG, Schertler GF and Tate CG (2011) The structural basis for agonist and partial agonist action on a 1-adrenergic receptor. Nature 469(7329): 241-244. Warne T, Serrano-Vega MJ, Baker JG, Moukhametzianov R, Edwards PC, Henderson R, Leslie AG, Tate CG and Schertler GF (2008) Structure of a 1- adrenergic G-protein-coupled receptor. Nature 454(7203): 486-491. Watson C, Chen G, Irving P, Way J, Chen WJ and Kenakin T (2000) The use of stimulus-biased assay systems to detect agonist-specific receptor active states: implications for the trafficking of receptor stimulus by agonists. Mol Pharmacol 58(6): 1230-1238. Wei H, Ahn S, Shenoy SK, Karnik SS, Hunyady L, Luttrell LM and Lefkowitz RJ (2003) Independent -arrestin 2 and G protein-mediated pathways for angiotensin II activation of extracellular signal-regulated kinases 1 and 2. Proc Natl Acad Sci U S A 100(19): 10782-10787. Weissman JT, Ma JN, Essex A, Gao Y and Burstein ES (2004) G-protein-coupled receptor-mediated activation of rap GTPases: characterization of a novel Galphai regulated pathway. Oncogene 23(1): 241-249. Westfield GH, Rasmussen SG, Su M, Dutta S, DeVree BT, Chung KY, Calinski D, Velez-Ruiz G, Oleskie AN, Pardon E, Chae PS, Liu T, Li S, Woods VL, Jr., 334 Steyaert J, Kobilka BK, Sunahara RK and Skiniotis G (2011) Structural flexibility of the Gs -helical domain in the 2-adrenoceptor Gs complex. Proc Natl Acad Sci U S A 108(38): 16086-16091. Whistler JL and von Zastrow M (1998) Morphine-activated opioid receptors elude desensitization by -arrestin. Proc Natl Acad Sci U S A 95(17): 9914-9919. White JH, Wise A, Main MJ, Green A, Fraser NJ, Disney GH, Barnes AA, Emson P, Foord SM and Marshall FH (1998) Heterodimerization is required for the formation of a functional GABA(B) receptor. Nature 396(6712): 679-682. Whittle BJ, Oren-Wolman N and Guth PH (1985) Gastric vasoconstrictor actions of leukotriene C4, PGF2, and thromboxane mimetic U-46619 on rat submucosal microcirculation in vivo. The American journal of physiology 248(5 Pt 1): G580- 586. Whorton MR, Bokoch MP, Rasmussen SG, Huang B, Zare RN, Kobilka B and Sunahara RK (2007) A monomeric G protein-coupled receptor isolated in a high- density lipoprotein particle efficiently activates its G protein. Proc Natl Acad Sci U S A 104(18): 7682-7687. Whorton MR, Jastrzebska B, Park PS, Fotiadis D, Engel A, Palczewski K and Sunahara RK (2008) Efficient coupling of transducin to monomeric rhodopsin in a phospholipid bilayer. J Biol Chem 283(7): 4387-4394. Wiltbank MC, Diskin MG and Niswender GD (1991) Differential actions of second messenger systems in the corpus luteum. J Reprod Fertil Suppl 43: 65-75. Winitz S, Russell M, Qian NX, Gardner A, Dwyer L and Johnson GL (1993) Involvement of Ras and Raf in the Gi-coupled acetylcholine muscarinic M2 receptor activation of mitogen-activated protein (MAP) kinase kinase and MAP kinase. J Biol Chem 268(26): 19196-19199. Wisler JW, DeWire SM, Whalen EJ, Violin JD, Drake MT, Ahn S, Shenoy SK and Lefkowitz RJ (2007) A unique mechanism of -blocker action: carvedilol stimulates -arrestin signaling. Proc Natl Acad Sci U S A 104(42): 16657-16662. Wittpoth C, Scholich K, Yigzaw Y, Stringfield TM and Patel TB (1999) Regions on adenylyl cyclase that are necessary for inhibition of activity by βγ and Giα subunits of heterotrimeric G proteins. Proceedings of the National Academy of Sciences 96(17): 9551-9556. Wolf G, Ziyadeh FN, Zahner G and Stahl RA (1996) Angiotensin II is mitogenic for cultured rat glomerular endothelial cells. Hypertension 27(4): 897-905. 335 Woodward DF, Krauss AH, Chen J, Gil DW, Kedzie KM, Protzman CE, Shi L, Chen R, Krauss HA, Bogardus A, Dinh HT, Wheeler LA, Andrews SW, Burk RM, Gac T, Roof MB, Garst ME, Kaplan LJ, Sachs G, Pierce KL, Regan JW, Ross RA and Chan MF (2000) Replacement of the carboxylic acid group of prostaglandin F2 with a hydroxyl or methoxy substituent provides biologically unique compounds. Br J Pharmacol 130(8): 1933-1943. Woodward DF, Krauss AH, Wang JW, Protzman CE, Nieves AL, Liang Y, Donde Y, Burk RM, Landsverk K and Struble C (2007) Identification of an antagonist that selectively blocks the activity of prostamides (prostaglandin- ethanolamides) in the feline iris. Br J Pharmacol 150(3): 342-352. Wrzal PK, Devost D, Pétrin D, Goupil E, Iorio-Morin C, Laporte SA, Zingg HH and Hébert TE (2012a) Allosteric interactions between the oxytocin receptor and the 2-adrenergic receptor in the modulation of ERK1/2 activation are mediated by heterodimerization. Cell Signal 24(1): 342-350. Wrzal PK, Goupil E, Laporte SA, Hebert TE and Zingg HH (2012b) Functional interactions between the oxytocin receptor and the 2-adrenergic receptor: implications for ERK1/2 activation in human myometrial cells. Cell Signal 24(1): 333-341. Wu B, Chien EY, Mol CD, Fenalti G, Liu W, Katritch V, Abagyan R, Brooun A, Wells P, Bi FC, Hamel DJ, Kuhn P, Handel TM, Cherezov V and Stevens RC (2010) Structures of the CXCR4 chemokine GPCR with small-molecule and cyclic peptide antagonists. Science 330(6007): 1066-1071. Wu H, Wacker D, Mileni M, Katritch V, Han GW, Vardy E, Liu W, Thompson AA, Huang XP, Carroll FI, Mascarella SW, Westkaemper RB, Mosier PD, Roth BL, Cherezov V and Stevens RC (2012) Structure of the human -opioid receptor in complex with JDTic. Nature 485(7398): 327-332. Xu F, Wu H, Katritch V, Han GW, Jacobson KA, Gao ZG, Cherezov V and Stevens RC (2011) Structure of an agonist-bound human A2A adenosine receptor. Science 332(6027): 322-327. Xu W, Chou CL, Sun H, Fujino H, Chen QM and Regan JW (2008) FP prostanoid receptor-mediated induction of the expression of early growth response factor-1 by activation of a Ras/Raf/mitogen-activated protein kinase signaling cascade. Mol Pharmacol 73(1): 111-118. Yamada T, Akishita M, Pollman MJ, Gibbons GH, Dzau VJ and Horiuchi M (1998) Angiotensin II type 2 receptor mediates vascular smooth muscle cell apoptosis and antagonizes angiotensin II type 1 receptor action: an in vitro gene transfer study. Life Sci 63(19): PL289-295. 336 Yamauchi J, Nagao M, Kaziro Y and Itoh H (1997) Activation of p38 mitogen- activated protein kinase by signaling through G protein-coupled receptors. Involvement of G and Gq/11 subunits. J Biol Chem 272(44): 27771-27777. Yona S, Lin H-H, Siu WO, Gordon S and Stacey M (2008) Adhesion-GPCRs: emerging roles for novel receptors. Trends Biochem Sci 33(10): 491-500. Yoon S and Seger R (2006) The extracellular signal-regulated kinase: multiple substrates regulate diverse cellular functions. Growth Factors 24(1): 21-44. Yoshida M, Sagawa N, Itoh H, Yura S, Takemura M, Wada Y, Sato T, Ito A and Fujii S (2002) Prostaglandin F2, cytokines and cyclic mechanical stretch augment matrix metalloproteinase-1 secretion from cultured human uterine cervical fibroblast cells. Mol Hum Reprod 8(7): 681-687. Yu Y, Lucitt MB, Stubbe J, Cheng Y, Friis UG, Hansen PB, Jensen BL, Smyth EM and FitzGerald GA (2009) Prostaglandin F2 elevates blood pressure and promotes atherosclerosis. Proc Natl Acad Sci U S A 106(19): 7985-7990. Zafari AM, Ushio-Fukai M, Minieri CA, Akers M, Lassegue B and Griendling KK (1999) Arachidonic acid metabolites mediate angiotensin II-induced NADH/NADPH oxidase activity and hypertrophy in vascular smooth muscle cells. Antioxidants & redox signaling 1(2): 167-179. Zamponi GW, Bourinet E, Nelson D, Nargeot J and Snutch TP (1997) Crosstalk between G proteins and protein kinase C mediated by the calcium channel 1 subunit. Nature 385(6615): 442-446. Zerbib F, Keywood C and Strabach G (2010) Efficacy, tolerability and pharmacokinetics of a modified release formulation of ADX10059, a negative allosteric modulator of metabotropic glutamate receptor 5: an esophageal pH- impedance study in healthy subjects. Neurogastroenterol Motil 22(8): 859-865, e231. Zhang J, Gong Y and Yu Y (2010a) PGF2 Receptor: A Promising Therapeutic Target for Cardiovascular Disease. Frontiers in pharmacology 1: 116. Zhang S, Coso OA, Collins R, Gutkind JS and Simonds WF (1996) A C-terminal mutant of the G protein subunit deficient in the activation of phospholipase C-. J Biol Chem 271(33): 20208-20212. Zhang W and Liu HT (2002) MAPK signal pathways in the regulation of cell proliferation in mammalian cells. Cell Res 12(1): 9-18. Zhang X, Wang G, Dupre DJ, Feng Y, Robitaille M, Lazartigues E, Feng YH, Hebert TE and Wu G (2009a) Rab1 GTPase and dimerization in the cell surface 337 expression of angiotensin II type 2 receptor. J Pharmacol Exp Ther 330(1): 109- 117. Zhang X, Wang G, Dupre DJ, Feng Y, Robitaille M, Lazartigues E, Feng YH, Hebert TE and Wu G (2009b) Rab1 GTPase and dimerization in the cell surface expression of angiotensin II type 2 receptor. J Pharmacol Exp Ther 330(1): 109- 117. Zhang Y, Rodriguez AL and Conn PJ (2005) Allosteric potentiators of metabotropic glutamate receptor subtype 5 have differential effects on different signaling pathways in cortical astrocytes. J Pharmacol Exp Ther 315(3): 1212- 1219. Zhang Y, Tang W, Jones MC, Xu W, Halene S and Wu D (2010b) Different Roles of G Protein Subunits β1 and β2 in Neutrophil Function Revealed by Gene Expression Silencing in Primary Mouse Neutrophils. J Biol Chem 285(32): 24805-24814. Zhong H, Voll RE and Ghosh S (1998) Phosphorylation of NF-kappa B p65 by PKA stimulates transcriptional activity by promoting a novel bivalent interaction with the coactivator CBP/p300. Mol Cell 1(5): 661-671. Zhu WZ, Chakir K, Zhang S, Yang D, Lavoie C, Bouvier M, Hébert TE, Lakatta EG, Cheng H and Xiao RP (2005) Heterodimerization of 1- and 2-adrenergic receptor subtypes optimizes -adrenergic modulation of cardiac contractility. Circ Res 97(3): 244-251. Zimmerman B, Beautrait A, Aguila B, Charles R, Escher E, Claing A, Bouvier M and Laporte SA (2012) Differential -arrestin-dependent conformational signaling and cellular responses revealed by angiotensin analogs. Science signaling 5(221): ra33. Zimmerman B, Simaan M, Akoume MY, Houri N, Chevallier S, Seguela P and Laporte SA (2011) Role of arrestins in bradykinin B2 receptor-mediated signalling. Cell Signal 23(4): 648-659. Zimmerman B, Simaan M, Lee MH, Luttrell LM and Laporte SA (2009a) c-Src- mediated phosphorylation of AP-2 reveals a general mechanism for receptors internalizing through the clathrin pathway. Cell Signal 21(1): 103-110. Zimmerman B, Simaan M, Lee MH, Luttrell LM and Laporte SA (2009b) c-Src- mediated phosphorylation of AP-2 reveals a general mechanism for receptors internalizing through the clathrin pathway. Cell Signal 21(1): 103-110. 338 Zitzer H, Honck HH, Bachner D, Richter D and Kreienkamp HJ (1999) Somatostatin receptor interacting protein defines a novel family of multidomain proteins present in human and rodent brain. J Biol Chem 274(46): 32997-33001. Zwick E, Wallasch C, Daub H and Ullrich A (1999) Distinct calcium-dependent pathways of epidermal growth factor receptor transactivation and PYK2 tyrosine phosphorylation in PC12 cells. J Biol Chem 274(30): 20989-20996. 339 APPENDICES 340